Phylogeography in Response to Reproductive Strategies and Ecogeographic Isolation in Ant Species on Madagascar: Genus Mystrium (Formicidae: Amblyoponinae)

Natalie R. Graham

A thesis submitted to Sonoma State University in partial fulfillment of the requirements for the degree of

MASTER OF SCIENCE in Biology

______Dr. Derek Girman, Chair

______Dr. Richard Whitkus

______Dr. Brian L. Fisher

______Date

By Natalie R. Graham

Authorization for Reproduction of Master’s Thesis

I grant permission for the print or digital reproduction of this thesis in its entirety, without further authorization from me, on the condition that the person or agency requesting reproduction absorb the cost and provide proper acknowledgment of authorship.

I grant permission for the print or digital reproduction of parts of this thesis without further authorization from me, on the condition that the person or agency requesting reproduction absorb the cost and provide proper acknowledgment of authorship.

DATE: ______Signature

______Street Address

______City, State, Zip

Phylogeography in Response to Reproductive Strategies and Ecogeographic Isolation in Ant Species on Madagascar: Genus Mystrium (Formicidae: Amblyoponinae)

Thesis by Natalie R. Graham

ABSTRACT

Purpose of the Study: Madagascar is a region of great biological diversity and complex microendemism patterns. Ants (Formicidae) are a hyperdiverse group, which afford finer scale information regarding microendemism than vertebrates, in part because of their reduced vagility. The purpose of this study is to use molecular phylogenetic methods along with geographic and habitat data to examine the diversification of a particular group of ants on the island of Madagascar.

Procedure: We have assembled a nuclear and mitochondrial phylogeny of a genus of ants, Mystrium, from Madagascar. Species within the genus Mystrium display two different colonial reproductive strategies; six Mystrium species endemic to the island of Madagascar use dependent colony foundation (DCF) and have wingless ergatoid queens. Conversely, four species of Mystrium, two which are endemic to the island reproduce via independent colony foundation (ICF) and have winged queens. Thus, we are able to assess complex microendemism patterns and recent vertebrate derived species diversification hypotheses using an arthropod system with contrasting vagility.

Findings: Among Mystrium species which use DCF there is a deep phylogenetic split between species which occur in more mesic conditions of the eastern rainforest and the more arid conditions of the western tropical dry-forest and southern spiny desert. While examining the phylogeographic signal of conspecifics, Mystrium species which reproduce by DCF display deep mitochondrial phylogenetic divergence. Mystrium species which reproduce by ICF display shallow mitochondrial phylogenetic divergence. Tropical rainforest Mystrium species also appear to be diverging due to isolation on mountains during periods of paleoclimatic change.

Conclusions: There are other patterns which emerge from the arthropod data set; particularly there are regions of the island which contain unique assemblages of Mystrium associated with microhabitat such as Tsingy formations. Overall, Mystrium species provide insight into how reproductive strategy impacts species diversification across a region with high microendemism.

Chair: ______Signature

MS Program: Biology Sonoma State University Date: ______

iii

Acknowledgements

Faculty, friends and family members have helped me to complete this thesis. I would like to express my gratitude to these individuals for their support and assistance. The faculty of this department provided many insightful discussions of biological concepts; both informally during my graduate career and during classroom time as an undergraduate. I am particularly grateful to my advisor, Dr. Derek Girman, for his willingness to go along with many tangential directions that the development of the final thesis has taken me. His criticisms have always had a direct influence on the improvement of my performance, in writing and critical thinking. I offer much thanks to Dr. Brian Fisher, for invaluable contributions to the Mystrium story, his participation on my graduate committee and generally schooling me in the ways of ants. To my other committee members: Dr. Richard Whitkus, for assistance with making the best possible final document; Dr. Diana Outlaw for help with the initial molecular analysis methods and Dr. Eileen Thatcher for her early encouragement. I’d also like to thank Dr. Phil Ward for helping fuel my fledgling interest in ants during Bioblitz 2008 and his guidance with molecular techniques, particularly how to tackle the NuMts question. I am very grateful to each of the professors who taught AntCourse, Uganda 2012. Dr. Matthew Molet and Dr. Chrisian Peeters, thank you for the invitation to share my preliminary results with your lab group in Paris. Without your painstaking research into the colony reproductive strategies of Mystrium, this manuscript could not have been written. Finally, I was fortunate to be born to wonderful parents who always taught me to pursue my interests and to follow my dreams.

Table of Contents

Page

Abstract ...... iv Introduction ...... 1 Taxonomy of Mystrium...... 3 Mystrium Reproductive Strategies ...... 4 Materials and Methods ...... 6 Sampling ...... 6 DNA Isolation, Amplification, and Sequencing ...... 7 NuMts Detection ...... 9 Analyses ...... 9 Results ...... 13 Discussion ...... 16 Morphological Taxonomy ...... 17 Paraphyly of Dependent Colony Foundation ...... 17 Reproductive Strategy Effect on Phylogeography ...... 18 Large-scale Ecogeographic Constraints ...... 21 Montane Impacts ...... 23 Lowland Endemism ...... 25 Microendemism ...... 27 Conclusions ...... 29

Appendix A – Tables ...... 31 Appendix B – Figures ...... 37 Appendix C – Figures Legend ...... 40 References ...... 41

List of Tables

Table 1 – List of current Mystrium species and species group reproductive types from most recent revision of the genus by Yoshimura and Fisher (2014).

Table 2 – List of all specimens, museum accession numbers, Wilme et al. (2007) center of endemism or retreat dispersal watershed, habitat type, and collection locality information. Specimens in nuclear phylogeny are indicated with an asterisk* next to the museum accession number.

Table 3 – Primer sequences for amplification and sequencing of nuclear phylogeny with models of evolution selected by AIC in Modeltest and Mr.Modeltest. Primer sequences for amplification and sequencing of cytochrome oxidase I (CO1) gene for mitochondrial phylogeny and nuclear mitochondrial like sequence (NuMts) detection.

Table 4 – Cytochrome c Oxidase I Sequence divergence values within and between species of Mystrium calculated using K2P model of evolution in Mega version 6.0

Table 5 – Cytochrome c Oxidase I sequence divergence values within and between subclades of Mystrium morphospecies calculated using K2P model of evolution in Mega version 6.0

List of Figures

Figure 1 – Land classification and elevation of Madagascar

Figure 2 – Nuclear Phylogeny of Mystrium

Figure 3 – Mitochondrial Phylogeny of Mystrium

vii

INTRODUCTION

Species have evolved in isolation on Madagascar since the breakup of Indo-Madagascar and the northwards drifting of India and the Seychelles started 88 million years ago (Ali and Aitchison 2008). Today the entire island of Madagascar is a globally recognized biological hotspot, a region of extremely high biodiversity that contains a large number of endemic species (Goodman and Benstead 2005). Madagascar has varied climatic regions and topography (Figure 1). There are complex micro-endemic patterns on the island, often non-concordant among taxa (Kremen et al. 2008). Species radiations on the island have been difficult to adequately explain, often because they are examined at regional or taxonomically restricted levels (Yoder et al. 2005; Yoder and Nowak 2006). Recently a flurry of diversification models have been developed, across multiple taxa, utilizing a variety of methods, to describe patterns of lowland endemism (Wilme, Goodman and

Ganzhorn 2006), high-montane endemism (Wollenberg et al. 2008), rivers as barriers

(Goodman and Ganzhorn 2004) and a division of endemism between northern and southern sites, or eastern and western sites by ecogeographic constraints (Yoder and

Heckman 2006). Many of these diversification mechanisms proposed for the fauna of

Madagascar have been reviewed and the perspectives for testing them were concisely outlined (Vences et al. 2009). These authors make an argument for Madagascar as a promising system for the general study of patterns and processes in species diversification. However, these models largely have been constructed and evaluated using vertebrate taxa. Many vertebrate species (birds, primates, lizards) typically have relatively high levels of vagility that allow them to disperse across landscape features that may act as boundaries to less vagile species.

Arthropods are being recognized as invaluable for outlining the influence of fine scale micro-habitats, thus making their distribution patterns useful for conservation planning.

Ants are a hyper-diverse group of arthropods and have long been utilized as an indicator species for conservation, being described as being important in surveying and restoration monitoring (Underwood and Fisher 2006; Kaspari and Majer 2000). While conducting a survey takes an account of the ant fauna across a geographic area at one point in time, monitoring is repeated sampling typically undertaken in areas where habitat changes are underway. Surveys and monitoring have typically used a morphospecies approach to distinguish among distinct taxonomic units, however this approach is time-intensive and therefore limiting (Fisher and Smith 2008; Lawton et al. 1998). Molecular phylogenetic methods within the field of myrmecology have been opening up the way that ants can be used to gain an understanding of the historical biogeography of a region and in applications for conservation (Fisher and Smith 2008; Moreau 2009). Phylogeography deals with historical, phylogenetic components of the spatial distributions of gene lineages and serves to place into broader temporal context traditional ecogeographic perspectives (Avise 2000; Avise et al. 1987a). Thus, the phylogeographic approach is important for understanding the long-term natural patterns of species in relation to their habitats and physiographic constraints. Relevant molecular information regarding biodiversity is invaluable as an alpha-taxonomy method which increases the rate of assessing speciation. Recent studies have utilized the fine scale patterns of habitat utilization of ants, demonstrating ants are particularly well suited to illuminate patterns of

3 endemism on a much smaller scale than vertebrate groups (Smith et al. 2005; Kremen et al. 2008; Fisher and Girman 2000).

A molecular phylogenetic analysis of a genus of ants from Madagacar along with geographic and habitat data can be used to examine the diversification on the island of

Madagascar of a hyperdiverse group of arthropods. The genus Mystrium Roger, 1862,

(Subfamily Amblyoponinae) is a prime candidate for this approach as it contains species which exhibit two forms of dispersal, via colony foundation by winged (alate) queens or colony foundation by a wingless reproductive caste (ergatoid queens), and thus displays patterns of variable vagility.

Taxonomy of Mystrium

Recently a revision for the genus Mystrium for the Malagasy region along with descriptions for six new species was published (Yoshimura and Fisher 2014). Previous taxonomic works (Menozzi 1929, Brown 1960) were insufficient to diagnose the species boundaries of Mystrium in the Malagasy region. Additionally Yoshimura and Fisher

(2014) assigned all recognized species of Mystrium to one of three newly proposed species groups (Table 1).

Mystrium species are considered to retain ancestral character states for both behavioral and morphological traits (Brown 1960; Hölldobler and Wilson 1990; Ward 1994; Wilson

1971) and are part of the clade that contains the subfamilies most ancestral among ants

(Saux, Fisher and Spicer 2004; Brady et al. 2006; Moreau et al. 2006; Ouellette et al.

2006; Kück et al. 2011, Moreau and Bell 2013). The workers of the genus Mystrium can be distinguished easily from other Amblyoponine genera by their characteristic head shape and mandibles (Yoshimura and Fisher 2014). Behaviorally, Mystrium are known for having snapping mandibles that are specialized for hunting centipedes; a similar mechanism is seen rarely in other ants (trap-jaw) and evolved convergently in termites

(Gronenberg et al. 1998; Moffett 1986; Patek et al. 2006) Mystrium queens of some species have been observed practicing an unusual feeding behavior called non-destructive cannibalism (Masuko 1986; Wheeler and Wheeler 1988). However, despite the striking generic morphological and behavioral characteristics, morphological variation within castes, in some species, body size and shape, setae or body sculpture is remarkably high, while differences among species is so slight it can be confounding for taxonomists

(Yoshimura and Fisher 2014).

