FAT1 Expression and Mutations in Adult Acute Lymphoblastic Leukemia

Supplementary Information

FAT1 expression and mutations in adult acute lymphoblastic leukemia

by Neumann et al.

Supplementary Methods

Supplementary Figure S1. Expression of FAT1 in different acute leukemia cell lines by (A) western blot and (B) real-time PCR.

Supplementary Figure S2. Expression of FAT1 in acute leukemia in adult patients (A) and in normal hematopoiesis (B).

Supplementary Figure S3. Overall survival (A) and duration of remission (B) for patients with T-ALL according to their mutational status.

Supplementary Table S1. Characteristics of adult T-ALL patients according to their FAT1 expression.

Supplementary Table S2. Characteristics of adult B-lineage ALL patients according to their FAT1 expression.

Supplementary Table S3. Mutations of FAT1 in 68 T-ALL patients.

Supplementary Table S4. Characteristics of T-ALL patients with FAT1 mutation.

1 Supplementary Methods

Patients and immunophenotype

We analyzed specimens from 112 adult T-ALL patients and 129 adult preB-ALL patients, which were sent to the reference laboratory of the German Study Group for adult ALL (GMALL). Of these, 180 patients were enrolled in the trials GMALL 06/99 and 07/03 with available clinical follow-up. The GMALL protocols are based on intensive combination chemotherapy and stem cell transplantation in high-risk patients. An allogeneic stem cell transplantation (SCT) was scheduled for high risk B-lineage and T-ALL. Details of the protocols were previously described1. All patients gave written informed consent to participate in the above mentioned trials according to the Declaration of Helsinki. The GMALL trials were approved by the ethics board of the Johann Wolfgang Goethe-Universität Frankfurt am Main, Germany. In the GMALL study, immunophenotyping was centrally performed in the GMALL reference laboratory at the Charité, University Hospital, Berlin. Immunophenotyping and subtype assignment was carried out as previously described2-4. High risk T-ALL was defined by an immunophenotype of an early or mature T-ALL. ETP-ALL was defined as an early T-ALL with the following immunophenotype: CD1a-, CD8-, CD5dim with expression of stem cell (CD34, HLA-DR, CD117) and/or coexpression of myeloid antigens (CD13, CD33, CD65s).

Real time PCR

For the detection of FAT1 mRNA expression levels, mRNA was isolated from diagnostic bone marrow samples and complementary DNA was synthesized. qRT-PCR performed, using Glucose-6-Phosphate Isomerase (GUS) as internal control, as previously described5. For FAT1 amplification forward primer TGATCCCTGTCTTTCCAAGAAGCCT, reverse-primer CGGCAGAGGAACGCTTGGCA and probe FAM-CAGCCTTCCCAGCCATACAGTGCCCGGG- BHQ1 spanning exons 26 and 27 were used. We adapted the expression definition from de Bock et al6: FAT1 was considered as ‘expressed’, if the expression was higher than the expression in BE13 cells.

Nucleic acid preparation and targeted sequencing of candidate genes

2 For 82 T-ALL samples, we performed next generation sequencing for FAT1. We constructed libraries from 3 µg of genomic DNA of diagnostic samples as previously reported7, 8. These were labeled by barcode indices (length: 6 bases). Customized biotinylated RNA oligo pools (SureSelect, Agilent) were used to hybridize the targeted regions. We performed 76-bp paired- end sequencing on an Illumina Genome Analyzer IIx platform. Reads were mapped to NCBI hg19 RefSeq. For a variant call we required at least a read depth of 30, an allele frequency of 20% and an average base calling quality of Q13. Polymorphisms annotated in dbSNP 135 were excluded. FAT1 mutations were validated by Sanger sequencing.

Statistical analyses

Differences in the clinical characteristics were calculated by Pearson χ2 test respectively Fisher test. Survival analysis was performed with the Kaplan-Meier method. Overall survival was calculated from the date of diagnosis to the date of death or date of last follow-up. Remission duration was calculated from the date of CR to the date of relapse or date of last follow-up. Patients who died in CR, received a stem cell transplantation in first CR or in whom study treatment was stopped were censored at the respective dates. Comparisons of survival curves were performed with log-rank tests. For all tests, a P-value < 0.05 (two-sided) was considered to indicate a significant difference. Regarding the statistical power of the analysis, we would detect a hazard ration of 1.8 in the case of BCP-ALL (n=105) and of 2 in the case of T-ALL (n=75) with the power of 0.9. All calculations were performed using SPSS software version 17 (SPSS Inc., Chicago, IL, USA), SAS program (SAS-PC, Version 9, SAS Institute, Cary, NC), and GraphPad Prism® software version 5 (GraphPad Software Inc., La Jolla, CA, USA).

