DOCSLIB.ORG

Cronobacter Sakazakii

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Cronobacter Sakazakii Danger lurking in infant formula… Cronobacter Sakazakii A Case History The bacteria, Cronobacter sakazakii is ubiquitous in A female infant born in New nature, but can cause severe Mexico was delivered vaginally illness or death in newborn at full term. She had been fed babies if it is ingested. The powdered infant formula since most likely cause for an birth. At four weeks old a family infection is through By Jay Hardy, CLS, SM (NRCM) member noted that she had a contaminated powdered infant fever of 100.9 deg. F., and formula or if the bacteria are consequently was taken to the present in the water used to mix Jay Hardy is the founder and emergency room. powdered infant formula. president of Hardy Diagnostics. He began his career in She was observed then Because Cronobacter sakazakii microbiology as a Medical Technologist in Santa Barbara, discharged without treatment, is found frequently in nature, it California. but returned to the ER again is important to sterilize both In 1980, he began manufacturing after becoming fussier, bottles and the water used to culture media for the local vomiting, and exhibiting make the formula. hospitals. Today, Hardy seizure-like activity. Diagnostics is the third largest culture media manufacturer in the Before 2007, this Gram United States. This time she was found to have negative rod was known as a bulging fontanel, severe neck Enterobacter sakazakii. While To ensure rapid and reliable turn around time, Hardy Diagnostics stiffness, and dehydration. the organism has been found in maintains eight US distribution Cerebrospinal fluid and blood other foods, only Powdered centers, and produces over 3,500 cultures were taken. After 11 Infant Formula (PIF) has been products used in clinical and industrial microbiology weeks of hospitalization and linked to disease outbreaks, laboratories throughout the world. receiving extensive antibiotic since PIF is not a sterile therapy, the infant was product. The organism is discharged with severe brain unusually resistant to injury. Although the blood desiccation and can be viable cultures were negative, the for years in a dried state. spinal fluid cultures showed growth of Cronobacter Premature, low weight and sakazakii. immune compromised infants are at a higher risk of infection. The way powdered infant formula becomes contaminated with these bacteria is not well understood. Contamination can occur from the raw ingredients used in the formula, during the manufacturing process or during the preparation and reconstitution process. Contamination may also occur through blenders, feeding bottles and utensils used to cleanse feeding bottles. Contamination may be more likely when reconstituted formula is kept at improper temperatures prior to use or for The photo above shows November 2011 - Several a longer duration than suggested colonies of C. sakazakii shipments of Kotex tampons by manufacturers. growing on Hardy Diagnostics were recalled due to a C. HardyCHROM sakazakii. sakazakii contamination. The organism has been found in other foods, but only powdered April 2008 – A male baby that infant formula has been linked Recent incidents of C. sakazakii was breastfed for six months to disease outbreaks. Adults can contamination include: was transitioned to PIF. At also become infected, but the seven months old he died disease is far less severe than March 2012 – An entire unexpectedly while taking his with infants. shipment of baby food powder usual nap. The blood cultures from Russia (manufactured in taken at autopsy revealed a Israel) was impounded due to septicemia due to C. sakazakii. positive samples for C. sakazakii. April 2001 – A prematurely born infant in a Tennessee December 2011 - Four infants NICU died due to C. sakazakii. in the US became sick and two It was found that the PIF used died from C. sakazakii bacteria in the NICU, called Portagen, believed to come from was contaminated with C. Cronobacter sakazakii is powdered infant formula or the sakazakii. dangerous because once it water used during preparation. enters the digestive system, it Two of the infants had The CDC states that typically quickly causes death to portions consumed Mead Johnson’s four to six cases of infant of the intestines, often leading Enfamil PIF, however, no infections with C. sakazakii to septicemia and meningitis. pathogens could be recovered occur each year, however in from other units within the same 2011, there were twelve. It is While digestive issues are lot. estimated that 40 to 80% of the common in newborn babies, a cases will be fatal. Cronobacter sakazakii infections have symptoms that Hardy Diagnostics produces a rapidly worsen. chromogenic culture medium specifically for C. sakazakii, in which the colonies will turn a turquoise color, that facilitates the easy recognition of these bacteria. More information can be found on the CDC website. Jay Hardy Santa Maria, California C. sakazakii is a gram negative rod closely related to the Enterobacter and Citrobacter genera. At the onset of infection, C. sakazakii would lead to digestive symptoms in The information contained in this article is for newborns. These may include educational purposes only and is not intended nor recommended as a substitute for medical irritability caused by abdominal advice, diagnosis, or treatment. pain, fever, food intolerance, vomiting, and a complete lack of appetite. This may progress very quickly to more severe symptoms as the bacteria cause tissue necrosis in the intestines. More severe symptoms may include abdominal distention (swelling) and blood in the feces. As time passes, skin over the abdomen will turn a dark reddish color. Due to the many problems associated with PIF, sterile liquid formula (though more expensive) would be a better choice for these infants than non-sterile PIF. Even better still, would be to continue breast feeding for as long as possible. .
