Aptamer-Based Impedimetric Sensor for Bacterial Typing

Aptamer-based Impedimetric Sensor for Bacterial

Typing

Mahmoud Labiba, Anna S. Zamayb, Olga S. Kolovskayab, Irina T. Reshetnevac, Galina S.

Zamayb, Richard J. Kibbeed, Syed A. Sattard, Tatiana N. Zamayb, and Maxim V. Berezovskia* a Department of Chemistry, University of Ottawa, 10 Marie Curie, Ottawa, Ontario K1N 6N5,

Canada; b Institute of Molecular Medicine and Pathological Biochemistry, Krasnoyarsk State

Medical University, 1 P. Zheleznyaka str., Krasnoyarsk 660022, Russia; c Department of

Microbiology, Krasnoyarsk State Medical University, 1 P. Zheleznyaka str., Krasnoyarsk

660022, Russia; d Centre for Research on Environmental Microbiology, Faculty of Medicine,

University of Ottawa, 451Smyth Road, Ottawa, Ontario K1H 8M5, Canada.

ABSTRACT

The development of an aptamer-based impedimetric sensor for typing of bacteria (AIST-B) is presented. Highly specific DNA aptamers to Salmonella enteritidis were selected via Cell-

SELEX technique. Twelve rounds of selection were performed; each comprises a positive selection step against S. enteritidis and a negative selection step against a mixture of related pathogens, including Salmonella typhimurium, Escherichia coli, Staphylococcus aureus,

Pseudomonas aeruginosa, and Citrobacter freundii to ensure the species-specificity of the selected aptamers. After sequencing of the pool showing the highest binding affinity to S.

1 enteritidis, P DNA sequence of high affinity to the bacteria was integrated into an impedimetric sensor via self-assembly onto a gold nanoparticles-modified screen-printed carbon electrode

(GNPs-SPCE). Remarkably, this aptasensor is highly selective and can successfully detect S. enteritidis down to 600 CFU mL‒1 (equivalent to 18 CFU in 30 µL assay volume) in 10 minutes and distinguish it from other salmonella species, including S. typhimurium and S. choleraesuis.

This report is envisaged to open a new venue for the aptamer-based typing of a variety of microorganisms using a rapid, economic, label-free electrochemical platform.

Recent estimates from the U.S. Centers for Disease Control and Prevention (CDC) suggest that approximately 1.4 million cases of salmonellosis occur annually in the United States, resulting in

15,000 hospitalizations, 400 deaths and annual expenditures up to $2.3 billion per year due to loss of productivity and medical care expenses.1 Salmonella species are Gram-negative, flagellated, facultative anaerobic bacilli possessing three major antigens: (H) or flagellar antigen,

(O) or somatic antigen and (Vi) antigen, possessed by only a few serotypes.2 Certain serovars of

Salmonella cause variable disease symptoms in different hosts, ranging from gastroenteritis to highly invasive diseases.3

Serologic classification of Salmonella strains based on the properties of various surface polysaccharide (O) and flagellar (H) antigens is the reference method for epidemiologic surveillance. This method involves the characterization of over 150 unique O and H antigens to produce an antigenic formula which can be scored using the Kauffman-White scheme to determine a serovar of an isolate.4 S. enteritidis is recognized as the first most common serotype of Salmonella found in humans which accounts for the largest number of food poisoning

2 outbreaks, estimating 2751 outbreaks from 1993 to 1997.5 Although serotyping using the

Kauffman-White scheme remains the gold standard for serovar determination, it is not free from significant deficiencies including high cost, inability to serotype between 5% and 8% of the isolates, often taking three or more days for a highly trained technician to produce a result. In addition, incorrect serotyping may occur due to atypical expression of surface O or H antigen as in the case of mucoid strains in which the O antigen is obscured or for non-motile and/or monophasic isolates for which only one flagellar phase antigen can be determined.6

A number of recent molecular strategies have been adopted for genovar classification of

Salmonella, including PCR-based approaches,7 ribotyping,8 pulsed-field gel electrophoresis,9

IS200 analysis,10 random amplification of DNA polymorphism,11 and DNA microarray analysis.12 Besides involving many steps of DNA processing, these methods require highly skilled personnel, sophisticated instrumentation, and centralized laboratories. Further, both sero- and geno-typing methods require a pre-enrichment step according to the ISO6579 standard, which takes 2-3 days for presumptive results and 7-10 days for confirmation,13 thus adding to time and complexity of the assays. Therefore, there is a dire need for rapid, simple, sensitive, specific, and affordable techniques for typing of pathogens such as S. enteritidis.

