Supplementary Information s46

Supplementary information

Methods RNAscope Multiplex Fluorescent

We performed in situ hybridization using RNAscope Multiplex Fluorescent kit (Advanced

Cell Diagnostics) according to the manufacturer’s instruction. Briefly, fresh frozen tissues were sliced, mounted on slides and then fixed in 10% formalin (Thermofisher scientific,

Waltham, MA) for 20 min at 4°C. After 3 washes in 1X PBS, brain slices were dehydrated in

50, 70 and 100% ethanol. Brain sections were then treated with protease solution

(pretreatment 4) for 20 min at room temperature. After pretreatment 4, target probes for the neuronal marker Rbfox3 (NM_001134498.2)1 and Prdm2 (gene bank accession number:

NM_001077648.1) were applied on the slides and incubated at 40°C for 2 h in the HybEZ oven. Next we incubated the slides with preamplifier and amplifier probes (AMP1, 40°C for

30 min; AMP2, 40°C for 15 min; AMP3, 40°C for 30 min). We then incubated the slides with fluorescently labeled probes by selecting a specific combination of colors: green (Alexa 488) for Prdm2 and red (Alexa 550) for RbFox3. Finally, brain sections were incubated for 20 s with DAPI (Thermofisher scientific, Waltham, MA). Fluorescent images of the dmPFC were captured using LSM700 Zeiss upright confocal.

Methylated Immunoprecipitation quantitative PCR. DNA was isolated from a separate batch of rats (n=8/groups) using the QIAamp Fast DNA Tissue kit (Qiagen). Purified DNA was diluted to 23 ng/µl in 60 µl volume and fragmented using a Bioruptor Pico sonicator

(Diagenode) to a mean fragment size of 400 bp (verified by agarose gel electrophoresis).

Immunoprecipitation (IP) was then performed overnight using the MagMeDIP kit (Diagenode) according to manufacturer’s protocol. Quantitative PCR on the IP samples, and their respective input fractions (DNA before IP), was carried out on a 7900HT Fast Real-Time

PCR instrument using the Fast SYBR® Green Master Mix 2X (Applied Biosystems). Primers for three regions close to Prdm2 transcription start site was designed using the Primer3 web tool2 (Supplemental Table X). In addition, two commercial primer pairs (pp-1043 and pp-

1046; Diagenode) that specifically amplifies strongly hyper- and hypomethylated regions in the rat genome were used as controls. All qPCR assays, except for Prdm2 exon 1, were run in technical duplicates using 6 µl template and 0.25µM primer concentration. Due to low methylation, exon 1 were run in quadruplicates with 8 µl template. Rn values was then imported to the LinRegPCR software3 where Cq values, adjusted for mean assay PCR efficiency, was extracted and used to calculate the percent IP sample to the respective inputs.

IP efficiency was calculated taking the percent Cq of the negative to the positive control.

REFERENCES

1. Kim KK, Adelstein RS, Kawamoto S. Identification of neuronal nuclei (NeuN) as Fox-3, a new member of the Fox-1 gene family of splicing factors. The Journal of biological chemistry 2009; 284(45): 31052-31061.

2. Untergasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm M et al. Primer3--new capabilities and interfaces. Nucleic acids research 2012; 40(15): e115.

3. Ruijter JM, Ramakers C, Hoogaars WM, Karlen Y, Bakker O, van den Hoff MJ et al. Amplification efficiency: linking baseline and bias in the analysis of quantitative PCR data. Nucleic acids research 2009; 37(6): e45. Supplementary Figure 1: Lentivirus vector map. Supplementary Figure 2. No difference in Prdm2 promoter DNA-methylation between postdependent rats and controls. Methylated immunoprecipitation quantitative PCR was used to estimate relative DNA-methylation at three separate locations relative to the CpG island (CpGi) of the Prdm2 promoter. (a) Boxplot/stripe chart shows that methylation increases with relative distance from TSS, but no difference are seen between groups C: control and PD: post-dependent rats. (b) The PD outliers were not explained by immunoprecipitation efficiency as estimated by the relative ratios between positive and negative control assays, representing methylation levels at highly methylated and non-methylated regions respectively. Supplementary Table 1. ChIP-seq alignment statistics.

