Integrated analysis of metabolomes and transcriptome between the testis of non- repropductive season and reproductive season of oriental river prawn, Macrobrachium nipponense
Shubo Jin ( [email protected] ) Freshwater Fisherues Research Center
Research article
Keywords: Macrobrachium nipponense, Metabolomes and transcriptome, Testis, Histological observation, Sex-differentiation and development
Posted Date: July 10th, 2019
DOI: https://doi.org/10.21203/rs.2.11204/v1
License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License
Page 1/27 Abstract
Background: The better understanding of male sexual differentiation and development mechanism of M. nipponense is urgently needed, in order to maintain the sustainable development of M. nipponense industry. In the present study, we aimed to identify the key genes and metabolites involved in the male sexual differentiation and development of M. nipponense through performing the integrated analysis of metabolomes and transcriptomes of testis between the reproductive season and non-reproductive season. Results: A total of 385 differentially expressed metabolites (DEMs) and 12,230 differentially expressed genes (DEGs) were identifed. Glycerophospholipid metabolism and Sphingolipid metabolism were predicted to have dramatic effects on male sexual differentiation and development in M. nipponense, based on the integrated analysis of metabolomes and transcriptomes. According to the KEGG enrichment analysis of DEGs, Oxidative phosphorylation, Glycolysis/Gluconeogenesis, HIF-1 signaling pathway, Citrate cycle, Steroid hormone synthesis and Spliceosome were predicted to promote the male differentiation and development through providing ATP, promoting the synthesis of steroid hormone and providing correct gene products. SDHB, PDE1, HSDL1, Cp450, SRSF and SNRNP40 from these metabolic pathways were predicted to have dramatic effects in M. nipponene through performing the qPCR analysis in different reproductive season of testis and various tissues. Conclusion: This study provides new evidences for analyzing the process of male sexual differentiation and development in M. nipoponense.
Background
The Oriental river prawn, Macrobrachium nipponense (Crustacea; Decapoda; Palaemonidae), can be commonly found in the freshwater and low-salinity estuarine regions of China [1-5]. M. nipponense is a major commercial aquaculture species in China, and the production gradually increased in recent years. The annual production is about 272,592 tons in 2016 with an annual output value of more than 20 billion RMB [6]. Male M. nipponense grow faster than the female counterparts, and reach larger size at the harvest time. Thus, culture of all male populations may have dramatic economic advantages. The early maturity of testis is the main problem, restricting the sustainable development of M. nipponense industry. The M. nipponense testis was began to be differentiated at post-developmental stage day 13 (PL13), and matured at PL22, according to the histological observation and steroid hormone measurement [7]. The early testis maturity will result in inbreeding between the offspring and their parents, leading to low market value of the M. nipponense product because of the poor survival, low growth rate and short life span. Thus, it is urgent to better understand the male sex-differentiation and development mechanism, in order to make some genetic improvements.
The testis has multiple functions, playing a key role in reproduction, sexual maturity, and sex differentiation [8]. The process of testis development includes 5 developmental stages, which are spermatogonium, primary spermatocyte, second spermatocyte, spermatid, sperm. The cDNA library of M. nipponense has been constructed, and a total of 5202 expressed sequence tags (ESTs) were carried out with an average length of 954 bp [9]. A series of ESTs from the M. nipponense testis cDNA library was
Page 2/27 analyzed, and their functions in male sexual differentiation and development were also identifed, including sex-lethal, transformer-2 and extra sex comb [10-12]. Other male reproductive studies in M. nipponense have been conducted at the organic and cellular level [13-15]. However, the male sexual differentiation and development mechanism was still unclear. A reasonable explanation was that only limited unigenes were carried out, and the complete set of metabolites of M. nipponense testis was unknown.
Metabolomics is an idea technique to analyze the chemical processes involving metabolites, which is the products and small molecule intermediates of metabolism. The metabolome represents the complete set of metabolites in a biological cell, tissue, organ or organism, which are the end products of cellular processes [16]. Transcriptomic and proteomic analyses reveal the gene products in the cell, representing one aspect of cellular function. Conversely, metabolic profling represents the instantaneous snapshot of the physiology in the cell, providing the direct physiological state of an organism. The metabolomic information, integrated with the genomics, transcriptomic, proteomic data, can provide a better understanding of cellular biology [17-18].
In this study, our objectives were to identify the key genes and metabolites capable of regulating the male sexual differentiation and development of M. nipponense through integrating the metabolomic and transcriptomic profling analysis of testis between thereproductive season and non-reproductive season. This study will provide valuable evidence for better understanding the molecular mechanisms, determining the male sex-differentiation and development in M. nipponense.
Results
Histological observation
The morphological difference between the testis of non-reproductive and reproductive season was analyzed by histological observation (Fig. 1). According to the histological observation, both of non- reproductive and reproductive season include the spermatogonium, spermatocyte and sperm. Over 70% of the cells in the testis of reproductive season are sperms, whereas spermatogonium and spermatocyte are the dominant cells in the testis of non-reproductive season.
Metabolic transcriptome analysis
The metabolic profling analysis of the testis between non-reproductive season and reproductive season were performed, and the overall structure of the GS/MS dataset was assessed by principal component analysis (PCA) (Fig. 2-A). The metabolic profle was also checked by using the orthogonal projections to latent structures-discriminate analysis (OPLS-DA) (Fig. 2-B). The criterion of the robustness and predictive ability of the model was set as seven-fold cross-validation, and further validation was performed using permutation tests. The R2 and Q2 intercept values were 0.934 and -0.896 after 200 permutations of the
Page 3/27 treatments. The low Q2 intercept values show strong robustness and reliability of the model and the risk of overftting was low, indicating the metabolites related to male sexual differentiation and development is represented by different metabolic patterns in the testis of non-reproductive season and reproductive season. A total of 268 differentially expressed metabolites (DEMs) were identifed between the testis of non-reproductive and reproductive season, including 171 up-regulated metabolites and 98 down- regulated metabolites in the testis of reproductive season, using the criterion of >1.2 as up-regulated metabolites and <0.8 as down-regulated metabolites (Additional fles 1 Table S1). The most 10 up- regulated and 10 down-regulated metabolites were listed in Table 2. These DEMs were assigned to 22 metabolic pathways. According to the integrated analysis of metabolomes and transcriptomes, Glycerophospholipid metabolism (Additional fles 2 Figure S1) and Sphingolipid metabolism (Additional fles 2 Figure S2) were the most enriched metabolic pathways in both of the metabolomes and transcriptome analysis.
