Andrew P. Kinziger(1), Rodney J. Nakamoto(2), and Bret C. Harvey(2)
Total Page:16
File Type:pdf, Size:1020Kb
Local-scale invasion pathways and small founder numbers in introduced Sacramento pikeminnow (Ptychocheilus grandis)
Conservation Genetics
Andrew P. Kinziger(1), Rodney J. Nakamoto(2), and Bret C. Harvey(2)
(1) Department of Fisheries Biology, Humboldt State University, One Harpst Street, Arcata, CA 95521
(2) U.S.D.A. Forest Service, Pacific Southwest Research Station-Arcata, 1700 Bayview Drive, Arcata, CA 95521
Corresponding author: Andrew P. Kinziger, [email protected], phone: 707-826-3944, fax: 707-826-4060 Supplementary Table 1. Population ID, water body, sample size for microsatellites (n uSats), sample size for mitochondrial DNA (n mtDNA), collection location, latitude/longitude, date of collection and voucher numbers for specimens deposited into the Humboldt State University fish collection.
HSU Water n n mtDNA Collection Accession Body uSats ID Location Latitude Longitude Date Number South Fork Eel River near Eel 59 14 Miranda, October 2004 River Humboldt 40o 13’ 03.91" 123o 49’ EEL Co., CA N 00.79” W 5040 Eel River at Eel Rio Del, 18 10 July 2006 River Humboldt 40o 29' 53.27" 124o 05' EEL Co., CA N 26.13" W 5041 Williams Creek, tributary to Eel 16 13 Middle Fork September 2011 River Eel River, Mendocino 39o 48’ 59.62" 123o 08’ EEL Co., CA N 01.60" W 5042 Black Butte Eel River, 15 16 September 2011 River Mendocino 39o 49’ 123o 04’ EEL Co., CA 14.61” N 53.57” W 5043 Eel River near Eel Dos Rios, 14 16 September 2011 River Humboldt 39o 41’ 123° 21’ EEL Co., CA 13.43” N 33.52” W 5044 EEL Eel 13 15 Parimore 39o 19’ 122° 52’ September 2011 5045 River Creek to Rice 36.47” N 16.10” W Fork of Eel River, Humboldt County, CA North Fork Eel River off Eel 0 4 Mina Road, September 2011 River Mendocino 39o 56’ 123o 20’ EEL Co., CA 17.61” N 55.55” W 5046 Martin Slough at Eureka Hum- August 2008, Municipal boldt 6 6 November 2008, Golf Course, Bay July 2011 Humboldt 40o 45’ 124o 10’ ELK Co., CA 27.03” N 16.76” W 5047 Kelsey Creek Clear 16 16 at Kelseyville, 38o 58’ 122o 50’ April 2009 Lake CL Lake Co., CA 53.91” N 36.26” W 5048 Cache Creek October 2004, Cache 13 12 at Rumsey, 38o 53’ 122o 14’ 5049, May 2009 CAC Yolo Co., CA 24.56” N 16.66” W 5050 Cache Creek Cache at Guinda, 38o 49’ 122o 10’ October 2004 CAC 4 0 Yolo Co., CA 47.43” N 56.18” W 5051 North Fork Cache Creek at NFCC Cache 15 16 State Wildlife Area, Lake 38o 59’ 122o 32’ CAC Co., CA 17.90” N 24.26” W March 2012 5052 CAC Cache 1 1 North Fork 39o 04’ 122o 32’ May 2009 5053 Cache Creek 38.92” N 05.36” W downstream of Indian Valley Reservior Dam, Lake Co., CA Indian Valley Cache Reservoir, 39o 04’ 122o 32’ September 2010 CAC 2 3 Lake Co., CA 52.11” N 15.72” W 5054 Indian Valley May 2009, March Cache 3 3 Reservoir, 39o 10’ 122o 31’ 