A Contribution to the Earthworm Diversity (Clitellata, Moniligastridae) of Kerala, a Component of the Western Ghats Biodiversity

Home , Moniligastridae, Neyyar (river), Periyar National Park

Animal Biodiversity and Conservation 44.1 (2021) 117 A contribution to the earthworm diversity (Clitellata, Moniligastridae) of Kerala, a component of the Western Ghats biodiversity hotspot, India, using integrated taxonomy

S. S. Thakur, A. R. Lone, N. Tiwari, S. K. Jain, S. W. James, S. Yadav

Thakur, S. S., Lone, A. R., Tiwari, N., Jain, S. K., James, S. W., Yadav, S., 2021. A contribution to the earthworm diversity (Clitellata, Moniligastridae) of Kerala, a component of the Western Ghats biodiversity hotspot, India, using integrated taxonomy. Animal Biodiversity and Conservation, 44.1 117–137, Doi: https://doi.org/10.32800/ abc.2021.44.0117

Abstract A contribution to the earthworm diversity (Clitellata, Moniligastridae) of Kerala, a component of the Western Ghats biodiversity hotspot, India, using integrated taxonomy. Earthworms (Clitellata, Moniligastridae) of Chaliyar River Malappuram, Eravikulam National Park, Neyyar Wildlife Sanctuary, Parambikulam Tiger Reserve, Peppara Wildlife Sanctuary, Periyar National Park, Shendurney Wildlife Sanctuary and Wayanad Forest, Kerala, a component of the hotspot of Western Ghats, India, were studied by the standard method of taxonomy, and their DNA barcode signatures using the mitochondrial gene cytochrome c oxidase I (COI) were generated for the first time. This study represents eleven species of earthworms of the family Moniligastridae: Drawida brunnea Stephenson, Drawida circumpapillata Aiyer, Drawida ghatensis Michaelsen, Drawida impertusa Stephenson, Drawida nilamburensis (Bourne), Drawida robusta (Bourne), Drawida scandens Rao, Drawida travancorense Michaelsen, Moniligaster aiyeri Gates, Moniligaster deshayesi Perrier, and Moniligaster gravelyi (Stephenson). In the phylogenetic analysis all the species were recovered in both neighbour–joining (NJ) and maximum likelihood (ML) trees with high clade support. The average K2P distance within and between species was 1.2 % and 22 %, whereas the clear barcode gap of 2–5 % was suggested by barcode gap analysis (BGA) of studied species, reflecting the accuracy of characterization. The study presents the first step in the molecular characterization of the native earthworm family Moniligastridae of India.

Data published through GBIF (Doi: 10.15470/l2nlhz)

Key words: COI, Genomic signature, DNA barcoding, Earthworms biodiversity, Moniligastridae, Western Ghats, Kerala

Resumen Una contribución a la diversidad de lombrices (Clitellata, Moniligastridae) de Kerala, un componente de la gran diversidad en Western Ghats, en la India, utilizando taxonomía integrada. Las lombrices (Clitellata, Moniligas- tridae) del río Chaliyar de Malappuram, el Parque Nacional de Eravikulam, el refugio de especies silvestres de Neyyar, la reserva de tigres de Parambikulam, el refugio de especies silvestres de Peppara, el Parque Nacional de Periyar, el refugio de especies silvestres de Shendurney y el bosque de Wayanad, en Kerala, que son una parte de la elevada diversidad de Western Ghats, en la India, se estudiaron mediante el método convencional de taxonomía, y su código de barras del ADN utilizando el gen de la oxidasa I del citrocromo c (COI). El estudio representa 11 especies de lombrices de la familia Moniligastridae, a saber: Drawida brunnea Stephenson, Drawida circumpapillata Aiyer, Drawida ghatensis Michaelsen, Drawida impertusa Stephenson, Drawida nilamburensis (Bourne), Drawida robusta (Bourne), Drawida scandens Rao, Drawida travancorense Michaelsen, Moniligaster aiyeri Gates, Moniligaster deshayesi Perrier y Moniligaster gravelyi (Stephenson). En el análisis filogenético, todas las especies se recuperaron tanto en los árboles producidos mediante el método de unión de vcinos como en los árboles basados en la máxima verosimilitud, con un elevado apoyo de los clados. La distancia media calculada con el modelo K2P dentro de una misma especie y entre especies fue del 1,2 % y el 22 %, respectivamente, mientras que el análisis de deficiencias del código de barras (BGA) de las especies

ISSN: 1578–665 X © [2021] Copyright belongs to the authors, who license the eISSN: 2014–928 X journal Animal Biodiversity and Conservation to publish the paper under a Creative Commons Attribution 4.0 License. 118 Thakur et al.

estudiadas sugirió una brecha del 2–5 %, lo que refleja la precisión de la caracterización. En el estudio se presenta el primer paso en la caracterización molecular de la familia de lombrices Moniligastridae, autóctona de la India.

Datos publicados en GBIF (Doi: 10.15470/l2nlhz)

Palabras clave: COI, Estructura genómica, Código de barras del ADN, Biodiversidad de lombrices, Moniligastridae, Western Ghats, Kerala

Received: 18 I 21; Conditional acceptance: 23 II 21; Final acceptance: 23 III 21

Samrendra Singh Thakur, Department of Biotechnology, School of Biological Sciences, Dr. Harisingh Gour, Vishwavidyalaya (A Central University), Sagar, 470003, Madhya Pradesh, India.– Azhar Rashid Lone, Nalini Tiwari, Subodh Kumar Jain, Shweta Yadav, Department of Zoology, School of Biological Sciences, Dr. Harisingh Gour, Vishwavidyalaya (A Central University), Sagar, 470003, Madhya Pradesh, India.– Samuel Wooster James, Department of Regenerative Agriculture, Maharishi International University, Fairfield, Iowa, 52557 United States. Animal Biodiversity and Conservation 44.1 (2021) 119

Introduction Material and methods

Moniligastridae is a family of earthworms indigenous Study site to southeast and eastern Asia. It is believed that the family Moniligastridae originated in the Malaya Kerala is a small state in the south–western tip of Archipelago’s geographical region (Gates, 1972; India. It is a narrow strip of coastal plain that bor- Blakemore, 2014), but later Jamieson (1977) sug– ders the Arabian Sea from the north to south, next gested an origin near Myanmar. Its natural range to the neighbouring states of Karnataka and Tamil encompasses south, southeast and east Asia, from Nadu. The state is recognized for its lush greenery, peninsular India to Japan through Myanmar, China, highly dense forests, diversified ecological habitats, the extreme southern portion of far Eastern Rus- topography, and the high biodiversity. It is bounded sia, Korea, the Philippines, Borneo, and Sumatra by the thickly wooded and forested hills of the Wes- (Gates, 1972). Moniligastrids are dominant mem- tern Ghats to the east and the Arabian Sea to the bers of the earthworms fauna in India especially in west. Kerala occupies 38,863 sq. km and comprises the South and North East Regions. Three genera approximately 1.18 % of India’s landmass (Sreedha- Desmogaster Rosa, 1890; Drawida Michaelsen ran, 2004). Out of the total length of the Western 1900; and Moniligaster Perrier, 1872 are known Ghats, Kerala covers around 600 km. Nearly 56 % from India (www.earthwormsofindia.com). Among of the total geographical area of the state has an them Drawida is most diverse with 73 species in annual average temperature ranging between 31 to India. Earthworms of this family have drawn the 37 oC and annual rainfall of 3,500 mm, mainly due attention of earthworm biologists as they retain the to the windward location to the Ghats (Rao, 1976). single layered clitellum characteristic of Clitellata Due to the integration and combination of different other than earthworms (Crassiclitellata) yet function climatic conditions, like warmer climate, altitudinal ecologically as do the crassiclitellate earthworms. variations, two different rainfall patterns and seasons The Moniligastridae have a broad size range, just (Southwest monsoon and North–East monsoon), like earthworms sensu stricto. The family is cha- several soil types and agro–ecological zones, Kerala racterized by simple pointed setae, four pairs per has a variety of macro environments that vary from segment, a clitellum beginning on segment 9 or 10 tropical rain forests to hot dry deciduous forests. and extending over 3 to 10 segments, including These diversified habitats and local ecological ni- those bearing genital pores; male pores one pair ches contributed to a variety of macro and micro (Drawida, Moniligaster) or two pairs (Desmogaster) environments conducive for a variety of flora and in or near grooves 10/11, 11/12 or 12/13; female fauna requiring contrasting environment. Of the pores one pair in 11/12 or XII or XIV. The sper- biota of India, the state sustains over 24 % of the mathecal pores are one or two pairs in 7/8 or 8/9 plant species, 30 % of the animal species, and 35 % or 7/8 and 8/9; the oesophagus with two gizzards of the freshwater fish species (Sreedharan, 2004). anterior to X or two to ten gizzards at the beginning of the intestine. The last hearts are two segments in Collection of earthworm samples front of the ovarian segment; they are holonephri- dial. Testes and funnels one or two pairs enclosed Earthworm samples analysed in the present study in one or two pairs of testis sacs. Vasa deferentia were collected from different sampling sites in Kerala opening into prostate glands. One pair of ovaries (fig. 1; see also the dataset published through GBIF in the segment immediately in front of the groove (Doi: 10.15470/l2nlhz). The locations, species names, or segment on which the female pores are situated, coordinates, and their BOLD accession numbers one pair of ovisacs extending backwards from the are provided in table 1. Samples were collected by ovarian segment. One or two pairs of spermathe- digging and hand–sorting according to the method cae with long tubular ducts. Without typhlosole, described by Satchell (1969). The specimens were calciferous glands, supra–intestinal glands and anesthetized in 30 % (v/v) ethanol. Small pieces seminal vesicles. of muscle tissue from the tail region were then cut The use of these morpho–anatomical characteristics and preserved in 100 % (v/v) ethanol solution for has often been a barrier to the identification of these molecular investigation. Next the earthworm samples earthworms, leading to imprecise identification of were fixed in 10 % (w/v) formalin for morphological taxa. The present study is the first attempt to provide identification. 100 % ethanol preserved tissue of each a means for rapid assessment of some moniligastrids sample was placed in the Museum of Dr. Harisingh by using molecular data. The study was performed Gour Vishwavidyalaya (A Central University), Sagar, in the Kerala state, as half of its area falls under Madhya Pradesh, India as reference. the Western Ghats, one of the world's eight most important biodiversity hotspots (Myers et al., 2000; Sample management and morphological classification Mittermeier et al., 2011). Therefore, the present study aimed to assess the earthworm diversity and Prior to applying the molecular technique for eva- the phylogenetic relationship of some moniligastrids luation, we identified earthworms on the basis of with the use of DNA barcodes as a standard genetic specific diagnostic morphological characters under a marker for identification of earthworm species of stereoscopic zoom microscope (Leica Model No. M60) Kerala. using the available literature (Stephenson, 1923; Aiyer, 120 Thakur et al.

75º 10' 75º 50' 76º 30' 77º 10' Drawida brunnea

Kasaragod India Drawida circumpapillata 12º 15' 12º 15' Drawida ghatensis Drawida impertusa Kannur Drawida nilamburensis 11º 40' Wayanad 11º 40' Drawida robusta Kozhikode Drawida scandens Drawida travancorense Malappuram 11º 05' 11º 05' Moniligaster aiyeri

Palakkad Moniligaster deshayesi Moniligaster gravelyi 10º 30' Thrissur 10º 30'

Ernakulam 9º 55' Idukki 9º 55'

Kottayam

9º 20' Albppuzha Pathanamthita 9º 20'

Kollam

8º 45' 8º 45' 0 50 km Thiruvananthapuram

75º 10' 75º 50' 76º 30' 77º 10'

Fig. 1. Study area with distribution of Moniligastrids in Kerala.