Transcriptome analysis
A total of 48,520 non-redundant transcripts were assembled de novo using Trinity program (Additional fles 1 Table S2), ranging from 301 to 20,628 bp with an average of 1344.91 bp. The majority of the non- redundant transcripts were 301-400 bp (23.62%) in length, followed by >2000 bp (19.61%) and 401-500 bp (13.36%) in length (Fig. 3).
To identify their putative functions, all of the assembled unigenes were compared with the non-redundant protein database and nucleotide sequences in NCBI using Blastp and Blastx at an E-value of <10-5 in the priority order of the Kyoto Encyclopedia of Genes and Genomes (KEGG) database, Gene Ontology (GO) and Cluster of Orthologous Groups (COG) database. A total of 16,472 (33.95%) unigenes were annotated in Nr database, while the other unannotated unigenes represent novel genes whose functions were still not clear.
GO and COG analysis aimed to provide a structured vocabulary to describe gene products. A total of 11,306 and 10,594 unigenes were highly matched the protein with known functions in GO and COG database, respectively. GO analysis comprised of 55 functional groups, in which Cell, Cell parts, Cellular process, Binding and Organelle with the number of unigenes > 7,000 represent the largest functional groups (Fig. 4). The matched unigenes in COG database were classifed into 25 functional categories, in which General function prediction only, Signal transduction mechanisms and Posttranslational modifcation, protein turnover, chaperones with number of unigenes >1000 represent the largest groups (Fig. 5). KEGG analysis aimed to match the assembled unigenes in biological pathways in the ladybird. A total of 7,621 unigenes were highly matched the known genes in KEGG databse, mapped onto 273 metabolic pathways.
Page 4/27 Identifcation of candidate male differentiation and development related genes and pathways
The transcriptome profling analysis between the testis of non-reproductive season and reproductive season was performed, in order to select candidate male sexual differentiation and development related genes in M. nipponense. A total of 12,230 unigenes were differentially expressed between the testis of non-reproductive and reproductive season, including 6,151 up-regulated unigenes and 6,079 down- regulated unigenes in the testis of non-reproductive season, compared with those of reproductive season, using the criterion of >1.5 as up-regulated unigenes and <0.66 as down-regulated unigenes (Additional fles 1 Table S3).
A total of 1,136 DEGs highly match the known proteins in KEGG pathway database, mapped onto 181 predicted metabolic pathways. Purine metabolism, Spliceosome, Endocytosis and Lysosome represent the most enriched metabolic pathways, in which the number of DEGs were more than 40.
Several important candidate enriched metabolic pathways were selected, which may affect the male sexual differentiation and development. These metabolic pathways include Oxidative phosphorylation, Glycolysis/Gluconeogenesis, HIF-1 signaling pathway, Citrate cycle, Steroid hormone synthesis and Spliceosome (Table 3). Oxidative phosphorylation, Glycolysis/Gluconeogenesis, HIF-1 signaling pathway, Citrate cycle may promote the male sexual differentiation and development through providing ATP. Steroid hormone synthesis synthesizes steroid hormone and spliceosome ensures the correct alternative splicing product, in order to promote the male sexual differentiation and development in M. nipponense. Several DEGs were also selected which may play essential roles in these metabolic pathways (Table 3). SDHB, PDE1 and Gadph-PA are involved in the at least two ATP-releasing related metabolic pathways. HSDL1 and CYP450 are the most two signifcant up-regulated DEGs in the testis of reproductive season in the metabolic pathway of steroid hormone synthesis. SRSF, HSC70 and SNRNP40 are the most three signifcant up-regulated DEGs in the testis of reproductive season in the metabolic pathway of spliceosome. XDO and MHC are the most two signifcant up-regulated DEGs in the testis of reproductive season. Based on the importance of these metabolic pathways in male sexual differentiation and development in M. nipponense, these DEGs may also play vital roles in male sexual differentiation and development in M. nipponense. qPCR analysis qPCR analysis was frstly used to verify the expression pattern of these 10 DEGs in the testis of non- reproductive season and reproductive season. According to the qPCR analysis, these 10 DEGs showed the same expression pattern with those of RNA-Seq. All of these 10 DEGs were up-regulated in the testis of reproductive season, compared with those in the testis of non-reproductive season (Fig. 6).
Page 5/27 qPCR analysis was then used to verify the expression of these DEGs in different tissues, in order to analyze the functions of these 10 DEGs in depth (Fig. 7). SDHB, PDE1 and Gadph-PA were the ATP- releasing related genes. SDHB and PDE1 had the highest expression levels in testis, and showed the signifcant expression difference with those in other tested tissues (P < 0.05). Gadph-PA showed the highest expression level in heart, whereas the expression in testis was relatively low. HSDL1 and CYP450 were steroid hormone synthesis-related genes. HSDL1 and CYP450 showed the similar expression pattern that these two genes had the expression levels in hepatopancreas, followed by testis, and the expressions in testis showed signifcant difference with those in other tested tissues (P < 0.05). SRSF showed the highest expression level in testis, and showed signifcant difference with other tested tissues (P < 0.05). The highest expression level of SNRNP40 was observed in ovary, followed by testis, and showed signifcant difference with other tested tissues (P < 0.05). However, the expression levels of the other tested genes in testis were dramatically low. The expression levels of XDO and MHC were dramatically low in testis. XDO was dramatically expressed in hepatopancreas and brain (P < 0.05). The peak expression of MHC was observed in muscle (P < 0.05).