Load more

Recommended publications
  • Is It Essential to Sequence the Entire 16S Rrna Gene for Bacterial
    » INSTRUMENTATION » Is it Essential to Sequence Introduction Bacterial Identification in the biopharmaceutical industry, especially in the Entire 16S rRNA Gene manufacturing facilities, is very important because an occurrence of a problematic microorganism in the final product could be harmful for the end user and detrimental to a company’s finances and reputation. for Bacterial Identification? Environmental Monitoring (EM) programs are the cornerstone of understanding the microbial ecology in a manufacturing facility and have become a regulatory requirement for most manufacturers. The EM program is a biological surveillance system which enables companies to quickly identify organisms which are transient or resident in their facilities before these organisms have an opportunity to contaminate a product. A properly executed EM program provides an early warning of potential contamination problems due to Sunhee Hong, PhD and equipment failure, inadequate cleaning, or deficiencies in staff hygiene Christine E. Farrance, PhD training, for example, so that problems can be corrected to prevent Charles River adulteration of the end product. The Food and Drug Administration (FDA) has published guidelines for the production of sterile drugs by aseptic processing which includes a section on EM programs, and the USP general information chapter “Microbiological Control and Monitoring of Aseptic Processing Environments” also contains detailed information regarding EM programs1. The EM program is only effective if the organisms recovered from the facility are accurately identified, so the information gathered can be used to understand the microbial control through tracking and trending and dictate appropriate remediation activities. There are several different options available for bacterial identification; however, the use of 16S rRNA gene sequences has been considered the most powerful and accurate tool, while conventional phenotypic methods often show major weaknesses2-5.
    [Show full text]
  • Prevalence, Distribution, and Phylogeny of Type Two Toxin-Antitoxin Genes Possessed by Cronobacter Species Where C. Sakazakii Homologs Follow Sequence Type Lineages
    microorganisms Article Prevalence, Distribution, and Phylogeny of Type Two Toxin-Antitoxin Genes Possessed by Cronobacter Species where C. sakazakii Homologs Follow Sequence Type Lineages Samantha Finkelstein, Flavia Negrete, Hyein Jang, Jayanthi Gangiredla, Mark Mammel, Isha R. Patel, Hannah R. Chase, JungHa Woo, YouYoung Lee, Caroline Z. Wang, Leah Weinstein, Ben D. Tall * and Gopal R. Gopinath Center of Food Safety and Applied Nutrition, U. S. Food and Drug Administration, 8301 MuirKirk Rd, Laurel, MD 20708, USA; sfi[email protected] (S.F.); [email protected] (F.N.); [email protected] (H.J.); [email protected] (J.G.); [email protected] (M.M.); [email protected] (I.R.P.); [email protected] (H.R.C.); [email protected] (J.W.); [email protected] (Y.L.); [email protected] (C.Z.W.); [email protected] (L.W.); [email protected] (G.R.G.) * Correspondence: [email protected] Received: 4 October 2019; Accepted: 9 November 2019; Published: 12 November 2019 Abstract: Cronobacter species are a group of foodborne pathogenic bacteria that cause both intestinal and systemic human disease in individuals of all age groups. Little is known about the mechanisms that Cronobacter employ to survive and persist in foods and other environments. Toxin–antitoxin (TA) genes are thought to play a role in bacterial stress physiology, as well as in the stabilization of horizontally-acquired re-combinatorial elements such as plasmids, phage, and transposons. TA systems have been implicated in the formation of a persistence phenotype in some bacterial species including Escherichia coli and Salmonella.