5055, 2012 CAC Lake Co., CA 01.70” N 38.49” W 5056 North Fork Cache Creek Cache 0 3 at Spring March 2012 Valley, Lake 39o 04’ 122o 34’ CAC Co., CA 25.24” N 57.46” W 5057 Sacramento River near Sacra- January - March 16 16 Red Bluff, mento 2007 Tehema Co., 40o 09’ 122o 12’ SAC CA 10.53” N 00.64” W 5058 Sacramento River near Sacra- 47 49 Red Bluff, September 2007 mento Tehema Co., 40o 09’ 122o 12’ SAC CA 10.53” N 00.64” W 5059 Sacramento River near Sacra- January - 0 3 Red Bluff, mento February 2008 Tehema Co., 40o 09’ 122o 12’ SAC CA 10.53” N 00.64” W 5060 PUT Putah 0 1 Putah Creek 38o 48’ 122o 36’ July 2011 5061 Creek near 19.09” N 52.51” W Middletown, Lake Co., CA Putah Creek Putah at Coyote 0 3 April 2009 Creek Valley, Lake 38o 48' 02.17” 122o 34’ PUT Co., CA N 30.85” W 5062 Anderson Creek near Putah 0 3 Anderson July 2009 Creek Springs, Lake 38o 46’ 122o 40’ PUT Co., CA 38.65” N 57.99” W 5063 Russian River off Wohler Russian July - August 56 58 Road, River 2008 Sonoma Co., 38o 30’ 122o 52’ RUS CA 30.60” N 59.70” W 5064 Allelic Locus Richness Size Range Cycling Conditions Reference CYPG21 43 174-382 95o for 60 seconds, 30 cycles of: 95oC for 60 seconds, 67oC for Baerwald, M. R., and B. 45 seconds with -0.5 oC/cycle, and 72oC for 120 seconds May. 2004. CYPG22 11 201-277 95o for 60 seconds, 30 cycles of: 95oC for 60 seconds, 67oC for Baerwald, M. R., and B. 45 seconds with -0.5 oC/cycle, and 72oC for 120 seconds May. 2004. CYPG24 12 162-225 95o for 60 seconds, 30 cycles of: 95oC for 60 seconds, 67oC for Baerwald, M. R., and B. 45 seconds with -0.5 oC/cycle, and 72oC for 120 seconds May. 2004. CYPG37 32 132-224 95o for 60 seconds, 30 cycles of: 95oC for 60 seconds, 67oC for Baerwald, M. R., and B. 45 seconds with -0.5 oC/cycle, and 72oC for 120 seconds May. 2004. CYPG48 19 133-209 95o for 60 seconds, 30 cycles of: 95oC for 60 seconds, 67oC for Baerwald, M. R., and B. 45 seconds with -0.5 oC/cycle, and 72oC for 120 seconds May. 2004. CYPG49 10 101-138 95o for 60 seconds, 30 cycles of: 95oC for 60 seconds, 67oC for Baerwald, M. R., and B. 45 seconds with -0.5 oC/cycle, and 72oC for 120 seconds May. 2004. RHCA15 16 145-190 92oC for 30 seconds, 45 cycles of: 92oC for 30 seconds, 50oC Girard, P., and B. b for 15 seconds, 68oC for 15 seconds, and 68oC for 120 seconds Angers. 2006. Supplementary Table 2. Microsatellite loci details including allelic richness across all populations, size range (including amplified flanking regions and microsatellite repeats) in base pairs (bp), cycling conditions, and references. Supplementary Table 3 Source population, intrinsic rate of increase (R), number of generations since introduction (T), carrying capacity of the introduced population (NK), estimate of effective number of founders (NEF) in the introduced population, and lower and upper 95% support limits.