Mystrium Reproductive Strategies

Mystrium species exhibit various reproductive forms including typical winged queens, small ergatoid queens (Molet et al. 2007a), short-winged queens (Molet et al. 2009) and intercastes (Molet et al. 2009; Molet et al. 2012). Two major colonial reproductive strategies have been described in ants. During independent colony foundation (ICF), mated alate queens (winged queens) disperse away from the natal colony and become the sole foundress of a new nest, either metabolizing her wing muscles for the initial brood care, or leaving the nest untended to forage for food. Alate queens require considerable colony resources while they are being reared and have a high-mortality rate after leaving the nest (Peeters 2011). Alternately, during dependent colony foundation (DCF), ant

5 species have a permanently wingless reproductive caste (ergatoid queens) and the colony reproduces by fission or budding. An ergatoid queen who disperses to establish a new nest is accompanied by nestmate workers which help during DCF to provision the initial brood.

The small ergatoid queens of Mystrium have been described as ‘multi-purpose’ because they are a reproductive caste, and if left unmated, replace the role of nurses played by minor workers in Mystrium species that reproduce with winged queens. Smaller ergatoid queens require less of a per capita energy investment for colonies (Peeters 2011). Thus, the ‘multi-purpose’ ergatoid queens represent a decrease in colony reproductive investment compared to the production of alate queens (Molet et al., 2007ab; Molet et al.,

2009).

We employed a molecular taxonomic dataset for elucidation of species level distinction in the genus Mystrium, using ~2 kilobases (kb) of DNA sequence data from four independently segregating nuclear loci. Additionally we built a mitochondrial phylogeny using a 790 bp fragment from cytochrome c oxidase I (CO1) locus adjacent and overlapping the standard region used in DNA barcoding. The rapid accumulation of base-pair differences within mtDNA and its position outside the nuclear genome make it an invaluable starting point for examining species affinity and phylogeography (Avise

2000). We recognize that reconstructions using gene trees made from mtDNA are not appropriate for resolving evolutionary relationships among taxa. That is why we concurrently constructed a nuclear phylogeny. Nevertheless, analysis using CO1 is a

6 useful tool for species delineation and phylogeography. For example, an analysis of endemism of ants on Madagascar examined the structure among populations of Mystrium ants in Eastern Madagascar using CO1 data (Fisher and Girman 2000) and the data quickly captured areas of endemism phylogeographically. Using CO1 in a study across ant genera showed the molecular data correctly captured morphologically defined species with great reliability (Smith et al. 2005). Also, using CO1 has proven useful in species delimitation and species identification in taxa with a high potential for hidden diversity such as butterflies (Hebert et al. 2004a; Linares et al. 2009).

Here we examine Mystrium species lineage distribution patterns across the island. We tested the reciprocal monophyly of species previously defined using morphological characteristics (morphospecies). We also examined if the Mystrium species that use dependent colony foundation (DCF) form a monophyletic group, or whether this colonial reproductive strategy has arisen more than once within the genus. With regard to the discrete difference in vagility between species, we investigate whether there are discernable differences in biogeographic patterns between species with ergatoid and alate queens. While comparing an invertebrate phylogenetic profile with recent diversification mechanisms proposed for vertebrate taxa, we also examine whether Mystrium species lineages conform to existing biogeographic theories. We use this approach to also identify additional physiographic parameters that can be discovered from a phylogeographic perspective that might influence conservation planning.

MATERIALS AND METHODS

Sampling

Samples in this study represent regions of Madagascar where Mystrium was collected during arthropod surveys between the years of 1992 through 2003 (Fisher 2005).

Currently understood species distinctions based on morphological characters were taken into account for sampling. Mystrium oberthueri Forel (1897), M. rogeri Forel (1899), M. voeltzkowi Forel (1897), M. shadow Yoshimura and Fisher (2014), M. barrybressleri

Yoshimura and Fisher (2014) and M. mirror Yoshimura and Fisher (2014) are endemic to the island; M. mysticum Roger (1862) is endemic to the Malagasy region. Mystrium camillae Emery (1889) is found across South-East Asia east to the Philippines and south into northern Australia. Mystrium silvestrii Santschi (1914) is found throughout West and

Central Africa. All specimen data for material used in this study are available on AntWeb

(www.antweb.org). All voucher specimens are deposited with the California Academy of

Sciences, Department of Entomology Collection (CASC). Only samples successfully producing for both primer pairs and considered unique sequences were included in the analyses (Table 2). Thus each sequence often represents haplotypes shared by multiple individuals. Outgroup taxa were chosen based on their relationship to Mystrium in higher level taxonomic studies (Saux et al. 2004; Ouellette et al. 2006; Moreau et al. 2006).

Adetomyrma is a recently described genus endemic to Madagascar (Ward 1994), which appears to be sister taxa to Mystrium. Amblyopone is world distributed, and the most specious genus of the Amblyoponinae.

DNA isolation, Amplification, and Sequencing

Genomic DNA was extracted from specimens stored in 95% ethanol at –80 0C using

Qiagen Dneasy Tissues Kit (Quiagen Inc., Valencia, CA) following the protocol for animal tissues. Briefly, individual ants or part of a specimen were placed in 1.5 ml microtubes and frozen in liquid nitrogen, then ground up thoroughly using a disposable pestle, the material was then digested overnight using 20 uL of 20 mg/mL Proteinase K at

55 0C. The lysate was pipetted onto a silica-gel-membrane and purified with a series of ethanol washes using supplied Dneasy Buffers. The DNA was resuspended with 200 uL of 10 mM Tris buffer.

For the mitochondrial phylogeny, two sets of primer pairs from the 5’ end of cytochrome oxidase I (CO1) gene were chosen from a previous study and used for polymerase chain reaction (PCR) (Table 3). For the nuclear phylogeny the following loci were chosen from previous studies in which they provided useful resolution for ant phylogenies and amplified according to the following protocols with some variation in annealing temperature and MgCl2 concentration: 398 bp from the wingless locus; 559 bp from the abdominal-A locus; 410 bp from the 28s rRNA locus, and 580 bp from the long- wavelength rhodopsin locus (Table 3). Reactions contained 1.5 mM MgCl2, 0.175 mM dNTPs, 0.050 U/ul Taq, 0.540 uM each primer, and 2 uL of template, with the total reaction volume of 10 uL. The amplification protocol consisted of thirty-five cycles of 30 s at 94 0C, 1 min at 51 0C and 2 min at 72 0C, preceded by 3 min at 94 0C and followed by a final extension for 10 min at 72 0C. The PCR products were purified by exonuclease I and shrimp alkaline phosphatase digestion of single-stranded DNA (primers) and dNTPs

(ExoSAP-IT, USB Corporation, Cleveland, Ohio, U.S.A). Samples were sequenced in 10 ul reaction volumes, in both the forward and reverse directions, using the same primers.

Dye terminator cycle sequencing was performed using one-eighth to one-twelfth the amount of BigDye, and the protocol specified by the ABI BigDye Terminator v1.1 Cycle

Sequencing Kit on ABI genetic analyzer 3100 (Applied Biosystems, Foster City, CA) at the Core DNA Analysis Facility located at Sonoma State University. Sequences were assembled using the program Sequencher 4.6 (Gene Codes Corporation Inc.). All sequences were confirmed and adjusted by visual inspection of chromatograms.

NuMts Detection

When relatively conserved regions of mtDNA are used to design primers which can amplify mitochondrial fragments from an unknown species, there is a risk of generating paralogous nuclear mitochondrial-like sequences (NuMts). These will cause the number of species to be overestimated if they are treated as orthologous, as a large number of these NuMts have unusually high numbers of point mutations (Song et al. 2008). To eliminate suspicion of pseudogenes we first checked the aligned CO1 data for known diagnostic characters such as stop codons and frameshift mutations by translating the

CO1 sequences using the invertebrate genetic code in Bioedit 7.0 (Hall 1999). NuMts have been characterized in ants and will show up as an accumulation of base pair differences, generally in the third codon position, at a faster rate than the accumulation of stop codons or indels, so the above mentioned strategies for detecting these pseudogenes may be ineffective (Martins et al. 2007). Consequently, using additional protocols (Ward

10 pers. comm.), we verified the sequence of fifteen samples with the longest branches and unusually high sequence divergence values. Briefly, after amplifying a longer stretch of mitochondrial DNA with primers LF1 (Smith et al. 2005) and an ant-customized version of the Pat primer (Ward unpublished) (Table 3), the amplicons were visualized on a TAE gel, cut out, and then re-amplified with our CO1 primers and sequenced again, under the assumption that most NuMts are less than 1 kb in length (Pamilo et al. 2007).

Analyses

In the nuclear phylogeny the concatenated data set includes 19 Mystrium and two outgroup accessions and is 1948 basepairs (bp) in length. When working with a concatenated data set it is likely that each gene will have different sequence characteristics and rates of evolution. Therefore, we first partitioned the data in

Mr.Bayes 3.1 (Huelsenbeck and Ronquist, 2001; Huelsenbeck and Ronquist, 2003) then used Mr.ModelTest 2.3 (Nylander, J.A.A., 2004) to estimate the substitution model parameters for the four genes individually (Table 3). Bayesian inference (BI) analysis was carried out using both the best nucleotide substitution models according to both

Akaike’s Information Criterion (AIC) and likelihood-ratio test (LRT) with

Mr.ModelTest. There was no difference between the topology or Bayesian posterior probability (pp) values so only the tree from LRT is presented.

Bayesian inference (BI) analysis was carried out using Mr.Bayes 3.1 (Huelsenbeck and

Ronquist 2003). Starting from random trees, we initiated two individual runs of four

Markov-chain Monte Carlo (MCMC) chains, three hot and one “cold”, with fifty-million

11 iterations each and trees were sampled every 2000 generations, with an initial seed tree at

12,000 iterations. The analysis did not need to run any longer than 50,000,000 generations, because at the end of the run the average standard deviation among topologies was below 0.000001. Each run resulted in 20,000 trees and converged on the same topology. The first 25% of samples from the cold chain were conservatively discarded as our “burn in” percentage. Tracer 2.0 was used to verify stationarity had been reached (http://beast.bio.ed.ac.uk). A 50% majority-rule consensus tree was generated from the remaining trees. Bayesian posterior probability (pp) values, which represent the percentage of trees sampled after burn-in that recover any particular clade on the tree, were calculated as measures of support.

Maximum-parsimony (MP) analyses were performed with PAUP* version 4b10

(Swofford 1998) to estimate phylogeny. First we generated an uncorrected neighbor- joining tree and from this we estimated, using maximum likelihood (ML) and empirical base frequencies, the gene- and codon-position-specific sequence characteristics, including transition:transversion (Ti:Tv) ratio, proportion of invariable sites (I), and among-site rate variation (). The codon-position-specific Ti:Tv ratios were then incorporated into a MP bootstrap analysis in PAUP* via user-defined step matrices.