In this work, DNA aptamers specific to S. enteritidis were selected based on Cell-SELEX 14, 15 from 80nt DNA library containing 40nt random region, 5’-CTC CTC TGA CTG TAA CCA CG-

N40- GC ATA GGT AGT CCA GAA GCC -3’ (Integrated DNA Technologies, U.S.) as provided in details in Supporting Information. Aptamer selection consisted of 12 rounds; each comprising alternating negative- and positive-selection steps except the first round where only positive-selection was adopted to enrich ssDNA pool with binding aptamers (Figure 1).

Positive-selection was performed against S. enteritidis to increase the affinity of the aptamers,

3 whereas negative-selection was carried out against a mixture of related pathogens, including S. typhimurium, E. coli, S. aureus, P. aeruginosa, and C. freundii to increase the selectivity of the aptamers. Briefly, the first round of selection (only positive) comprised 4 steps, including (1) incubation of the ssDNA library with S. enteritidis, (2) removal of unbound aptamers, (3) extraction of bound aptamers, and (4) amplification of extracted aptamers using symmetric and asymmetric PCR. The next eleven rounds of selection were carried out starting from negative- selection and comprised 6 steps, including (1) incubation of the ssDNA sequences obtained from the previous step with a mixture of related pathogens, (2) collection of unbound aptamers, then this was followed by the previous four steps employed for positive-selection. The affinity of the collected aptamer pools to S. enteritidis was analyzed by flow cytometry. This was performed by incubation of 100 nM of Alexa-488-labeled aptamer pools with 50 × 103 CFU of the bacteria followed by flow cytometric analysis. It was observed that the aptamer pool collected at the 7th round of selection had the highest binding affinity to the bacteria (KD = 7 nM). Subsequently, this pool was cloned and the clones showing the highest affinity to the bacteria were sequenced and the sequences are provided in Table S1. An ssDNA sequence (SENT-9) showing the highest affinity to S. enteritidis was modified at the 5’ position with a 6-hydroxyhexyl disulfide group

(Integrated DNA Technologies, U.S.), then it was utilized to develop the aptamer-based impedimetric sensor for typing of the bacteria (AIST-B), as schematically depicted in Figure 2.

The electrochemical characteristics of the developed aptasensor were investigated by cyclic voltammetry (CV), as shown in Figure 3A. The pre-treated electrode surface presents a quasi- reversible voltammogram indicating that the redox reactions easily occurred on the bare gold surface, evidenced by very large redox currents (curve a). Formation of SAM of the thiolated aptamer onto the electrode surface substantially reduced the electrode current, indicating the

4 formation of a highly compact layer (curve b). Final treatment with 2-mercaptoethanol significantly reduced the redox currents because they could penetrate down to the electrode surface, thereby blocking the direct access of the conducting ions (curve c). The thiol group of the back-filling agent could effectively displace the weaker adsorption contacts between the aptamer nucleotides and the gold surface, leaving the capture probe primarily tethered through the thiol end group. Such conformation improved the flexibility of the probe and rendered it more accessible to the target molecules. Moreover, displacement of the non-specific adsorption provided free volume into the film, which enhanced the transport of counter-ions and solvent molecules through the modified film.16

Prior to titration experiments, aliquots containing different concentrations of S. enteritidis (1 ×

103, 0.5 × 104, 1 × 104, 0.5 × 105, and 1 × 105 CFU mL‒1) in 30 µL of Dulbecco’s phosphate buffered saline (DPBS, #D8662, Sigma-Aldrich, U.S.) were incubated with the aptasensor at

25°C for 1 h. Electrochemical impedance spectroscopy (EIS) was performed at each concentration (Figure 3B). The complex impedance was presented as the sum of the real Z, Zre, and imaginary Z, Zim, components that originate mainly from the resistance and capacitance of the cell, respectively. A suitable equivalent circuit, shown in the inset of Figure 3B, was carefully selected to reflect the real electrochemical process and to enable fit producing accurate values. A modified Randles circuit consists of the ohmic resistance; RS, of the electrolyte solution, the electronic charge transfer resistance, RCT, in series with the finite length Warburg

W, and in parallel with a constant phase element, CPE, associated with the double layer and reflects the interface between the assembled film and the electrolyte solution. The solution resistance, RS, is the resistance between the aptamer-modified electrode and the reference electrode. The high frequency semicircle of the Nyquist diagram corresponds to the charge