    [Show full text]
  • International Journal of Systematic and Evolutionary Microbiology (2016), 66, 5575–5599 DOI 10.1099/Ijsem.0.001485
    International Journal of Systematic and Evolutionary Microbiology (2016), 66, 5575–5599 DOI 10.1099/ijsem.0.001485 Genome-based phylogeny and taxonomy of the ‘Enterobacteriales’: proposal for Enterobacterales ord. nov. divided into the families Enterobacteriaceae, Erwiniaceae fam. nov., Pectobacteriaceae fam. nov., Yersiniaceae fam. nov., Hafniaceae fam. nov., Morganellaceae fam. nov., and Budviciaceae fam. nov. Mobolaji Adeolu,† Seema Alnajar,† Sohail Naushad and Radhey S. Gupta Correspondence Department of Biochemistry and Biomedical Sciences, McMaster University, Hamilton, Ontario, Radhey S. Gupta L8N 3Z5, Canada [email protected] Understanding of the phylogeny and interrelationships of the genera within the order ‘Enterobacteriales’ has proven difficult using the 16S rRNA gene and other single-gene or limited multi-gene approaches. In this work, we have completed comprehensive comparative genomic analyses of the members of the order ‘Enterobacteriales’ which includes phylogenetic reconstructions based on 1548 core proteins, 53 ribosomal proteins and four multilocus sequence analysis proteins, as well as examining the overall genome similarity amongst the members of this order. The results of these analyses all support the existence of seven distinct monophyletic groups of genera within the order ‘Enterobacteriales’. In parallel, our analyses of protein sequences from the ‘Enterobacteriales’ genomes have identified numerous molecular characteristics in the forms of conserved signature insertions/deletions, which are specifically shared by the members of the identified clades and independently support their monophyly and distinctness. Many of these groupings, either in part or in whole, have been recognized in previous evolutionary studies, but have not been consistently resolved as monophyletic entities in 16S rRNA gene trees. The work presented here represents the first comprehensive, genome- scale taxonomic analysis of the entirety of the order ‘Enterobacteriales’.
    [Show full text]
  • Phage S144, a New Polyvalent Phage Infecting Salmonella Spp. and Cronobacter Sakazakii
    International Journal of Molecular Sciences Article Phage S144, a New Polyvalent Phage Infecting Salmonella spp. and Cronobacter sakazakii Michela Gambino 1 , Anders Nørgaard Sørensen 1 , Stephen Ahern 1 , Georgios Smyrlis 1, Yilmaz Emre Gencay 1 , Hanne Hendrix 2, Horst Neve 3 , Jean-Paul Noben 4 , Rob Lavigne 2 and Lone Brøndsted 1,* 1 Department of Veterinary and Animal Sciences, University of Copenhagen, 1870 Frederiksberg C, Denmark; [email protected] (M.G.); [email protected] (A.N.S.); [email protected] (S.A.); [email protected] (G.S.); [email protected] (Y.E.G.) 2 Laboratory of Gene Technology, KU Leuven, 3001 Leuven, Belgium; [email protected] (H.H.); [email protected] (R.L.) 3 Department of Microbiology and Biotechnology, Max Rubner-Institut, Federal Research Institute of Nutrition and Food, 24103 Kiel, Germany; [email protected] 4 Biomedical Research Institute and Transnational University Limburg, Hasselt University, BE3590 Diepenbeek, Belgium; [email protected] * Correspondence: [email protected] Received: 25 June 2020; Accepted: 21 July 2020; Published: 22 July 2020 Abstract: Phages are generally considered species- or even strain-specific, yet polyvalent phages are able to infect bacteria from different genera. Here, we characterize the novel polyvalent phage S144, a member of the Loughboroughvirus genus. By screening 211 Enterobacteriaceae strains, we found that phage S144 forms plaques on specific serovars of Salmonella enterica subsp. enterica and on Cronobacter sakazakii. Analysis of phage resistant mutants suggests that the O-antigen of lipopolysaccharide is the phage receptor in both bacterial genera. The S144 genome consists of 53,628 bp and encodes 80 open reading frames (ORFs), but no tRNA genes.