Parsimony analyses were then performed with PAUP* using heuristic searches with 100 random addition replicates and tree-bisection-reconnection (TBR) branch swapping; we assessed support with 1000 bootstrap replicates. From these analyses we constructed 50% majority-rule consensus tree.

ML bootstrap analysis was performed using TREEFINDER (Jobb et al. 2004). We partitioned the data by gene by applying a data filter, then initiated a ML bootstrap analysis of 1000 replicates and incorporated the models of gene evolution suggested by

ModelTest and the AIC. A 50% majority-rule consensus tree was generated with bootstrap support.

In the mitochondrial phylogeny a total of 82 Mystrium, three Amblyopone and one

Adetomyrma accessions were included for analysis. The Kimuras two-parameter (K2P) model assumes equal base frequencies, two substitution types and takes into account that transitions and transversions occur at different rates by adding an additional parameter

“K”, thereby computing genetic distances while correcting for differences in the frequency of transition/transversion substitutions. We used the K2P model of evolution

(Kimura 1980), with 1000 bootstrap replicates for support, to generate a neighbor-joining

(NJ) tree (Saitou and Nei 1987) using MEGA version 6 (Tamura et al. 2013). This provided a graphic representation of the among-species divergences and allowed us to group Mystrium in MEGA according to morphospecies, and calculate within and between group means, also using K2P distance model.

We ran Bayesian analysis and Maximum Likelihood on Cipress Science Gateway

(Miller, Pfeiffer and Schwartz, 2010). For Bayesian analysis we first partitioned the data by codon position and then used Mr.ModelTest 2.3 (Nylander, J.A.A. 2004) to estimate the best nucleotide substitution model for each codon position. For first position and third position the best model determined was GTR+I+ Γsubstitution model according to

Akaike’s Information Criterion (AIC). The best model determined for the second position is GTR+I. Bayesian inference (BI) analysis was carried out using Mr.Bayes 3.2.2

(Huelsenbeck and Ronquist 2003). Starting from random trees, we initiated two individual runs of four Markov-chain Monte Carlo (MCMC) chains, three hot and one

“cold”, with ten-million iterations each and sampling every 1000 generations. The analysis did not need to run any longer, because at the end of the run the average standard deviation was below 0.000001. Each run resulted in 10,000 trees and converged on the same topology. The first 25% of samples from the cold chain were conservatively discarded as our “burn in” percentage. Tracer 2.0 was used to verify stationarity had been reached (http://beast.bio.ed.ac.uk). A 50% majority-rule consensus tree was generated from the remaining trees. Bayesian posterior probability (pp) values, which represent the percentage of trees sampled after burn-in that recover any particular clade on the tree, are used as support.

For Maximum likelihood analysis we used blackbox RAXML (Stamatakis et al. 2008).

First, we partitioned the data by codon position and then set the models to GTR+I+ Γfor all positions because of limitations in RAXML. We used the default settings for RAXML and calculated standard bootstrap values based on 1000 replicates which are used for branch support.

RESULTS

A nuclear phylogeny of Mystrium species constructed from the Bayesian analysis, with support from ML and MP methods is presented (Figure 2). Mystrium is a monophyletic

14 group that is well supported in all analyses (1.0 pp, 100% MLbs, 100% MPbs). Mystrium rogeri is a monophyletic group that is well supported in all analyses (1.0 pp, 100% MLbs,

100% MPbs). Mystrium barrybressleri is a distinct evolutionary lineage. Mystrium oberthueri is a monophyletic group that is well supported in all analyses (1.0 pp, 100%

MLbs, 100% MPbs). Sister-taxa to M. oberthueri is a clade which contains M. mysticum and M. shadow (.98 pp, 57% MLbs). Mystrium shadow is well supported in all analyses

(1.0 pp, 99% MLbs, 100% MPbs). Mystrium voeltzkowi and M. mirror are sister taxa

(.97 pp, 95% MLbs, 81% MPbs). Mystrium mirror is well supported in all analyses (.99 pp, 99% MLbs, 95% MPbs). Mystrium voeltzkowi also form a monophyletic group (.96 pp, 94% MLbs, 86% MPbs). The species which reproduce by dependent colony foundation M. shadow, M. oberthueri, M. mirror and M. voeltzkowi, likely form a monophyletic group (0.94 pp, 94% MLbs, 73% MPbs).

A mitochondrial phylogeny of Mystrium species from the Bayesian analysis, with support from ML and NJ methods is presented (Figure 3). Phylogenetic support for morphospecies and for subclades within morphospecies was high across all three methods, despite a few minor differences in topology at distal branches. Average congeneric pairwise divergence was 14.28%. Sequences were heavily AT biased; this is normally the case with insect mtDNA (Crozier and Crozier 1993). There was no presence of paralogous nuclear mitochondrial-like genes detected. There were 313 parsimony informative sites.

Comparisons of the average K2P divergence values within and between morphospecies are listed in table 4. Comparisons of average K2P divergence values within and between subclades of morphospecies are listed in table 5.

Mystrium camillae forms a well-supported clade (1.0 pp, 100% MLbs, 100% NJbs).

Mystrium camillae is sister taxa to M. silvestrii. The off island species, M. camillae and

M. silvestrii are basal in the phylogeny of Mystrium. Mystrium form a well-supported clade (1.0 pp, 100% MLbs, 99% NJbs). All endemic species of Mystrium likely form a clade (.97 pp, 81% MLbs, 72% NJbs).

Mystrium rogeri forms a well-supported clade (1.0 pp, 100% MLbs, 97% NJbs).

Sequence divergence within M. rogeri ranged from a low of 0.127% to a high of

10.759%. Mystrium rogeri fall out into two clades, a northern clade spread across the mountains from the northwest to the northeast, encompassing Montagne d’Ambre, R.S.

Manongarivo, Foret d’Ambilanivy, down the Masoala peninsula and a southern clade spread across south central to southern Madagascar. An additional evolutionary lineage of M. rogeri was collected on the island of Nosy Be (Lokobe 30).

Mystrium barrybressleri forms a well-supported clade (1.0 pp, 98% MLbs, 100% NJbs).

Sequence divergence within M. barrybressleri ranged from a low of 0.127% to a high of

9.022%. Mystrium barrybressleri contains four subclades, restricted by locality; a northwest clade (R.S. Manongarivo), northeast clade (Res. Anjanaharibe-Sud), a south central clade (R.S. Ivohibe) and a southeast clade (Mandena/St. Luce).

Mystrium oberthueri forms a well supported clade (1.0 pp, 96% MLbs, 98% NJbs).

Sequence divergence within M. oberthueri ranged from a low of 0.127% to a high of

13.165%. Mystrium oberthueri contains three subclades, a Marojejy clade (Marojejy

610), a Masoala peninsula clade (Amban 25, Amban 425, Cap Masoala 125), and a

Southern Toamasina clade (Andriantantely, Sandranantitra).

Mystrium voeltzkowi form a well-supported clade (1.0 pp, 95% MLbs, 93% NJbs).

Sequence divergence values of M. voeltzkowi range from a low of 0.127% to a high of

12.674%. Mystrium voeltzkowi was collected in the northern highlands at sites within the

Réserve Spéciale de l'Ankarana (Ankarana 210, Ankarana 80), or within the Réserve

Spéciale d'Ambre (Sakaramy 325), two specimens are from the coastal island of Nosy Be

(Lokobe 30), and one is from Montagne des Français (Français 180). Mystrium voeltzkowi form several clades, ‘clade 1’ contains haplotypes collected at Ankarana 80 and Ankarana 210, ‘clade 2’ contains haplotypes collected at Ankarana 80, Ankarana

210, Sakaramy 325, and Lokobe 30. An additional haplotype collected from Ankarana

210 forms an independent evolutionary lineage. A third clade collected at Sakaramy 325 and Français 180 is consistent with specimens that were morphologically keyed out to the complex level of M. voeltzkowi by taxonomists at the California Academy of Sciences

(BL Fisher, pers comm).

Mystrium mirror form a clade (.89 pp, 85% MLbs, 73% NJbs) and are sister taxa to M. voeltzkowi. Sequence divergence values within M. mirror ranged from a low of 0.0127% to a high of 16.84%. Mystrium mirror forms one subclade (Forêt d'Anabohazo) and several evolutionary lineages, which were collected at widely dispersed localities, including tropical dry-forest on and off Tsingy formations and in spiny desert localities.

Mystrium mysticum is well supported in all analyses (1.0 pp, 99% MLbs, 100% NJbs).

Mystrium shadow and Mystrium mysticum group together (1.0 pp, 100% MLbs, 99%

NJbs). Mystrium shadow and M. mysticum form a clade of rainforest and montane rainforest collected individuals, and these localities were above the Tsingy formations of the region.

DISCUSSION

Mystrium species form monophyletic groups with strong support in both the nuclear and mitochondrial phylogenies. Variation between discontinuous evolutionary groupings

(subclades) within some morphospecies of Mystrium is many times higher than the 2% or

3% mitochondrial sequence divergence threshold that was used to successfully identify the majority of morphospecies of ants in Madagascar (Smith et al. 2005) and the 1.9% conspecific mitochondrial sequence divergence value found among ants of North

America (Smith et al. 2005). Thus, the intraspecific sequence divergence values among some lineages within Mystrium have values well above those levels typically seen among species of ants. The large amount of intraspecific phenotypic variation found in Mystrium is likely a reflection of this high genetic divergence. However, it is probably also an effect of the lower dispersal ability afforded by species of Mystrium that use DCF as a reproductive strategy. Mystrium species form clades which are associated with large- scale habitat distinctions and various topographical features. Among DCF species there is a deep-phylogenetic split into more mesic and more arid habitats. Within ICF species there is a phylogenetic split among northern and southern sites.

Morphological Taxonomy

Morphological taxonomy from Yoshimura and Fisher (2014) is broadly confirmed by our molecular phylogenies. This suggests that the selection of morphological characters used for species level delineation was discrete enough to capture the phenotypic variation within species, while disallowing for confusion when distinguishing among the morphologically similar congenerics in Mystrium. Here we exemplify the iterative process of modern alpha-taxonomy, using an alternate approach based in molecular phylogenetics to test species erected using morphological taxonomic methods.

Paraphyly of Dependent Colony Foundation

The species groups of Yoshimura and Fisher (2014) are not consistent in the case of M. mysticum (Table 1). Species groups were constructed mainly on the reproductive forms known from each species. Mystrium mysticum is associated instead with M. shadow, and other DCF species, within the molecular phylogenies (Fig 2, Fig 3). Mystrium species that reproduce by DCF likely form a distinct yet paraphyletic group and M. mysticum which uses ICF is nested among the DCF species. Although, there is not sufficient branch support to demonstrate that M. barrybressleri and M. rogeri, and thus the colony reproductive strategy of ICF, are basal among Madagascar’s endemic Mystrium species, the data suggest this, and it has been proposed in colony reproduction studies, which cited unpublished molecular data (Molet et al. 2007ab; 2009). Mystrium mysticum likely retained ICF, because the loss of winged queens is thought to be irreversible (Peeters

2011).

