DOCTORADO EN CIENCIAS Y BIOTECNOLOGÍA DE PLANTAS

Análisis genómico del /ocus MATen Mycosphaerella fijiensis

Tesis que-para obtener el grado de: Doctor en Ciencias Presenta:

Biol. Laura Conde Ferráez

Centro de Investigación Científica de Yucatán, A.C.

Mérida, Yucatán, México

2007

CONTENIDO

Reconocimientos

Usta de figuras V

Lista de tablas vii

1 Lista de abreviaturas ix

Resumen xi

Abstract xii

INTRODUCCIÓN 1

PLANTEAMIENTO DEL PROBLEMA 3

OBJETIVOS 5

OBJETIVO GENERAL 5

OBJETIVOS PARTICULARES 5

REFERENCIAS 5

CAPITULO 1: ANTECEDENTES GENERALES 7

1.1 Antecedentes Parte 1: Generalidades de la Sigatoka negra y otras enfermedades foliares 7 1.1.1 LAS ENFERMEDADES DE MANCHA FOLIAR DEL BANANO 7 1.1.2 DISTRIBUCIÓN DE LA SIGATOKA NEGRA 8 1.1.3 DESARROLLO DE LA ENFERMEDAD DE LA SIGATOKA NEGRA 9 1.1.4 TAXONOMÍA DE Mycosphaerella fijiensis 10 1.1 .5 BIOLOGÍA Y CICLO DE VIDA DE Mycosphaerella fijiensis 11 1.1.6 GENÉTICA Y GENÓMICA DE Mycosphaerella fijiensis 13

1.2 Antecedentes parte 2: Ellocus MAT (mating-type) dede los ascomicetos: su evolución, estructura y regulación. 15 1.2.1 INTRODUCCION 15 1.2.2 LOS GENES DEL LOCUS MAT 15 1.2.3 EVOLUCIÓN DEL LOCUS MAT 16 1.2.4 ESTRUCTURA DEL CONTEXTO GENÓMICO DEL LOCUS MAT 17 1.2.5 REGULACIÓN DE LA EXPRESIÓN DE LOS GENES MAT 19 1.2.6 LOS GENES MAT EN HONGOS ANAMÓRFICOS 20 1.2.7 CONSIDERACIONES FINALES 21

1.3 REFERENCIAS 22

CAPITULO 2: MATERIALES Y MÉTODOS GENERALES 29

2.1 ESTRATEGIA EXPERIMENTAL 29

2.2 OBTENCIÓN DEL GEN DNA LIASA 29

2.3 OBTENCIÓN DEL GEN sla2 30

2.4 ESCRUTINIO DE UNA BIBLIOTECA BAC DE M. FIJIENSIS POR PCR E HIBRIDACION 31

2.5 PREPARACION E HIBRIDACION DE MEMBRANAS DEL CARIOTIPO MOLECULAR DE M. fijiensis 31

2.6 AMPLIFICACIÓN DE LOS GENES MAT POR PCR 32 2.6.1 OBTENCION DE LA CAJA HMG DE M. MUS/COLA 35

2.7 OBTENCION DE LOS IDIOMORFOS COMPLETOS 35

2.8 REFERENCIAS 36

CAPITULO 3: ANÁLISIS DEL CARIOTIPO MOLECULAR Y DE UNA BIBLIOTECA GENÓMICA BAC DE MYCOSPHAERELLA FIJIENSIS 39

3.1 INTRODUCCION 39

3.2 MATERIALES Y METODOS 40 3.2.1 Análisis del cariotipo molecular 40 3.2.1.1 Obtención de "Piugs" de micelio 40 3.2.1.2 Resolución de los cromosomas por PFGE 41 3.2.1.3 Southern Blot e Hibridaciones del cariotipo 41 3.2.1.4 Preparación de las Sondas utilizadas en las hibridaciones 42 3.2.2 Análisis de una biblioteca BAC 42 3.2.2.1 Elaboración de filtros de alta densidad 42 3.2.2.2 Escrutinio de la biblioteca por hibridación 42 3.3 RESULTADOS 43 3.3.1 Análisis del cariotipo 43 3.3.1.1 Hibridaciones del cariotipo 45 3.3.2 Obtención de fragmentos de genes flanqueantes 47 3.3.3 Escrutinio de una biblioteca BAC 4 7

3.4 DISCUSION 49 3.4.1 Análisis del cariotipo molecular 49 3.4.2 Hibridaciones del cariotipo y escrutinio de una biblioteca BAC 50

3.5 CONCLUSIONES 51

3.6 REFERENCIAS 51

CAPITULO 4: ISOLATION ANO CHARACTERIZATION OF THE MATING TYPE LOCUS OF MYCOSPHAERELLA F/J/ENSIS, THE CAUSAL AGENT OF BLACK LEAF STREAK DISEASE OF BANANA 53

4.1 INTRODUCTION 53

4.2 EXPERIMENTAL PROCEDURES 54 4.2.1 Fungal isolates and DNA extraction 54 4.2.2 PCR and DNA walking strategies 56 4.2.3 PCR confirmation of inverted sequences within the idiomorphs 56 4.2.4 Bioinformatic analyses 56

4.3 RESUL TS 57 4.3.1 PCR amplification of the HGM box and flanking genes 57 4.3.2 Long -range PCR isolation of the mat1-1 idiomorph 59 4.3.3 Characterization of the idiomorphs 59 4.3.4 ORF finding and gene prediction 63 4.3.5 Comparative analysis 63

4.4 DISCUSSION 63 4.4.1 Amplification of the HMG box 63 4.4.2 Characterization of the idiomorphs 65 4.4.3 Comparative analysis 65 4.4.4 Synteny amongst ascomycetes 66 4.4.5 The use of the idiomorphs for the study of populations and evolution.67

4.5 ACKNOWLEDGEMENTS 67

4.6 REFERENCES 67 CONCLUSIONES GENERALES Y PERSPECTIVAS 71

ANEXOS 73 RECONOCIMIENTOS

Este trabajo fue posible gracias a la Beca de Doctorado, CONACYT 70133, y fue desarrollado en su mayor parte en las instalaciones del Laboratorio de Biotecnología Molecular del CICY.

Agradezco profundamente a:

Mi director de tesis Dr Andrew James, por su apoyo y confianza; Dra Blondy Canto Canché, por sus valiosas enseñanzas, aportaciones científicas y discusiones; Dr Edwin C.A. Abeln y Dr Cees Waalwijk por sus contribuciones en el desarrollo de este trabajo, Dr Gert H.J. Kema por discusiones y apoyo durante la estancia en su laboratorio. A la QFB Rosa Grijalva Arango y al Biol Néstor Raigosa Flores por su gran apoyo técnico , aportaciones científicas y compañerismo. En general a todos mis compañ-eros del laboratorio, por su disponibilidad, ayuda y compañerismo, sobre todo a la M.C. Leticia Peraza Echeverría, por su apoyo incondicional y por sus aportaciones al trabajo expuesto en el capítulo 3, al igual que a la Ora Cecilia Rodríguez García y la M.C. Diana Guillén Maldonado. Al personal de Plant Research lnternational por su apoyo durante la estancia realizada en el desarrollo de este trabajo, en particular a lneke de Vries, Odette Mendes y Theo Van der Lee. A mi comité tutora! y predoctoral, a los revisores de tesis, por sus comentarios y sugerencias para mejorar este trabajo: Dr Jean Philippe Vielle Calzada, Dr Alfredo Herrera Estrella, Ora Caroline Burgeff D'Hondt, Ora Aileen O'Connor Sánchez, Dr Osear Moreno Valenzuela y Ora Renata Rivera Madrid.

Dedico este trabajo y mis logros a mi familia y a Dios, ya que sin ellos nada hubiera sido posible. 11 "Si no quieres perderte en el olvido tan pronto como estés muerto y corrompido, escribe cosas dignas de leerse, o haz cosas dignas de escribirse': Benjamin Franklin

" .. .Debemos estudiar para saber, y debemos saber para servir[. ..] Si un necio lee muchos libros, al final sólo será un necio que ha leído muchos libros. Léelos tú, porque eso te dará conocimiento. Pero acércate con amor a la gente, y escúchala, porque eso te dará sabiduría. Y la sabiduría es más importante que el puro conocimiento, porque es conocimiento con amor''. Armando Fuentes Aguirre

111 iv LISTA DE FIGURAS

Figura 1.1. Expansión de la Sigatoka negra en México y Centro América (Tomado de Orozco-Santos, 1998). 9 Figura 1.2. Etapas de Desarrollo de los síntomas de la Sigatoka negra; (a) elapas 1 y 2, (b) etapas 3 y 4, (e) etapas 5 y 6 (tomado de Mourichon et al., 1997). 10 Figura 1.3. Ciclo de vida de Mycosphaerella fijiensis (Tomado de Manzo- Sánchez et al., 2005) 12 Figura 1.4. Esporas de Mycosphaerella fijiensis: a: (1) peritecio, (2) aseas, (3) ascosporas; b: (1) estroma, (2) células conidiogenas (3) conidio (Tomado de Pons, 1987). 12 Figura 1.5. Comparación dellocus MATen cinco especies de hongos. 17 Figura 2.1. Diagrama de flujo de las reacciones de PCR que se realizan utilizando el kit DNA walking SpeedUp (Seegene ®). Figura tomada del manual del usuario. · 36 Figura 3.1 . "Piugs" de micelio incluido en agarosa 41 Figura 3.2. a) Separación de los cromosomas de M fijiensis tamaño pequeño por medio de electroforesis de campo pulsante, y teñido con SYBR green; las condiciones electroforéticas son específicas para cromosomas pequeños y se describen en materiales y métodos. b) Hibridación del los cromosomas pequeños de M fijiensis y d) de los cromosomas grandes, empleando como sonda el telómero (TTAGGG) 18 , para verificar el patrón de bandeo del cariotipo. e) Separación de los cromosomas grandes de M fijiensis por PFGE con tinción con SYBR green. 44 Figura 3.3. Autorradiografías obtenidas al hibridar con las sondas de 7 kb , mat1-1 (a) y mat1-2 (b). 45 Figura 3.4. Autorradiografías obtenidas al hibridar con las sondas de 7 kb, mat1-1 (a) y mat1-2 (b). La hibridación se realizó a 48 oc, al igual que los lavados; dos de 30 min con 2x SSC, 0.1% SOS; de 30 min y 1.5 hr con 1x SSC, 0.1% SOS y uno de 0.1x SSC, 0.1% SOS 1.5 hr. 45 Figura 3.5. a) Gel de agarosa teñido con SYBR Green, en el que se resolvieron los cromosomas de M fijiensis de hasta 2,200 kb, b) Autorradiografía obtenida al hibridar los cromosomas de 200- 2,200 kb de M fijiensis con la caja la caja HMG de M graminicola, a 48° C. Los lavados fueron a 48° C, dos de 30 m in con 2xSSC. 0.1 %SOS; y uno de 15 m in con 1 x SSC, 0.1% SOS. El film se expuso 24 hr. e) Autorradiografía obtenida al hibridar con la misma sonda a 55 °C. 46 Figura 3.6. Amplicones obtenidos utilizando oligos degenerados para la DNA liasa (a) y sla2 (b). 47 Figura 4.1. Multiple sequence alignments of predicted amino acids from a) the HMG box and b) the alpha box, of Mycosphaerella fijiensis, · Mycosphaerella musicola, Septoria passerinii, Cochliobolus

V heterostrophus, Sordaria macrospora, Alternaría alternata, Colletotrichum musae, Coch/iobolus sativus, Fusarium oxysporum, Leptosphaeria maculans, Neurospcra crassa, Podospora anserina and Pyrenopeziza brassicae. 58 Figura 4.2. Diagram of the mat locus organization in Mycosphaerella fijiensis. The boxes labeled mat1-1 and mat1-2 represent the idiomorphs; the adjacent genes are labeled APC (Anaphase Promoting Complex) and DNA lyase. 60 Figura 4.3. Dotplot graph of both idiomorphs of M. fijiensis generated with Blast2. X axis: sequence of mat1-1, Y axis: sequence of mat1-2. The flanking regions draw two lines from bottom left to top right. 61 Figura 4.4. PCR confirmation of the inverted regions found within the idiomorphs of M. fijiensis. 62 Figura 4.5. Neighbour-joining phylograms based on multiple alignment of the predicted amino acid sequences from a) the HMG box and b) the alpha box, of severa! ascomycetes (same species presented in Fig 3.1 ). 64

Vl LISTA DE TABLAS

Tabla 2.1: Oligonuceótidos degenerados para amplificar el gen de la DNA liasa. 30 Tabla 2.2 : Oligonuceótidos degenerados para amplificar 1.2 kb de s/a2 30 Tabla 2.3. Lista de oligonucleótidos utilizados en los ensayos para amplificar regiones conservadas de los idiomorfos. 33 Tabla 3.1. Localización de las clonas positivas en la hibridación usando como sonda el fragmentos del gen sla2 y DNA liasa. 48 Table 4.1. DNAs used in this work. Grand Naine is a cultivar of Musa acuminata, which is highly susceptible to M. fijiensis. 55 Table 4.2. Primers used to amplify regions of the mating type idiomorphs, the DNA lyase gene and the sla2 gene. 57

vii ·. .·

V111 LISTA DE ABREVIATURAS

Abreviatura Significado ADN Ácido desoxirribonucleico AFLP Amplified Fragment Length Polymorphism ARN Ácido ribonucleico BAC Cromosoma Bacteriano Artificial CBS Centraalbureau voor Schimme/chultures CHEF Contour-clamped Homogeneous E/ectric Field CICY Centro de investigación Científica de Yucatán cm centímetros EDTA ácido etilenodiaminotetraacético EST Expressed Sequence Tag HMG High Mobility Group ITS Interna/ Transcribed Spacer kb kilo pares de bases LB medio Luria-Bertani m minutos Mb Mega pares de bases mm milímetros mM milimolar ml mililitros ORF Open Reading Frame pb pares de bases PCR Reacción en cadena de la polimerasa PDB caldo papa dextrosa PFGE Pulsed Field Gel Electrophoresis pH Potencial de Hidrógeno S segundos sla2 synthetically lethal with Abp 1p ( actin binding protein 1) SSR Simple Sequence Repeats ¡.¡g microgramo ¡.¡m micómetros ¡.¡M micro molar uv ultra violeta oc grados Celcius

lX X RESUMEN

Mycosphaerella fijiensis, agente causal de la Sigatoka negra, la enfermedad mas devastadora del banano y plátano, es un ascomiceto heterotálico, con un tipo de apareamiento bipolar. En hongos con este tipo de reproducción, los genes mat representan una herramienta poderosa para identificar líneas compatibles sexualmente ya que determinan el tipo de apareamiento de las diferentes líneas. Los genes responsables de la especificidad y desarrollo sexuales se localizan en el Jocus MA T. En este locus se encuentran una de dos formas alternativas denominadas idiomorfos mat1-1 y mat1-2, que son llamados así por poseer secuencias totalmente diferentes entre sí. Además, se han utilizado en análisis pob'lacionales y como marcadores filogenéticos, en comparación con las secuencias de los ITS. Los genes mat presentan un relativamente bajo porcentaje de conservación en secuencia de nucleótidos entre los ascomicetes (alrededor de un 24-64% de identidad). Sin embargo, las regiones características de la caja alfa y HMG (en mat1-1 y mat1-2 respectivamente) presentan mayor porcentaje de identidad entre especies distantes. En el presente trabajo, se realizaron experimentos para ubicar físicamente el Jocus MA T dentro del cariotipo molecular de M. fijiensis, por medio de Southern blot y sondas radiactivas. Al mismo tiempo, se intentó ubicar el locus dentro de una biblioteca genómica tipo BAC. Usando oligonucleótidos degenerados, se logró amplificar la caja HMG de mat1-2 de M. fijiensis, la cual mostró homología con la de Mycosphaerella graminico/a. Se clonaron y secuenciaron los genes de la DNA liasa y sla2, los cuales se encuentran flanqueando a este locus en varias especies de levaduras y hongos filamentosos, usando oligos degenerados. Mediante la estrategia de "DNA walking", anclándose en la DNA liasa hacia la caja HMG, se obtuvo la región de mat1-2 de 9 kb. Usando PCR de amplio rango con oligos en las regiones flanqueantes, las cuales tienen cerca de 100% de identidad entre los idiomorfos, se obtuvo un amplicón de 5 kb correspondiente a mat1-1. Se encontraron regiones invertidas con altos porcentajes de identidad (77-89 %) dentro de los idiomorfos de M. fijiensis, lo que sugiere eventos únicos de inversión que nunca han sido publicados y que podrían haber sido significativos en la evolución de esta especie. Los genes predichos presentan los intrones conservados en ambos idiomorfos y además un intrón adicional dentro de la caja alfa. Se discuten las implicaciones en la evolución de las especies del complejo Mycosphaerel/a en el banano.

Xl Xll ABSTRACT

Mycosphaerella fijiensis, the causal agent of Black Sigatoka, the most devastating disease of banana and plantain, is a hetherothallic ascomycete, with a dipolar mating system. In fungi with this kind of reproduction, mat genes represent a powerful tool to identify compatible partners, because they define the mating type of fungi and sexual compatibility among different lines. The genes responsible for specificity and sexual development are located in the MA T locus. In this locus are found one out of two alternative forms named idiomorphs mat1-1 and mat1-2. These are so called because of the dissimilarity of their sequences. In addition, they have been used in population analysis of many species, and as phylogenetical markers in comparison to ITS sequences. The mat genes show relatively low conservation among ascomycetes (around 24-64% identity). However, characteristical regions, the alpha and the HMG box (mat1-1 and mat1-2 respectively), have shown some conservation between distantly related fungi. Experiments were performed to physically localize the mat locus in-M. -fijiensis electrophoretic karyotype, and in a BAC genomic library. Degenerate oligonucleotides were used to amplify the HMG box of the mat1-2 idiomorph from M. fijiensis, showing homology with the HMG box of Mycosphaerella graminico/a. The DNA lyase and s/a2 genes were cloned, which flank the MA T locus in several yeast and filamentous fungi. Fragments of both genes were amplified using degenerate oligonucleotides and sequenced. Using a DNA walking strategy, anchored on the DNA lyase gene towards the HMG box, a 9 kb long region of mat1-2 was obtained. A 5 kb fragment from the mat1-1 region was obtained by long range PCR using primers on the flanking regions, which have el ose to 100% identity between both idiomorphs. High identity (77 -89% ), inverted regions within both idiomorphs in M. fijiensis were found, which suggest unique inversion events, which have not been found befare, and that could have been significant in the evolution of this species. The predicted genes showed the conserved introns in both idiomorphs as well as a unique additional intron within the alpha box. The implications for the evolution of species in the Mycosphaerella complex on banana are discussed.

xiii XIV INTRODUCCIÓN

El hongo ascomiceto Mycosphaerel/a fijiensis es el agente causal de la enfermedad denominada Sigatoka negra del banano y el plátano. Esta enfermedad ha sido controlada principalmente mediante fungicidas, sobre todo en variedades altamente susceptibles como la variedad "Enano Gigante", de gran importancia económica en nuestro país (Orozco et a/., 2001). Además del control químico, existen otras opciones de control de la enfermedad, para lo cual se han desarrollado programas de mejoramiento convencional con el fin de generar plantas híbridas resistentes a la Sigatoka Negra, así como la generación de plantas genéticamente modificadas a través de la transformación genética. Sin embargo, los frutos no cubren los requerimientos de las empresas exportadoras y por consiguiente son aceptados únicamente en los mercados locales (Fullerton y Olsen, 1995).

Aunque los fungicidas sistémicos permiten luchar contra la Sigatoka negra en las plantaciones comerciales, los costos, los efectos sobre el medio ambiente y la habilidad de las poblaciones del patógeno para desarrollar resistencia a estas medidas de control, obligan a tratar de encontrar otras alternativas. Una posibilidad es desarrollar nuevas estrategias basadas en el conocimiento del genoma del patógeno, para conocer el mecanismo de infección y para poder llegar a identificar los genes relacionados con la virulencia.

Es por ello necesario enfocarse en los aspectos biológicos y genéticos del patógeno, que permitan conocer más a fondo sus características individuales y poblacionales. Entre los antecedentes de los estudios genómicos se encuentran estudios de microsatélites (Neu et al., 1999, Molina, et al., 2001, Palacios et al., 2002) y RFLPs (Carlier et a/, 1994), entre otros marcadores (Müeller, et al., 1997), que han permitido evaluar las poblaciones de diferentes continentes. Sin embargo, aparte de esto, es poco lo que se conoce del genoma de M. fijiensís y su congéner M. musícola.

Iniciando los trabajos al respecto, recientemente en el grupo de la Unidad de Biotecnología del CICY se obtuvo una biblioteca genómica BAC (Guillén­ Maldonado, 2003) y se encuentra en proceso el desarrollo de un mapa genético utilizando marcadores tipo AFLP (Manzo-Sánchez, comunicación personal). Siguiendo estas iniciativas, el objetivo de este trabajo es el aislamiento y caracterización de los genes mat de M. fijíensís y su comparación con hongos relacionados del mismo género.

1 En los ascomicetos, los genes mat son los responsables de la compatibilidad reproductiva entre dos líneas, cuyas estructuras masculinas solamente pueden fecundar a las femeninas del "mating type" opuesto (o tipo de apareamiento opuesto), llamados respectivamente mat1-1 y mat1-2. A estos se les denomina idiomorfos y no aleles, por tratarse de secuencias muy diferentes que, sin embargo, ocupan el mismo /ocus.

En Mycosphaerella graminicola y en otros hongos ascomicetos relacionados e incluso distantes, encontramos un alto grado de sintenia alrededor del locus MA T (Waalkwijk et al., 2004, Butler et al, 2004 ), lo cual resulta útil puesto que los genes flanqueantes suelen ser más conservados que los genes maten sí.

Los genes mat son fundamentales durante la reproducción sexual, la compatibilidad y el desarrollo de esporas sexuales. Además de su importacia biológica, las características de sus secuencias, las cuales son muy poco conservadas, los hacen útiles para estudiar la evolución de especies relacionadas. La obtención de los genes mat de M. fijiensis como hongo modelo dentro del grupo de los Mycosphaerellaceae, sería la base de estudios genéticos, poblacionales y de-filogenia;-así-como de estudios de la interacción planta-patógeno y del proceso de infección.

2 PLANTEAMIENTO DEL PROBLEMA A pesar de la importancia del patógeno M. fijiensis, la información acerca de su genética y genómica es a la fecha muy limitada. El hongo estudiado mas cercano es M. gramicola, por lo que se tomó como modelo en este trabajo, surgiendo las siguientes preguntas fundamentales: ¿cuál es la secuencia y estructura de los genes m;;Jt en M. fijiensis?, ¿cuál es el cromosoma en el que se localiza el locus MA 1?, ¿existe sintenia alrededor del /ocus?, ¿existe microsintenia dentro de los genes mat (conservación en secuencia, posición de intrones, longitud)?, ¿es comparable con lo observado en M. graminico/a y otros hongos más distantes? Para contestar estas preguntas, se propusieron los siguientes objetivos:

3 4 OBJETIVOS

OBJETIVO GENERAL Aislamiento de los genes mat de Mycosphaerella fijiensis y análisis de sintenia con otros hongos relacionados.

OBJETIVOS PARTICULARES

1. Obtener e hibridar el cariotipo electroforético (cromosomas resueltos mediante PFGE) de M. fijiensis. 2. Seleccionar e identificar el cromosoma que contenga el locus MA T por hibridación. 3. Identificar las clonas de una biblioteca genómica de M. fijiensis que contienen el locus MA T. 4. Amplificación de genes flanqueantes de los idiomorfos 5. Amplificación fragmentos conservados de los idiomorfos. 6. Obtener los idiomorfos completos de M. fijiensis. 7. Caracterización de los genes deLiocus MAT de M. fijiensis. 8. Análisis de sintenia con Mycosphaerella graminico/a y Septoria passerinii.

REFERENCIAS

• Butler, G., Kenny, C., Fagan, A. , Kurischko, C., Gaillardin, C., Wolfe, K.H. 2004. Evolution of the mat locus and its Ho endonuclease in yeast species. Proc. Natl. Acad. Sci. USA 101:1632-1637. • Carlier J., Mourichon, X ., Gonzalez-de León, D. , Zapater, M., Lebrun, M.H. 1994. DNA restriction fragment length polymorphisms in Mycosphaerella species that cause banana leaf spot diseases. Phytopathology 84:751-756. • Fullerton, R.A. ,Oisen, T.L. 1995. Pathogenic variability in Mycosphaerella fijiensis Morelet, cause of black sigatoka in banana and plantain. New Zealand Journal of Crop and Horticulture Science. 23:39-48. • Guillén Maldonado, D. 2003. Construcción de una biblioteca genómica tipo Cromosoma Bacteriano Artificia de Mycosphaerella fijiensis. Tesis de Maestría, Centro de Investigación Científica de Yucatán. • Malina, C., Kaemmer, D. , Aponte, S., Weising, K., Kahl, G. 2001 . Microsatellite markers for the fungal banana pathogen Mycosphaerella musicola. Molecular Ecology 1:137-139. • Müller, R. , Pasberg-Gauhl, C. , Gauhl, F., Ramser, J., Kahl , G. 1997. Oligonucleotide fingerprinting detects genetic variability at different levels in Nigerian Mycosphaerella fljiensis. Journal of Phytopathology 145:25-30

5 • Neu, C. , Kaemmer, D., Kahl , G., Fisches, D., Weising, K. 1999. Polymorphic microsatellite markers for the banana pathogen Mycosphaerel/a fijiensis. Molecular Ecology 8:513-525. • Orozco, S.M., Farias, Larias., G. Manzo S, S. Guzmán. 2001 . La Sigatoka negra (Mycosphaerella fijiensis Morelet) en México. INFOMUSA. 10(1):33-37. • Palacios, G., Bustamante, S., Malina, C., Winter, P. , Kahl , G. 2002. Electrophoretic identification of new genomic profiles with a modified selective amplification of microsateilite polymorphic loci technique based n AT/AAT polymorphic repeats. Electrophoresis 23:341-3345. • Waalwijk, C. , van der Lee, T., de Vries, l. , Hesselink, T., Arts, J. , Kema, G.H.J. 2004. Synteny in toxigenic Fusarium species: the fumonisin gene cluster and the mating type region as examples. European Journal of Plant Pathology. 110: 533-544.

6 CAPITULO 1:

Antecedentes Generales

En este capítulo se presenta en la primera parte una recopilación acerca de los antecedentes generales de la especie de estudio de este trabajo, y a continuación, en la segunda parte, los antecedentes referentes a los genes del mating type.

1.1 Antecedentes Parte 1: Generalidades de la Si gato ka negra y otras enfermedades foliares

1.1.1 LAS ENFERMEDADES DE MANCHA FOLIAR DEL BANANO

Los cultivos de plátano y de banano son importantes a nivel mundial debido a que son una fuente rica en carbohidratos, vitaminas y minerales. Las principales enfermedades de las manchas foliares del banano son la Sigatoka amarilla y la Sigatoka negra.

Mycosphaerella fijiensis Morelet (anamorfo Paracercospora fijiensis) causa la enfermedad foliar más destructiva de los bananos, la Sigatoka negra. En particular, el desarrollo de la enfermedad genera una marcada disminución en la producción bananera por maduración precoz del fruto y reducción de la capacidad fotosintética de la planta debido a la destrucción del tejido foliar. La pérdida de la producción puede llegar hasta el 50% (Sánchez y Cárdenas, 2002).

Las esporas de este hongo son diseminadas por el viento y depositadas en las hojas, en donde germinan, penetran por los estomas y colonizan varias células. Los síntomas de esta enfermedad consisten en manchas café-rojizas, que se alargan hasta formar lesiones necróticas y halos amarillentos con el centro ligeramente gris, que provocan necrosis, destruyendo grandes áreas del tejido foliar, dando como resultado la reducción en la producción y madurez prematura de la fruta (Stover, 1974; Polanco etal., 2002).

Por su parte, la enfermedad causada por el hongo M. musicola Leach (anamorfo Pseudocercospora musae), es conocida comúnmente como Sigatoka Amarilla. M. musicola fue primeramente identificada en Java en 1902, mientras que M. fijiensis fue observada por primera vez como un nuevo patógeno en Fiji en 1963 {Rhodes, 1964 ). Ambas especies son muy similares en muchos aspectos, pero M. fijiensis es más virulenta e infecta una rango mayor de genotipos de bananos y plátano (Stover, 1980). 7 Hoy en día, la sigatoka amarilla ha sido desplazada por la Sigatoka negra, lo cual se atribuye a la mayor agresividad y adaptación que tiene M. fijiensis en las regiones tropicales con altitudes de O a 500 msnm. La Sigatoka amarilla se encuentra en zonas altas mayores de 1,000 msnm (Mouliom-Pefoura et al., 1996). Posteriormente se reportó una nueva enfermedad que causa manchas foliares a los bananos y plátanos y se le llamó mancha foliar eumusae (Carlier et al., 2000b). Los síntomas iniciales aparecen como pequeñas estrías de color café ligero. Cuando la densidad de infección es baja, las estrías desarrollan lesiones ovales o elipsoidales con el centro gris. Sin embargo, cuando la densidad de infección es alta, las lesiones cohalecen y se tornan necróticas, formando grandes áreas dañadas de tejido foliar. Estos síntomas se asemejan a los producidos por enfermedades como la Sigatoka negra y la Sigatoka amarilla. La mancha foliar eum usae es causada por el hongo Mycosphaerella eumusae (anamorfo Pseudocercospora eumusae, Crous y Mourichon, 2002). Actualmente, este patógeno causa severos daños en plantaciones del sureste de la Ind ia, Sri Lanka, Tailandia, Malasia, Vietnam, Mauritius y Nigeria. Esta enfermedad en pocos años podría causar grandes daños económicos en estas regiones productoras (Carl ier et al., 2000b).

1.1.2 DISTRIBUCIÓN DE LA SIGATOKA NEGRA

Su dispersión ocurrió por vez primera en el Sureste de Asia y el Pacífico Sur (Stover, 1980). En febrero de 1963, esta enfermedad se esparcía rápidamente y se predijo que en 1964 todo el Valle Sigatoka, (islas Fiji), estaría cubierto con esta enfermedad (Rhodes, 1964; Leach, 1964 ). Subsecuentemente la enfermedad fue reportada en otros lugares del Pacifico, Asia y en América Latina (Marín et al. , 2003 y Mourichon y Fullerton, 1990). desplazando posteriormente a varios países de Centro América y Sur América (Stover, 1980). Se propagó hacia el norte (Guatemala, Belice) y hacia el sur (el Salvador, Nicaragua, Costa Rica, Panamá, Colombia, Ecuador, Perú, Bolivia). La detección de la enfermedad en el Caribe es más reciente y ocurrió después de 1990 (Jones, 2000): se registró en Venezuela, Cuba, Jamaica, República Dominicana, Brasil y Florida (Mourichon et al. , 1997; Carlier et al., 2000a).

En México, se identificó por primera vez en el área de Tapachula (Chiapas) a finales de 1980 (Contreras, 1983) y oficialmente se reportó afectando las plantaciones comerciales en los estados de Chiapas y Tabasco en 1981 ; hoy en día se localiza en todas las regiones productoras de bananos y plátanos (Fig 1.1) (Orozco-Santos et al. , 2000). La Sigatoka Negra, se detectó en Veracruz y Oaxaca en 1985, en el estado de Colima en 1989 y un año después en los estados vecinos de Michoacán, Jalisco y Guerrero. En 1994, la enfermedad se encontró en el estado de Nayarit. Con este último registro, la enfermedad se encuentra prácticamente en todas las áreas productoras de banano y de plátano en la República Mexicana (Orozco et al., 2001 ).

8 Figura 1.1. Expansión de la Sigatoka negra en México y Centro América (Tomado de Orozco-Santos, 1998).

En América Latina, se detectó por primera vez en 1972 en Honduras, y de ahí se fue

1.1.3 DESARROLLO DE LA ENFERMEDAD DE LA SIGATOKA NEGRA

Se han identificado seis etapas principales en el desarrollo de los síntomas de la enfermedad (Fouré, 1982). • Etapa 1, se caracteriza por una primera fase de pequeños puntos blancuzcos y amarillos en la zona del envés de la hoja y por una segunda fase en la cual los puntos se vuelven de color café. Los puntos miden menos de 1 mm de longitud y no son visibles a través de la hoja. • · Etapa 2, los puntos se expanden y se convierten en bandas angostas y de color café rojizo o café oscuro. Por lo general, estas estrías o bandas miden de 2 - 5 mm y son más visibles en el envés de la hoja. En algunos casos, las estrías llegan a aparecer del lado del haz. El color café cambia a negro en la superficie de la hoja, pero se mantiene café en el envés (Fig 1.2a).

9 • Etapa 3, las estrías pueden alcanzar 20 - 30 mm de longitud. Si las condiciones son favorables y el inóculo es adecuado, las bandas de las etapas dos o tres se unen y causan necrosis. • Etapa 4, las estrías que se mantienen individuales, se engrosan y forman una mancha color café en la parte inferior de la hoja, pero negra en la parte superior (Fig 1.2b) . • Etapa 5, se caracteriza por manchas negras en ambos lados de la hoja. El centro de la mancha comienza a deprimirse y se observa un halo amarillento que rodea la mancha. • Etapa 6, la porción central de las lesiones se seca y cambia de color a un gris blancuzco. La mancha esta comúnmente rodeada por un borde negro bien definido, que a su vez se encuentra rodeado por un halo de color amarillo brillante (Fig 1.2c).

Figura 1.2. Etapas de Desarrollo de los síntomas de la Sigatoka negra; (a) etapas 1 y 2, (b) etapas 3 y 4, (e) etapas 5 y 6 (tomado de Mourichon et al. , 1997).

El clima es un factor muy importante en el comportamiento de la Sigatoka negra. La lluvia, la temperatura, la humedad relativa y el viento son las principales variables climáticas que afectan el desarrollo de la enfermedad (Marín y Romero, 1992). Sin embargo, existen evidencias de que la duración de exposición de las esporas a la radiación ultravioleta del sol es una de las principales limitaciones para la dispersión aérea (Burt, 2002). La lluvia es primordial en la liberación del inóculo, ya que provee las condiciones de humedad que favorecen el progreso de la enfermedad (Marín y Romero, 1992). Las temperaturas favorables para el desarrollo de la Sigatoka fluctúan entre los 22° C y los 28° C, con un óptimo de 26° C. La humedad relativa óptima para la germinación de conidios y ascosporas es de 92 - 100 % y 98 - 100 % respectivamente (Marin y Romero, 1992; Jacome y Schuh, 1992).

1.1.4 TAXONOMÍA DE Mycosphaerella fijiensis

Mycosphaerella fijiensis, en su clasificación más reciente, se ubica taxonómicamente de la siguiente manera de acuerdo al lndex Fungorum (CABI Bioscience: http://www.indexfungorum.org/lndex.htm): Mycosphaerellaceae, Mycosphaerellales, Dothideomycetidae, Ascomycetes, Ascomycota, Fungi. 10 Cabe señalar que Corlett (1995), enlistó más de 2,000 especies pertenecientes al género Mycosphaerella, y recientemente Aptroot (2006) menciona más de 3,000, esto lo hace uno de los géneros más abundantes de ascomicetos conocidos, incluyendo patógenos de plantas y animales.

1.1.5 BIOLOGÍA Y CICLO DE VIDA DE Mycosphaerella fijiensis

El ciclo de vida de M. fijiensis (Fig 1.3), se caracteriza por tener dos estados, el estado perfecto (reproducción sexual) y el imperfecto (reproducción asexual) (Aiexoupoulos y Mims, 1979).

El estado perfecto o telomorfo se caracteriza por la producción de espermagonios, peritecios y ascosporas (Fig 1.4a). Los espermagonios u órganos masculinos son de forma oval o casi globosa, que se forman frecuentemente en la cámara subestomal del estoma; los espermagonios contienen la espermatia hialina. Los peritecios corresponden a las estructuras que más tarde darán origen a las ascosporas. Por lo general las ascosporas son hialinas, globosas, con un septo y una pequeña constri cción en el septo, formando dos células unidas en donde una es ligeramente mas abultada que la otra (Stover, 1969; Meredith y Lawrence, 1969). Los peritecios maduros se encuentran en áreas de color gris blancuzco, en regiones de necrosis de la hoja.

