Stephanie A. J. Preston, Deborah A. Dawson, Gavin J. Horsburgh, Ben J. Hatchwell
Total Page：16
File Type：pdf, Size：1020Kb
1
Characterisation of microsatellite loci in the rifleman (Acanthisitta chloris,
Acanthisittidae, AVES) and their predicted genome locations
STEPHANIE A. J. PRESTON, DEBORAH A. DAWSON, GAVIN J. HORSBURGH, BEN J.
HATCHWELL
Department of Animal and Plant Sciences, University of Sheffield, Western Bank, Sheffield, South
Yorkshire, S10 2TN, UK
* S.A.J. Preston E-mail: [email protected] 2
Online Resource 1
Table 1. Additional microsatellite loci characterised in 4 unrelated rifleman Acanthisitta chloris individuals (2 male and 2 female) but abandoned from further testing
(a) Additional newly isolated rifleman microsatellite loci
Locus EMBL Repeat Primer Sequence (5’-3’) Tm Ta Fluoro Expected/ N A Chromosome BLAST E Value Marker Status Accession Motif Label Observed Location Number (F) Size (bp) Ach092 HE599034 (GT)12 F:TCCTTGGAAAGGGATTAGGG 60.3 60 HEX 135/ (4) -- No matches (Gga) - Failed to amplify in males Ach18F07 R:CCACTTCAGCTCAAATCAACAC 59.8 - TguZ, 66784737† 1.0e-21 WGS† (0.0) and females
Ach115 HE599097 (ATCT)14 F:ATGTGTCTCGAACACCTCCAG 60.2 60 6FAM 207/ 4 6 Gga8, 2291741† 2.0e-50 WGS† (0.0) Polymorphic but amplified Ach21C06 R:TGCAAAGTCTCTGTTGGTTCC 60.3 202-214 Tgu8, 4792269 2.6e-93 two different loci 378-390 Ach122 HE599064 (AC)17 F:AGGGATTTAACAGAAAGGCAAAG 60.0 60 6FAM 222/ (4) -- Gga1, 183850561 1.2e-109 Failed to amplify Ach21D04 R:TCAACCAACTCCTTGACATCC 60.0 - Tgu1, 45621322 8.9e-173
Ach125 HE599067 (GT)23 F:ACCATGCAGTGAAGGAAAGG 60.1 60 HEX 217/ (4) -- No matches (Gga) 7.0e-38 WGS† (0.0) Failed to amplify Ach21D10 R:CTTCTTGTGGCTACAGCCTTG 60.1 - Tgu2, 12389296† 1.0e-28 WGS† (0.0)
Ach137 HE599079 (CTTT)49 F:TACGGGTGGTGATATCTTTCC 58.8 60 6FAM 330/ (4) -- No matches (Gga) - Failed to amplify Ach21F05 R:AGTGGAAAGGAGGTATGTAGCC 58.7 - Tgu1, 43942064 6.1e-112
Ach193 HE599135 (GT)28 F:GATCTGAACTCAGGTCTACACTAATAAGC 60.5 60 HEX 360/ (4) - No matches (Gga) 5.0e-21 WGS† (0.0) Failed to amplify Ach22G12 R:CCTCCCACTTGTCCCTTAGTC 60.0 - Tgu2, 38049847 4.2e-56
Ach201 HE599143 (AG)23 F:ACAGAACTGCAACCTGTCAAG 58.0 60 6FAM 193/ (4) -- Gga3, 58421687† 4.0e-25 WGS† (0.0) Failed to amplify Ach23A05 R:ATAGGCTGGGAATTGAGTCAC 58.1 - Tgu3, 58738733† 9.0e-64 WGS† (0.0) 3
(b) Additional published microsatellite loci
Locus Reference for locus Ta Fluoro Label Expected Size ZF/ N A Chromosome BLAST E Value Marker Status and primer sequences (Forward) Observed Size RF Location (bp) TG01-000 Dawson et al., 2010 56 6FAM 253/ 4 1 Gga1, 725367 0.0 Monomorphic 201 Tgu1A, 206523 1.7e-197
TG01-040 Dawson et al., 2010 56 6FAM 286/ 4 1 Gga1, 45170091 1.3e-145 Monomorphic 275 Tgu1A, 42620504 0.0
TG01-077 Dawson et al., 2010 56 HEX 153/ 4 1 Gga1, 86284969 0.0 Monomorphic 152 Tgu1, 95581733 0.0
TG01-092 Dawson et al., 2010 56 6FAM 183/ 4 1 Gga1, 101715086 2.4e-294 Monomorphic 177 Tgu1, 101715086 0.0
TG01-114 Dawson et al., 2010 56 HEX 182/ 4 1 Gga1, 123969711 0.0 Monomorphic 181 Tgu1, 15302987 0.0
TG01-124 Dawson et al., 2010 56 6FAM 403/ 4 1 Gga1, 135576703 4.8e-140 Monomorphic 400 Tgu1, 32303776 0.0
TG01-148 Dawson et al., 2010 56 HEX 195/ 4 1 Gga1, 163900541 9.1e-159 Monomorphic 188 Tgu1, 65236877 0.0