1929; Gates, 1972; Julka, 1988; Narayanan et al., NCBI and BOLD free public domain for molecular 2016, 2017). A camera lucida was used for drawings analysis (see table 2 for more details). and abbreviations: spp, spermathecal pore; mp, male pore; atr, atrium; spd, spermathecal duct; amp, am- Sequence alignment and data analysis pulla; tss, testis sac; vd, vas deferens; prs, prostate; atrgl, atrial gland were used in the figures. Voucher The alignment of 56 COI data matrix [28 COI from specimens are housed in the Museum, Department this study (table 1) and 28 additional from NCBI and of Zoology, Dr. Harisingh Gour Vishwavidyalaya (A free public domain of BOLD (table 2) were analysed Central University), Sagar, Madhya Pradesh, India. in MEGA X (Kumar et al., 2018). For intraspecific and interspecific genetic distances within and DNA sequencing between species, the best substitution model i.e., Kimura two–parameter (K2P) (Kimura, 1980) was For DNA sequencing the small pieces of muscle tis- used. For phylogenetic analysis we used the COI sue from tail region were used. A total of 28 samples matrix to generate the neighbour–joining (NJ) and of moniligastrids were sent to Barcode of Life Data maximum likelihood (ML) trees using MEGA X, with Systems (BOLD System), Biodiversity Institute of a graphic depiction for the evolutionary distances Ontario, University of Guelph, Canada (Ratnasing- between species. Node robustness was inferred ham and Hebert, 2007) following appropriate proto- with 1,000 bootstrap replicates. The barcoding gap col to obtain DNA sequences, accession numbers analysis was also inferred in the barcode gap analy- and Barcode. All the data used in present study is sis (BGA) tool available on BOLD, but only 28 COI available on BOLD website under the project entitled sequences generated in this study were used. Simi- 'Diversity studies in earthworms of India' (IEW). In larly, the calculation of sequence composition was addition, 28 COI sequences were retrieved from the computed in MEGA X. Animal Biodiversity and Conservation 44.1 (2021) 121

Table 1. The list of moniligastrid species from Kerala along with sample IDs, locations, GPS coordinates, and their BOLD accession numbers (BAN): CCR, Close to Chaliyar River, Malapuram, Areekode, Malappuram; ENP, Eravikulam National Park, Kannan Devan Hills; NWS, Neyyar Wildlife Sanctuary, Trivandrum; PNP, Periyar National Park, Idukki; PTR, Parambikulam Tiger Reserve, Palakkad; PWS, Peppara Wildlife Sanctuary, Thiruvananthapuram; SWS, Shendurney Wildlife Sanctuary, Kollam; WFA, Wayanad Forest Area near to Agraharam Resort, Wayanad.

Tabla 1. La lista de especies de moniligástridos de Kerala con el código de identificación de la muestra, la ubicación, las coordenadas GPS y los números de accesión de la base de datos de registros de código de barras BOLD (BAN): CCR, cerca del Río Chaliyar, Malapuram, Areekode, Malappuram; ENP, Parque Nacional de Eravikulam, Kannan Devan Hills; NWS, Refugio de fauna silvestre de Neyyar, Trivandrum; PNP, Parque Nacional de Periyar, Idukki; PTR, Reserva de tigres de Parambikulam, Palakkad; PWS, Refugio de fauna silvestre de Peppara, Thiruvananthapuram; SWS, Refugio de fauna silvestre de Shendurney, Kollam; WFA, bosque de Wayanad cerca del complejo Agraharam Resort Wayanad, Wayanad.

Num. Sample ID Species Exact site GPS coordinates BAN 1 KERL269A2 D. brunnea PWS 8.62075, 77.1676 ADH0514 2 KERL273A5 D. circumpapillata ENP 10.1158, 77.089 ADH2327 3 KERL0268A3 D. ghatensis NWS 8.53344, 77.1482 ADH1313 4 KERL0275A4 D. ghatensis NWS 8.55006, 77.2425 ADH1313 5 KERL0275A5 D. ghatensis NWS 8.55006, 77.2425 ADH1313 6 KERL0275A6 D. ghatensis NWS 8.55006, 77.2425 ADH1313 7 KERL0275A7 D. ghatensis NWS 8.55006, 77.2425 ADH1313 8 KERL0275A8 D. ghatensis NWS 8.55006, 77.2425 ADH1313 9 KERL0269A6 D. impertusa PWS 8.62075, 77.1676 ADH1401 10 KERL0269A8 D. impertusa PWS 8.62075, 77.1676 ADH1401 11 KERL0274A2 D. impertusa PWS 8.62075, 77.1676 ADH1401 12 KERL0274A4 D. impertusa PWS 8.62075, 77.1676 ADH1401 13 KERL0274A6 D. impertusa PWS 8.62075, 77.1676 ADH1401 14 KERL53A2 D. nilamburensis CCR 11.3179, 76.1889 ADH3257 15 KERL0270A4 D. robusta PWS 8.62075, 77.1676 ADH1162 16 KERL0270A12 D. robusta PWS 8.62075, 77.1676 ADH1162 17 KERL077A2 D. scandens WF 11.9117, 76.0075 ADH2690 18 KERL0274A5 D. travancorense PWS 8.64311, 77.1807 ADH1161 19 KERL0264A1 M. aiyeri ENP 10.1156, 77.0871 ADH1655 20 KERL0276A1 M. aiyeri ENP 10.1109, 77.0911 ADH1655 21 KERL0276A2 M. aiyeri ENP 10.1109, 77.0911 ADH1655 22 KERL0267A5 M. deshayesi PTR 10.3929, 76.7756 ADH1656 23 KERL0272A5 M. deshayesi PNP 9.45628, 77.2316 ADH1656 24 KERL0270A13 M. gravelyi SWS 8.88436, 77.1676 ADH0515 25 KERL0270A14 M. gravelyi SWS 8.88436, 77.1676 ADH0515 26 KERL0270A18 M. gravelyi SWS 8.62075, 77.1676 ADH0515 27 KERL0270A19 M. gravelyi SWS 8.88436, 77.1676 ADH0515 28 KERL0270A20 M. gravelyi SWS 8.88436, 77.1676 ADH0515 122 Thakur et al.

Table 2. Details of COI sequences retrieved from NCBI and BOLD database.

Tabla 2. Datos relativos a las secuencias del COI extraídos del Centro Nacional de Información Biotecnológica de los Estados Unidos (NCBI) y de la base de datos gratuita BOLD.

Database accession number Num Species name BOLD NCBI References 1 D. bullata ACB6680 JN793527 BOLD system and NCBI database 2 D. bullata ACB6680 JN887894 BOLD system and NCBI database 3 D. ghilarovi ADR5225 KY711499 BOLD system and NCBI database 4 D. ghilarovi ADR5225 KY711501 BOLD system and NCBI database 5 D. ghilarovi ADR3943 KY711517 BOLD system and NCBI database 6 D. ghilarovi ADR4360 KY711477 BOLD system and NCBI database 7 D. gisti Not available JQ657807 NCBI database 8 D. gisti Not available JQ657808 NCBI database 9 D. gracilis ACB6701 JN887887 BOLD system and NCBI database 10 D. gracilis ACB6701 JN793516 BOLD system and NCBI database 11 D. hattamimizu AAM4518 AB543219 BOLD system and NCBI database 12 D. hattamimizu AAM4518 AB543220 BOLD system and NCBI database 13 D. hattamimizu AAM4518 AB543224 BOLD system and NCBI database 14 D. hattamimizu AAM4518 AB543217 BOLD system and NCBI database 15 D. hattamimizu AAM4518 AB543214 BOLD system and NCBI database 16 D. japonica Not available JQ677078 NCBI database 17 D. japonica Not available JQ677080 NCBI database 18 D. japonica Not available JQ677081 NCBI database 19 D. japonica Not available JQ677079 NCBI database 20 D. japonica AEG3736 MH882855 BOLD system and NCBI database 21 D. koreana AEG3736 MH882566 BOLD system and NCBI database 22 D. koreana AEG3736 MH845538 BOLD system and NCBI database 23 D. koreana AEG3736 MH845504 BOLD system and NCBI database 24 D. nepalensis ADH4589 MT570064 BOLD system and NCBI database 25 D. nepalensis ADH4589 MT570063 BOLD system and NCBI database 26 D. nepalensis ADH4589 MT472588 BOLD system and NCBI database 27 D. nepalensis ADH4589 MT472587 BOLD system and NCBI database 28 Mollusca sp. Not available MF983247 NCBI database

Results Family Moniligastridae

The earthworm species collected and identified from Genus Drawida Michaelsen, 1900 the study area are arranged in alphabetical order. Each entry gives the information in sequence: ear- Deep pigmentation or without pigmentation, clitellum thworms' scientific name, material examined, sample on X–XIII segments, one pair of male pores in 10/11, ID with accession number(s), collection site, descrip- female pores in 11/12, spermathecal pores in 7/8. Two tion of species. Brief descriptions of the genera are to eight gizzards at the beginning of the intestine. Last also given. heart in IX. Dorsal pores usually absent. One pair of tes- Animal Biodiversity and Conservation 44.1 (2021) 123

tss VII atr spp VIII vd spd IX mp amp X prs XI 1 mm 1 mm 1 mm A B C

Fig. 2. Camera lucida sketch of Drawida brunnea: A, ventral view; B, spermathecae; C, testis sac with prostate. (For abbreviations, see Material and methods).

Fig. 2. Dibujo con cámara lúcida de Dawida brunnea: A, vista ventral; B, espermateca; C, saco testicular con próstata. (Para las abreviaturas, véase Material and methods).

tes and funnels enclosed within setal sac which project on parietes joined by the slightly coiled duct at base from septum 9–10 into segment X or segment IX and (fig. 2). X. Prostate of various forms, ovaries XI, this segment may be reduced to a special ovarian chamber of char- Drawida circumpapillata Aiyer, 1929 acteristic form, one pair of ovisac projecting backwards from septum 11–12. Spermathecae with or without Material examined: KERL273A5 atrium like dilation (diverticulum, function unknown) at Sample ID with BOLD accession number: KER- the ectal end, without stalked glands. Penial setae and L0273A5 (ADH2327) copulatory setae absent. Genital markings rarely found. Collection site: Eravikulam National Park (10º 06' 56.9'' N, 77º 05' 20.5'' E), Kannan Devan Hills, Kerala, India. Drawida brunnea Stephenson, 1915 Date of collection: 29 X 2015 Diagnostic features: length 40–60 mm; diameter Material examined: KERL269A2 3–5 mm, segments 127–150. Colour light grey. Sample ID with BOLD accession number: KER- Dorsal pores absent. Setae closely paired; aa < bc; L0269A2 (ADH0514) dd equal or lesser to ½ circumference visible from Collection site: Peppara Wildlife Sanctuary III segment. Clitellum dark brown saddle–shaped (8º 37' 14.7'' N, 77º 10' 03.3'' E), Thiruvanantha- in X–XIII. Nephridiopores in cd visible from IV. Male puram, Kerala, India. pores between b and c nearer to b, minute on a Date of collection: 25 X 2015 conical elevation in the centre of a large circular Diagnostic features: length 70 mm; diameter 5 mm, papillae, sometimes almost touch each other in segments 180; body short and relatively broad, the mid–ventral line. Each papillae extends out- dorsoventrally flattened. Prostomium prolobus. wards about half bc of setal zones both in X and Setae small, closely paired, aa < bc and dd = ½ XI segments. Female pores in ab. Spermathecal circumference. Male pores eye shaped bordered by pores in d (sometimes in ab) slit–like aperture. prominent shape midway between b and c. Female Septa 5/6–8/9 thickened. Three gizzards in XII– pores nearer b. Spermathecal pores in cd, close XIV. Testis sacs large ovoid sacs in X, tapered to c. Septa 5/6–8/9 thickened. Three gizzards in towards posterior end. Vas deferens lies on the XIII–XV, the first less firms than others. Testis sacs anterior face of septum 9/10 in segment IX, where large kidney–shaped occupies in 9/10 more into X, it twines round the heart and enters the prostate on vas deferens short without coiling; prostate opaque its anterior side near the ectal end. Prostate large white, spherical/ovoid with short moderately thick club–shaped, furry or papillose, densely covered stalk, smooth but no muscular iridescence. Ovarian with large granulated gland cells. Ovarian chamber chamber with its roof at the dorsal parietes, funnel present, ovisacs very long extending backwards extends upwards on each side of the gut nearly through eight and ten segments. Spermathecal to mid–dorsal line, ovisacs in XII. Spermathecal ampulla sac–like in VIII, atrium digitiform in VII, ampulla ovoid, atrium mammillary in shape sessile duct loosely colled entering its ectal end (fig. 3). 124 Thakur et al.

vd tss VII spp amp prs VIII spd IX atr X XI mp

1 mm 1 mm 1 mm

A B C

Fig. 3. Camera lucida sketch of Drawida circumpapillata: A, ventral view; B, spermathecae; C, testis sac with prostate. (For abbreviations, see Material and methods).

Fig. 3. Dibujo con cámara lúcida de Drawida circumpapillata A, vista ventral; B, espermateca; C, saco testicular con próstata. (Para las abreviaturas, véase Material and methods).