Discussion
The present study aimed to select the candidate metabolites and genes involved in the male sexual differentiation and development in M. nipponense, through the integrated analysis of metabolomics and transcriptomic analysis of the testis between reproductive season and non-reproductive season. The morphological differences between the testis of reproductive season and non-reproductive season were revealed by histological observation. The dominant cells in the testis of reproductive season were sperms, whereas spermatogonium and spermatocyte were the majority cells in the testis of non-reproductive season. Thus, identifcations of DEMs and DEGs are urgently needed, in order to fully understand the male sexual differentiation and development mechanism in M. nipponense. A testis cDNA library of M. nipponense was constructed in previous study using Roche 454 sequencing platform. A total of 5,539 EST were sequenced with an average length of 989 bp, and 52 sex- or reproduction-related genes were identifed [9]. To the best of our knowledge, there is no previous study related to the metabolic transcriptome analysis of testis in M. nipponense. In the present study, a total of 16,472 unigenes were identifed in the testis transcriptome of M. nipponense, providing more basic information for the male sexual differentiation and development analysis in M. nipponense than previous study. In addition, 385 metabolites and 12,230 genes were differentially expressed between the testis of reproductive season and non-reproductive season. These DEMs and DEGs were predicted to dramatically affect the male sexual differentiation and development in M. nipponense, based on the dramatic morphological difference between the testis of reproductive season and non-reproductive season.
Glycerophospholipid metabolism and Sphingolipid metabolism were the most enriched metabolic pathways in both of the metabolomes and transcriptome analysis. The glycerophospholipids of the plasma membrane bilayer play an important role in the generation of both extracellular and intracellular signals. Intact glycerophos- pholipids and primary and secondary glycerophospholipid metabolites have
Page 6/27 been implicated in the regulation of many aspects of cell function [19-21]. Sphingolipids have been proven to be involved in many aspects, including the regulation of cell growth, differentiation, and programmed cell death. This action is performed through interacting of complex sphingolipids (such as gangliosides) with growth factor receptors, neighboring cells, and the extracellular matrix [22]. The signifcant enrichment in both of metabolomes and transcriptome analysis indicated that lipid metabolism play essential roles in male sexual development in M. nipponense.
Some other important metabolic pathways, involved in the male sexual differentiation and development, were also identifed through transcriptome analysis. Spliceosome is the most enriched metabolic pathway in this study with 49 DEGs. The spliceosome removes introns from a transcribed pre-mRNA, in order to produce necessary transcripts. This process cuts out irrelevant or incorrect introns from the initial pre-mRNA and sends the processed version to the director for the fnal cut [23-24]. The dramatic enrichment of DEGs in the metabolic pathway of spliceosome indicated that this metabolic pathway plays essential roles in producing necessary gene products involved in the male sexual differentiation and development. The signifcant DEGs in this metabolic pathway are the expected candidate genes involved in the male sexual differentiation and development. Serine/arginine-rich splicing factor RS2Z32 (SRSF) is the most signifcant DEG in spliceosome with 2.63-folder higher in the testis of reproductive season. SRSF is an important splicing factor, playing essential roles in pre-mRNA splicing [25-27]. SRSF is necessary for all splicing reactions to infuence splice site selection, resulting in alternative splicing [26]. Heat shock 70kDa protein 8 (HSPA8), coding for heat shock protein 70 (HSC70), plays vital roles in regulating cellular functions through interacting with many molecules. HSC70 has been proven to be synthesized in haploid cells during spermatogenesis and are mainly activated at the spermatid stage [28]. The other main functions of HSC70 include the protecting of cells from stressful damage [29], regulating of protein folding [30-31] and promoting of ATP synthesis [32-33].
Adenosine triphosphate (ATP) is an unstable high-energy compound, which is the most direct energy source in organisms. Every activity in an organism needs ATP to provide energy, including the male differentiation and development. In the present study, 4 important ATP-related metabolic pathways were found, including Oxidative phosphorylation, Glycolysis/Gluconeogenesis, HIF-1 signaling pathway and Citrate cycle (TCA cycle). Oxidative phosphorylation is the metabolic pathway, almost found in all aerobic organisms. Cells use enzyme to oxidize nutrients, releasing energy to produce ATP [34]. Glycolysis/Gluconeogenesis converts glucose (C6H12O6) into pyruvate (CH3COCOO− + H+), releasing free energy to form the high-energy molecules ATP and NADH (reduced nicotinamide adenine dinucleotide) [35]. TCA cycle is found in all aerobic organisms using a series of chemical reactions to release stored energy into ATP. The energy is released through oxidation of acetyl-CoA derived from carbohydrates, proteins, and fats [36]. Several genes are up-regulated in HIF-1 signaling pathway, when hypoxic conditions are stabilized, in order to promote survival in low-oxygen conditions [37]. These upregulated genes include glycolysis enzymes, promoting ATP synthesis in an oxygen-independent manner. The DEGs in these metabolic pathways may integrate to promote the male sex-differentiation and development in M. nipponense (Fig. 8). Several ATP synthesis-related DEGs were identifed, which are involved in at least two metabolic pathways. Succinate dehydrogenase [ubiquinone] iron-sulfur subunit, Page 7/27 mitochondrial (SDHB) is a DEG with 3.72-folder higher expression in the testis of reproductive season, playing vital roles in Oxidative phosphorylation and Citrate cycle (TCA cycle). SDHB is one of four protein subunits forming succinate dehydrogenase, which catalyzes the oxidation of succinate [38-39]. Pyruvate dehydrogenase E1 is involved in the Glycolysis/Gluconeogenesis, HIF-1 signaling pathway and Citrate cycle (TCA cycle) with 1.7-folder higher expression in the testis of reproductive season. The pyruvate dehydrogenase complex (PDC) plays essential roles in transforming pyruvate into acetyl-CoA through pyruvate decarboxylation [40-41]. Acetyl-CoA may then be used in the citric acid cycle to produce ATP. Pyruvate dehydrogenase is the frst component enzyme of PDC. Pyruvate dehydrogenase E1 performs the frst two reactions within PDC, including a decarboxylation of pyruvate and a reductive acetylation of lipoic acid [42-43]. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) is a DEG with 1.65-folder higher expression in the testis of reproductive season, enriched in Glycolysis/Gluconeogenesis and HIF-1 signaling pathway. GADPH generates products, catalyzing a vital energy-yielding step. It occurs through the reversible oxidative phosphorylation of glyceraldehyde-3-phosphate when inorganic phosphate and NAD are present [44]. Energy and molecular carbon are released when GADPH is catalyzed to break down glucose [45].