3 Supplementary Figure S1. Expression of FAT1 in different acute leukemia cell lines by (A) PCR and (B) real-time PCR in lymphoblastic leukemia cell lines.

4 Supplementary Figure S2. Expression of FAT1 in (A) adult acute leukemia and in (B) subsets of normal hematopoietic cells.

A Expression values for FAT1 in samples from healthy donors (BM, CD34+-cells, PB, CD3+-cells, BM stroma). Additionally, expression values in BM stroma cells of six AML patients are shown. B FAT1 Expression was determined by quantitative RT-PCR. Expression values for diagnostic samples in BCP-ALL, T-ALL, and AML are shown. A sample was considered positive for FAT1 expression, when the expression was higher compared to FAT1 expression in the reference cell line BE13. One T-ALL sample showed FAT1 expression levels higher than 3 and is not displayed in the figure.

Abbreviations: HD, healthy donor; ALL, acute lymphoblastic leukemia; preB-ALL, B-precursor ALL; AML, acute myeloid leukemia; BM, bone marrow; PB, peripheral blood.

5 Supplementary Figure S3. Overall survival (A) and duration of remission (B) for patients with T-ALL and available clinical follow-up according to their mutational status.

6 Supplementary Table S1. Characteristics of adult T-ALL patients with respect to FAT1 expression.

FAT1 expression yes (N=60) no (N=52) N % N % p value Sex 0.66 Female 13 21.7 14 26.9 Male 47 78.3 38 73.1

Age (years) 0.32 Median 35 29 Range 18-61 16-60

White blood cell count <.001 <30.000/µl 13 22.4 29 58 >30.000/µl 45 77.6 21 42

Subgroups <.001 early 1 1.7 23 44.2 mature 9 15 11 21.2 thymic 50 83.3 18 34.6

Immunophenotype CD2pos 50 83.3 34 65.4 0.02 CD5pos 55 91.7 41 78.7 0.05 CD34pos 8 13.3 23 44.2 <.001 CD117pos 4 6.7 8 15.4 0.22 CD13pos 5 8.3 13 25 0.02 CD33pos 1 1.7 14 46.4 <0.001

TCR rearrangement (n=75) monoclonal 34 91.9 22 57.9 0.001

Gene expression median range median range BAALC 0.02 0-0.02 0.2 0-160.3 0.01 IGFBP7 0.35 0-6.3 0.9 0-22.6 0.001 MN1 0.21 0-3.6 0.78 0-12.7 0.04

Response to induction therapy (for 75 pts available) 0.04 CR 49 98 21 84 Death 1 2 1 4 Failure 0 0 3 12

Abbreviations: CR, com plete rem ission.

7 Supplementary Table S2. Characteristics of adult B-lineage ALL patients with respect to FAT1 expression.

FAT1 expression yes (N=41) no (N=88) N % N % p value Sex 0.35 Female 24 58.5 43 48.9 Male 17 41.5 45 51.1

White blood cell count 0.66 <30,000/µl 23 65.7 52 71.2 ≥30,000/µl 12 34.3 21 28.8

Subgroups <0.01 pro bALL 1 2.4 10 11.3 pre bALL 17 41.5 13 14.8 c-ALL 23 56.1 65 73.9

Gene expression median range median range IGFBP7 (n=37) 1.1 0.3-3.6 1.04 0.04-43 0.49 BAALC (n=129) 0.85 0-56.1 2.79 0-91 0.02

Response to induction therapy (for 105 pts available) 0.69 CR 20 87 65 79.3 Death 2 8.7 10 12.2 Failure 1 4.4 7 8.6

8 Supplementary Table S3. Mutations of FAT1 in 68 T-ALL patients

ID Chrom Position Ref Var Transcript AA change Reads VarFreq 17 chr4 187630414 C -T ENST00000441802 189fs 63 48,44% 21 chr4 187630303 G A ENST00000441802 R227C 117 49,57% 53 chr4 187542585 T C ENST00000441802 I1719V 186 42,47% 54 chr4 187518072 G A ENST00000441802 R4208W 131 22.39% 56 chr4 187542430 A C ENST00000441802 Y1770* 36 41,67% 65 chr4 187510008 T C ENST00000441802 Q4502R 63 46,03% 66 chr4 187549336 A C ENST00000441802 N1594K 30 26.67% 80 chr4 187628566 G A ENST00000441802 R806C 147 55.78% 80 chr4 187542434 T C ENST00000441802 E1769G 124 50.81%