En el estado imperfecto o anamorfo (Paracercospora), se forman los conidios (Fig 1.4b), en estructuras denominadas conidióforos que emergen del estoma individualmente, en grupos, o bien, formando fascículos sobre un estoma. Los conidióforos pueden contener de dos a cuatro conidios, estos presentan una forma recta, cilíndrica, o ligeramente curva, poseen de 1 - 10 septos (comúnmente 5 -7), miden de 30 - 132 ¡Jm de longitud y 2.5 - 5 ¡Jm en su parte más ancha (MOider y Stover, 1976; Carlier et al., 2000a). Asimismo, los conidios se desarrollan primeramente en las pequeñas manchas cafés o en las estrías jóvenes de la superficie inferior de la hoja y continúan produciéndose hasta la etapa 6 de la enfermedad. Los conidióforos emergen en los estomas que se encuentran en el borde de la lesión, aunque la mayoría de ellos son producidos en el envés, muy pocos alcanzan la parte superior (Carlier et al., 2000a).

Las hojas infectadas liberan las esporas que viajan a través del viento y de la lluvia. Los conidios son transportados principalmente por la lluvia y las ascosporas por el aire (Burt, 2002). Estas son depositadas en las hojas y si las condiciones de humedad son elevadas, emiten un tubo germinativo que penetra por los estomas de las hojas para luego ramificarse, colonizar varias células vecinas y producir los síntomas (Marín y Romero, 1992). M. fijiensis es un hongo que inicialmente es biotrófico, pues no daña las células de la planta en forma directa. Se alimenta del apoplasto, lo que ocasiona clorosis y reduce la asimilación de la luz en las plantas de banano y de plátano (Okole y Schultz, 1997).

11 ~• .....~ ;QJ> "117 .::: ,·· PrptopQnlQ~ Esperin agonio · . .rwL(t Lesiones maduras \' · / ·Lesio. nes jó.vimes (manchas) . (pizcas y asirias)

Lesiones en hojas

Figura 1.3. Ciclo de vida de Mycosphaerella fijiensis (Tomado de Manzo­ Sánchez et al., 2005)

a b Figura 1.4. Esporas de Mycosphaerella fijiensis: a: (1) peritecio, (2) aseas, (3) ascosporas; b: (1) estroma, (2) células conidiogenas (3) conidio (Tomado de Pons, 1987).

Sin embargo, mientras la biomasa del hongo va aumentando y demandando más nutrimentos, M. fijiensis se convierte en un organismo necrotrófico, pues induce la 12 muerte celular de las hojas (Buchanan et al., 2000). Por ello, este comportamiento define a M. f¡jiensis como patógeno hemibiotrófico, sin desarrollar haustorios.

Con la finalidad de entender la interacción patógeno-hospedero, se ha desarrollado un sistema de transformación en M. fijiensis, M. musicola y M. eumusae. Se han generado cepas enn las cuales se expresa constitutivamente el gen de la proteína verde fluorescente (GPF) in vitro e in vivo. La transformación es un paso inicial en el desarrollo de herramientas moleculares para la manipulación genética de estos patógenos (Balint-Kurti et al., 2001 ), que conduciría a la identificación de la patogenicidad y factores de virulencia requeridos para la infección de la planta y el desarrollo de los síntomas. Estos y otros estudios son necesarios para profundizar en el conocimiento de estos importantes patógenos, y generar nuevas estrategias de control más eficientes.

1.1.6 GENÉTICA Y GENÓMICA DE Mycosphaerella fijiensis

El conocimiento de la estructura genética y el flujo de genes de poblaciones de hongos patógenos, es de relevancia directa para llevar a cabo procesos de cuarentena y manejo de una enfermedad (McDonald, 1997). Por ello, hoy en día se ha implementado el uso de marcadores moleculares para determinar el nivel de la diversidad genética en poblaciones de hongos fitopatógenos. Algunos se basan en la digestión e hibridación de ADN (RFLP: Restriction Fragment Length Polymorphism:), en la amplificación del ADN con iniciadores al azar (RAPO: Randomly amplified polymorphic DNA) o iniciadores específicos como los polimorfismos de la longitud de fragmentos amplificados (AFLP: Amplified Fragment Length Polymorphism) y microsatélites (SSR: Simple Sequence Repeats), entre otros.

Las técnicas moleculares han sido una herramienta indispensable en el estudio de Mycosphaerella spp. Un ejemplo es el diagnótico de M. fijiensis y M. musicola presentes en hojas infectadas de plátano, utilizando como técnica la reacción en cadena de la polimerasa (PCR) que amplifica la región del espacio interno transcrito (ITS) del ADN ribosomal (ADNr) (Johanson y Jeger, 1993).

Los RFLPs han perm itido determinar la gran diversidad genética que existe entre las poblaciones de M. fijiensis y M. musicola de diferentes regiones geográficas (Sudeste Asiático, Islas del Pacífico, África y América Latina). Los niveles más altos de diversidad genética se hallaron en las dos poblaciones del Sudeste Asiático (Carlier et al., 1994), lo que concuerda con la hipótesis de que esta región es el centro de origen de M. fijiensis (Stover, 1978).

En otro estudio llevado acabo en poblaciones representativas de alrededor del mundo, se identificó un desequilibrio gamético en las poblaciones analizadas, indicando que existe una reproducción sexual al azar, así como un alto nivel de diversidad alélica; también se determinó que la migración natural de M. fijiensis entre continentes es muy poco probable (Carlier et al. , 1996). En un trabajo similar se evaluó el nivel de diversidad genética de poblaciones de Australia, Papua Nueva Guinea y de las Islas del Pacifico y se encontró un nivel de variación genética moderado en todas las poblaciones y que cada una tuvo eventos fundadores separados (Hayden et al., 2003). 13 También se han utilizado microsatélites (SSR) para el análisis de poblaciones de M. fijiensis. El análisis de poblaciones procedentes de México y Nigeria, las cuales permitieron determinar que la diversidad alélica dentro de cada región fue comparativamente baja y que es poco probable que exista la migración a través de esporas (conidios o ascosporas) de los hongos entre estos continente3 (Neu et al., 1999). Por otra parte, Müller y colaboradores (1997), utilizaron microsatélites para determinar la diversidad genética a escalas macro y microgeográficas entre una lesión, entre lesiones de una planta, entre plantas, entre diferentes cultivares y entre distintas localidades geográficas, demostrando que el estado sexual del hongo heterotálico representa una fuente importante de variación genética. De igual forma, aislados de 13 países en América Latina, el Caribe y África fueron analizados usando PCR-RFLP previamente desarrollados y también SSR; ~ os resultados indicaron que existe un alto nivel de diversidad genética dentro de una plantación, así como también dentro de la una planta (Rivas et al. , 2003).

Además, se han desarrollado nuevos marcadores modificados con la finalidad de hacer análisis poblacionales mas finos y específicos (Palacios et al., 2002; Malina y Kahl, 2004). Palacios y colaboradores (2002) mejoraron la técnica de la amplificación selectiva de loci de microsatélites polimórficos (SAMPL), detectando polimorfismo entre individuos de una población segregante de M. fijiensis de padres tolerantes al fungicida propiconazol.

Por otra parte, en nuestro laboratorio se obtuvo recientementeel cariotipo molecular de M. fijiensis por medio de electroforesis de campo pulsante (Conde, 2001; Conde­ Ferráez, 2002). También se llevó a cabo la construcción de una biblioteca genómica BAC (Guillén Maldonado, 2003) y se encuentra en proceso el desarrollo de un mapa genético utilizando marcadores tipo AFLP (Manzo et al., en preparación).

Ante la necesidad de obtener más conocimientos acerca de este patógeno, recientemente se ha conformado el consorcio sobre la genómica de Mycosphaerella ("Mycosphaerel/a genomics consortium"), formado por investigadores de varios países involucrados en estudios moleculares del hongo, incluyendo aquellos que también trabajan con M. graminicola (México, Francia, Holanda, Brasil, Colombia, Australia, Suiza y Estados Unidos). El consorcio tiene el objetivo de implementar herramientas de biología molecular para obtener el primer mapa genético y físico de M. fijiensis, construir bibliotecas tipo BAC y obtener ADNc, EST y microarreglos de la interacción Musa-M. fijiensis.

Se ha sugerido que dentro el género Mycosphaerella, M. graminicola, patógeno del trigo y en M. fijiensis, patógeno de los bananos y plátanos, podrían ser modelos dentro del grupo de los Dotideomicetides por ser miembros de un género tan extenso e importante de hoílgos patógenos, dentro del cual no se tiene actualmente ninguna especie modelo (Goodwin et al. , 2004).

14 1.2 Antecedentes parte 2: Ellocus MAT {mating-type) dede los ascomicetos: su evolución, estructura y regulación.

Esta sección se encuentra en prensa en la Revista Iberoamericana de Micología (Conde Ferráez, L. 2007. El /ocus MAT (mating-type) dede los ascomicetos: su evolución, estructura y regulación. Rev. lberoamer. Mico/. 24(2): en prensa).

1.2.1 INTRODUCCION

La reproducción sexual de los hongos se lleva a cabo por la fusión de núcleos sexualmente compatibles para la posterior producción de esporas recombinantes. La compatibilidad reproductiva está determinada por un sitio particular del genoma denominado locus MAT, el cual determina el tipo de apareamiento o "mating type", término usado para diferenciar entre individuos que son sexualmente compatibles. Aunque los hongos, con pocas excepciones, son hermafroditas, existen especies autocompatibles (homotálicas) y autoincompatibles (heterotálicas). En la mayoría de los ascomicetes, existe un solo locus del tipo de apareamiento, con dos formas alternativas, por lo que el apareamiento es bipolar; pero en el caso de los basidiomicetes, existen tanto el sistema bipolar como el tetrapolar (con cuatro factores determinantes). En este caso, el número de tipos de apareamiento dependen de si éstos están determinados por dos loci con dos o más alelas, o por varios loci con cientos de alelas que resultan en varios miles de tipos de apareamiento (Souza et al., 2003). Además del heterotalismo, en los ascomicetes filamentosos podemos encontrar otras estrategias reproductivas. Muchas especies son homotálicas, capaces de autofecundarse y completar su ciclo de vida sexual sin necesidad de otra línea para aparearse. En las levaduras, que son básicamente heterotálicas, se logra un sistema homotálico por medio del cambio de tipo de apareamiento. Algunas especies como Podospora anserina y Neurospora tetrasperma son pseudohomotálicas (Raju y Perkins, 1994). Esto quiere decir que poseen ascosporas con dos núcleos de "mating type" opuesto, :por lo que los aislados monoascospóricos son autofértiles.

1.2.2 LOS GENES DEL LOCUS MAT

Los /oci MA T se definen genéticamente por la segregación en la progenie de elementos que controlan el desarrollo y la producción de esporas sexuales (Tugeon, 1998). A las secuencias que se encuentran dentro del locus MA T. se les denomina idiomorfos y no alelas, por tratarse de secuencias muy diferentes que, sin embargo, ocupan el mismo locus en el genoma (Coppin et al., 1997, Souza et al., 2003, Turgeon, 1998). Los genes del /ocus MA T poseen ciertas regiones conservadas entre 15 especies distantes, que se denominan caja HMG (en el idiomorfo MA T1-2 también llamado MAT-2) y caja alfa (en el idiomorfo MAT1-1 también llamado MAT-1 Fig 1.5); éstas son motivos de unión al ADN, lo cual es congruente con sus funciones, ya que en general los genes mat codifican para factores de transcripción, (Coppin et al., 1997, Souza et al., 2003, Turgeon, 1998).

El modelo más conocido para el estudio de los genes mat, es la levadura Saccharomyces cerevisiae, en la cual las secuencias presentes en el locus MAT definen las células haploides como "a" ó "a". Los procesos del apareamiento se desencadenan después de la unión de las feromonas producidas por un haploide a los receptores de membrana del haploide del "mating type" opuesto; a esto le sigue la transducción de la señal al interior de la célula que involucra a una serie de Map­ kinasas (Souza et al. , 2003). Los ascomicetes filamentosos mejor estudiados en cuanto al tipo de apareamiento son probablemente Neurospora crassa y P. anserina. En N. crassa se presentan dos formas alternativas denominadas MatA y Mata (Giass et al., 1988, 1990), mientras que en P. anserina se denominan mat+ y mat- (Fig 1.5).

1.2.3 EVO-LUCIÓN DEL LOCUS MAT

No se sabe como las secuencias tan diferentes de los idiomorfos llegaron a ocupar el mismo sitio en el genoma, aunque se cree que alguna vez fueron secuencias idénticas pero que divergieron a través de sucesivos rearreglos y deleciones/inserciones (Turgeon, 1998). También se ha sugerido que las pequeñas "islas de identidad" que se pueden encontrar entre ellosellos son remanentes que indican su origen común (Coppin et al., 1997).

El estudio de la estructura del locus ha ayudado a dilucidar aspectos de la evolución de las especies heterotálicas y homotálicas.Los datos moleculares han demostrado que el modelo de evolución de laslas levaduras, en las cuales el ancestro sería homotálico, es inapropiado para explicar el homotalismo en los ascomicetes filamentosos y no va de acuerdo a la genética de poblaciones; por lo tanto, el ancestro debiera ser heterotálico (Coppin et al., 1997). Esta hipótesis ha sido sustentada experimentalmente en especies del género Cochliobolus, en las que el análisis de secuencias reveló que un evento de recombinación desigual en los losprogenitores heterotálicos pudo dar origen a una fusión de los idiomorfos (Yun et al., 1999). De igual forma, los análisis filogenéticos apoyan el origen monofilético y apomórfico (derivado) del homotalismo dentro del ciado de Fusarium graminearum (O'Donnell et al., 2004). Sin embargo, estos hallazgos difieren con lo observado en Neurospora, en donde el heterotalismo parece ser la condición apomórfica (Poggeler et al., 1999), al igual que en Aspergillus y Neosartorya (Geisser et al., 1998). Los datos obtenidos a partir de la comparación de los genomas de Aspergillus nidulans, A. fumigatus y A. oryzae, apoyan la hipótesis acerca de la evolución de los estilos reproductivos homotálico, heterotálico y asexual en el género Aspergillus, sugiriendo que la capacidad de reproducirse sexualmente se haya perdido recientemente en los dos últimos debido a una pérdida de genes del ancestro homotálico, o que aún podrían ser capaces de llevarla a cabo como especies heterotálicas (Galagan et al., 2005). 16 Al estudiar a N. tetrasperma se concluyó que el cromosoma en donde se localiza el locus MA T evoluciona de manera diferente a los demás; la progenie obtenida por autofertilización presenta baja variabilidad en todos sus cromosomas excepto en las secuencias del cromosoma donde se encuentra el locus MA T, lo cual sugiere una historia evolutiva distinta (Merino et al., 1996). Los análisis de las secuencias de los genes mat del género Coch/íobolus y hongos relacionados han revelado que estos genes parecen evolucionar más rápidamente que otras secuencias en el genoma dado que la variación entre especies es alta. Sin embargo, la variación intraespecífica es baja por lo que los genes mat podrían ser útiles para determinar el concepto de especie biológica y especie filogénetica, en hongos con cruzamientos interespecíficos (Turgeon, 1998).

Aunque se ha hipotetizado que los genes mat tienen potencial de delimitar las fronteras entre especies (Yun et al., 2000), se han hecho pocos estudios profundos al respecto. Al comparar los datos obtenidos con el ITS del ADN ribosomal, Barve y colaboradores (2003) demostraron la mayor utilidad de la caja HMG para construir la filogenia de especies de Ascochyta, dado que las secuencias de los ITS presentaron insuficiente variabilidad para diferenciar los aislados, mientras que las secuencias de la región HMG del idiomorfo MAT1-2 fueron substancialmente más variables. De igual forma, Du y colaboradores (2005) demostraron que las secuencias de la caja HMG de MAT1 -2 permitieron definir la filogenia dentro del género Col/etotrichum de manera equivalente o superior a utilizando secuencias de los ITS, permitiendo la diferenciación de especies dentro de este grupo. Finalmente Yokoyama y colaboradores (Yokoyama et al. , 2003) demostraron que las secuencias de MAT1-1 y MAT1-2 permitieron reconstruir la filogenia dentro de la familia Clavicipitaceae con una mejor resolución que las secuencias del ARNr 18S.

1.2.4 ESTRUCTURA DEL CONTEXTO GENÓMICO DEL LOCUS MAT

El estudio de la sintenia, es decir, la conservación parcial del orden y secuencia de los genes alrededor del locus MA T, desde las levaduras hasta los hongos filamentosos que divergieron hace millones de años, ha contribuido al conocimiento de sus relaciones evolutivas. Se ha reportado un extraord.inario nivel de sintenia en la región del locus MA T entre hongos distantemente relacionados, como A. nidulans, Magnaporthe grisea, N. crassa y Fusarium (Waalwijk et al. , 2004). En levaduras, Saccharomyces castellii, S. cerevisae, Gandida glabrata y Kluyveromyces delphensis, ellocus MA Testa flanqueado por los genes BUD5 y HO endonucleasa (requerida para el cambio de tipo de apareamiento); mientras que en otras levaduras como Saccharomyces kluyveri, Kluyveromyces lactis, Pichia angusta y Yarrowia /ípolytica el locus MAT se encuentra junto al gen sla2, involucrado en el ensamblaje del citoesqueleto (Butler et al., 2004). Es interesante notar que este último gen también se encuentra en las inmediaciones del locus MATen ascomicetes filamentosos como N. crassa (GenBank AABX01000036) y varias especies de Fusarium (Waalwijk et al. , 2004). También flanquean al idiomorfo, el gen de la DNA liasa y el de APC (complejo promotor de la anafase) en Mycosphaerel/a graminicola (Waalwijk et al., 2002) y en 17 Leptosphaeria maculans también se encontró un homólogo de la DNA liasa en la misma ubicación (Cozijnsen y Howlett, 2003). Se ha propuesto que la conservación del orden de los genes en la región vecina allocus MA T se debe a la presencia de los idiomorfos: la recombinación es muy limitada en este punto por la presencia de secuencias tan distintas entre sí, lo cual lleva a que se conserven el orden y secuencia de los genes flanqueantes (Waalwijk et al., 2004). De manera similar, en los cromosomas sexuales (X) de los mamíferos, se observa alto grado de sintenia debido a este fenómeno (Fraser et al., 2004a); este hecho junto con rearreglos, deleciones y translocaciones que ocurrieron en las regiones determinantes del sexo, han dado origen a la estructura de los cromosomas actuales. Estos estudios sugieren que la estructura de la región del locus MA T de los hongos podría representar una etapa temprana en la evolución de los cromosomas sexuales (Fraser et al. , 2004b).

a Neurospora crassa (heterotálico) A mata-1 mata-2 matA -3 matA-2 matA -1 ~ < ~

mat+ Podospora anserina {heterotálico) mat- FPR1 SMR2 -SMR1 FMR1 ~ < ~

MAT-2 Coch/iobolus heterostrophus {heterotálico) MAT-1 mat1-2 mat1-1

MAT-2 Aspergillus fumígatus (asexual*) MAT-1 mat1-2 mat1-1 ~

Pleospora sedícola (homotálico)

mat-1 mat-2 ~ ~

Figura 1.5. Comparación del locus MATen cinco especies de hongos. A la izquierda se presenta un tipo de apareamiento y el opuesto a la derecha, para cada especie. Las flechas indican la dirección de la transcripción de los genes, los rayados codifican proteínas con la caja HMG, los cuadriculados proteínas con la caja Alfa. P. sedicola es un hongo homotálico en el que ambos idiomorfos se presentan dentro del locus MA T. * A. fumigatus es considerado anamórfico, aunque evidencia reciente sugiere la posibilidad de reproducción sexual (ver texto). Esquema basado y modificado de Coppin et al. , (1997), Paoletti et al. , (2005) e lnderbitzin et al., (2005).

18 1.2.5 REGULACIÓN DE LA EXPRESIÓN DE LOS GENES MAT

Los análisis moleculares de los idiomorfos MAT de los ascomicetes filamentosos comenzaron en 1988 con la clonación de las llamadas regiones "A" y "a" de N. crassa (Giass et al., 1988) (Fig 1.5). Además, los sistemas de apareamiento de las levaduras S. cerevisae y Schizosaccharomyces pombe han sido analizados y han servido para proponer modelos de regulación (Ciark y Sprange, 1989; Nielsen y Davey, 1995). En ambos, ellocus MA T codifica factores de transcripción que controlan la producción de feromonas y sus receptores de membrana respectivos.

La información disponible acerca de la regulación de la expresión de los genes de este locus es poco consistente. Por ser genes cuyos productos son factores de transcripción o proteínas regulatorias de otros genes, es de esperarse que su expresión basal sea mínima o nula. Sin embargo, en N. crassa (Ferreira et al., 1996) y Cordyceps takaomontana (Yokoyama et al., 2003) y L. maculans (Cozijnsen et al. , 2003) se ha observado que se expresan en el micelio vegetativo. Por el contrario, la constitución del medio de cultivo es determinante en la expresión en otros hongos. Por ejemplo, en cultivos de Cochliobolus heterosptrophus crecidos en medio enriquecido no se encuentran transcritos de los genes mat, y por el contrario, estos son abundantes al crecer el hongo en medio mínimo, aun en ausencia del tipo de apareamiento opuesto (Leubner-Metzger, 1997). Por el contrario, los transcritos de los genes mat de L. maculans (Cozijnsen et al., 2003) se detectaron tanto en medio completo como en medio mínimo, lo cual sugiere que en éste último, la expresión de estos genes no es dependiente de la fuente de carbono o nitrógeno.

En P. anserina, se han caracterizado los genes FPR1 (del tipo mat+), y los genes FMR1 , SMR1 , SMR2 (del tipo mat-) (Fig 1.5). Coppin y Debuchy (2000) demostraron que FMR1 y FPR1 se expresan en el micelio vegetativo y en los peritecios, mientras que SMR1 y SMR2 se transcriben sólo en los peritecios. Se descubrió por medio de líneas trangénicas que la expresión simultánea de FPR1 y SMR2, y la sobreexpresión de FMR1 son letales. Sin embargo, la expresión de SMR1 suprimió esta letalidad, sugiriendo que este último gen tiene un efecto regulatorio postranscripcional sobre los otros genes MA T.

Haciendo un estudio comparativo entre Sordaria macrospora y N. crassa se observó que los dos genes del "mating type" a (mata-1 y mata-2, Fig 1.5) son cotranscritos, y por lo tanto, estarían regulados por el mismo promotor, y que podrían tener "splicing" alternativo (Poggeler et al., 2000). Los resultados de Ferreira et al. (1998) indican que mat A-1 y mat a-1 son los factores críticos para el apareamiento y desarrollo sexual en N. crassa, mientras que mat A-2 y mat A-3 (Fig 1.5), aumentan la eficiencia del proceso, pero no son indispensables para la producción de ascosporas. Los homólogos de mat A-2 y mat A-3 en otros ascomicetes no son funcionales o se encuentran ausentes.

En L. maculans y C. heterostrophus (Cozijnsen y Howlett, 2003; Wirsel et al., 1998), los trascritos de los genes MA T incluyen una región de 3 kb corriente abajo, que en el 19 segundo resultaron ser cruciales para la producción de ascosporas.Un hallazgo que podría ser significativo, es que en C. heterostrophus el gen MA T1-1 presenta transcritos de diferentes tamaños, mientras que MAT1-2 solamente uno, lo cual sugiere diferentes niveles en la regulación postranscripcional (Leubner-Metzger et al., 1997).

1.2.6 LOS GENES MATEN HONGOS ANAMÓRFICOS

De la totalidad de los hongos conocidos, un gran número de ellos se considera que únicamente llevan a cabo la reproducción asexual. Sin embargo, la pregunta obligada es si son realmente asexuales o si llevan a cabo la reproducción sexual de manera infrecuente o inconspicua, y por lo tanto el telomorfo no ha podido ser observado. En este caso se encuentran hongos de importancia agrícola y médica, en los que el aislamiento de los genes mat ha ayudado a ir contestando estas preguntas. Rhynchosporium seca/is, patógeno de la cebada, es un deuteromicete del cual se tiene evidencia circunstancial de la existencia de su telomorfo, pero éste no ha sido aislado. Sin embargo, el estudio de los genes (Foster y Fitt, 2004 ), junto con estudios de genética de poblaciones han dado evidencia de la existencia de un estadio sexual en esta especie.

Fusarium es un género al que pertenecen fitopatógenos y productores de toxinas peligrosas para los animales y el ser humano; éste género incluye hongos tanto anamórficos como telomórficos. Los genes mat se encuentran presentes en especies de Fusarium consideradas como asexuales, e incluso son funcionales (Kerényi et al., 2004), siendo consistente con la hipótesis de que su fase sexual debe ser críptica o rara en la naturaleza, y por ello no ha sido observada.

En algunos casos, las poblaciones no llevan a cabo la reproducción sexual por la ausencia de uno de los "mating types" como en ciertas poblaciones de Tapesia yal/undae (Douhan et a/. , 2002a, 2002b) y Tapesia acuformis (Douhan et a/., 2002a), de las cuales, aunque no se ha reportado la presencia de cuerpos fructíferos, se sabe que sí son capaces de reproducirse sexualmente en condiciones propicias.

Un caso particular es el de Cryptococcus neoformans, que a pesar de ser un basidiomiceto, presenta un sistema de apareamiento que se asemeja al de los ascomicetes, ya que es bipolar con dos formas alternativas MATa y MATa (Lengeler et al. , 2002). Hasta algunos años atrás todos los aislados del serotipo A (responsable de la mayoría de las criptococosis) analizados fueron identificados como de tipo MATa, hasta que se encontraron aislados del tipo MATa que se creía extinto (Lengeler et al. , 2000). De manera excepcional, recientemente se ha descrito en esta especie la posibilidad de llevarse a cabo la reproducción sexual entre individuos del mismo tipo de apareamiento (MATa) (Lin et al., 2005), siendo quizás una estrategia de estas poblaciones de superar la limitada distribución de los individuos del tipo de apareamiento opuesto (MATa).

A partir de la secuenciación del genoma de Gandida albicans (www­ sequence.stanford.edu/group/candida), se descubrieron muchos genes homólogos a 20 los de S. cerevisiae, entre ellos los genes mat y se les denominó MTL (mating-type­ like). Esta levadura oportunista, de gran importancia médica, fue considerada hasta entonces como asexual, pero posteriormente se reportaron cruzamientos in vitro (Magee y Magee, 2000) y en un hospedero mamífero (Hull et al. , 2000). Evidencias de la reproducción sexual en C. albicans las revisan más profundamente Bennet y Johnson (2005. Adicionalmente, se descubrió que muchos de los genes que en S. cerevisiae están involucrados en el proceso del apareamiento y reproducción, se encuentran en el genoma de C. albicans, así como en el de C. glabrata (Wong et al., 2003). Estos incluyen los genes responsables de la respuesta a las feromonas y la producción y secreción de las mismas, y otros involucrados en procesos meióticos. La posibilidad de reproducción sexual de C. albicans en la naturaleza fue estudiada por medio de análisis de haplotipos, encontrándose evidencia de recombinación {Tavanti et al. , 2004). Por lo tanto, la reproducción sexual estaría ocurriendo en la naturaleza, y sería suficiente para aumentar la variabilidad genética de estos patógenos, aunque la reproducción clona! es mucho más común.

El caso de C. albicans es en particular interesante, ya que la identidad sexual está influenciada por factores ambientales: la expresión de los genes MTL depende de los niveles de expresión del gen Hbr1 , el cual responde a la cantidad de hemoglobina del hospedero (Pendrak et al., 2003).

Otro caso importante es el patógeno A. fumigatus, del cual recientemente se aislaron los genes mat (Paoletti et al., 2005) y del cual se han obtenido diferentes evidencias de una posible reproducción sexual (Dyer y Paoletti, 2005): 1) estudios de genética de poblaciones (Debeaupuis et al., 1997), en los que se encontró alta variabilidad; 2) evidencias de estudios genómicos (Halagan et al. , 2005), en los que se han encontrado los genes necesarios para llevar a cabo la reproducción sexual; y 3) evidencia taxonómica, ya que el telomorfo del género Neosartorya es muy relacionado a A. fumigatus e incluso se ha conseguido obtener cleistotecios abortivos al cruzar A. fumigatus con Neosartorya fennelliae (Varga, 2003), lo cual es un indicativo de su cercanía filogenética.

Finalmente, en casos como el de Alternaría altemata y Fusarium oxysporum, en los que se ha comprobado la funcionalidad de los genes del locus MAT por expresión heteróloga, la ausencia de la reproducción sexual podría deberse a la falta de otros factores necesarios para este fin (Arie et al. , 2000; Y un et a/.,2000; Poggeler, 2001 ). En la actualidad, los análisis de genómica comparativa pueden permitir obtener esta información para especies relacionadas y por ejemplo, otros géneros considerados asexuales.

1.2.7 CONSIDERACIONES FINALES

Los genes MAT han demostrado ser una valiosa herramienta para el estudio de la biología y genética de poblaciones de los hongos y prometen ser útiles marcadores para análisis filogenéticos. Además, son herramientas para el estudio de los mecanismos de interacción entre células y fertilidad entre especies fúngicas. En el caso de hongos de importancia médica y agronómica, con evidencias que sugieren 21 posible reproducción sexual, es un hecho que los genes MA T tendrían una enorme repercusión en su genética poblacional. El estudio de la frecuencia y distribución de los genes MA T en poblaciones naturales nos indica qué tanto se está llevando la reproducción sexual respecto a la reproducción asexual en dichas poblaciones. Dada la segregación mendeliana de los idiomorfos, se esperaría encontrar una relación de tipos de apareamiento de 1:1 en poblaciones que se reproducen sexualmente de manera frecuente. Este conocimiento es valioso en el manejo adecuado de las poblaciones y para el estudio y combate de las enfermedades que provocan los patógenos fúngicos.

1.3 REFERENCIAS

• Alexoupoulos, C.J ., Mims, C.W. 1979. lntroductory Mycology. 3rd edition, John Wiley and Sons, New York, USA • Aptroot, A. 2006. Mycosphaerella and its anamorphs: 2. Conspectus of Mycosphaerella. CBS Biodiv. Ser. 5, 231 pp. Centraalbureau voor Schimmelcultures. Utrech, The Netherlands • Arie, T., Kaneko, 1. , Yoshida, T., Noguchi, M., Nomura, Y., Yamaguchi, l. 2000. Mating type genes from asexual phytopathogenic ascomycetes Fusarium oxysporíum and Alternaría alternata. Mol Plant Micro be lnteract; 13:1330- 1339. • Balint-Kurti, P.J., May, G.D., Churchill, A.C .L. 2001 . Development of a transformation system for Mycosphaerella pathogens of banana: a tool for the study of hosUpathogen interactions. FEMS Microbiology Letters. 195:9- 15. • Barve, M.P. , Arie, T. , Salimath, S.S., Muehlbauer, F.J ., Peever, T.L. 2003. Cloning and characterization of the mating type (MA T) locus from Ascochyta rabíeí (teleomorph: Didymella rabíe1) and MA T phylogeny of legume associated Ascochyta spp. Fungal Genet Biol; 39: 151-167. • Bennet, R.J ., Johnson, A.D. 2005. Mating in Gandida albicans and the search for a sexual cycle. Annu Rev Microbio! ; 59:233-255 • Buchanan B.B., Gruissem W ., Jones R.L. 2000. Biochemistry and molecular biology of plants. American society of plant physiologists. USA. 1367 p. • Burt P.J.A. 2002. Airborne dispersa! of Mycosphaerella fijíensís. Mycosphaerella leaf spot diseases of bananas: present status and outlook. Proceedings of the 2"d lnternational workshop on Mycosphaerel/a leaf spot diseases held in San José, Costa Rica, 20- 23 May 2002. L. Jacome, P. Lepoivre, D. Marin, R. . , · ~~.§,~~~~~=¡;g itors . ~ ~ . 1. pp. - -- . • Carlier, J., Fouré, E. , Gauhl, F., Jones, D.R. , Lepoivre, P., Mourichon, X, Pasberg­ Gauhl, C. , Romero, R.A. 2000a. Fungal diseases of the foliage en: Disease of banana, abacá and enset. Ed . D.R. Jones. CABI Publishing. 37-79. • Carlier, J., Lebrun, M.H. , Zapater, M. Dubois, C. , Mourichon, X. 1996. Genetic structure of the global population of banana black leaf streak fungus, Mycosphaerel/a fijiensis. Molecular Ecology 5:499-510. • Carlier, J. , Zapater, M.F., Lapeyre, F., Jones, D.R., Mourichon, X. 2000b. Septoria leaf spot of banana: a newly discovered disease caused by Mycosphaerella eumusae (anamorph Septoria eumusae). Phytopatology 90 :884-890. • Clark, K.L., Sprague, G.F. Jr. 1989. Yeast pheromone response pathway: characterization of a suppressor that restores mating to receptorless mutants. Mol Cell Biol; 9:2682-2694 • Conde-Ferráez, L. Rodríguez, M. Peraza, L. James, A. 2002. An electrophorectic karyotype for Mycosphaerella fijiensis. Mycosphaerella leaf spot diseases of bananas: present status and outlook. Proceedings of the 2"d lnternational workshop on Mycosphaerel/a leaf spot diseases held in San José, Costa Rica, 20 - 23 May 2002. L. Jacome, P. Lepoivre, D. Marin, R. Ortiz, R. Romero and J.V." Escalant, Editors. 141 pp. • Conde Ferráez, L. , 2001 . Obtención del cariotipo molecular y tamaño genómico de Mycosphaerel/a fijiensis. Tesis de licenciatura. Universidad Autónoma de Yucatán, Facultad de Medicina Veterinaria y Zootecnia. Mérida, Yucatán, México.

1 • Contreras, M.E.M. 1983. El chamusco negro (Sigatoka): una nueva enfermedad de la hoja de plátanos. Universidad Autónoma de Chapingo. México. Revista de Geografía Agrícola 4:61-102. • Coppin, E. , Debuchy, R. 2000. Co-expression of the mating type genes involved in internuclear recognition is lethal in Podospora anserina. Genetics; 155: 657- 669. • Coppin, E. , Debuchy, R. , Arnaise, S., Picard, M. 1997. Mating types and sexual development in filamentous ascomycetes. Microbio! Mol Biol Rev; 61:411- 428 • Corlett, M. 1995. An Annotated list of the published names in Mycosphaerel/a and Sphaerella: Corrections and additions. Mycotaxon 53:37 - 56 • Cozijnsen, A.J., Howlett, B.J. 2003. Characterisation of the mating type locus of the plant pathogenic ascomycete Leptosphaeria maculans. Curr Genet; 43: 351- 357. • Crous, P.W. , Mourichon, X. 2002. Mycosphaerel/a eumusae and its anamorph Pseudocercospora eumusae spp. Nov.: causal agent of eumusae leaf spot disease. Sydovia 54:35-43. • Debeaupuis, J.P., Sarfati, J., Chazalet, V., Latgé, J.P. 1997. Genetic diversity among clinical and environmental isolates of Aspergil/us fumigatus. lnfect lmmunity; 65:3080-3085. • Douhan, G.W., Murray, T.D., Dyer, P.S. 2002a. Species and Mating-type distribution of Tapesia yallundae and T. acuformis and occurrence of apothecia in the U.S. Pacific Northwest. Phytopathol; 92:703-709.

23 • Douhan, G.W., Peever, T.L., Murray, T.D. 2002b. Multilocus population structure of · Tapesia ya/lundae in Washington State. Mol Ecol; 11 :2229-2239. • Du, M., Schardall , C.L., Nuckles, E.M ., Vaillancourt, L.J. 2005. Using mating-type sequences for improved resolution of Colletotrichum species complexes. Mycologia; 97:641-658. • Dyer, P.S. , Paoletti, M. 2005. Reproduction in Aspergillus fumigatus: sexuality in a supposedly asexual species? Med Mycol; 43 : S7-S14 • Ferreira, A.V.B. , An , Z., Metzenberg, R.L., Glass, N.L. 1998. Characterization of mat A-2, mat A-3 and ~ matA Mating-Type Mutants of Neurospora crassa. Genetics; 148: 1069-1079 • Ferreira, A.V.B., Saupe, S.N., Glass, L. 1996. Transcriptional analysis of the mtA idiomorph of Neurospora crassa identifies two genes in addition to mtA-1 . Mol Gen Genet; 250: 767-77 • Foster, S.J., Fitt, B.D. 2004. lsolation and characterisation of the mating-type (MA T) locus from Rhynchosporium secalis. Curr Genet; 44: 277-286. • Fouré, E. 1982. Etude de la sensibilité variétale des bananiers et plantains a Mycosphaere/la fijiensis au Gabon (Y). Fruits 37:759-770. • Fraser, J.A. , Diezmann, S. , Subaran. R.L. , Allen, A., Lengeler, K.B. , Dietrich, F.S. , Heitman, J. 2004a. Convergent evolution of chromosomal sex-determining reg ions in the animal and fungal kingdoms. PLOS Biol; 2: 2243-2255. • Fraser, J.A., Heitman, J. 2004b. Evolution of fungal sex chromosomes. Mol Microbio!; 51 : 299-306. • Galagan, J.E. , Calvo, S.E. , Cuomo, C. , Ma, L-J ., Wortman, J.R., et al., 2005. Sequencing of Aspergillus nidulans and comparative analysis with A. fumigatus andA. oryzae. Nature; 438:1105-1115. • Geisser, D.M. , Frisvad, J.C., Taylor, J.W. 1998. Evolutionary relationships in Aspergillus section Fumigati inferred from partial hydrophobin and beta­ tubulin DNA sequences. Mycologia; 90:831-845. • Glass, N.L., Grotelueschen, J., Metzenberg, R. L. 1990. Neurospora crassa A mating type region . Proc Natl Acad Sci USA; 87:4912-4916. • Glass, N.L., Vollmer C, Staben C, Grotelueschen J, Metzenberg RL, Yanofsky C. 1988. DNAs of the two mating types alleles of Neurospora crassa are highly dissimilar. Science; 241 : 570-573. • Hayden, H.L., Carlier, J. , Aitken, E.A.B. 2003. Genetic structure of Mycosphaerella fijiensis populations from Australia, Papua New Guinea ant the Pacific lslands. Plant Pathology 52:703-712. • Herrera, T., Ulloa M. , 1990. El Reino de los hongos, Micología básica y aplicada. Universidad Nacional Autónoma de México. Fondo de Cultura Económica. Segunda Edición . México D.F. 36-49, 281 . • Hull, C.M. , Raisner, RM., Jonson, A. D. 2000. Evidence for mating of the "asexual" yeast Gandida albicans in mammalian host. Science; 289: 307-310. • lnderbitzin, P. , Harkness, J., Turgeon, B.G ., Berbee, M. 2005. Lateral transfer of mating system in Stemphylium. Proc Natl Acad Sci USA; 102:11390- 11395.Kerényi Z, Moretti A, Waalwijk C, Oláh B, Hornok L. 2004. Mating type sequences in asexually reproducing Fusarium species. Appl Enviran Microbio!; 70:4419-4423.