Drawida ghatensis Michaelsen, 1910 L0269A6 (ADH1401), KERL0269A8 (ADH1401), KERL0274A2 (ADH1401), KERL0274A4 Material examined: KERL268A1; KERL268A3; KER- (ADH1401), KERL0274A6 (ADH1401) L275A4; KERL275A5; KERL275A6; KERL275A7; Collection site: Peppara Wildlife Sanctuary KERL275A8 (8º 37' 14.7'' N, 77º 10' 03.3'' E), Thiruvanantha- Sample ID with BOLD accession number: KER- puram, Kerala, India. L0268A1 (ADH1313); KERL0268A3 (ADH1313); Date of collection: 25 X 2015 KERL0275A4 (ADH1313); KERL0275A5 Diagnostic features: length 45–100 mm; diameter (ADH1313); KERL0275A6 (ADH1313); KER- 4 mm, segments 165. Colour dark bluish olive, dar- L0275A7 (ADH1313); KERL0275A8 (ADH1313) ker dorsally. Prostomium small, prolobous. Dorsal Collection site: Neyyar Wildlife Sanctuary (8º 33' 00.2'' N, pores absent. Setae visible in III, closely paired, aa 77º 14' 33.1'' E), Trivandrum, Kerala, India. less than bc, except at hinder end. Nephridiopores Date of collection: 27 XI 2015 in cd. Clitellum on X–XIII. Male pores between b Diagnostic features: length 80–190 mm; diameter and c bounded by narrow lips; a pair of fairly whitish 2–7 mm, segments 140–186. Colour bluish grey. papillae on the segment in front of the male pores. Prostomium prolobous. Dorsal pores absent. Setae Female pores in b. Spermathecal pores in c. Four visible from III segment, closely paired; aa equal gizzards in XIV–XVII. Testis sacs ovoid projecting or slightly greater than bc; dd slightly greater than in IX and X. Vas deferens slightly coiled. Prostate ½ circumference. Nephridiopores usually in cd. spherical (sometimes pear–shaped), glandular, Male pores transverse slit like aperture between duct joins at its anterior end. Ovaries in segment b and c. Female pores in ab. Spermathecal pores XI, sessile, almost circular. Ovarian chamber pre- minute aperture slightly at b or lateral to b. Five sent, ovisacs present extending back to XIII or XIV. gizzards in XVI–XXII. Testis sacs ovoidal in XIII– Spermathecae with pear–shaped ampulla, long XVI. Vas deferens highly coiled and forms a cluster coiled duct and no atrial dilation (fig. 5). equal or larger than testis sac. Prostate ovoid or thickly pear–shaped, with investment of glandular Drawida nilamburensis (Bourne, 1894) cells. Ovarian chamber present. Spermathecal ampulla pear–shaped. Atrium with bilobed cavity, Material examined: KERL53A2 duct highly coiled entering atrium in the depression Sample ID with BOLD accession number: KERL53A2 between the lobes (fig. 4). (ADH3257) Collection site: Close to Chaliyar River (11º 19' 04.6'' N, Drawida impertusa Stephenson, 1920 76º 11' 19.9'' E) Malapuram, Areekode, Malappu- ram, Kerala, India. Material examined: KERL269A6, KERL269A8, KER- Date of collection: 09 IX 2014 L274A2, KERL274A4, KERL274A6 Diagnostic features: length 500–700 mm; diameter Sample ID with BOLD accession number: KER- 7 mm, segments 550–600, secondary annulation Animal Biodiversity and Conservation 44.1 (2021) 125

amp vd tss VII spp spd VIII prs IX mp X atr

XI 1 mm 1 mm 1 mm A B C

Fig. 4. Camera lucida sketch of Drawida ghatensis: A, ventral view; B, spermathecae; C, testis sac with prostate. (For abbreviations, see Material and methods).

Fig. 4. Dibujo con cámara lúcida de Drawida ghatensis: A, vista ventral; B, espermateca; C, saco testicular con próstata. (Para las abreviaturas, véase Material and methods).

vd VII amp tss prs VIII spp spd IX

X mp XI 1 mm 1 mm 1 mm A B C

Fig. 5. Camera lucida sketch of Drawida impertusa: A, ventral view; B, spermathecae; C, testis sac with prostate. (For abbreviations, see Material and methods).

Fig. 5. Dibujo con cámara lúcida de Drawida impertusa: A, vista ventral; B, espermateca; C, saco testicular con próstata. (Para las abreviaturas, véase Material and methods).

present. Slightly pigmented. Prostomium broad. (not clearly visible to draw under camera lucida) Setae long, aa greater than bc; dd greater than embedded in the body wall (fig. 6). ½ circumference visible from IV segment. Nephri- diopores in cd. Male pores between b and c or at Drawida robusta (Bourne, 1886) b or nearer b. Female pores in ab. Spermathecal pores in cd. Septa 5/6–8/9 strongly thickened. Material examined: KERL270A4, KERL2701 Five gizzards in XXVII–XXXI. Testis sacs ovoid. Sample ID with BOLD accession number: KER- Prostate not glandular, ovoidal in appearance, L0270A4 (ADH1162); KERL027012 (ADH1162) vas deferens long, very coiled. Ovarian chamber Collection site: Peppara Wildlife Sanctuary present. Spermathecal ampulla pear–shaped, (8º 37' 14.7'' N, 77º 10' 03.3'' E) Thiruvanantha- atrium as a dilation of the end of the duct, small puram, Kerala, India. 126 Thakur et al.

VII spp vd VIII spd tss IX prs amp X

XI mp 1 mm 1 mm 1 mm A B C

Fig. 6. Camera lucida sketch of Drawida nilamburensis: A, ventral view; B, spermathecae; C, testis sac with prostate. (For abbreviations, see Material and methods).

Fig. 6. Dibujo con cámara lúcida de Drawida nilamburensis: A, vista ventral; B, espermateca; C, saco testicular con próstata. (Para las abreviaturas, véase Material and methods).

Date of collection: 25 X 2015 and c; posterior male pores on 10/11, in line/just Diagnostic features: length 80–180 mm; diameter outside of setae b, in the antero–lateral angles 4–6 mm, segments 150–160. Colour bluish to of a thickened median patch which occupies the greenish brown. Setae closely paired, very small aa ventral surface (almost entire) of XI. Female pores greater than bc; dd greater than ½ circumference in 11/12 between the lines a and b. Spermathecal visible from III segment. Nephridiopores in cd. pores in ab or slightly lateral to b. Septa 6/7–8/9 Male pores between b and c nearer to c. Female considerably thickened, 5/6 thin, 9/10 and a few pores in ab. Spermathecal pores in cd very minute following slightly thickened. Two gizzards in XIII aperture. Number of gizzards four in XII–XV. Testis and XIV, sometimes three in XIII–XV. Testis sacs sacs large sub–ovoidal or spherical in X–XI. Vas extending into IX and X. Prostate two pairs in deferens long and highly coiled. Prostate hemis- IX and X, elongated, cylindrical or pear–shaped, pherical, glandular, duct joins at its posterior region. surface soft, minutely papillated. No ovarian cham- Ovarian chamber present, ovisacs small, tubular ber, spermathecal atrium ovoid and sac like, duct confined to XII. Spermathecal ampulla pyriform to entering towards the ectal end (fig. 8). oval. Atrium bilobed, duct (not much coiled) entering in the depression between the lobes (fig. 7). Drawida travancorense Michaelsen, 1910

Drawida scandens Rao, 1921 Material examined: KERL274A5 Sample ID with BOLD accession number: KER- Material examined: KERL77A2 L0274A5 (ADH1161) Sample ID with BOLD accession number: KERL077A2 Collection site: Peppara Wildlife Sanctuary (ADH2690) (8º 38' 35.2'' N, 77º 10' 50.6'' E), Trivandrum, Collection site: Wayanad Forest area near Agraharam Kerala, India. Resort (11º 54' 42.2'' N, 76º 00' 27.0'' E), Wayanad, Date of collection: 26 XI 2015 Kerala, India. Diagnostic features: length 60–110 mm; diameter Date of collection: 08 IX 2014 3 mm, segments 127. Colour light grey. Dorsal Diagnostic features: length 38–45 mm; diameter pores absent. Setae closely paired, begin from II, 1.5–2 mm, segments 144–161. Colour dark bluish aa lesser than bc; dd greater than ½ circumference brown or olive. Prostomium prolobous. Setae visible from II segment. Clitellum saddle–shaped, closely paired, large and prominent especially in interrupted between the lines a, including X–XIII. the ventral bundles of III–XII; aa = bc or in the Nephridiopores in cd visible from IV. Male pores anterior part of the body is rather greater; dd = ½ comma like slits, the broader end towards the circumference Male pores two pairs, the anterior in middle line between b and c nearer to b. Female 9/10, rather outside the line of setae b, on a median pores in ab. Spermathecal pores in c slit like transverse somewhat dumbbell–shaped cushion, aperture. Septa 5/6–8/9 strongly thickened. Two extending on each side to between the line of b gizzards in XI–XV. Testis sacs large irregular in Animal Biodiversity and Conservation 44.1 (2021) 127

spp amp tss vd VII VIII IX spd X mp XI atr prs

1 mm 1 mm 1 mm

A B C

Fig. 7. Camera lucida sketch of Drawida robusta: A, ventral view; B, spermathecae; C, testis sac with prostate. (For abbreviations, see Material and methods).

Fig. 7. Dibujo con cámara lúcida de Drawida robusta: A, vista ventral; B, espermateca; C, saco testicular con próstata. (Para las abreviaturas, véase Material and methods).

tss spd vd

VII spp atr VIII IX amp prs mp X XI 1 mm 1 mm 1 mm

A B C

Fig. 8. Camera lucida sketch of Drawida scandens: A, ventral view; B, spermathecae; C, testis sac with prostate. (For abbreviations, see Material and methods).

Fig. 8. Dibujo con cámara lúcida de Drawida scandens: A, vista ventral; B, espermateca; C, saco testicular con próstata. (Para las abreviaturas, véase Material and methods).

shape in X–XI (sometimes IX–XI). Vas deferens Genus Moniligaster Perrier, 1872 short, not much coiled, confined in X. Prostate large pear–shaped, pigmented reddish with fine One pair of male pores in 10/11, one pair of female grooves. Ovarian chamber present, ovisacs thick, pores in 11/12, one pair of spermathecal pores in 7/8. short extending backwards through one or two Gizzards 4 or 5 in front of the intestine. Last pair of segments. Spermathecal ampulla pear–shaped or hearts in IX. One pair of testis sacs on septum 9/10. ovoid, atrium club–shaped sac in VII, duct entering Prostates with duct distinguishable from glandular its ental end (fig. 9). part, ovisacs in XI. Ovisacs extending backwards 128 Thakur et al.

tss VII spp amp vd VIII spd atr IX prs X mp XI

1 mm 1 mm 1 mm

A B C

Fig. 9. Camera lucida sketch of Drawida travancorense: A, ventral view; B, spermathecae; C, testis sac with prostate. (For abbreviations, see Material and methods).

Fig. 9. Dibujo con cámara lúcida de Drawida travancorense: vista ventral; B, espermateca; C, saco testicular con próstata. (Para las abreviaturas, véase Material and methods).

from 11/12. Spermathecae with a bifid muscular atrial than the testis. Prostate large mushroom–shaped, chamber (fig. 10), each horn of which bears a lobulat- muscular, thick, opaque and lined internally with ed glandular mass. Genus differs from Drawida in the white material which is raised into irregular ridges. presence of two horns of atrial chamber (one pair of Ovarian chamber present, ovisacs with thick wall glands discharging by its own canal into a common extending into XVI. Spermathecal duct is 20 mm duct; fig. 10) and mostly found in South India. long and passes into the base of posterior atrial gland. Two atrial glands with the usual mammillated Moniligaster aiyeri Gates, 1940 surface. Ectally two glands appear united but can be separated after removal of the investing tissues, Material examined: KERL264A1, KERL276A1, KER- the common duct of atrial glands is thick, short, L276A2 lateromesially flattened (fig. 11). Sample ID with BOLD accession number: KER- L0264A1 (ADH1655), KERL0276A1 (ADH1655), Moniligaster deshayesi Perrier, 1872 KERL0276A2 (ADH1655) Collection site: Neyyar Wildlife Sanctuary Material examined: KERL267A5, KERL0272A5 (10º 06' 39.2'' N, 77º 05' 28.1'' E), Trivandrum, Sample ID with BOLD accession number: KER- Kerala, India. L0267A5 (ADH1656), KERL0272A (ADH1656) Date of collection: 27 XI 2015 Collection site: Parambikulam Tiger Reserve Diagnostic features: length 400–600 mm; diameter (10º 23' 34.6'' N, 76º 46' 32.0'' E), Kerala, India. 8–10 mm, segments 310. Colour dark reddish Date of collection: 17 IX 2015 brown. Dorsal pores absent. Setae closely paired, Diagnostic features: length 120–150; diameter 6 mm, aa = bc; dd = ½ circumference. Nephridiopores segments 167–180. Colour dark blue. Dorsal pores usually at ab. Clitellum annular extending on absent. Setae closely paired, aa = bc; dd = slightly X–XIIII. Male pores transversely placed elliptical more than ½ circumference. Nephridiopores in apertures on 10/11 in bc nearer to b, each aperture ab or cd, no regular alternation. Clitellum not protuberant to the exterior an antero–posteriorly well marked. Male pores small in bc nearer to b. flattened, penis like structure with transversely slit Female pores indistinct in b. Spermathecal pores like aperture on the ventral face. Female pores at c. Septa 4/5 and 5/6 fused at their peripheral minute on b. Spermathecal pores transversely attachment; 6/7–8/9 much thickened. Four gizzards placed slits in cd or d. Septa 6/7 is thickly muscular, in XV–XVIII. Testis sacs tubular sac like in 9/10. 7/8–8/9 very thickly muscular. Three–five gizzards Vas deferens very long, twisted into a number of in XVI–XXII. Testis sacs smaller than the cluster hair–pin loops under the sac and passes down into of vas deferens which is much thicker, very long, a vertical column of leaflets. Prostate very large, loop of slender portion in IX and X, thickened sausage–shaped, extending back through several portion in a cluster of loops in IX which is larger segments. Ovarian chamber present, ovisacs large Animal Biodiversity and Conservation 44.1 (2021) 129

extending back through several segments. Sper- mathecae with ovoid ampulla and coiled duct, which joins a bifurcation of the atrial gland in VII, which is large, bifid, each half compact and rounded with a yellowish mammillated surface, the stalk of the two halves unite to form a common duct (fig. 12).