9 Supplementary Table S4. Characteristics of T-ALL patients with and without FAT1 mutations.

FAT1 mutation yes (N=8) no (N=60) N % N % p value Sex 0.33 Female 2 25 8 13.3 Male 6 75 52 86.7

White blood cell count 0.46 <30.000/µl 4 50 20 35.7 >30.000/µl 4 50 36 64.3

Subgroups 0.4 early 3 37.5 9 15 mature 0 0 15 25 thymic 5 62.5 36 60

Immunophenotype CD2pos 5 62.5 42 70 0.7 CD5pos 6 75 48 80 0.66 CD34pos 2 25 14 23.3 0.99 CD117pos 2 25 4 6.7 0.14 CD13pos 1 12.5 10 16.7 0.99 CD33pos 1 12.5 8 13.3 0.99

FAT1 expression 0.15 yes 2 25 30 54.5 no 6 75 25 45.5

TCR rearrangement (n=63) monoclonal 4 66.7 43 75.4 0.64

Gene expression (n=63) median range median range BAALC 0.07 0.01-9 0.08 0-10.4 0.86 IGFBP7 0.45 0.03-2.4 0.46 0-22.6 0.49 MN1 0.17 0-2.8 0.28 0-12.7 0.3

Response to induction therapy (for 45 pts available) 0.85 CR 6 100 37 95 Death 0 0 1 3 Failure 0 0 1 3

10 Reference List

(1) Gokbuget N, Raff R, Brugge-Mann M, Flohr T, Scheuring U, Pfeifer H, et al. Risk/MRD adapted GMALL trials in adult ALL. Ann Hematol 2004;83 Suppl 1:S129-S131.

(2) Ludwig WD, Rieder H, Bartram CR, Heinze B, Schwartz S, Gassmann W, et al. Immunophenotypic and genotypic features, clinical characteristics, and treatment outcome of adult pro-B acute lymphoblastic leukemia: results of the German multicenter trials GMALL 03/87 and 04/89. Blood 1998 Sep 15;92(6):1898-909.

(3) Schwartz S, Rieder H, Schlager B, Burmeister T, Fischer L, Thiel E. Expression of the human homologue of rat NG2 in adult acute lymphoblastic leukemia: close association with MLL rearrangement and a CD10(-)/CD24(-)/CD65s(+)/CD15(+) B-cell phenotype. Leukemia 2003 Aug;17(8):1589-95.

(4) Baldus CD, Martus P, Burmeister T, Schwartz S, Gokbuget N, Bloomfield CD, et al. Low ERG and BAALC expression identifies a new subgroup of adult acute T-lymphoblastic leukemia with a highly favorable outcome. J Clin Oncol 2007 Aug 20;25(24):3739-45.

(5) Baldus CD, Burmeister T, Martus P, Schwartz S, Gokbuget N, Bloomfield CD, et al. High expression of the ETS transcription factor ERG predicts adverse outcome in acute T- lymphoblastic leukemia in adults. J Clin Oncol 2006 Oct 10;24(29):4714-20.

(6) de Bock CE, Ardjmand A, Molloy TJ, Bone SM, Johnstone D, Campbell DM, et al. The Fat1 cadherin is overexpressed and an independent prognostic factor for survival in paired diagnosis- relapse samples of precursor B-cell acute lymphoblastic leukemia. Leukemia 2012 May;26(5):918-26.

(7) Greif PA, Dufour A, Konstandin NP, Ksienzyk B, Zellmeier E, Tizazu B, et al. GATA2 zinc finger 1 mutations associated with biallelic CEBPA mutations define a unique genetic entity of acute myeloid leukemia. Blood 2012 Jul 12;120(2):395-403.

(8) Greif PA, Yaghmaie M, Konstandin NP, Ksienzyk B, Alimoghaddam K, Ghavamzadeh A, et al. Somatic mutations in acute promyelocytic leukemia (APL) identified by exome sequencing. Leukemia 2011 Sep;25(9):1519-22.