24 • Jacome, L.H ., Schuh, W. 1992. Effects of Leaf Wetness Duration and Temperature on Development of Black Sigatoka Disease on Banana lnfected by Mycosphaerella fijiensis var. difformis. • Johanson, A. , Jeger M.J . 1993. Use of PCR for detection of Mycosphaerella fljiensis and M. musico/a, the causal agents of sigatoka leaf spots in banana and plantain. Mycological Research 97:670-674. • Jones, D.R. 2000. lntroduction to Banana, Abacá and Ensete. In : Diseases of Banana, Abacá and Ensete. CABI Publishing. London, U.K. Edited by D.R. Jones. 7 - 9 pp ." • Leach, R. 1964. Report on lnvestigations into Cause and Control of the New Banana Diseases in Fij i, Black Leaf Streak. Council Papers Fiji 38, Suv~ . • Lengeler, K.B., Fax, D.S., Fraser, J.A., Allen, A. , Forrester, K. , Dietrich, F.S., Heitman, J. 2002. Mating type locus of Cryptococcus neoformans: a step in the evolution of sex chromosomes. Eukaryotic Cell; 1:704-718. • Lengeler, K.B., Wang, P., Cox, G.M., Perfect, J.R., Heitman, J. 2000. Mating type locus of Cryptococcus neoformans: a step in the evolution of sex chromosomes. Proc Natl Acad Sci USA; 97:14455-14460. • Leubner-Metzger, G., Horwitz, B.A., Yoder, O.C, Turgeon, B.G. 1997. Transcripts at the mating type locus of Cochliobolus heterostrophus. Mol Gen Genet; 256:661-673. • Lin , X. , Hull, C. M. , Heitman, J. 2005. Sexual reproduction between partners of the same mating type in Cryptococcus neoformans. Nature; 434: 1017-1021 . • Magee, B.B., Magee, P.T. 2000. lnduction of Mating in Gandida a/bicans by construction of MTLa and MTLa strains. Science; 289: 310-313. • Manzo-Sánchez, G., Guzmán-González, S. , Rodríguez-García, C.M., James, A. , Orozco-Santos, M. 2005. Biología de Mycosphaerel/a fijiensis Morelet y su interacción con Musa spp. Revista Mexicana de Fitopatología 23(1):122- 131 . • Marin, V.D., Romero C.R. , 1992. El combate de la Sigatoka negra. Divulgación Científica al servicio del productor Bananero Nacional. 104-129. • McDonald, B.A. 1997. The population genetics of fungi: tools and techniques. Phytopathology 87:448-453. • Meredith, D.S., Lawerence, J.S. 1969. Black leaf streak disease of bananas (Mycosphaerel/a fijiensis): symptoms of disease in Hawaii, and notes on the conidial state of the causal fungus. Transactions British Mycological Society. 52(3):459-476. • Merino, S.T., Nelson, M.A. , Jacobson, D.J., Natvig, D.O. 1996. Pseudohomothallism and evolution of the mating-type chromosome in Neurospora tetrasperma. Genetics; 143: 789-799. • Malina, C., Kaemmer, D., Aponte, S., Weising, K. , Kahl , G. 2001 . Microsatellite markers for the fungal banana pathogen Mycosphaerella musicola. Molecular Ecology 1:137-139. • Mouliom-Pefoura, A. , Lassoudiére, A., Foko, J., Fontem, D.A. 1996. Comparison of develópment of Mycosphaerella fijiensis and Mycosphaerella musicola on banana and plantain in the various ecological zones in Cameroon. Plant Disease 80:950-954. 25 • Mourichon, X., Fullerton, R.A. 1990. G,eographical distribution of the two species Mycosphaerella musico/a Leach (Cercospora musae) and M. fijiensis Morelet (C. fijiensis), respectively agents of sigatoka disease and black leaf streak disease in bananas and plantains. Fruits 45:213-218. • Mourichon, X. , J. Carlier, E. Foure. 1997. Enfermedades de Sigatoka, Raya negra de la hoja (Sigatoka negra) enfermedad de sigatoka (Sigatoka amarilla). INIBAP. Hoja Divulgativa No. 8. • Mülder, J.L., Stover, R.H. 1976. Mycosphaerella species causing Banana leaf spot. Transactions British Mycological Society, 67: 77- 82 • Mülder, J.L., Stover, R.H. 1976. Mycosphaerella species causing Banana leaf spot. Transactions British Mycological Society. 67:77-82. • Müller, R., Pasberg-Gauhl, C., Gauhl, F., Ramser, J., Kahl, G. 1997. Oligonucleotide fingerprinting detects genetic variability at different levels in Nigerian Mycosphaerella fijiensis. Journal of Phytopathology 145:25-30 • Neu, C., Kaemmer, D., Kahl, G., Fisches, D., Weising, K. 1999. Polymorphic microsatellite markers for the banana pathogen Mycosphaerella fljiensis. Molecular Ecology 8:513-525. • Nielsen, 0 ., Davey, J. 1995. Pheromone communication in the fission yeast Schizosaccharomyces pombe. Semin Cell Biol.; 6:95-104. • O'Donnell, K., Ward, T.J., Geiser, D.M ., Kistler, C.H., Aoki, T. 2004. Genealogical concordance between the mating type locus and seven other nuclear genes supports formal recognition of nine phylogenetically distinct species within the Fusarium graminearum clade. Fungal Genet Biol; 41 : 600-623. • Okole, B.M. , Schulz, F.A. 1997. Selection of Mycosphaerel!a fijiensis-resistant cell lines from micro-cross section of banana and plantain. Plant Cell Reports. 16:339-343. • Orozco, S.M., Farias, Larias., G. Manzo S, S. Guzmán. 2001 . La Sigatoka negra (Mycosphaerel/a fijiensis Morelet) en México. INFOMUSA. 10(1 ):33-37. • Orozco-Santos, M. 1998. Criterios para el control químico de la Sigatoka negra del banano (Mycosphaerel/a fijiensis). En: Memorias de la 1a Reunión para el control de Sigatoka negra, Julio, 1998. Colima, México. SAGAR, INIFAB. Pp 87-92. • Orozco-Santos, M., Farías-Larios, J., Manzo-Sánchez, G., Guzmán-González, S. 2000. Black sigatoka in México. lnfoMusa 10:33-37. • Palacios, G., Bustamante, S., Malina, C. , Winter, P. and Kahl, G. 2002. Electrophoretic identification of new genomic profiles with a modified selective amplification of microsatellite polymorphic loci technique based on AT/AAT polymorphic repeats. Electrophoresis 23:341-3345. • Paoletti, M., Rydholm , C. , Schwier, E.U., Anderson, M.J., Szakacs, G., Lutzoni, F., et a/. , 2005. Evidence for sexuality in the opportunistic fungal pathogen Aspergillus fumigatus. Curr Biol ; 15:1242-1248. • Pendrak, M.L., Yan, S.S., Roberts, D.D. 2003. Haemoglobin regulates expression of Mating-type-like locus a genes in Gandida albicans. Eukaryotic Cell ; 3:764- 775 • Poggeler, S, Kück U. 2000. Comparative analysis of the mating-type loci from Neurospora crassa and Sordaria macrospora: identification of novel transcribed ORFs. Mol Gen Genet; 263: 292-301. 26 • Poggeler, S. 1999. Phylogenetic relationships between mating-type sequences from homothallic and heterothallic ascomycetes. Curr Genet; 36: 222-231 . • Poggeler, S. 2001 . Mating-type genes for classical strain improvements of ascomycetes. Appl Microbio! Biotechnol; 56: 589-601 . • Polanco, T. , Carlier J., Zapater M.F., 2002. Diagnóstico, Distribución y aislamiento de Mycosphaerella presentes en musaceas de República Dominicana. Centro Agronomico Tropical y Enseñanza. Manejo Integrado de Plagas y Agroecología. No. 64. • Pons, N. 1987. Notes on Mycosphaerella fijiensis var. difformis. Transsactions of the British Mycological Society. 89: 120-124. • Raju, N.B., Perkins D.D. 1994. Diverse programs of . ascus development in pseudohomothallic species of Neurospora, Ge/asinospora and Podospora. Dev Genet; 15: 104-118. • Rhodes, P.L. 1964. A new Banana disease in Fiji. Commonwealth Phytopathological News, 10: 38-41 • Rivas, G.-G ., Zapater, M.-F., Abadie, C., Carlier, J. 2003. Founder effects and stochastic dispersa! at the continental scale of the fungal pathogen of bananas Mycosphaerella fijiensis. Molecular Ecology 13:4 71 -482. • Sánchez, M., Cárdenas, W. 2002. Producción de anticuerpos policlonales contra el hongo causante de la Sigatoka negra, Mycosphaerella fijiensis. Revista Tecnológica 15(1 ):55-61 . • Souza, C.A.J., Silva, C.C., Ferreira , A.V-B. 2003. Sex in fungi: lessons of gene regulation. Gen Mol Res; 2:136-147. • Stover, R. H. 1969. The Mycosphaerel/a species associated with banana leaf spots. Tropical Agriculture (Trinidad) 46 :325-332 • Stover, R.H . 1974. Effect of measured levels of Sigatoka disease of bananas on fruit quality and leaf senescence. Tropical Agriculture. Vol. 55: 531-542 • Stover, R.H . 1978. Distribution and probable origin of Mycosphaerel/a fijiensis in southeast Asia . Tropical Agriculture (Trinidad) 55:65-68. • Stover, R.H. 1980. Sigatoka leaf spot of bananas and plantains. Plant Disease 64: 750-756. • Tavanti, A. , Gow, N.A.R., Maiden, M.C.J., Odds, F.C. , Shaw, D.J. 2004. Genetic evidence for recombination in Gandida albicans based on haplotype analysis. Fungal Genet Biol; 41 :553-562. • Turgeon, G. 1998. Application of mating type gene technology to problems in fungal biology. Annu Rev Phytopathol; 36:115-137. • Varga J. 2003. Mating type homologues in Aspergillus fumigatus. Microbio!; 149: 816-819. • Waalwijk, C. , Mendes, 0 ., Verstappen, E. , de Waard, M., Kema, G.H.J. 2002. lsolation and characterization of the mating-type idiomorphs from the wheat septoria leaf blotch fungus Mycosphaerella graminicola. Fungal Genet Biol; 35: 277-286. • Waalwijk, C. , Van der Lee, T., de Vries, 1. , Hesselink, T., Arts, J., Kema, G.H.J. 2004. Synteny in toxigenic Fusarium species: the fumonisin gene cluster and the mating type region as examples. European J Plant Pathol;110:533- 544.

27 • Wirsel, S., Horwitz, B., Yamaguchi, K. , Yoder, O.C., Turgeon, B.G. 1998. Single mating type-specific genes and their 3' UTRs control mating and fertility in Cochliobolus heterostrophus. Mol Gen Genet; 259:272-281 . • Wong, S., Fares, ·M.A., Zimmermann, W., Butler, G., Wolfe, K.H. 2003. Evidence from comparative genomics for a complete sexual cycle in the asexual pathogenic yeast Gandida glabrata. Genome Biol; 4:R10 .. • Yokoyama, E. , Yamagishi, K. , Hara, A. 2003. Structures of the mating type loci of Cordyceps takaomontana. Appl Enviran Microbio!; 69: 5019-5022. • Yun, S., Berbee, M., Yoder, O.C., Turgeon, G. 1999. Evolution of the fungal self­ fertile reproductive life style from self-sterile ancestors. Proc Natl Acad Sci USA; 96:5592-5597. • Yun, S-H. , Arie, T. , Kanwko, 1., Yoder, O.C., Turgeon, B.G. 2000. Molecular organization of mating type loci in heterothallic, homothallic, and asexual Gibberella!Fusarium species. Fungal Genet Biol; 31: 7-20.

28 CAPITULO 2:

Materiales y Métodos Generales

2.1 ESTRATEGIA EXPERIMENTAL

Se siguieron en general tres estrategias: PCR, hibridación y DNA Walking. Se utilizará la nomenclatura para los idiomorfos propuesta por Turgeon y Yoder (2000), en la que se de no m in a a los idiomorfos como MA T1-1 y MA T1-2. Primeramente el objetivo fue localizar el locus MAT en el cariotipo electroforético de M. fijiensis, por hibridación. Para estudiar la conservación del orden de los genes alrededor del locus se utilizó también una biblioteca genómica de M. fijiensis que fue elaborada previamente en CICY (Diana Guillén Maldonado, tesis de maestría, 2003). En M. graminicola, y en otros hongos ascomicetos encontramos que el gen de la DNA liasa se localiza cercanamente allocus MA T (Waalkwijk et al., 2004 ). Bajo el supuesto de que, al igual que en M. graminicola, el locus MA T se encontraría a aproximadamente 10 kb del gen de la DNA liasa, se obtuvo un fragmento de dicho gen por PCR, el cual sirvió como anclaje del DNA Walking. Por otra parte, se ha visto que en varias especies de ascomicetos se encuentra también el gen sla2 localizado en las proximidades del locus MAT (Butler et al 2004; Waalkwijk et al., 2004). Aunque en M. graminicola no es así, (Waalwijk et al., 2002), cabía la posibilidad de que M. fijiensis fuera una excepción, por lo que se obtuvo un fragmento de dicho gen de M. fijiensis por PCR. La pregunta inicial era si en M. fijiensis este gen se encuentra también corriente abajo del locus MA T, y si es así, utilizarlo como anclaje para hacer PCR de largo rango, utilizando oligonucleótidos específicos para la DNA liasa y sla2. De esta manera, se amplificarían el idiomorfo y las regiones flanqueantes del mismo. También se probaron oligonucleótidos degenerados diseñados para amplificar fragmentos de MAT1-2. La caja HMG se encuentra relativamente conservada entre ascomicetos distantes y ha logrado ser aislada por PCR degenerada en otros hongos (Arie et al, 1997), mientras que la caja alfa es en general menos conservada entre ascomicetos distantes.

2.2 OBTENCIÓN DEL GEN DNA LIASA

Se utilizaron los siguientes aligas degenerados y espécificos basados en la secuencia obtenida con éstos, los cuales se presentan a continuación en la tabla 2.1.

29 Tabla 2.1: Oligonuceótidos degenerados para amplificar el gen de la DNA liasa.

Primer Tm Secuencia Basado en M. graminico/a, N. • CGC GCC GAT GAG AGC NGA crassa, F. graminearum, DNAiydegF3 78.9 RGARGG M. grises. yA. nidulans M. graminicola, N. CAT TCT TCT TCG TGT CCC ARY crassa, F. graminearum, DNAiydegR3 69.1 RNGTRT M. grises y A. nidulans DNAiyaseMfF 65.2 TCTCACGTCGGTCCAGATG M. fijiensis DNAiyaseMfR 64.7 TGAGGTTTCGTATCCGATGG M. fijiensis DNAiyaseMmfF 63.6 CATCAGTCCAGATCGCAGAC M. musicola DNAiyaseMmR 65.6 GTTCCGTACACGCCAGTCC M. musicola

Las condiciones de PCR de los oligocleótidos degenerados fueron:

94C 60S 94 e 30 S 60-55 e 30 S cada ciclo -1 C 72 e 30 S 94 e 30 S 55 e 30 S 30 ciclos 72 e 30 S 72 e 120 S 10 e 00 Las condiciones de la PCR con los oligos específicos fueron: 94 e 2 min 94 e 1 min 55 e 30 s } 25ciclos 72 e 1 min 72 e 120 s 10 e oo

2.3 OBTENCIÓN DEL GEN s/a2 Se diseñaron oligonucleótidos degenerados (con base en la secuencia de A. nidulans, N. crassa y M. grisea), los cuales se presentan a continuación en la tabla 2. Se usó como templado ADN genómico de M. fijiensis. Tabla 2.2 : Oligonuceótidos degenerados para amplificar 1.2 kb de s/a2

Nombre Tm Secuencia Basado en lA. nidulans, N. crassa y M. Sla2degF1 73.2 CATCAACGACCCCAAYGARGGNTAYGA !grisea !A. nidulans, N. crassa y M. Sla2degR1 72.8 CCCGCTCVCGGATCATRTCNGC !grisea 30 Las condiciones del termociclador fueron las siguientes:

94 e 2 min 94 e 1 min 60 e 30 S } 25ciclos 72C 1 min 72C 5min 10 e ro

2.4 ESCRUTINIO DE UNA BIBLIOTECA BAC DE M. FIJIENSIS POR PCR E HIBRIDACION

Se utilizó como herramienta la biblioteca genómica BAC de M. fijiesis, la cual fue construida en CICY por Diana Guillén Maldonado (2003), la cual consta de cinco microplacas de 384 pozos, dando un total de 1920 clonas con tamaño de inserto promedio de 90 kb. Se hizo una copia de esta biblioteca en PRI , en microplacas-de 384 pozos (24 por 16), utilizando medio LB-freeze más cloranfenicol (12.5 f..Lg/mL). De igual forma, se prepararon filtros de alta densidad de la biblioteca, de la siguiente manera. Se prepararon microplacas sin divisiones (Nunc) con 33 mL de medio LB agar más cloranfenicol (12.5 f..Lg/mL). Sobre el medio se colocó una membrana Hybond-N+, sobre la cual se inocularon las clonas en un formato 4 x 4, de manera, que las cinco microplacas estan representadas en un solo filtro de alta densidad. Estas membranas fueron utilizadas en experimentos de hibridación. Se realizo el marcaje radiactivo del fragmento de la DNA liasa de M. fijiensis, el cual fue utilizado como sonda homóloga para hibridar los filtros de la biblioteca. El marcaje se realizó con 32 P-a.dATP por Random Primer. La hibridación se llevó a cabo a 65° C. El fragmento del gen sla2 también fue utilizado como sonda para hibridar los mismos filtros. Este fragmento de 1.2 kb fue marcado radiactivamente con 35S-a.dATP. La hibridación se llevó a cabo a 65° C. Se realizaron los lavados de alta astringencia. Por otra parte, se usaron sondas heterólogas de los idiomorfos de M. graminicola, de 7 kb que incluyen los idiomorfos y regiones flanqueantes, y las cajas HMG y alfa de M. graminicola. '

2.5 PREPARACION E HIBRIDACION DE MEMBRANAS DEL CARIOTIPO MOLECULAR DE M. fijiensis

Se prepararon plugs (bloques de agarosa) conteniendo el micelio de M. fijiensis, siguiendo la metodología de McCiuskey y Milis (1990) modificada (ver capítulo 3). Los plugs obtenidos fueron utilizados para resolver los cromosomas de M. fljiensis mediante electroforesis de campo pulsante (PFGE), utilizando el sistema CHEF. Estos geles fueron teñidos con el colorante SYBR Green 1 (Molecular Probes ® ).

31 La metodología para la transferencia del cariotipo a las membranas de nylon se basó en Sambrook y Rusell (2001 ), y se describe a continuación. 1. Exposición del gel a una fuente de luz UV (254 nm) por 5 min. 2. Depurinación: se realizó sumergiendo el gel por 20 min y en agitación, en una solución 0.25 N de HCI. 3. Se lavó brevemente con agua destilada estéril. 4. Desnaturalización: se llevó a cabo sumergiendo el gel en 0.5M NaOH, 1.5M NaCI, por 30 min, con agitación. Luego se cambió la solución y se incubó por otros 15 min. 5. Neutralización: se sumergió el gel en una solución 0.5M Tris-HCI, 1.5M NaCI, pH7.5; por 30 min, y luego 15 min más. 6. Transferencia: se realizó utilizando 1Ox SSC pH 7, durante al menos 24 hr. La torre de transferencia se construyó sobre esponjas sumergidas en 1Ox SSC. Terminada la transferencia, la membrana se lavó brevemente en 2x SSC. 7. Fijación: el ADN se fijó sometiendo la membrana a luz UV en un Crosslinker ®.

Las hibridaciones se hicieron con la finalidad de localizar el cromosoma que contiene el locus MA T. Se utilizaron sondas de aproximadamente 7 kb, las cuales fueron proporcionadas por C. Waalwijk y G. Kema, (Piant Research lnternational, Wageningen, Holanda). Estas sondas corresponden a los genes mat1-1 y mat1-2 de M. graminico/a respectivamente, e incluyen las regiones flanqueantes del locus MA T. También se utilizaron sondas de aproximadamente 250 y 300 pb, las cuales son fragmentos correspondientes a las cajas a. y HMG de M. graminico/a. Cada sonda (25 ng) fue marcada por medio del kit Random Primer (Life Technologies ®) de acuerdo a las recomendaciones del fabricante, utilizando 35S [a.-dATP] o 32P [a.­ dATP]. Las membranas fueron prehibridadas en tubos de hibridación, utilizando 20 mi de una solución con buffer Denhardt (6x SSC, 5x Denhardt, 0.5% SOS), a 65° C por al menos 2 hr. Las hibridaciones se llevaron a cabo en 1O mi de la solución Denhardt. Se hicieron variaciones en las temperaturas de hibridación y en los lavados (ver capítulo 3). Los experimentos se realizaron primero a bajas temperaturas, ya que las sondas utilizadas eran heterólogas, y poco a poco se fue subiendo tanto la temperatura de hibridación como la de los lavados. Igualmente, se procuró hacer los lavados de menor astringencia primero y luego ir subiendo la astringencia conforme a los resultados observados.

2.6 AMPLIFICACIÓN DE LOS GENES MAT POR PCR

Se ensayaron diferentes pares de oligonucleótidos degenerados para amplificar las regiones con cierto grado de conservación de los genes mat, que son la caja alfa (mat1-1) y la caja HMG (mat1-2). Se probaron aligas específicos para M. graminicola y para S. passerinni; así como diferentes aligas degenerados basados en la secuencia de ambos y de otros ascomicetos. Estos se presentan en la tabla 2.3. 32 Tabla 2.3. Lista de oligonucleótidos utilizados en los ensayos para amplificar regiones conservadas de los idiomorfos.

Clave Nombre Secuencia Basado en Referencia MT1F MAT1-1F CCGCTTTCTGGCTTC MAT-1 M.graminicola, Waalwijk et al , TTCGCACTG 2002 MT1R MAT1 -1R TGGACACCATGGTGA MAT-1 M.graminicola, Waalwijk et al, GAGAACCT 2002 MT2F MAT1-2F GGCGCCTCCGAAGC MA T-2 M.graminico/a, Waalwijk et al , AACT 2002 MT2R MAT1 -2R GATGCGGTTCTGGA MA T-2 M.graminicola, Waalwijk et al, CTGGAG 2002 E6 Mat1-2degF2 MA T-2 M.graminico/a, Este trabajo CCCGCCA TTGAGTTT Magnaporthe grisea, 1 CTGAARAARGAYGC Fusaríum graminearum, Aspergil/us nidu/ans, E? Mat1-2deg~3 MA T-2 M.graminicola, Este trabajo Magnaporthe grisea, GGCATGCTGACGCTT Fusarium graminearum, YTCYTCYTC l Aspergil/us nidulans, target is: 10427 -10417 of AF440399 E8 Mat1-2degR4 MA T-2 M.graminicola, Este trabajo Magnaporthe grisea, ~ GCGCTCACGGACGT Fusarium graminearum, TYTCNACNAC 1 Aspergíllus nidulans, target is: 10544-1 0534 of AF440399 A mat2CR aa MAT-2 de M. Este trabajq GTRGGNCYNATGGT graminicola, S. passerinni, CATGTTCGGGGCCT A. a/ternata, L. macu/ans, C. heterostrophus B Mat2DR a.a. MAT-2de M. Este trabajo GGNKCNTTYGGGCC graminico/a, S. passerinni, 1 GCTCTTCTTCTCC A. alternata , L. macu/ans, C. heterostrophus e Mat2Exon 1F TGCTCACGTCACTCA Mat-2 M. graminicola Este trabajo GTATGG D Mat2Exon1R CGTTCCTGATCTATC Mat-2 M. graminicola Este trabajo GCCTC E Mat2Exon2R GCTGAGGAGGAGAA Mat-2 M. graminicola Este trabajo GCGTC F HMGF AACGCGTTCCTGATC Mat-2 M. graminico/a Este trabajo TATCG 1 G HMGR GCAGAAGGCTGAGG Mat-2 M. graminicola Este trabajo AGGAG H Mat2GKIK CGGCAAGATCAAGC Mat-2 M. graminicola y S. Este trabajo 33 GCCCAARMYGC passerinii 1 MT-F Regiones flanqueantes de Goodwin et al., CTTCTTGCCTGCGCC los idiomorfos en S. 2003 ACAGG passerinii 2 MT-R Regiones flanqueantes de Goodwin et al. , GGTCGTCAACTCTGG los idiomorfos en S. 2003 TCCTTGCTG passerinii 3 KPNL-F CCGAAGCGTCCGCT Mat-1 M. graminico/a y S. Este trabajo CAAC ¡passerinii 4 LLSKAY-R TGT ARGCCTTGGACA Mat-1 M. graminicola y S. Este trabajo RSAG lpasserinii 5 KIKRP-F AAGATCAAGCGYCCA Mat-2 M. graminicola y S. Este trabajo AAG ¡passerinii 6 SEKKR-R ATGCGRCGIDCTTC Mat-2 M. graminicola y S. Este trabajo TCSG ¡passerinii 7 Alfa1594-R CGGTATGTGGATGAT Mat-1 S. passerinii Goodwin et al. , GGAAGAAAGG 2003 8 HMG849-R TAGTCGGGACCTGAA Mat-2 S. passerinii Goodwin et al. , GGAAGTG 2003 9 Alfa1881 -F AGAGGTTGGTGCGG Mat-1 S. passerinii Goodwin et al. , AGCG 2003 10 HMG796-F TCTGGCGAAAGAACA Mat-2 S. passerinii Goodwin et al. , , AACTACC 2003

Los ADNs genómicos de las diferentes líneas que se utilizaron como templado en los experimentos de PCR se enlistan a continuación, junto con el tipo de apareamiento inferido por cruzas in vitro (Manzo et al. , datos no publicados):

323 M. graminicola Mat1 269 M. graminicola Mat2 86 M. fijiensis + 89 M. fijiensis 1240 M. fijiensis + 139a M. fljiensis Vera cruz M. fijiensis 42 M. musico/a (no se tiene información de cruzas)

Se variaron las condiciones de PCR como temperatura de anillamiento, entre 50-58°C, tiempo de extensión de acuerdo al tamaño esperado, y "hot start" y condiciones de "towchdown" de 60-50 °C cuando se consideró necesario para aumentar la especificidad de la amplificación.

Los amplicones fueron clonados en el vector pCR2.1 -TOPO {lnvitrogen ®) y secuenciados. Las secuencias fueron analizadas por tBLASTx y BLASTn. Se llevaron a cabo alineamientos múltiples de las secuencias correspondientes de M. graminico/a, S. passerinii.

34 2.6.1 OBTENCION DE LA CAJA HMG DE M. MUS/COLA

Se ensayaron el par de oligos 5+6 (KIKRPF + SEKKRR), y H+6 (GKIKR+SEKKRR), a 55°C de temperatura de anillamiento, y 40 s de extensión. Con base en la secuencia obtenida de la caja HMG de M. fijiensis, se diseñaron oligonucleótidos específicos para amplificar dicha caja. Estos fueron probados tanto en M. fijiensis como en M. musico/a, a 65°C de temperatura de anillamiento y 30 s de extensión. Nombre Secuencia Tm Left3 GTCTCGACCTCCACGCAACCATCG 72.96 Right3 ATTGCATGCTGGCGCTTCTCTTCC 71.39

2. 7 OBTENCION DE LOS IDIOMORFOS COMPLETOS

La obtención de los idiomorfos completos fue realizada mediante DNAWalking utilizando el kit DNAwalking SpeedUp de Seegene ®. Este sistema está diseñado para obtener secuencias desconocidas adyacentes a secuencias conocidas (Fig 2.1). Se basa en la utilización de oligos llamados DW-ACP, (del1 al 4) diseñados para capturar secuencias desconocidas; un oligo universal DW-ACP-N , y oligos específicos de la secuencia de anclaje (llamados TSP, del1 al 3). La secuencia que se utilizó de anclaje fue la de la DNA liasa, a partir de la cual se diseñaron oligos específicos para realizar tres reacciones de PCR, dos de las cuales anidadas.

35 'DW-ACP1 1 Knovm uqtlt:.nce ~ ~ c::======::J Template ONA ONAWalking TSPt ACP-PCRm UnkrrownseqtUtnclt 1 - m 1 -

..TSP2 - 11" nested PCR Amplification of Universal Primer (or OW·ACP-Nl ~ an unknown 2nd PCR product 1 1 .... - target sequence TSP3 l ~· nested. PCR 3«~ ' PCR product 1 - Dírect sequencing, OR Clonfng; of the final amplified unknown target product

Figura 2.1 . Diagrama de flujo de las reacciones de PCR que se realizan utilizando el kit DNA walking SpeedUp (Seegene ®). Figura tomada del manual del usuario.

Los siguientes aligas se utilizaron para amplificar ambos idiomorfos, y están basados en las secuencias flanqueantes de los idiomorfos: E56-F (5'­ CCCTCTGGACCAGGATACC-3'); y E66-R (5'-TCGCAAAATGAGTTGAAACG-3').

2.8 REFERENCIAS

• Arie, T., Christiansen, S.K. , Yoder., O.C., Turgeon, B.G. 1997. Efficient cloning of ascomycete mating type genes by PCR ampl ification of the conserved MAT HMG box. Fungal Genet. Biol. 21 , 118-130.

36 • Butler, G., Kenny, C., Fagan, A. , Kurischko, C. , Gaillardin, C., Wolfe, K.H. 2004. Evolution of the mat locus and its Ho endonuclease in yeast species. Proc. Natl. Acad . Sci. USA 101 ,1632-1637. • Goodwin, S.B., Waalwijk, C., Kema, G.H.J., Cavaletto, J.R., Zhang, G. 2003. Cloning and analysis of the mating type idiomorphs from the barley pathogen Septoria passerinii. Mol. Gen. Genom . 269,1-12. • Guillén Maldonado, D. 2003. Construcción de una biblioteca genómica tipo Cromosoma Bacteriano Artificial de Mycosphaerella fijiensis. Tesis de Maestría, Centro de Investigación Científica de Yucatán. • McCiuskey, K; Russell, B.W. , Milis, D. 1990. Electrophoretic karyotyping without the need for generating protoplasts. Curr Genet. 18: 385-386. • Sambrook, J. , Russell, D.W. 2001 . Molecular cloning (A Laboratory Manual). 38 ed ., Cold Spring Harbar Laboratory Press. New York, USA. • Turgeon, B.G., Yoder, O.C. 2000. Proposed nomenclature for mating type genes of filamentous ascomycetes. Fung . Genet. Biol. 31 ,1-5. • Waalwijk, C., Mendes, 0 ., Verstappen, E., de Waard, M. , Kema, G.H.J. 2002. lsolation and characterization of the mating-type idiomorphs from the wheat septoria leaf blotch fungus Mycosphaerel/a graminicola. Fungal Genet. Biol. 35, 277-286. • Waalwijk, C., van der Lee, T. , de Vries, 1., Hesselink, T., Arts, J., Kema, G.H.J . 2004. Synteny in toxigenic Fusarium species: the fumonisin gene cluster and the mating type region as examples. Eur. J. Plant Pathol. 11 O, 533- 544.

37 38 CAPITULO 3:

Análisis del Cariotipo Molecular y de una Biblioteca Genómica BAC de Mycosphaerella fijiensis

Parte de los resultados de este capítulo fueron publicados en Canadian Journal of Plant Pathology. (Rodríguez-García, C.M., Raigosa-Fiores, N. , Conde-Ferráez, L., Peraza-Echeverría, L., Canto-Canché, B. , James-Kay, A. 2006. Variation in e/ectrophoretic karyotype among Mexican iso/ates of Mycosphaerella fijiensis. Can J P/ant Patho/28:1-6. Ver anexos).

Otra parte de los resultados se encuentran en prensa en Molecular Biotechnology (Canto-Canché, B., Guillén-Maldonado, D.K. , Peraza-Echeverría, L., Conde-Ferráez, L., James-Kay, A. 2007. Construction and Characterization of a BAC library of the banana pathogen ', Mycosphaerella fijiensis. Mol Biotech. In press. Ver anexos).

3.1 INTRODUCCION

Entre los estudios básicos de la biología y del genoma de un organismo se encuentra el análisis de cariotipo. La Electroforesis de Campo Pulsante (PFGE; Schwartz and Cantor, 1984) ha permitido la separación de cromosomas y la estimación del tamaño genómico en organismos cuyo pequeño tamaño cromosómico dificulta la aplicación de métodos citológicos, como en el caso de los hongos, muchos de ellos de importancia comercial y agrícola. Estos estudios han demostrado la alta variabilidad molecular que existe entre hongos de la misma especie y con diferente virulencia, en cuanto al número y tamaño cromosómico (Masel et al., 1990; Taylor et al., 1991 ). En estudios recientes, se ha podido estimar el número de cromosomas de diferentes aislados de M. fijiensis (Conde-Ferráez, 2002, Raigosa Flores, 2004).

El conocimiento del cariotipo y los polimorfismos cromosómicos es una herramienta importante para el estudio de la biología del hongo y su interacción con su hospedero. Además, en el contexto del lnternational Mycosphaerella Genomics Consortium, se ha generado el primer mapa genético de M. fijiensis (Manzo-Sánchez et al., no publicado), por lo que resulta de gran importancia poder localizar el locus MAT tanto física como genéticamente, para establecer un vínculo entre el mapa genético y el mapa físico.

Con el objetivo de localizar el cromosoma que contenga el /ocus MA T, se estandarizaron las metodologías de transferencia, hibridación y electroelución de cromosomas. Con los resultados obtenidos confirmamos que podemos transferir los cromosomas (al menos de hasta 1600-2000 kb) a membranas de nylon. Para tratar de localizar el cromosoma que contenga el locus MA T, se utilizó la metodología de

39 hibridación de los cromosomas resueltos de M. fijiensis. Para ello, se utilizaron diferentes sondas heterólogas de Mycosphaerella graminicola y sondas homólogas.

En M. graminicola, y en otros hongos ascomicetos encontramos que el gen de la DNA liasa se localiza cercanamente al locus MA T y que se encuentra bastante conservado (Waalkwijk et al., 2004). Bajo el supuesto de que al igual que en M. graminicola, el locus MA T se encuentra a aproximadamente a 1O kb del gen de la DNA liasa, se obtuvo un fragmento de dicho gen. Por otra parte, se ha visto que en varias especies de ascomicetos se encuentra también el gen sla2, localizado en las proximidades del locus MA T (Butler et al., 2004 ). La primera fase de los experimentos consistió en diseñar oligonucleótidos que amplificaran un fragmento del gen de la DNA liasa y de sla2. La pregunta inicial fue si en M. fijiensis estos genes se encuentran también flanqueando el locus MA T, es decir, si el orden de los genes se encuentra conservado (sintenia). Como herramienta, se utilizó una biblioteca genómica BAC (Bacteria! Artificial Chromosome) de M. fijiensis que fue elaborada previamente en CICY (Guillén Maldonado, 2003), la cual consta de cinco microplacas de 384 pozos, dando un total de 1920 clonas con tamaño de inserto promedio de 90 kb.