    [Show full text]
  • Enterobacter Sakazakii)
    J. Microbiol. Biotechnol. (2011), 21(5), 509–514 doi: 10.4014/jmb.1007.07059 First published online 3 March 2011 The Phenotypic and Genotypic Characterization of Korean Isolates of Cronobacter spp. (Enterobacter sakazakii) Kim, Jung-Beom1, Suk-Ho Kang1, Yong-Bae Park1, Jae-Ho Choi2, Sung-Jin Park2,3, Seung-Hak Cho4, Mi-Sun Park4, Hae Kyung Lee5, Na-Jung Choi2, Ha-Na Kim2, and Deog-Hwan Oh2* 1Division of Health Research and Planning, Gyeonggi-do Research Institute of Health and Environment, Suwon 440-290, Korea 2School of Bioscience and Biotechnology, Kangwon National University, Chuncheon 200-701, Korea 3Center of Senior Industry, Youngdong University, Youngdong-gun, Chungbuk 370-701, Korea 4Division of Enteric Bacterial Infections, Center for Infectious Diseases, National Institute of Health, Seoul 122-701, Korea 5Department of Laboratory Medicine, Catholic University College of Medicine, Uijongbu 480-130, Korea Received: July 30, 2010 / Revised: February 8, 2011 / Accepted: February 11, 2011 This study was conducted to investigate the phenotypic and was initially known as yellow-pigmented Enterobacter genotypic characteristics of Korean isolates of Cronobacter cloacae and reclassified based on biochemical characteristics, spp. (Enterobacter sakazakii). A total of 43 Cronobacter DNA-DNA hybridization, and antibiotic susceptibility spp., including 5 clinical isolates, 34 food isolates, 2 patterns in 1980 [5, 18]. Cronobacter spp. infection, which environmental isolates, and 2 reference strains (C. sakazakii causes life-threatening meningitis, septicemia, and necrotizing ATCC 29004 and C. muytjensii ATCC51329) were used in enterocolitis in infants, has been implicated in foodborne this study. Korean isolates of Cronobacter spp. were outbreaks worldwide [17, 22]. The pathogen has been divided into 11 biogroups according to their biochemical isolated from a variety of food, clinical, and environmental profiles and 3 genomic groups based on the analysis of sources including cheese, vegetables, grains, soil, and powdered their 16S rRNA gene sequences.
    [Show full text]
  • Cronobacter: an Emerging Opportunistic Pathogen Associated with Neonatal Meningitis, Sepsis and Necrotizing Enterocolitis
    Journal of Perinatology (2013) 33, 581–585 & 2013 Nature America, Inc. All rights reserved 0743-8346/13 www.nature.com/jp STATE-OF-THE-ART Cronobacter: an emerging opportunistic pathogen associated with neonatal meningitis, sepsis and necrotizing enterocolitis CJ Hunter1,2 and JF Bean1 Members of the genus Cronobacter are an emerging group of opportunist Gram-negative pathogens. This genus was previously thought to be a single species, called Enterobacter sakazakii. Cronobacter spp. typically affect low-birth-weight neonates, causing life-threatening meningitis, sepsis and necrotizing enterocolitis. Outbreaks of disease have been associated with contaminated infant formula, although the primary environmental source remains elusive. Advanced understanding of these bacteria and better classification has been obtained by improved detection techniques and genomic analysis. Research has begun to characterize the virulence factors and pathogenic potential of Cronobacter. Investigations into sterilization techniques and protocols for minimizing the risk of contamination have been reviewed at national and international forums. In this review, we explore the clinical impact of Cronobacter neonatal and pediatric infections, discuss virulence and pathogenesis, and review prevention and treatment strategies. Journal of Perinatology (2013) 33, 581–585; doi:10.1038/jp.2013.26; published online 28 March 2013 Keywords: Cronobacter sakazakii; meningitis; necrotizing enterocolitis; neonatal infections; infant formula INTRODUCTION single clinical setting.10 Cronobacter neonatal infection rates Cronobacter is an emerging genus of opportunistic Gram-negative remain low and are reported in the USA as one Cronobacter pathogens associated with potentially fatal neonatal infections, infection per 100 000 infants, 8.7 per 100 000 low-birth-weight including meningitis, sepsis and necrotizing enterocolitis (NEC).1 neonates, and one Cronobacter infection per 10 660 very low- 13 These infections typically affect our smallest and most vulnerable birth-weight neonates.