Steroid hormone has been proven to play essential roles in sexual development. Steroid hormone generally divided into fve main classes, including glucocorticoids, mineralocorticoids, androgens, oestrogens and progestogens. The natural steroid hormones, which are lipids, are generally synthesized from cholesterol in the gonads and adrenal glands [46-47]. The steroid hormone biosynthesis metabolic pathway was one of the main enriched pathways in the present study, including 17 DEGs. Hydroxysteroid dehydrogenase like 1 gene (HSDL1) is the most signifcant DEG in the metabolic pathway of steroid hormone synthesis, which the expression in the testis of reproductive season is 12.58-folder higher than that of non-reproductive season. HSDL1 is a novel human gene, which is highly expression in reproductive tissues. HSDL1 is highly expressed in testis and ovary, revealed by Northern blot. In situ hybridization analysis indicated that HSDL1 is predominantly expressed in the prostate cancer compared with the normal prostate cancer [48]. In addition, this gene has been proven to be involved in the development of sheep fetus in late gestation [49]. Cytochrome P450 (CYP450) is another main DEG, which is 10.24-folder higher in the testis of reproductive season than that of non-reproductive season. The previous studies have been proven that a series of CYP enzymes play important roles in the synthesis of steroid hormones ( steroidogenesis) by the adrenals, gonads, and peripheral tissue [50-53]. For instance, CYP19A is involved in the aromatization of androgens to estrogens [54-55]. The dramatically higher expression of HSDL1 and CYP450 in the testis of reproductive season than that of non-reproductive season indicated that these two genes are strong candidate genes in male sexual differentiation and development in M. nipponense.
The expression levels of the 10 selected DEGs in the testis of non-reproductive season and reproductive season were verifed in qPCR. The expression patterns of these 10 DEGs were as the same as that of RNA-Seq, based on the qPCR analysis. All of these DEGs were up-regulated in the testis of reproductive season, indicating the results of RNA-Seq in the present study were correct. The expression levels of these 10 DEGs were further investigated in different tissues of M. nipponense. Pyruvate dehydrogenase E1α Page 8/27 (PDE1 α) is a testis-specifc form in human, and it has been proven to be expressed in postmeiotic spermatogenic cells [42]. SDHB and PDE1 were ATP-releasing related genes, showed the highest expression levels in the testis of M. nipponense, indicating SDHB and PDE1 may have dramatic effects on male sexual differentiation and development in M. nipponense. HSDL1 and Cp450, which were selected from the metabolic pathway of steroid hormone synthesis, were highly expressed in hepatopancreas, followed by testis. HADL1 has been proven to be highly expressed in hepatopancreas and testis, and played vital roles in hepatic growth [49, 56]. Liver Cytochrome P450 Metabolism has been proven to be involved in the endogenous steroid hormones, bile acids, and fatty acids synthesis [57]. In addition, Vitellogenin (Vg) is the precursor of yolk protein, functioning as a nutritive resource and playing essential roles in embryonic growth and gonad development. Vg has been proven to be only expressed in the female hepatopancreas, hemolymph, and ovary in M. nipponense [58]. The highly expressed of HSDL1 and Cp450 in male hepatopancreas and testis in present study predicted that HSDL1 and Cp450 may play similar roles in male sexual differentiation and development in M. nipponene as that of Vg in female sexual development. RSRF and SNRNP40 were signifcant DEGs in the metabolic pathway of spliceosome in present study. The highest expression level of RSRF was observed in testis, indicating RSRF has positive effects on producing correct gene products to promote male sexual differentiation and development in M. nipponense. The highest expression level of SNRNP40 was observed in ovary, followed by testis. This result implies SNRNP40 may dramatically promote gonad development in M. nipponense. However, the expression levels of the other tested DEGs in testis were dramatically lower than the other tested tissues, implying these DEGs may also have other important physiology functions in M. nipponenes, which needs further analysis.
Conclusion
In the present study, we selected the male sexual differentiation and development related metabolites and genes through integrating the metabolomic and transcriptomic profling analysis of testis between thereproductive season and non-reproductive season. A total of 385 metabolites and 12,230 genes were differentially expressed between the testis of reproductive season and non-reproductive season, which may promote the male sexual differentiation and development in M. nipponense. In addition, Oxidative phosphorylation, Glycolysis/Gluconeogenesis, HIF-1 signaling pathway and Citrate cycle were predicted to promote the male differentiation and development through providing ATP, whereas Steroid hormone synthesis and Spliceosome may promote through promoting the synthesis of steroid hormone and providing correct gene products, respectively. SDHB, PDE1, HSDL1, CYP450, SRSF and SNRNP40 were predicted to have dramatic effects on male sexual differentiation and development in M. nipponene, according the qPCR analysis of 10 DEGs in different reproductive season of testis and various tissues.
Methods
Sample collection
Page 9/27 Male specimens of oriental river prawn at nonreproductive season and reproductive season (body weights, 2.67–5.37 g) were respectively collected from a wild population in Tai Lake, Wuxi, China (120°13′44″E, 31°28′ 22″N) in winter and summer. According to the previous study, the specimens at the water temperature of 15°C or below were collected as non-reproductive season, while the specimens at the water temperature of 28°C or above were collected as reproductive season. All the samples were transferred to a 500 L tank and maintained in aerated freshwater. The testes were respectively collected from the specimens from non-reproductive season and reproductive season, and immediately preserved in liquid nitrogen until used for metabolomics and transcriptomic analysis.
Morphological observation
Hematoxylin and eosin (HE) staining was used to observe the morphological difference between the testis of non-reproductive season and reproductive season. The testis of non-reproductive season and reproductive season were respectively collected at the water temperature of 15°C or below and 28°C or above. The procedure of HE staining has been well-described in previous studies [59-60]. The histological slides were observed under an Olympus SZX16 microscope.
Metabolomic profling analysis
The comparative metabolic analysis of testis between the non-reproductive and reproductive season were performed, in order to select candidate metabolites involved in the male sexual differentiation and development in M. nipponense. In order to ensure the sufcient amount of RNA samples, at least 0.5g testes were pooled to form one biological replicate, and eight biological replicates were sequenced for the testes from both of the non-reproductive and reproductive season. Differentially expressed metabolites between the testis of non-reproductive season and reproductive season involved in the male sexual differentiation and development were determined using liquid chromatography-mass spectrometry (LC/MS) analysis [61].
