DOCSLIB.ORG

Molecular Identification of T Cells That Respond in a Primary Bulk Culture

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Molecular Identification of T Cells That Respond in a Primary Bulk Culture Molecular Identification of T Cells That Respond in a Primary Bulk Culture to a Peptide Derived from a Platelet Glycoprotein Implicated in Neonatal Alloimmune Thrombocytopenia Krystyna Maslanka, Maryam Yassai, and Jack Gorski Immunogenetics Research Section, Blood Research Institute, The Blood Center of Southeastern Wisconsin, Milwaukee, Wisconsin 53201-2178 Abstract Among these, the platelet alloantigen system associated with surface integrin GPIIb/IIIa (␣IIb␤3) plays an important role in Neonatal alloimmune thrombocytopenia induced by the hu- pregnancy and transfusion related alloimmunity (1, 2). man platelet alloantigen 1a (HPA1a) is characterized by A characteristic of these alloimmune responses is the pres- generation of alloantibodies by a mother who is homozy- ence of circulating antibodies specific for the alloantigen. These gous for the HPA1b alloantigen and almost always HLA- are thought to mediate the destruction of the cells expressing DRB3*0101. The disease is viewed as B cell mediated but the alloantigen. One particular alloimmune response is inter- the linkage with HLA is indicative of a role for T cells. The esting in its HLA restriction. The GPIIb/IIIa alloantigens HPA1a and HPA1b allotypes are defined, respectively, by HPA1a and HPA1b are defined by antibodies which are sensi- Leu and Pro at amino acid 33 of the ␤-chain of the platelet tive to the polymorphism at position 33 of the GPIIIa chain integrin GPIIbIIIa (␣IIb␤3). Under the assumption that the (3). Mutagenesis experiments have shown that this polymor- same polymorphism may control both the B cell epitope and phism is sufficient for inducing alloantibody recognition (4). constitute the MHC-bound peptide, we restimulated PBMC The generation of a response to HPA1a (GPIIIaLeu33) requires from a woman with an affected child with a synthetic pep- that the responder be HPA1b (GPIIIaPro33) homozygous. The tide from this polymorphic region. Molecular analysis of the resulting platelet destruction gives rise to post-transfusion responding T cell repertoire identified two T cells which thrombocytopenia purpura (PTP) or neonatal alloimmune predominated in cultures stimulated with the alloantigen thrombocytopenia (NAIT).1 Interestingly, responders are al- peptide and which were absent in cultures with the autoanti- most always HLA DRB3*0101 (5) or DQB1*02 (6). For gen peptide. In spite of the use of different V families, sequence NAIT, the relative risk for DRB3*0101 has been calculated as of the CDR3 region of the T cell receptor (TCR) ␤-chain 141, which is of the same order as for one of the best examples revealed the presence of a shared motif, L-P-S/T. Oligonu- of an HLA-linked autoimmune disease, ankylosing spondylitis cleotide probes specific for the CDR3 sequence indicated and HLA B27. Also of interest is that the reverse response that these T cells were present in the PBMC at the highest (anti-HPA1b) is much less frequent and does not show an levels immediately after delivery of the affected infant and HLA linkage (7). their frequency dropped at later times. (J. Clin. Invest. 1996. The contribution of B cells to this response has been stud- 98:1802–1808.) Key words: alloantigen • platelet • T cell an- ied by identification of factors involved in generating the tigen receptor, beta chain • gene rearrangement • comple- epitopes on GPIIIa recognized by these cells. Not only has the mentarity determining region controlling polymorphism been identified for this response, a number of experiments have led to the concept that the B cell Introduction epitope is complex (8) and may involve contributions from various parts of the GPIIIa chain (9, 10). Alloimmunity is generally considered as an important compo- While the B cell contribution