    [Show full text]
  • Isolation of Cronobacter Spp.(Formerly Enterobacter Sakazakii) from Infant
    BMC Microbiology BioMed Central Research article Open Access Isolation of Cronobacter spp. (formerly Enterobacter sakazakii) from infant food, herbs and environmental samples and the subsequent identification and confirmation of the isolates using biochemical, chromogenic assays, PCR and 16S rRNA sequencing Ziad W Jaradat*†, Qotaiba O Ababneh†, Ismail M Saadoun, Nawal A Samara and Abrar M Rashdan Address: Department of Biotechnology and Genetic Engineering, Jordan University of Science and Technology, P. O. Box 3030, Irbid-22110, Jordan Email: Ziad W Jaradat* - [email protected]; Qotaiba O Ababneh - [email protected]; Ismail M Saadoun - [email protected]; Nawal A Samara - [email protected]; Abrar M Rashdan - [email protected] * Corresponding author †Equal contributors Published: 27 October 2009 Received: 10 March 2009 Accepted: 27 October 2009 BMC Microbiology 2009, 9:225 doi:10.1186/1471-2180-9-225 This article is available from: http://www.biomedcentral.com/1471-2180/9/225 © 2009 Jaradat et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background: Cronobacter spp. (formerly Enterobacter sakazakii), are a group of Gram-negative pathogens that have been implicated as causative agents of meningitis and necrotizing enterocolitis in infants. The pathogens are linked to infant formula; however, they have also been isolated from a wide range of foods and environmental samples. Results: In this study, 233 samples of food, infant formula and environment were screened for the presence of Cronobacter spp.
    [Show full text]
  • A Novel Primer Targeted Gyrb Gene for the Identification of Cronobacter Sakazakii in Powdered Infant Formulas (PIF) and Baby Foods in Iran
    Received: 21 July 2018 Revised: 18 November 2018 Accepted: 26 November 2018 DOI: 10.1111/jfs.12609 ORIGINAL ARTICLE A novel primer targeted gyrB gene for the identification of Cronobacter sakazakii in powdered infant formulas (PIF) and baby foods in Iran Afsaneh Mashoufi1 |KiarashGhazvini2 | Mohammad Hashemi1 | Majid Ghayour Mobarhan1 | Vida Vakili3 | Asma Afshari1 1Department of Nutrition, Faculty of Medicine, Mashhad University of Medical Abstract Sciences, Mashhad, Iran The aim of this study was to perform a molecular identification and design a polymerase chain 2Department of Microbiology, Faculty of reaction (PCR) method based on a specific gene (gyrase subunit B [gyrB]) for rapid detection of Medicine, Mashhad University of Medical Cronobacter sakazakii. In this study, from February 2017 to January 2018, 100 powdered infant Sciences, Mashhad, Iran formula milks (PIF1-6) and 100 baby food items (BF1-8) (total number = 200 samples) were pur- 3Department of Social Medicine, Faculty of Medicine, Mashhad University of Medical chased from different commercial brands from different pharmacies of the Mashhad city, Iran Sciences, Mashhad, Iran from different pharmacies of the Mashhad city, Iran. Correspondence After isolation of Cronobacter, DNA extraction and PCR assay were performed to detect and Asma Afshari, Department of Nutrition, confirm genus and species of isolated bacteria with 16S ribosomal RNA (16S rRNA) and designed Faculty of Medicine, Mashhad University of gyrB primers, respectively. The abundance of C. sakazakii in PIFs and baby foods by culture Medical Sciences, Mashhad, Iran. Email: [email protected] method were 5/100 (5%) and 8/100 (8%), respectively; also, the final analysis based on gyrB Funding information primer pairs in PIF and baby food showed contamination rates of 0/100 (0%) and 3/100 (3%), Mashhad University of medical science, respectively.