Moniligaster gravelyi Stephenson, 1915

Material examined: KERL270A13, KERL270A14, KERL270A18, KERL270A19, KERL270A20 Sample ID with BOLD accession number: KER- L0270A13 (ADH0515), KERL0270A14 (ADH0515), KERL0270A18 (ADH0515), KERL0270A19 (ADH0515), KERL0270A20 (ADH0515) Collection site: Shendurney Wildlife Sanctuary (8º 53' 03.7'' N, 77º 10' 03.3'' E), Kollam, Kerala, India. Date of collection: 26 X 2015 Diagnostic features: length 80–120 mm; diameter 1 mm 6 mm, segments 100–130. Colour dark bluish grey. Dorsal pores absent. Setae very closely paired, Fig. 10. Microphotograph of atrial gland in aa = bc; dd = ½ circumference. Nephridiopores Moniligaster sp. in ab or cd, no regular alternation. Male pores transversely placed slits on 10/11 in bc nearer to Fig. 10. Microfotografía de la glándula accesoria b, each aperture surrounded by finely wrinkled, de Moniligaster sp. annular band. Female pores nearer to b. Sper- mathecal pores median to c. Septa 6/7 is thickly muscular, 7/8–8/9 very thickly muscular. Five gizzards in XIII–XVII. Testis sacs ovoidal in IX–X. Vas deferens clusters of hair pin loops, enters prostate at its ectal end. Prostate extends back to ned to VII, single or indistinctly bifid (demarcated XIII, large flattened, strap like with slight incisions by transverse furrow) with mamillated surface, a of the lateral margins, narrower at the ectal end. short moderately stout duct being given off from Ovarian chamber present, ovisacs large extending its under surface, spermathecal duct joins atrial back through several segments. Atrial gland confi- gland on its upper end of demarcation (fig. 13).

vd VII spp atr VIII atrgl prs IX amp spd X mp XI 1 mm 1 mm 1 mm A B C

Fig. 11. Camera lucida sketch of Moniligaster aiyeri: A, ventral view; B, spermathecae; C, testis sac with prostate. (For abbreviations, see Material and methods).

Fig. 11. Dibujo con cámara lúcida de Moniligaster aiyeri: A, vista ventral; B, espermateca; C, saco testicular con próstata. (Para las abreviaturas, véase Material and methods). 130 Thakur et al.

tss atr VII VIII spp vd IX X amp prs mp spd XI 1 mm 1 mm 1 mm

A B C

Fig. 12. Camera lucida sketch of Moniligaster deshayesi: A, ventral view; B, spermathecae; C, testis sac with prostate. (For abbreviations, see Material and methods).

Fig. 12. Dibujo con cámara lúcida de Moniligaster deshayesi: A, vista ventral; B, espermateca; C, saco testicular con próstata. (Para las abreviaturas, véase Material and methods).

Molecular characterization and census of Moniligastrids pertusa, D. nilamburensis, D. robusta, D. scandens, of the study area D. travancorense) and three in the genus Moniligaster (M. aiyeri, M. deshayesi, M. gravelyi). The ave- From the study area, the investigation revealed eleven rage nucleotide compositions were G = 18.18 %, species belonging to the family Moniligastridae. Out of C = 23.43 %, A = 25.21 %, T = 32.43 % and mean them eight species were recorded in genus Drawida GC% detected was 42.43%, which is normally obser- (D. brunnea, D. circumpapillata, D. ghatensis, D. im- ved in earthworms (Thakur et al., 2020). The 56 COI

atr vd VII spp tss amp VIII IX prs spd X mp XI 1 mm 1 mm 1 mm

A B C

Fig. 13. Camera lucida sketch of Moniligaster gravelyi: A, ventral view; B, spermathecae; C, testis sac and prostate. (For abbreviations, see Material and methods).

Fig. 13. Dibujo con cámara lúcida de Moniligaster gravelyi: A, vista ventral; B, espermateca; C, saco testicular con próstata. (Para las abreviaturas, véase Material and methods). Animal Biodiversity and Conservation 44.1 (2021) 131

Table 3. The average percentage of K2P intra (shaded diagonally) and interspecific distance at 1,000 bootstrap replicates of moniligastrids from Kerala, Western Ghats.

Tabla 3. El porcentaje medio de la distancia calculada con el modelo K2P dentro de una misma especie (celdas sombreadas en diagonal) y entre especies con 1.000 réplicas bootstrap de los moniligástridos de Kerala, en Western Ghats.

dataset with average intraspecific as well as average integrative approach, would aid in better estimate interspecific evolutionary distances revealed by K2P earthworm diversity (Dayrat, 2005; Lone et al., 2020). distance summary were 1.2 % and 22 %. The lowest The reliability of the DNA barcode as a data source interspecific K2P distance recorded was 5.58 % bet- for species delimitation depends on the barcode ween D. ghatensis and D. impertusa. The highest gap, which is a marked discontinuity between the interspecific distance was 35 % between D. japonica values of intraspecific and interspecific divergences. and M. deshayesi. Similarly, the highest intraspecific A clear break between intraspecific and interspecific distance was 7.5 % in D. ghilarovi followed by D. divergences improves confidence of species delimi- japonica (6.9 %) and D. impertusa (4 %). Furthermore, tation and identification (Hebert et al., 2004; Meier et the average K2P distance at 1,000 bootstrap replicates al., 2008). In our study, BGA suggested a barcode of moniligastrids is shown in table 3. Barcode gap gap of 2–5 % with no overlap, which support the analysis suggested a clear barcode gap of 2–5 % accuracy of DNA barcoding to delimit moniligastrid showing no overlapping interactions between evolu- taxa. Furthermore, in DNA barcoding, species are tionary distances of sequences (table 4, fig. 14). The distinct from their nearest neighbours (NN) if their phylogenetic analysis showed full support for each maximum intraspecific distance is less than the dis- taxon and there were minor differences in topologies tance to their nearest neighbour sequence (Ashfaq of NJ (fig. 15) and ML (fig. 16) trees. In addition, all et al., 2014). Similar observations were seen in our the species represented separate clades and were report (table 4) where all the intraspecific distances fully recovered on both NJ and BI trees. were less than to their nearest neighbour (NN), which further support DNA barcoding for species delimitation of earthworms. The interspecific K2P Discussion genetic distances among the moniligastrid species ranged between 5.6 % and 34.0 % (table 3). The Earthworms are one of the most valuable soil ani- smallest K2P interspecific distance was 5.6 %, mals but their characteristics and burrowing nature observed between D. impertusa and D. ghatensis. makes their taxonomy difficult, resulting in a mas- Owing to their smallest interspecific distances they sive underestimation of the true level of earthworm appeared closest on ML and NJ trees. Conversely, diversity (Sket, 1999). The DNA barcodes combined the highest interspecific K2P distance was 34.0 % with the classical morpho–anatomic screening, the between D. japonica and M. deshayesi followed 132 Thakur et al.

Table 4. Barcode gap analysis based on K2P showing distances to nearest neighbour (NN). (If the species is a singleton, intra–specific values are shown with N/A).

Tabla 4. Análisis de deficiencias del código de barras basado en el modelo K2P en el que se muestran las distancias al vecino más cercano (NN). (Si la especie solo cuenta con un individuo, el valor intraespecífico se indica con 'N/A').

Mean Min Distance intra–specific inter–specific to Species N distance (%) distance (%) NN NN D. brunnea 1 N/A 0 M. aiyeri 23.06 D. circumpapillata 1 N/A 0 M. gravelyi 19.5 D. ghatensis 6 0.25 0.47 D. impertusa 5.53 D. impertusa 5 0.36 0.63 D. ghatensis 5.53 D. nilamburensis 1 N/A 0 D. travancorense 19.62 D. robusta 2 0.16 0.16 D. impertusa 16.43 D. scandens 1 N/A 0 M. aiyeri 23.1 D. travancorense 1 N/A 0 M. aiyeri 19.27 M. aiyeri 3 0 0 D. travancorense 19.27 M. deshayesi 2 0.31 0.31 D. nilamburensis 22.72 M. gravelyi 5 0.1 0.16 D. circumpapillata 19.5

by D. japonica and D. gracilis 33.9 %. The highest thworm diversity using molecular tools. Identification K2P intraspecific distance was found inD. ghilarovi. using molecular data helps to morphologically identify This could be explained by the presence of different variable individuals of the same species, juvenile morphs and therefore a species complex (Blakemore specimens and cocoons. In the case of earthworms, et al., 2014). Moreover, except for D. japonica and the classical standards of taxonomy are mainly ba- D. ghilarovi, all the studied moniligastrids had low sed on genital structures, while the collection of the intraspecific genetic distances. Moreover, the NJ and sexually developed worms is uncertain. Therefore, ML phylogenetic trees' topologies further confirmed the generation of a DNA database of sequences of that these eleven species were distinct evolutionary earthworms is advantageous and inevitable. The study units. All species were recovered as clade. However, presents eleven earthworm species belonging to two it appears that Moniligaster may need revision, as the genera of the family Moniligastridae, represents about representatives used here nested within Drawida. In 55 % of this family (20 species) (Blakemore, 2007; recent times, the use of molecular identification has Narayanan et al., 2016) and about 2.5 % (435 spe- increased, along with morphological characteristics, cies/subspecies) of the country (Thakur and Yadav, to differentiate earthworm species and to detect 2018). It is noteworthy that Kerala possesses about cryptic species (Decaëns et al., 2013). 50.5 % of the earthworm diversity found in the Western Progress in molecular taxonomy of earthworms of Ghats biodiversity hotspot (Julka et al., 2009; Nair India has been ad hoc. The fact that we do not know et al., 2010). The giant earthworm species Drawida the full systematic inventory the soil biota generally, nilamburensis about 75 cm body length, native to and especially the key earthworms, is an oversight Kerala, is reported in this study. that urgently needs to be redressed. Each ecosystem The study explored eight different sites in the State is composed of populations of species and each of Kerala. Other regions, especially western and species has its particular ecological requirements and south–western parts of the state remain unexplored responses. Earthworms in general are keystone ani- and need to be investigated further. All recorded spe- mals in nutrient cycling processes due to their role as cies were endemic, indicating undisturbed habitats major detritivores (i.e., feeding on dead and decaying within the protected areas of Kerala. Moreover, of matter, including dung). Correct species identification the eleven earthworm species reported in this study, is important to accurate ecological study that we need COI sequences of only three species (D. ghatensis, as a first step to fully understanding, appreciating and D. impertusa and D. travancorense) are available in utilizing this natural and national resource appropria- the NCBI database, which indicates limited availa- tely. DNA barcoding is an indispensable tool for its bility of molecular analysis and assessment of ear- speed and accuracy, but only after the initial vouchers thworm diversity in Kerala. Some recent reports on are correctly identified. Thus, the present study has earthworm diversity are available, however, based on been taken to provide a baseline status survey of ear- morphological observations (Narayanan et al., 2016, Animal Biodiversity and Conservation 44.1 (2021) 133

A 100 Mean intraspecific 80 60 40 20 Frequency (%) Frequency 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 Genetic divergence (%, K2P)

B 100 Distance to NN 90 80 70 60 50 40 30 20

Frequency (%) Frequency 10 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 Genetic divergence (%, K2P)

C 100 Intraspecific 90 80 Interspecific 70 60 50 40 30 20 Frequency (%) Frequency 10 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 Genetic divergence (%, K2P)

Fig. 14. Histogram of barcode gap analysis of Moniligastrids based on K2P distance from Kerala: A, mean intraspecific genetic divergence; B, distance to nearest neighbour; C, distributions of intraspecific and interspecific genetic divergences based on 28 mitochondrialCOI sequences for 11 species of Moniligastrids.