has been the subject of much nent in transplantation and the MHC is one of the most potent study, the contribution of T cells has been generally ignored. alloantigen systems. However, alloimmunity can also be a The high degree of HLA restriction in this response as well as complication of pregnancy or transfusion. While the MHC the fact that the antibodies are IgG indicate that the B cells re- again plays an important role, other antigen systems contrib- quire T cell help. In this paper, we worked under the hypothe- ute substantially. Such non-MHC antigen systems include the sis that the polymorphic region controlling the antibody polymorphic proteins expressed on other circulating cells. epitope could also function as the antigenic peptide responsi- ble for this stimulation, a hypothesis which had been sup- ported by preliminary experiments (11). We used a combina- Address correspondence to Jack Gorski, Blood Research Institute, tion of approaches to identify two likely T cell clonotypes Blood Center of S.E. Wisconsin, P.O. Box 2178, Milwaukee, WI involved in this response using the TCR ␤-chain as a clono- 53201-2178. Phone: 414-937-6367; FAX: 414-937-6824; E-mail: typic marker. Clonotype-specific probes were used to investi- [email protected]. Krystyna Maslanka’s current address is Institute of gate the levels of these T cells at various times after pregnancy. Haematology and Blood Transfusion, Department of Serology, ul.Choci- mska 4, 00-957 Warsaw, Poland. Received for publication 29 January 1996 and accepted in revised Methods form 26 July 1996. Cells. The cells of a healthy Caucasian woman who had delivered two babies with NAIT were investigated. The woman was typed as J. Clin. Invest. © The American Society for Clinical Investigation, Inc. 0021-9738/96/10/1802/07 $2.00 1. Abbreviations used in this paper: NAIT, neonatal alloimmune Volume 98, Number 8, October 1996, 1802–1808 thrombocytopenia; TCR, T cell receptor. 1802 K. Maslanka, M. Yassai, and J. Gorski HPA-1b and HLA DRB1*02, DRB1*03, DRB3*0101. Circulating Gels were run 100 min to resolve the region corresponding to 120– anti-HPA1a antibodies were found after both the first and second 220 bp. The labeled PCR product was analyzed by Molecular Dynam- pregnancy using antigen capture ELISA. Blood samples were obtained ics FluorImager 575 (Sunnyvale, CA). under an Institutional Review Board (IRB) approved protocol. Subcloning and DNA sequencing. The TCR ␤-chain cDNA cor- PBMC obtained from whole citrate blood were isolated by Ficoll- responding to specific spectratype bands were subcloned by perform- Hypaque (Pharmacia LKB Biotechnology Inc., Piscataway, NJ) gra- ing a separate PCR using subcloning primers. These contained an ad- dient and used throughout this procedure. PBMC were collected at ditional PstI restriction site on the BV primers or a BamHI site on the different times after delivery of the second child (6, 18, 24, 30, and C region primer. The primer sequences are: BV5.3, CTCAGGTCTG- 42 mo, respectively). CAGTTCCCTAACTATAGCTCTGAGC; BV11, GAGTCTGCA- Platelet membranes were prepared (12) from the platelet-rich GTCTCCAGAATAAGGACGGAGC; and BC, GAGCCATCA- plasma fractions collected from HPA1a and HPA1b homozygous in- GAAGCAGAGATCTGGATCCCCCA. The C region primer is dividuals. The platelet donors were unrelated to the subject of the synthesized as inverse complement of the sequence shown here. study. All blood samples were obtained with informed consent and PCR products were purified with phenol/chloroform extraction under IRB approval. followed by ethanol precipitation. After resuspension in a small vol- Culture conditions. Culture was performed using PBMC isolated ume of water, the DNA was digested with the appropriate enzymes 30 mo after delivery, in RPMI-1640 culture medium (Whittaker, and ligated into digested pGEM 3zf(f) plasmid vector (Promega Rockville, MD) supplemented with 10% heat inactivated AB pool Corp., Madison, WI). The sequence