5 transfer resistance, RCT, in parallel with the CPE. The former represents the electron-transfer kinetics of the redox probe at the electrode surface, whereas the latter corresponds to a nonlinear capacitor accounting for the inhomogeneity of the formed film.17 The diameter of the semicircle corresponds to the interfacial resistance at the electrode surface, the value of which depends on the dielectric and insulating features of the surface layer. On the other hand, the Warburg impedance, ZW, accounts for a diffusion-limited electrochemical process, presumably due to molecular motions within the film caused by conducting ions penetration.18 The rationale behind this electrochemical approach is that the binding between the target bacteria and the respective aptamers will further block the charge transfer from a solution-based redox probe to the electrode surface. Consequently, RCT will become increasingly high and can be used to monitor the binding

19 event. It was observed that the RCT value increases linearly with increasing the concentration of

S. enteritidis, in the range from 1 × 103 to 1 × 105 CFU mL‒1, with the regression equation of y =

2 1818.3x + 1328.8 (R = 0.97670), where y is the RCT value in Ω and x is the log concentration of

S. enteritidis in CFU mL‒1, as shown in the inset of Figure 3B and Table S2. The relative standard deviation (RSD) values were between 0.9 and 4.1%. Beyond the upper bacterial concentration, the response became nonlinear, indicating the saturation of the surface with

‒1 bacteria. The limit of detection (LOD) was 600 CFU mL , estimated from 3(Sb/m), where Sb is the standard deviation of the measurement signal for the blank and m is the slope of the analytical curve in the linear region 20.

The sensor’s ability to distinguish between S. enteritidis and other Salmonella species, namely

S. typhimurium and S. choleraesuis was confirmed by EIS experiments, as shown in Figure 4. It was observed that incubation of the sensor with 1 × 105 CFU mL‒1 of S. typhimurium caused

5 ‒1 26.2% increase in the RCT value (7648 Ω), whereas incubation with 1 × 10 CFU mL of S.

6 choleraesuis caused only 18.1% increase in the RCT value (7370 Ω). Percentages were obtained with reference to incubation with buffer alone (0%, 6751 Ω) and with 1 × 105 CFU mL‒1 of S. enteritidis (100%, 10170 Ω). The specificity of the sensor was also tested using 0.1 mg mL−1 human serum albumin (HSA, Sigma-Aldrich) which caused a 20.3% increase in the RCT value

(7445 Ω).

This work presents the proof of concept for the first aptamer-based impedimetric sensor for typing of bacteria (AIST-B) taking advantage of the tunable selectivity of aptamers, which enables the underneath sensor to distinguish between different species of the same bacteria. This work is envisaged to open a new venue for the development of a genus-specific array chip comprising highly specific aptamers for each species, to enable typing of a variety of pathogens.

Although there is a long way ahead for establishing such typing format, it is attainable considering the substantial efforts of many researchers to produce highly specific aptamers and the recent advances in selection technologies. Both trends are foreseen to produce a species- specific aptamer with the same ease of analyzing the species genome. Finally, aptamers alone or coupled with antibiotics were recently reported as highly capable of inhibiting pathogenic bacteria such as Bacillus cereus 21. This trend is recently adopted to overcome the persistent problem of antibiotic resistance. The inhibitory effect of the developed aptamers on S. enteritidis is currently under investigation in our laboratories and further results will be released in due course.

ASSOCIATED CONTENT

Supporting Information

7 Additional information as noted in text. This material is available free of charge via the Internet at http://pubs.acs.org.

AUTHOR INFORMATION

Corresponding Author

*Maxim V. Berezovski, E-mail: [email protected]. Phone: 1-613-562-5600 (1898).

Notes

The authors declare no competing financial interest.

ACKNOWLEDGMENTS

Authors thank the Natural Sciences and Engineering Research Council of Canada, the Ministry of Education and Science of the Russian Federation (the Federal Target Program) and Siberian

Branch of Russian Academy of Science for funding this work. The bacterial isolates for aptamer selection were kindly provided by the Federal State Institution of Health “Center for Hygiene and Epidemiology of the Krasnoyarsk Territory”.

REFERENCES

(1) Voetsch, A. C.; Van Gilder, T. J.; Angulo, F. J.; Farley, M. M.; Shallow, S.; Marcus, R.;

Cieslak, P. R.; Deneen, V. C.; Tauxe, R. V. Clin Infect Dis 2004, 38 Suppl 3, S127-134.