TG02-078 Dawson et al., 2010 56 HEX 308/ 4 1 Gga2, 80089604 0.0 Monomorphic 287 Tgu2, 82845909 0.0
TG02-088 Dawson et al., 2010 56 6FAM 266/ 4 1 Gga2, 90692690 0.0 Monomorphic 255 Tgu2, 93538047 0.0
TG02-120 Dawson et al., 2010 56 6FAM 230/ 4 1 Gga2, 125741769 3.2e-251 Monomorphic 231 Tgu2, 127242053 0.0
TG03-002 Dawson et al., 2010 56 6FAM 127/ 4 1 Gga3, 2475598 5.2e-128 Monomorphic 117 Tgu3, 28478877 0.0
TG03-031 Dawson et al., 2010 56 6FAM 208/ 4 1 Gga3, 36376128 4.2e-255 Monomorphic 197 Tgu3, 36376128 0.0 4
Locus Reference for locus Ta Fluoro Label Expected Size ZF/ N A Chromosome BLAST E Value Marker Status and primer sequences (Forward) Observed Size RF Location (bp) TG03-035 Dawson et al., 2010 56 HEX 213/ 4 1 Gga4, 35573626 5.6e-131 Monomorphic 208 Tgu4, 7353303 0.0
TG03-098 Dawson et al., 2010 56 HEX 235/ 4 1 Gga3, 103032357 8.7e-293 Monomorphic 247 Tgu3, 102966495 0.0
TG04-012 Dawson et al., 2010 56 HEX 150/ 4 1 Gga4, 11964133 6.6e-309 Monomorphic 139 Tgu4A, 17044351 0.0
TG04-012A Dawson et al., 2010 56 6FAM 236/ 4 1 Gga4, 11862446 2.3e-252 Monomorphic 233 Tgu4A, 16934636 0.0
TG04-041 Dawson et al., 2010 56 HEX 173/ 4 1 Gga4, 41461742 0.0 Monomorphic 176 Tgu4, 37987125 0.0
TG04-061 Dawson et al., 2010 56 HEX 186/ 4 1 Gga4, 61990163 8.9e-259 Monomorphic 190 Tgu4, 20910674 0.0
TG05-030 Dawson et al., 2010 56 HEX 186/ 4 1 Gga5, 35196360 2.3e-262 Monomorphic 179 Tgu5, 32518629 0.0
TG05-053 Dawson et al., 2010 56 HEX 196/ 4 1 Gga5, 59348340 5.9e-174 Monomorphic 191 Tgu5, 61275929 0.0
TG06-009 Dawson et al., 2010 56 6FAM 127/ 4 1 Gga6, 10668281 1.8e-97 Monomorphic 119 Tgu6, 3612453 0.0
TG07-022 Dawson et al., 2010 56 HEX 416/ 4 1 Gga7, 22591719 2.1e-221 Monomorphic 443 Tgu7, 11939763 0.0
TG08-024 Dawson et al., 2010 56 HEX 128/ 4 1 Gga8, 24356390 0.0 Monomorphic primer set 1 126 Tgu8, 21095625 0.0
TG08-024 Dawson et al., 2010 56 HEX 243/ 4 1 Gga8, 24356390 0.0 Monomorphic primer set 2 243 Tgu8, 21095625 0.0
TG09-014 Dawson et al., 2010 56 6FAM 152/ 4 1 Gga9, 15901402 0.0 Monomorphic 148 Tgu9, 16778581 0.0
TG12-015 Dawson et al., 2010 56 HEX 283/ (4) - Gga12, 15500052 6.6e-120 Failed to amplify - Tgu12, 16293509 0.0 5
Locus Reference for locus Ta Fluoro Label Expected Size ZF/ N A Chromosome BLAST E Value Marker Status and primer sequences (Forward) Observed Size RF Location (bp) TG13-016 Dawson et al., 2010 56 6FAM 136/ 4 1 Gga13, 17663220 7.2e-140 Monomorphic 125 Tgu13, 1151543 0.0
TG22-001 Dawson et al., 2010 56 HEX 269/ (4) - Gga22, 529626 3.8e-168 Failed to amplify - Tgu22, 1428098 0.0
Tm, melting temperature Ta, annealing temperature N, number of unrelated rifleman Acanthisitta chloris individuals genotyped A, number of alleles observed Tgu zebra finch Taeniopygia guttata chromosome; Gga chicken Gallus gallus chromosome Chromosome Location; † signifies where the location in zebra finch was assigned by an “indirect BLAST” i. e. we initially identified a homologous zebra finch whole genome shotgun (WGS) sequence which was then compared to the assembled genome of same species (method as described in Dawson et al. 2007). Duplicate hits to the “unknown” chromosome were ignored and regarded as artefacts of the assembly process.