analysis was performed using human serum, 1 mM L-glutamine, 1 mM sodium pyruvate, 10 IU/ml Taq Dye Deoxy-Terminator Cycle Sequencing Kit (Applied Biosys- heparin, 4 ␮g/ml gentamicin, 100 ␮g/ml streptomycin, 100 ␮g/ml pen- tems Inc., Foster City, CA). icillin and 25 mM HEPES buffer, in 6-well flat bottom plates (Costar Colony and electroblot hybridization. Probes specific for the Corp., Cambridge, MA) which were kept in incubator at 37ЊC in a hu- CDR3 of the TCR (clonotype-specific probes) were designed on the midified 5% CO2 air atmosphere. basis of the DNA sequences generated (Table I). The probe se- PBMC (106 cells/ml per well) were initially incubated with differ- quence for the BV4 clonotype is GAGGGGGGGACCTCCTACG. ent concentrations (50 ␮M, 25 ␮M, 12.5 ␮M, or 2 ␮M) of synthetic Optimal hybridization and washing conditions were determined using 32 peptides GPIIIa 26–38leu33 or GPIIIa 26–38pro33 (as negative control). Af- plasmid cloned DNA. The probes were labeled using P␥ATP and ter 7 d, the cultures were divided in two parts. To both parts, fresh ir- polynucleotide kinase and used for colony hybridization as described radiated autologous PBMC (106 cells/ml) and the same appropriate (16). Spectratypes were electroblotted from acrylamide gels onto ny- concentration of peptide were added. To one part 50 IU/ml recombi- lon membranes (0.22 mm; Magna Graph, MSI, Westboro, MA). The nant human IL-2 (Genzyme Corp., Cambridge, MA) was added and DNA was crosslinked for approximately 30 s UV using a Stratalinker culture continued for 7 more days. After 14 d, cells were harvested, UV 1800 (Stratagene Inc., La Jolla, CA), baked at 80ЊC for 60 min, washed in PBS, and used for RNA preparation. and hybridized in 50ЊC with 32P-labeled clonotype-specific probes. Peptide synthesis. The peptide GPIIIa26–38leu33 and GPIIIa26–38pro33 Hybridization was conducted in hybridization buffer (10 ϫ Denhard were synthesized on Pepsyn KA resin (Millipore Corp., Bedford, MA) solution, 5 ϫ SSC, 7% SDS, 20 mM Na2HPO4 and 100 ␮g/ml dena- using a 9050 Pepsynthesizer (Millipore Corp.) according to the manu- tured herring sperm DNA) at 50ЊC overnight. The membranes were facture-specified protocols. The peptides were purified by reverse washed at 50ЊC twice in 10 ϫ Denhard solution, 5% SDS, 70 ␮M phase HPLC (Beckman Instruments, San Ramon, CA) to Ͼ 90% pu- phosphate buffer, pH 7.0 and twice in 1 ϫ SSC, 1% SDS and sub- rity using a C18 column (Vydac, Hesperia, CA).
Load more

Recommended publications
  • Donor-Alloantigen-Reactive Regulatory T Cell Therapy in Liver
    Confidential Page 1 of 80 Donor-Alloantigen-Reactive Regulatory T Cell Therapy in Liver Transplantation Version 7.0/ August 1, 2018 IND# 15479 Study Sponsor(s): The National Institute of Allergy and Infectious Diseases (NIAID) Grant #: R34AI095135 and U01AI110658-01 Study Drug Manufacturer/Provider: Sanofi US PRINCIPAL INVESTIGATOR CO- PRINCIPAL INVESTIGATOR CO- PRINCIPAL INVESTIGATOR SANDY FENG, MD, PHD JEFFREY BLUESTONE, PHD SANG-MO KANG, MD, FACS Professor of Surgery Executive Vice Chancellor and Provost Associate Professor Director, Abdominal Transplant A.W. Clausen Distinguished Professor University of California, San Surgery Fellowship in Medicine Francisco University of California, San University of California, San Francisco 513 Parnassus Ave. Francisco 513 Parnassus Ave. Box 0780, HSE-520 505 Parnassus Ave. Box 0400, HSW-1128 San Francisco, CA 94143-0780 Box 0780, M-896 San Francisco, CA 94143-0780 Phone: (415) 353-1888 San Francisco, CA 94143-0780 Phone: (415) 476-4451 E-mail: Sang- Phone: (415) 353-8725 Fax: (415) 476-9634 [email protected] Fax: (415) 353-8709 E-mail: [email protected] E-mail: [email protected] CO- PRINCIPAL INVESTIGATOR BIOSTATISTICIAN MEDICAL OFFICER QIZHI TANG, PHD DAVID IKLÉ, PHD NANCY BRIDGES, MD Associate Professor Senior Statistical Scientist Chief, Transplantation Branch Director, UCSF Transplantation Rho, Inc. Division of Allergy, Immunology, Research Lab 6330 Quadrangle Drive and Transplantation University of California, San Chapel Hill, NC 27517 NIAID Francisco Phone: (910) 558-6678