Alignment Sample ID Total reads Mapped reads percentage ChIP-Control 1 24,726,690 23,906,809 96.68% ChIP-Control 2 30,038,990 28,363,457 94.42% ChIP-Control 3 30,990,914 28,954,982 93.43% ChIP-Control 4 30,024,058 27,668,895 92.16% ChIP-PostDependent 1 27,953,056 26,472,435 94.70% ChIP-PostDependent 2 29,886,218 28,251,754 94.53% ChIP-PostDependent 3 28,206,040 25,846,767 91.64% ChIP-PostDependent 4 29,251,088 27,914,169 95.43% Input-Control 1 27,632,814 25,704,220 93.02% Input-Control 2 31,997,452 30,174,497 94.30% Input-Control 3 44,169,940 41,523,879 94.01% Input-Control 4 37,727,426 35,832,332 94.98% Input-PostDependent 1 30,979,216 29,490,864 95.20% Input-PostDependent 2 25,238,588 23,907,843 94.73% Input-PostDependent 3 47,004,092 44,221,242 94.08% Input-PostDependent 4 38,399,060 36,464,688 94.96%

Supplementary Table 2. See excel file: EdgeR significance analysis of regions that exhibited differential enrichment with H3K9me1 in ChIP-sequencing analysis of control versus postdependent dmPFC.

Supplementary Table 3. See excel file: RNA-sequencing data for 119 genes that showed an alcohol-induced decrease in H3K9me1 according to ChIP-seq data of control versus postdependent dmPFC. Supplementary Table 4. Genes significantly dysregulated as a result of Prdm2 knockdown in the dmPFC.

Column ID p-value(Column 8) p-value(P vs. V) Ratio(P vs.Fold-Change(P V) vs. V) Grm8 0.00104438 0.00104438 0.034528 -28.9624 WNK2 0.00485256 0.00485256 0.086536 -11.5559 CACNA1D 0.00808003 0.00808003 0.179746 -5.56342 Syt7 0.00926456 0.00926456 2.50E-06 -400061 PRDM2 0.0118749 0.0118749 0.226749 -4.41017 NOP14 0.012347 0.012347 0.120905 -8.27096 setdb1 0.0155153 0.0155153 0.048413 -20.6558 Rab3c 0.019102 0.019102 62.7372 62.7372 ABCD3 0.0209117 0.0209117 0.057126 -17.5053 Grin3b 0.0215778 0.0215778 0.193968 -5.1555 MAPK1 0.0219561 0.0219561 0.04974 -20.1045 Syt9 0.0226291 0.0226291 0.12482 -8.01156 Sstr2 0.0237123 0.0237123 0.082247 -12.1585 Gabrr2 0.0237153 0.0237153 0.175945 -5.6836 Grm3 0.0238447 0.0238447 0.022644 -44.1617 hdac5 0.0249071 0.0249071 0.057093 -17.5154 Ncor2 0.0252736 0.0252736 0.267299 -3.74113 PIK3r2 0.02723 0.02723 0.061557 -16.2452 ABHD6 0.0289669 0.0289669 0.129945 -7.69557 AVPr2 0.0290358 0.0290358 0.241949 -4.13309 hdac2 0.0361938 0.0361938 0.301046 -3.32175 CACNA1l 0.03679 0.03679 0.147937 -6.75963 Drosha 0.037765 0.037765 0.090194 -11.0873 Htr1b 0.0385226 0.0385226 0.145382 -6.87845 Prkacb 0.0416381 0.0416381 0.059186 -16.896 BSN 0.0434876 0.0434876 0.006968 -143.509 Helz 0.0436105 0.0436105 0.207071 -4.82927 Grm2 0.0443411 0.0443411 0.234091 -4.27185 PER3 0.046487 0.046487 0.304456 -3.28455 Adrb1 0.0479082 0.0479082 0.062935 -15.8895 PPP1R1B 0.0486614 0.0486614 0.225856 -4.42761 Grm5 0.0488235 0.0488235 0.038429 -26.0221 dnmt1 0.0494751 0.0494751 0.1446 -6.91563 Supplementary Table 5. Primers used in methylated immunoprecipitation quantitative PCR.

Assay Amplified region Primers chr5:161879051- Prdm2 - 1st exon 161879160 Forward: GCCGTGTCGACGTCACTT Reverse: GACGTGCCAACGCTTCAG

Prdm2 - Proximal chr5:161879249- promoter 161879326 Forward: GCGACACGGGCTTCCTTT Reverse: GACTTGTGTCGCCCTCTCTGTC

Prdm2 - Distal chr5:161879372- promoter 161879432 Forward: GCTACCATGCCAGTCAGTCCA Reverse: TCATATTTTCCTCAGCGAATCCA

Gapdh - Negative chr4:161285768- control 161285833 Commercial Diagenode: Cat. No. pp-1046

Tsh2b - Positive chr17:48290238- control 48290336 Commercial Diagenode: Cat. No. pp-1043

All assays were run using the following PCR settings: Initiation = 50oC for 2 min -> Hot start = 95oC for 10 min -> Cycling = 95oC for 15 s follwed by 60oC for 1 min (repeated for 45 cycles)