3.2 MATERIALES Y METODOS

3.2.1 Análisis del cariotipo molecular

3.2.1.1 Obtención de "Piugs" de micelio Los plugs son bloques pequeños de agarosa que incluyen la muestra de interés. Se elaboraron utilizando la metodología estandarizada en el CICY, basada en lo reportado por McCiuskey y colaboradores (1990). Los hongos se crecieron en medio líquido PDB (patato dextrose broth) inoculado con 130 mg de micelio fresco y crecido por 6 días en luz continua a 26 oc con agitación (100 rpm). El micelio fue cosechado por centrifugación a 6000 g por 10 min a 4 oc y resuspendido con 10 mL de buffer STE (sorbitol, 1 moi/L; Tris, 25 mmoi/L, pH 8; ácido etilen diaminatetraacético (EDTA), 25 mmoi/L pH 8) y molido con mortero y pistilo. El micelio fue lavado una vez más con STE y finalmente resuspendido en 2 mL de buffer SE (sorbitol, 500 mmoi/L; EDTA, 125 mmoi/L,). Se mezcló con un volumen de agarosa de bajo punto de fusión (Bio­ Rad , Hercules, CA) al 1.5% preparada en buffer SE a 45°C y vaciado a los moldes de los ?lugs. Los plugs se incubaron con proteinasa K {lnvitrogen, Carlsbad, CA), 1 mg mL- ; EDTA, 45 mmoi/L, y 1% sodium dodecil sulfate (SOS) a 50 oc por 48 h. Finalmente, los plugs fueron lavados con EDTA (0.5 moi/L) y almacenados a 4 oc. (Fig 3.1).

40 Figura 3.1 . "Piugs" de micelio incluido en agarosa

3.2.1.2 Resolución de los cromosomas por PFGE Previa estandarización de las condiciones de corrida, los geles de campo pulsante fueron corridos en el sistema CHEF DRil y CHEF Mapper (Biorad ®) , en diferentes condiciones que permitieron resolver los cromosomas de M. fijiensis. Las condiciones que resultaron ser mejores para resolver los cromosomas pequeños (de no más de 1.5 Mb) fueron : agarosa 1%, 0.5x TBE (Tris [base] 45 mmoi/L; ácido bórico, 45 mmoi/L; EDTA, 1 mmoi/L, pH 8) 14°C; 3v/cm; 120 s- 250 s de pulsos; 120° de ángulo fijo; 72 hr de corrida. Los cromosomas de tamaño grande (mayor de 3.5 Mb) se resolvieron en geles de 0.6%, 1x TAE (Tris [acetate] 40 mmoi/L, 0.1 % (v/v) ácido acético glacial; EDTA, 2 mmoi/L, pH 8) 11°C; 1.5 V/cm, 1800-4800 s de pulsos, angulo 106°, por 72 hr de corrida. Los geles fueron teñidos con SYBR green 1:1O 000 (Sigma, St. Louis, MO) por 60 m in en el buffer de corrida y fotografiados en luz UV.

3.2.1.3 Southern Blof e Hibridaciones del cariotipo Los geles que contenían los cromosomas fueron expuestos 5 min a luz UV de 254 nm y depurinados con HCI (0.25 moi/L) por 20 min, para después ser desnaturalizados con NaOH (0.5 moi/L) NaCI (1 .5 moi/L) dos veces, por 30 min y 15 min. La neutralización se realizó sumergiendo en NaCI (1 .5 moi/L)/Tris-HCI (0.5 moi/L) dos veces 30 y 15 min. Los cromosomas fueron transferidos por capilaridad a membranas de nylon Hybond®-N + (Amersham Pharmacia Biotech, Piscataway, NJ) con 10x SSC (NaCI, citrato de sodio) por 24 h. Las membranas se prehibridaron por al menos 4 h en SSC 6x con 0.1% (SDS y solución Denhardt's 5x (1x Denhardt's equivale a 0.02% Ficoll® 400, 0.02% polivinilpirrolidona, y 0.02% albúmina de suero bovina), a 65 oc, e hibridadas en el mismo buffer (fresco) durante toda la noche, a temperatura variable 42° C - 65°C de acuerdo a la sonda utilizada. Después de la hibridación, las membranas se lavaron 20 m in con 2x SSC y 0.1% SDS una vez, y con 1x SSC y 0.1% SDS, una vez más, a 42- 550C para la las sondas heterólogas, a 65°C para las homólogas; con un lavado adicional de 0.2x SSC y 0.1% SDS en este último caso. Las membranas se colocaron en casetes con pantallas intensificadoras (Kodak®) para exponer films autorradiográficos sensibles a 32 P (Biomax® MR filters Kodak®).

41 3.2.1.4 Preparación de las Sondas utilizadas en las hibridaciones Las sondas fueron preparadas a partir de productos de PCR o insertos de clonas, que después de ser purificados utilizando una columna de Sefadex, fueron marcados radiactivamente con 32P-cx,dCTP o 35S [u-dATP] por Random Primers (lnvitrogen), según las especificaciones del fabricante. Se utilizó una sonda telomérica que contiene la secuencia repetitiva (TIAGGG)18 de Fusarium oxysporum, la cual fue proporcionada por Kistler (Powell y Kistler, 1990). Esto con la finalidad de confirmar el patrón de bandeo cromosómico. Para localizar el cromosoma que contiene el locus MA T en M. fijiensis, se utilizaron como sonda las cajas HMG y alfa (aprox 250 pb) , y amplicones de 7 kb de mat1-1 y mat1-2, que incluyen los idiomorfos y regiones flanqueantes, todos de M. graminicola, que fueron proporcionadas por C. Waalwijk. Para usar como sondas homólogas, se obtuvieron fragmentos de los genes flanqueantes del locus MA T. Se utilizaron los oligos degenerados Sla2degF1 y Sla2degR1 para obtener un fragmento de 1.2 kb del gen s/a2. Se utilizaron los oligos degenerados DNAiydegF3 y DNAiydegR3 para amplificar una banda de aproximadamente 850 pb de la DNA liasa. Las secuencias de los oligos y los detalles de la metodología se presentan en el siguiente capítulo. El fragmento de la DNA liasa y del gen s/a2 de M. fijiensis, fueron utilizados para hibridar los filtros de la biblioteca y del cariotipo.

3.2.2 Análisis de una biblioteca BAC

3.2.2.1 Elaboración de filtros de alta densidad Se elaboró manualmente una copia de la biblioteca BAC de M. fijiensis en microplacas de 384 pozos (24 por 16), utilizando medio LB-freeze más cloranfenicol (12.5 11g/mL). Se prepararon filtros de alta densidad de la biblioteca de la siguiente manera. Se prepararon microplacas sin divisiones (Nunc) con 33 mL de medio LB de agar más cloranfenicol (12 .5 11g/mL). Sobre el medio se colocó una membrana Hybond-N+, sobre la cual se inocularon robóticamente las clonas en un formato 4 x 4, de manera, que las cinco microplacas estan representadas en un solo filtro de alta densidad. Estas membranas fueron utilizadas en los experimentos de hibridación.

3.2.2.2 Escrutinio de la biblioteca por hibridación Se realizó el marcaje radiactivo del fragmento de la DNA liasa y del gen s/a2 de M. fijiensis, los cuales fueron utilizados como sondas homólogas. El marcaje del primero se realizó con 32P-udATP y el segundo con 35S- cx,dATP. Las hibridaciones se llevaron a cabo a 65° C toda la noche y se realizaron lavados de alta astringencia. Por otra parte, también se usaron las sondas heterólogas de M. graminico/a de 7 kb y las cajas HMG y alfa. Para las primeras, la temperatura de hibridación y lavados fue de 55° C y para las cajas alfa y HMG de M. graminico/a, a 58° C toda la noche.

42 3.3 RESULTADOS

3.3.1 Análisis del cariotipo Se obtuvo el cariotipo electroforético de varios aislados de M. fijiensis. Se observaron polimorfismos en el tamaño y en el número de los cromosomas entre los diferentes aislados.

Los cromosomas del rango de tamaño entre 0.5 y 1.4 Mb se detectaron claramente usando las condiciones para separar cromosomas pequeños, entre 225 - 1500 kb (Fig 3.2 a). Se observó una zona de compresión por encima de 1.5 Mb, la cual no fue tomada en cuenta en el perfil cromosómico de los cromosomas pequeños. Los perfiles del cariotipo electroforético de rango de tamaño pequeño mostraron diferentes números de cromosomas entre los aislados, variando desde 4 hasta 9 bandas. Para resolver los cromosomas medianos y grandes de más de 1.5 Mb se probaron diferentes condiciones electroforéticas. Sin embargo, no se observaron cromosomas en el rango de 1.5 a 3 Mb en ninguno de los aislados analizados. Se encontraron dos bandas mayores de 5.7 Mb, cuyo tamaño no puede ser estimado con presición debido a que no existe un marcador para tamaños mayores a 5.7 Mb. El patrón de bandeo de los cromosomas grandes fue casi el mismo en todos los aislados (Fig 3.2 e) . El cromosoma mayor fue de 8.6 Mb y el mas pequeño de 0.5 Mb . Estos resultados muestran un patrón de cariotipo electroforético diferente para cada aislado, siendo de 8 a 13 bandas, por lo que la estimación del tamaño del genoma se encuentra en un rango aproximado de entre 27 y 35 Mb como mínimo.

Para comprobar que las bandas observadas se tratan en realidad de cromosomas, se hibridaron utilizando la sonda telomérica (TIAGGG)18 (Fig 3.2b y d).

3.3.1.1 Hibridaciones del cariotipo Cuando las membranas de los cromosomas fueron hibridadas con las sondas de los idiomorfos de M. gramínicola de 7 kb (mat1-1 y mat1-2), se observó en ambos casos que hibridaron fuertemente en la zona de compresión de los geles electroforéticos, en todos los aislados estudiados, y con menos intensidad con el resto de los cromosomas pequeños, observándose esta inespecificidad incluso con el marcador de peso molecular (figura 3.3).

43 KB Sc1 2 3 4 5 6 7 8 9 10 11

825 785 750 680 610 565 450 365 285 225 a b

Sp1 2 3 4 5

Mb 5.7_.

4.6 ..

3.5 ..

e d

Figura 3.2. a) Separación de los cromosomas de M. fljiensis tamaño pequeño por medio de electroforesis de campo pulsante, y teñido con SYBR green; las condiciones electroforéticas son específicas para cromosomas pequeños y se describen en materiales y métodos. b) Hibridación del los cromosomas pequeños de M. fijiensis y d) de los cromosomas grandes, empleando como sonda el telómero {TTAGGG}18, para verificar el patrón de bandeo del cariotipo. El tamaño de los cromosomas fue estimado usando el estándar de cromosomas de Saccharomyces cerevisiae (Se carril 1). Los aislados M. fijiensis utilizados son provenientes de Yucatán (carril 2, CIRAD1231 ; carril 3, CIRAD1233; carril 4, EGRRJC1 ; carril 5, NCHR2K}, Veracruz (carril 6, C1 N3H2), Tabasco (carril 7, C1 N1 P4; carril 8, C5N2P3) y Chiapas (carril 9, C2L3H1 ; carril 10, 8#13e1a; carril 11 , SN1#2C1). e) Separación de los cromosomas grandes de M. fijiensis por PFGE con tinción con SYBR green; las condiciones electroforéticas son específicas para cromosomas grandes y se describen en materiales y métodos. El tamaño de los cromosomas fue estimado usando el estándar de cromosomas de Schyzosaccharomyces pombe (Sp carril 1 ). Los aislados M. fljiensis utilizados son provenientes de Yucatán (carril 2, (CIRAD1231 ), Veracruz (carril 3, C1 N3H2), Tabasco (carril 4, C1N1P4}, y Chiapas (carril 5, SN1#2C1). Kb, kilopares de bases; Mb, megapares de bases; zc, zona de compresión (Figuras a, b y e publicadas en Rodríguez-García et al. , 2006; el film d no corresponde al gel e, se presenta para ejemplificar los resultados).

44 se se

a b Figura 3.3. Autorradiografías obtenidas al hibridar con las sondas de 7 kb , mat1-1 (a) y mat1-2 (b). La hibridación se hizo a 42°C, al igual que los lavados; uno de 15 min con 2x SSC , 0.1% SOS, y dos de 30 m in con 1x SSC, 0.1% SOS , y finalmente se les realizó un lavado adicional a 65° C con 0.1 x SSC , 0.1% SOS por 35 m in. El último carril contiene el marcador de peso molecular S. cerevisiae (se).

Cuando se hibridaron los cromosomas grandes usando las sondas heterólogas de 7kb (de hasta más de 5.7 Mb), se observó señal débil con todos los cromosomas, en el caso de la sonda mat1-1 y ninguna señal en el caso de la sonda de mat1-2 (Fig 3.4).

a b Figura 3.4. Autorradiografías obtenidas al hibridar con las sondas de 7 kb , mat1-1 (a) y mat1-2 (b). La hibridación se realizó a 48 oc. al igual que los lavados; dos de 30 min con 2x SSC , 0.1% SOS; de 30 min y 1.5 hr con 1x SSC, 0.1% SOS y uno de 0.1x SSC, 0.1% SOS 1.5 hr.

45 Al utilizar las sondas heterólogas de las cajas alfa y HMG, la caja alfa no produjo señal en la hibridación, mientras que la caja HMG hibridó fuertemente con la zona de compresión de los cromosomas pequeños (Fig 3.5b). Para descartar que la señal observada fuera inespecífica, se realizó un experimento con mayor temperatura y lavados de mayor astringencia teniendo como resultado una señal muy tenue en la zona de los cromosomas no resueltos (Fig 3.5c).

Estos resultados sugieren que el cromosoma que contiene el /ocus MATes mayor de 1.5 Mb. Aunque se han logrado separar los cromosomas de M. fijiensis con un tamaño estimado de hasta 8.6 Mb, no fue posible ubicar el locus MA T entre estos cromosomas grandes, ya que las hibridaciones con esta misma sonda mostraron señal inespecífica tenue o ninguna (no se presenta la figura) .

Se realizaron también hibridaciones de los filtros de la biblioteca genómica de M. fijiensis utilizando las sondas de 7 kb, sin obtener resultados satisfactorios.

1600kb

1125kb

a b e

Figura 3.5. a) Gel de agarosa teñido con SYBR Green, en el que se resolvieron los cromosomas de M fijiensis de hasta 2,200 kb . Las condiciones de la electroforesis fueron 1% agrosa; 0.5x TBE; 3v/cm; 120 s- 250 s; 120°; 70 hr. Carril 1 marcador S. cerevisiae; carril 2, Veracruz (C1N3H2); carril 3, Tabasco (C1N1P4); carriles 4-7 Veracruz (C1 N3H2);. b) Autorradiografía obtenida al hibridar los cromosomas de 200- 2,200 kb de M. fijiensis con la caja la caja HMG de M. graminicola, a 48° C. Los lavados fueron a 48° C, dos de 30 m in con 2xSSC. 0.1%SOS ; y uno de 15 m in con 1x SSC , 0.1% SDS. El film se expuso 24 hr. e) Autorradiografía obtenida al hibridar con la misma sonda a 55 °C. Los lavados se hicieron a 55°C, dos de 30 min con 2xSSC. 0.1 %SOS; y dos de 30 m in con 0.2x SSC, 0.1% SDS. Zc, zona de compresión.

46 3.3.2 Obtención de fragmentos de genes flanqueantes Los aligas para la DNA liasa amplificaron una banda de aproximadamente 850 pb en diferentes especies de ascomicetos (Fig 3.4), la cual fue purificada para ser secuenciada. La correspondiente a M. fijiensis fue usada como sonda. En el caso de s(a2, los aligas degenerados amplificaron una banda única de 1.2 kb en M. fijiensis, la cual también fue purificada para ser clonada, secuenciada y usada como sonda.

1kb 2 3 C-

850 pb1 .2 kb +------+

b a

Figura 3.6. Amplicones obtenidos utilizando aligas degenerados para la DNA liasa (a) y sfi;¡2 (b) . Los ADNs templados son a) carriles 1 y 2 M. graminicola, carriles 3, 4, 6, 7 y 8 M. fijiensis; carril 5, M. musae; carriles 9 y 1O M. musico/a. C-, control negativo. b) carriles 1-3M. fijiensis, C-, control negativo.

3.3.3 Escrutinio de una biblioteca BAC Al hibridar los filtros de la biblioteca con el fragmento de la DNA liasa de M. fijiensis, se obsevaron 3 clonas positivas (Fig 3.7, tabla 3.1); al hibridar con el fragmento de s/a2 se observaron varias clonas positivas, con diferentes intensidades (Fig 3.7). De estas últimas, al menos 5 fueron confirmadas como positivas (tabla 3.1) haciendo un Southern blot de las clonas.

47 ¡;JI . 1 . .. 1 . ... ··6)··· ' •· . .. o • ._ lo • "-· •• 4' f ' ~ ~.: .. ·cv ,. 0 .. 0. G . .. 0 . '- ·· ~·# a b

Figura 3. 7 Autorradiografías obtenida al hibridar filtros de alta densidad de la biblioteca genómica de M fijiensis con las sondas homólogas correspondientes a: a) la DNA liasa y b) al gen s/a2 (Datos publicadas en Canto-Canché et aL , en prensa).

Tabla 3.1. Localización de las clonas positivas en la hibridación usando como sonda el fragmentos del gen s/a2 y DNA liasa.

Sonda No. Placa Clona 1 5 G6 2 5 J4 3 4 N8 sla2 4 4 M18 5 5 M24 6 5 813 1 1 C11 DNA 2 4 114 Liasa 3 1 K4

También se realizaron hibridaciones usando estas sondas homólogas sobre el cariotipo y se obtuvo en ambos casos una señal muy débil en la zona de compresión (no se presenta la figura) , coincidiendo este resultado con el obtenido con las sondas heterólogas. 48 En las hibridaciones de los filtros de la, biblioteca genómica de M. fíjiensis utilizando sondas de 7 kb y cajas alfa y HMG de M. graminicola, se observaron algunas clonas positivas, pero estos resultados no fueron reproducibles; ~on filtros gemelos, por lo tanto no fue posible ubicar el locus mat entre las clonas de la biblioteca.

3.4 DISCUSION

3.4.1 Análisis del cariotipo molecular

El patrón de bandeo cromosómico se verificó usando la sonda telomérica, dado que los cromosomas contienen un telómero en cada extremo, por lo que se espera observar una banda correspondiente a cada cromosoma en la hibridación. Sin embargo, no se puede afirmar que cada banda observada corresponda a un solo cromosoma, puesto que cabe la posibilidad de que los cromosomas de tamaño similar comigren en los geles. Se observa una mayor intensidad en algunas bandas, tanto en los geles como en las hibridaciones, que posiblemente representan cromosomas sobrelapados. Este hecho es importante tomarlo en cuenta para hacer estimaciones del tamaño genómico. El tamaño promedio del genoma de los ascomicetos se encuentra en un rango de 30 - 40 Mb (Hargreaves y Keon, 2002). Estudios de M. fijiensis con aislamientos procedentes de diferentes regiones (Conde, 2001 , Conde­ Ferráez, 2002, Raigosa Flores, 2004 ), caen dentro de este rango.

La diferencia en el número cromosómico entre los diferentes aislados de M. fijiensis puede ser relacionado a la pérdida de algunos cromosomas llamados supernumerarios, los cuales no son "esenciales" para la vida de muchos organismos (Keijer et al., 1996) que, sin embargo, en muchos casos pueden contribuir a la variabilidad patogénica y alterar el potencial para infectar diferentes hospederos; también pueden ser los responsables de ciertas respuestas como resistencia a fitotoxinas, entre otros (Miao et al. , 1991 ). De la misma manera, la variabilidad en el tamaño cromosómico puede ser causada por ADN no esencial, el cual se encuentra presente en ciertos aislados, y ausente en otros, pudiendo ser resultado de mecanismos tales como deleciones, inserciones y translocaciones (Trash-Bingham y Gorman, 1992).

Existen reportes de cariotipo electroforético, en los cuales se ha relacionado el polimorfismo con la virulencia (Taylor et al., 1991 ). En M. fijiensis se han observado polimorfismos entre aislados con diferente grado de agresividad patogénica (Raigosa­ Fiores, et al., 2004), aunque aún no existen datos suficientes para correlacionar la agresividad y el cariotipo.

Se ha reportado que los polimorfismos pueden ser resultado de la recombinacióon entre aislados de diferentes cariotipos (Vallejo et al. , 2002). Sin embargo, en Sordaria macrospora, al realizarse cruzas entre líneas las cuales tenían un cariotipo diferente, se observaron aberraciones en las ascosporas, baja fertilidad o infertilidad (Pi:iggeler et al. 2000). Sería interesante probar si en M. fijiensis ocurre algo similar, ya que se ha reportado diferente grado de fertilidad de algunos aislados cruzados in vitro (Etebu et al. 2003). Pi:iggeler et al. (2000), mencionan que los polimorfismos podrían aislar a las 49 poblaciones promoviendo el aislamiento genético de dos líneas y por lo tanto, podría representar un primer paso en la especiación. Recientemente se ha descrito un nuevo patógeno foliar del banano, Mycosphaerella eumusae (Carlier et al., 2000), el cual ocasiona síntomas muy similares a la Sigatoka negra y que es discernible por su secuencia de ITS. Aunque se supone que M. fljiensis, M. musicola y M. eumusae poseen un ancestro común, la posibilidad de que se puedan llevar a cabo cruzas interespecíficas se desconoce. Tener disponibles las herramientas del cariotipo y los genes mat, podrían permitir poner a prueba esta hipótesis.

3.4.2 Hibridaciones del cariotipo y escrutinio de una biblioteca BAC

La fuerte inespecificidad observada en las hibridaciones con la sonda de 7 kb es posible se deba a que ambas sondas comparten alrededor de 4 kb de regiones flanqueantes, además de que las condiciones de hibridación fueron poco astringentes, ya que se trata de sondas heterólogas. Sin embargo, es notable que aún en alta astringencia se conserve la señal en la zona de compresión de los cromosomas pequeños, tanto con las sondas heterólogas como las homólogas. Por lo tanto, es posible que el cromosoma que contiene estos genes se encuentre dentro de la zona de compresión de los geles de campo pulsante donde los cromosomas resueltos tiem¡m un máximo de 1.4 Mb. En el caso de M. graminicola, se ha logrado mapear genética y físicamente el cromosoma que contiene ellocus MA T, el cual resultó ser de 1.8 Mb (Kema et al., 2000), por lo que es probable que en M. fljiensis no se encuentre entre los cromosomas más pequeños, lo cual coincide con los resultados observados. A pesar de que los experimentos usando sondas homólogas se realizaron a alta astringencia, existe la posibilidad de que los resultados observados se deban a un artefacto debido a la mayor concentración de ADN presente en esta zona, ya que no se han observado cromosomas en el rango de entre 1.5-3 Mb; no obstante, no se observó hibridación específica con ninguna de las sondas al hibridar los cromosomas de más de 3 Mb.

Por lo tanto es necesario resolver los cromosomas de esta zona de tamaño, para poder determinar con mayor exactitud cual es el cromosoma que hibrida con el /ocus MA T. Ya que actualmente se cuenta con sondas específicas para los idiomorfos de M. fijiensis, se podrían realizar los experimentos a alta astringencia para elim inar toda inespecificidad.

Por otra parte, la localización de los genes DNA liasa y sla2 en la biblioteca BAC nos muestra que las clonas positivas no coinciden, lo cual nos indica que no se encuentran adyacentes en el genoma, por lo que se descartó la posibilidad de hacer PCR de largo rango utilizando como anclaje estos dos genes para obtener el locus MA T. La sintenia alrededor del/ocus MA T se discute con detalle en el sigui·ente capítulo.

50 3.5 CONCLUSIONES

Se resolvieron los cromosomas de M. fijiensis por PFGE, observándose polimorfismos en número y tamaño de los cromosomas entre diferentes aislados. Se estandarizó la metodología de transferencia e hibridación de cromosomas. Se obtuvo señal al hibridar con sondas heterólogas de M. graminicola, y sondas homólogas de la DNA liasa y s/a2 en la zona de compresión de los cromosomas pequeños en el gel PFGE, lo cual podría sugerir que se trata de un cromosoma de más de 1.5 Mb. Se amplificó un fragmento de 800 pb del gen de DNA liasa y uno de 1.2 kb del gen s/a2, de M. fijiensis. Se identificaron las clonas de la biblioteca que contienen el gen s/a2 y DNA liasa. El hecho de que no coincidan las clonas positivas de la DNA liasa con las de s/a2 nos hizo descartar el uso de PCR de largo rango usando estos genes como anclaje para clonar el locus MA T.

3.6 REFERENCIAS • Canto-Canché, B. , Guillén-Maldonado, D.K., Peraza-Echeverría, L., Conde­ Ferráez, L. , James-Kay, A. 2007. Construction and Characterization of a BAC library of the banana pathogen, Mycosphaerella fijiensis. Mol Biotech. In pre'ss • Carlier, J., Zapater, M.F. , Lapeyre, F. , Jones, D.R. , Mourichon, X. 2000. Septoria Leaf Spot of Banana: A Newly Discovered Disease Caused by Mycosphaerella eumusae (Anamorph Septoria eumusae). Phytopathology 90 :884-890. • Conde, L. , 2001 . Obtención del cariotipo molecular y tamaño genómico de Mycosphaerel/a fijiensis. Tesis de licenciatura. Universidad Autónoma de Yucatán, facultad de Medicina Veterinaria y Zootecnia. Mérida, Yucatán, México. • Conde-Ferráez, L. Rodríguez, M. Peraza, L. James, A. 2002. An electrophorectic karyotype for Mycosphaerella fijiensis. Mycosphaerel/a leaf spot diseases of bananas: present status and outlook. Proceedings of the 2nd lnternational workshop on Mycosphaerella leaf spot diseases held in San José, Costa Rica, 20 - 23 May 2002. L. • Etebu, E. , Pasberg-Gauhl, C., Gauhl, F., Daniei-Kalio, L.A. 2003. Preliminary studies of in vitro stimulation of sexual mating among isolates of Mycosphaerel/a fijiensis, causal agent of black sigatoka disease in bananas and plantains. Phytoparasitica 31 : 1-7. • Guillén Maldonado, D. 2003. Construcción de una biblioteca genómica tipo Cromosoma Bacteriano Artificial de Mycosphaerella fijiensis. Tesis de Maestría, Centro de Investigación Científica de Yucatán. • Hargreaves, J.A., Keon , J.P.R. 2001 - 2002. Understanding pathogenesis by Septoria tritici through analysis of expressed gene sequences. Plant­ Pathogen lnteraction, IACR. Annual Report 2001 - 2002. 20- 23pp.

51 • Keijer, J., Hounterman, P.M., Dullemans, A.M ., Korsman, M.G. 1996. Heterogeneity in electrophoretic karyotype within and between anastomosis groups of Rhizoctonia sola ni. Mycol Res. 100(7): 789 - 797 • Kema, G.H.J., Verstappen, E.C.P., Waalwijk, C. 2000. Avirulence in the wheat Septoria tritici leaf blotch fungus, Mycosphaerella graminicola is controlled by a single locus. Mol Plant-Microb lnterac. 13:1375-1379. • McCiuskey, K. Rusell, B.W. Milis, D. 1990. Electrophoretic Karyotyping without the need for generating protoplasts. Current Genetics. 18: 385 - 386 • Miao, V.P. Covert, F. VanEtten, H.D. 1991 . A fungal Gene of Antibiotic Resistance on a Dispensable ("B") Chromosome. Science. 240:1773- 1775 • Poggeler, S., Masloff, S. , Jacobsen, S., Kück, U. 2000. Karyotype polymorphism correlates with intraspecific infertility in the homothallic ascomycete Sordaria macrospora. J. Evol. Biol. 13:281-289. • Powell, W.A. , H.C. Kistler. 1990. In vivo rearrangement of foreign DNA by Fusarium oxysporum produces linear self-replicating plasmids. J. Bact. 172:3163-3171 • Raigosa Flores N. E., 2004, Agresividad patogénica de aislamientos de Mycosphaerella fijiensis y su cariotipo electroforético. Tesis Licenciatura. Instituto tecnológico agropecuario No. 2 "lng. Jose Alberto Navarrete Ruiz" Conkal, Yucatán, México. • Raigosa-Fiores, N., Conde-Ferráez, L. , Grijalva-Arango, R. , Canto-Canché, B. , Rodríguez-García, C.M. , James-Kay, A. 2004. Agresividad Patogénica entre aislados de Mycosphaerella fijiensis de diferentes cultivares de banano. Memorias del XXXINi Congreso Nacional/Internacional de la Sociedad Mexicana de Fitopatología, A.C. Fuentes-Dávila et al. Eds. Veracruz, Veracruz México, 25-28 Julio, 2004. • Rodríguez-García, C.M., Raigosa-Fiores, N. , Conde-Ferráez, L. , Peraza- Echeverría, L., Canto-Canché, B. , James-Kay, A. 2006. Variation in electrophoretic karyotype among Mexican isolates of Mycosphaerel/a fijiensis. Can J Plant Pathol 28:1-6. • Schwartz, D.C., Cantor, C.R. 1984. Separation of yeast chromosome-sized DNAs by pulsed field gradient gel electrophoresis. Cell 37: 67-75. • Trash-Bingham , C. Gorman, J.A. 1992. DNA translocations contribute to chromosome lenght polymophisms in Gandida a/bicans. Curr Genet. 22:93 - 100 • Vallejo, 1. , Carbú, M., Muñoz, F., Reborditos, L., and Cantora!, J.M. 2002. lnheritance of chromosome-length polymorphisms in the phytopathogenic ascomycete Botryotinia fuckeliana (anam . Botrytis cinerea). Mycol. Res. 106: 1075-1085. • Zhong, S. , Steffenson, B.J. , Martinez, J.P., Ciuffetti, L.M . 2002. -A . molecular genetic map and electrophoretic karyotype of the plant pathogenic fungus Cochliobolus sativus. Mol Plant-Microb lnter, 15(5): 481-492.

52 CAPITULO 4:

lsolation and characterization of the mating type locus of Mycosphaerella fijiensis, the causal agent of black leaf streak disease of banana

Este capítulo fue publicado en Molecular Plant Pathology (Conde-Ferráez, L; Waalwijk C; Canto-Canché 88; Kema GHJ; Crous PW; James JA; Abeln, ECA. 2007. Mol Plant Pathol. 8,1: 111-120. Ver anexos)

4.1 INTRODUCTION

Bananas (Musa spp.) are grown in all tropical regions of the world and play a key role in the econom ies of many developing countries. World consumption during 1998 - 2000 in developing countries was 21 kg per capita (mostly domestically produced), while the total value of the international banana trade ranges between US$ 4.5 and 5 bill ion per year (Arias et al., 2003).

The crop is affected by several diseases and pests such as the foliar fungal pathogens Mycosphaerella fijíensis, M. musícola and M. eumusae, which all share similar morphologies and symptom development. M. fijíensís (anamorph Pseudocercospora f¡jíensís; Mycosphaerellaceae) is the causal agent of Black Sigatoka or black leaf streak disease (BLSD) that rapidly became the most devastating disease of banana production world-wide. lt decreases photosynthesis, reduces fruit size and induces premature maturation. The cost of controlling the disease in large plantations is about $US 1,000 per hectare (Arias et al., 2003), but it is higher in smaller plantations where fungicides cannot be applied by air and in which crop losses can be up to 50% (Mobambo et al., 1993). Repercussions of the frequent and high input of fungicides include the development of both reduced sensitivity and res istance to these active compounds (Romero and Sutton, 1997; Sierotzki et al., 2000}. This was recently exemplified by the rapid development and spread of resistance to strobilurin fungicides in Central America (Marín et al., 2003).

Due to the fact that Mycosphaerel/a is one of the largest genera of plant pathogenic fungi, with more than 3,000 Mycosphaerel/a species (Aptroot, 2006), Goodwin et al. (2004) proposed Mycosphaerella gramínícola as the working model for the Dothideomycetes. As a result, the genomes of both M. gramíníco/a and M. fijíensís are currently being sequenced within the DOE-JGI Community Sequencing Program (see www.jgi .doe.gov/sequencing/cspseqplans2006.html}. '

The sexual cycle of the fungus plays an important role in BLSD epidemiology (Gauhl et al., 2000; Hayden et al., 2003). Apart from the generation of air-borne inoculum, sexual reproduction results in genetic variation and contributes to evolution. In heterothallic 53 ascomycetes, such as M. fijiensis (Mourichon and Zapater, 1990), mating can only occur between strains with opposite mating types. These mating types are determined by highly dissimilar sequences, called idiomorphs, that are embedded in regions common to all isolates of a given species, and from which the only conserved regions are designated as the alpha box (for mat1-1) and the HMG box (for mat1-2) {Turgeon and Yoder, 2000). In addition, the structure of the mat idiomorphs has aided in understanding the evolution of heterothallic and homothallic species (Poggeler, 1999; Turgeon, 1998; Yun et al. , 1999).

As Mycosphaerella leaf spot disease in banana is caused by a complex of at least three species (M. Arzanlou, personal communication), knowledge of the mat genes sequences in M. fijiensis is a starting point to a better understanding of the relevance of reproduction and recombination, in relation to the epidem iology of these important pathogens and the interaction with other species.

We presumed substantial synteny between M. graminico/a and M. fijiensis as a basis to isolate the mat genes of the latter. lndeed, a PCR-based strategy using the DNA lyase gene, that flanks the idiomorphs in M. graminicola, allowed cloning the mat1-2 idiomorph. In turn, the flanks of the mat1-2 idiomorph were used to clone the mat1-1 idiomorph by long-range PCR. Comparative analyses showed that both idiomorphs contain a highly unusual inversion never observed in idiomorphs in other ascomycetes.

4.2 EXPERIMENTAL PROCEDURES

4.2.1 Fungal isolates and DNA extraction Monoascoporic strains of M. fijiensis were obtained from diverse sources (Table 1) and were grown at 26 oc in Patato Dextrose Broth (PDB) with continuous shaking (100 rpm) under continuous light. DNA was extracted from mycelium collected after filtration by grinding under liquid nitrogen according to the protocol described by Johanson (1997). We used DNAs from M. graminico/a and S. passerinii isolates of known mating type as comparisons in degenerate PCRs. The list of DNAs used in this study is summarized in Table 4.1 .

4.2.2 PCR and DNA walking strategies We aligned the mat genes and flanking sequences of M. graminico/a and its clase relative S. passerinii; and the DNA lyase and the s/a2 genes from several other ascomycetes, to develop degenerate primers using the Codehop program (http:l/nar.oxfordjournals.org/cgi/content/full/31/13/3763) Specific primers were developed using the Primer3 program (Rozen and Skaletsky, 2000). Only those primers that yielded amplicons are shown in Table 4.2 .

PCRs were performed in an Eppendorf thermal cycler. General cycling conditions were 94°C for 1 min, 30 cycles of 94°C 1 min, annealing temperature of 55°C for 1 m in, and 72°C for 1 min, followed by a final extension of 7 min at 72°C. For degenerate PCR, with primers based on the DNA lyase, s/a2 and the idiomorphs from other fungi, a

54 touchdown PCR was used, from 60 to 55 °C for the annealing temperature (-1°C per cycle), with 30 additional cycles atan annealing temperature of 55°C.

To obtain the mat1-2 idiomorph, a DNA walking strategy was performed with the DNA walking SpeedUp™ Premix Kit (Seegene, Seoul, Korea), using the DNA lyase gene as anchor according to the specifications given in the DNA walking manual. The full length of the mat1-1 idiomorph was obtained by long range PCR with primers E56 and E66 (Table 4.2), which were designed based on the mat1--2 sequence, and are located in a region outside the idiomorph. The annealing temperature was 55°C for 40 s; with an extension at 72°C for 3 min 30 s. The resulting 5.5 kb PCR product was sonicated, followed by treatment with T4 DNA polymerase (Promega Benelux b.v., Leiden, The Netherlands} to obtain blunt ends and treated with kinase (T4 polynucleotide kinase, NEB) for 30 s. The fragments were then ligated into the pUC19 vector linearized with Smal (Promega). Clones with insert sizes between 300 and 1200 bp were selected to be sequenced . Other amplicons were either cloned into the pCR2.1-TOPO vector (lnvitrogen ®), according to the -manufacturer's instructions or were purified and sequenced directly. Sequencing was performed using Big Oye ® Terminator technology (Applied Biosystems, USA).

Table 4.1. DNAs used in this work. Grand Naine is a cultivar of Musa acuminata, which is highly susceptible to M. fijiensis.