    [Show full text]
  • Java Based Distributed Learning Platform
    Journal of Pharmacy and Pharmacology 8 (2020) 110-123 doi: 10.17265/2328-2150/2020.04.003 D DAVID PUBLISHING Blood Group Cartography (ABO, RHESUS, KELL and DUFFY) and Hemogram of Icteric Newborn in Sendwe Hospital, Lubumbashi/D.R.C Monga Kalenga J. J1, Monga Ngoy Davidson2, Matanda Kapend Serge3, Masendu Kalenga Paulin4, Haumont Dominique5 and Luboya Numbi Oscar1 1. Department of Pediatrics, Faculty of Medicine, University of Lubumbashi, Haut-Katanga 1825, DRC. 2. Laboratory Department Head Sendwe Hospital, Haut Katanga, Lubumbashi 1825, DRC 3. Department of Internal Medicine, Faculty of Medicine, University of Lubumbashi, Haut-Katanga 1825, DRC. 4. CHR The Citadel, Neonatology Department, University of Liège, Liège 4450, Belgium. 5. Free University of Brussels, Brussels 1050, Belgium Abstract: Background: Allo immunization jaundice is a common cause of neonatal jaundice. According to racial group the concerned blood group may not be the same. In our Country people are exposed to high transfusionnal risk because of malaria and sicklanemia and the blood group research in laboratory include only ABO/D. Objective: Our objective was to establish a blood group cartography of this icteric newborn population and their mother; the frequency of rare blood group and the compatibility level between mother and newborn. Our interest was also to study hemogram of this population. Methodology: We studied blood group ABO/D; RH/Kell and Duffy of 56 newborn whom developped an indirect bilirubin and their mothers. We performed bilrubin level and hemogram. Results: The frequency of icteric newborn was 17.17%. The mother blood mapping was O (60.71%), RhD positive (83.9%), C negative (91.07%) E negative (89.29%) c positive (91.07%), epositive (92.86%), kell negative (100%) and duffy null (100%).
    [Show full text]
  • Humoral Alloimmunity in Cardiac Allograft Rejection
    Humoral alloimmunity in cardiac allograft rejection Jawaher Alsughayyir Darwin College Department of Surgery University of Cambridge This dissertation is submitted for the degree of Doctor of Philosophy July 2018 i Declaration This dissertation is the result of my own work and includes nothing which is the outcome of work done in collaboration except where declared in the text. It has not been submitted in whole or part for a degree at any university. The length of this thesis does not exceed the 60,000 word limit i Dissertation title: Humoral alloimmunity in cardiac allograft rejection Student name: Jawaher Alsughayyir Abstract Although the short-term outcomes of solid allograft survival have improved substantially over the last few decades, there has been no significant improvement in long-term survival of solid allografts. This thesis presents the initial characterisation of alloantibody mediated rejection in a murine heart transplant model, with particular focus on the impact of the different phases of the humoral alloimmune response (follicular or germinal centre) on graft rejection. The key findings of this work are: 1) The precursor frequency of allospecific CD4 T cells determines the magnitude of the alloantibody response, with a relatively high frequency of CD4 T cells eliciting strong extrafollicular responses, while a high frequency of B cells promotes slowly-developing germinal centre responses. 2) Strong extrafollicular antibody response can mediate acute heart allograft rejection in the absence of CD8 T cells alloresponses. 3) Germinal centre humoral immunity mediates chronic antibody-mediated rejection. 4) Recipient memory, but not naïve, CD4 T cells that recognise one graft alloantigen can provide ‘unlinked’ help to allospecific B cells that recognise a different graft alloantigen for generating germinal centre alloantibody responses.