Reproductive Strategy Effect on Phylogeography

There is a difference in the phylogeographic patterns produced by species that reproduce by independent colony foundation versus species which reproduce by dependent colony foundation. Average intraspecific sequence divergence in M. rogeri and M. barrybressleri is considerably lower than intraspecific sequence divergence of the

Malagasy Mystrium reproducing by DCF. The greater vagility that is afforded by having winged queens leads to the formation of just two clades across the island in M. rogeri.

The northern clade of M. rogeri spreads across sites in the major massifs in the northern region of Madagascar and contains low intraspecific divergence values (2.5%). Likewise the southern clade of M. rogeri contains haplotypes collected from six localities with low intraspecific sequence divergence values among them (0.68%).

We are not surprised to find lower intraspecific divergence values in species which reproduce by independent colony foundation because the facilitation of gene-flow is aided by these species’ ability to transverse greater distances and across barriers which would effectively trap Mystrium species which reproduce via DCF. In heterogeneous environments consisting of a set of discrete patches that persist for a finite time, movement between patches only occurs by flight. Flight only occurs in species practicing

ICF. There appears to have been more gene flow historically between populations of M. rogeri compared to populations of M. barrybressleri. We are not able to evaluate here what the potential isolating mechanism might be; however, further work with improved sampling across the region from ICF species as well as DCF species would assist in answering this question. It should be noted that in M. barrybressleri, the Mandena/St.

Luce locality is littoral rainforest habitat, at 20 m elevation (Fig 3). Littoral rainforests are known to contain unique assemblages of plants and animals, and this may be a factor in the formation of the south-east Madagascar M. barrybressleri clade (Fisher and Girman

2000).

Conversely, Mystrium with ergatoid queens display high intraspecific sequence divergence values between conspecifics. Colonies which practice DCF are limited by terrestrial dispersal from their natal colony and the necessary accompaniment of sister- workers. One consequence the short range dispersal of ergatoid queen colonies has is a severe effect on gene-flow (Molet et al. 2007a, 2009; Peeters 2012). High divergence levels are a product of the minimal genetic exchange between populations. As such, sequence divergence levels within these species are expected to be higher. An increased density of colonies leads to stronger among-colony competition for resources, and this increased competition selects for DCF because workers are vital for this type of reproduction. So, for species with ergatoid queens, once a favorable site is found it can favorably be exploited by daughter colonies remaining in same area, and dividing by fission. Newly divided colonies are strong competitors from their beginning. There are enough adults to forage, rear the brood, and build a safe nest; making it possible for the advantages of group living to be retained throughout all phases of colony development

(Molet et al. 2012).

The subclades of Mystrium using DCF in some cases consist of individuals collected at isolated habitats or locations. In M. mirror each geographic location consists of a unique

21 clade (Anabohazo 120) or evolutionary lineage (Manatalinjo 150, Marie 160,

Andranopasazy 150) and average intraspecific sequence divergence is 11.69%.

Intraspecific sequence divergence among the Anabohazo clade and other evolutionary lineages of M. mirror (16%) rivals interspecific sequence divergence levels in Mystrium.

Sequence divergence among clades within M. oberthueri is also high (10.8% to 13.6%).

Comparisons between the Marojejy clade and the remaining M. oberthueri clades yields the highest intraspecific divergence, likely due to the unique habitat of high mountains and sheer cliffs in the region, made up of ancient granites and gneisses, which are very resistant to weathering.

Geographically segregated clades are expected in species with ergatoid queens (Fisher and Smith 2008). Deep CO1 divergences occur between different collection localities in ant genera Odontomachus and Anochetus (O. coquereli, A. goodmani, A. boltoni), which also have ergatoid queens (Fisher and Smith, 2008). Fisher and Smith (2008) predicted that species with ergatoid queens will have high sequence divergence among clades at geographically localized areas because of their reduced dispersal ability. Thus, female- limited dispersal might lead to an extremely site-specific phylogeographic signal in ergatoid queen species.

However, the remaining subclades within morphospecies of Mystrium with ergatoid queens have no obvious habitat or geological barriers. In M. oberthueri, the Masoala peninsula clade classify as lowland rainforest and rainforest at midelevation. The

Southern Toamasina clade was collected in rainforest at midelevation from two localities.

Thus, although geographically segregated clades are present in a couple cases in

Mystrium species with ergatoid queens, there are apparently other influences propelling

Mystrium species diversification that complicate the expected pattern of site-specific phylogeographic signal.

Large-scale Ecogeographic Constraints

Within Mystrium there were radiations into the more mesic conditions of rainforest and less mesic conditions of tropical dry forest and spiny desert (Fig 1, Fig 2). The sharp ecological distinction between the humid eastern rainforest and arid western habitat constitutes a barrier to gene flow, causing a basal split between eastern and western clades in the phylogeography of species of initially wide distribution. Mystrium oberthueri and M. shadow are sister taxa and are both rainforest restricted species.

Mystrium mirror and M. voeltzkowi are sister taxa and are restricted to less mesic habitats. Mystrium mirror has multiple evolutionary lineages which fall out according to habitat (Fig 3). Three haplotypes are from tropical dry forest habitat (Anabohazo 120).

Two haplotypes are from spiny forest habitat (Manatalinjo 150, Marie 160). One haplotype is from the unique limestone outcrops of the Parc National Tsingy de

Bemaraha (Andranopasazy 150). Mystrium voeltzkowi is primarily a tropical dry forest species, collected at sites which contain limestone outcrops (Ankarana 80, Ankarana 210) and sites which are tropical dry forest without the presence of Tsingy (Sakaramy 325).

The collections from the coastal island of Nosy Be (Lokobe 30) are Sambirano.

Sambirano is a special kind of monsoon rainforest, a transition between dry deciduous forest and rainforest. It is believed to have formed later than the eastern rainforest, during

23 the Late Miocene or Pliocene age (Wells 2003). Sambirano is known to contain its own unique assemblage of plants and animals. Climate has been correlated with ant diversity, with a combination of temperature and precipitation often representing the best two climatic predictors for diversity of litter-dwelling ants (Weiser et al., 2010).

The range of ICF species is much greater than species which use DCF. Although M. barrybressleri range is restricted to rainforest habitat on the island, M. rogeri and M. mysticum have been collected in both rainforest and less mesic conditions. Only M. rogeri and M. mysticum from rainforest were included in this study, as such, whether an additional split would occur in these species between more mesic and less mesic conditions can only be discovered with the addition of samples from the tropical dry- forest or spiny desert habitat. Nevertheless, there is a phylogenetic split between haplotypes collected in the north and the south in the ICF species M. barrybressleri and

M. rogeri.

Several studies (Smith et al. 2007, Boumans et al. 2007, Yoder and Heckman 2006) have divided Madagascar into east-west bioclimatic regions and much of the northern fourth of

Madagascar is included in the eastern rainforest region (Fig 1). Yoder and Heckman

(2006) refer to this hypothesis as the ‘ecogeographic constraint’ and revised this hypothesis after producing a phylogeny of mouse lemurs (genus Microcebus) in which the primary phylogenetic spilt is between a northern and a southern clade. Deep interspecific north-south splits have also been found in reptiles (Raxworthy et al. 2002;

Nagy et al. 2007). To date, there is no obvious biogeographic barrier discovered which would explain this division between the north and south. However, an explanation for the

24 north-south phylogenetic split may be related to the mountain ranges of the north and south. The mountains may have been acting as species pumps (Smith et al. 2007) where species will subsequently recolonize the surrounding lowland habitat after montane diversification due to climatic conditions which placed restrictions on inhabiting lowland areas for a period of geologic time. The mountains of the south may be thus acting as species pumps for the southern lowlands and the mountains of the north may be acting as species pumps for the northern lowlands, thus causing this deep phylogenetic split between northern and southern species. There exist phylogenetic splits separating species

(east west) or subclades (north south) within morphospecies of Mystrium. Thus the hypothesis for speciation due to ecogeographic constraint appears valid when an invertebrate profile is examined.

Montane Impacts

High elevation lineages appear in all of the Mystrium species that were collected in tropical rainforest habitat. Major massifs in the northern region of Madagascar include

Manongarivo, Tsaratanana, Anjanaharibe-Sud, and Marojejy (Fig 1). Several high mountain ecosystems such as Tsaratanana and Andringitra massifs, which are characterized by forest with moss and lichens, are thought to be important zones for evolutionary change during the warming and cooling patterns of the Quaternary

(Raxworthy and Nussbaum, 1995; Wells, 2003). Mountains have been areas of endemism for certain species adapted to higher altitude which do not recolonize the lower- surrounding regions after allopatric speciation on mountain tops. These vegetation shifts would create an opportunity for allopatric speciation for montane-restricted ant

25 populations. Wollenberg et al. (2008) described the mechanism for cophaline frogs and suggested that once a mountain is reached by a dispersing lineage, a new regional radiation can be triggered. The ‘Montane refugia’ hypothesis can be tested by comparing whether sister lineages within species occur on and are endemic to neighbouring massifs

(Vences et al. 2009). The M. shadow haplotypes collected at Ambilanivy 600 and Ambre

925 are sister taxa. The M. barrybressleri haplotypes collected at Manon 780 are sister taxa to the haplotypes collected at Anja 875. The M. rogeri haplotypes collected at

Manon 1175 are sister taxa to the haplotypes collected at Ambre 925. Thus, mountains appear to have acted as refugia for allopatric speciation in rainforest adapted species of

Mystrium. As a further example, north of the Tsaratanana chain in Northern Madagascar, is the Montagne d’Ambre. This mountain is not linked elevationally with the Tsaratanana chain, and is further distinguished by its volcanic origin. In both ICF and DCF species, haplotypes collected at Montagne d’Ambre form distinct evolutionary lineages.

Conversely, mountains and their interconnecting ridges may act as corridors to facilitate gene-flow. In work concerning a new species of shrew, the mountain chain of the

Tsaratanana massif was consistently found to be faunistically different from the mountainous regions of Central Madagascar, and the region was dubbed the Northern

Highlands (Goodman et al. 2006). This region is connected through a mountain chain that transects the island and extends down the Masoala Peninsula. There are ridges radiating off Tsaratanana either in contact with or forming stepping-stones to the other massifs. Such ridges effectively create bridges between massifs for gene flow during glacial minima. Conversely to the montane refugia hypothesis, this could lead to closely related species being effectively distributed throughout the Northern montane region.

During warmer and wetter periods of climatic variation montane vegetation descended along the surface of mountains, but during periods of glaciation, when the climate was cooler and drier, it was isolated in the higher zones (Burney 1997). Dispersal was limited most drastically for species which reproduce by DCF, isolated populations would have arisen and today be more geographically distinct. It is perhaps because of the ability of

M. rogeri to disperse further distances between suitable habitat during glacial minima that intraspecific divergence within the mountain lineages of the north and the south is relatively low.