MATING ISOLATE SPECIES HOST ORIGIN REFERENCE TYPE Kema et al., IP0323 M. graminicola Wheat mat1-1 The Netherlands 2002 IP09426 Kema et al., M. graminicola Wheat mat1-2 The Netherlands 9 2002 Goodwin et al., P64 S. passerinii Barley mat1-1 USA 2003 Goodwin et al., P76 S.passerinii Barley mat1-2 USA 2003 Mourichon and 86 M. fijiensis Grand Naine A* Cameroon Zapater, 1990 Mourichon and 89 M. fijiensis Grand Naine a* Cameroon Zapater, 1990

Mourichon and 139a M. fijiensis Grand Naine a* Colombia Zapater, 1990

Mourichon and 138 M. fijiensis Grand Naine A* Colombia Zapater, 1990 1231 M. fijiensis Grand Naine mat1-2 Tabasco, Mexico This work

1233 M. fijiensis Grand Naine mat1-1 Tabasco, Mexico This work

*The mating type tester strains have been traditionally designated as "A" and "a"; in this work it was determined that "A" mating type corresponds to mat1-1, while "a" corresponds to mat1-2. 55 Table 4.2. Primers used to amplify regions of the mating type idiomorphs, the DNA lyase gene and the s/a2 gene.

Primer Sequence 1 Based on mat1-2 from M. graminicola and S. KIKRP-F 5'- AAGATCAAGCGYCCAAAG-3' passerinii mat1-2 fromM. graminicola and S. SEKKR-R 5'-ATGCGRCGTTTCTTCTCSG-3' passerinii DNA lyase from M. graminicola, N. DNAiydegF3 5'-CGCGCCGATCAGAGCNGARGARGG-3' crassa, F. graminearum, M. grisea and A. nidulans DNA lyase from M. graminicola, N. DNAiydegR3 5'-CA TTCTTCTTCGTGTCCCARYRNGTRT- 3' crassa, F. graminearum, M. grisea and A. nidulans DNAiyaseMfF 5'-TCTCACGTCGGTCCAGATG-3' DNA lyase from M. fijiensis DNAiyaseMf 5'-TGAGGTTTCGTATCCGATGG-3' DNA lyase from M. fijiensis R 5'-CATCAACGACCCCAA YGARGGNT AYGA - sla2 from A. nidulans, N. crassa and M. SLA2degF1 3' fgrisea s/a2 from A. nidulans, N. crassa and M. SLA2degR1 5'- CCCGCTCVCGGATCATRTCNGC-3' fgrisea Flanking region upstream of M. fijiensis E 56 5'-CCCTCTGGACCAGGATACC-3' idiomorphs Flanking regions downstream of M. E66 5'-TCGCAAAATGAGTTGAAACG-3' fijiensis idiomorphs Flanking regions upstream of M. fijiensis flan4739-F 5'-GCGGTTTTGGAGCGGTCAGG-3' idiomorphs lnverted sequence within idiomorphs, inver5656-R 5'- GAAGCTCTGGGT ATCTCAGCACAGG-3' tupstream mat1-2) lnverted sequence within idiomorphs inver8486-F 5'-GCACCTCAGGGAGGCA TTGG-3' tdownstream mat1-2) Flanking regions downstream of M. flan9352-R 5'-TGATGCATCCTGCCGAGACC-3' fiiiensis idiomorphs

4.2.3 PCR confirmation of inverted sequences within the idiomorphs Primers flan4739-F, inver5656-R, inver8486-F and flan9352-R (Table 4.2) were designed on the predicted inverted reg ions and on the flanking regions of the idiomorphs; the orientation (forward or reverse) correspond to the sequence of mat1-2. These primers were used in four different combinations (A, B, C and D), which are specified in the table inserted in figure 4. The annealing temperature used was 62°C for 40s, and an extension of 40s at 72°C.

4.2.4 Bioinformatic analyses Sequences were assembled and ed ited in SeqMan and EditSeq programs (DNAstar, Lasergene™) and analyzed using Blast (http://www.ncbi.nlm .nih.gov). Sequence alignments were performed by ClustaiW (http://www.ebi.ac.uk/clustalw/), Blast2- 56 sequences (http://www.ncbi.nlm.nih .gov/blast/bl2seq/wblast2.cgi) and MegAiign (Lasergene DNAstar™). Neighbour-joining trees were constructed based on alignments of the conserved alpha and HMG domains respectively, using the tree­ drawing application in Clustal X. Bootstrap analysis (1000 replicates) was performed to evaluate the degree of support for each group in the tree.

ORF finding and gene predictions were performed using FGENESH and FGENESH+ software (Softberry rM , http://www.softberrv.com/berrv.phtml) with the codon usage of M. grisea. The results were compared with those obtained with GenScan (http://genes.mit.edu/GENSCAN.html) and GenomeScan (http://genes.mit.edu/genomescan.html) softwares, using as homolog models the MAT proteins of M. graminicola and S. passerinii. Conserved intron boundaries (GT/AG) and branching signals (RCURAY) most commonly found in other fungi (Kupfer et al., 2004) were also identified in the predicted genes.

4.3 RESULTS

4.3.1 PCR amplification of the HGM box and flanking genes To amplify the HMG box from mat1-2 isolates, primers reported for M. graminicola (Waalwijk et. al, 2002) and Septoria passerinii (Goodwin et al., 2003) were unsuccessfully assayed. However, the degenerate primer pair KIKRP-F + SEKKR-R (­ F means forward and -R means reverse) (Table 4.2) produced amplicons with the expected size of around 300 bp in some isolates of M. fijiensis. Therefore, these bands were cloned and sequenced. TBLASTx analysis revealed homology with the HMG box from M. graminicola (E= 6e-1 O) and S. passerinii (E= 1e-09) , showing 71 .9% identity in a predicted 82 amino acid sequence. A multiple alignment of the predicted amino acid sequences is presented in Fig 4.1 a.

In add ition, DNA lyase and sla2 homologs in M. fijiensis were both amplified by degenerate PCR. A 1200 bp amplicon showed homology to the putative SLA2 protein (involved in cytoskeleton assembly, with no known function in mating) in Aspergillus fumigatus (E= 6e-85, 87% identity; GenPept accession no. EAL92953), Magnaporthe grisea (E= 6e-85, 78% identity; GenPept accession no. EAL92953), and Neurospora crassa (E=6e-85, 73% identity GenPept accession no. EAA35004 ). The 850 bp amplicon showed homology to DNA lyase from severa! other fungi. In analogy a DNA walking strategy was employed using the DNA lyase as initial anchor. This strategy resulted in a 9817 bp genomic sequence containing the complete DNA lyase gene, a gene encoding the anaphase promoting complex (APC) and the mat1-2 idiomorph (Fig 4.2), which was deposited in GenBank with accession number DQ787016. The DNA lyase sequence obtained is 1868 bp long; the predicted gene has a single exon and 622 amino acids. Local alignments showed up to 70% identity in a 106 aa stretch (E= 2e-158; 70% identities, 82% similarities) and up to 75% identity on a 65 aa portian (E = 1e-95, 78% similarities), with the DNA lyase sequence from M.

57 graminico/a. ClustaiW global multiple alignments showed an overall identity of 40% with M. graminico/a and Cordyceps militaris.

(a) HMG.box

·¡,¡lijl.,¡s M m'l!li

1 M.l#{tfl!fs í $.(1(!$$lltÍI"# 1 M. f¡fmt~¡ioo/1 1 G. {#J/fír(J!l/rbfífldi 1 $. IÍ1ll".ros¡:M 1 ;..;~uemala 1 Le!.!! M!ill= ":~ C. ortJ$tl9i 1 C.tatvus 1 f.

/J. . f¡iootio 'Pilini IJ. t.t:.. ,linio!llt . S C. I I!IIEtllr.lmpi>tJ~ S~ll'~ ·Ail'TllrllllÚl C.fl'IISIUJ s c.safíM F.OI~ L·mowtw N.crol\Sll R onserir.a P..!wSSÍCI!I(I

Figura 4.1 . Multiple sequence al (gnments of predicted amino acids from a) the HMG box and b) the alpha box, of Mycosphaerella. fijiensis, Mycosphaerella musico/a, Septoria passerinii, Cochliobolus heterostrophus, Sordaria macrospora, Alternaría alternata, Col/etotrichum musae, Cochliobo/us sativus, Fusarium oxysporum, Leptosphaeria macu/ans, Neurospora crassa, Podospora anserina and Pyrenopeziza brassicae. Black arrows indicate the positions of the conserved introns; the gray arrow indicates another intron present only in Mycosphaerel/aceae alpha box. Shaded amino acids are in agreement with the consensus.

58 Tblastx analysis qn the mat1-2 idiomorph, showed only homology with the HMG box region of mat1-2 from M. graminicola, with expected value E= 6e-69, on a 40 aa stretch, (67% identities and 77% similarities). The next hit was mat1-2 from S. passerinii, with an expected value of E= 4e-27 (70% identities, 77% similarities). No other region with similarity was found within the mat1-2 idiomorph.

4.3.2 Long -range PCR isolation of the mat1-1 idiomorph Long-range PCRs using primers anchored on the flanking regions of the mat1-2 idiomorph (primers E56 and E66, Table 4.2) resulted in a 5.8 kb fragment corresponding to mat1-2, in sorne isolates and a slightly smaller fragment (5 .2 kb) in others. This 5.2 kb fragment was identified as containing the mat1-1 idiomorph. The sequence was deposited in the GenBank database with accession number 09787015. Tblastx analysis of the mat1-1 sequence of M. fijiensis, showed homology with mat1-1 of M. graminico/a and S. passerinii as first hits (E= 3e-75 and E=5e-68, respectively). MegAiign and ClustaiW multiple alignment of amino acid sequence showed a particularly conserved region, which corresponds to the alpha box of mat1-1 (Fig 4.1b).

4.3.3 Characterization of the idiomorphs Primers that were developed on the flanking regions enabled the amplification of the complete idiomorphs (Fig 4.2). To define the flanking regions of the idiomorphs, the nucleotide sequences of mat1-1 and mat1-2 of M. fijiensis were aligned in ClustaiW. The sequence similarity between the flanking regions, which had 95.2- 98.4% identity, differed significantly from that of the idiomorphs (Fig 4.3). We predicted the upstream ends of the idiomorphs mat1-1 and mat1-2 in positions 1004 bp and 4848 bp, respectively, and the downstream ends were determined on nucleotide 4877 of the mat1-1 sequence, and nucleotide 9254 of the mat1-2 sequence. Hence, the length of the mat1-1 idiomorph is 3873 bp and that of mat1-2 is 4406 bp.

r

59 mat1-2 Start Stop 4 6 6 6 77 7 9 8 5 7 7 11 9 2 4 5 3 6 28 5 5 8 5 4 o 4 8 1 ' 11 ~ ' t:!;!:l ' HMG ' .. ' ' ' APC DNA lyase 2 ' 5 8 7 ' mat1-2 1 9 6 ' 3 5 3 '

~~--~~>----~'~-[======e5871=====>~==~ bp ~ --1-kb 3853 10> .,. 9724 E56 mat1-1 E66

/ 5241 bp / 1 11> ... 5242\ / E56 E66

/

/

/ / mat1-1

.· / Start Stop 4 / 1 2 2 222 3 3 3 8 / o 5 7 899 11 8 7 o 2 7 21 7 4 9 4 / 4 4 3 584 2 2 5 7 \ .,;;,._/ ---f~L.C...... L-'//"'--"--~L...... <.....L· f,___l'-----1 _l-"'--- >~~::....:....<...-___,¡

a 1 kb

Figura 4.2. Diagram of the mat locus organization in Mycosphaerella fijiensis. The boxes labeled mat1-1 and mat1-2 represent the idiomorphs; the adjacent genes are labeled APC (Anaphase Promoting Complex) and DNA lyase. Numbers indicate positions in the sequences of mat1-1 (GenBank 00787015) and mat1-2 (GenBank DQ787016) from M. fijiensis . Numbered triangles represent primers used in long PCR. In the close-up diagrams, the arrow-shaped boxes represent the predicted genes interrupted by introns (black boxes); the dashed boxes are inverted regions with high percentage of identity between the plus (+) strand of one idiomorph and the minus (-) strand of the other.

60 Surprisingly, the alignment showed two regions with a high percentage of identity but in reverse orientation compared to the flanking sequences. These regions of inverted homology were located close to the ends of both idiomorphs (Fig 4.3). In M. fijíensis a portian of 1127 bp in the 5' end of mat1-1 idiomorph shows 77% of identity (in nucleotide sequence) to a portian of the 3' end of mat1-2 idiomorph, but in reverse orientation. The same is observed on the 3' end of mat1-1, in which a 697 bp portian is highly similar (89% identity) to the 5' end of mat1-2 in the minus chain. lnterestingly, this phenomenon was not observed when the idiomorphs of M. graminicola, S. passerinii, Leptosphaeria maculans or P. nodorum were aligned among each other (data not shown).

9254 ...... ····························· ·· ·········································· ······· 9191 •····· ·················<>. ; ' ¡~ ¡ 8063•······ ...... L...... ¡ 1

¡ ! ! 1 6043 ...... ¡...... ¡...... ~

:::: ; ,1 -~ r ,1 ,

L()• L() N N mat1-1

Figura 4.3. Dotplot graph of both idiomorphs of M. fijíensis generated with Blast2. X axis: sequence of mat1-1 , Y axis: sequence of mat1-2. The flanking regions draw two lines from bottom left to top right. The high identity regions within the idiomorphs appear from top left to bottom right (between + and - strands). The numbers correspond to nucleotide positions on each sequence.

To rule out the possibility of assembly artifacts, we confirmed the presence of these inverted regions by PCR using primers on the flanking regions and others designed on the sequence of one of the idiomorphs. This approach allowed us to observe the amplification in one of the mating types and absence of an amplicon in the opposite mating type, and the reciproca! situation was observed when combining two reverse or two forward primers to produce amplicons from the opposite mating type (Fig 4.4).

61 ,---- ! a)

• .. . o . . . . : o. •. •• o.·.·.··o · ~·· .: .: o .

~· mat1·2 ·. W~~----1-

Expected amplicon s 4'-- - --.,,...------'~

Primers mat1-1 mat1-2 B

A 1+2 non e 91 7 bp 1 kb

B 3+4 none 896 bp

e 1+3 966 bp none o 2+4 325 bp none

A B

Figura 4.4. PeR confirmation of the inverted regions found within the idiomorphs of M. fijiensis. a) Location of the primers and predicted PeR results if inversions occur (inserted table). Salid boxes represent the idiomorphs, the dashed boxes are inverted regions with high percentage of identity between the plus (+) strand of one idiomorph and the minus (-) strand of the other; numbered arrows represent primers; primer 1 is flan4739, primer 2 is inver5656, primer 3 is inver 8486 and primer 4 is flan9352, which were used in four different combinations (A, B, e and D). b) Agarose gel showing PeR results with primer pairs A, B, e and D. Primers 1 and 4 work as "forward" and "reverse" primers respectively for both idiomorphs, while primer 2 is "reverse" for mat1- 2 but "forward" for the inverted sequence in mat1-1; and primer 3 is "forward" for mat1- 2, but "reverse" for the inverted sequence in mat1-1. Therefore, if the inversions are present, in mat1-2 the ampl ification only occurs if forward and reverse primers are com bined (e.g. 1+2 , 3+4 ); while in mat1-1 the a m plification only occurs if two forward or two reverse primers are combined (1+3, 2+4). DNAs employed were from strains 86 (mating type mat1-1) and 89 (mating type mat1-2); marker (M) is 1kb Plus (lnvitrogen ®). 62 4.3.4 ORF finding and gene prediction The predicted M. fijiensis mat1-1 gene has three introns (Fig 4.2); the conserved alpha region is included in a predicted protein of 388 amino acids. In comparison, in M. graminicola the predicted MAT1-1 protein has 297 aa (Waalwijk et al., 2002); whilst the orthologous gene in S. passerinii (Goodwin et al., 2003) has two introns as well , and the predicted protein has 31 O residues. lt is im portant to notice that two of the predicted introns are located in the alpha box. The first (277 4-2824) is located in a conserved position shared by all ascomycetes (Fig 4.1b). The second intron (in position 2919-2973) is unique to Mycosphaerel/aceae (Fig 4.1 b, 4.2). The conserved sequence of the alpha box would be interrupted if this intron was not excised. The last intron is located in position 3143-3191 (Fig 4.2). The excision of the last intron was confirmed by comparison with the mat1-1 cONA sequence (S. Zhong, personal communication). The predicted coding region of mat1-1 of M. fijiensis is 1167 bp which is in good agreement with those reported for M. graminicola and S. passerinii.

On the other hand, the M. fijiensis mat1-2 predicted gene has two introns and the protein has 441 amino acids. The intron positions are 6735-6767 bp and 7130-7179 bp (Fig 4.1 a, 4.2).

4.3.5 Comparative analysis When comparing the idiomorphs of M. fijiensis with those from M. graminicola and S. passerinii, using Blast2, the alignments showed that mat1-1 sequences are closer to the diagonal than mat1-2 (not shown). This indicates a generally higher similarity between the mat1-1 sequences, which is remarkable as it has been observed in ascomycetes that the HMG box shows a stronger conservation than the alpha box (Arie et al., 1997).

Nevertheless, in a short 39 amino acids stretch of the HMG box, the comparison with M. graminicola was as high as 66% identity and 73% similarity, whilst mat1-1 showed a lower percentage of similarity but in a longer stretch of 157 amino acids (36% identity, 46% similarity). ClustaiW analysis of the conserved alpha and HMG amino acid sequences of several ascomycetes resulted in two phylogenetic trees shown in Fig 4.5 .

4.4 DISCUSSION

4.4.1 Amplification of the HMG box We successfully used postulated synteny between M. graminicola and M. fijiensis to clone the mat1-1 and mat1-2 idiomorphs from the banana black leaf streak pathogen M. fijiensis. The HMG box of the mat1-2 locus from several distantly related fungi has been obtained by PCR (Arie et al., 1997), but reported primers did not amplify the HMG box in M. fijíensís. The HMG box has been used as an indicator to differentiate Fusaríum species (O'Donnell et al., 2004), and it has been proposed as a candidate to construct reliable phylogenetic trees (Yun et al. , 2000). Based on ITS sequences, M. 63 graminico/a and M. fijiensis appeared to be closely related (Goodwin et al., 2001 ). However, primers reported for M. graminico/a and S. passerinni also failed to amplify the HMG box of M. fljiensis. Our sequence analyses of the mat orthologs and the flanking regions suggest that M. fijiensis and M. graminico/a seem to be more distantly related than previously expected.

r----...... --- I'Ut. ,.....------M.í9JitD(;r

-r------A.W41 ~

c.~ a 0.H ÚY'IIf ,...... ----l'l!M 4lfM ,.....----- ~>~~~ si!th r---- $· -~·­ ...._$í __N,_,

r-----C.MIISH.

a b

Figura 4.5. Neighbour-joining phylograms based on multiple alignment of the predicted amino acid sequences from a) the HMG box and b) the alpha box, of several ascomycetes (same species presented in Fig 3.1). Bootstrap support for each nade is expressed in percentage ( of 1000 replications ).

We did expect similarity between the two banana pathogens M. fijiensis and M. musicola, and indeed, primers based on the M. fljiensis HMG box sequence successfully produced an amplicon in M. musico/a. tBLASTx analysis of the M. musicola amplicon sequences (212 bp) showed homology with mat1-2 from S. passerinii, (E= 4e-04, 68% identities). Overall nucleotide sequences of the HMG box of M. fijiensis and M. musícola showed a high percentage of identities (85%) on pairwise alignments. Predicted amino acid sequence alignment of HMG box of M. fijiensis and the fragment of the HMG box of M. musícola (53 aa) showed 92% identity (Fig. 1a). The similarities found between these banana pathogens are in agreement with the 64 findings obtained with ITS analysis (Goodwin and Zismann, 2001 ), according to which, M. fijiensis and M. musicola are closely related (Pseudocercospora anamorphs) as are S. passerinii and M. graminicola (Septoria anamorphs).

As seen in all fungi reported so far, a serine is found in the conserved intron position of the HMG box which is presentas well in M. fijiensis (Fig 4.1a).

4.4.2 Characterization of the idiomorphs We hypothesize that the inverted sequences in the M. fijiensis idiomorphs might have originated from an inversion event in a recent ancestor, given that independent blast analyses of these regions did not result in significant homologies in the databases, including the M. graminicola genome. The only exception was a hit with a small fragment of mat1-1 of S. passerinii (E= 2e-04, 58% 20/34 identities), on a non-coding region of the upstream end of the idiomorph. To our knowledge, the only two reports in which large portions of sequences of one idiomorph are found in the opposite is in Cordyceps takaomontana (anamorph: Paecilomyces tenuipes), where a mat1-1-1 pseudogene is found in the mat1-2 idiomorph (Yokoyama et al. , 2003); and Aspergi/lus fumigatus (Paoletti et al., 2005), where a fragment of mat1-2-1 is found within the flanking reg ion of the mat1-1 idiomorph. In addition, small fragments of common sequences were found in Cochliobolus spp., which were called "islands of identity" of 8-9 bp, and may indicate recombination spots (Yun et al., 1999). lt is not known how such dissimilar sequences of the idiomorphs can occupy the same locus in the genome, but it is thought that they were initially identical, but diverged through successive rearrangements and deletion/insertion events (Turgeon, 1998). lt has also been suggested that the small fragments of identical sequence that have been found in both idiomorphs are probably remnants explaining their common origin (Coppin et al. , 1997). In Stemphylium spp. it was found that an inversion-fusion event gave rise to selfing species from outcrossing ancestors, resulting in a mat locus with both idiomorphs, one of which was inverted with respect to the heterothallic ancestor (lnderbitzin et al. , 2005). Conversely, the inverted regions found in M. fijiensis correspond to non-coding sequences. Whether a homothallic ancestor gave rise to M. fijiensis as a heterothallic species with this particular feature, as proposed for Aspergi/lus spp. (Paoletti et al. , 2005), is a question that can be addressed with the cloning of the mating type genes of other clase Mycosphaerel/a relatives. These inverted regions represent an important finding, which can be the basis for further evolutionary studies on hamo- and heterothallic species that are related to M. fijiensis.

4.4.3 Comparative analysis As seen in M. graminicola (Waalwijk et al., 2002) and other fungi (such as Rhynchosporium seca/is and Cochliobolus heterostrophus) (Foster and Fitt, 2004; Turgeon et al., 1993), the boundaries of the idiomorphs in M. fijiensis are defined by highly similar flanking regions, but in other species (like Phaeosphaeria nodorum and Neurospora crassa) there is only a gradual transition from the flanking region to the idiomorphs (Bennett et al., 2003; Randall and Metzenberg, 1998).

65 M. fijiensis idiomorphs (3873 bp for mat1-1 and 4406 bp for mat1-2) are lonr er than the orthologs in M. graminicola, (2839 bp for mat1-1 AF440399 and 2772 bp for mat1- 2, AF440398), S. passerinii, (3048 bp for mat1-1, AF483193, and 2897bp for mat1-2 AF483194) and Xanthoria polycarpa in which the mat1-1 idiomorph is 3270 bp (AJ884599) and mat1-2 is 3150 bp (AJ884598). The M. fijiensis idiomorphs seem to be more comparable in size to more distantly related species such as P. nodorum, in which mat1-1 is 4282bp (AY212018) and mat1-2 is 4505bp (AY212019); Fusarium oxysporum (mat1 -1 is 4618bp, AB011379 and mat1-2 is 3849bp AB011378) or R. secalis (mat1-1 is 4049 bp, EMBL: AJ537511 and mat1-2 is 3153 EMBL: AJ549759). Conversely, other single-gene idiomorphs can be much shorter, for example C. heterostrophus idiomorph mat1-1 is 1297bp (AF029913), and mat1-2 is 1171bp (AF027687).

4.4.4 Synteny amongst ascomycetes We used synteny to isolate the idiomorphs of M. fljiensis by DNA walking anchored on a flanking gene. An extraordinary level of synteny has recently been reported in the mating type region of distantly related fungi such as Aspergil/us nidulans, M. grisea, N. crassa, Fusarium proliferatum and Gibberella zeae (Waalwijk et al., 2004). lt has been proposed that the conservation in gene arder in the vicinity of the mat locus is due to suppressed recombination that is caused by the dissimilarity of the idiomorph sequences.

The mat locus of several ascomycete species has been characterized in detail. In yeast species such as Saccharomyces cerevisiae, S. castellii Gandida glabrata, and Kluyveromyces delphensis, the genes encoding BUD5 and HO endonuclease, which are required for the mating type switching, are located in the region of the idiomorph; whilst in other species such as S. kluyveri, K. lactis, Pichia angusta and Yarrowia lipolytica, the mat locus is located next to the sla2 gene (Butler et al. , 2004; Debuchy & Turgeon, 2006). This gene is also located nearby the mat locus in filamentous fungi such as N. crassa (AABX01000036) and several species of Fusarium (Waalwijk et al. , 2004). The DNA lyase and APC genes flank the mat idiomorph in M. graminicola (Waalwijk et al., 2002). In L. maculans an ortholog of the DNA lyase gene was also found in the same location (Cozijnsen and Howlett, 2003). In fact, data mining performed during this work showed that orthologs of the DNA lyase gene are found nearby the mat locus in Glomerella cingulata (AY357890}, Sordaria macrospora (Y10616), P. tenuipes (AB084921) and C. militaris (AB084257). Other examples of fungi in which both the DNA lyase and sla2 genes flank the idiomorphs are Y. lipolytica (CR382129), Xanthoria parietina and X. polycarpa (AJ884600 and AJ884598}. l:lowever, in M. fijiensis, it is unlikely that the sla2 gene is located nearby the mat locus. The 1200 bp sla2 amplicon that we obtained in our study was used as a probe against a M. fijiensis BAC library (90 kb mean insert size) at high stringency conditions (Guillén-Maldonado et al. , unpublished). The sla2 homolog was present in at least six different BAC clones (data not shown), but hybridizations with different heterologous and homologous mat probes suggested that sla2 and the mat idiomorphs are not physically linked, which is supported by the draft sequence of the M. graminicola genome (DOE-JGI Community Sequencing Program).

66 4.4.5 The use of the idiomorphs for the study of populations and evolution. The synteny observed in gene arder and intron position in contrast to the high sequence divergence within the idiomorphs, reflects the importance of the mat locus in determining a species barrier. Because of its polymorphism, the mat locus can be used as a marker for population studies, and it is currently being used for genetic mapping (Manzo-Sánchez et al., unpublished).

Population genetic studies support the hypothesis that in M. fijiensis sexual reproduction is random and frequent (Carlier et al., 1996; Hayden et al., 2003; Rivas et al., 2004). The identification of the mat genes will provide further evidence for this observation, because populations with a high occurrence of sexual reproduction would have strains of opposite mating type distributed in a 1:1 ratio (Zhan et al., 2002).

The highly similar inverted regions that we identified within the idiomorphs of M. fijiensis, and the additional intron found within the alpha box, are unique features, which will be useful in evolution studies. Ongoing studies have shown that both are present in the mat genes from M. musicola, suggesting that these events occurred befare speciation (L. Conde-Ferráez, unpublished results). Future work focusing on these characteristics would give additional information about the evolution and ecology of the Mycosphaerella genus. As the Mycosphaerella pathogens of banana constitute a complex of species that have coexisted and interacted on their ·common host, the analysis of their mating type loci would give insights for a better understanding on their relationship and evolution.

4.5 ACKNOWLEDGEMENTS We thank l. de Vries, O. Mendes, T. Van der Lee (PRI, The Netherlands) and M. Arzanlou (CBS, The Netherlands) for technical support; J. Carlier (CIRAD, France), S . . Goodwin (Purdue University, USA), G. Manzo (CICY, México), for providing fungal strains and DNAs; S. Zhong, (Department of Plant and Environmental Protection Sciences, University of Hawaii, USA), for sharing a cONA sequence from mat1-1 gene. L. Cámara Ferráez is acknowledged for valuable support in figures preparation and S. Peraza-Echeverría for support on fig 4.5. L. Conde-Ferráez has a scholarship CONACYT (70133) and this work was partially supported by project CONACYT 37602- B and work was developed in CBS, CICY and PRI facilities.

4.6 REFERENCES

• Aptroot, A. 2006. Mycosphaerel/a and its anamorphs: 2. Conspectus of Mycosphaerel/a. CBS Biodiv. Ser. 5, 231pp. Centraalbureau voor Schimmelcultures. Utrech, The Netherlands • Arias, P., Dankers, C., Liu, P., Pilkauskas, P. 2003. The World Banana Economy 1985-2002. FAO Commodity studies. Rome: Food and Agriculture Organization of the United Nations. 67 • Arie, T., Christiansen, S.K., Yoder., O.C., Turgeon, B.G. 1997. Efficient cloning of ascomycete mating type genes by PCR amplification of the conserved MAT HMG box. Fungal Genet. Biol. 21 , 118-130. • Bennett, R.S. , Yun, S.-H. , Lee, T.Y., Turgeon, B.G., Arseniuk, E., Cunfer, B.M., Bergstrom, G.C. 2003. ldentity and conservation of mating type genes in geographically diverse isolates of Phaeosphaeria nodorum. Fungal Genet. Biol. 40, 25-37. • Butler, G. , Kenny, C., Fagan, A., Kurischko, C. , Gaillardin, C., Wolfe, K.H. 2004. Evolution of the mat locus and its Ho endonuclease in yeast species. Proc. Natl. Acad. Sci. USA 101,1632-1637. • Carlier, J. , Lebrun, M.H., Zapater, M., Dubois, C., Mourichon, X. 1996. Genetic structure of the global population of banana black leaf streak fungus, Mycosphaerella fijiensis. Mol. Ecol. 5, 499-510. • Coppin, E., Debuchy, R., Arnaise, S. , Picard, M. 1997. Mating types and sexual development in filamentous ascomycetes. Microbio!. Mol. Biol. R. 61,411- 428. • Cozijnsen A.J ., Howlett, B.J. 2003. Characterisation of the mating type locus of the plant pathogenic ascomycete Leptosphaeria macu/ans. Curr. Genet. 43, 351-357. • Debuchy, R., Turgeon, B.G. 2006. Mating-type structure, evolution and function in euascomycetes. In The Mycota l. Growth, differentiation and sexuality (Kües, U. and Fischer, eds) Berlin Heidelberg: Springer Verlag, pp. 293- 323. • Foster, S.J. , Fitt, B.O. 2004. lsolation and characterisation of the mating-type (MAT) locus from Rhynchosporium secalis. Curr. Genet. 44, 277-286. • Gauhl, F., Pasberg-Gauhl, C. , Jones, D.R. 2000. Black leaf streak. Disease Cycle and Epidemiology. In Diseases of Banana, Abaca and Enset (Jones, D.R, ed .) Wallingford, UK: CAB lnternational, pp. 56-62. • Goodwin, S.B. , Dunkle, L.D., Zismann, V.L. 2001. Phylogenetic analysis of Cercospora and Mycosphaerella based on the interna! transcribed spacer region of ribosomal DNA. Phytopathol. 91, 648-658. • Goodwin, S.B ., Waalwijk, C., Kema, G.H .J. 2004. Genetics of Mycosphaerel/a graminico/a: a model for the Dothideales. In Applied Mycology & Biotechnology. An lnternational Series. Vol 4, Fungal Genomics Cap 13. Elsevier B.V., pp. 315-330. • Goodwin, S.B., Waalwijk, C., Kema, G.H .J., Cavaletto, J.R., Zhang, G. 2003. Cloning and analysis of the mating type idiomorphs from the barley pathogen Septoria passerinii. Mol. Gen . Genom. 269,1-12. • Goodwin, S.B ., Zismann, V.L. 2001. Phylogenetic analyses of the ITS region of ribosomal DNA reveal that Septoria passerinii from barley is closely related to the wheat pathogen Mycosphaerella graminico/a. Mycologia, 93, 934- 946. • Hayden, H.L., Carlier, J., Aitken, E.A.B. 2003. Genetic structure of Mycosphaerella fijiensis populations from Australia, Papua New Guinea and the Pacific lslands. Plant Pathol. 52, 703-712.

68 • lnderbitzin, P., Harkness, J., Turgeon, B.G ., Berbee, M. 2005. Lateral transfer of mating system in Stemphylium. Proc. Natl. Acad. Sci. USA, 102,11390- 11395. • Johanson, A. 1997. Detection of Sigatoka Leaf Spot Pathogens of Banana by the Polymerase Chain Reaction. Chatham , UK: Natural Resources lnstitute. • Kema, G.H.J ., Goodwin, S.B. , Hamza, S. , Verstappen, E.C.P., Cavaletto, J.R., Van der Lee, T.A.J. , de Weerdt, M., Bonants, P.J.M., Waalwijk, C. 2002. A Combined Amplified Fragment Length Polymorphism and Randomly Amplified Polymorphism DNA Genetic Linkage Map of Mycosphaerella graminico/a, the Septoria tritici Leaf Blotch Pathogen of Wheat. Genetics, 161 , 1497-1505. • Kupfer, D.M. , Drabenstot, S.D., Buchanan, K.L. , Lai , H., Zhu, H., Dyer, D.S., Roe, B.A., Murphy, J.W. 2004. lntrons and Splicing Elements of Five Diverse Fungi. Eukaryot. Cell 3, 1088-11 OO . • Marín, D.H., Romero, M.A. , Guzmán, M., Sutton, T.B. 2003. Black Sigatoka: and increasing threat to banana cultivation. Plant Disease 87, 208-222. • Mobambo, K.N., Gauhl, F., Vuylsteke, D., Ortiz, C. , Pasberg-Gauhl C. , Swennen, R. 1993. Yield loss in plantain from black Sigatoka leaf spot and field performance of resistant hybrids. Field Crops Res. 35 , 35-42. • Mourichon, X., Zapater, M.F. 1990. Obtention in vitro du stade Mycosphaerella fijiensis, forme parfaite de Cercospora fijiensis. Fruits. 45, 553-557. • O'Donnell, K. , Ward, T.J., Geiser, D.M. , Kistler, C. H. , Aoki, T. 2004. Genealogical concordance between the mating type locus and seven other nuclear genes supports formal recognition of nine phylogenetically distinct species within the Fusarium graminearum clade. Fungal Genet. Biol. 41, 600-623. • Paoletti, M., Rydholm , C., Schwier, E.U ., Anderson, M.J., Szakacs, G., Lutzoni, F., Debeaupuis, J.P., Latgé, J.P., Denning, D.W ., Dyer, P.S. 2005. Evidence for sexuality in the opportunistic fungal pathogen Aspergil/us fumigatus. Curr. Biol. 15, 1242-1248. • Poggeler, S. 1999. Phylogenetic relationships between mating-type sequences from homothallic and heterothallic ascomycetes. Curr. Genet. 36, 222-231 . • Randall, T.A., Metzenberg, R.L. 1998. The mating type locus of Neurospora crassa: identification of an adjacent gene and characterization of transcripts surrounding the idiomorphs. Mol. Gen. Genet. 259, 615-21. • Rivas, G.G, Zapater, M.F., Abadie, C., Carlier, J. 2004. Founder effects and stochastic dispersa! at the continental scale of the fungal pathogen of bananas Mycosphaerella fijiensis. Mol. Ecol. 13, 471-482. • Romero, R.A., Sútton, T.B. 1997. Sensitivity of Mycosphaerella fijiensis causal agent of Black Sigatoka of banana to propiconazole. Phytopathology 87:96-100. • Rozen, S. , Skaletsky, H.J. 2000. Primer3 on the WWW for general users and for biologist programmers. In Bioinformatics Methods and Protocols: Methods in Molecular Biology (Krawetz, S. and Misener, S. , eds), Totowa, NJ : Humana Press, pp. 365-386. • Sierotzki, H., Parisi, S., Steinfeld, U., Tenzer, 1. , Poirey, S., Gisi, U. 2000. Mode of resistance to respiration inhibitors at the cytochrome bc1 enzyme complex of Mycosphaerella fijiensis field isolates. Pest. Manag. Sci. 56, 833-841 . 69 • Turgeon, B.G., Bohlmann, H., Ciuffetti, L.M. , Christiansen, S.K., Yang , G., Schafer, W ., Yoder, O.C. 1993. Cloning and analysis of the mating type genes from Cochliobolus heterostrophus. Mol. Gen. Genet. 238, 270-284. • Turgeon, B.G., Yoder, O.C. 2000. Proposed nomenclature for mating type genes of filamentous ascomycetes. Fung. Genet. Biol. 31,1 -5. • Turgeon, G. 1998. Application of mating type gene technology to problems in fungal biology. Annu. Rev. Phytopathol. 36, 115-37. • Waalwijk, C. , Mendes, 0 ., Verstappen, E., de Waard, M., Kema, G.H.J . 2002. lsolation and characterization of the mating-type idiomorphs from the wheat septoria leaf blotch fungus Mycosphaerella graminicola. Fungal Genet. Biol. 35, 277-286. • Waalwijk, C., van der Lee, T., de Vries, 1., Hesselink, T., Arts, J., Kema, G.H.J. 2004. Synteny in toxigenic Fusarium species: the fumonisin gene cluster and the mating type region as examples. Eur. J. Plant Pathol. 110, 533- 544. • Yokoyama, E. , Yamagishi, K. , Hara, A. 2003. Structures of the mating-type loci of Cordyceps takaomontana. Appl. Environ. Microbio!. 69, 5019-5022. • Yun, S., Berbee, M. , Yoder, O.C. , Turgeon, G. 1999. Evolution of the fungal self­ fertile reproductive life style from self-sterile ancestors. Proc. Natl. Acad . Sci. USA 96, 5592-2297. • Yun, S.-H., Arie, T., Kanwko, 1. , Yoder, O.C., Turgeon, B.G. 2000. Molecular organization of mating type loci in heterothallic, homothallic, and asexual Gibberella!Fusarium species. Fungal Genet. Biol. 31 , 7-20. • Zhan, J., Kema, G.H.J. , Waalwijk, C. , McDonald, B.A. 2002. Distribution of mating type alleles in the wheat pathogen Mycosphaerella graminico/a over spatial scales from lesions to continents. Fungal Genet. Biol. 36, 128-136.