Fig. 14. Histograma del análisis de deficiencias del código de barras de los moniligástridos de Kerala basado en la distancia calculada con el modelo K2P: A, promedio de la divergencia genética intraespe- cífica; B, distancia al vecino más cercano; C, distribución de las divergencias genéticas interespecíficas e intraespecíficas basadas en 28 secuencias mitocondriales COI para 11 especies de Moniligastridos.

2017). The present study fills the gap of molecular huge variety of endemic fauna, where records are taxonomy of earthworms, with 28 COI datasets of scanty. Furthermore, threats to biodiversity have al- endemic earthworms of Kerala having been gene- ready raised alarms with respect to the conservation rated. The findings may serve as a reference library of biodiversity and much emphasis has been given of genomic signatures of earthworms in the study to endemic species. Considering the high diversity area, providing data for taxonomic assessments, of earthworms (e.g. Blakemore, 2000; Chang et al., phylogeny, molecular identification, dispersal, and 2008), biomass (e.g. Brockie and Moeed, 1986) and population dynamics. Yet, in total of 83 species ecosystem functioning (Boyer and Wratten, 2010) are of moniligastrids are known from India, but none likely to be threatened with extinction. The genomic ones given here are barcoded and published. An signature of these species may not only delimit ear- integrative taxonomic classification, incorporating thworm species but could be used in various other morphological classification, DNA barcoding and fields such as conservation strategies, toxicological phylogeny is especially useful when working on a research, and bioremediations. 134 Thakur et al.

0.05

Fig. 15. Neighbour–joining tree containing 56 COI dataset at 1,000 bootstrap analysis in MEGA X with Mollusca sp. as out–group.

Fig. 15. Árbol producido mediante el método de unión de vecinos que contiene el conjunto de datos de 56 COI obtenido con un análisis de bootstrap de 1.000 réplicas en MEGA X con especies del filo Mollusca como grupo externo. Animal Biodiversity and Conservation 44.1 (2021) 135

Fig. 16. Maximum likelihood tree containing 56 COI dataset at 1,000 bootstrap analysis in MEGA X with Mollusca sp. as out–group.

Fig. 16. Árbol producido mediante el método de la máxima verosimilitud que contiene el conjunto de datos de 56 COI obtenido con un análisis de bootstrap de 1.000 réplicas en MEGA X con especies del filo Mollusca como grupo externo. 136 Thakur et al.

Conclusion cast mining–A review. Basic and Applied Ecology, 11(3): 196–203, Doi: 10.1016/j.baae.2009.12.005 This study used the DNA sequence of a 650 bp fragment Brockie, R. E., Moeed, A., 1986. Animal biomass in a of the COI gene to delimit the species of native monili- New Zealand forest compared with other parts of gastrid earthworms in the state of Kerala, a component the world. Oecologia, 70(1): 24–34, Doi: 10.1007/ of the Western Ghats biodiversity hotspot. The geno- BF00377108 mic signatures of eight Drawida species (D. brunnea, Chang, C. H., Lin, S. M., Chen, J. H., 2008. Molecular D. circumpapillata, D. ghatensis, D. impertusa, D. systematics and phylogeography of the gigantic nilamburensis, D. robusta, D. scandens, and D. earthworms of the Metaphire formosae species travancorense) and three Moniligaster species (M. group (Clitellata, Megascolecidae). Molecular aiyeri, M. deshayesi, and M. gravelyi) are provided. Phylogenetics and Evolution, 49(3): 958–968, Doi: The results of this study may serve as a reference 10.1016/j.ympev.2008.08.025 library for moniligastrid earthworms within Kerala State Dayrat, B., 2005. Towards integrative taxonomy. Bio- and help to strengthen the fidelity of morpho–anato- logical Journal of the Linnean Society, 85: 407–415, mical identification. Doi: 10.1111/j.1095–8312.2005.00503.x Decaëns, T., Porco, D., Rougerie, R., Brown, G. G., James, S. W., 2013. Potential of DNA barcoding Acknowledgements for earthworm research in taxonomy and ecology. Applied Soil Ecology, 65: 35–42, Doi: 10.1016/j. The authors are thankful to Principal Chief Con- apsoil.2013.01.001 servator Forest (PCCF), Kerala and Department of Gates, G. E., 1972. Burmese earthworms: an intro- Biotechnology, Ministry of Science and Technology, duction to the systematics and biology of megadrile Government of India, New Delhi for the financial oligochaetes with special reference to Southeast support to carry out the study. Asia. Transactions of the American Philosophical Society, 62(7): 1–326, Doi: 10.2307/1006214 Hebert, P. D., Stoeckle, M. Y., Zemlak, T. S., Francis, References C. M., 2004. Identification of birds through DNA barcodes. Plos Biology, 2(10): 312, Doi: 10.1371/ Aiyer, K. P., 1929. An account of the Oligochaeta of journal.pbio.0020312 Travancore. Records Indian Museum, 31: 13–76. Jamieson, B. G. M., 1977. On the phylogeny of the Ashfaq, M., Hebert, P. D., Mirza, J. H., Khan, A. M., Moniligastridae, with description of a new species of Zafar, Y., Mirza, M. S., 2014. Analysing mosquito Moniligaster (Oligochaeta, Annelida). Evolutionary (Diptera: Culicidae) diversity in Pakistan by DNA Theory, 2: 95–114. barcoding. Plos One, 9(5): 1–12, Doi: 10.1371/ Julka, J. M., 1988. The Fauna of India and Adjacent journal.pone.0097268 Countries. Megadrile Oligochaeta (Earthworms). Blakemore, R. J., 2000. Native earthworms (Oligo- Haplotaxida: Lumbricina: Megascolecoidea: Oc- chaeta) from southeastern Australia, with the de- tochaetidae. Government of India, Calcutta, India. scription of fifteen new species. Records Australian Julka, J. M., Paliwal, R., Kathireswari, P., 2009. Museum, 52(2): 187–222, Doi: 10.3853/j.0067- Biodiversity of Indian earthworms – an overview. 1975.52.2000.1314 In: Proceedings of Indo–US Workshop on Vermi- – 2007. Checklist of 505 earthworms species from technology in Human Welfare (C. A. Edwards, R. India, Sri Lanka and the adjacent regions (exclud- Jayaraaj, I. A. Jayraaj, Eds.). Rohini Achagam, ing Myanmar) compiled from various sources [eg Coimbatore, India. Stephenson (1923), Gates (1972), Julka (1988) Kimura, M., 1980. A simple method for estimating etc.]. A series of searchable texts on earthworm evolutionary rates of base substitutions through biodiversity, ecology and systematic from various comparative studies of nucleotide sequences. Jour- regions of the world, 3rd Edition. Available online nal of Molecular Evolution, 16(2): 111–120, Doi: at: http://www.annelida.net/earthworm 10.1007/BF01731581 – 2014. Miscellaneous earthworm types in the Natural Kumar, S., Stecher, G., Li, M., Knyaz, C., Tamura, K., History Museum, London (Annelida: Oligochaeta: 2018. MEGA X: molecular evolutionary genetics Megadrilacea: Eudrilidae, Lumbricidae, Megascol- analysis across computing platforms. Molecular ecidae, Moniligastridae, Octochaetidae). Opuscula Biology and Evolution, 35(6): 1547–1549, Doi: Zoologica (Budapest), 45(2): 119–155. 10.1093/molbev/msy096 Blakemore, R. J., Lee, S., Seo, H. Y., 2014. Re- Lone, A. R., Tiwari, N., Thakur, S. S., Yadav, S., ports of Drawida (Oligochaeta: Moniligastridae) 2020. Exploration of four new Kanchuria sp. of from far East Asia. Journal of Species Research, earthworms (Oligochaeta: Megascolecidae) from 3(2):127–166, Doi: 10.12651/JSR.2014.3.2.127 the North Eastern Region of India using DNA bar– Bourne, A. G., 1894. On Moniligaster grandis, AGB, coding approach. Journal of Asia–Pacific Biodiver- from the Nilgiris, S. India; together with descriptions sity, 13: 268–281, Doi: 10.1016/j.japb.2020.02.004 of other species of the genus Moniligaster. Quarterly Meier, R., Zhang, G., Ali, F., 2008. The use of mean Journal of Microscopical Science, 36: 307–384. instead of smallest interspecific distances exag- Boyer, S., Wratten, S. D., 2010. The potential of earth- gerates the size of the 'barcoding gap' and leads worms to restore ecosystem services after open- to misidentification. Systematic Biology, 57(5): Animal Biodiversity and Conservation 44.1 (2021) 137

809–813, Doi: 10.1080/10635150802406343 Doi: 10.1111/j.1471-8286.2007.01678.x Mittermeier, R. A., Turner, W. R., Larsen, F. W., Rao, Y. P., 1976. Southwest monsoon, meteorological Brooks, T. M., Gascon, C., 2011. Global biodi- monograph. India Meteorological Department, New versity conservation: the critical role of hotspots. Delhi, India. In: Biodiversity hotspots: 3–22 (F. E. Zachos, J. Satchell, J. E., 1969. Methods of sampling earthworm C. Habel, Eds.). Springer, Berlin, Heidelberg, Doi: populations. Pedobiologia, 9(1969): 20–25. 10.1007/978-3-642-20992-5_1 Sket, B., 1999. The nature of biodiversity in hypo- Myers, N., Mittermeier, R. A., Mittermeier, C. G., Da gean waters and how it is endangered? Biodi- Fonseca, G. A., Kent, J., 2000. Biodiversity hotspots versity and Conservation, 8(10): 1319–1338, Doi: for conservation priorities. Nature, 403(6772): 10.1023/A:1008916601121 853–858, Doi: 10.1038/35002501 Sreedharan, T. P., 2004. Biological Diversity of Kerala: Nair, K. V., Manazhy, J., Manazhy, A., Reynolds, J. W., A survey of Kalliasseri panchayat, Kannur district. 2010. A new genus of earthworm (Oligochaeta: Almi- Kerala Research Programme on Local Level dae) from Kerala, India. Megadrilogica, 14: 53–58. Development, Centre for Development Studies, Narayanan, S. P., Sathrumithra, S., Christopher, G., Thiruvananthapuram, India. Thomas, A. P., Julka, J. M., 2016. Checklist of Stephenson, J., 1923. Oligochaeta: The Fauna of Brit- the earthworms (Oligochaeta) of Kerala, a con- ish India, including Ceylon and Burma. Taylor and stituent of Western Ghats biodiversity hotspot, Francis Limited, London, UK, Doi: 10.1038/113455b0 India. Zootaxa, 4193(1): 117–135, Doi: 10.11646/ Thakur, S. S., Lone, A. R., Tiwari, N., Yadav, S., zootaxa.4193.1.5 2020. Exploring new records of Eutyphoeus sp. Narayanan, S. P., Sathrumithra, S., Christopher, G., (haplotaxida: Octochaetidae) from garo hills, Me- Julka, J. M., 2017. New species and new records ghalaya, North Eastern state of India with use of of earthworms of the genus Drawida from Kerala DNA barcodes. Mitochondrial DNA Part A, 1–8, part of the Western Ghats biodiversity hotspot, Doi: 10.1080/24701394.2020.1781834 India (Oligochaeta, Moniligastridae). ZooKeys, 691: Thakur, S. S., Yadav, S., 2018. Exploration of 1–18, Doi: 10.3897/zookeys.691.13174 Earthworms of India through Online Digital Library. Ratnasingham, S., Hebert, P. D., 2007. bold: The Bar- In: Earthworms: The Ecological Engineers of Soil: code of Life Data System (http://www.barcodinglife. 33–59 (S. Ray, Ed.). Intechopen, London, United org). Molecular Ecological Notes, 7(3): 355–364, Kingdom, Doi: 10.5772/intechopen.75666 ii Thakur et al.

Supplementary material

FASTA file of COI sequences of all samples included in the study.

Archivo FASTA de secuencias COI de todas las muestras incluidas en el estudio.