    [Show full text]
  • High-Throughput 16S Rrna Gene Sequencing of Butter Microbiota Reveals a Variety of Opportunistic Pathogens
    foods Article High-Throughput 16S rRNA Gene Sequencing of Butter Microbiota Reveals a Variety of Opportunistic Pathogens Mikhail Y. Syromyatnikov 1,2,*, Anastasia V. Kokina 1,2, Sergey A. Solodskikh 1,2, Anna V. Panevina 1, Evgeny S. Popov 3 and Vasily N. Popov 1,2 1 Department of Genetics, Cytology and Bioengineering, Voronezh State University, 394018 Voronezh, Russia; [email protected] (A.V.K.); [email protected] (S.A.S.); [email protected] (A.V.P.); [email protected] (V.N.P.) 2 Laboratory of Metagenomics and Food Biotechnology, Voronezh State University of Engineering Technologies, 394036 Voronezh, Russia 3 Department of Service and Restaurant Business, Voronezh State University of Engineering Technologies, 394036 Voronezh, Russia; [email protected] * Correspondence: [email protected]; Tel.: +7-(473)-239-92-81 Received: 8 April 2020; Accepted: 8 May 2020; Published: 9 May 2020 Abstract: Microbial contamination of dairy products with a high fat content (e.g., butter) has been studied insufficiently. No studies using modern molecular methods to investigate microbial communities in butter have been conducted so far. In this work, we used high-throughput sequencing and Sanger sequencing of individual bacterial colonies to analyze microbial content of commercially available butter brands. A total of 21 samples of commercially available butter brands were analyzed. We identified a total of 94 amplicon sequence variants corresponding to different microbial taxa. The most abundant lactic acid bacteria in butter were Lactobacillus kefiri, Lactobacillus parakefiri, Lactococcus taiwanensis and Lactococcus raffinolactis. A large amount of Streptococcus spp. bacteria (87.9% of all identified bacteria) was found in one of the butter samples.
    [Show full text]
  • Isolation and Partial Characterization of Cronobacter Sakazakii by 16S
    International Journal of Scientific & Engineering Research, Volume 5, Issue 4, April-2014 671 ISSN 2229-5518 Isolation and partial characterization of Cronobacter sakazakii by 16S rRNA sequence analysis isolated from milk of dairy cows with Mastitis in Chikmagalur, Karnataka, INDIA Vineeth B, Priyanka B, Ramesh B S, Makari Hanumanthappa K*, Vinay Suvarna M N and Vivek Chandramohan Abstract Mastitis is a chronic inflammation of milk glands which is caused by the bacteriological variations in the milk and other changes in the glandular tissue. Mastitis occurs throughout the world wherever dairy farms are found. Cronobacter sakazakii is one of the causative organism and also it is known as Enterobacter sakazakii. Cronobacter sakazakii enters the cattle through the udder, where the cattle are reared in the unhygienic condition. The bacteria were isolated from Mastitis infected raw milk around the Chikmagalur District. Bacteria were isolated with the standard protocols and were maintained in Lowry broth (LB) media. All the isolates were subjected to RAPD analysis. Further DNA of the bacteria was isolated by CTAB method and subjected to 16s ribosomal sequence analysis using 16S rRNA FU8 universal primers (16s rRNA F-5’AGAGTTTGATCCTGGCTCAG 3’, 16s rRNA R- 5’ACG GCTACCTTGTTA3’) and phylogenetic analysis were used to molecular relatedness of the isolated animal pathogenic bacteria.16S rRNA sequences were submitted to GenBank, NCBI and accession number was allotted. The obtained 16S rRNA sequences were subjected in-silico analysis by genomics workbench software for Sequence information, atomic composition, nucleic acid distribution, nucleotide distribution, histogram and secondary structure prediction. The findings of this research greatly anticipated for the identification and characterization of the animal pathogen Cronobacter sakazakii was first time reported in Chikmagalur, Karnataka, India.