    [Show full text]
  • Investigation of Penicillamine-Induced Autoimmunity
    Mechanistic Investigation of Penicillamine-Induced Autoimmunity: Covalent Binding of Penicillamine to Macrophages, Involvement of Th17 cells, and Its Relation to Idiosyncratic Drug-induced Liver Injury By Jinze Li A thesis submitted in conformity with the requirements for the degree of DOCTOR OF PHILOSOPHY Graduate Department of Pharmaceutical Sciences University of Toronto ©Copyright by Jinze Li 2009 Library and Archives Bibliothèque et Canada Archives Canada Published Heritage Direction du Branch Patrimoine de l’édition 395 Wellington Street 395, rue Wellington Ottawa ON K1A 0N4 Ottawa ON K1A 0N4 Canada Canada Your file Votre référence ISBN: 978-0-494-61128-9 Our file Notre référence ISBN: 978-0-494-61128-9 NOTICE: AVIS: The author has granted a non- L’auteur a accordé une licence non exclusive exclusive license allowing Library and permettant à la Bibliothèque et Archives Archives Canada to reproduce, Canada de reproduire, publier, archiver, publish, archive, preserve, conserve, sauvegarder, conserver, transmettre au public communicate to the public by par télécommunication ou par l’Internet, prêter, telecommunication or on the Internet, distribuer et vendre des thèses partout dans le loan, distribute and sell theses monde, à des fins commerciales ou autres, sur worldwide, for commercial or non- support microforme, papier, électronique et/ou commercial purposes, in microform, autres formats. paper, electronic and/or any other formats. The author retains copyright L’auteur conserve la propriété du droit d’auteur ownership and moral rights in this et des droits moraux qui protège cette thèse. Ni thesis. Neither the thesis nor la thèse ni des extraits substantiels de celle-ci substantial extracts from it may be ne doivent être imprimés ou autrement printed or otherwise reproduced reproduits sans son autorisation.
    [Show full text]
  • Immune Approach to Primary Graft Dysfunction
    Immune approach to Primary Graft Dysfunction Ankit Bharat MD FACS Harold & Margaret Method Professor Director, Lung Transplant & ECMO Disclosures None PRIMARY GRAFT DYSFUNCTION • Incidence >50-70% • Occurs within first 24 hours following transplant • Characterized by respiratory failure • Leading cause of short-term mortality • Predominant risk factor for chronic rejection PGD INDUCES CYTOKINE STORM AND ALLOIMMUNITY Bharat et al, Annals Thor Surg, 2011 Spectrum of PGD Neutrophil-mediated Ischemia- Donor non-classical monocytes allograft injury reperfusion injury Recipient classical monocytes Donor Pneumonia Donor Alveolar Macrophages Donor-specific antibodies Complement activation Antibody-mediated rejection Immune complex deposition Monocyte/macrophage activation (hyperacute/acute) Lung-restricted antibodies Inadequate allograft Endothelial Necroptosis preservation damage NEUTROPHILS MEDIATE PGD Kreisel D et al. J Clin Invest 2011;121:265–276. PERFUSED HUMAN DONOR LUNGS CONTAIN MONOCYTES Bharat et al, AJRCMB, Jan 2016 Zhikun et al, Science Transl Med, 2017 Demonstration of non-classical monocytes in the intravascular space of donor lungs Human Mouse NCM CM Neutrophils n o i s u f r e p e r - e r P n o i s u f r e p e r - t s o P NCM are visualized at sites of neutrophil recruitment and endothelial injury Human PGD LIPOSOMAL CLODRONATE DEPLETES Ly6Clow MONOCYTES IN PERFUSED LUNGS Control Clo-lip 87.1 73.2 12.9 26.5 Flushed Lung Ly6C MHC II Tissue monocytes Patrolling endothelial- bound monocytes Flushed Lung Ly6C MHC II Depletion of donor
    [Show full text]
  • HLA Overview