Source R T NK NEF 95% Lower 95% Upper CL 3 6 30000 4.3 3.3 5.7 CL 3 6 60000 4.3 3.3 5.8 CL 3 6 90000 4.4 3.3 5.7 CL 3 11 30000 4.3 3.3 5.8 CL 3 11 60000 4.3 3.3 5.8 CL 3 11 90000 4.3 3.3 5.7 CL 4 6 30000 4.3 3.3 5.7 CL 4 6 60000 4.3 3.3 5.7 CL 4 6 90000 4.3 3.3 5.7 CL 4 11 30000 4.3 3.3 5.7 CL 4 11 60000 4.3 3.3 5.8 CL 4 11 90000 4.3 3.3 5.7 CAC 3 6 30000 3.3 2.7 4.1 CAC 3 6 60000 3.3 2.7 4.1 CAC 3 6 90000 3.3 2.7 4.1 CAC 3 11 30000 3.3 2.7 4.1 CAC 3 11 60000 3.3 2.7 4.1 CAC 3 11 90000 3.3 2.7 4.1 CAC 4 6 30000 3.3 2.7 4.1 CAC 4 6 60000 3.3 2.7 4.1 CAC 4 6 90000 3.3 2.7 4.1 CAC 4 11 30000 3.3 2.7 4.1 CAC 4 11 60000 3.3 2.7 4.1 CAC 4 11 90000 3.3 2.7 4.1 SAC 3 6 30000 2.9 0 3.5 SAC 3 6 60000 2.9 0 3.5 SAC 3 6 90000 2.9 0 3.5 SAC 3 11 30000 2.9 0 3.4 SAC 3 11 60000 2.9 0 3.4 SAC 3 11 90000 2.9 0 3.4 SAC 4 6 30000 2.9 0 3.4 SAC 4 6 60000 2.9 0 3.4 SAC 4 6 90000 2.9 0 3.4 SAC 4 11 30000 2.9 0 3.4 SAC 4 11 60000 2.9 0 3.4 SAC 4 11 90000 2.9 0 3.5 Supplementary Table 4 Haplotype ID and haplotype definitions for the 17 haplotypes in our Sacramento pikeminnow study populations.
Haplotype ID Haplotype Definition Hap_1 GTATAGCAAAGTATCTGTGTAA Hap_2 GTACAGTAAAGTATTCGTGTAA Hap_3 GTGCAATAAGGTACTCATGCGA Hap_4 GTACAGTGAAGTGTTCGTGTAA Hap_5 GTGCAATAAGGTACTCGTGTGA Hap_6 ATGCAATAGGGTACTCGTGTGA Hap_7 GTGCAATAGGGTACTCGTGTGA Hap_8 GTACAGTAAAGTATTCGTGTAG Hap_9 GTACAGCAAAGTATTCGTGTAA Hap_10 GTGCAATAAGGTACTCGTGCGA Hap_11 GTACAGTAAAATACTCGTGTAA Hap_12 GTACAGTAAAGCATTCGTGTAA Hap_13 GTACAGCAAAGTATCTGTGTAA Hap_14 GTACGGCAAAGTATTCGTATAA Hap_15 GTACAGTAAAGTATTCGCGTAA Hap_16 GTACAACAAAGTATCCGTGTAA Hap_17 GGACGGCAAAGTATTCGTATAA Supplementary Table 5 Mitochondrial DNA haplotype frequencies among Sacramento pikeminnow populations.
Haplotype : EEL ELK CL CAC SAC PUT RUS Hap_1 26 0 0 7 0 0 0 Hap_2 62 6 12 25 42 3 0 Hap_3 0 0 4 5 0 2 0 Hap_4 0 0 0 1 9 0 0 Hap_5 0 0 0 0 0 0 55 Hap_6 0 0 0 0 0 0 2 Hap_7 0 0 0 0 0 0 1 Hap_8 0 0 0 0 2 0 0 Hap_9 0 0 0 0 1 0 0 Hap_10 0 0 0 0 5 0 0 Hap_11 0 0 0 0 2 0 0 Hap_12 0 0 0 0 1 0 0 Hap_13 0 0 0 0 2 0 0 Hap_14 0 0 0 0 2 1 0 Hap_15 0 0 0 0 1 0 0 Hap_16 0 0 0 0 1 0 0 Hap_17 0 0 0 0 0 1 0 Supplementary Fig. 1 Mean estimate of Ln probability of data versus assumed cluster number (K) resulting from the Bayesian cluster methods implemented in STRUCTURE. Supplementary Fig. 2 ΔK versus cluster number (K) resulting from Bayesian cluster analysis implemented in STRUCTURE.