70 CONCLUSIONES GENERALES Y PERSPECTIVAS

Dada la relevancia de los genes del/ocus MA T y el impacto que tiene el patógeno foliar Mycosphaerella fijiensis, este trabajo representa un importante avance en el conocimiento de la organización del genoma y en la comprensión de los genes involucrados en la compatibilidad reproductiva. Se trata de la primera reconstrucción y descripción de una región del genoma de M. fijiensis, y el primer esfuerzo por localizar genes en el cariotipo molecular de este patógeno. Como conclusiones generales del trabajo se menciona lo siguiente:

• Se observó sintenia en el orden y secuencia de los genes que flanquean el locus MAT. El gen DNA /iasa se encuentra cercano al /ocus, mientras que el gen s/a2 se encuentra en otro contexto genómico. • Aunque no fue posible resolver completamente todos los cromosomas de M. fijiensis, los experimentos de hibridación pueden sugerir que el /ocus MA T se encuentra localizado en un cromosoma de tamaño mayor a 1.5 Mb y no entre los cromosomas de menor tamaño. • La estrategia de DNA walking fue exitosa para aislar los idiomorfos de Mycosphaerella fijiensis. • El porcentaje de identidad entre las regiones flanqueantes de los idiomorfos (95 .2 - 98.4%) fue notablemente diferente de lo observado dentro de los mismos, en donde no se observó identidad. Por lo tanto, se definieron los límites de los idiomorfos usando estas regiones de alta identidad, tal y como sucede en M. graminicola, y otros, a diferencia de lo observado en algunas especies en las que la transición hacia la region de los idiomorfos es gradual. • Los idiomorfos de M. fijiensis son diferentes entre sí, excepto por dos regiones de alto porcentaje de identidad entre uno y otro, pero en posición invertida, una de 1127 bp (77% de identidad) y otra de 697 bp (89% de identidad), ambos presuntamente no codificantes. • Las regiones invertidas encontradas dentro de los idiomorfos sugieren eventos de inversión, nunca antes reportados para otra especie, y que podrían representar una herramienta importante para estudios evolutivos y de filogenia. • Se predijo la estructura de los genes mat1-1 y mat1-2, los cuales presentaron un intrón en posición conservada. • El gen mat1-1 de M. fijiensis presenta un intrón adicional al conservado, dentro de la caja alfa, el cual se ha observado en los Mycosphaerellaceae. • En cuanto al tamaño de los idiomorfos de M. fijiensis (3873 pb para mat1-1 y 4406 bp para mat1-2), éstos son más largos que sus ortólogos en especies relacionadas, y son más comparables en tamaño con especies más distantes.

La caracterización de los genes mat de M. fijiensis reveló que su estructura es muy particular y podría ser relevante en la evolución de ésta y otras especies dentro de este grupo de patógenos del banano.

71 Entre las perspectivas más importantes, se podría mencionar la profundización de estos estudios para la determinación del origen evolutivo de las regiones invertidas, analizando otras especies cercanas como M. musicola y M. eumusae, así como otras del género Cercospora, muy relacionado con este grupo. La obtención de los idiomorfos de otras especies cercanas permitiría analizar la hipótesis de que un ancestro homotálico pudiera haber dado lugar a M. fijiensis como heterotálico, por medio de mecanismos de inversión o recombinación. Además, se podría utilizar este conocimiento para la determinación del tipo de apareamiento previamente a realizar cruzas experimentales, lo cual aceleraría el proceso de selección de parentales para estudios genéticos y los estudios acerca de la fertilidad de los aislados. Finalmente, la ubicación del locus MA T en un cromosoma y su ligamiento con marcadores genéticos permitiría comenzar la integración del mapa genético y físico para una mejor comprensión de la organización del genoma.

72 ANEXOS

En esta sección se presentan un artículo en prensa y otros dos tal y como fueron publicados:

1. "Construction and Characterization of a BAC library of the banana pathogen·, Mycosphaerella fijiens" (Canto-Canché, B., Guillén-Maldonado, D.K., Peraza­ Echeverría, L., Conde-Ferráez, L., James-Kay, A. 2007. Mol Biotech. En prensa). 2. "Variation in electrophoretic karyotype among Mexican isolates of Mycosphaerel/a f¡jiensis" (Rodríguez-García, C.M., Raigosa-Fiores, N., Conde-Ferráez, L. , Peraza-Echeverría, L., Canto-Canché, B., James-Kay, A. 2006. Can J Plant Patho/28:236-241) 3. "lsolation and characterization of the mating type locus of Mycosphaerella fijiensis, the causal agent of black leaf streak disease of banana" (Conde­ Ferráez, L; Waalwijk' C; Canto-Canché BB ; Kema GHJ; Crous PW ; James JA; Abeln, ECA. 2007. Mol Plant Pathol. 8,1: 111-120).

73 M,.,¡ llíota:htd OOJ 10.1001i.t1m:H'QHllllli·2

3 Construction mtd, characterization of a bacteria] .artificial 4 cbromosome Ji'brary of ·the causal agent of Ulack Sigatoka fungal S leaf spot disease of banana and plantain MycosplmereUa fiJ~·íeftsis

6 Ulonil.1• C:.tnto·CnncM ·O.Iaua Ktrrin:t Guill6n.Mall1Qill\tl<> • 7 1.<-tíeW. r•enl7ól•Ech(>VCfl'Ía • Laum ())ndc· crrácz• $ Anilrew Jatm•s·Kay

9 R=iv

1'1 Abslnlli .A bac~triaJ a1lifidal chromQli(!lllC library oftlle lnlmducllon 29 12 etul$al agent flf !he llladi: Sigatob le:lf spot di$Q e Di 13 OOJilll\3 and plrunain, Myro.M fiflt'tl,fi. (Morekt) l>el~hHm) i; n h :~ploid , heter.::>- 3 ) 1.5 cbmeteríud usíng both lmmolol);OII 111td heteric fi!amento tl~ aseomyee t ~ • .1111d lhe 16 prObes. AfiET llm ~nd a secood ~ize selection of PF<.lE• tau ~ent bhld; le:lf strenk disease {Block SlJY!tok:l), 33 17 fractlonatcd UNA, .a ligotioo was ol~lned wing a 1:4 ~<1íreh ~ t • i!jor worldwide ron.\troinl ·to lx!nJoo. nnd 34 1& 11l()ll!r ratio (insert:vtctor) . .On~ hundll!d nmd001 clones ~&lmin {Mil.ta lpp.) produetíoo. Yield lnues l;ctween 20 . $ 19 wcre N.tnlyud. Md roo m~n in~ ~ze WM est!mated to Jll¡.,..nnd 90~ nve been r~ooed [l], Md, ~ . fll'e.~lll . bt eom · .36 20 be 90 lib. Thc range d the í1rsen l1.es wlls betw~n 40 and merci.ár'plllntlltiOO$ it'<:.tln onl.y be con trolla! by fu:ngieides. 31 !l lGO kb, Tlw. highest percentllge. of insms beloo~d to. e lt$ m~jor h!'4lXt hliS ~leen. in tllo:se areos <>f Centnll and 38 22 fM . gehctwee n 8():~nd 100 l:b;~%oflheict~en h~ '0} 3 th AmeriC'4 .tlnd AfriC~~. which r~ly on OOllllnQ and 39 23 interna! N()JJ ítes. "Ihls libt:!ry eomi$1.$ of 1920 clooes;,l~ J 1 Mt:lin (.<\All g~no •re ) .M .a st:!ple. f<>\')({ (2]. 40 24 thegenonric .si:Le isat l ta~ I SSMb , tl~•r th'in~presents4 ~ fn ,s:pite of Ule ímporta1we of this ptllhogm, to date 41 15 geoome equi\'lllent$, whkh vas supported by h íduJ>Lam lhtre llliS bccn llcry few genttic $ludies cl: lllatk Siglll:okü 42 26 rasult . wíth lllllll\ll~oos ond !Jtte".rologO!.Il ~ · . fl-6]; howft'~r. wi dr the u.o;e <>f tlw techníqu~ of· 43 molecular biofogy ~ ntf senomi ~ W~ CWI !\UÍlt ·U l'!lOI'<> 44 21 R<:>ywurd~ Myét>S¡lltaf!:ti..Jl ftjinsie un~rstwuling ti tll~> di;ea~. Jrt this 4S 2~ llAC libra~)' rc.¡¡?CCI , tltt llrst ehromQSO!ne kal)'(!ly.[lÍng of M.f¡jieff.ris 46 Irás been tS!~bli.!íhtd (7J Jliklwín¡¡, lhe numhet and 5 Í7~ <:f 41 M. ftjicff.ti:~ ebmmOliOmes, Md 1~ g~riQme slte to be 4S estbn~ ted; ~~~ Agrobt:elffr!um tut1k'foció'1.<-medioled triliiS• 49 f01m:uion $y.;tem hll ~ also been. e.stabit<;hed [i).l More t¡,n so 5S.nuc'l~(llide sequence.s hove bren depPsited in Oenll~nk , SI cnd seqlR'ndng ot the whole geJtQme is pre ently lwing 52 undmaken withi1r \he fr~mewo rk nf ·t~.e Coormu trlty Al Sequenclng Progrl!lll oithe ()()e /!Qlnt Oell(!lllC Jnstitutt, Al OS/!• . SS A u~fuf lool for flC itomic sllllfki ~ the ton~truetloo e{ S6 Al (lo>i U6,.lvt>ltmodo • brge-hm:Jt geoonríc !íbnníes. To date, se,ver.cl fungo! 57 M C<>r.de-Fwkt. · genomlc librar~~ ming Ilacteríal Anítieial Chromo~e :'í& AS "'- J•"'*K•y (BAC) vntofs b:we heen tQIHU'Il t~d. BAC lihr:!ríe-~ hnv~ A{; Ckrnilka de Yl>!•U.n, Urtk!' ¡¡io. OOJk 4,l No. !JO. C«. Chcl>=.á . c!~ Hl, AS MJ slllbilicy 11.nd lower crJ.mrilm thflll tbe Yeost A•tificial

,..~... ; ,. e ~w.T fi( .Dt~

74 63 7 includíng whole gt~l<>me ~uencing oud physicol phoryl .:n.~ . wns olllaíned ftQm Epiccmre, tJSA. l 15 68 .map¡1lng. 'Electroromprtent edil~ wer~ pte_pclred acconling to SND• JI() 69 lkcauseot'lheflilW~rofthi$ moleculnrtwl f.ltx>ra /'í'l~tt iríea 14 [12] and in fuo~g,i , lhe H:~$diomycetes Cbpritms cifltrtu. 15 [ll) llnd Usti/ago mayd<•, [14]. How<1ver, ihe mníority of i\ non-spbaero¡~ustinz technique, ada~ fmm Úl~ of myce.. 123 '7$ (18}, Jlh11Mria graminir f.~p lt(Jráei [Jl)J, 'f'ridwJermtt lium wus {\I'(IU'nd in a ~rt nn f,e~te wilh 01. 3 mt .of 114 '79 n:t ti [:íO]. f>t:rti <: ilimn chry.'lllg~flwn [21) Magna¡wrilt~ s~rile Wllltt, ~I'()Wil for od in lOO ml of roa in 2,3l) mt 125 SO 01')7/lC l22j Md úpw.pltiUJrla tnaculans (2:3], Dmongst llasks and mal.ntai ned ith "SÍlation 41. j 00 rpm with 126 IU other&. '!'heS(' fungai l3AC lUl!':ll'~,\ hnve l¡een U$~d for o:.ntinuOilli whitel4!ht ppmxin•lllely 35 mi of myce!ium 127 S'2 tew•:nl genomie :lj)J)liellli<>n.~ ~uro "'~ ro fllcilitllle map- in PDll "'"s , ~ldod in lií &ckm~n .12-)I.U centrifuge at 12 SJ bo ..d ciM.'ÍO¡\ <$ lila. 11VÍ!II!et>.l><' g- looll$; l)el!e$ T"\\po 4000 rpm (en. .>2Q(lg) ,for 2{) min at 4<'C. 1'he pellet w:~s 129 84 sible fO'r phcn01ypie clm11ges in $peeif~e fu11!li; ~~ lli~ fa- dislod¡;ed with 10 mi of ñlter•sterilized buffer rontnining 130 S$ phy;9eal marring by fingerpn.nting; 10 nnd ,gellQitle. resioo.~ l M ~~101, 25 mM 1'ris pH 8.0 and 25 mM .~'J)'('A 131 86 ín whích 1TMsp05oos tcnd .to elu.11er, clusters amongsr (S'\'!31. Thls l'ni)(Lillt' wastllm ground 10 powder in 11rnol'Uir 132 ll7 bt<>ma$5 J'ed in IX 'f'E nt 4"C until ready ror nse. 149 lOO Torre, Ver~~Cmz Slllte, M;~ioo. ~oooascosporic isolate< 101 wer~ m~in t ained. Oit:pOialo &xtro_>e awsr (PDA), or _grown l'etial digdl (f'\):'8) for liquid cuiruríng, el :llld ~ize fraetionJllioo by PFGE l.Sl 103 26 ± 2•c with contil\UQU ~ · ·hite liRhL. The !dentity of 10:1 MtctKsphamOa ftjkns¡, (}1f} was confinred by (1) 4lniíi· Tooptímiz~ diffil.sion ofbuffer3ndre tricti.ooewzyll.lt.ltuo 15'.! I.OS cial inoeul&l\ill of oonidia f.!.S) onto llw SUJCefl tlble cultivar the aga~~ . eaeh pi~ Wll$ cut into l4 ~i!llly si1.ed 15" 106 ' Orllnd Naiti•, {2) morpholosicall!ppi!lll'iii!Ce nfmy.:elium jl<)l' tious cnd jlre-incutxlt~d for '.! t> on ice, with all !he 134 10'7 4nd cooidi11 [2()) a.ud. (3) PCR aoll'litlcatioot cl: the inter• ro·mj)Oittlll\ for rligestion withont.tht!.e111..yme 1/imiiJf. witl! 15$ t~ Mil y yof.t ~ib · ~cr regjon l (lTS) of ribo$0mal DNA hufftr tKChllllf',C .llfter 1 .11; followld by incubatl!lll Qt 37 C l$6 109 1'2'1]- TI!

~ ~ IJí!Q. ll.t;f'U 1

.Añ.«)$~ ,1 ,, CTYl'I!SI

75 160 resolved In a CHEF I>IUI System (B iomd) whh ~~~ BAC size :malysi~ ¡¡ruflibnuy as~elffily 21l 161 lndude.d lll~le of JZO,, 11nd were size-sele:ct.ed N<\ce. F« 162 lll'$t. $Ízt seleaioo, 1he followlng rondiliQit wen~ use(!: 1% Whlte colonies were rMdomly ·$t.iected for pl~~;mid Jli?J'>' 212 l$1 puLsa! tleld etr~itied agarose (B!ORAD), $\I?Í ich time 111·~ion (28J . !>i~~;mids weredige$1ed witl:\ lU Nml ·in40 ~1t 21:3 1(>4 90~90 s, 6 Wcm f& 16 1:, :ll .12S"C ilt.5X 'NlS. A lnmlxla .reaetioo. Me.:lll insen $ize wns determined IYy l'fGE under 214 Hi5 50 kb (Bíornd) cooc.nreme:r ladlkr was 113ed ll$ 4 síu ihe follo"ing eondilioos: H" Pf'GE.ceniíkd ~gorQ.;e , 215 166 mnncer. Foliowlngcleetr~pllore~s,pieres ofgel contalnlng ~witch time 5- 15 $, tS Vfcm for l6 h In .5x 'rilE. I>NA 216 ltll the mMker lane:~ were exdsw, 1 1~lned wilh elhldium fragmenl$ from indtviducl liACs we :Wsuali1.ed by 1.11 168 broml® :~nd re-lliigo.W m tbe unstl!ined pan of the gel. stQining th~ ¡;el wítn ethídium brnmi ~nd insclt ~i7.es 1.18 Hí9 Section! of gel conmining DNA between lSO nnd 350 kb were ~tilmted by llddin,g tite ~ius Of ill gNA in,1en· 2.19 110 '''ere rut lnto two plece~ cl' S mm enclt :md dte I>NA tragments derlved fr01nthe digestión óf e:!cl!. BAC. Mean 220 111 clectreelut~d byPf'GE [Si] undenhe fQ!IowJngronditlons: ín~n $ÍR, insel1 si1.e diwibution1 tite perctuÍ~ge L 6 V km for 4 h llt12.s•ctn .sx 1'BE. without in erts and the f¡-eqreru:y of in t'cm~l Noil ~~ ~ ~ 222 l1S F01· seMnd size &dcction., elcctroohned DN:\ wn cQrcfuliy wcre;:;¡lcull!~d ftom !he digé$· n nnd Pf0€;stpamtioo ol '223 114 mixed wirh 011e renrh/volloodi.ng buffer .QJ\d ~eparoted e gd elcctrophur~sl~ , High..:lensíty tlher:s wcre prcpared usi.ng $ingle wcll Nunc. 228 181 u.~lng for 1·eter~nu lnmlxln DNA el' known concentrnllon. pllllll<' wldl33 mll.B.nsnr plw chlt)l'mnphenia:>l {12.5 ll.!!l~nl}. m A Hy!JO!id·'N+ n yloo !Jk!Tffir:me w:l$ pl31!ed oo. top, and 230 liAC cloning robi)IÍG'lllly inoeulared w\th 4584-needle pintool (F1exys1¡.1 1.}1 (',a¡omi Soouioos¡. The mkropl41es were incub.lltffi 4t '232 18:3 Electroconlpetent E. td nnd tite DNAs were tlxed wi1h '254 nm UV 237 188 instnJCrlo:n.~ o1' tiJe manofaemrer wid1 the followín modi: J l1¡lllt in a Crmslinker (Tfocf-e.· UVC 500, Atn!rsnmn Dio· 238 189 1lcMlons: 25 ng of vector wns mixed with lOO ng o1'...1 'ci~re} for ·os, .al maximum power. These .filler& were :1::>9 i90 ¡;enomic DNi\ and incubl!ted at 55°C for 1_9 mln. After mred ut room rem·per4lure lmd used fi)r hyl>ri<.lil.11tíott 240 )91 rooling tu room ternpm!Lurc. 14.4 jll of OX. F<~,<;t..link cxperimenl.l with D'NA pmhes, ~ deseí'ibed furthe.r. 241 192 li~tion t>uffcr, 1.45 jll of lOO mM ATP .11nd 2.9 ·1!1 otFa~­ f>rol)eS were pr.~Jlllfed by 'mditlllctive ld~líng wilh 242 1 193 Unk DNA lig- (clt frl)ln Epitenttt) were ~dded givlng a ('lS)«..:l:\11' or (" f~<.:~- incu. hybridi7.1ltioo, memb.rn11e~ were tr~ted uc<:onlfog to Sl!lll· 244 195 b:11ed fur 12 h ot Hí~C. 'the ligase' wns sdl [28] ll'nd immedJutely cxpo al tQ Kodllk 24S 1% he~ing Al (l!JNA of d1e 247 198 ft.mnaticol of bQ:wricl ctli!¡lr . s oftbe lig~~.tioo M. f¡jitn.tiJ> Llolme fMf Sl\l' from clQIIi!d fr:;gmtnts ot: gt:ll!~ from 2$) 201 ~::~pa~itl!ll~ . :lmll 4!l'hnís. 'transforma! ccll~ wtrt H!l\S• ¡\{y<;()SfJ/I(ltrri/la t,ramillitcla. 2;.SJ 20! fcrrtd into 1 mll)!'SOCmedium [28J TCJ +40 ¡¡g/LX-úcl + 125 ¡¡ghrll 205 chl«~.nphilnicol). :Vhite cokurlel were i.noewllled l nto 206 cini ng (,() 111 Lll freeúng n"'dium 207 '04.132 mMKB".: P04, 17 mMsodium 20$ cirr111e, . rñM tgSO;(rH~O . 6R mM (NH,h'>O.., 441'1: The lt!tntity ef tht M. fijilm.ii~ iS()fare fMI 3S92Só was 20'} _¡;l.)'t'ilrol] wiili1'l.5 ¡;glml chlof'.!ll'{lhcnirolllltd incubl!ted at «>nflrtned by mocphol<>gy y f'CR {ll{)t ~ hown).

~ ~ · t~ ~~}¡, ~ 2:~'1 ~,., ~ 1

N(idtNo~ll '" tl "' 0 11'l"'r~T

76 1ST To~tablí¡;t¡ (he rondlt!onJ forpaníallllge.s tioo rK ONA, li.f:~ tioo lndlcated 4 ~~~ lnsertsi;re rK90 kb wíth insen 276 2S3 differentleveb ofenr.ymt (.0, .3,.6, 1.2, 2.4 U{¡.d} .:md 4. S. iZeJ l'illl.f:Íl\g fmm 4() !O l(i) kh (Flg l fl): 26% of 1he 2n 259 md IZ min inroMlion lirms wcre eompared. '!'be optilnum dooes were bcJWeen SQ Md 100 .tb. A llbl'ltry of 1920 2711 200. rondlauns glv li1g lht maximum qu~ntity of DNA retwun clones WliS p ltainh~g ll p;~nic ularc l one u lng .a Jli ~ 284 264 A large-in. n am)'ed M./IJ1msis BAC librnry wu ron· ihoukl be 99' . 21\S 263' ;.;t ruttrowiOt HifldlH·p3ntcl!ydigestedDN'Adon~d íntQ the 'J'able l sllO\I'Hlí.>t ofthe 21\6 21)() liAC vector pCCISAC atal:4 ()n:.~rt :vcctor) mol~mttlo. ;\ 287 261 ligctloow4 ñrllt mildewlfhllsl ngle -sl7.esele<: t i.on;.boll~' r 2811 268 ll mhúprep AIU!lyllis of 2S el<,-nes indie lA $h W$ !he dl,sc.

.Flg, 1 M~'f'/I(Jtn!/.Jn. }'Jimmllle .w.,d ~l•t.>win¡¡ lhe in.orl!l <126 ron.ioo-.ty oc:l«:i M. )i¡Ju.:;.is BA(; Jil.-,:ry. :A bun.imlfl:AC<::~ ""1<·t""lbwJy :r.::h:<.í<•• ""re)'io""d 'l!;•irot lf"'P'IlOY t;Jf t>Ol.'Um=

8

1\1_ n n n o ..... * t.t-&f: 414 J1~•f" ,11~f.1:10 1tM -4iO ln$ért $ ilé {Id>)

~ ~ ·:ooJ. · ~ : ::.....:ocn P-IF• ~ " Aló:-. )1~~ u C1 Ut o 'f'f?.aET Ul<~ ~ M> 1111' 0> t(-

77 -r.hlt 1 SUmm:tl')' or plllll<.•uood IOcbllr:ietcrir.:thd~\,..,,p/:lll!'r.lln [)j,·c u!¡_([OD 320 f.iltn.<# I!AC lilr•ry l'm!>e 'PuU!he (Jv<:Írs ot gene.tk iniorm:nion. for {'hy$col mop-. ping. mop ·lX~sed clOJtíng und gcJIOOle $equenclng, l:v~e ib'nOO.&"llS i n ~n BAC libr.vit.$ are a t:rhicallool in m1 J. f'ung~l nomic lihfllrie.~ 'SSR~ M t'S~RIJ7 h:we been ro nwill:r~d frocn ,geoomk DNA~ll:liMd from 'SSR6 Mf.SSR244 NO pro roplllst< (s ¡>Meropl~s l< ) , wblclt nr€ Jl''ll!'."n'd u ·in¡¡ en·. •sSRr W·SSRl l!i zyme&10 degrade. the cdl wnll ; lh b 1s suiii~¡Y ~ lwooallll 1 'Mf·LYS2 LYS2 lll.~k anll nn empíricalprocedur ur knowt«""J'!Wl.er lhe ti!'$! BAC librMy eons1tu.c noo phaemp· Ml~2!! Allétt1111•.L"'nor 1 1.1$ting ~c hu i que. l't•· tíl· e tlle ' plmcrop• Mf·ll A9C :u~¡pone r Nt.J 1.1$tíng tccllnique has .~ limitlllions dtle to úH~ Roped:he n·s ITS ll bettrogenei ty of the ctll alt i1 growing .b:yphac. Thi$ ()(lllt {mil:!d"") f;(}ll/ 4 may ~loe overrome y \1!-~íng eerrnínatín,s: eonldí~ ~s A !~Al )'>'"' JJNA /)'4Jif f•J>Ill'lflk.:opyril'llidínle) 3 s~e of sphaem asu: ·no~vu, pr()duetlon of MllídíA i$ SI.:! .SJ:A~~- b rml. elwa~~ re oi!UcíDI nd large quontities ae requit-ed for li bfary R!lf\lelíon. 'II\e me1hod reponed llcri! Í$ Hotornlo¡¡""" sim,pl.e, cnst.-e ñcient:lltd m3y be! u,>eful íor fungi. where 'l'ilg....,¡ ilma12 Molyíll$ 1ype .iclamotl" 1 ""d l NO sph:leroplas t in~ h not h«n d-toped llltd linte. h ¡'kubl!llr. Tul>cline knll"'" boÚt eell ""'" compo:¡it1on . "hkh E-'>r 81 Hon'i~i~ Piffennt tedmique~ h:lve bren u:ml ror th~ elímínatloo Trkh!-~1'7!1< Hlltore dc.,._'1C: 2 t frequ etüly the firs1 .!izc sekcted IYrl'A fr~sm~nts ar~ Trl<:b ~~-r900 l'lwn.,k ATI'..e ~ Sul;je::i'ed lf> 4 socond ~ ~e~ t ioo by ITGI". Oonsidering lhe M)ll\1!4 A!. ¡¡rnmUwli1 i\llC4 2 menn in sm :ll1.e, t he ligorion. effiele!ICy cl' 1 x 10~ efll/~g ~()ctJiC~r"-'0. U" .u-J.g:c:.r.c.&:. Mf. M)'t:tJJ¡.•i.:uuJia fijÜ!.Jtsix; .Mg, vect(ll' ONA obtcitllld, IV!Il ,rimílar 10 thllt reponed in the My:o.rpiJaat:iW ~u:mirácalc; 1':kh. 1') in,g ONA i.~nted from .sJliu'eropl ast-. Ghren d<.u:CI!:d 1 dtot the estim:llcd f.ell()(!lt slw of M. fijit>~.rLt i1 al least .33 Mb 11.1 it is expoo!NA l y;~se ,SCIW hOiT><>Iog frogmcnt ~SM IYilal senome equlvlllem U~ing ttl!Q) ¡;e~tom lc T>NA :ss n 300 examplcs of hybridiz:nion resul~ (Fig 2A. D). Figuu;c h~ bridii.fOYed thil ~UgCiti(~l Q( $ rn4ll rr11g·· 1 ' ~.ese r~ults may indicll!e thM th ~ g~oome &i7.i! i.sunder­ 314 monts ~ue IJlo~. correspondin,s: m Jite miroch 315 f\mgcl ¡;enome. ' expectcd, !he repetitivc ínteJMUy onl y u. '·ng o~ tn7,)'lm for tion. Ji<)wewr this fibr~l)' 316 ttAnscrilíed ·$fl""'l!'t 1 ~k>'n of ril>ooom al DNA ~equel'l.-e l< cutremly· ín d,w to iwae a t\umber of impnn.:uttgen.ot$, 317 (ITS) w:u ou Ínt 1he hlghest ropy numiX'r of ~11 probe.\ .sueh u.~ A.flC lt:onsponers, whlcll reprc~nt .a muhi-gcne 313 t~$~i:l Y<'Íih ll pnsithc ctones which Jll!Ve &rong ¡ignal$ fl!mi ly, in~ l ~d in muhiple phy

78 Mol Biota:l\11()1

fl~ . Z Colocy l¡ylo-idluni;)ft nf Mp((i!t{]ttdlti fijín~J"i.t BAC liltm pmt>cd wllb ) M ·HK': {11) flNA lyO><; {(;) TwJ. ~romieDNA oi.' M..fjmnx ol'oowing ht¡;bly lepodth·~ ~""m'"' DNI\. {0) Mitodl<>nl!ñol Mf..COO " ·"" 'ibe~hd•• :1«1 wl!h ( liJ.«·ATl' u-f 1~·A'rP

72 aceryl a~ aU oi' whlch haw shown lo he r~pt-ntcl ln d1 is l . (l:..rlior. J., I);C~:Rn. H.. l'--"¡»tct. M. F.. D:>b<.i._ C .. &. fl,ft>otk.hoo>, 407 :m tibr.lry. BAC librarits ar~ imJ'l JX'll"l>tloo rí !n""n• 40S l""f' otrn~J;: funpu. tr<"'J'' >OC:n:ll• fljlm~l$. Jtfolwllar }.'colufl'l, 409 ~4 m~; wilf geoetlc and phy kol whích llS.$lJt. lbr example, J, 4 S lO. 410 :m !he ml p•msed cloning of avirulen<:e &enes. 6AC.sare aso 4. Neu; C•. ~a<:onm<:r. D.. K:lhl, l)m~c micm:lr.. ""p:c.lr 412 371 · :~SSlld lho P«:itlc bhllils. /'lor.t Pmi>1IOJ1Y, S), 411 t ltnt ·ne ••-h<>ro: ib"".k J. Mlllb ({lellCúx, Aot-.b:o, 1ó:>-m . 418 C'..,rm>l1)'1 E. ()ni~ (lru•irlllo 'focnol.t\Sia:> e!« Mcrld:l. Métk" ~.~<). fi:"'""l"·""· M. !':, Rl>i:~JU-.r.&l. A. C<>!;OI>, S .. & Clr1kr. J. 4.lll Me~ •t:d T. Von dcr L.nt Rt:<<~>r<:h Intcm>cion•t. ;\\<~sen· ( 420 io.¡;¡:o. 11>: Nelbe~and<), for óeehnic•J "'1'1"'" In elle p-cfW'I1kll> of p$. .-lld C. W<~>lwijk (Ptm Í«:.«OlO-b l"'er· P,mtll..Jilcbe•'C11Í>. l.. Ca;c<>-('Anc:bO, R. , & h"""'·KUS c¡¡ntrib1.1lm u( l"''*" corropood ir._¡¡ to ·(2()Í)6) Vab!ioo ·in ci«.1"'Pboreiic b.r)'O!)'Jl" lrtwoen Mcxlcan 425 Tri'ro.:. Mj'ém,oilatfdlo ¡;r~ffll.oktdo '"''""" ci Myro'l!hatrt!la jijilr.sis. ea,....¡;., Jcumai niPiant 426 M_¡¡>\'f R~ (1\ BC I). mil M. guuriiii!Jola m>Íi"''l !)'!" ldícm>rp¡, l'i:tltvklfl {In J!""'V· 427 ~cdvc1y . Wet'hnrik l..tAk:b C$ na1il f~7- fortecñnk.11 :(;Uppt)Jt ll. B>lint-Kl:lti, P. J .. M"l'· (J .. & (,'1ll!rellill, A. {200 t) 0.\'G~""' 42$ in il¡rcre prcp.lt>lion. Thi• ...,..1; '" "'l'JXXtcd b;)· .nl. of" mm:furm:o:lm ~""'"' (,.- M)X:f)tph.?~rtiln ¡»th<>.¡,"r.' of 429 No.l1«lZ·fl allil tb: (~(JNAC~F-OL~ J'"'¡:T~m {Makc¡­ b""•·""' o k<>l f..- fue. >hldy ol' h<>s:!JU:hrtgnry 1> ('..,n<>h\lc$ llicti){JiolaJIY.l"-um, lí/J. 9- 1~. 431 CM!>(Ji(cium ulliler íhc Jnpctvi!!ioo ol' Dr. J"""av (I¡> IW.l:l!U'Y o( M<>leculltr C)'t<>g'llCti<:.s ';op.c! Cytomr. i'ISnllil"'>t>knuír,~ !"!imcn~l Baany. Solo<' '"'""~ 6. ~n~. <.'ucll Rep¡.'hll<. o f lOI).Il.llobll>o-J'IÍf rl'll&monliuslr. ~A 434 frotn W.bor< ""Pío• ""' "'"ililbki. f:..fuCltdrit. J'. !l.. k Ot"'n. t.t. V. 437 {f99() !klcclloo CStrir.o:l<>u ci chimcrlc yll , '!'.A.• &t la ,JC~. C•~ 1'., \layl.!lde!J· bo::ti:rl:ll ortítlcbl rl>romc""""" llbruy <> ( Pil:,tl)f)htoro lr,/atl:lt.t 441 <; >ttJ, C.. k. 'wcm:cn, R. (l'l?l) )'leld I<>lí;m of clooa; h>!Q P. 1~•""'·'· .flJ."$(11 Cit.nl!k's 442 ., •P"' nr.d fuld ¡;olfnc<: af """""'"' (JJid llig¡: la f(i)-170. 443 ¡>< ~Jt(Btk, JJ, lS-:12. 12. R., AUon. :tt '-· 444 4 (ll"'"'- T. L ( 1 ?'~) l'ath<>,¡¡cnic~n i>hility In l'oníweyl; Z. B.}tM,J.,'Whi-n. S.C. llltcll. P. R., klky,..., 44$ 'ún.ri.• .Marekt. ~""""' o( bi.Ck Siptolct in J. L 1:1003) A f ""l contl.¡; 'J"'Miog lhe 44(/ 'l>:ln., •. •ll Md Hoff;.. N.ror•uf'Qm p<:lllJi/i~Q (i\\¡ ••1n:kr.oe !Cnc. loo>• AtR l Ni!. 447 ~tlimJ &Im:e. 2J, i!'l-1$. ""''tm' (;o,.til:s t~Rd' /')pi~~ :JS, 3!\-42. 448

~ t t)Ut :JI'~t~tt c 'J' .V tit)t. -~ : ... t:!...... ,. M$QCf : K ""'"'