Transcriptomic profling analysis
The comparative transcriptome analysis of testis between the non-reproductive and reproductive season were performed, in order to select candidate genes and pathways involved in the male sexual differentiation and development in M. nipponense. In order to ensure the sufcient amount of RNA samples, at least 30 testes were pooled to form one biological replicate, and three biological replicates were sequenced for the testes from both of the non-reproductive and reproductive season.
Total RNA, RNA samples for comparative transcriptome analysis were prepared followed by the previous studies [62-63]. Illumina HiSeq 2500 platform was employed to performed the transcriptome analysis.
Page 10/27 The detailed procedure has been well described in previous studies [62-63]. The bioinformatics analysis, including the transcriptome assemble and annotation, was also described in the previous studies [62-63].
Quantitative real-time PCR (qRT-PCR) analysis
The expression level of 10 DEGs were determined in different reproductive seasons of testis and different tissues by using quantitative Real-time PCR (qPCR), in order to further analyze the gene functions in depth. These 10 selected DEGs were predicted to have potential functions in male sex-differentiation and development in M. nipponense, based on the expression fold change by RNA-Seq. The different tissues include testis, ovary, hepatopancreas, muscle, eyestalk, gill, heart and brain. The preparation of RNA samples for qRT-PCR analysis has been described in previous studies [64-65]. Bio-Rad iCycler iQ5 Real- Time PCR System was used to carry out the SYBR Green RT-qPCR assay. The procedure and statistical analysis can be also seen in previous studies [64-65].
Declarations Acknowledgement
Thank you for the international English editing company to revise the manuscript.
Authors contributions
HF designed the project. YH, SJ and YX collected the samples and participated in fgure preparation. HQ and WZ performed data analysis. SJ and SS prepared the manuscript. YG and YW revised the manuscript.
Fundings
This research was supported by grants from the National Key R&D Progrom of China (2018YFD0900201); Central Public-interest Scientifc Institution Basal Research Fund CAFS (2019JBFM02, 2019JBFM04); the National Key R&D Progrom of China (2018YFD0901303); Jiangsu Agricultural Industry Technology System (JFRS-02); the National Natural Science Foundation of China (31572617); the China Agriculture Research System-48 (CARS-48); the New cultivar breeding Major Project of Jiangsu province (PZCZ201745)
Available data and materials
The reads of M. nipponense transcriptome were submitted to NCBI with the accession number of SRP196455. The data of M. nipponense were submitted to MetaboLights with the accession number of
Page 11/27 MTBLS1025.
Ethics Approval
We got the permission from the Tai Lake Fishery Management Council. M. nipponense is not an endangered species in China, thus it can be used for experimental purpose. All of the experimental programs involved in this study were approved by the committee of Freshwater Fisheries Research Center, and followed the experimental principles. Tissues from each prawn individuals were sheared under MS222 anesthesia, and efforts were made to minimize stress.
Consent for publication
Not applicable.
Competing interests
The authors declare that they have no competing interests.
Reference
1. Cai Y, Shokita S. Report on a collection of freshwater shrimps (Crustacea: Decapoda: Caridea) from the Philippines, with descriptions of four new species. Rafes. B. Zool. 2006; 54:245–270.
2. Grave SD, Ghane A. The establishment of the oriental river prawn, Macrobrachium nipponense (de Haan, 1849) in Anzali Lagoon, Iran. Aquat. Invasions. 2006; 1(4):204–208.
3. Salman SD, Page TJ, Naser MD, Yasser AG. The invasion of Macrobrachium nipponense (De Haan, 1849) (Caridea: Palaemonidae) into the southern Iraqi marshes. Aquat. Invasions. 2006; 1(3): 109-115.
4. Ma KY, Feng JB, Lin JY, Li JL. The complete mitochondrial genome of Macrobrachium nipponense. Gene. 2011; 487(2): 160–165.
5. Yu H, Miyake S. Five species of the genus Macrobrachium (Crustacea, Decapoda, Palaemonidae) from Taiwan. Ohmu. 1972; 3: 45-55.
6. Bureau of Fisheries, Ministry of Agriculture, P.R.C. Fisheries economic statistics. In: China Fishery Yearbook. Beijing China Agricultural Press. 2016; 236.
7. Jin SB, Zhang Y, Guan HH, Fu HT, Jiang SF, Xiong YW, et al. Histological observation of gonadal development during post-larva in oriental river prawn, Macrobrachium nipponense. Chin. J. Fish. 2016; 29(4): 11–16.
Page 12/27 8. Qiao H, Fu HT, Jin SB, Wu Y, Jiang SF, et al. Constructing and random sequencing analysis of normalized cDNA library of testis tissue from oriental river prawn (Macrobrachium nipponense). Comp. Biochem. Phys. D 2012; 7: 268–276.
9. Zhanga YP, Qiao H, Zhang WY, Sun SM, Jiang SF, Gong YS, et al. Molecular cloning and expression analysis two sex-lethal homolog genes during development in Oriental river prawn, Macrobrachium nipponense. Genet. Mol. Res. 2013; 12(4): 4698–4711.
10. Zhangb YP, Fu HT, Qiao H, Jin SB, Gong YS, Jiang SF, et al. cDNA cloning, characterization and expression analysis of a transformer-2 gene in the oriental river prawn, Macrobrachium nipponense. J. World Aquacult. Soc. 2013; 44 (3): 338–349.
11. Zhangc YP, Jiang SF, Xiong YW, Sun SM, Qiao H, Jin SB, et al. Molecular cloning and expression analysis of extra sex combs gene during development in Macrobrachium nipponense. Turk. J. Fish. Aquat. Sc. 2013; 13: 331–340.
12. Cao JX. The molecular mechanism in male reproductive tract of the prawn, Macrobrachium rosenbergii. Zhejiang University. 2006.
13. Guo ZH. Study on proliferation and differentiation of spermatogenic cells from Macrobrachium nipponense in vitro. Hebei University. 2007.
14. Qiu GF, Du NS. Lai W. Studies on the male reproductive system of the freshwater prawn, Macrobrachium nipponense. J. Shanghai Fish. Univ. 1995; 4: 107–111.
15. Yang WX, Du NS, Lai W. Functional relationship between spermatogenic cells and Sertoli cells during spermatogenesis of freshwater shrimp, Macrobrachium nipponense. Acta Zool. Sin. 19099; 45(2): 178– 186.