(2) Ekdahl, K.; de Jong, B.; Wollin, R.; Andersson, Y. Clin Microbiol Infect 2005, 11, 138-

144.

8 (3) Chiu, C. H.; Tang, P.; Chu, C.; Hu, S.; Bao, Q.; Yu, J.; Chou, Y. Y.; Wang, H. S.; Lee, Y.

S. Nucleic Acids Res 2005, 33, 1690-1698.

(4) Grimont, P. A. D.; Weill, F.-X. Antigenic Formulae of the Salmonella Serovars, 9th Ed.

WHO Collaborating Centre for Reference and Research on Salmonella ed.: Geneva, Switzerland,

2007.

(5) Olsen, S. J.; MacKinnon, L. C.; Goulding, J. S.; Bean, N. H.; Slutsker, L. MMWR CDC

Surveill Summ 2000, 49, 1-62.

(6) Edwards, R. A.; Olsen, G. J.; Maloy, S. R. Trends Microbiol 2002, 10, 94-99.

(7) Herrera-Leon, S.; McQuiston, J. R.; Usera, M. A.; Fields, P. I.; Garaizar, J.; Echeita, M.

A. J Clin Microbiol 2004, 42, 2581-2586.

(8) Esteban, E.; Snipes, K.; Hird, D.; Kasten, R.; Kinde, H. J Clin Microbiol 1993, 31, 233-

237.

(9) Kerouanton, A.; Marault, M.; Lailler, R.; Weill, F. X.; Feurer, C.; Espie, E.; Brisabois, A.

Foodborne Pathog Dis 2007, 4, 293-303.

(10) Uzzau, S.; Hovi, M.; Stocker, B. A. Epidemiol Infect 1999, 123, 37-46.

(11) Torpdahl, M.; Ahrens, P. J Appl Microbiol 2004, 97, 566-573.

(12) Scaria, J.; Palaniappan, R. U.; Chiu, D.; Phan, J. A.; Ponnala, L.; McDonough, P.; Grohn,

Y. T.; Porwollik, S.; McClelland, M.; Chiou, C. S.; Chu, C.; Chang, Y. F. Mol Cell Probes 2008,

22, 238-243.

(13) Eyigor, A.; Carli, K. T.; Unal, C. B. Lett Appl Microbiol 2002, 34, 37-41.

9 (14) Sefah, K.; Shangguan, D.; Xiong, X.; O'Donoghue, M. B.; Tan, W. Nat Protoc 2010, 5,

1169-1185.

(15) Hamula, C. L.; Zhang, H.; Guan, L. L.; Li, X. F.; Le, X. C. Anal Chem 2008, 80, 7812-

7819.

(16) Radi, A. E.; Acero Sanchez, J. L.; Baldrich, E.; O'Sullivan, C. K. J Am Chem Soc 2006,

128, 117-124.

(17) Dijksma, M.; Boukamp, B. A.; Kamp, B.; van Bennekom, W. P. Langmuir 2002, 18,

3105-3112.

(18) Baur, J.; Gondran, C.; Holzinger, M.; Defrancq, E.; Perrot, H.; Cosnier, S. Anal Chem

2010, 82, 1066-1072.

(19) Labib, M.; Shipman, P. O.; Martić, S.; Kraatz, H. B. Analyst 2011, 136, 708-715.

(20) Bard, A. J.; Faulkner, L. R. Electrochemical Methods: Fundamental and Applications;

Wiley, New York, 2001.

(21) Schlesinger, S. R.; Lahousse, M. J.; Foster, T. O.; Kim, S.-K. Pharmaceuticals 2011, 4,

419-428.

Figure 1. Aptamer selection scheme for S. enteritidis. Aptamer selection consists of 12 rounds; each comprises two alternating negative and positive selection steps except the first round where only positive selection was performed. Negative selection was carried out against a mixture of related pathogens, including S. typhimurium, E. coli, S. aureus, P. aeruginosa, and C. freundii.

Figure 2. Schematic diagram of an aptamer-based impedimetric sensor for typing of bacteria

(AIST-B). A thiolated Salmonella enteritidis-specific DNA aptamer was self-assembled onto a gold nanoparticles-modified screen-printed carbon electrode (GNPs-SPCE). Binding of the S. enteritidis to the immobilized aptamer causes an increase in interfacial resistance, measured via electrochemical impedance spectroscopy. On the other hand, incubation with other Salmonella species (S. typhimurium and S. choleraesuis) produces negligible changes in impedance.