Lowland Endemism

Wilmé et al. (2006) incorporated the idea of paleoclimatic oscillations in temperature that caused forests to expand and contract, along with an analysis of the biogeographic importance of rivers that have headwaters in different elevational zones, to explain patterns of lowland endemism. They postulated that watersheds with sources at relatively low elevations would have experienced more-notable ecological shifts, associated with aridification, and greater levels of habitat isolation than those occurring at higher elevations. The lowland zones where called centers of endemism (COE) and the higher elevation watersheds were called retreat-dispersion watersheds (RDW). Evidence for this mechanism of diversification has been detected in groups of reptiles (Pearson and

Raxworthy 2009) and lemurs (Goodman and Ganzhorn 2004).

For M. rogeri in the south, being at higher elevation and with greater vagility, the lack of genetic differentiation could be due to what Wilmé et al. (2007) postulated about species

27 in RDW, that were effectively less isolated during periods of climatic oscillation. In contrast, for the M. barrybressleri population, the lowland littoral forest species is in a

COE, and became more genetically isolated from the species of M. barrybressleri in the adjacent retreat-dispersion watershed.

However in M. oberthueri, phylogeographic splits are found which cannot be readily explained by current potential barriers to gene flow such as borders between bioclimatic regions, mountain ranges, or lowland centers of endemism. Mystrium oberthueri fall into a single Wilmé et al. (2006) center of endemism (Fig 3, Table 2). During the Pleistocene glaciations rainforest was present in the North and North East of Madagascar, while the eastern coast may have been covered by tropical woodland (Ray and Adams 2001).

Boumans et al. (2007) hypothesized that if this was the case, northern Madagascar habitats have been stable through the Pleistocene glaciations until today. The stability of these biogeographic regions would have allowed the area to act as refugia for species.

Given that historical patterns of habitat stability are good predictors of species richness, especially in endemic low-dispersal taxa (Graham et al. 2006) this suggests that stability in the North would be congruent with the high degree of endemism found there. Also, the major habitat break between the North and rest of Madagascar, would predict a lesser degree of endemism throughout the rest of the rainforest on the Eastern coast. This north- eastern coast rainforest is the restriction of M. oberthueri range. This region is also the range restriction of one of Madagascar’s flagship species, a large lemur, Indri indri.

Mystrium voeltzkowi fall into a single Wilmé et al. (2006) center of endemism, with the exception of the haplotypes collected on the coastal island of Nosy Be. Yet there is

28 strikingly high sequence divergence values between M. voeltzkowi collected at the same locality. These specimens are from a tropical dry-forest region, at elevations where there are towering structures of limestone formations. Ecogeographic variation on a much smaller scale has likely been influencing species diversification in M. voeltzkowi.

Microendemism

Other than habitat differences, allopatric speciation on mountain tops or lowlands, there is another potential explanation for the disjunct clades found within M. voeltzkowi. Local vicariance events in the dry deciduous forests of the north have caused M. voeltzkowi to be long isolated, but in close proximity to conspecifics, from which they’ve become genetically isolated, if not yet morphologically differentiated. Species with limited mobility, such as ants, are greatly affected by local phenomena that alter the landscape such as divergence of waterways or rapid changes in substrate. Much of the phylogeography of M. voeltzkowi is likely affected by the presence of limestone (Tsingy) throughout or surrounding the dry deciduous forest of the collection locality, versus the absence of Tsingy.

The Ankarana Massif is an approximately 5km x 20km plateau that rises abruptly from the surrounding grassy plain and is dominated by impressive formations of Tsingy

(Veress et al. 2009). There exists throughout the region an extensive system of caves with underground rivers. Some of the largest caves have collapsed, permitting isolated pockets of river-fed forest to grow. Dry deciduous forest grows around the periphery of the massif and penetrates up into the larger canyons. The Réserve Spéciale de l'Ankarana

29 another 18,225 hectares which encompasses the National Park, a dense dry deciduous forest punctuated by limestone formations (Wilson et al. 1988). North of the Réserve

Spéciale d’Ankarana is the Forêt d’Ambre, which consists of dense humid evergreen forest and transitional forest, but at the site Sakaramy 325 is dense dry deciduous forest that does not contain limestone formations (B.L. Fisher, pers. comm.).

Three M. voeltzkowi haplotypes from the Réserve Spéciale de l’Ankarana (Ankarana 210) do not group together, and have high sequence divergence among them (8.9%-10%) (Fig

3). Some M. voeltzkowi, collected at sites within the Réserve Spéciale de l'Ankarana

(Ankarana 80) have high sequence divergence values among them (10.3%). The divergence of the Ankarana 80 haplotypes group either group with Ankarana 210

(average 0.389%) or are more closely related to samples from the coastal island of Nosy

Be. Thus, in some cases, M. voeltzkowi, collected at sites 44-51 miles apart, have relatively low sequence divergence among them (0.4%-2.5%). Likewise, some haplotypes collected at the same locality in the Forêt d’Ambre (Sakaramy 325) have high divergence values among them (12%). Other haplotypes collected at Ankarana 80 and

Sakaramy 325 have shallow divergence values among them (<1%).

The CO1 sequence divergences within M. voeltkowi occur within geographically discordant populations. Sequence divergence values, therefore, do not just relate to the isolation of populations because of distance, but relate to the divergence time of the populations, which are separated by some other isolating effect, like a physical barrier to gene flow. Geological change occurs slowly; and takes place along a gradient, like for example, the gradual rise of mountains, happening at an initial point and spanning

30 outward. Populations relatively nearby may be separated by barriers of formation for longer than populations further apart. The Ankarana Tsingy in the northern part of

Madagascar appears in smaller or greater patches with a total extension being about 200 km2. Tsingy develops due to direct rainfall on such limestone which is very well bedded, clean, has low porosity and is full of joints. Different versions of the Ankarana Tsingy can be distinquished such as clint tsingy, blade tsingy and pinnacle tsingy (Veress et al.

2009). The formation of tsingy is continuous and the destroying of the tsingy is continuous as well, as pinnacles (towers of old tsingy) of many meters high may fall as the side slopes crack or dissolve. Clearly, this is an area of constant change, and likely small scale habitat fragmentation, as patches of deciduous forest are throughout and surrounding the limestone. For M. voeltzkowi the changes in the landscape may have presented effective barriers to gene-flow. This segregation of populations, time and again, over the evolution of the Ankarana Tsingy, may have been a driving factor in the diversification of this species. Likewise, it explains why haplotypes collected farther apart in similar dry-deciduous forest habitat, are more similar than those closer together, and in direct relationship to Tsingy.

CONCLUSIONS

Using molecular methods, we were able to confirm Mystrium morphological species delineation; although our phylogeny calls into question the species groups formed by

Yoshimura and Fisher (2014). We demonstrate that the reproductive strategy of dependent colony foundation has likely arisen once. Furthermore, we were able to show that contrasting phylogeographic patterns are created by species with differential

31 reproductive ability. Species of Mystrium clearly demonstrate the potential isolating function of distinct habitat types. Whether on the larger scale level of diversification within more mesic or less mesic habitat, or at a microhabitat level such as association with Tsingy, ecological conditions appear to drive the diversification of species which reproduce via DCF more than the species with winged queens. Some models for species diversification based on vertebrate taxa do not adequately explain Mystrium radiations.

Although a missing part of our data set is a lack of timing of events. Further work might take into account the timing of Mystrium radiations along with paleoclimatic oscillations to better gauge species diversification mechanisms for arthropods on the island of

Madagascar.

APPENDIX A

Table 1. List of current Mystrium species and species group reproductive types from most recent revision of the genus by Yoshimura and Fisher (2014). camillae species group barrybressleri Yoshimura & Fisher, 2014 alate queen Madagascar camillae Emery, 1889 alate queen South-East Asia, Australia labyrinth Yoshimura & Fisher, 2014 alate queen Madagascar leonie Bihn & Verhaagh, 2007 alate queen Indonesia maren Bihn & Verhaagh, 2007 alate queen Indonesia silvestrii Santschi, 1914 alate queen Africa mysticum species group mysticum Roger, 1862 alate queen Madagascar, Comoros rogeri Forel, 1899 alate queen Madagascar, Comoros voeltzkowi species group eques Yoshimura & Fisher, 2014 ergatoid queen Madagascar janovitzi Yoshimura & Fisher, 2014 ergatoid queen Madagascar mirror Yoshimura & Fisher, 2014 ergatoid queen Madagascar oberthueri Forel, 1897 ergatoid queen Madagascar shadow Yoshimura & Fisher, 2014 ergatoid queen Madagascar voeltzkowi Forel, 1897 ergatoid queen Madagascar, Mayotte