16. Weckwerth W. Metabolomics in systems biology. Annu. Rev. Plant. Biol. 2003; 54: 669-89.
17. Patti GJ, Yanes O, Siuzdak G. Innovation: Metabolomics: the apogee of the omics trilogy. Nat. Rev. Mol. Cell Biol. 2012, 13(4):263-9.
18. Saito K, Matsuda F. Metabolomics for functional genomics, systems biology, and biotechnology. Annu. Rev. Plant. Biol. 2010; 61:463-89.
19. Dennis EA, Rhee SG, Billah MM, Hannun YA. Role of phospholipase in generating lipid second messengers in signal transduction. FASEB J. 1991; 5: 2068-77.
20. Exton JH. Phosphatidylcholine breakdown and signal transduction. Biochim. Biophys. Acta. 1994; 1212: 26-42.
Page 13/27 21. Meagher EA, Fitzgerald GA. The molecular basis of eicosanoid action. Hypertens. Pregnancy. 1993; 12: 439-51.
22. Spiegel S, Merrill AH. Sphingolipid metabolism and cell growth regulation. FASEB J. 1996; 10(12):1388-1397.
23. Nilsen TW. The spliceosome: the most complex macromolecular machine in the cell? Bioessays. 2003; 25(12):1147-9.
24. Will CL, Lührmann R. Spliceosome structure and function. Cold Spring Harb Perspect Biol. 2011, 3(7): pii: a003707.
25. Kim DJ, Oh B, Kim YY. Splicing factor ASF/SF2 and transcription factor PPAR-gamma cooperate to directly regulate transcription of uncoupling protein-3. Biochem. Bioph. Res. Co. 2009, 378 (4): 877–82.
26. Zuo P, Manley JL. Functional domains of the human splicing factor ASF/SF2. EMBO J. 1993, 12(12): 4727–37.
27. Li X, Manley JL. Inactivation of the SR protein splicing factor ASF/SF2 results in genomic instability. Cell. 2005, 122(3): 365–78.
28. Matsumoto M, Kurata S, Fujimoto H, Hoshi M. Haploid specifc activations of protamine 1 and hsc70t genes in mouse spermatogenesis. Biochim. Biophys. Acta 1993; 1174: 274–278.
29. Terlecky SR, Chiang HL, Olson TS, Dice JF. Protein and peptide binding and stimulation of in vitro lysosomal proteolysis by the 73-kDa heat shock cognate protein. J. Biol. Chem. 1992; 267(13): 9202-9.
30. Beckmann RP, Mizzen LE, Welch WJ. Interaction of Hsp 70 with newly synthesized proteins: implications for protein folding and assembly. Science. 1990, 248(4957):850-4.
31. Beckmann RP, Lovett M, Welch WJ. Examining the function and regulation of hsp 70 in cells subjected to metabolic stress. J. Cell Biol. 1992, 117(6):1137-50.
32. Goldfarb SB, Kashlan OB, Watkins JN, Suaud L, Yan W, Kleyman TR, et al. Differential effects of Hsc70 and Hsp70 on the intracellular trafcking and functional expression of epithelial sodium channels. Proc. Natl. Acad. Sci. USA. 2006; 103(15): 5817-22.
33. Chappell TG, Welch WJ, Schlossman DM, Palter KB, Schlesinger MJ, Rothman JE. Uncoating ATPase is a member of the 70 kilodalton family of stress proteins. Cell. 1986; 45(1): 3-13.
34. Dimroth P, Kaim G, Matthey U.Crucial role of the membrane potential for ATP synthesis by F(1)F(o) ATP synthases. J. Exp. Biol. 2000; 203(Pt 1): 51–59.
35. Lubert S. “Glycolysis,” in Biochemistry, 4th Edn. (New York, NY: W.H. Freeman and Company), 1995; 483–508. Page 14/27 36. Fernie AR, Carrari F, Sweetlove LJ. Respiratory metabolism: glycolysis, the TCA cycle and mitochondrial electron transport. Curr. Opin. Plant. Biol. 2004, 7(3): 254-61.
37. Formenti F, Constantin-Teodosiu D, Emmanuel Y, Cheeseman J, Dorrington KL, et al. Regulation of human metabolism by hypoxia-inducible factor. Proc. Natl. Acad. Sci. U.S.A. 2010; 107: 12722–12727.
38. Kita K, Oya H, Gennis RB, Ackrell BA, Kasahara M. Human complex II (succinate-ubiquinone oxidoreductase): cDNA cloning of iron sulfur (Ip) subunit of liver mitochondria. Biochem. Biophys. Res. Commun. 1990, 166(1): 101–8.
39. Au HC., Ream-Robinson D, Bellew LA, Broomfeld PL, Saghbini M, et al. Structural organization of the gene encoding the human iron-sulfur subunit of succinate dehydrogenase. Gene. 1995, 159 (2): 249–53.
40. Holness MJ, Sugden MC. Regulation of pyruvate dehydrogenase complex activity by reversible phosphorylation. Biochem. Soc. Trans. 2003, 31(Pt 6): 1143-51.
41. Kim JW, Tchernyshyov I, Semenza GL, Dang CV. HIF-1-mediated expression of pyruvate dehydrogenase kinase: a metabolic switch required for cellular adaptation to hypoxia. Cell Metab. 2006, 3(3): 177-85.
42. Dahl HHM, Brown RM, Hutchison WM, Maragos C, Brown GK. A testis-specifc form of the human pyruvate dehydrogenase E1α subunit is coded for by an intronless gene on chromosome 4. Genomics. 1990, 8(2): 225-232.
43. Dallo SF, Kannan TR, Blaylock MW, Baseman JB. Elongation factor Tu and E1 beta subunit of pyruvate dehydrogenase complex act as fbronectin binding proteins in Mycoplasma pneumoniae. Mol. Microbiol. 2002; 46(4):1041-51.
44. Rius SP, Casati P, Iglesias AA, Gomezcasati DF. Characterization of Arabidopsis lines defcient in GAPC-1, a cytosolic NAD dependent glyceraldehyde-3-phosphate dehydrogenase. Plant Physiol. 2008; 148: 1655–1667.
45. Tarze A, Deniaud A, Le Bras M, Maillier E, Molle D, Larochette N, et al. GAPDH, a novel regulator of the pro-apoptotic mitochondrial membrane permeabilization. Oncogene. 2007; 26: 2606–2620.