    4/12/2018 American Red Cross HLA Laboratories Playing with Matches Shonna Sims, MBA HLA Director American Red Cross [email protected] I have no real or I have no relevant apparent conflict of financial relationship to interest or other disclose. relationships related to the content of this presentation. American Red Cross 1 HLA Overview • HLA = Human Leukocyte Antigen • HPA = Human Platelet Antigen American Red Cross 2 1 4/12/2018 Human Leukocyte Antigen System • HLA Antigens are found on the surface of both platelets and white cells as well as on other nucleated cells of the body. • Platelets carry Class I HLA antigens and lack Class II antigens. American Red Cross 3 Human Leukocyte Antigen System (Class I Antigens) HLA –A, B, C Found on most body tissue cells Interact with cytotoxic T cells American Red Cross 4 Human Leukocyte Antigen System (Class II Antigens) HLA –DR, DP, DQ Limited Cellular Expression Interact with T-helper cells American Red Cross 5 2 4/12/2018 HLA Antibodies HLA antibodies can cause the destruction of transfused platelets. Sensitization may develop due to: • Pregnancy • Multiple transfusions American Red Cross 6 What about HPA? • Refractoriness can be caused by HPA (platelet glycoprotein) antibodies alone (<6% of patients – although I have seen <1%) or in combination with HLA antibodies (<10%). – Some HPA antibodies do not cause recognizable refractoriness due to low pathogenicity and/or low population antigen frequency (OR low titer)…. American Red Cross 7 What about Class II or Cw – they are on the report… • HLA Class II DR/DQ/DP are mainly of interest for bone marrow or tissue transplants, or disease association (DR).
    [Show full text]
  • Blood Product Administration in Children and Young Adults Likely to Need a Solid Organ Transplant October 2020
    Evidence-Based Care Guideline 50 Blood Product Administration in Children and Young Adults Likely to Need a Solid Organ Transplant October 2020 TARGET POPULATION FOR THE RECOMMENDATION Inclusion Criteria Children and young adults who are likely to require solid organ transplantation: For heart transplant, patients with: • single ventricle physiology • cardiac dysfunction • hypertrophic cardiomyopathy • restrictive heart disease For kidney transplant, patients with: • Chronic Kidney Disease (CKD) stage 3 or higher (estimated GFR of < 60 ml/min/1.73 m2) • on dialysis • under evaluation or waitlisted for kidney transplantation • have received a kidney transplant For liver transplant, patients with: • listed for liver transplantation • having received a liver transplant For lung transplant, patients with: • listed for transplantation • having received a lung transplant For small bowel transplant, patients with: • listed for transplantation • having received a small bowel transplant Exclusion Criteria Bone marrow transplant or hematopoietic stem cell transplant recipients EVIDENCE-BASED CARE RECOMMENDATIONS Clinical Assessment Care Recommendation Statement 1 It is strongly recommended that the theoretical future risk of allosensitization should not Recommendation Strength prevent or delay administration of blood products in patients with life threatening conditions Strong that could be reversed by blood product administration (Local Consensus, 2020 [5]). Care Recommendation Statement 2 It is strongly recommended that the decision to administer blood products consider all Recommendation Strength perceived risks and benefits in each individual patient (Scornik, 2013 [1a]). Strong • Note 1: This includes the risk of allosensitization, which has been associated with longer wait times and increased risk of rejection and mortality in patients who are in need of kidney or heart transplantation (Scornik, 2013 [1a]; McKee, 2018 [3a]; Ibrahim, 2011 [4a]).