Table 2. List of all specimens, museum accession numbers, Wilme et al. (2007) center of endemism or retreat dispersal watershed, habitat type, and collection locality information. Specimens in nuclear phylogeny are indicated with an asterisk* next to the museum accession number. Elev Morphospecies Casent # Habitat Wilme Locality Code Locality Name State/Prov (m) Lat Long M. voeltzkowi 0500419* tropical dry forest 12 Ankarana 210 Réserve Spéciale de l'Ankarana 13.6 km 192° SSW Anivorano Nord Antsiranana 210 -12.8636 49.2258 M. voeltzkowi 0500393* tropical dry forest 12 Sakaramy 325 Réserve Spéciale d'Ambre 3.5 km 235° SW Sakaramy Antsiranana 326 -12.4689 49.2422 M. voeltzkowi 0500425 tropical dry forest 12 Sakaramy 325 Réserve Spéciale d'Ambre 3.5 km 235° SW Sakaramy Antsiranana 325 -12.4689 49.2422 M. voeltzkowi 0500434 tropical dry forest 12 Sakaramy 325 Réserve Spéciale d'Ambre 3.5 km 235° SW Sakaramy Antsiranana 325 -12.4689 49.2422 M. voeltzkowi 0500436 tropical dry forest 12 Sakaramy 325 Réserve Spéciale d'Ambre 3.5 km 235° SW Sakaramy Antsiranana 325 -12.4689 49.2422 M. voeltzkowi 0500394 tropical dry forest 12 Ankarana 210 Réserve Spéciale de l'Ankarana 13.6 km 192° SSW Anivorano Nord Antsiranana 210 -12.8636 49.2258 M. voeltzkowi 0500437 tropical dry forest 12 Ankarana 80 Réserve Spéciale de l'Ankarana 22.9 km 224° SW Anivorano Nord Antsiranana 80 -12.9089 49.1097 M. voeltzkowi 0500435* Sambirano 11 Lokobe 30 Nosy Be Réserve Naturelle Intégrale de Lokobe 6.3 km 112° ESE Hellville Antsiranana 30 -13.4194 48.3311 M. voeltzkowi 0500397 Sambirano 11 Lokobe 30 Nosy Be Réserve Naturelle Intégrale de Lokobe 6.3 km 112° ESE Hellville Antsiranana 30 -13.4194 48.3311 M. voeltzkowi 0500431 tropical dry forest 12 Ankarana 210 Réserve Spéciale de l'Ankarana 13.6 km 192° SSW Anivorano Nord Antsiranana 210 -12.8636 49.2258 M. voeltzkowi 0500438* tropical dry forest 12 Ankarana 80 Réserve Spéciale de l'Ankarana 22.9 km 224° SW Anivorano Nord Antsiranana 80 -12.9089 49.1097 M. voeltzkowi 0500392 tropical dry forest 12 Ankarana 80 Réserve Spéciale de l'Ankarana 22.9 km 224° SW Anivorano Nord Antsiranana 80 -12.9089 49.1097 M. voeltzkowi 0500429 tropical dry forest 12 Ankarana 80 Réserve Spéciale de l'Ankarana 22.9 km 224° SW Anivorano Nord Antsiranana 80 -12.9089 49.1097 M. voeltzkowi 0500415 tropical dry forest 12 Ankarana 80 Réserve Spéciale de l'Ankarana 22.9 km 224° SW Anivorano Nord Antsiranana 80 -12.9089 49.1097 M. voeltzkowi 0500424 tropical dry forest 12 Ankarana 80 Réserve Spéciale de l'Ankarana 22.9 km 224° SW Anivorano Nord Antsiranana 80 -12.9089 49.1097 M. voeltzkowi_complex 0500395 tropical dry forest 1 Francais 180 Montagne des Français 7.2 km 142° SE Antsiranana (=Diego Suarez) Antsiranana 180 -12.3228 49.3381 M. voeltzkowi_complex 0500387 tropical dry forest 12 Sakaramy 325 Réserve Spéciale d'Ambre 3.5 km 235° SW Sakaramy Antsiranana 325 -12.4689 49.2422 M. voeltzkowi_complex 0500417* tropical dry forest 12 Sakaramy 325 Réserve Spéciale d'Ambre 3.5 km 235° SW Sakaramy Antsiranana 325 -12.4689 49.2422 M. mirror 0500388 tropical dry forest 10 Anabohazo 120 Forêt d'Anabohazo 21.6 km 247° WSW Maromandia Antsiranana 120 -14.3089 47.9144 M. mirror 0500440 tropical dry forest 10 Anabohazo 120 Forêt d'Anabohazo 21.6 km 247° WSW Maromandia Antsiranana 120 -14.3089 47.9144 M. mirror 0501743* TDF on Tsingy 8 Andranopasazy 150 Parc National Tsingy de Bemaraha 10.6 km ESE 123° Antsalova Mahajanga 150 -18.7094 44.7181 M. mirror 0501744 spiny forest 5 Manantalinjo 150 Parc National d'Andohahela Forêt de Manantalinjo 33.6 km 63° ENE Amboasary Toliara 150 -24.8169 46.6100 M. mirror 0501742* spiny forest 6 Marie 160 Réserve Spéciale de Cap Sainte Marie 14.9 km 261° W Marovato Toliara 160 -25.5944 45.1469 M. mirror 0500412 tropical dry forest 10 Anabohazo 120 Forêt d'Anabohazo, 21.6 km 247° WSW Maromandia Antsiranana 120 -14.3089 47.9143 M. mysticum 0500088* rainforest 12 Ankarana 150, 7 km Rés. Ankarana, 7 km SE Matsaborimanga Antsiranana 150 -12.9000 49.1167 M. mysticum 1862(50)-01 rainforest 10 Manon 780 R.S. Manongarivo 12.8 km 228° SW Antanambao Antsiranana 780 -13.9767 48.4233 M. mysticum BLF1996(12)-06 rainforest 10 Manon 400 R.S. Manongarivo 10.8 km 229° SW Antanambao Antsiranana 400 -13.9617 48.4333 M. shadow 0500432* montane rainforest 12 Ambre 925 Parc National Montagne d'Ambre 3.6 km 235° SW Joffreville Antsiranana 925 -12.5344 49.1794 M. shadow 0500439* rainforest 10 Ambilanivy 600 Ampasindava Forêt d'Ambilanivy 3.9 km 181° S Ambaliha Antsiranana 600 -13.7986 48.1617 M. oberthueri MCZ71.3549 rainforest 2 Marojejy 610 Marojejy R.N.I. #12 Antsiranana 610 -14.4358 49.7606 M. oberthueri BLF0886(15)-01 lowland rainforest 2 Amban 25 6.3 km S Ambanizana Andranobe Toamasina 25 -15.6833 49.9500 M. oberthueri 0500105* lowland rainforest 2 Amban 25 6.3 km S Ambanizana Andranobe Toamasina 25 -15.6833 49.9500 M. oberthueri BLF0926(03)-02 rainforest 2 Amban 425 5.3 km SSE Ambanizana Andranobe Toamasina 425 -15.6667 49.9667 M. oberthueri 0500091* rainforest 2 Amban 425 5.3 km SSE Ambanizana Andranobe Toamasina 425 -15.6667 49.9667 M. oberthueri 0500136* lowland rainforest 2 Cap Masoala 125 1 km W Andampibe Cap Masoala Antsiranana 125 -15.6936 50.1814 M. oberthueri HJR107 rainforest 2 Sandranantitra F.C. Sandranantitra Toamasina 450 -18.0483 49.0917 M. oberthueri 0500063 rainforest 2 Sandranantitra F.C. Sandranantitra Toamasina 450 -18.0483 49.0917 M. oberthueri 0500071* rainforest 2 Andriantantely F.C. Andriantantely Toamasina 530 -18.6950 48.8133 M. oberthueri HJR121(15)-01 rainforest 2 Andriantantely F.C. Andriantantely Toamasina 530 -18.6950 48.8133 M. oberthueri 0500112 rainforest 2 Amban 25 6.3 km S Ambanizana, Andranobe Toamasina 25 -15.6813 49.9580 M. oberthueri 0500138 lowland rainforest 2 Cap Masoala 125, 1 km 1 km W Andampibe, Cap Masoala Antsiranana 125 -15.6936 50.1814 M. oberthueri 0500142 rainforest 2 Marojejy 610 Marojejy R.N.I. #12 Antsiranana 610 -14.4358 49.7606 M. rogeri 0500389 Sambirano 11 Lokobe 30 Nosy Be Réserve Naturelle Intégrale de Lokobe 6.3 km 112° ESE Hellville Antsiranana 30 -13.4194 48.3311 M. rogeri 0500391 montane rainforest 12 Ambre 925 Parc National Montagne d'Ambre 3.6 km 235° SW Joffreville Antsiranana 925 -12.5344 49.1794 M. rogeri 0500441 montane rainforest 12 Ambre 925 Parc National Montagne d'Ambre 3.6 km 235° SW Joffreville Antsiranana 925 -12.5344 49.1794 M. rogeri 0500409* montane rainforest 12 Ambre 925 Parc National Montagne d'Ambre 3.6 km 235° SW Joffreville Antsiranana 925 -12.5344 49.1794

M. rogeri 0500390* rainforest 10 Ambilanivy 600 Ampasindava Forêt d'Ambilanivy 3.9 km 181° S Ambaliha Antsiranana 600 -13.7986 48.1617 M. rogeri BLF1948 montane rainforest 10 Manon 1175 14.5 km 220° SW Antanambao Antsiranana 1175 -13.9983 48.4283 M. rogeri 0500097 montane rainforest 10 Manon 1175 R.S. Manongarivo Antsiranana 1175 -13.9983 48.4283 M. rogeri 0500087 lowland rainforest 2 Amban 25 6.3 km S Ambanizana Andranobe Toamasina 25 -15.6833 49.9500 M. rogeri 0500102 rainforest D Andri 825 43 km S Ambalavao Rés. Andringitra Fianarantsoa 825 -22.2333 47.0000 M. rogeri BLF0742 rainforest D Andri 785 45 km S. Ambalavao Fianarantsoa 785 -22.2167 47.0167 M. rogeri SR02-1 montane rainforest D Ivohibe 8.0 E R.S. Ivohibe 7.5 km ENE Ivohibe Fianarantsoa 1200 -22.4833 46.9683 M. rogeri SR07-1 montane rainforest D Ivohibe 8.0 E R.S. Ivohibe 7.5 km ENE Ivohibe Fianarantsoa 1200 -22.4833 46.9683 M. rogeri 0500090* rainforest D Andri 785 45km S. Ambalavao Fianarantsoa 785 -22.2167 47.0167 M. rogeri 1756(06)-01 montane rainforest D Ivohibe 9.0 NE 9.0 km NE Ivohibe Fianarantsoa 900 -22.4267 46.9383 M. rogeri 0500119 rainforest 5 Ando 330 Rés. Andohahela 6 km SSW Eminiminy Toliara 330 -24.7333 46.8000 M. barrybressleri 1996(64)-03 rainforest 10 Manon 400 R.S. Manongarivo 10.8 km 229° SW Antanambao Antsiranana 400 -13.9617 48.4333 M. barrybressleri 1862(41)-01 rainforest 10 Manon 780 R.S. Manongarivo 12.8 km 228° SW Antanambao Antsiranana 780 -13.9767 48.4233 M. barrybressleri 1862(11)-01 rainforest 10 Manon 780 R.S. Manongarivo 12.8 km 228° SW Antanambao Antsiranana 780 -13.9767 48.4233 M. barrybressleri 0500082* rainforest 2 Anja 875 6.5 km SSW Befingotra Rés. Anjanaharibe-Sud Antsiranana 875 -14.7500 49.5000 M. barrybressleri BLF1070(17)-03 rainforest 2 Anja 875 6.5 km SSW Befingotra Rés. Anjanaharibe-Sud Antsiranana 875 -14.7500 49.5000 M. barrybressleri BLF1070(07)-01 rainforest 2 Anja 875 6.5 km SSW Befingotra Rés. Anjanaharibe-Sud Antsiranana 875 -14.7500 49.5000 M. barrybressleri BLF1745(39)-07 rainforest D Ivohibe 7.5 ENE 7.5 km ENE Ivohibe Fianarantsoa 900 -22.4700 46.9600 M. barrybressleri BLF1745(24)-01 rainforest D Ivohibe 7.5 ENE R.S. Ivohibe 7.5 km ENE Ivohibe Fianarantsoa 900 -22.4700 46.9600 M. barrybressleri 0500083 littoral rainforest 5 Mandena Mandena 8.4 km NNE 30° Tolagnaro Toliara 20 -24.9517 47.0017 M. barrybressleri BLF2040(47)-05 littoral rainforest 5 Mandena Mandena 8.4 km NNE 30° Tolagnaro Toliara 20 -24.9517 47.0017 M. barrybressleri BLF2102(43)-50 littoral rainforest 5 St. Luce 2.7 km WNW 302° Ste. Luce Toliara 20 -24.7717 47.1717 M. barrybressleri 0500114 rainforest 10 Manon 400 R.S. Manongarivo, 10.8 km 229° SW Antanambao Antsiranana 400 -13.9617 48.4333 M. barrybressleri 0500079 rainforest 10 Manon 780 R.S. Manongarivo, 12.8 km 228° SW Antanambao Antsiranana 780 -13.9767 48.4233 M. silvestrii 0408192 rainforest Ndakan 360 Parc National Dzanga-Ndoki, 37.9 km 169° S Lidjombo Central African Rep 360 2.3707 16.1725 M. camillae 0500094* K mixed beach forest Brooketon Coal Mine Borneo, Brooketon coal Mine Brunei 6 5.0100 115.0300 M. camillae MBD1768 K mixed beach forest Brooketon Coal Mine Borneo, Brooketon coal Mine Brunei 6 5.0100 115.0300 Adetomyrma caputleae 0500384* montane rainforest Andranomay 1300 3 km 41° NE Andranomay, 11.5 km 147° SSE Anjozorobe Antananarivo 1300 -18.4733 47.9600 Amblyopone sp. mad01 0500009 rainforest Ivohibe 7.5 ENE R.S. Ivohibe, 7.5 km ENE Ivohibe Fianarantsoa 900 -22.4700 46.9600 Amblyopone sp. mad01 1010385* montane rainforest Ambre 1300 Parc National Montagne d'Ambre, 12.2 km 211° SSW Joffreville Antsiranana 1300 -12.5964 49.1594 Amblyopone sp. tan06 0500028 Tanzania Mkomazi Game Reserve, Valley behind Ibaya Tanzania 3.9667 37.8000

