Supporting Informations

SUPPORTING INFORMATIONS

MULTIPLE COURSES OF G-CSF IN PATIENTS WITH DECOMPENSATED

CIRRHOSIS: CONSISTENT MOBILIZATION OF IMMATURE CELLS EXPRESSING

HEPATOCYTE MARKERS AND EXPLORATORY CLINICAL EVALUATION

Silvia Gaia 1, Antonella Olivero 1, Antonina Smedile 1, Marco Ruella 2, Maria Lorena Abate 1, Maurizio Fadda 3, Emanuela Rolle 1, Paola Omedè 4, Paola Bondesan 4, Roberto Passera 5, Alessandra Risso 6, Manuela Aragno 7, Alfredo Marzano 1, Alessia Ciancio 1, Mario Rizzetto 1 and Corrado Tarella 2

1 Department of Gastro-hepatology, San Giovanni Battista University Hospital, Torino; 2 Division of Hematology and Cell Therapy, Mauriziano Hospital and University of Torino; 3 Department of Clinical Nutrition, San Giovanni Battista University Hospital, Torino; 4 Division of Hematology 1, Giovanni Battista University Hospital, Torino; 5 Division of Nuclear Medicine 2, Giovanni Battista University Hospital, Torino; 6 Molecular Biotechnology Center, University of Torino; 7 Department of Medicine and Experimental Oncology, University of Torino, Italy.

1 Supporting Information - link-1: Eligibility criteria included being aged between 18 and 80 years, having advanced liver cirrhosis of any origin with a Child–Pugh score >6 and a Meld score >12, having had at least one previous episode of severe liver failure, including porto-systemic encephalopathy, abdominal ascites or variceal bleeding. Exclusion criteria were: i. candidature for liver transplantation; ii. spleen diameter of larger than 180 mm (14, 15); iii. diagnosis of concomitant hepatocellular carcinoma or other cancer; iv. digestive hemorrhage due to portal hypertension in the previous 7 days; v. recent episodes of portal vein thrombosis (16, 17); vi. severe renal or cardiac dysfunction; vii. acute infection or disseminate intravascular coagulation; viii. active alcohol abuse; alcohol assumption had to have been interrupted at least 12 months prior to enrollment.

Supporting Information - link-2: Cells were purified using the CD34 MicroBead kit (Miltenyi Biotech, Bergisch Gladbach, Germany) containing MicroBeads directly conjugated to CD34, for magnetic labeling of CD34-expressing hematopoietic progenitor cells. Peripheral blood mononuclear cells (PBMCs) were isolated using Ficoll-Paque® (1.077 density) according to the manufacturer’s protocol. PBMCs were then washed with PBS at 1500 rpm for 10 minutes, and resuspended in 300µl of Miltenyi Buffer® (for up to 108 cells). Cells were mixed with 100µl of FcR Blocking Reagent® and 100 µl of CD34 MicroBeads® followed by incubation for 30 minutes at 4°C. Subsequently, cells were washed with Miltenyi Buffer® at 1500 rpm for 10 minutes, resuspended and loaded into a MACS® Column placed in the magnetic field of a MACS® Separator. The magnetically labeled CD34+ve cells were retained within the column whilst the unlabeled cells flowed through. After removing the column from the magnetic field, the magnetically retained CD34+ve cells were eluted as the positively-selected cell fraction.

Supporting Information - link-3: Concentration and purity of extracted RNA were assessed by an ND-1000 Spectrophotometer (NanoDrop Technologies Inc., Wilmington, DE). RNA was reverse- transcribed using the QuantiTect Reverse Transcription kit (Qiagen, Germany) including an initial incubation step with a gDNA Wipeout Buffer to eliminate genomic DNA contamination. PCR was performed using a Hot Star Taq Master Mix kit (Qiagen, Germany) under the following conditions: initial activation step at 95°C for 15 min, 50 cycles at 94°C for 15 sec, 55°C for 30 sec and 72°C for 30 sec. PCR products were electrophoresed on a 2% agarose gel containing 0.5 µg/ml ethidium bromide and visualized under UV light by Gel Doc 2000 (Bio-Rad Laboratories, Inc. USA).

2 Normal liver human tissue was used as a positive control. The housekeeping gene, glyceraldehyde- 3-phosphate dehydrogenase (GAPDH), was used as an internal RNA standard, and liver tissue samples obtained from healthy subjects were used as positive controls.

Supporting Information - link-4:. RT-PCR for the HCV RNA 5' non-coding region was performed with primers C67 (5'CGCAGAAAGCGTCTAGCCATG 3'–fw) and C213 (5'GAGCGGGTTGATCCAAGAAAGG 3' - rv) using standard reaction conditions.

Supporting Information- Table 4. Child Pugh and MELD score variations in 15 treated patients

during 4 courses of G-CSF and follow-up according to their prognosis*.

Liver function Months Prognosis p score 0 3 6 9 12 18 21 G-CSF Follow-up survived 8 (6-11) 8 (5-9) 7 (5-9) 7 (5-11) 6 (5-11) 7 (5-10) 6 (5-10) 0.016 Child Pugh dead 11 (9-13) 9.5(8-11) 10.5 (9-12) - - - - - survived 15 (9-32) 14 (10-26) 15 (10-27) 15 (10-31) 13 (6-23) 13 (6-22) 14 (6-21) ns MELD dead 27.5 12-39) 12.5 (12-13) 22 (16-28) - - - - -

Results are reported as median (range).

*To avoid the misleading idea that the CP improved after treatment because dead patients were not

considered in the last follow-up, we also considered data only from survivors confirming that CP

score significantly improved in treated patients.