46. Payne AH, Hales DB. Overview of steroidogenic enzymes in the pathway from cholesterol to active steroid hormones. Endocr. Rev. 2004, 25(6): 947-70.
47. Mayes JS, Watson GH. Direct effects of sex steroid hormones on adipose tissues and obesity. Obes. Rev. 2010, 5(4): 197-216.
48. Huang Y, Tang R, Dai JF, Gu SH, Zhao W, et al. A novel human hydroxysteroid dehydrogenase like 1 gene (HSDL1) is highly expressed in reproductive tissues. Mol. Biol. Rep. 2002, 28: 185-191.
Page 15/27 49. Gentili S, Morrison JL, McMillen IC. Intrauterine growth restriction and differential patterns of hepatic growth and expression of IGF1, PCK2, and HSDL1 mRNA in the sheep fetus in late gestation. Biol. Reprod. 2009, 80(6): 1121-7.
50. Simpson ER, Mahendroo MS, Means GD, Kilgore MW, Hinshelwood MM, et al. Aromatase cytochrome P450, the enzyme responsible for estrogen biosynthesis. Endocr. Rev. 1994 ; 15(3): 342-55.
51. Waxman DJ, Lapenson DP, Aoyama T, Gelboin HV, Gonzalez FJ, et al. Steroid hormone hydroxylase specifcities of eleven cDNA-expressed human cytochrome P450s. Arch. Biochem. Biophys. 1991; 290(1):160-6.
52. Jefcoate CR, McNamara BC, Artemenko I, Yamazaki T. Regulation of cholesterol movement to mitochondrial cytochrome P450scc in steroid hormone synthesis. J. Steroid Biochem. Mol. Biol. 1992, 43(8): 751-67.
53. Nomura T, Bishop GJ. Cytochrome P450s in plant steroid hormone synthesis and metabolism. Phytochem. Rev. 2006, 5(2–3): 421–432.
54. Van NS, Andersen Ø. Temperature effects on sex determination and ontogenetic gene expression of the aromatases cyp19a and cyp19b, and the estrogen receptors esr1 and esr2 in atlantic halibut (Hippoglossus hippoglossus). MoL. Reprod. Dev. 2006; 73(12): 1481-90.
55. Trant JM, Gavasso S, Ackers J, Chung BC, Place AR. Developmental expression of cytochrome P450 aromatase genes (CYP19a and CYP19b) in zebrafsh fry (Danio rerio). J. Exp .Zool. 2001; 290(5): 475-83.
56. Marc M, Janina T, Ferdinand H, Rebekka M, Jerzy A. Human and zebrafsh hydroxysteroid dehydrogenase like 1 (HSDL1) proteins are inactive enzymes but conserved among species. Chem-Biol. Interact. 2009; 178(1–3): 197-205.
57. Zimniak P, Waxman .J. Liver Cytochrome P450 Metabolism of Endogenous Steroid Hormones, Bile Acids, and Fatty Acids. Springer, 1993; Chapter 8, 123-144.
58. Bai HK, Qiao H, Li FJ, Fu HT, Sun SM, et al. Molecular characterization and developmental expression of vitellogenin in the oriental river prawn Macrobrachium nipponense and the effects of RNA interference and eyestalk ablation on ovarian maturation. Gene. 2015; 562: 22–31.
59. Ma XK, Liu XZ, Wen HS, Xu YJ, Zhang LJ. 2006. Histological observation on gonadal sex differentiation in Cynoglossus semilaevis Günther. Mar.Fish. Res. 2006; 27(2): 55-61.
60. ShangGuan BM, Liu ZZ, Li SQ. Histological Studies on Ovarian Development in Scylla serrata. J. Fish.China. 1991; 15(2): 96-103.
61. Ortiz-Villanueva E, Navarro-Martín L, Jaumot J, Benavente F, Sanz-Nebot V, et al. Metabolic disruption of zebrafsh (Danio rerio) embryos by bisphenol A. An integrated metabolomic and transcriptomic
Page 16/27 approach. Environ. Pollut. 2017, 231(Pt 1): 22-36.
62. Jin SB, Fu HT, Zhou Q, Sun SM, Jiang SM, Xiong YW, et al. Transcriptome Analysis of Androgenic Gland for Discovery of Novel Genes from the Oriental River Prawn, Macrobrachium nipponense, Using Illumina Hiseq 2000. PLoS ONE. 2013; 8(10): e76840.
63. Jin SB, Fu HT, Sun SM, Jiang SF, Xiong YW, et al. Integrated analysis of microRNA and mRNA expression profles at sex-differentiation sensitive period in oriental river prawn, Macrobrachium nipponense. Sci. Rep. 2017; 7 (1): 12011.
64. Jin SB, Jiang SF, Xiong YW, Qiao H, Sun SM, et al. Molecular cloning of two tropomyosin family genes and expression analysis during development in oriental river prawn, Macrobrachium nipponense. Gene. 2014; 546: 390–397.
65. Jin SB, Fu HT, Jiang SF, Xiong YW, Sun SM, et al. Molecular Cloning, Expression, and In situ Hybridization Analysis of Forkhead box protein L2 during Development in Macrobrachium nipponense. J. World Aquacult. Soc. 2018, 49(2): 429-440.