Table 3. Primer sequences for amplification and sequencing of nuclear phylogeny with models of evolution selected by AIC in Modeltest and Mr.Modeltest. Primer sequences for amplification and sequencing of cytochrome oxidase I (CO1) gene for mitochondrial phylogeny and nuclear mitochondrial like sequence (NuMts) detection. Locus Primer Sequence 5'--->3' Reference Model Wingless LepWG1F GARTGYAARTGYCAYGGYATGTCTGG Brower and DeSalle (1998) GTR + G LepWG2R ACTICGCRCACCARTGGAATGTRCA Brower and DeSalle (1998) 28s rRNA M06F CCCCTGAATTTAAGCATAT Schmitz and Moritz (1994) HKY + I 28SCR CGGTTTCACGTACTCTTGAA Brady (2003) LW-Rh LR-143F GACAAAGTKCCACCRGARATGC Ward and Downie (2005) GTR + G LR672R CCRCAMGCVGTCATGTTRCCTTC Ward and Downie (2005) Abd-A AA1172F CACATCGGCACCGGCGATATGAG Ward and Downie (2005) HKY + G AA1881R GGTTGTTGGCAGGATGTCAAAGG Ward and Downie (2005) CO1 M13 CI13F ATAATTTTTTTTATAGTTATACC Brady (2003) M13 CI14R ATTTCTTTTTTTCCTCTTTC Brady (2003) CO1 JerryF CAACATTTATTTTGATTTTTTGG Brady (2003) Ben3R GCWACWACRTAATAKGTATCATG Brady (2003) NuMts LF1F ATTCAACCAATCATAAAGATATTGG Smith et al. (2005) TRL-3382R TYCAWTGCACTTAWTCTGCCATATTA P.S. Ward personal communication COII-3946R TATTC ATANCTTCARTATCATTGRTG P.S. Ward personal communication

Table 4. Cytochrome c Oxidase I Sequence divergence values within and between species of Mystrium calculated using K2P model of evolution in Mega version 6.0 M. oberthueri M. voeltzkowi M. rogeri M. mirror M. barrybressleri M. mysticum M. shadow M. camillae M. silvestrii Average within 8.19% 8.16% 5.23% 11.69% 6.92% 1.17% 9.27% 0.13% M. oberthueri M. voeltzkowi 16.01% M. rogeri 15.70% 15.35% M. mirror 16.61% 15.59% 17.10% M. barrybressleri 14.96% 15.40% 14.48% 16.26% M. mysticum 15.41% 14.70% 13.95% 16.25% 14.26% M. shadow 15.54% 15.93% 15.03% 16.19% 14.06% 6.81% M. camillae 15.86% 16.08% 14.04% 17.67% 13.93% 13.43% 13.44% M. silvestrii 15.96% 15.32% 13.87% 17.61% 13.65% 14.60% 15.96% 12.08%

Table 5. Cytochrome c Oxidase I sequence divergence values within and between subclades of Mystrium morphospecies calculated using K2P model of evolution in Mega version 6.0 M. rogeri North South Within subclade 2.47% 0.68% North South 7.23%

M. barrybressleri Manon Anja Ivohibe Littoral Within subclade 0.99% 0.34% 0.51% 0.34% Manon clade Anja clade 4.80% Ivohibe 8.09% 5.92% Littoral Forest 9.27% 7.98% 7.14%

M. voeltzkowi Clade 1 Clade 2 Complex Within subclade 0.39% 2.69% 4.86% Clade 1 Clade 2 10.59% Complex 12.44% 11.46%

M. oberthueri Marojejy Pennisula So. Toam Within subclade 4.17% 1.92% 3.52% Marojejy Pennisula 12.90% So. Toamasina 13.63% 10.80%

Anabohazo Manatalinjo M. mirror 120 150 Marie 160 Andranopasazy150 Within subclade 0.34% Anabohazo 120 Manatalinjo 150 16.01% Marie 160 16.84% 5.85% Andranopasazy 150 16.52% 14.88% 14.26%

APPENDIX B

APPENDIX C

Figure 1: Land classification and elevation of Madagascar – Maps of Madagascar showing land classification cover on right and elevation on left. Maps by Robert Simmon, from the website http://earthobservatory.nasa.gov

Figure 2: Nuclear Phylogeny of Mystrium – Bayesian phylogeny based on 1948 bp of the four nuclear genes LW Rh, Abd-A, 28s, Wg, summarized as consensus tree in Mr. Bayes. Support values above branches represent posterior probabilities (pp), those below branches ML bootstrap/MP bootstrap respectively. Scalebar shows nucleotide changes per base pair. Colonial reproductive strategy and broad habitat type are labeled in adjacent bars.

Figure 3: Mitochondrial Phylogeny of Mystrium – Bayesian phylogeny based on 790 bp of CO1, summarized as a consensus tree in MrBayes. Support values above branches represent posterior probabilities (pp), those below branches ML bootstrap. Scalebar shows nucleotide changes per base pair. Taxa are labeled with specimen codes and locality codes. Symbols beside species names on the phylogeny correspond to distribution markers in the adjacent map of Madagascar.

References

Ali JR, Aitchison JC (2008) Gondwana to Asia: Plate tectonics, paleogeography and the biological connectivity of the Indian sub-continent from the Middle Jurassic through latest Eocene (166–35 Ma). Earth-Science Reviews 88: 145–166. doi:10.1016/j.earscirev.2008.01.007.

Avise JC (2000) Phylogeography: the history and formation of species. Cambridge, Mass: Harvard University Press.

Avise JC, Arnold J, Ball RM, Bermingham E, Lamb T, et al. (1987) Intraspecific phylogeography: the mitochondrial DNA bridge between population genetics and systematics. Annual review of ecology and systematics 18: 489–522.

Bihn JH, Verhaagh M (2007) A review of the genus Mystrium (Hymenoptera: Formicidae) in the Indo-Australian region. Zootaxa 1642: 1–12.

Boumans L, Vieites DR, Glaw F, Vences M (2007) Geographical patterns of deep mitochondrial differentiation in widespread Malagasy reptiles. Molecular Phylogenetics and Evolution 45: 822–839.

Brady SG (2003) Evolution of the army ant syndrome: The origin and long-term evolutionary stasis of a complex of behavioral and reproductive adaptations. PNAS 100: 6575–6579. doi:10.1073/pnas.1137809100.

Brady SG, Schultz TR, Fisher BL, Ward PS (2006) Evaluating alternative hypotheses for the early evolution and diversification of ants. Proceedings of the National Academy of Sciences 103: 18172–18177.

Brower AVZ, DeSalle R (1998) Patterns of mitochondrial versus nuclear DNA sequence divergence among nymphalid butterflies: the utility of wingless as a source of characters for phylogenetic inference. Insect Molecular Biology 7: 73–82. doi:10.1046/j.1365- 2583.1998.71052.x.

Brown Jr WL (n.d.) I960. Contributions toward a reclassification of the Formicidae, ш. Tribe Amblyoponini Mus Сотр Zool Bull 122: 145–230.

Burney DA (1997) Theories and facts regarding Holocene environmental change before and after human colonization. In: Goodman SM, Patterson BD, editors. Natural change and human impact in Madagascar. Washington, DC: Smithsonian Institution Press. pp. 75–79.

Crozier RH, Crozier YC (1993) The mitochondrial genome of the honeybee Apis mellifera: complete sequence and genome organization. Genetics 133: 97–117. De Menten L, Niculita H, Gilbert M, Delneste D, Aron S (2003) Fluorescence in situ hybridization: a new method for determining primary sex ratio in ants. Molecular Ecology 12: 1637–1648. doi:10.1046/j.1365-294X.2003.01827.x.

Fisher BL (1997) Biogeography and ecology of the ant fauna of Madagascar (Hymenoptera: Formicidae). Journal of Natural History 31: 269–302. doi:10.1080/00222939700770141.

Fisher BL, Girman DJ (2000) Biogeography of ants in eastern Madagascar. Mémoires de la Sociétéde Biogéographie, Paris. pp. 331–344.

Fisher BL (2005) A model for a global inventory of ants: a case study in Madagascar. PROCEEDINGS-CALIFORNIA ACADEMY OF SCIENCES 56: 86.

Fisher BL, Smith MA (2008) A Revision of Malagasy Species of Anochetus Mayr and Odontomachus Latreille (Hymenoptera: Formicidae). PLoS ONE 3: e1787. doi:10.1371/journal.pone.0001787.

Goodman SM, Raxworthy CJ, Maminirina CP, Olson LE (2006) A new species of shrew tenrec (Microgale jobihely) from northern Madagascar. Journal of Zoology 270: 384–398.

Goodman SM, Benstead JP, editors (2003) Natural History of Madagascar. Chicago: University of Chicago Press.

Goodman SM, Benstead JP (2005) Updated estimates of biotic diversity and endemism for Madagascar. Oryx 39: 73–77. doi:10.1017/S0030605305000128.

Goodman SM, Ganzhorn JU (2004) Biogeography of lemurs in the humid forests of Madagascar: the role of elevational distribution and rivers. Journal of Biogeography 31: 47–55.

Graham CH, Moritz C, Williams SE (2006) Habitat history improves prediction of biodiversity in rainforest fauna. Proceedings of the National Academy of Sciences of the United States of America 103: 632–636.

Gronenberg W, Hölldobler B, Alpert GD (1998) Jaws that snap: control of mandible movements in the ant Mystrium. Journal of insect physiology 44: 241–253.

Hall TA (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic acids symposium series. Vol. 41. pp. 95–98.

Hebert PD, Penton EH, Burns JM, Janzen DH, Hallwachs W (2004) Ten species in one: DNA barcoding reveals cryptic species in the neotropical skipper butterfly Astraptes fulgerator. Proceedings of the National Academy of Sciences of the United States of America 101: 14812– 14817.

Hölldobler B (1990) The ants. Cambridge, Mass: Harvard University Press.

Huelsenbeck JP, Ronquist F (2001) MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 17: 754–755.

Jobb G, Von Haeseler A, Strimmer K (2004) TREEFINDER: a powerful graphical analysis environment for molecular phylogenetics. BMC Evolutionary Biology 4: 18.

Kaspari M, Majer JD (2000) Using ants to monitor environmental change. In: Agosti D, Majer JD, Alonso LE, Schultz TR, editors. Ants: standard methods for measuring biodiversity. Washington, DC: Smithsonian Institution Press. pp. 89–98.

Kimura M (1980) A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. Journal of molecular evolution 16: 111– 120.

Kremen C, Cameron A, Moilanen A, Phillips SJ, Thomas CD, et al. (2008) Aligning conservation priorities across taxa in Madagascar with high-resolution planning tools. Science 320: 222–226.