79 1~. Mcro¡;llQ.l) · o.~e d I'CR. l"""'ri:il ani&i•1 -"""C (11 A(.') libr.uy o( (i>p!inlt ¡., b;ar... nund pi>J)l>ÍJ<. M')'n>l111irul lit-'''""''• 508 '14. MáS< m. K~ Sholu., J. T<.b~i. F.. J>,.,.i, 1<., Henrlle~lilnr dMiJrg ,1 3:10 11., & 1.1$1>1(001, 0 . /\. {Woomo>M1<. J.Abiwat~ · M<01uai). W r.d. Ncw \'mi::, OSA: Cclk1 $¡Írl m bl51:e. (knt>IIW1, 4._~. Hb/bor l..ol)matOf)' P.,~. 512 ~'1-216. 29. Mt(:tnlto· 513 15. Zlm. H, ('boi, .S., Jom..~. A. K .. Wing. R. A .. ll: lh'ln R. A. r«k: bl)'roU.,.I ..16.. 514 \19'>1) A bq¡e4n.elt (I.Ul kbp) b:l<1eri•l •nifld•l d110rr..o""""'. (')¡nnd (lt.nttio; JI$. m-:386. 515 liloc>J}' of ·\he. rk~ ¡,¡.., f•..,su• M1¡¡¡mpath< c•i.<r.s. H. !l. Wo.? ,S .. S, &Wíns, R. A. ( 9')!)~ BA<;. Y.ACaiX! Si6 """1)"'"' cootigL«cmbly. >1>1! ll"""' dtnld libwy am•ll'!>:tih¡;y, 11' 3:17-347. .Piia1iiJti Wil<:y. (.'hicbe<~cr, VK. 518 HS. Ní. Sil .• :ll. S1rn. O. W':: &.' Amcmí)'O, C T. (1977) 519 Shimin:. N, Kol.1>, H. lb.eb:, A., & X>w>oUki, Sh. {1 ?<>S) Matlocl ímprovcmc.nt ofl'AC >ro llAC k>'Od by 520 Q•""rnx:ti;>n d • BAC líbnuy of ího rk:o blm t~"' Ma¡;J>'.llliC:d-floldi:d...,p¡aY~)'"t.ti:i diF>i uf SZl fl"ltl.t gtisOdflMllt DNA. Pn>a.t:du.f/.1 , Natk""'l Acadknl ¡;f ~~ten, 522 trootp.>llmS let:d lo clm«:r. IJitJscimcJ! Bfultchti!Ó(JI%)' or.d 15, 3<$.3%1. i 523 lli«lrem•rtl}' 61. 15ts..:1S21 . $1 . Ctorto:. L. & CA!boo, J. (19r!\! A 1"")' b>rJ; wmalnln¡¡ J.)J>· 524 11. Jem,J.S., C.'bcn, IJ .. Yi, G.H.,& W••s.O.I• . f.!®)eticolld cbctic Ct\1 El ll)ttld pl;umi tCJ:!<$ti,eof11lc.erlitc.f: <;til'i 525 ¡>h)'lik:>l ""'Pr1111t ()( 1'15{1). • IO<:U< •lii!Od•l«< ,..ilh .bro0m::f' . 1 Co!ulM\iioo o( O bo:.'l. •mltld\1 <;hmmo;;orre. q~r>l)'. di>tcnntnnloo !JI' $<1l0m< •lu, ond 52$ Hi. Aitn• V., $cn.It<:, V .. & Hnh:I,J, J. O. (200l) ll)'bri&uniM· cbl>op7ó s•no fMa crluxa link>)ló J:I'<>'UP U •nd V. NÜ»!Í-JSO. 530 (ilt*lk S. /JJ. 1015-1 mil. :34. Mcg.¡th.J. M.. Shllw.)LS .. Delo•Re)..,.,ll. O., &Wdllllld, J.l. S:ll W. P~r=. C .. Wu, B. k úic$< , H. (2ü!)Z) A Jl l..,..tria $'r.miJ:i< {m1J Coo.:n.~i'"' of • "'jlar'b:<:t llAttid 3:32 r"1' hm'.cl BAC liblll.l}"gy &pmt~J'. 22. ~2 •.. 533 Otrr~:r.t (je»etic~ 42, 1OJ:-113 . ~ . ~ai;a, l. B·lg.¡. M.. foo~lcr. D. B., &.ernbh,.-. R. N. {2!Y.l$J 534 :!0. Dkter, !i.li,<.'tlcJI~¡>Jt>, M. K.. Mil, ~tind c.h:mll:e<:ri7.'.lr. CmpSciHI ~t. 4J, IS71-t.S71 . 53() rt~st i$ ~cnome c.oo1en1, <>'i!lni~xinn and evohuion ~"<'-'k:d . J:-l:tbmuro. S., "'-"~:>""'·S .. Ohmidl). N. t'illrui K. Shimitu. H.. 537 tl¡n¡¡,¡;h !lA(: Jibroty dllltACieri"'tloo. F'flJtg# (ifl"'-lie> (11rtf & X>-.:....-11:1. S. ( 1997) COOMN:tion uf >O ~l> cooll.!i In ·lhc 538 Biti<.'l;); 41 , IIJ77-J!JS7. ne.r'<'<:J:lJ<..,~k: re¡:lon ()( !ho ri<» bl"'" rc:ll ur,c,c l>"'"" Pl·ti! 539 :U. Xu, Z., V•n '· M2ll. 541 Z!ur,¡;. f!. !l. (:!tl!6) Ge'"""'e ~·•kili lll3ppi~ fmrn l;u~.;¡~;;crt 31. i{,_~il. B. L , Llü. 0. Vt<:b>lm•, J. & '>\~lklhl. H. H. c'2(:61 542 e1<>nill•l)· etm¡OOru!.: u (:<>n;;g .u;t :ph)$k:o.. 1 n""'J.> 1>1' l'míciil.·um tliiYIWIJl chrornr f.pich!a ~jt:ttJICII~. ;a mutu:ili.tle 544 54 S " 1/r.rmn:h, J.l, o.l!l.. . . , . .1:." . .,¡ hmpt <:r.d~)'IC <11' ¡¡ru.c~ f'WJ:¡¡al (;e>>t.tia ar.d llioiiJI(Y, 41 , - 1'hoo • .M. R, P>n. H.,l'l,.,..,r, S., Pap:do.,J., Thro; A:, Mttdlell, 2:h1l. 546 'r. K . .& DOJPO:<>.~I<: tlernuJ 38. Chus, Y.. l!entk¡llez, X.. l'rG~. P .. CC!J"r,blver. O., &.7Jur~. 541 clllili..~bl>$1 H. {20:0) A plllr.t tr~ol) · frotn 546 (tr.¡ut Mo~u;pt:íJ'IÍII! &;":flt. t'..m> 7. R 16 \he. Arabidsls ¡/Jaf!Qifa. L<1Jl "'"~)l." IOr futctior.al alld 549 z;!. (lwt, L. YIXIIII, J. , !;lllm.M.t..llbil;e. 1_;,1 f~~t,M. C•ttlllico, compr;eh·e ll"r.tl)qtit, M. H.. & 'R~lltel , T. (.!OCJli) [:o.! in tbl.tldf 26'>-li6. 5.51 rowhtoo: 11» Anl.ml .-JNk.<(lll(1nfa ·NJilOIÜI1't.t. Mm. J. (i Wl!) An lmp""'t:d 4f'll"'>JCh tbr 553 2-1. Jo~.. "'"'~· A (1997) Dmnion()j'Sif(Qtol.z'lt"¡¡f•f'l'''lfhar.::;ra by """' trudoo of bb~t~t~li<.s, S2. 1-8. 53'5 IMtitu"" OniYor:d1y ()( (in:tnw1Cll «l . .l'«<i< f~ . 5S6 ~. Ml!Cr, . 'r. { 1~7) Exl!"rim:nul hmlc:J ílAC lil><>' l)·-<:ol>li~ btildin oud mkro.<)'f>ICJ\lo' :>rauo rJ>IIIi-cmflhaeT•IIu f.iimsú. Frllils. 41, "19~-198 . 41 • .Shc. K. (~)S<>Yw>r~tQwork with~•r~ 'fbcBA(: ~ . 559 26. Mcl&r. J. L . & fl;>lli,y, l't·1~7-1). CMI IJ<:oeripilon n( ¡>Jih· llk!TW~>~<~~y Jo¡yflil!, J, 6~74 . 5-(10 ogcr.le 1\mp and ·~Jl ""'lm:e.

~...... : ' 0 T"''J'ltmT (1(,. ..

80 236

Fungal taxonomy 1 Taxonomie fongique

Variation in electrophoretic karyotype among Mexican isolates of Myco.sphaerella fijiensis

C.M. Rodríguez·García, N. Raigosa-Fiores, L Conde·Ferráez. L. Pernza-Echeverría, B. Cant o-Canché,, and A. J'ames·Kay

A bstrnet: The decrropl-nretic kar¡n type of t.b< filamentou f urQ¡q Myrosph<~endfa jijensis "''" do.tennined usi n.!l g.cnous eltctrir ftdd (CHEF) ~d d ertrr.phm diffcr, t.b< hi¡;OO,.t variati<>n in the bo.ndin,\! profilcs wM found in tk chromo,., m:~ wi~1 sizes bdow 1.5 meJlllb4scS poirs (Mbp). The minimol ¡¡;onome síz< ww: t-

Key wonfs: ¡\fyC~:~q.hacldla jijcMis. bl ac.k SillOtakA. cbromosome 1<1111th p:>lym:lrphísm. dectrophore.tic kar:yo lyJX', contoor-clmnpod homo~rn ou • eloctric field gel ekcUt>phnreias.

R fsumt : Le cnry<.typc éle:ctraphorétiq,u.e_d.u ctmmp'tpnon. fjlamcntcux M.v~D:pixr~n:lla ]:j:c11.Jir fut détcr:mln6 pnr é l ec trnpb:u~ s ur gd en chtt mJ:l"i' al.te.rrlé5 hl' m ogCnes fix.i1: ~ Panni LO i~ll..ttl!i ct pnJ'ICn'l.n"-C p!ú.gml'h)que dítfé.re:nto,. .la plu!' fo ttt:'; '!tro·laüou dm.1s. les p:u.ü1:.: d.e m:if!raúo r~ .tút truu.vée cha. l.cs c.hn:m~~(':tl.tc s. dn m tu tl'IUJe, é-mli en ~\de ·1.5 p<>ircs do mEgabases (Mbp). La dímensioo rninimnlc. e•timée du g6mno se si.tuo.it ur la camruction de l>nnqu« pmomigues s¡:&ift¡¡uos á. de>

.M fl.'l rlE.f r¡: M,W'.

lntroduction sizes :md nu:mbers of organlsn1~ th((t are difficr.ilt to study. u.s ing Cj1ok>picnl metl!Od.s, l:ecau.se of the smatl si:re of Mycosphauella fijiensis Mor~le t is ronsidered to be t.he tbcir cbromosomes. TI1is tcclnique lns ernbled anew npproadl mo.'il econDmi cally irupNtru.tr pathop;en of bananas and plan­ fr•· tllt' s111dy of fungtd dlromos !:ut:e .~: it allows to:> '-'ll:lWte tains (M11.sa spp.) worldwld.e. 1t is the onu~ of hlack Siga­ and analyz.e indi\'idu:ú chrnnlL'SOme.> in fungi ( McDmnld to kn or black leaf slre:lk di~~- D~ pi:til Uw ecooomíc impad and Mattíilez 1991; Fraissihet-Tacbet et al. JmJ. Jt hm ofthis funsus, llttle Js lm.own abnu.l iL' ge:netics and.s,enomics. prn,•ed. to 'be a Ll s~fLd techniqu.e fc;r localinttion. of specific Ne•er!hetes.s, two mokcuJ:tr fuhniques, ntío::rosafellitc mark­ p.enes on cluX>nu~nl:ls (Beclter et oL 1995; Chávcz et. aL ers and DN A rcstrictioo f:ragment l en~th polymorphism, ha ve 200 1), :lrld for geoeric mapping (Suga eral. 2002; Zhon¡:: et: l:een de\t> h>ped :md' used to stu dy pc;op u latiott genetics of aL 2002.). In a:ldit.ion, complete physictd mnps have been tltis fungus (Neu et. al !999· Hayden et al. 2003). d.eveloped ~itnthis approxh, nnd PFGE- sepa.rated chromo­ KnowledB'J ubour the p;enorre si:ze :md the number ru:ul sornes bave l:een med to construct or define clu·onn.sonl'!­ siz~ of the dtt:omosomes of M. fijien..rO­ specific gennrnic libraries, whkh l~el\'e aided in gene cloníng >i de a basís {CIJ' l'ul1h.er ge:noruic $htd.ie.<. Pulsed-field gcll und chronnoonl:l lll!lppins (Lol.tm 1995). By JreOJJ s oi ho­ electrophoresis (PFGE), t1t~ t eslnblt.shoo by Sel:twam nnd molosous nod ronserved hetcrologous gene probes, genes C:!r.tt01' (1984 . can determine k:n-yotypes (cllromo ro Joo Cltlt be tmtpped by hybridi7.atiott on PFGE-~epamied' chro-

A oce¡~ Uding uuthor (e~uuih a·ud yj007 (cid .;;y'" o"'.).

Con , J. Plont 1'\rd>:>l. 28: 23&-241 12006)

81 237 n'iJsomes. The mast frequrotly emptoyed probes ínchocle Tabk, l. Geosmph),al oiil;!ln of slr,;ns of My<::osplXll!.rd!ajijicnsl:r telomerk pmbes (Powell ancl Kistle.r 1990), fm¡;¡ments of i•<>lolcd frau 1"'""' ,;f M11sa acumina:a 'Grand. N of the kl.lt)'otype alld cl1ron:o.!1Jn:e length j.X)ly­ ¡,, det 389275 varillt ío n in k:.ryoty¡re profiles anxms 10 iscibtes of C2l3Hl Cbinpa~ 3S92i6 M. jiji,>nl'il· culled.ed ln different meas •Jf México, SNl#2C'I Chiopos 3892n 8Jt13eln Chía¡:Iotos "'"" O.,po.lii..' 2006), Ftmgn 1 ísolaies Lcaves of banana (Musa acuminata Colla 'Grnnd Naín' , subgn1up Gi~mt O twndlsh. J.'l!llOme AU) sb.owlng symptoms l'ulsed-lirld gel eledrllphot·csís of black Sig:ll oka were collecred ínr fuur banana-growiog re­ CHEF; one \:triation of PFGE (Cbtl ct al 1986 }. was gions c>f México Yucnt1n, Veracruz, Tabasco , and Chiapas;). u.1ect to separ::de Ü1t a:;t chrcm):>!Dnl'!s with a CHEF nn~r Momosporil· isol ates were obt ailll.'d by asCO"fll11'e discb arge apparatus (Bio-Rad). For the separatlon of chromosomes onto \\C":Lter ~s;tr (Jobanson and Jeger 19931 from mature ne­ smaller !han 1.5 nl!gaba!e,s pairs (Mbp), electrophoresis was croti c lesions on lenve.s. The identity of single-a~co.>pore perfmmed on 1% (tll'v) :¡garose (ptdsed-iield ce.1.ified, Bi o­ st.r:tins was con!innccl b)~ (ll the morpho!08)' ofthe mycc­ Rad'¡ ::md 0.5x TBE buffer (Tris, 45 nm¡o[fL; \;.;)ric adtl lium .and collidia, (2) the symptOill exprossíon ::úrer inoculruion 4-5 mmo1fL; EDTA, J m.moi!L, pH 8) under tbe following of banana leaves wlth CO illdiu and (or) ground myrelium cond/1') li!.fijiemis (Jahn:nscm and Jeger 1 93). The 10 isol::ues used stacial acetk a cid; EDT A, 2 mmolfl., pH 8) uoder the fo l­ for k~U)'Oi ypiug, thelr geogmphic¡d. f.ltigl tl, and ac;:cssitm Jowing cm¡d'ítions: 14 "C, a t'Oilstanl m1gl e ret at 106°, ru1d numters are lls-ted in Table 1. Al! "''<'re deposited nt. th.e ln­ 1.5 V/crn, with pulses increasing from 1000 to 1600 s fot ternatiooal Mycological Institute (CABI Bi oscience Centre, 66 h. Chro moSQmeslarger thnn 3.5 Mbp werc ,o;epa.rnted on Egham, UIQ. 0.6% (m/v) a,r.trose and 1 TAE buff'er under .the fullowj.ng ·ooo.diúon.s; 11 'C, a consmnt nngle set nt 106 °, nnd 1.5 Vkm, Pr·rp¡¡raHon wn in 100 mL of patato dextro.se broth .so~res of Sacclrm;mycer errnüíae Me)en a Hatt!im .st.raío (PDB), inoculated \l-ith !Jtl mg offresh m ~'l."cdi a, and. main­ YNN29-5 (Bi.:>-Rad), H an.11.~rw/a wi'ngt'!i Wick stmi n YB-4662- taint.>cl. ft>r 6 cl~1ys Íll t'onti lmc>u.s light tll 26 "C with sh.akíng VIA (Bio-Rad}, ~utd Srllyw!l.lcdumnnyces pombe Iinctner nt 100 n'min (l r =2 nrad), Fungalpl.ugs Wet'e prep:u-ed ful­ str:lin 972.-b (.Bio-Rnd.l •,tero med as nmlecubr-\\llÍ,I;bt mmkels, lowing a r3pid and eflicient m~h od develo¡;ed by McCiustro¡y The chromosornes were visuali1.ed by sf3ining tite ge ls fc.r et aL 1990), The mycelia were haryeste:l by centrifu¡,jition 60 min in tbe nmn.ing buffe1; contaíuing 1 : lO000 SYB R nt 6000g (a,'<' rnge radius, 14.6 cm) for JO m in :lt 4 "C. re­ Green I (Sig ma, Sl. Lou is, Mo.), and ph otogrnphcd un.der suspended with 10 mL of buffer STE (i;orbitoJ, l ruoli L~ UV tmnsillmnimtion with a digjlal camem (Bi o- Rad). The Ttl 25 rnmot/L, pH 8; e th ylened in:núnetetrnare ti e acíd genorne slze was estima red i:w adding the val ues assígned to (EDTA), 2.5 mmoliL), and. ground with a .mortar and pcstle. e:aob resol\'ed. PFGE band .. AJl experiments v.ere repeated. at Th.e m,yce.li~l weN wa~he d ag~1in in STE :md fi1Huly ¡esus­ lt> r~Sl . three times, ea<'h time wit.b a fre.sb tultute ru1.d phtg pended in 2 mLof SE buffer (s:¡rbltol, 500 mmo!IL: EDTA, prep:~ration , 125 rumol!L, pH 8), Tl:tis was mixed witb, eme volume oí 1.5% (¡nlv) .low-melting-point (LMP) ag¡tro9:.'- (Bio-Rad. Her­ s ()lf!ht>lll blof assw cules. Ca1if.). prepared' with SE buffer at 45 "C. and thi.'.n Gefs rontainíng PFGE-separated ehromo.some bamfs were pottred into plug moulds. Plugs were incubak'd in proteinase exposccl ior 5 min in.254. um UV ligbt Depuriumion, de.natur­ K (lnvi trog,etl, Cartsbad, C~1l if.) , 1 mglmL; EDTA, ing, :md neutmlizaúon we1e d.one follo witlíl .ltm.iard n~thocb 45 mmol!L; and 1% m/v) sodium dodecyl sulpbale (SDS) (Snmbrook and RusseU 2001), Depurination was o:mduc,ted at :SO "C for 48 n. Plugs ·Wi.'.re ihe.n wa~fied, and .stored in in HCt r;0.25 moL'L) for 20 rnin, followecl by dcnaturl1fion. EDTA (0.5 mollL) at 4 ~c . mi ce in a mixture ofNaOH (O.S mol/L) - NaCl (1 .5 mo1JL)

82 Con. J. Pl:lnt Pothol. Vol. 2$. 2006

F~ 1- (A) Scf\'lf~tion o( smatl-si1.cd ~ ht'MI09:)me~ ci My«Jspllaeld!<: jfjimsis by resis wllb <'rnus d«trk fodd en ~ b<, 19 .,..,¡fy t"' el•as tt:rai-uao chr;<:n> the ísol•te.<: M. [¡ji•nsidrom Y~r.'Utin (laue. '2. CIRADI 2.1 1: l•ue J. C IRADl 2.~3 ; ¡.,"' 4, F.GRRJC l; '""' S. NCH:R2K), Vc.nactu>. (lane 6, C1N3H2). Tal::osco (loo.e 1, Cl NIJ>4; lane 8, CSI\T2J>3). '"~ ChínJX~$ (la~~e, 9, Clt:!l! l; Lne 10, Slll3c la; lune 11. SNHI2Cl . Ei<.:tropb.,..,oic. c.ond.ití"'os spe;:ifi<\ to •nlliU.,;>e,d ebrornos""'<'-' •o:-d<,r.ibe .oeri>l~ ~nd meohod -. C;~ e""'pres

A B f« 30 nin and 15 min . For necllmlir~,tioll , thl!: ,gel wns suh­ ••¡g. 2. &par4rion of lar...-- iud clv-orro..,.,.,. of M>-casphact•:!la n~r~d t wke in :1 mixture of NaCI t J.5 molfL - Trls-HO JÍ}itASir qy Ckctl':.'j.ioc.-esil: wido CCI'ItOOr·dano¡>éd h<>nHl\qiOOS O.S molll) fu<- 30 min md 15 min. Chton'i:>»n'l~l DNA dedóc IÍm<>sorne w:os trnosferred to H bood"-W ny Ion filte.r {Amersham sizes w('f"e t$llm:tcd usq &Jt.•:pmcchar~»tryca paniH: Ph(l(macia Biotech. 1\scamway, NJ. b ropHlr.-ity, using dml'IY....-.•nes Oan' 1) ,.. ' "'n:Lrd,. ~.,¡,.,,... in c.-eh L>ne Hlx SSC (NaCl, oodium citrale) fur 24 .h. 'file- foher was ettr<'spond to thc is<>l'llcs : M. Jjiu.fiy h:m y...,...¡¡, ()Me 2, p;ehybridi:~~ed fot at .least 4 h in 6>< SSC with 0. 1.% m!V ORAD!Zll), "=rMrut. (!.une 3. CJN"..H2), T.tbal<'lnc 4. SDS and5~ Denbardt's $\llutJ.Jn 1 Denh3rdt's sXl Ekar<:ploorctio 0.02% .11f0 .FicctJ «' 400, 0.02% {mM polyvinylpyrrolídooe, conditíoo• spiOII><'> '"" "'"'ríbed in :md (J.02% vnlo-) bo\'il>e $emn albllnin). al 65 "C, and hybrid­ Mutm•l< '"~ m<'lh"O\\'ell and lGíótler 1990) wn.s ctll from the done pNia-17, using .HcoRt and Him:m. After pu rifirotion, 25 n,s. of the in!lect was labeled by mndom priming with Le.- ~ deoxy­ cylidine triphospbate dCIP), 50 }1-Ci 1 Ci = 37 GBq). and used as a. p;obe. Aftu hybridi:r.Olli on, the fih.-:rs were washed at42 •e on (mlv) SOS and oOO! in l>< SSC und 0.1% (mh') SDS, exh for20 mio . ~2J> «n lithl' au tor.tdiogmphy .filnts {RiollU!l" MR fíhcos Kodak"'j \\eJll exposed in un onrettsifying Mteen (Kodak) for 3 d:¡y:s.

Results FJedn1phordic k:tryoty¡•ts Independenl pri:p:IN!tions of'the .sn n~les showed that the Yu.c:JI5n h:td the bighestnumber of ~esolvable bllllds in tbe ba~dinol profilel' of the clootrophoretic k:ti)'Qtypcs (EKs) small-siz.ed rnng.e (nine hands), 1he isolatc CSN2P3 from wece reproduci ble. Tbe chromosomc5 rmging from 0.5 to Tabasco h:ld d:oc lowcs't l'our bands), ami tbe other isolnte. 1.4 Mbp were clea1y derectsonl:ls. To resolve nli!d.ium and !ruge chro· erni, tbeteforc, a hybridized bmd Wt!S e~~i!d for c~h mooomes, ®o\oe 1.5 Mbp, we te1n~ diffecent ektuophiXoclc b!md di!phyed in dlC EK p¡·ofíle. Ne\'Mhclcss. we cn11001 rondítions. Tite EK profile:! ¡Jtoww diff¡;,~ent numbers of delemline if a si nsfe b:llld oomprim

83 1'41- ~. S<::hcn\illle Jej>~JliJIUol\ of t~ ~""'ll'<''f1Mt>etk .kru:¡t> l}"f>'i ti . irola t .~-~ of Mycee< re.~.nll>ti c¡¡OI)S¡X>nd to !he .Í>;o~At~ : Myct~ sph;eal Jllso mc, ~cuuse iT h~h iate,uity of floo~sce•c.e •nd hybridiz~ti . on $Ó$n•l. Mbp 3 4 5 7 8 10 11 -·- · - -· -·- -·-- -· 5~7 -· -· -· - -· -- -· 4.6 - · llf - * - * - · - · - · - · - · 3.5 -· -·-·-· -· ---·-·-· 1.125 - -·.. ------* -· -·- -,. 1.020· -· - 0.945 - - - -·- =· 0.785 - - - - ().'750 =· -· -* - 0.680 ------· - 0.450 - Mhriwd 'cbromosome number- 11 13 11 11 lO 8 11 11 10 t ... t .. t t .. Minimal genome me (Mbp) 32 35 Z7 32 30 28 31• 31• 31 chromosomes. In fa.ct, the high inli!nsity of lluorescenre lates were oo~íous. Tbe largest ch romosco~ .identified was and hybridlzation uf SQm.e bands is possibly represen~:~ ti ve appro:dmatel y 8.6 .Mbp and t.he s1rorte5t oue w~ 0.5 Mb p. o.f .su.ch c¡o;erl::pping chrc-nlosorres th:tt went undistingui:>hed The banding profi'ies were. almo.st the .san~ in aH ísolates bemnse of lhis event Tbe lndicated numbers of chromo ­ for the largest cluumosomes, but th ey bada high varlab11ity .some:s and llf\Don-e si:te:s should therefore be considered ns 31ll00S the sm••lest eh romosoo-es. The:se results .sugge:st .a minima.l \'31 ues. different Lwyotype pattern for eaeh isolate; wm prisins S K! We did nut ob~sve any chroJtto~ me in tl~e mnscof 1.5 13 chrom0$0m:d band.s wíth estimated .si~> from 0.5 Mbp to 3 Mbp .ín any of the isolates (dut.~ not showu}. \\e fotul.d ttl approximatcly Si> lvlbp. Acrordins to tlúsdcttnninat.ktn, two bands lMger tlmn S.7 Mbp; our estimation of the m.ini­ the mini mal gen oroo sl!íl of M~fíjiu~Ji$ was estima:led to be mal .sí::.e ctfthere bonds WllS 6$ll0d 8.6 Mbp (Jig. '2). ln the ill the .rans,c of 27 ro 35 Mbp. res:.Jution oflarge chro.mo9:1m:aJ bru1ds, the Jin.útation a~'9) ­ ciare4 with !'FOB technique.s, in. ad.diriou ro the llck of a. re­ Oiscussion liahle commerci:ú :;i·ze marker for chro tl1()$llmcs abo\'e 5.7 :Mbp, could le:td to the undere&ímation of !he chromosorna P.PGE of 1O M. jijktMis stmins loo la1ed fro m !vlí!cxieo re­ :numbers ~md s,cnome sizes of tiJeSe isolates. H ~we-.·er, tak­ ~'e:ded. lhat tbis plant. ¡mth.ogen rollltlirr.> Jtt larphism, The im3te mínima.! sizes of tbe iwo largest cbromosmnes abo"-e minlnnl s,cnome sl::.e of tbe~ lsolates w:IS e.<;tl moted. to be 5.7 Mbp ro oo 6.. 8 an.d 8.6 Mbp. bo.Jt these si tes :sh.ould be OOIWOOil "2:.7 md 35 Mbp. whkh is in the ranse of -th e se· ro n:>idered. a~ !entalíve. oome size for Oml:J>' nsc;omyccte f<.~1gi. tln i~ ru:ound 30-40 TOO rosults me Jchemrdiclll ly sunxnarized in Fig. 3. Dif.· Mbp. Jn the first rep:xt of too El; ohl:tiood fur the ,related fermcc:s in nu®ecs and sizes o.f cll!omo;romes in these .i.oo - fungus M)r:osplmcndla gu¡millicota (Fuckel) J. Sd:Jrót.,. 14-

84 240 Cm. J . Plant Pothol. Vol. 28, .2006

16 chrotm.!lomes were ob...,rved (McDontlld and Martfnez sr.ry .to is::illlle !he DNA from índi'ddual c-hromosonnl bmds, 1991), n1Q8Íng Jn size from nppmximatcly 0.3 to 3.5 Mbp . digcst it with a rl>stricttt'lll c¡¡z.yme, separate it in 'IS":lon-ere ~(!(j \1\'llt:e (Mi'lh et al. 2002). Tbls dlscrepancy could be exphüned by tbe et al .. 1995). romigratiun of simJI.ar-stzt!tl cltn.>n1c~'omes and could lll~ l The elet'trophorelir klrryolyping presented heJ? has esl:lh­ be dtte to tbe diffcreol clectrophorctic cQoditions usod Of lished a relíabla molecular tool to charnc~erí:re M. J!iie•:sis diffemnt M ..~ramit~icola slfllitu. l9Jlates. In th.is reg:ud, the OJmpleLe gemnne of M. fiji~ nsis The lacl.: of chrotuosomes in dte range of 1.510 3 llibp in wín t;.e. sequenced in 2006 and. 40 000 ex.pressed sequence al! isli[ates was unexpeced, Cl'lnüary to tbe situ.ation ab­ t~ will b.: U\"J.ilnble witltio. the DOE...JGI Community Se­ serwd ln M. ¡¡rominiC()/.a, where chromosomes in that size quencing Program (US Dep:vinl."nl o( F..nergy- Joint Genrrne ran~ huve be.:n reported fKema et al. 2002). On !be ilther Instítute 2006), Pbysical and ~eni!tic mappinB of M.fijien:sis hand, we d~tected reproduci·ble EK~ for each Jsolnte dudng could lemf to tbe deve!opment of new .!traregíes for tbe con­ 2 years of repeated subcultucing and sarnple prepar:nion . trol of black Sigatoka. Tbis work would ínclude cloning and Thl~ ~'Ugg;.>s.ts llmt tb.e EK differences observed lo th<': 10 cbamcted:úog ~n~ of .interest such as tho.li! as.sociafecl ¡solatt>s are not artifacts doo to the experimental conditions, with :t\'Ü'Ul.enc~, pathogenieity fuctors, and. fu ngicide resis­ but probably ib.e n."Sull. of recombination among i~olate~ tance, usin~ a map-based cloning str,oregy. with di'ffewnt karyotyl"-'s, a.~ d~soibed ín ot~r fungi (Vallejo ct aL 2002), Diff~rences in chromoliome number nnd cbro­ mo.sotre !ength. polymorpbisms bave been ob.<;e·t'\tler (Universiiy of Minne$01.u, USA! 2004). Severat studi~ have docmrented tnat. chromoson:e for provlding the telomece Iragment used as n rrob~, oo.d length polymorpbisms in fungal sttalns could he deri\•ed Dr. Jenn (.'<:lrlier (Ceutre !fu roo¡:én:tíon intem::tioMle en re­ from ~noma rearrang,errems.sucll as trarulocations {11lrash­ cherche (lglt11ll1lltlqtle pt-ur le M.elopp!!neut (CIRAD), Fmu~ Binglmm and Gorm:UJ 1992)·, deletions, insertlon~. or d.upli­ for the ClRADl23l and C'JRADI233 M. .fiJimsis strains. catíon.s ro probably ncmes;;enúnl "'quenre~ (ll.iiüt> et·al. 1991; We also th:nk Q.En. Rosa Grijalvn Arango fc.r the Zi)lan 1995), 'Dtese polymorphisnt~ oould be rolated to pb ys­ maintenance of t~ fung.al i.solaLe~ from ,¡he Centro de iofogic-~1 dlff~r~nres , or may be due to tiJe lct'> of sorre Invcstigaci6n CicntJfica de Yu~:li .áll (CICY), Thl$work \\·M cltromosontes, known as supemumer:u:y dtromo9Jmes, financed in pmt by the Consejo NacÍL-.tal de Ciencia y wbich are not indispensable focthe sucvíval ofthe orgMism Ternalog!a (CONACYT. Méxiro), ptojocts No, 37602-B (Frnissinet-Tacbet et al 1996; Kci jcr et al. 1996). Dispens­ and No. 40936-Q. able cbtotnosomes may contribute lo !.'l"l.l•mc variability of phytopallmgenlc fungi, ~s th.ey can :ú1er the potential of fune;í to parasitire dit'ferent hPSts (Akamat,"Uet ru . J 9t)9} by, References for example, rutering resistan reto phyttll!:.xins Mino et :.U. Aknnmtsu) :u., Tn~. ~ ~ -~ Kodnma, M~, J'ohn ~ n , R., Otnni, 11., 1991; Covert e t ru . 1996 ). a.nd. K<>luooto, K. 19;19. Molcoulor knr;nlyp:,• l'ltins. Curr. culf)• C'L1r0UlOSOOles h'ger· than 3.5 .Mbp, we triod, ,in this G'cnll. R.. W•dl>r, H., n.nd 4.6 Mbp, since M. fi_iiet:tis seems io haw hrger chrmno­ Olher; ~ .G. 1995 . Chromtlsorm; polym.,rphisrns el ose to tm ('ffi­ somes. Con.'lequently, we determÜJed the minimnl numbel: ;\DI:J lo->u• .of C.:ndi&; n~alrosa , M.ol. Gen .. G'cuel, 247: 5111- llf chron.1osomes ft'f eac!J ls.1late. 111ere :.-e no mo1e.::u.br­ 602. wei8)tt mnrk= a'•ail

le to <.'Stimote chromosomes larger Cbiq::r., R~ J; ierr~ F., G•rdillo, P., ~[arfín, J.P., tmd ·tñarl 5.7 Mbp , bu f, Jt. bas been possible ta :~Ssign an ¡¡pproxl­ n!~ zr.aguint:* J. 200L El~trop.horcti c. L:-..lf) u type c:d' lhc. ftku.nen­ m.:>­ S oc.) Mi<"~biol. L:tt. 205: 379--3S3. somes, os reponed for Coch!iobolus satim& (li:o & Kurib.) Chu. C., Yollrl\tb, D., and ¡¡,..,¡¡¡, R.. W. 1IJS6 . Scpun11Í<>u of lar,:<­ DNA m >kur<>¡,"·"''"" •""-trie fieln. D.C.), 23il t 1582-1585. geste.:! by Ute brighter fluoresrenre of some of the band s as C.mrl, S.F~. Enkuli, ] .. Miao, \ :P.\\\, \á nElt~n , .lLD. 19-)6. A wellos a higlwrstgn:llin autoradio~rom s (Fi~. 1A, 1B. and ,sene for m.'l~tt..kial:n detoxif.Clltion from 01. d.ioo•C.~k, n, 1'. ar>d ¡¡¡,...,, M. 1996 . if unresoh, we detesponding lo tb.e smaller­ sfru~tu :re oJ ~(-.:oo.sph.'TUC'lla fiji~r.s'is pcpultltic:ns t'rcrn Aust~n­ sízed chromosonl.'s among tbe isolates are notan artífact: lia, Popr aN.w Guittto. ood the Paoiftc Jdonds. Mol Ec"J. 52: du.e lo DNA manJpulatí.on. In Ibis sludy. the bybri.dization 7 0 ~712. pattems t'Onfumecl the EK predi le il1 al! Jsolrues. To deter­ lntornatioonl H~... olo:;iml In. títut•• 2006. CABI C>e~~

85 241

tional M)"o l o~ i.:al ln..-<11, ~\\A .. ,,. .,.¡ Ki stk.•, 1-LC. 1g¡;¡¡), In vivo l'C~rrangoinent of http :/1194.~03.77.76/¡;rcli ndcochtm f""'-·• •scd J>nu•r; ~006]. fuJt:í.gn DNA by rr~&1riíun ox.r.'SfJ()nm produces li.ne:rr sc.lf­ .lob1m"''"· i\ .. nnd J-v;.r, MJ. 199J. u,.. ofPCRf<>.r cktcctilm <>f rcplicatin¡;rlmnid.,. J. Bo.oteriol. 172:· 3163-3171. MyeorplmaN1fa fijfrr.rir tmd J.f. musicol~ th e cmtSnJ ngen~ of Snmbrook, JJ'., nnd Rus,.,ll, I>.W. 2001. Mol.C., • nd Co.nwr, C• .R. J 9134.- S q;w-t11ion ..of J'""" M .G. 1996. 1-fsome-sizcd DN\s by pulsod. f•eJd grnd'•ent gel eloetr<>­ and between alll$tOnns:is ,srou.ps of R h t~ctania. so!ani. ]\..1y!!ol. pboro&• . Cel~ 37: 61-75. Ru. lOO : 789-797. Su¡¡a, 11 , lked!l, S., T»¡¡u, M., K!l¡t<}';lma, K., ...,d N>n>a, G.H.J, Gooowiu. S.ll. Ha mx..,, ••, Vtr•tapp<•n . .R..CJ'., U':--rnkun-.~u: hi, M. 21m. P.JI!'C(ft.ljlhGxtd:c .buyctypiog mtd ge ne Cnol•tto, .).R., Von 4.r L••• T.A.J., W•.rdt, M. dt, ma.pping ()f1 ~even fotm4C." ~~.ci..'l Jes i n Fasañum J()/t.:.ti. Curr. Jlononts, PJ.l\-t, and w.. lwijk, C. :2002. A com.bincd Mlpli­ Go:ne.t 41: 154-'260. fied fr•~n-.:n l l ch~h ·p t~y m <• rphism und rundomly amplified Thrasl•-Uinglwm. C. . •nd C.rmon, J.A. 1 99~ . DNA polymorphism DNA I!"Rt. 22: 9.1-1 OO. Genetics. 16 1: 1497-1 ~ 5 . IJS O.parinwnt of EnorJl..v - J oint Grnom<~ lmtitute. 2006. !'>k.Ciutke)', K ., R""-"'U, U.W., •uKI l\-li1ls, D. 199 0. Etcctropbo­ Comntunhy !b:jucncín¡¡ Pro¡:;ro nt [onHnej. Opcr•tcd by the ·n:,tk. .k atpltypin~ w'itht1ut tbe nccd ftn ~tcrrn.tlng pruhlJJI:t~.s . Un'tversily le fr om Md)onald, U.;\, and Morlín•z, J.P. 1991. Chrcrno L, Carl.IIÍ. M., Muñ..,, K Robnr.dítos, 1 ~, !I)'Otinia Soience (\\lt< hi i\SlOII, D-.C.), 254: 1773-1776. ful.'kdicr..:: (a.J\:lnt. BQ/t;dis cirwn:.,). Myr spccia. J. lla•ic '2002. A mole <.: ulur pcnc(n; mup wu.l d e(.~ lr C'J:h t.Tcth: kuryctype Microbio 1. 44( l): 36-4 L ~)r tlr:, ¡1lu.nt 'P.(~i h:.\bvenk. fu ·u gu~ Curhlft1lniu.f Haivu.r. Mol. Ne:u, C., Kt\f.1rumi!r. D.. K~hl , C-... Fi.s.C~r, D. ~ ~nd '\r~ i sln~ K. Pl,m-Mkrroe [nfemcc 15: 4Sl-49l. 1999. Polymorphlc mkrosateJJitc. motker• f<>r tb.e bamn• patbo­ Zolnn, ~u;. 1995. Chronnsome-l en¡¡th p ol~morphi gi. gen Myem:plwarlfaflji