    [Show full text]
  • Cronobacter Sakazakii in Foods and Factors Affecting Its Survival, Growth, and Inactivation
    International Journal of Food Microbiology 136 (2009) 204–213 Contents lists available at ScienceDirect International Journal of Food Microbiology journal homepage: www.elsevier.com/locate/ijfoodmicro Cronobacter sakazakii in foods and factors affecting its survival, growth, and inactivation Larry R. Beuchat a,⁎, Hoikyung Kim b, Joshua B. Gurtler c, Li-Chun Lin a, Jee-Hoon Ryu d, Glenner M. Richards e a Center for Food Safety and Department of Food Science and Technology, University of Georgia, 1109 Experiment Street, Griffin, Georgia 30223-1797, USA b Division of Human Environmental Science, College of Life Science, Wonkwang University, 344-2 Shinyong-dong, Iksan, Jeonbuk 570-749, Republic of Korea c United States Department of Agriculture, Agricultural Research Service, Eastern Regional Research Center, 600 East Mermaid Lane, Wyndmoor, Pennsylvania 19038-8598, USA d Graduate School of Life Sciences and Biotechnology, Korea University, Anam-dong, Sungbuk ku, Seoul 136-701, Republic of Korea e Department of Science and Technology, Evangel University, 1111 North Glenstone, Springfield, Missouri 65802, USA article info abstract Keywords: Cronobacter sakazakii has been isolated from a wide range of environmental sources and from several foods of Cronobacter sakazakii animal and plant origin. While infections caused by C. sakazakii have predominantly involved neonates and Enterobacter sakazakii infants, its presence on or in foods other than powdered infant formula raises concern about the safety risks Foodborne illness these foods pose to immunocompromised consumers. We have done a series of studies to better understand Infant formula the survival and growth characteristics of C. sakazakii in infant formula, infant cereal, fresh-cut produce, and juices made from fresh produce.
    [Show full text]
  • Enterobacter Sakazakii)
    International Journal of Research in Pharmacy and Biosciences Volume 6, Issue 4, 2019, PP 4-14 ISSN 2394-5885 (Print) and ISSN 2394-5893 (Online) Cronobacter Sakazakii (Enterobacter Sakazakii) Mohamed M. Amer1*, Hoda M. Mekky2 1Department of Poultry Diseases, Faculty of Veterinary Medicine, Cairo University, Giza, Egypt 2Poultry Diseases Department, Veterinary Research Division, National Research Centre, Giza, Egypt *Corresponding Author: Mohamed M. Amer, Department of Poultry Diseases, Faculty of Veterinary Medicine, Cairo University, Giza, Egypt, Email: [email protected] ABSTRACT Enterobacter sakazakii (E. sakazakii) is an opportunistic pathogen gram-negative, motile with peritrichous flagella, nonspore-forming, gram-negative, belonging to the family of Enterobacteriaceae. It considered being a food borne pathogen causing meningitis, septicemia and enterocolitis in neonates, cerebral infarcts with resulting in a premature infant. In poultry industry the organism was reported to contaminate fertilized eggs and may result in weak chicks, poor chick growth and low FCR, increased mortality of embryos, lower hatchability and increased early chick mortality. Pathogenicity of E. sakazakii to broiler chickens in the form of clinical signs, mortality, pathological lesions and decreased FCR was reported. Conclusion: As poultry remains a vehicle of important pathogens to human as well as the possible economic losses a strategy must be considered in the evaluation, prevention, and control of this infections. Keywords: E. sakazakii, food borne pathogen, Pathogenicity, chicks, clinical signs, pathological lesions. INTRODUCTION introduced as a new species (E. Sakazakii). Recently, a taxonomic reclassification of this Enterobacter spp. is the sixth most common pathogen to consist of 5 species within a new cause of nosocomial infection and antibiotic genus ''Cronobacter'' was proposed resistant strains are observed with increasing (Baumgartner et al., 2009).
    [Show full text]