Tables
Table 1. Primers used in this study
Page 17/27 Primer Sequence
SDHB-F ACCGCAAGAAGTTGGATGGT SDHB-R TCGATGATCCAACGGTAGGC
PDE1-F TGACCTTAACGGCAACGAGG
PDE1-R TCCAGGGCAGAATTGAGAGC
Gapdh1-F CACGGTGTCTTCAAGGGTGA
Gapdh1-R CCATGGAATGTTCTCGGGCT
HSDL1-F AGCCTAAGCGTTCCAACTCC
HSDL1-R TATTCAGCAGACCTCGTGGC
Cp450-F CGCTGGACCTAGACAATCCC
Cp450-R CGAAGAAGTCGCTGAGGGTT
SRSF-F GTGGGTGGTCTCAGTTACCG
SRSF-R TGACAATGTCCCGTAAGCGT
HSC70-F GTACCGCGAAGAGGACGAAA
HSC70-R GCTGATGATGGTCTGACGGT
SNRNP40-F TTGCCACTGCTGGTATGGAC
SNRNP40-R TCCACTTGTTGTGTCCCAGC
XDO-F CAAACAAGCACGACGAAGGG
XDO-R TGTCGTCGCCATGATAGTCG
MHC-F GAAACTTGGTCTCCTCGCCA
MHC-R TGGCTTGGGCTTGATGAACA
EIF-F CATGGATGTACCTGTGGTGAAAC
EIF-R CTGTCAGCAGAAGGTCCTCATTA
Table 2. The most significant DEMs in this study
Page 18/27 Metabolites Formula P-value Fold Change
Lucidone A C24H34O5 0.0001 9.713559
N-Acetyl-L-glutamate 5-semialdehyde C7H11NO4 1.67E-08 9.000468
2a-Hydroxygypsogenin 3-O-b-D-glucoside C36H56O10 5.57E-09 5.388934
Spirolide A C42H61NO7 1.2E-05 4.924578
10,20-Dihydroxyeicosanoic acid C20H40O4 1.14E-07 4.890561
N-arachidonoyl alanine C23H37NO3 3.93E-05 3.863745
trans-Dodec-2-enoic acid C12H22O2 0.0001 3.837056
DL-Tryptophan C11H12N2O2 0.0006 3.555371
Adenylosuccinate C14H18N5O11P 0.005 3.458149
Inosine 2'-phosphate C10H13N4O8P 0.01 3.010493
Ecabet C20H28O5S 2.65E-06 0.161544
Gibberellin A61 C19H24O5 8.35E-03 0.155394
Norethindrone C20H26O2 1.18E-05 0.154963
Tuftsin C21H40N8O6 0.0296 0.100134
Saxagliptin C18H25N3O2 0.00016 0.099222
Bromocriptine C32H40BrN5O5 0.003 0.099209
17-Octadecynoic Acid C18H32O2 0.005 0.096723
Glucosylceramide C40H77NO8 0.007 0.074842
Pregnanetriol C21H36O3 0.006 0.072796
PGF2a ethanolamide C22H39NO5 2.58E-06 0.043586
Table 3. Identification of important DEGs and metabolic pathways
Page 19/27 Protein Accession E- Metabolic pathway Fold Fold change
No. value change by verified by
RNA-seq qPCR
SDHB AIC55101.1 4.10E- Oxidative phosphorylation; 3.72 1.92
109 Citrate cycle
pyruvate dehydrogenase ATO96227.1 7.10E- Glycolysis/Gluconeogenesis; 1.7 3.21
E1 144 HIF-1 signaling pathway;
Citrate cycle (PDE1)
Gapdh1-PA ACL86920.1 2.00E- Glycolysis/Gluconeogenesis; 1.65 2.84
145 HIF-1 signaling pathway
HSDL1 AIC52474.1 1.30E- Steroid hormone synthesis 12.58 6.58
59
Cytochrome P450 ATO97722.1 1.3E- Steroid hormone synthesis 10.24 9.34
(CYP450) 80
Serine/arginine-rich ACL91485.1 4.80E- Spliceosome 2.63 3.13
splicing factor RS2Z32 25
(SRSF)
Heat shock 70kDa protein ABM82071.1 0 Spliceosome 2.56 11.2
8 (HSC70)
SNRNP40 AIC50347.1 1.40E- Spliceosome 2.1 2.36
84
Xanthine AAQ62072.1 4.50E- Purine metabolism; 49.04 20.90
dehydrogenase/oxidase 79 Peroxisome;
(XDO) Drug metabolism
Myosin heavy chain AIC63084.1 3.10E- Tight junction 42.79 32.12
(MHC) 192
Additional File Legend Page 20/27 Table S1: Differentially expressed metabolites between the testis of non-reproductive season and reproductive season.
Table S2: Summary of BLASTx results for unigenes of testis M. nipponense transcriptome.
Table S3: Differentially erxpressed genes between the testis of non-reproductive season and reproductive season.
Figure S1: Glycerophospholipid metabolism of integrated analysis
Figure S2: Sphingolipid metabolism of integrated analysis
Figures
Figure 1
Histological observation of the testis at non-reproductive season and reproductive season of M. nipponense. SP: Sperm; ST: Spermatogonium; SM: Spermatocyte.
Page 21/27 Figure 2
Principal component analysis (PCA) of metabolic profles of the testis samples (n=8) of M. nipponense specimens at non-reproductive season and reproductive season. A. PCA-X analysis. B. Orthogonal projections to latent structuresdiscriminate analysis (OPLS-DA) analysis. OPLS-DA score plots based on the GC-MS spectra of the testis samples (n=8) at non-reproductive season and reproductive season.
Page 22/27 Figure 3
Contig length distribution of M. nipponense transcriptome.
Page 23/27 Figure 4
Gene ontology classifcation of non-redundant transcripts. By alignment to GO terms, 11,306 unigenes were mainly divided into three categories with 55 functional groups: biological process (22 functional groups, 56,557 unigenes), cellular component (17 functional groups, 49,643 unigenes), and molecular function (16 functional groups, 16,066 unigenes). The left y-axis indicates the percentage of a specifc category of genes existed in the main category, whereas the right y-axis indicates the number of a specifc category of genes existed in main category.
Figure 5
Cluster of orthologous groups (COG) classifcation of putative proteins.
Page 24/27 Figure 6
Verifcation of the expressions of 10 differentially expressed genes (DEGs) between the testis of non- reproducrtive season and reproductive season by qPCR. The amounts of DEGs expression were normalized to the EIF transcript level. Data are shown as mean ±SD (standard deviation) of tissues in three separate individuals. * indicates expression difference of DETs between the testis of non- reproductive season and reproductive season.
Page 25/27 Figure 7
Identifcation of the expressions of 10 differentially expressed genes (DEGs) in different tissues by qPCR. The amounts of DEGs expression were normalized to the EIF transcript level. Data are shown as mean ±SD (standard deviation) of tissues in three separate individuals. Capital letters indicate expression difference of DEGs in different tissues.
Page 26/27 Figure 8
Integration of foure energy related metabolic pathways.
Supplementary Files
This is a list of supplementary fles associated with this preprint. Click to download.
TableS2.xls FigureS1.png TableS1.xlsx TableS3.xls FigureS2.png
Page 27/27