    [Show full text]
  • Proposal for Crossmatch Project 18.10.12.Docx
    Aus der Klinik für kleine Haustiere des Fachbereichs Veterinärmedizin der Freien Universität Berlin Studies in feline pre-transfusion testing: Evaluating a novel blood typing device and serial cross-matching in transfusion patients Inauguraldissertation zur Erlangung des Grades eines Doktors der Veterinärmedizin an der Freien Universität Berlin Vorgelegt von Layla Hourani Tierärztin aus Rostock Berlin 2017 Journal-Nr.: 3990 Gedruckt mit Genehmigung des Fachbereichs Veterinä rmedizin der Freien Universitä t Berlin Dekan: Univ.-Prof. Dr. Jürgen Zentek Erster Gutachter: Univ.-Prof. Dr. Barbara Kohn Zweiter Gutachter: Univ.-Prof. Dr. Heidrun Gehlen Dritter Gutachter: Univ.-Prof. Dr. Robert Klopfleisch Deskriptoren (nach CAB-Thesaurus): blood type, blood typing, cat, cross-matching, pre- transfusion testing, point-of-care, transfusion medicine, transfusion safety Tag der Promotion: 19.07.2017 2 To Friedolin, Krikri, Molly, Spotty and the old gibbon couple at Sababurg Zoo 3 Table of contents LIST OF ABBREVIATIONS.....................................................................................................................6 TABLES AND FIGURES .........................................................................................................................7 1 INTRODUCTION ...........................................................................................................................8 1.1 HISTORY OF TRANSFUSION MEDICINE AND TRANSFUSION SAFETY .......................................................9 1.2 PATIENT SAFETY IN
    [Show full text]
  • Blood Grouping
    WHO GMP ANTISERA CERTIFIED ANTISERA J. MITRA Ensure Your Blood Compatibility with our Product Range... & CO. PVT. LTD. The ABO blood group system is a classification system for the antigens of human blood discovered by Karl Landsteiner in 1900. There are four blood groups : A, B, AB and O. The Rh blood group system is the second most significant system for blood grouping. Rh factor refer to Rh D antigen only. Determination of Rh factor along with ABO is essential for defining the Rh +ve or Rh -ve status of the individual. Around 85% of the human population is Rh +ve while 15% is Rh -ve. The ABO & Rh systems are the most significant blood group systems from the clinical point of view. JML Range of Blood Grouping... Anti-A Monoclonal Anti-B Monoclonal Anti-AB Monoclonal Anti-D (IgM) Rh1 Monoclonal Anti-D (IgG+IgM) Rh1 Monoclonal Anti-H Lectin Anti-A1 Lectin Anti Human Serum Bovine Albumin AANNTTII--HH LLEECCTTIINN AABBOO BBLLOOOODD GGRROOUUPPIINNGG Ulex europaeus lectin for slide and Tube Tests (Anti-A, Anti-B, Anti-AB, Anti-D (IgM) & Anti-D (IgG + IgM) Monoclonal) Anti-H Lectin is used to show the presence of Salient Features: The routine practice of blood typing and cross-matching blood products prevent adverse 'H' antigen on human red blood cells. The 'H' Excellent Avidity antigen is a precursor of A & B antigen. transfusion reactions caused by ABO antibodies. ABO blood grouping is used to check Clearly visible agglutination the RBCs & plasma compatibility of donor and recipient before blood transfusion. Individuals that test as type 'O' by ABO blood Shelf Life : 24 months at 2-8ºC group system may have Bombay Phenotype (hh).
    [Show full text]
  • The Immune System and Kidney Disease: Basic Concepts and Clinical Implications
    REVIEWS The immune system and kidney disease: basic concepts and clinical implications Christian Kurts1, Ulf Panzer2, Hans-Joachim Anders3 and Andrew J. Rees4 Abstract | The kidneys are frequently targeted by pathogenic immune responses against renal autoantigens or by local manifestations of systemic autoimmunity. Recent studies in rodent models and humans have uncovered several underlying mechanisms that can be used to explain the previously enigmatic immunopathology of many kidney diseases. These mechanisms include kidney-specific damage-associated molecular patterns that cause sterile inflammation, the crosstalk between renal dendritic cells and T cells, the development of kidney-targeting autoantibodies and molecular mimicry with microbial pathogens. Conversely, kidney failure affects general immunity, causing intestinal barrier dysfunction, systemic inflammation and immunodeficiency that contribute to the morbidity and mortality of patients with kidney disease. In this Review, we summarize the recent findings regarding the interactions between the kidneys and the immune system. Considerable progress has been made both in under- role of the cellular immune responses that drive renal 1Institutes of Molecular standing the basic immune mechanisms of kidney disease. Moreover, we summarize recent discoveries Medicine and Experimental disease and in translating these findings to clinical about complement- and antibody-mediated nephritis, Immunology (IMMEI), therapies. Sophisticated animal studies combined and we discuss kidney pathologies that are mediated Rheinische Friedrich- with the analysis of clinical samples have led to a pre- by renal autoantigen-specific antibodies, especially those Wilhelms-Universität, cise knowledge of the autoimmune targets and of the that are induced by crossreactive microorganism-specific Sigmund-Freud-Str. 25, 53105 Bonn, Germany. mechanisms responsible for kidney injury.