Figure 3. (A) Cyclic voltammograms of the typing impedimetric sensor after each immobilization or binding step. Cyclic voltammograms were recorded at a scan rate of 100 mV s,–1 where (a) bare SPGE; (b) after self-assembly of the thiolated S. enteritidis-specific aptamer;

(c) after back-filling with 0.1 mM 2-mercaptoethanol. (B) Nyquist plot (─Zim vs. Zre) of impedance spectra obtained using (a) 1 × 103, (b) 0.5 × 104, (c) 1 × 104, (d) 0.5 × 105, and (e) 1 ×

105 CFU mL‒1 of S. enteritidis in Dulbecco’s phosphate buffered saline (DPBS). The right inset represents a modified Randles circuit applied to fit to the measured data and consists of the ohmic resistance; RS, of the electrolyte solution, the electronic charge transfer resistance, RCT, in series with the finite length Warburg W, and in parallel with a constant phase element, CPE. The left inset represents a calibration plot of the resistance to charge transfer (RCT) vs. concentration of S. enteritidis. The impedance spectra are recorded from 100 kHz to 0.1 Hz and the amplitude is 0.25 V vs. pseudo Ag reference using 20 mM Tris-ClO4 buffer (pH 8.6), containing 2.5 mM

K4Fe(CN)6 and 2.5 mM K3Fe(CN)6.

Figure 4. Nyquist plot (─Zim vs. Zre) of impedance spectra for selectivity experiments performed using (a) buffer alone, (b) 5.1 mg mL−1 HSA, (c) 1 × 105 CFU mL‒1 of S. typhimurium, (d) 1 ×

105 CFU mL‒1 of S. choleraesuis, and (e) 1 × 105 CFU mL‒1 of S. enteritidis. The impedance spectra are recorded from 100 kHz to 0.1 Hz and the amplitude is 0.25 V vs. pseudo Ag reference using 20 mM Tris-ClO4 buffer (pH 8.6), containing 2.5 mM K4Fe(CN)6 and 2.5 mM

K3Fe(CN)6.

14 “For TOC only”

15 Supporting Information

Aptamer-based Impedimetric Sensor for Bacterial

Typing

Mahmoud Labiba, Anna S. Zamayb, Olga S. Kolovskayab, Irina T. Reshetnevac, Galina S.

Zamayb, Richard J. Kibbeed, Syed A. Sattard, Tatiana N. Zamayb, and Maxim V. Berezovskia* a Department of Chemistry, University of Ottawa, 10 Marie Curie, Ottawa, Ontario K1N 6N5,

Canada; b Institute of Molecular Medicine and Pathological Biochemistry, Krasnoyarsk State

Medical University, 1 P. Zheleznyaka str., Krasnoyarsk 660022, Russia; c Department of

Microbiology, Krasnoyarsk State Medical University, 1 P. Zheleznyaka str., Krasnoyarsk

660022, Russia; d Centre for Research on Environmental Microbiology, Faculty of Medicine,

University of Ottawa, 451 Smyth Road, Ottawa, Ontario K1H 8M5, Canada.

EXPERIMENTAL SECTION

Aptamer selection. Aptamers were selected based on cell-SELEX, an in vitro selection of nucleic acid binders to live cells, bacteria, and viruses from a random DNA library. Aptamers were selected against Salmonella enteritidis strains, provided by the Federal State Institution of

Health, Krasnoyarsk, Russia. The selection was started with a synthetic ssDNA library

(Integrated DNA Technologies, U.S.) which consists of a randomized region of 40 nucleotides

(A:T:C:G = 25%:25%:25%:25%) ﬂanked by two constant primer-hybridization sites, 5′-CTC

CTC TGA CTG TAA CCA CG -N40- GC ATA GGT AGT CCA GAA GCC-3′. Before each round of selection and binding experiments, the ssDNA library and aptamer pools were denatured by heating for 5 min at 95°C in Dulbecco’s phosphate buffered saline with CaCl2 and

MgCl2 (DPBS, #D8662, Sigma-Aldrich, U.S.) and then renatured on ice for 10 min. The selection consists of 12 rounds, which starts with a round of only positive selection against S. enteritidis followed by 11 rounds each consists of alternating negative and positive selection.