Kück P, Hita Garcia F, Misof B, Meusemann K (2011) Improved Phylogenetic Analyses Corroborate a Plausible Position of Martialis heureka in the Ant Tree of Life. PLoS ONE 6: e21031. doi:10.1371/journal.pone.0021031.

Lawton JH, Bignell DE, Bolton B, Bloemers GF, Eggleton P, et al. (1998) Biodiversity inventories, indicator taxa and effects of habitat modification in tropical forest. Nature 391: 72– 76.

Linares MC, Soto-Calderón ID, Lees DC, Anthony NM (2009) High mitochondrial diversity in geographically widespread butterflies of Madagascar: a test of the DNA barcoding approach. Molecular Phylogenetics and Evolution 50: 485–495.

Martins J, Solomon SE, Mikheyev AS, Mueller UG, Ortiz A, et al. (2007) Nuclear mitochondrial-like sequences in ants: evidence from Atta cephalotes (Formicidae: Attini). Insect molecular biology 16: 777–784.

Masuko K (1986) Larval hemolymph feeding: a nondestructive parental cannibalism in the primitive ant Amblyopone silvestrii Wheeler (Hymenoptera: Formicidae). Behav Ecol Sociobiol 19: 249–255. doi:10.1007/BF00300639.

Menozzi C (1929) Revisione della formiche del genere Mystrium Roger. Zoologischer Anzeiger 82: 518–536.

Miller MA, Pfeiffer W, Schwartz T (2010) Creating the CIPRES Science Gateway for inference of large phylogenetic trees. Gateway Computing Environments Workshop (GCE), 2010. IEEE. pp. 1–8.

Moffett MW (1986) Trap-jaw predation and other observations on two species of Myrmoteras (Hymenoptera: Formicidae). Insectes Sociaux 33: 85–99.

Molet M, Fisher BL, Ito F, Peeters C (2009) Shift from independent to dependent colony foundation and evolution of “multi-purpose”ergatoid queens in Mystrium ants (subfamily Amblyoponinae). Biological journal of the Linnean Society 98: 198–207.

Molet M, Peeters C, Fisher BL (2007a) Winged queens replaced by reproductives smaller than workers in Mystrium ants. Naturwissenschaften 94: 280–287.

Molet M, Peeters C, Follin I, Fisher BL (2007) Reproductive caste performs intranidal tasks instead of workers in the ant Mystrium oberthueri. Ethology 113: 721–729.

Molet M, Wheeler DE, Peeters C (2012) Evolution of novel mosaic castes in ants: modularity, phenotypic plasticity, and colonial buffering. The American Naturalist 180: 328–341.

Moreau CS (2009) Inferring ant evolution in the age of molecular data (Hymenoptera: Formicidae). Myrmecological News 12: 201–210.

Moreau CS, Bell CD (2013) Testing the museum versus cradle tropical biological diversity hypothesis: phylogeny, diversification, and ancestral biogeographic range evolution of the ants. Evolution 67: 2240–2257.

Moreau CS, Bell CD, Vila R, Archibald SB, Pierce NE (2006) Phylogeny of the ants: diversification in the age of angiosperms. Science 312: 101–104.

Nagy ZT, Glaw F, Andreone F, Wink M, Vences M (2007) Species boundaries in Malagasy snakes of the genus Madagascarophis (Serpentes: Colubridae sensu lato) assessed by nuclear and mitochondrial markers. Organisms Diversity & Evolution 7: 241–251.

Nylander JA, Ronquist F, Huelsenbeck JP, Nieves-Aldrey J (2004) Bayesian phylogenetic analysis of combined data. Systematic biology 53: 47–67.

Ouellette GD, Fisher BL, Girman DJ (2006) Molecular systematics of basal subfamilies of ants using 28S rRNA (Hymenoptera: Formicidae). Molecular Phylogenetics and Evolution 40: 359– 369.

Pamilo P, Viljakainen L, Vihavainen A (2007) Exceptionally high density of NUMTs in the honeybee genome. Molecular biology and evolution 24: 1340–1346.

Patek SN, Baio JE, Fisher BL, Suarez AV (2006) Multifunctionality and mechanical origins: ballistic jaw propulsion in trap-jaw ants. Proceedings of the National Academy of Sciences 103: 12787–12792.

Pearson RG, Raxworthy CJ (2009) The evolution of local endemism in Madagascar: watershed versus climatic gradient hypotheses evaluated by null biogeographic models. Evolution 63: 959– 967.

Peeters C (2012) Convergent evolution of wingless reproductives across all subfamilies of ants, and sporadic loss of winged queens (Hymenoptera: Formicidae). Myrmecological News 16: 75– 91.

Posada D, Crandall KA (1998) Modeltest: testing the model of DNA substitution. Bioinformatics 14: 817–818.

Raxworthy CJ, Nussbaum RA (1995) Systematics, speciation and biogeography of the dwarf chameleons (Brookesia; Reptilia, Squamata, Chamaeleontidae) of northern Madagascar. Journal of Zoology 235: 525–558.

Raxworthy CJ, Pearson RG, Zimkus BM, Reddy S, Deo AJ, et al. (2008) Continental speciation in the tropics: contrasting biogeographic patterns of divergence in the Uroplatus leaf-tailed gecko radiation of Madagascar. Journal of Zoology 275: 423–440.

Ray N, Adams J (2001) A GIS-based vegetation map of the world at the last glacial maximum (25,000-15,000 BP). Internet Archaeology 11, 1-44

Ronquist F, Huelsenbeck JP (2003) MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19: 1572–1574.

Saitou N, Nei M (1987) The neighbor-joining method: a new method for reconstructing phylogenetic trees. Molecular biology and evolution 4: 406–425.

Saux C, Fisher BL, Spicer GS (2004) Dracula ant phylogeny as inferred by nuclear 28S rDNA sequences and implications for ant systematics (Hymenoptera: Formicidae: Amblyoponinae). Molecular Phylogenetics and Evolution 33: 457–468.

Schmitz J, Moritz RFA (1994) Sequence analysis of the D1 and D2 regions of 28S rDNA in the hornet (Vespa crabro) (Hymenoptera, Vespinae). Insect molecular biology 3: 273–277.

Smith MA, Fisher BL, Hebert PDN (2005) DNA barcoding for effective biodiversity assessment of a hyperdiverse arthropod group: the ants of Madagascar. Phil Trans R Soc B 360: 1825–1834. doi:10.1098/rstb.2005.1714.

Smith SA, De Oca ANM, Reeder TW, Wiens JJ (2007) A Phylogenetic Perspective on Elevational Species Richness Patterns in Middle American Treefrogs: Why so Few Species in Lowland Tropical Rainforests? Evolution 61: 1188–1207. doi:10.1111/j.1558- 5646.2007.00085.x.

Song H, Buhay JE, Whiting MF, Crandall KA (2008) Many species in one: DNA barcoding overestimates the number of species when nuclear mitochondrial pseudogenes are coamplified. Proceedings of the National Academy of Sciences 105: 13486–13491.

Stamatakis A, Hoover P, Rougemont J (2008) A rapid bootstrap algorithm for the RAxML web servers. Systematic biology 57: 758–771.

Storey M, Mahoney JJ, Saunders AD, Duncan RA, Kelley SP, et al. (1995) Timing of hot spot— related volcanism and the breakup of Madagascar and India. Science 267: 852–855.

Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Mol Biol Evol 30: 2725–2729. doi:10.1093/molbev/mst197.

Townsend TM, Vieites DR, Glaw F, Vences M (2009) Testing species-level diversification hypotheses in Madagascar: the case of microendemic Brookesia leaf chameleons. Systematic biology 58: 641–656.

Underwood EC, Fisher BL (2006) The role of ants in conservation monitoring: if, when, and how. Biological conservation 132: 166–182.

Vences M, Wollenberg KC, Vieites DR, Lees DC (2009) Madagascar as a model region of species diversification. Trends in Ecology & Evolution 24: 456–465. doi:10.1016/j.tree.2009.03.011.

Veress M, Toth G, Zentai Z, Schläffer R (2009) The Ankarana tsingy and its development. Carpathian Journal of Earth and Environmental Sciences 4: 95–108.

Ward PS (1994) Adetomyrma, an enigmatic new ant genus from Madagascar (Hymenoptera: Formicidae), and its implications for ant phylogeny. Systematic Entomology 19: 159–175. doi:10.1111/j.1365-3113.1994.tb00585.x.

Ward PS, Downie DA (2005) The ant subfamily Pseudomyrmecinae (Hymenoptera: Formicidae): phylogeny and evolution of big-eyed arboreal ants. Systematic Entomology 30: 310–335. doi:10.1111/j.1365-3113.2004.00281.x.

Weiser MD, Sanders NJ, Agosti D, Andersen AN, Ellison AM, et al. (2010) Canopy and litter ant assemblages share similar climate–species density relationships. Biology letters 6: 769–772.

Wells N (2003) Some hypotheses on the Mesozoic and Cenozoic paleoenvironmental history of Madagascar. In: Goodman SM, Benstead JP, editors. The Natural History of Madagascar. University of Chicago Press. pp. 16–34.

Wheeler GC, Wheeler J (1988) An additional use for ant larvae (Hymenoptera: Formicidae). Entomological news (USA).

Wilmé L, Goodman SM, Ganzhorn JU (2006) Biogeographic evolution of Madagascar’s microendemic biota. Science 312: 1063–1065.

Wilson EO (1971) The Insect Societies. Cambridge, Mass: Harvard University Press.

Wilson JM, Stewart PD, Fowler SV (1988) Ankarana—a rediscovered nature reserve in northern Madagascar. Oryx 22: 163–171.

Wollenberg KC, Vieites DR, Van Der Meijden A, Glaw F, Cannatella DC, et al. (2008) Patterns of endemism and species richness in Malagasy cophyline frogs support a key role of mountainous areas for speciation. Evolution 62: 1890–1907.

Yoder AD, Heckman KL (2006) Mouse lemur phylogeography revises a model of ecogeographic constraint in Madagascar. Primate Biogeography. Springer. pp. 255–268.

Yoder AD, Nowak MD (2006) Has Vicariance or Dispersal Been the Predominant Biogeographic Force in Madagascar? Only Time Will Tell. Annual Review of Ecology, Evolution, and Systematics 37: 405–431. doi:10.1146/annurev.ecolsys.37.091305.110239.

Yoder AD, Olson LE, Hanley C, Heckman KL, Rasoloarison R, et al. (2005) A multidimensional approach for detecting species patterns in Malagasy vertebrates. Proceedings of the National Academy of Sciences of the United States of America 102: 6587–6594.

Yoder AD, Rasoloarison RM, Goodman SM, Irwin JA, Atsalis S, et al. (2000) Remarkable species diversity in Malagasy mouse lemurs (Primates, Microcebus). Proceedings of the National Academy of Sciences 97: 11325–11330.

Yoshimura M, Fisher BL (2014) A revision of the ant genus Mystrium in the Malagasy region with description of six new species and remarks on Amblyopone and Stigmatomma (Hymenoptera, Formicidae, Amblyoponinae). ZooKeys: 1.