IEW388-17|Drawida brunnea AACCCTATACTTCATCCTTGGGGTATGAGCAGGAATAATTGGGGCCGGAATAAGGCTCCTGATTCGA ATTGAGCTAAGACAGCCGGGGTCATTTCTAGGAAGTGATCAGTTATATAACACAATTGTAACAGCAC ATGCATTTATTATAATTTTTTTTCTAGTGATGCCAGTTTTTATCGGCGGGTTCGGTAACTGACTACTCC CACTAATATTGGGGGCACCAGACATAGCCTTCCCACGACTAAACAACTTAAGATTTTGACTATTGCCA CCAGCGCTAATTCTCCTGGTGTCATCAGCAGCTGTAGAAAAAGGTGCCGGAACCGGTTGAACAGTAT ACCCGCCCCTTGCCAGAAATCTGGCACATGCTGGCCCATCTGTTGACTTAGCAATTTTTTCTCTCCATT TGGCCGGGGCCTCATCAATTTTAGGGGCTATTAACTTCATCACAACAGTAGTAAACATGCGATGGCC GGGGATGTCCGTTGAACGAATTCCTCTATTTGTTTGGGGGGTCGTAATTACAGTTGTTCTACTTCTAC TATCACTTCCAGTTCTTGCCGGAGCAATTACCATATTATTAACAGACCGAAATCTAAATACATCATTTT TCGACCCCGCTGGTGGTGGTGACCCA------

IEW420-17|Drawida circumpapillata AACCCTGTATTTTATTTTAGGAATTTGAGCTGGAATGATTGGAGCTGGTATAAGACTTCTTATTCGAA TTGAATTAAGACAGCCGGGTGCCTTTCTAGGTAGTGATCAACTATACAACACTATTGTGACAGCCCAT GCATTCATTATAATCTTTTTCTTGGTTATGCCAGTATTTATTGGGGGTTTTGGTAATTGATTACTCCCTC TAATACTTGGTGCACCAGATATAGCATTCCCACGTCTTAACAATTTAAGATTTTGACTTCTACCCCCTG CCCTAATTCTTCTAGTATCATCTGCAGCAGTCGAAAAGGGGGCAGGTACAGGGTGAACAGTATACCC GCCCCTTGCAAGAAATTTGGCACATGCAGGGCCCTCAGTTGACCTGGCAATTTTTTCCCTTCATTTAG CCGGTGCATCATCTATTTTGGGGGCAATCAACTTTATCACTACAGTAATTAATATACGATGACCAGGA ATAAATATTGAGCGAATTCCATTATTTGTATGAGGCGTAACTATTACTGTTATCCTACTCCTTTTATCA CTTCCAGTTTTAGCCGGAGCTATTACCATGCTTCTTACCGACCGAAACCTCAATACATCATTCTTTGAT CCAGCGGGTGGTGGGGACCCAATTCTTTATCAACACCTATTT

IEW386-17|Drawida ghatensis AACACTTTATTTCATTCTAGGAGTTTGAGCTGGTATAATTGGAGCTGGCATAAGTCTTCTTATTCGTAT TGAGCTGAGACAGCCTGGCTCATTCTTAGGAAGAGACCAACTATACAACACCATTGTTACTGCTCATG CATTTATTATAATTTTCTTTTTAGTTATGCCAGTATTTATTGGTGGATTTGGTAATTGATTACTACCCCT AATACTTGGTGCTCCAGATATAGCCTTTCCGCGCCTCAATAATCTTAGATTTTGACTTCTACCGCCTGC ACTAATTCTTCTAGTTTCCTCTGCAGCCGTAGAAAAGGGGGCCGGGACCGGCTGAACAGTTTATCCC CCTCTTGCCAGAAATCTAGCTCATGCTGGCCCTTCAGTAGATCTAGCCATTTTCTCCCTTCATTTAGCA GGGGCCTCATCTATCCTCGGCGCTATTAATTTTATTACTACAGTAATTAATATACGATGACCGGGAAT AAACATCGAACGAATCCCCCTATTCGTTTGGGGTGTAACAATTACAGTAATTCTTCTTCTTCTATCACT TCCAGTTCTTGCAGGGGCCATCACCATACTTCTAACTGACCGAAATCTTAATACTTCGTTTTTTGACCC AGCCGGAGGCGGAGATCCA------TT

IEW432-17|Drawida ghatensis AACACTTTATTTCATTCTAGGAGTTTGAGCTGGTATAATTGGAGCTGGCATAAGTCTTCTTATTCGTAT TGAGCTGAGACAGCCTGGCTCATTCTTAGGAAGAGACCAACTATACAACACCATTGTTACTGCTCATG CATTTATTATAATTTTCTTTTTAGTTATGCCAGTATTTATTGGTGGATTTGGTAATTGATTACTACCCCT AATACTTGGTGCTCCAGATATAGCCTTTCCGCGCCTCAATAATCTTAGATTTTGACTTCTACCGCCTGC ACTAATTCTTCTAGTTTCCTCTGCAGCCGTAGAAAAGGGGGCCGGGACCGGCTGAACAGTTTATCCC CCTCTTGCCAGAAATCTAGCTCATGCTGGCCCTTCAGTAGATCTAGCCATTTTCTCCCTTCATTTAGCA GGGGCCTCATCTATCCTCGGCGCTATTAATTTTATTACTACAGTAATCAATATACGATGACCGGGAAT AAACATCGAACGAATCCCCCTATTCGTTTGGGGTGTAACAATTACAGTAATTCTTCTTCTTCTATCACT TCCAGTTCTTGCAGGGGCCATCACCATACTTCTAACTGACCGAAATCTTAATACTTCGTTTTTTGACCC AGCCGGAGGCGGAGATCCAA------Animal Biodiversity and Conservation 44.1 (2021) iii

IEW433-17|Drawida ghatensis AACACTTTATTTCATTCTAGGAGTTTGAGCTGGTATAATTGGAGCTGGCATAAGTCTTCTTATTCGTAT TGAGCTGAGACAGCCTGGCTCATTCTTAGGAAGAGACCAACTATACAACACCATTGTTACTGCTCATG CATTTATTATAATTTTCTTTTTAGTTATGCCAGTATTTATTGGTGGATTTGGTAATTGATTACTACCCCT AATACTTGGTGCTCCAGATATAGCCTTTCCGCGCCTCAATAATCTTAGATTTTGACTTCTACCGCCTGC ACTAATTCTTCTAGTTTCCTCTGCAGCCGTAGAAAAGGGGGCCGGGACCGGCTGAACAGTTTATCCC CCTCTTGCCAGAAATCTAGCTCATGCTGGCCCTTCAGTAGATCTAGCCATTTTCTCCCTTCATTTAGCA GGGGCCTCATCTATCCTCGGCGCTATTAATTTTATTACTACAGTAATTAATATACGATGACCGGGAAT AAACATCGAACGAATCCCCCTATTCGTTTGGGGTGTAACAATTACAGTAATTCTTCTTCTTCTATCACT TCCAGTTCTTGCAGGGGCCATCACCATACTTCTAACTGACCGAAATCTTAATACTTCGTTTTTTGACCC AGCCGGAGGCGGAGATCCAATTCTCTACCAACATCTATTT

IEW434-17|Drawida ghatensis AACACTTTATTTCATTCTAGGAGTTTGAGCTGGTATAATTGGAGCTGGCATAAGTCTTCTTATTCGTAT TGAGCTGAGACAGCCTGGCTCATTCTTAGGAAGAGACCAACTATACAACACCATTGTTACTGCTCATG CATTTATTATAATTTTCTTTTTAGTTATGCCAGTATTTATTGGTGGATTTGGTAATTGATTACTACCCCT AATACTTGGTGCTCCAGATATAGCCTTTCCGCGCCTCAATAATCTTAGATTTTGACTTCTACCGCCTGC ACTAATTCTTCTAGTTTCCTCTGCAGCCGTAGAAAAGGGGGCCGGGACCGGCTGAACAGTTTATCCC CCTCTTGCCAGAAATCTAGCTCATGCTGGCCCTTCAGTAGATCTAGCCATTTTCTCCCTTCATTTAGCA GGGGCCTCATCTATCCTCGGCGCTATTAATTTTATTACTACAGTAATTAATATACGATGACCGGGAAT AAACATCGAACGAATCCCCCTATTCGTTTGGGGTGTAACAATTACAGTAATTCTTCTTCTTCTATCACT TCCAGTTCTTGCAGGGGCCATCACCATACTTCTAACTGACCGAAATCTTAATACTTCGTTTTTTGACCC AGCCGGAGGCGGAGATCCAATTCTCTACCAACATCTATTT

IEW435-17|Drawida ghatensis AACACTTTATTTCATTCTAGGAGTTTGAGCTGGTATAATTGGAGCTGGCATAAGTCTTCTTATTCGTAT TGAGCTGAGACAGCCTGGCTCATTCTTAGGAAGAGACCAACTATACAACACCATTGTTACTGCTCATG CATTTATTATAATTTTCTTTTTAGTTATGCCAGTATTTATTGGTGGATTTGGTAATTGGTTACTACCCCT AATACTTGGTGCTCCAGATATAGCCTTTCCGCGCCTCAATAATCTTAGATTTTGACTTCTACCGCCTGC ACTAATTCTTCTAGTTTCCTCTGCAGCCGTAGAAAAGGGGGCCGGGACCGGCTGAACAGTTTATCCC CCTCTTGCCAGAAATCTGGCTCATGCTGGCCCTTCAGTAGATCTAGCCATTTTCTCCCTTCATTTAGCA GGGGCCTCATCTATCCTCGGCGCTATTAATTTTATTACTACAGTAATCAATATACGATGACCGGGAAT AAACATCGAACGAATCCCCCTATTCGTTTGGGGTGTAACAATTACAGTAATTCTTCTTCTTCTATCACT TCCAGTTCTTGCAGGGGCCATCACCATACTTCTAACTGACCGAAATCTTAATACTTCGTTTTTTGACCC AGCCGGAGGCGGAGATCCAATTCTCTACCAACATCTATTT

IEW436-17|Drawida ghatensis AACACTTTATTTCATTCTAGGAGTTTGAGCTGGTATAATTGGAGCTGGCATAAGTCTTCTTATTCGTAT TGAGCTGAGACAGCCTGGCTCATTCTTAGGAAGAGACCAACTATACAACACCATTGTTACTGCTCATG CATTTATTATAATTTTCTTTTTAGTTATGCCAGTATTTATTGGTGGATTTGGTAATTGATTACTACCCCT AATACTTGGTGCTCCAGATATAGCCTTTCCGCGCCTCAATAATCTTAGATTTTGACTTCTACCGCCTGC ACTAATTCTTCTAGTTTCCTCTGCAGCCGTAGAAAAGGGGGCTGGGACCGGCTGAACAGTTTATCCCC CTCTTGCCAGAAATCTAGCTCATGCTGGCCCTTCAGTAGATCTAGCCATTTTCTCCCTTCATTTAGCAG GGGCCTCATCTATCCTCGGCGCTATTAATTTTATTACTACAGTAATCAATATACGATGACCGGGAATA AACATCGAACGAATCCCCCTATTCGTTTGGGGTGTAACAATTACAGTAATTCTTCTTCTTCTATCACTT CCAGTTCTTGCAGGGGCCATCACCATACTTCTAACTGACCGAAATCTTAATACTTCGTTTTTTGACCCA GCCGGAGGCGGAGATCCAAT------

IEW391-17|Drawida impertusa AACACTTTATTTCATTCTAGGAGTTTGAGCTGGTATAATTGGAGCTGGTATAAGTCTTCTTATTCGTAT CGAGCTGAGACAGCCCGGCTCATTCCTAGGAAGAGACCAACTATATAACACCATTGTTACTGCTCAT GCATTCATTATAATTTTCTTTTTAGTCATGCCAGTATTTATTGGTGGATTTGGTAATTGATTATTACCCC TAATACTTGGTGCCCCAGATATAGCCTTTCCGCGTCTTAATAATCTTAGATTTTGACTTTTGCCCCCTG CATTAATTCTTCTAGTTTCCTCTGCAGCTGTAGAAAAGGGGGCCGGAACCGGCTGAACAGTTTACCCC CCTCTTGCCAGAAATCTAGCTCATGCTGGCCCTTCAGTAGATCTAGCCATTTTCTCGCTTCATCTAGCA GGGGCCTCATCTATTCTTGGTGCTATTAATTTTATTACTACAGTAATTAATATACGATGACCAGGAATA AATATTGAACGAATCCCCCTATTCGTTTGGGGCGTAACAATCACAGTAATTCTTCTTCTTCTATCTCTTC CAGTCCTTGCGGGGGCCATCACCATACTTCTAACCGACCGAAACCTTAATACTTCGTTTTTTGATCCG GCCGGAGGCGGAGATTCAA------iv Thakur et al.