86 MOilCtJ!AR PIANi PAfh'OWGI" (2QQ1) S( 1). 111-120 001 : 10.1 1111J. B64-3101. 2006.003 io.X lsolation and characterization of the mating type locus of Mycosphae·rella· fíjíensisl the causal agent of black leaf strea:k disease of banana

LAURA CO NDE-FERRÁ EZ 1• .. , CEES WAALWIJK 2, BL ONDY B. CANTO·CA NCHEl, GERT H. J. KEMA 2, PEDR O W. CRO US3, ANDREW C JAMES 1 AND EDWIN C. A. ABE LN3·t 'coobu á? taltei~Ci!n Cimllfl'(;J tia rocJ:Íil (CICY), c;,7a.4.JI'JD. 131. c~ba7!5domo'J.'go, C.P. 972W. M&idJ, raa:Jr!. ~!>J!Iw 1PIJlt. l!l!lllii!"ChiNIS'I!illl'0111f6. V., ro Bill' 16, lil{)iJ M }'i1{11r!'ilfli3l. lbe llell'l1dill1¡j¡ 'CmtEillfW(!;IrtVaJl Schlmmr!!'CI!í'lrm¡, FurgJ/ D,\1(\10'~' COOtrl: F060X 65!67, 3508 AU lllrrxht 1111 N~f!!li111ris

The crop is .affected ~ severalrdiseases and pests suc.h. as the SUMMARY foli¡r funJ!I (Xl1fngens .~1)~osphüefflfa fijíffisis, M. musicola (anamorph Pseudourcospora fijieriSls; iS>J iated. Deganera11e ollsas were u;ed t:> amplifythe HMG 'box Mycosphaerellaceaej is the caus;al agent of !liad: Sigatol t aL, 2000). This was recently both idiom:nphs as 1·~11 as an ad:litional intron within the exempl~ied bytherapid development and spread'of resistanc.e to alpha· box. The implications for the evolut ion of ~pecies in the s1roolurln fungicides ín Central Ameñca (Marín er ~.!., 2003). Mycusphae-telfa oompl'ex on banana ar·e.· discmsed. Owing to th.e fact that Mycosphaell!!fa is cm of the largest g:nera of pknt patrogenic fmg~ 1v'rth ma-e 1h 111 llOO M;cosphaet~lfa spedes (Aptrc>:~t, 2006), Goodl•rin et al (W04) prop:»Ed M¡cospht~M.~agramiricola astlle w:>ódng mxlelforthe Dothideomycetes,As a result, the geno mes of both M. !Tamiricola INTRODUCTION .andM. fijiensis are rurren~ybeing seqJenc.edwithin the DOE-JGI Sanares íMusa s¡:p:.) are gro\'ill in all 1ropkal regbns of the (ommunity Sequendng Program {see httpilwww.jgi.doegey,¡l world a1d play a key role ln the erat1omies of mJ!!IWr.a't!n1ril. .regions com1110n to d ~ olates of a gwen sped es, and from which

Q 2006 BLACY.WEll PUBLISHII·lG LTD 111 87 l12 L. CONDE-FERRÁH etaf. the only conser;ed reglons are dBigmted as the a'lpha baoc ·(for (E =(i... ·1O) and S. pa. 5~tinii (E =1....09 1 srowí ng 71.9% ídentíty matl-ll ami the HMG box (for matl -l¡ (Turgeon and Yodet in a predictecli 82-amino-acid .sequen ce. A mukiple alignment of 2000'¡.1n addtion , the siructure of the matidcm01phs has aided tbe pre d cted ami no a d d s eq.¡ en ces ís ¡::resen ted in. Fig. 1a . in un d!r.stan d ng íh e evol ution of hereroíh alllc an d homotha Ric In additíon, DNA lyase and sial hon1clo~es in M lif!ensis !¡let.:ies (Póggel:r, 1999; Turgeon, 1998; Yun ~tal., 1999). were both aJ11llified by degenerare llCR. A 1200-q, aiTflhcon P6 Myrosphat'fefla leafspotdisease in 'banana iscaused by srowl:'d homology ID the put:~ti·ve SIAl pro1ein Onvo1-re:l in a coiT]plex of at least tlm~e s:pecies {M. Arzanlou, personal cytoskeleron assembly, whh no known functi:m in matingl in c.ommunícation), knawlecf!Jl! ofthe matgEJ~e; sequences in M eyiensis Aspe~g i!fus. rumtgatus (E= Ge-85, '87% identity; GenPept is a starting pcint toa better understanding ofthe relevance of access ion na EAL92953 ), Magnaporthe grisea !E= fe-85, 78% repnxlu ction a nd reccm bin atkm, in relati on tJ !he epidemiology id!ntiiy; GenPeptaccessitn na EAL92gj3j and Nwrospr:xa aassa of .tñ!:se.inpcrta11 patOO:¡elS a1d the hti:ra::ti:ln with otra- speaies, (E= Ge-85, 73% idi:ntfty, Ge-!Pept accessbn no. EAA35004). We presum:d' substantial S}'llleny bet\•~Een M. gritminicola The 850-lJp amplkon slm'led homalogy to Df.IA l:¡ase from and M. f~iefiSis as a basf; ID i!IJ iale tl:e matgenes of the lnr. severa! other fung i. Further on, a DNA wal.king strategy was l'ndeed, a PCR-basecli strategy using th.e DNA ~ase gene, whidl employed using the· DNA lya1e a~ inkial anchor. This strategy flanks the id iomor ¡:ll~. in M. graminícdi!, allowed cloning the resu lted in a !l'! 17 -tp genomic sequ ence eco tai ni ng the romple te matl-2 tdicrncrFil. In tu m, the llanks of the mat1-2 idiomorph DNA lyase gene, a gene encoding 1he anaphase promoting W!EI'e used to cbne ihe mat1-l lidi cmorph by kng;·a1ge PC.R. canplex IAPQ a1d íhe mat1-2 idion'IJtph (Eig .. 2). whid:l was ComparatM= analyses srowed that both í:li:>morphs contain a deposited in GenBank with accessbn number DQ787016. hig hly un usual inversion not previouslyobsef'l!:d ln idiomorphs ln TI1e DNA l¡ase Slfeluen:eobiaii'P-d is 1858 bp lo~ tre predktro other as miTo/celes.. gene has a. sing le exon and 622 amino a.cids. lo.cal alignmenrs sho\-.ed up to 70% identiíy in a 1();-amino-acid stretch (E= 2e- 1 ~8 ; 82% similarities) andup to 75% identi1y on a 65-amino-add RESULTS pcnion{E = le-95, 78% similarities)wi!h ihe DNAI¡a>eSF.! reported militar/;. forM. g1aminico.'a (Waatwíjk ~~al, 2002) ancl Septoda pas~tinii ru astx analysiS oo il\e nml-2 idicm crph sh owed only hcrn clo~ (Goodwi ll et al, 2003) were , unsucrusful~ assayed. However, wiíh the HMG be»<: regim of matl-2 ircm M. yramir.icola, ~~ith 1he degenerate p:imer pair KIKRP-F + SEKKR-R (.f fur fcrward expa:ted va1ue E= 6e-69, on a 40-amho-acid stretch (67% and -R fur reverse) (la !:le 1) ¡::rcduced ampliccns with. the irent.ities and 77% sin1.~aritíes) . The next hit was matl-2 from expected size Df a-ound JDO q, in somll isolates of M. ffjif!lls.'s. .S: passeñr.i¡ with an expectedvalueofE = re.eal;rlhJrmiC9l'wtththe HfYIG boxfrom M. gramtnlcck 1•.i.1hil)'íhe mat1-2 idiomorph .

KIKF.H 5'·.¡\>\G ..IJ'CIJ,fjCGKOJIJY:, .. J' Jrwll-2 rrorn M. ;Ql•mWí!!.G ard s. fl1S>OiTh1 SCKKR·R 5' -AJ'GC:GI\I:GrTH:HCICSG·3' llf!tf.J linm M gr.~mJOíwJJ ard s. p;¡s;e~:;n;¡ CI.JAi yd~F3 S'.CGCGCCGATC ,o>¡;;;!;OC NGAAG.'f:.GG·3' Cf·AA l¡ose frorn M: f¡Jtlliiti:O/J,. II. WSSJ, F. f)(d>'nlill!i1i'ih1l, M g,1!m ~nd A n.lift.\óii JS DII A~'Ua]R3 !'>·CAnmcncGlGlCCUJ.YP.IlGTP..B ' Oti A t¡;r;e t orn M. f!Jm.ntoa 11. CGSSJ. F. griNM1u!JV.Gt M g;ls..~ and A n.idti;JIS 1 DtiAl¡ DIIAI¡;r;eMIR '!/-1GAGG TITCGMKCG ..~TGG · 3' DtiA ~;r;e torn M. f.¡iemif SLl\l ci2~F 1 5' .U.TCA.'C.GKC!:J:.>.A YIS.o\P.GG ti t~YGt\ · 3 ' $;¡2 rrom A n!l.t!!4;!s, N. trá5Sól S< and M. grisea. E56 5' ~ O:CTCJG(i/!, CC..AGGAlACC~~~ FlantJng r¡gJJn ur&tl:!am á M. ~,iún">. ~l:•mph s [66 5' ·H:GCAMATGI,G HGf.AI\CG ·3' Flanklng ~l:lns.dmln sttea mofM . ~,;a~'l:ll:lmphs llan 4l39·f 5' -GCGGT1TT'GGf..GCGGTCAG(i·3' Flan ~Jng ''llklr& u¡:&ri!.l mol M.t,r:emJHI J:m:Jrphs lrTfG565G ·P. S' ·GMGCTOGGGTATCJCAG C.N:AGG·3' lniNtnd !l!qJmce •,tthln ldlanmpt. (u¡ctr<>m m:tl-2) 1111G848G·F S '· GCACCTCAG•;G~GGCf..TTGG · 1 Jlli'erl!!d st\(Jlmce \ltthln Jdlcmorpi'li (dli.I'Mteam m¡¡fl.J) ftln 9352-R 5'·TGAfGCATCOGCCGAGACC·3' fl;nkJng r~lo r6 dO\Imtt:.

MOt E. CtltAR PLAN/ PAfi!Ot.06r(ZC•O!) S(li, 111-110 e 2006 BlAcr.'liEll ¡•UBLISHII'IG l!D 88 (a) HMG box

~-{...,... Y - <~~

li.V'•11-" ""'• ..,;¡ t:.. f• ~~ ~JH .A &r '*, t;. t!,V~f' .;.~~¡.,. F: t"f~\1 \Jf L.. .m.Y.i.J~ ' r;,cr"nl' ~ ...... ~ r. . {b) Alpha box

#.f•}!(-fl< S4•8tMlt•1 JA¡¡<~,;¡w,¡.,. SCI · -~ $.- ... - s Cl~4nV<;~s r.o;;v~ L; ->I'J.rli 11.,.,.... P,~ ­ P..bl!:s~e

Ftg ..l ~tubtpllso:¡ICJK(! 411JIIn.lm5oi ¡mdtloo ~mlao<~.."ÚSjoo/,l)llll! Ht.lGb:oX."/1 (ipB~ ~?¡wip/JJB'?C~ mi/SIC!l~, SI'Jlólli~ p~kll/, Cod\7oba!ü! h«i5:!1!i:O,co.'Iis, S!J¡'diG>'il ;:.;¡c;u;pa;¡¡,.;t,~ei1l<>"í1 ll~rtlll¡¡. co::e:o:t.ctJvmJ!WSilfi. camllrl/Jci;.os.s;:Nus. FU2riar. 1J93¡Jlrom, t~ln$1bil!Xi111JRaJ/JJs. NCi.l~tpiXUiiSI!fi!1alnd {yrol(]ff!lfla llr~e. 81.<1:1:. <1'10\\S rndlaitHM polltiOO$ á the CDM:r.'W ltl!01'6; the gl!,' arrov,• llldGill. long·range POI lsolali011 o( th~ mat1·.1 kMmorpb <:haracterizttion of the idiomorphs

Lorg-rhgp(llll!'l'se1cbl~the of m mi!t1·2 l:llana-¡tl (pri!rers ES6 an:l €66, Tabl~ 1) re51.1itoft ' ~Jdbrootph s, the nud:ot~seqlF.'Il<6 aod a sbghtly smaMer fragment (5 .2 kb) In others. This Sl·kb al ml!t1-1 and matl-2 of M fQf~iswere lllígned in Clu~aiW . fragmentwasidentill~ ascontaining the mMH idíomotph. Tht Tht sequence similarity bt!!ween thefl anking regíons, whitl! had seq¡ente WM cltposiled in the GenBan k databa~ \'4th aa:ession 95.2-98.4':1f ickntlty, differed ·signifltantly from that of the r~ DQJS7015. Thbstxanlllysls of the mat1-1 ~ of idbmorphs (Fig. 3). We predkt~ the upstream ends of the M. fijí~sís sOO.ve:l h tle lll¡i¡a b

C 2(;06 eLACY.WELt PUBUSHING LTO UCifCt/JAR PtiiNT i'AilfCUXiY (1001i 1( 1), 111-12(; 89 114 l. CONDE-FERRÁ,EZ m~

mat1-2

? 1 / r ,,1

FJQ. '2 Olag;n of M~ b:us ~albo h l1yrtJ~ll(lroi1/:¡.'i!ru:S. ~M~ lib.!~ Ntf.! ;M m~:J-2 J..'lféli!ll ti(! JIDn»ritll:tl(!~dj~.ml QMi!> ?m::lri.lll9l1SJ:!¡:R51ftl prirniS IISiOO ID btJ ·r;¡agl PCR.IftCXJ:IIIlll:!dd~~llt. •l .ll"!ariO\\CshapOO ton> lepi\':So:!lt IIIQ ¡:ro:!l:l¡lj ~~I(!Shll:llntpiOOb)'IIIIIODSillf¡l(k~:IIK!~OO OOI!s (...)stralll dllilltthet

Surprisinglf, the alignment shcrw~ tv.~:J regiol"6 wkh a high other (theendi ofboflldiomcr¡m lfig.3).ln M ffjiensl>a the $eq.Jtnct ofone of fle idiomor¡jls.This llFPI'Qílch adowed us pxtim of 1 t27 bp in 'l1e 5' e:o:f of the ¡r.dff·f ldb!mr¡:h 500.~-s ro~ t hea~:rplifk&l::tl h oreofd"~e~mthgt:¡pes .nJ abs~n::e 71% l:kntlty (kl nucleotm ~n::~ toa ¡:ortltl1 of tle 3' end of an ilfll'lk:on irllheopposlte rnatklg ~~~' and thereciprocat of the maff,lidiomorph, but in reverseor~atbn. TtF.samP.is sitlBti::m\•RI!>obseMdwhenmmbini19t\'"' re"~rseo r\\•Xlforward obsmed on the 3' end of matl-1, in which a 697-bp portion is p rime~s to pr~du ce amp k:ons fromt he óp po.sitt mdtíngtype (ñ g. 4). hígl~ysimílar (89% idmit¡i)to the S' end or ma!l-2 in the min~ chain , lntere1~ngly, this ¡jlencrnenco was not cbserttd \'#hen ORFffnd{¡g atri gm~ p!edfttfon f1e idíOII"OI)lhs ~ M. gramlnkoh, S.passffinii, Lepwsplíaer/8 The ¡:r!pfuffiJ nodctwt WffE: ~igm M'l«l9 ~h the con~ ¡11¡;11<1 f\!9bn 1s al~ h a predkt~ ¡rotein of

I.IOtfWtAJ/IlloNIPAiliCliJGY fl(}Oi) 8(1). 111·11& e 21:0(~ Bl.t.Cr.wtU PUBI.ISHII-~.H lO

90 generaly higher slmllarity ba\..en the m11tl -l s!!quentes, whidl ís remarkable as k has be en obst1nd in as.cornycttes flat the HMG box shtt.YS a stronger conserva ion flan lht atpha bolc: {Me ~al., 1997). Neveriheless, In a short 39· lmro.acld strett h of the HMG box,. íhe. canp.vison whh M:gr.ttr.lnirolawas a!>hlglas66% identity Md 73~himilarity, whlkt mat1·1 .show~d a k;.o.l!r ~rcen• of slmilarity but io a Ion~ st~ d 157 anino adds (36% identity, 46% siniaríy}. Ous1aiW ~nalysis of fle conserved ~lpha ;md HMG arnino add ~s of severa! aS

OISCOSSfOt~ l Amplification of tbe tiMG box \'ksw::essful~ ~ po$1Ub1ed syn!tnybet.'feo!fl M.fTW1kllcokt ~ S and M. fipfnslno cbne the mart·1 and matf·21diomorphs mat1·1 from ti~ ballf;rl!lh. lhJs. The HMG tooléli loca1ed ha oon<.Jfl"'''!<< l!:gíons Slfl9!!SI lf1at M. fijfflsls and M. sraminko!~rseem to be posltlon sha~ed by aH aS«Jmf:l!'le> (Fig. 1b ). Tile:!~!o:md lnuon more distantly related lilao pre~~iously apea:~ (in po~~ 2'319-2973) is utliqíle b Mycosph«~fli!c<-~ fijfflsft We dd tx~ sin~larity between the 11-.~> banana pathogens andhasno1been reportedín oth~fungi(Flgs lb a~ 2). The ron· A-t fjiemis and M, muslcd~r, and lndeed prime~ based a1 11~ served stqoence of tht alpha bOit woold be int~rupted lf ilis M. fijtriís HMG box~esuo:essltlypr«lu:edcn &~rpli::m lntroo was not f!Xcised The last lni'tn is loca11!d In pa;ltlon in M. musicoht tBlASTx aoai)'Sis of the M. mU>ic.ol11 ampliam 3143-3191 (Rg. 2). lreelttisbnof tle iMt Jwon I'R!Scorflnned by Y.Cilf!n:l!S 1212 bp)sh)\'J!'d ll:Jmolx.¡y v.iih tr..nl-:2from S. pitSfeffrli . ¡»ssetfnii ao:l M. graminicof;r (S~totfa When comparing ihe ldiomorphs of kf. fijlMSls \-.l th f!ose anamorphs). ftom M. gramínk¡¡f.t aod S. pass~inii, umg Blast2, the As~ In aH fungí reporte:! so fár, a sffi~ is found in the alignmt'nts showed that mai1·1 s~uen:es a~ doser to t~ consmed intron p05ition of the HMG bol\, whldl is prestni as diagonal than matJ-2 {data oot shown}. This indic;,tes a \~ in M. fljí~$ls iflfJ. 1a) ,

91 m; l. CONDf·HRRAEZ mi.

{a)

1 · ~~ a · . 't •• • ~ 2 ~ ~ · ...... : .;: . .. ______....:.. e .. ~ ,· ...... :.:· :~ .! . ' .: :: , .. . , o .. ...

•• ~ctQOam¡:lecat ~ maH-1 írt4tf·2 a nono ll17tp ~ l1

e 1+3 GOO~ ~ o 32Sbp 1I0M (b) ~

Ag. 4. PCRWlfklll:ll\lStru<~re pre!:mt 11 c;~lJ.l 11

ldomO!ph (Yd:oyama etd!., 2003); and AspergfKus fl..migari.Jf ChN~~ttéritn of the idiomCit'p~ iPaoletti et al., 2W>), \..tlt~ a fragmtnt of matt-2-1 is fwod We twothesi~ that the ínverted sequences in tht M. fijíffl;is wiihln~flankhg ~bn of ihemat1·1 idb!rorph. In a:lditiof\ ldiomorphs might have otiginated fr~m M invetsion evtflt in ~ smr, gven that indtpt•t l:.last anai}'S'es ofthe5t spp., villl:h \'.~!!re cal~d 'island; of i:lentity' of 8-9 bp, ard lll3'f rtgioosdi:l not result insigllflcarllhon'l)bgiesin tre dati!bases, irdicate recombit~ation spots (Yun et~tl, 1999), hcudhg ihe M. gram ílirol~ gstream th:;y W~fi: i1itlalty' ~ntí:al, btt dwgecl h'ol.gh SI.ICC!S$~ tnd oft~ idiomorph. To our knowledgt, the onlytwo reporu in ~ra!'í9!':mms and del:-tkln/ii\Serti:>n ~~ \Turgeon, t OOS).It which ldrge portian ofse.qJtnC!sofooe idicmcrph arelwnditl M> also ~o:o sug;¡<5ttd that the srrell1ra~fl1S <:4 i:!o:nticaf til!'oRX>sltps ~tao-u(~ Paedfcrrr¡'~ sequtnre that hwe been found In both idiOmorphs ar .~ ¡xobably tmip6). "i'lel'ea mitr.l-1·1 ~ 15 fwnd'n ne rrotl-2 remoants, expleining their tonllllon orígin ((o¡:pin dal, 1997).

I.'Ctf(llfAR ?i. /;NTP.A'iiiOt C(iY(.V~iJ . $(1 ), 111-12Q e ZO~BllaWELL PUSIISHING lTO

92 .------P. !>r;.. -

.------u.~ .----$.¡u1Wlri.

f ~;. s Nelglboo' ·!Oring ~togr;¡ns b3sal oo nlillple 311Jlf11ill1 Olth.: pral!ck!d a:111n0 :aaa ~lriJII(ól)Ú'ilUM:iboXlllol ~:tt(!\it; (!ilf'IK!spocl:!l prom!OO W1 FI:J , 1). IIOOISl~p S~! forl);l{h ooiH~M~D~(oi10CO -¡;­ rop!i:.1lbls). (o} (b}

In S~emplr¡lñ!msw. 1t \'laS foundthai an ínverstl)n.f\tsion event (AJ8845!:e~ The M, fg!t>rrsis idiomcr¡::lls stem iobe mo.re similar 9 n-r.>re dí:itMt!flt'l<~ted ~~s su:h as p, m:xfowm, in in a rr.¡ytlocus with ooth idbnmphs,ore of wlik:h was lnver\\!d v.'!lkh rr.atl·1 ls 4282 bp b\Y212018) and mat1·2 is 450S bp with 16p!{tb ti-e ~tñ:!Uicanresll'.lr(lirlerbiUin tt.t!, 2005}. tAY.!12019); fusitlbn ox¡s¡xmm (lr.at1-11s 4618 bp, ABOI1379, Convers~y, the hwerted regions found In M. ljiMSis' rorrespond and matl-2 is 3849 bp, A8011378) or & seciliír (11"..tt1-J is to non-<:cdng seq¡eh<:!S. \'ybefler a homO!haHic aoctsb' gave 40491;p,EMBI:AJJ37511 and mat1-2 .is 3153 bp,EMll:AI549759). rise to M. ffjifflsis as a hetero11aUrc spedes \\ith flis particular Conversely, o#ler sllgle-gene i®norphs can be much shoner, feilttre, ~ pro¡x>sed for Asp~!kls spp. {PI».'ll=ttl ~t ilf., 2005.), is kr elm1¡l~ (. heterrmro¡iuJS' idianotph mat1-1 is 1297bp aq~RS~i:mtñ:ltcan be a:ld~e>.sed wlt~ thecbnlogof th~ mlldng (ARl29ill~and mal1-2i.s 1171 bp (Af0276S7). tj'pe ~ of other cl:l!le MyCOJPhat'rt!fd l'!kltives. Tll!'S>! ir1~d regions represtnt an IJlllortant flnding. which tan be the basis Synteny amoog ascomyatts for furtler !Vclutionary stldies on horno· and hetft'othallic spedes i1at .are rtlated to M. !fi~ns~. Wt osed synteny to isr.late.the ídomotphs of M.lfjiffisis by DNA \-.aJ:ilg ~l»red en a flms) ttal, 2004). 1! has been pro¡:osed flat1he coomva1ioo In .9!ne (F05~nnd Rtt, 20~: Turgeon eurl, 1993), lhe boondaries of crderin thtvldnltyof 1he m!'t locus ls dut »suppresS!!d recan­ trn idíom>rphs n M. f.j~is ared!!f~ byhlgllysimilar flark- blniltion i~t .fs ca.1sed by tle dissln11arlty of ~~ ,id~ 1rg ~. bot 'In otber sf)!des (e!J, Phaeosphaffl.!J t'IIXicrom and sequeoces.TJw;om.rri.:J<:u; of S~~:vera l <19:orrtytftt-specii!S 1\:ls ~ N~/J/wpore t1'li$Sa) there is ooly a g!adualtoosltíon f~<:~m tle chara:~rizec:l in dftaíl 1n :yí!.;m spec:íes .such as Sacchoromjtes flanl:ing region to tht idiomorphs (Benneit t tat, 2003; Randa U rerevi>f8e, S. m~f!if, Ciindkfa ghlxatt'l]!1' tamhetffubg.6n M. grM!liflii:da{28~ bp regbn of t~ idiomcrphs; in otm ~íes su:h as S. f:liyvtrf, fo r matl-1. Af440399, arrl Zl7l bp for msfttílllí {}J4S bp ror matl-.1, Af483193, .and 28W bp !Or bca~l ~xt to ti~ sfii2 gene (llutier t't af., ~~¡ Oeboc~ and matt-2, AF483194l and Xan!h

e 2006 llUCKWELL PUBUSHBiG LTO JJCLfC:tJJAR PlANt I'AiifOUJúr (lOO Ti 8(1). 111 ~ 12()

93 118 l. CONDE:-F~RRÁEZ. et.1f. severa! sped3 af Fttsariom (Waolwijk eta!,, 2004}. The DNA catbn of tlle mat gell:S will provide. furtller evi:lence for thf; \fase andAPC genes flan k the ~rutidiomorphs in .M, gami1icola observation, because :populations with a high ocwrrence ot (Waalwijk:et a!,, 2002}. 1n L macdans an orfudog.~e of 1he ONA sexual reproduction, 1vould have strains of OfiPDSite mating ·type ~ase !J!ne was also foond in ihe same location (Colifnse~ and distributed in a 1 : l ratio (Zhan et .a/:.,2002). H.::r.vleit, 2003). In fa:~ data minirg peritfmed dtrio.;J 1his work The hi!tJly simUcr inv&ed regbns 1hat we í:lentified withn showed that orthologu;;s of thoe DNA lyase gene are found near tlle i:lbmoqihs of M. fyiemis, and ti'P- a:lditional intron fi:lund tlle mili locus in Glomerella cingulatil (A.Y357890), Sordarii! within the alpha box are un que fi=atur=s, which will re useful in mocrospora (Y10616), P.telxl~e> (AB084921) and C mifitarfs evolutiiln studies, Ongoing studies h<~~~t shown that both are (ABC€4257), 01her exampes of fungi' in 1..nid1 both 1he DNA presentin 1he·.mai!J!nesfrcm M. musiC:ola, .sug:¡esting thatthese ~ase and the sial !J!nes flan k the idomorphs are Y.lipolytica events occurred befcfe speciatien (\., Coo .de.ferráez, un¡:u~ished (Ci\38212g¡, Xamhoriil pariefina an:l X polycarpa (AJ884600 resu ks) . Fi.nure wcrk focus ng to thesecharacter.ist i:s III'OUkl give ancf AJ884598). additional information about the f:'II01ution and ecology of 1-bwever, in M. f.iíensis, it is unlilo:ly that ille sial gene is tlle g­ relatior:tship ard e110.lJtion. logue was present ln at leas! six diffi=rent 'BAC dones (d~ta not sh:mn), but hybri:lizations wiih diffi=rent h=terolog:¡us and EXPERIMENTAL PROCEOURES homoloyous mat prob es suggested that slal and the mat idiomor¡;lls are nat physically linked in M. fijíensí;, 1\nic.h is Fungal isolates and DNA.extraction ~u ¡::portee!~ the draft sequence ofthe M. graminicolt to !he hi1J seqLP-nce di·;agence within the icicmorphs, at'rl5. pas;erinli isolates of kmwn mating type as corrparisons reflects theírnportance ofthe matlocus in dete.rminirg a spe etal., 2004), The identift- and its dose relative S,passerilll( andtheONA IJa~andthe sial

lsclate spocies HC6t M<ílngi)lX1 Ge~r'lJhiCdl orrgln Récrerxe

1?0313 M. Qi'illlii'l!it:d~ whca mm.t lh~ r·Jclhcrl;nds r.crna rr <11. (2002) 1?09~2@ M. gram. :o{ro~ 1'/he1fi Ba~C(i Jl!O'tf.f USA Gae>d1•1n f!t ;¡¡, (2uu3! 1'16 s.piliSi!(inJ Ba~ey mJtf.z USA Goodlí/n .e.t.?.1• (2003j 86 M. lb'¡'t.'I'HIS. Gr::o.. t.l?,\kD 11l~ ·•l.lrk

'llll matlng ~~e 1351~rstralns ha';e boon U.Jji/IJnal~·de;t.lnalld as 'A: and 'a'; In ihiS\It:·rl: l t\\

MOLfCtltAil Pt AA'iPATii010GY(2001) 1(1). 111 -120 tll 2006 BlAcr.'liEll PUELISHING UD 94 ~d ation of Myccspf.al!fel/a fijiensi> id icmcl]:lls '119

genes frorn SIE'Ve!al otrer a¡¡corny:etes, to d~bp deg=nerate sequen:es (httpe.liw.wl.nd>iJJim.nih.gowblastlbllse:¡lwblast2.

Aptroot, A. (20C6) Mycc5phJet~N) ~nd Hs anlmorphs: z. cons¡:fctus P~ confirmation of inverted se<¡uences within Myco~hJe'i!ll• . ras s:od v. serte~ 5, In press. the idiomorphs Artas , P. , Oanbr~, C. , lltr, P. and PUkauskas,P. ('l!03)71Je . ValdBilf!Jn~ Prirne.rs flan4739-F, in·~er5656-R, inverB486-F and flan9352-R R&J:Jmy 1985-.1002; FJ..O commodty ~u el es. RCille: Focd andAgrlcu~ure (Table 1) were cesig1ed on lhe predi'cted iiwerted regions and on. orgnd to ihe sequenre of mat1-2. These F~irner< corr.er\'00 MATHMG bo;.;FUf!7J1~1H Bó'OI. 'll, 118-130. l'•~re ~1'\, used in fourdifrerentcombinatbns ll', e andi D), which Bl!nnett, R.S, Ylrn,S) Hc, Le~ , u . lllr~on , :E.G . Arsq¡Juk. E. c:unf.r, B.M:. are specilied 1n the. table in>erted in fg. 4. Anreallng wa; at and S~rg¡.t!om , G.<:: (1001) loontity and rons~r.•atico o1 mailng t¡pe 62 •e for 40 s. and extension at 72 '( for 40 s. genes In geo;¡r~phiC\ 101, 1632-1637. Sequen

e. ZOú6 BLACKWEll PUBLISHII

and m mi d>~elopmert In fllamentous ascom¡•c!tes. MlCT<1bN!I. Mol: O'llonner, K, ward, TJ,m, Oiffl!rentllt'oo Lutroni, F. Oeb~3uplts , J.P:, tatg~ . J. P. O@flnlng, D. w. , u and Ftscll!r, R, e:ls ~ pp. 29~3.13 . saHMielda­ P. S.. (20C6) E~1dence1or sexualtty lnthe owonunlstlc fungrotha lic ascom)··:ete~ C/Jrr. Gene t. 277-iFi5. 36,221-231. Gauhl, F.. PJSb@lg-GJuhl, C. and lOO@§, D.lt (lOCO) BlKk leal streal:. Randalt T.A. and Metzeribtqg, R.L. (1m) 11le matlng t,¡:e lxus of otease ey de a nd ept.!em bl>¡)'. 1n: D/Sruse5 of 8JnJnJ, Ab~il ;~n.d Mrro~¡;¡ IT2$'il klenu11:a11:ln ct an a:l~~ntg~ne and char;ICtHliJttAI faset(.t>nes, D.R , e:l), J:il ~2. I'.:JIIIngford, UK:CABin!Ernatbnal. oftranscr~:tS surrarndlng the i:!bm)q:Jls. ~iJI. ~n Gel!!. 259.615-611 . Goodv~n . S. B., o.uokle, l. D. 3rld Zlsmann.. v.t. (2 Olil ¡ Ph,·logenetlt Rfvas, G.G., zapa!€~', M.F. Abad te, c . and carlle!; J. (i!Co04) Founder anlt)sts of cercos,oora and M¡cos_oh•en!ll.l bmd on the 1nnrml effeas and stochmlt dlsp!lsal at the tomlnental Stale of 1he rungal mmcribed qm.er r~gion of rtbosoml ctJA. Fll]'lop2thology, ~1 , 64&- ,paihogen c•f bamn~s M}r:o;¡¡h;¡¡¡re'la f'Jii!'JSIS . Mol. Eco/, 13, 471-4&2. 658. Romero •. RA . and Sutton, T.B, (1997) SeMtMt,· of . Myros¡iJ.J!lr~Na Goodv~n. :S.B. IW3Ivnjk, C. ~nd Kema, G.H.I. (2004) Gen~lcs. of fiJ.;'>lllSi's caJsal agent of Black Stgatoka of banana to propltonazole. Mjros¡:lla.rella gr.rninlcola: a model for the DothldwiH 111 Ji¡:,olied Fhyro,oamaog¡, 87, 96-1 oo. .M¡cology <2nd Blotecbnolo!J¡. Ao ll!twn¿tlaflal sw.l?s, Vd • .i!, Rmg~ Roz~n . s. an tom !he SlerotüLH . Par~l . s. stglnleld,Ul, r~nzer, 1., P!>lrey, s. ~ncl Glsl , u. ·barl?l•patho¡¡en septnslifl•t.II~~Jiat~s. ~S!. M~n~~. m;¡I gene tochnc•b;b' topr.bP-rns MJ(OioJgfJ, ~3, 934-946. lnfurg~l blcologr.Anmt. Re;: P11¡tqmhol: 36, 1'15-137. Hayd~n . H.L, carn~r . J. and Altken. EAB. (2003) Genettc structure of 1\Jrgeoon. s. .G, Bohlh1ann, H.tfulfett( t .M. er.ampes. fllr, J, I'IJJ! gmnm.tol}, the 5eptort.1 frlt!ct ~~ bbiJ: h path091 nof wheai. Gg¡¡@c\ PJ!hul. 11.0, 533-544. 161 , 14~7-1505. Yoltoyama. E. Ylllnagls'hl, K. 3nd Hara, A. (2P03) structures ufth! Kupfe.r, O.M , Drab~nstot, S. D. Buchanan, K.L, L.al, H~ Zhu. H, D)l!f, m:rtlrg-tspe locl otcord¡iPpstJkoomontanJ.A.c,al, fbWoo. Mlc:oolci. o.s, Roe, B.A. and MW¡ihy. J.W. (2004) lntrcm 1nd spltdng !lements 69, 501 !i-50:12. ¡.fft,•¡ dlverse fung .. E'utJ;¡ut. Celp, 1OOS-11 OO. Ytrn, s ..-H. Art~. • r. Kanwto, 1. Yod~r. o.c •nd ru · g~Ol\ B.íi. (2000) Maríh, D. H., Romero , M.A., Guzm~n . M. andi~u. tton , T.B.(1003) Block MolecularorgaJizatlon rt matlngtwe.loctln h~erothallc, homothalll r, SI g;o'la8'E'II• MjCDS,dJJI!"e.N~ t¡'leTJfis;, forrroe pa rf:l lte de CI!'COSpO.f,2 ty,'f!n;K FrUitr,. , gmr..',¡lca'~C!.'erspattalscal!!l from ~mnstotontln~ . ntt. Fung;¡,' Gl!'let 45,553- 557. 6!1J I, 36, 12S-136.

MO!E.' WiA~ PMh'l PAJJ/Ot.OGI"(200'1) ltH. 111 - 120 e 2006 BLACY.WELL PUBLIIHING l TO 96