    [Show full text]
  • Multiplex Gene Analysis Reveals T-Cell and Antibody-Mediated Rejection
    www.nature.com/scientificreports OPEN Multiplex gene analysis reveals T‑cell and antibody‑mediated rejection‑specifc upregulation of complement in renal transplants Eva Vonbrunn1, Tajana Ries1, Stefan Söllner1, Janina Müller‑Deile2, Maike Büttner‑Herold1, Kerstin Amann1,3 & Christoph Daniel1,3* In renal transplantation, complement is involved in ischemia reperfusion injury, graft rejection and dysfunction. However, it is still unclear how induction of complement and its activation are initiated. Using allograft biopsies of a well‑characterized cohort of 28 renal transplant patients with no rejection (Ctrl), delayed graft function (DGF), acute T‑cell‑mediated (TCMR) or antibody‑mediated rejection (ABMR) we analyzed diferences in complement reaction. For that mRNA was isolated from FFPE sections, quantifed with a multiplex gene expression panel and correlated with transplant conditions and follow‑up of patients. Additionally, infammatory cells were quantifed by multiplex immunohistochemistry. In allograft biopsies with TCMR and ABMR gene expression of C1QB was 2‑4 fold elevated compared to Ctrl. In TCMR biopsies, mRNA counts of several complement‑related genes including C1S, C3, CFB and complement regulators CFH, CR1 and SERPING1 were signifcantly increased compared to Ctrl. Interestingly, expression levels of about 75% of the analyzed complement related genes correlated with cold ischemia time (CIT) and markers of infammation. In conclusion, this study suggest an important role of complement in transplant pathology which seems to be at
    [Show full text]
  • Pathophysiology, 6Th Edition
    McCance: Pathophysiology, 6th Edition Chapter 08: Alterations in Immunity and Inflammation Key Points – Print SUMMARY REVIEW Hypersensitivity: Allergy, Autoimmunity, and Alloimmunity 1. Inappropriate immune responses are misdirected against the host’s own tissues (autoimmunity); directed against beneficial foreign tissues, such as transfusions or transplants (alloimmunity); exaggerated responses against environmental antigens (allergy); or insufficient to protect the host (immune deficiency). 2. Allergy, autoimmunity, and alloimmunity are collectively known as hypersensitivity reactions. 3. Mechanisms of hypersensitivity are classified as type I (IgE-mediated) reactions, type II (tissue-specific) reactions, type III (immune complex–mediated) reactions, and type IV (cell- mediated) reactions. 4. Hypersensitivity reactions can be immediate (developing within minutes to a few hours) or delayed (developing within several hours or days). 5. Anaphylaxis, the most rapid immediate hypersensitivity reaction, is an explosive reaction that occurs within minutes of reexposure to the antigen and can lead to cardiovascular shock. 6. Allergens are antigens that cause allergic responses. 7. Type I (IgE-mediated) reactions are mediated through the binding of IgE to Fc receptors on mast cells and cross-linking of IgE by antigens that bind to the Fab portions of IgE. Cross- linking causes mast cell degranulation and the release of histamine (the most potent mediator) and other inflammatory substances. 8. Histamine enhances the chemotaxis of eosinophils into sites of type I allergic reactions 9. Atopic individuals tend to produce higher quantities of IgE and to have more Fc receptors for IgE on their mast cells. 10. Type II (tissue-specific) reactions are caused by five possible mechanisms: complement- mediated lysis, opsonization and phagocytosis, neutrophil-mediated tissue damage, antibody- dependent cell-mediated cytotoxicity, and modulation of cellular function.
    [Show full text]