IEW393-17|Drawida impertusa AACACTTTATTTCATTCTAGGAGTTTGAGCTGGTATAATTGGAGCTGGTATAAGTCTTCTTATTCGTAT CGAGCTGAGACAGCCCGGCTCATTCCTAGGAAGAGACCAACTATATAACACCATTGTTACTGCTCAT GCATTCATTATAATTTTCTTTTTAGTCATGCCAGTATTTATTGGTGGATTTGGTAATTGATTATTACCCC TAATACTTGGTGCCCCAGATATAGCCTTTCCGCGTCTTAATAATCTTAGATTTTGACTTTTGCCCCCTG CATTAATTCTTCTAGTTTCCTCTGCAGCTGTAGAAAAGGGGGCCGGAACCGGCTGAACAGTTTACCCC CCTCTTGCCAGAAATCTAGCTCATGCTGGCCCTTCAGTAGATCTAGCCATTTTCTCGCTTCATCTAGCA GGGGCCTCATCTATTCTTGGTGCTATTAATTTTATTACTACAGTAATTAATATACGATGACCAGGAATA AATATTGAACGAATCCCCCTATTCGTTTGGGGTGTAACAATCACAGTAATTCTTCTTCTTCTATCTCTTC CAGTCCTTGCGGGGGCCATCACCATACTTCTAACCGACCGAAACCTTAATACTTCGTTTTTTGATCCG GCCGGAGGCGGAGATCCAA------

IEW424-17|Drawida impertusa AACACTTTATTTCATTCTAGGAGTTTGAGCTGGTATAATTGGAGCTGGTATAAGTCTTCTTATTCGTAT CGAGCTGAGACAGCCCGGCTCATTCCTAGGAAGAGACCAACTATATAACACCATTGTTACTGCTCAT GCATTCATTATAATTTTCTTTTTAGTCATGCCAGTATTTATTGGTGGATTTGGTAATTGATTATTACCCC TAATACTTGGTGCCCCAGATATAGCCTTTCCGCGTCTTAATAATCTTAGATTTTGACTTTTGCCCCCTG CATTAATTCTTCTAGTTTCCTCTGCAGCTGTAGAAAAGGGGGCCGGAACCGGCTGAACAGTTTACCCC CCTCTTGCCAGAAATCTAGCTCATGCTGGCCCTTCAGTAGATCTAGCCATTTTCTCGCTTCATCTAGCA GGGGCCTCATCTATTCTTGGTGCTATTAATTTTATTACTACAGTAATTAATATACGATGACCAGGAATA AACATTGAACGAATCCCCCTATTCGTTTGGGGTGTAACAATCACAGTAATTCTTCTTCTTCTATCTCTTC CAGTCCTTGCGGGGGCCATCACTATACTTCTAACCGACCGAAACCTTAATACTTCGTTTTTTGATCCGG CCGGAGGCGGAGATCCAA------

IEW447-17|Drawida impertusa AACACTTTATTTCATTCTAGGAGTTTGAGCTGGTATAATTGGAGCTGGTATAAGTCTTCTTATTCGTAT CGAGCTGAGACAGCCCGGCTCATTCCTAGGAAGAGACCAACTATATAACACCATTGTTACTGCTCAT GCATTCATTATAATTTTCTTTTTAGTCATGCCAGTATTTATTGGTGGATTTGGTAATTGATTATTACCCC TAATACTTGGTGCCCCAGATATAGCCTTTCCGCGTCTTAATAATCTTAGATTTTGACTTTTGCCCCCTG CATTAATTCTTCTAGTTTCCTCTGCAGCTGTAGAAAAGGGGGCCGGAACCGGCTGAACAGTTTACCCC CCTCTTGCCAGAAATCTAGCTCATGCTGGCCCTTCAGTAGATCTAGCCATTTTCTCGCTTCATCTAGCA GGGGCCTCATCTATTCTTGGTGCTATTAATTTTATTACTACAGTAATTAATATACGATGACCAGGAATA AACATTGAACGAATCCCCCTATTCGTTTGGGGTGTAACAATCACAGTAATTCTTCTTCTTCTATCTCTTC CAGTCCTTGCGGGGGCCATCACTATACTTCTAACCGACCGAAACCTTAATACTTCGTTTTTTGATCCGG CCGGAGGC------

IEW448-17|Drawida impertusa AACACTTTATTTCATTCTAGGAGTTTGAGCTGGTATAATTGGAGCTGGTATAAGTCTTCTTATTCGTAT CGAGCTGAGACAGCCCGGCTCATTCCTAGGAAGAGACCAACTATATAACACCATTGTTACTGCTCAT GCATTCATTATAATTTTCTTTTTAGTCATGCCAGTATTTATTGGTGGATTTGGTAATTGATTATTACCCC TAATACTTGGTGCCCCAGATATAGCCTTTCCGCGTCTTAATAATCTTAGATTTTGACTTTTGCCCCCTG CATTAATTCTTCTAGTTTCCTCTGCAGCTGTAGAAAAGGGGGCCGGAACCGGCTGAACAGTTTACCCC CCTCTTGCCAGAAATCTAGCTCATGCTGGCCCTTCAGTAGATCTAGCCATTTTCTCGCTTCATCTAGCA GGGGCCTCATCTATTCTTGGTGCTATTAATTTTATTACTACAGTAATTAATATACGGTGACCAGGAAT AAACATTGAACGAATCCCCCTATTCGTTTGGGGTGTAACAATCACAGTAATTCTTCTTCTTCTATCTCT TCCAGTCCTTGCGGGGGCCATCACCATACTTCTAACCGACCGAAACCTTAATACTTCGTTTTTTGATCC GGCCGGAGGCGGAGATCCAATTCTCTACC------

IEW459-17|Drawida nilamburensis AACCCTATACTTTATTTTAGGGGTTTGAGCTGGAATAATCGGCGCTGGTATAAGCCTGCTTATTCGAA TTGAACTAAGACAGCCCGGGTCGTTCCTGGGAAGTGATCAACTATATAATACAATTGTTACTGCCCAC GCATTTATTATAATTTTCTTTCTTGTAATACCCGTATTTATTGGAGGATTTGGGAACTGATTACTACCTC TAATGCTGGGGGCCCCAGATATGGCATTTCCACGACTCAACAACTTGAGATTCTGACTCCTGCCCCCC GCTCTTATTCTCCTAGTATCTTCCGCAGCAGTTGAAAAGGGGGCCGGTACTGGATGAACTGTATACCC CCCTCTAGCAAGGAACCTTGCTCACGCTGGACCATCAGTTGATTTAGCTATCTTCTCCCTTCATTTGGC TGGAGCATCATCAATTCTTGGTGCTATCAACTTTATTACCACAGTAATTAACATACGATGACCTGGGA TAAATGTAGAGCGAATTCCCCTATTCGTATGAGGAGTGACCATTACAGTTATTCTTCTTCTCCTATCCC TGCCAGTCCTGGCGGGGGCTATTACCATACTTCTTACTGATCGTAACCTAAATACATCATTCTTTGATC CTGCGGGGGGTGGGGACCCAATTCTATATCA------Animal Biodiversity and Conservation 44.1 (2021) v

IEW444-17|Drawida robusta AACCCTTTATTTTATTTTGGGGGTCTGGGCTGGGATGATTGGAGCTGGTATAAGACTTCTTATTCGTA TCGAATTAAGACAGCCGGGCTCATTTCTAGGAAGAGACCAATTGTATAATACTATTGTTACTGCCCAT GCATTTATTATAATTTTCTTCTTAGTTATACCAGTATTTATTGGGGGGTTTGGAAACTGGCTTCTTCCTC TAATGTTAGGTGCCCCAGATATAGCCTTCCCACGACTCAATAACCTCAGATTCTGACTTTTACCCCCAG CATTAATTCTTCTAGTTTCCTCAGCAGCCGTTGAAAAAGGAGCCGGAACCGGGTGAACAGTTTATCCC CCACTCGCCAGAAATTTGGCTCATGCGGGGCCTTCAGTTGACCTTGCCATTTTCTCTCTTCACTTGGCA GGGGCCTCATCTATTCTTGGTGCCATTAACTTCATTACTACGGTAATTAATATACGATGACCAGGAAT AAATATTGAACGAATTCCACTATTTGTGTGGGGCGTAACAATTACAGTAATTCTTCTTCTTCTGTCTCT CCCAGTTCTTGCCGGTGCTATTACCATGCTTCTAACAGATCGAAATCTCAACACTTCATTTTTTGATCC AGCCGGAGGCGGGGATCC------

IEW445-17|Drawida robusta AACCCTTTATTTTATTTTGGGGGTCTGGGCTGGGATGATTGGAGCTGGTATAAGACTTCTTATTCGTA TCGAATTAAGACAGCCGGGCTCATTTCTAGGAAGAGACCAATTGTATAATACTATTGTTACTGCCCAT GCATTTATTATAATTTTCTTCTTAGTTATACCAGTATTTATTGGGGGGTTTGGAAACTGGCTTCTTCCTC TAATGTTAGGTGCCCCAGATATAGCCTTCCCACGACTCAATAACCTCAGATTCTGACTTTTACCTCCAG CATTAATTCTTCTAGTTTCCTCAGCAGCCGTTGAAAAAGGAGCCGGAACCGGGTGAACAGTTTATCCC CCACTCGCCAGAAATTTGGCTCATGCGGGGCCTTCAGTTGACCTTGCCATTTTCTCTCTTCACTTGGCA GGGGCCTCATCTATTCTTGGTGCCATTAACTTCATTACTACGGTAATTAATATACGATGACCAGGAAT AAATATTGAACGAATTCCACTATTTGTGTGGGGCGTAACAATTACAGTAATTCTTCTTCTTCTGTCTCT CCCAGTTCTTGCCGGTGCTATTACCATGCTTCTAACAGATCGAAATCTCAACACTTCATTTTTTGATCC AGCCGGAGGCGGGGATCCAATTTTATATCAACACTTATTT

IEW451-17|Drawida scandens AACCCTTTACTTCATCTTAGGAGTCTGAGCAGGAATAATCGGGGCGGGGATAAGCCTTCTAATCCGA ATTGAGCTAAGACAGCCAGGATCCTTCCTCGGGAGAGATCAATTATATAATACAATCGTAACCGCAC ACGCATTTATCATAATTTTTTTCTTAGTTATGCCAGTATTTATTGGAGGGTTTGGTAACTGACTCTTACC CCTAATACTGGGGGCACCAGACATGGCGTTCCCGCGACTAAATAACTTAAGATTCTGACTTTTACCAC CAGCCTTAATCCTGCTTGTAGCCTCAGCTGCTGTGGAAAAGGGAGCAGGTACCGGGTGAACAGTTTA CCCACCTTTAGCAAGAAACCTAGCCCATGCTGGACCTTCAGTTGATTTAGCCATTTTCTCACTACACCT TGCAGGTGCCTCATCTATTTTGGGGGCAATTAACTTTATTACAACAGTTATCAACATACGGTGACCTG GAATAAGAATCGAACGAATTCCATTATTTGTATGGGGGGTAGTAATTACAGTAGTATTACTACTTCTA TCTTTACCAGTACTAGCAGGAGCTATTACTATGCTACTCACAGATCGAAACCTAAATACCTCGTTTTTT GACCCGGC------

IEW425-17|Drawida travancorense AACCCTGTATTTTATCTTGGGCGTCTGAGCTGGAATAATCGGAGCCGGAATAAGGCTTCTTATTCGAA TTGAGCTAAGGCAGCCTGGAGCATTTCTTGGAAGGGATCAATTATATAATACTATTGTTACAGCCCAT GCATTTATTATAATCTTTTTTTTAGTAATGCCAGTATTTATTGGAGGGTTTGGAAACTGACTTCTTCCTC TAATGCTAGGGGCCCCAGACATAGCATTTCCGCGACTAAACAACCTGAGATTTTGGCTTCTTCCCCCC GCTCTTATTCTTCTAGTATCATCAGCTGCAGTTGAAAAGGGGGCTGGTACTGGATGAACGGTTTATCC ACCACTGGCAAGTAACTTAGCTCATGCTGGCCCTTCAGTAGACCTAGCAATCTTTTCTCTCCACTTAGC AGGCGCATCCTCCATCTTAGGCGCCATTAATTTTATCACCACTGTAATTAACATACGGTGACCCGGAA TAAACATTGAGCGAATTCCCCTATTTGTATGAGGCGTCACCATCACAGTAATTCTACTTCTTCTATCTC TGCCAGTACTAGCAGGGGCTATTACTATACTTCTTACTGATCGTAACTTAAATACTTCATTCTTTGATC CTGCAGGTGGAGGTG------

IEW369-17|Moniligaster aiyeri AACCCTATATTTTATCTTGGGTGTTTGAGCAGGAATAATTGGAGCCGGAATAAGACTTTTAATTCGAA TTGAGCTGAGCCAGCCAGGAGCATTTCTAGGTAGTGATCAACTATATAACACGATTGTAACAGCTCA TGCATTTATTATAATTTTCTTTCTAGTAATGCCAGTATTTATTGGTGGGTTTGGGAACTGACTTTTACC ACTAATACTTGGGGCTCCAGATATGGCTTTCCCACGCTTAAATAATTTAAGATTTTGACTTCTTCCACC AGCTTTAATCCTTCTAGTGTCATCGGCAGCTGTAGAAAAAGGAGCGGGTACTGGATGAACTGTTTAT CCGCCATTAGCTAGAAATTTAGCTCATGCTGGTCCATCAGTAGATCTAGCAATTTTTTCCCTTCATTTA GCAGGTGCATCATCAATTCTAGGAGCTATCAATTTTATTACAACAGTAGTAAACATGCGATGACCTGG AATAAACGTAGAGCGTATTCCATTATTTGTATGGGGGGTTACCATCACAGTAATTCTACTTCTTTTATC CTTACCGGTGCTAGCTGGAGCTATTACTATACTTCTTACTGATCGAAATTTAAATACTTCATTTTTTGAT CCGGC------vi Thakur et al.

IEW437-17|Moniligaster aiyeri AACCCTATATTTTATCTTGGGTGTTTGAGCAGGAATAATTGGAGCCGGAATAAGACTTTTAATTCGAA TTGAGCTGAGCCAGCCAGGAGCATTTCTAGGTAGTGATCAACTATATAACACGATTGTAACAGCTCA TGCATTTATTATAATTTTCTTTCTAGTAATGCCAGTATTTATTGGTGGGTTTGGGAACTGACTTTTACC ACTAATACTTGGGGCTCCAGATATGGCTTTCCCACGCTTAAATAATTTAAGATTTTGACTTCTTCCACC AGCTTTAATCCTTCTAGTGTCATCGGCAGCTGTAGAAAAAGGAGCGGGTACTGGATGAACTGTTTAT CCGCCATTAGCTAGAAATTTAGCTCATGCTGGTCCATCAGTAGATCTAGCAATTTTTTCCCTTCATTTA GCAGGTGCATCATCAATTCTAGGAGCTATCAATTTTATTACAACAGTAGTAAACATGCGATGACCTGG AATAAACGTAGAGCGTATTCCATTATTTGTATGGGGGGTTACCATCACAGTAATTCTACTTCTTTTATC CTTACCGGTGCTAGCTGGAGCTATTACTATACTTCTTACTGATCGAAATTTAAATACTTCATTTTTTGAT CCGGCTGGTGGAGGTG------

IEW438-17|Moniligaster aiyeri AACCCTATATTTTATCTTGGGTGTTTGAGCAGGAATAATTGGAGCCGGAATAAGACTTTTAATTCGAA TTGAGCTGAGCCAGCCAGGAGCATTTCTAGGTAGTGATCAACTATATAACACGATTGTAACAGCTCA TGCATTTATTATAATTTTCTTTCTAGTAATGCCAGTATTTATTGGTGGGTTTGGGAACTGACTTTTACC ACTAATACTTGGGGCTCCAGATATGGCTTTCCCACGCTTAAATAATTTAAGATTTTGACTTCTTCCACC AGCTTTAATCCTTCTAGTGTCATCGGCAGCTGTAGAAAAAGGAGCGGGTACTGGATGAACTGTTTAT CCGCCATTAGCTAGAAATTTAGCTCATGCTGGTCCATCAGTAGATCTAGCAATTTTTTCCCTTCATTTA GCAGGTGCATCATCAATTCTAGGAGCTATCAATTTTATTACAACAGTAGTAAACATGCGATGACCTGG AATAAACGTAGAGCGTATTCCATTATTTGTATGGGGGGTTACCATCACAGTAATTCTACTTCTTTTATC CTTACCGGTGCTAGCTGGAGCTATTACTATACTTCTTACTGATCGAAATTTAAATACTTCATTTTTTGAT CCGGCTGGTGGAGGTGATCCAATTCTATACCAGCACTTATTT

IEW382-17|Moniligaster deshayesi AACCCTATACTTCATTCTTGGAGTTTGAGCAGGGATAATTGGGGCCGGTATAAGACTTCTAATTCGAA TTGAGCTTAGACAACCCGGGTCGTTTCTTGGAAGGGACCAACTCTACAATACAATTGTTACAGCTCAC GCGTTCATCATAATTTTTTTCCTTGTTATACCCGTATTCATTGGGGGGTTTGGTAACTGGCTACTTCCC CTTATGCTAGGCGCCCCAGATATGGCATTTCCACGTCTAAATAACTTAAGATTTTGGTTACTACCTCCT GCCTTAATCCTCCTAGTATCTTCGGCCGCAGTCGAAAAGGGGGCAGGAACCGGCTGAACAGTCTATC CACCACTGGCGAGAAACCTCGCGCACGCAGGACCCTCAGTAGATCTAGCAATCTTCTCTCTTCACCTT GCGGGGGCTTCATCCATTCTAGGGGCCATTAACTTTATTACAACAGTAATCAATATACGATGGCCCG GAATAAATGTAGAACGAATTCCCCTATTTGTATGGGGTGTGACAATTACAGTAATTCTGCTCCTTTTA TCTCTTCCTGTACTAGCAGGGGCCATCACTATATTATTAACTGATCGAAATCTAAATACTTCTTTCTTTG ACCCTGCCGGTGGTGGAGACCCA------

IEW415-17|Moniligaster deshayesi AACCCTATACTTCATTCTTGGAGTTTGAGCAGGGATAATTGGGGCCGGTATAAGACTTCTAATTCGAA TTGAGCTTAGACAACCCGGGTCGTTTCTTGGAAGGGACCAACTCTACAATACAATTGTTACAGCTCAC GCGTTCATCATAATTTTTTTCCTTGTTATACCCGTATTCATTGGGGGGTTTGGTAACTGGCTACTTCCC CTTATGCTAGGCGCCCCAGATATGGCATTTCCACGTCTAAATAACTTAAGATTTTGGTTACTACCTCCT GCCTTAATCCTCCTAGTATCTTCGGCCGCAGTCGAAAAGGGGGCAGGAACCGGCTGAACAGTCTATC CACCACTGGCGAGAAACCTCGCGCACGCAGGACCCTCAGTAGATCTAGCAATCTTCTCTCTTCACCTT GCGGGGGCTTCATCCATTCTAGGGGCCATTAACTTTATTACAACAGTAATCAATATACGATGGCCCG GAATAAATGTAGAACGAATTCCCCTATTTGTATGGGGTGTGACAATTACAGTAATTCTGCTCCTTTTA TCTCTTCCTGTACTAGCGGGGGCCATCACTATATTATTAACTGATCGAAATCTAAATACATCTTTCTTT GACCCTGCCGGTGGTGGAGACCCAAT------

IEW404-17|Moniligaster gravelyi AACCCTATACTTTATTCTAGGGGTTTGAGCAGGTATAATCGGAGCCGGGATAAGTCTTCTAATCCGA ATTGAGCTAAGACAGCCAGGAACATTCCTCGGGAGAGACCAACTCTATAACACTATTGTAACAGCCC ATGCATTTATTATAATTTTCTTCTTGGTAATGCCAGTATTTATCGGGGGATTTGGAAACTGACTCCTCC CCCTAATACTAGGTGCCCCCGATATAGCTTTCCCACGTCTAAATAATCTTAGATTTTGACTACTACCCC CTGCCTTAATTCTCCTTGTTTCATCAGCCGCAGTAGAAAAGGGGGCCGGAACTGGATGAACCGTATA CCCCCCACTAGCAAGAAATTTAGCCCATGCAGGCCCATCTGTAGACCTGGCCATTTTTTCTCTTCACTT AGCGGGGGCTTCCTCTATTCTGGGAGCAATCAATTTTATTACCACAGTCATCAACATACGATGACCAG GAATAAATATCGAACGAATCCCCTTATTCGTATGAGGTGTAACTATTACAGTTATTCTCCTCCTTTTAT CCCTCCCAGTTTTAGCTGGAGCCATTACTATGCTTCTAACCGATCGCAATCTAAATACCTCATTTTTCG ACCCAGCCGGTGGAGGTGA------Animal Biodiversity and Conservation 44.1 (2021) vii

IEW405-17|Moniligaster gravelyi AACCCTATACTTTATTCTAGGGGTTTGAGCAGGTATAATCGGAGCCGGGATAAGTCTTCTAATCCGAA TTGAGCTAAGACAGCCAGGAACATTCCTCGGGAGAGACCAACTCTATAACACTATTGTAACAGCCCA TGCATTTATTATAATTTTCTTCTTGGTAATGCCAGTATTTATCGGGGGATTTGGAAACTGACTCCTCCC CCTAATACTAGGTGCCCCCGATATAGCTTTCCCACGTCTAAATAATCTTAGATTTTGACTACTACCCCC TGCCTTAATTCTCCTTGTTTCATCAGCCGCAGTAGAAAAGGGGGCCGGAACTGGATGAACCGTATAC CCCCCACTAGCAAGAAATTTAGCCCATGCAGGCCCATCTGTAGACCTGGCCATTTTTTCTCTTCACTTA GCGGGGGCTTCCTCTATTCTGGGAGCAATCAATTTTATTACCACAGTCATCAACATACGATGACCAGG AATAAATATCGAGCGAATCCCCTTATTCGTATGAGGTGTAACTATTACAGTTATTCTCCTCCTTTTATC CCTCCCAGTTTTAGCTGGAGCCATTACTATGCTTCTAACCGATCGCAATCTAAATACCTCATTTTTCGA CCCAGCCGGTGGAGGTGA------

IEW409-17|Moniligaster gravelyi AACCCTATACTTTATTCTAGGGGTTTGAGCAGGTATAATCGGAGCCGGGATAAGTCTTCTAATCCGA ATTGAGCTAAGACAGCCAGGAACATTCCTCGGGAGAGACCAACTCTATAACACTATTGTAACAGCCC ATGCATTTATTATAATTTTCTTCTTGGTAATGCCAGTATTTATCGGGGGATTTGGAAACTGACTCCTCC CCCTAATACTAGGTGCCCCCGATATAGCTTTCCCACGTCTAAATAATCTTAGATTTTGACTACTACCCC CTGCCTTAATTCTCCTTGTTTCATCAGCCGCAGTAGAAAAGGGGGCCGGAACTGGATGAACCGTATA CCCCCCACTAGCAAGAAATTTAGCCCATGCAGGCCCATCTGTAGACCTGGCCATTTTTTCTCTTCACTT AGCGGGGGCTTCCTCTATTCTGGGAGCAATCAATTTTATTACCACAGTCATCAACATACGATGACCAG GAATAAATATCGAGCGAATCCCCTTATTCGTATGAGGTGTAACTATTACAGTTATTCTCCTCCTTTTAT CCCTCCCAGTTTTAGCTGGAGCCATTACTATGCTTCTAACCGATCGCAATCTAAATACCTCATTTTTCG------

IEW410-17|Moniligaster gravelyi AACCCTATACTTTATTCTAGGGGTTTGAGCAGGTATAATCGGAGCCGGGATAAGTCTTCTAATCCGA ATTGAGCTAAGACAGCCAGGAACATTCCTCGGGAGAGACCAACTCTATAACACTATTGTAACAGCCC ATGCATTTATTATAATTTTCTTCTTGGTAATGCCAGTATTTATCGGGGGATTTGGAAACTGACTCCTCC CCCTAATACTAGGTGCCCCCGATATAGCTTTCCCACGTCTAAATAATCTTAGATTTTGACTACTACCCC CTGCCTTAATTCTCCTTGTTTCATCAGCCGCAGTAGAAAAGGGGGCCGGAACTGGATGAACCGTATA CCCCCCACTAGCAAGAAATTTAGCCCATGCAGGCCCATCTGTAGACCTGGCCATTTTTTCTCTTCACTT AGCGGGGGCTTCCTCTATTCTGGGAGCAATCAATTTTATTACCACAGTCATCAACATACGATGACCAG GAATAAATATCGAGCGAATCCCCTTATTCGTATGAGGTGTAACTATTACAGTTATTCTCCTCCTTTTAT CCCTCCCAGTTTTAGCTGGAGCCATTACTATGCTTCTAACCGATCGCAATCTAAATACCTCATTTTTCG ACCCAGCCGG------

IEW446-17|Moniligaster gravelyi AACCCTATACTTTATTCTAGGGGTTTGAGCAGGTATAATCGGAGCCGGGATAAGTCTTCTAATCCGA ATTGAGCTAAGACAGCCAGGAACATTCCTCGGGAGAGACCAACTCTATAACACTATTGTAACAGCCC ATGCATTTATTATAATTTTCTTCTTGGTAATGCCAGTATTTATCGGGGGATTTGGAAACTGACTCCTCC CCCTAATACTAGGTGCCCCCGATATAGCTTTCCCACGTCTAAATAATCTTAGATTTTGACTACTACCCC CTGCCTTAATTCTCCTTGTTTCATCAGCCGCAGTAGAAAAGGGGGCCGGAACTGGATGAACCGTATA CCCCCCACTAGCAAGAAATTTAGCCCATGCAGGCCCATCTGTAGACCTGGCCATTTTTTCTCTTCACTT AGCGGGGGCTTCCTCTATTCTGGGAGCAATCAATTTTATTACCACAGTCATCAACATACGATGACCAG GAATAAATATCGAACGAATCCCCTTATTCGTATGAGGTGTAACTATTACAGTTATTCTCCTCCTTTTAT CCCTCCCAGTTTTAGCTGGAGCCATTACTATGCTTCTAACCGATCGCAATCTAAATACCTCATTTTTCG ACCCAGCCGGTGGAGG------