Negative selection was carried out against a mixture of different bacteria, including Salmonella typhimurium, Escherichia coli, Staphylococcus aureus, Pseudomonas aeruginosa, and

Citrobacter freundii to ensure that the selected aptamers maintain high species specificity for the target, S. enteritidis. Prior to selection experiments, 3 × 106 CFU of S. enteritidis were washed, resuspended in DPBS and used for the positive selection round. In the first round, the bacteria was incubated in 500 µL DPBS containing 1 µM (0.5 nmol or 3 × 1014 molecules) of ssDNA library for 30 min at 25 °C and then centrifuged at 3 500 × g for 10 min at 15 °C, to remove unbound aptamers, followed by rinsing twice with DPBS. Subsequently, the cells pellet was resuspended in 95 µL of 10 mM Tris-HCl buffer containing 10 mM EDTA, pH 7.4 (TE buffer,

Integrated DNA Technologies, U.S.), and heated for 10 min at 95 °C, to release the aptamers bound to the bacteria. After the denaturing step, the bacterial debris was removed by centrifugation at 14 000 × g for 15 min at 4 °C and the supernatant, which contains the aptamers, was collected and stored at ‒20 °C before the PCR amplification. Bacterial-bound aptamers were ampliﬁed using symmetric and asymmetric PCR cycles, respectively. For the symmetric PCR:

5 µL of the aptamer pool in TE buffer was mixed with 45 µL of symmetric PCR Master Mix, containing the following reagents in the final concentrations: 1X PCR buffer, 2.5 mM MgCl2,

0.02 U µL-1 KAPA 2G Hot Start Robust Polymerase (KAPA Biosystems, U.S.), 220 µM dNTPs,

500 nM forward primer (5′- CTC CTC TGA CTG TAA CCA CG-3′), and 500 nM reverse primer (5′- GGC TTC TGG ACT ACC TAT GC-3′) (Syntol, Russia). Afterward, asymmetric

PCR was performed where 5 µL of the symmetric PCR product in TE buffer was mixed with 45

µL of the asymmetric PCR Master Mix containing the same reagents as above, except 1 µM forward Alexa-488 primer (5′-Alexa488-CTC CTC TGA CTG TAA CCA CG-3′), and 50 nM reverse primer. Ampliﬁcation was performed using the following PCR program: preheating for 2 min at 95°C, 15 cycles for symmetric PCR or 10-15 cycles for asymmetric PCR of 30 s each at

95 °C, 15 s at 56.3 °C, 15 s at 72°C, and hold at 4°C. The concentration of the PCR product was estimated using 3% agar electrophoresis and the produced aptamers were stored at ‒20 °C. Next,

100 nM of the fluorescently labeled aptamers were introduced into the second round of selection which starts with a negative selection step, where the aptamers were incubated with a mixture of different bacteria, including S. typhimurium, E. coli, S. aureus, P. aeruginosa, and C. freundii in

500 µL DPBS, 3 × 106 CFU each, for 30 min at 25°C in order to obtain highly specific aptamers for S. enteritidis. The unbound aptamers were retrieved by centrifugation at 3 500 × g for 10 min at 25 °C and then used for the second step of positive-selection as described before. Importantly,

S. enteritidis was preincubated with masking DNA from Salmon sperm (0.1 mg mL−1) during the positive selection step starting from round six in order to suppress the non-specific binding.

Cloning and sequencing of the aptamer pool. The 7th aptamer pool showing the highest affinity to S. enteritidis, according to the flow cytometry data, was cloned. Briefly, the dsDNA pool was extracted from the gel using DNA gel extraction kit Axy prep (AxyGen Biosciences,

U.S.) in order to purify the DNA from the PCR mix. Cloning was performed according to the supplied protocol using M13mp18 Perfectly Blunt Cloning Kit (Novagen, Germany). White 3

colonies were collected into separate tubes, left to grow over night in 1 mL SOC medium

(Callgro, U.S.) at 37°C and then analyzed by PCR and Agarose gel electrophoresis to ensure that the clones have the insert in the plasmids. For each PCR reaction, 2 µL of the cell suspension

was mixed with 18µL of the PCR Master Mix containing: 1X PCR buffer B, 2.5 mM MgCl2

(Mallinckrodt Baker, Inc., U.S.), 0.02 U µL−1 KAPA 2G Robust Hot Start DNA polymerase

(Kapa Biosystems, U.S.), 220 µM dNTPs, 0.5 µM forward FAM primer, and 0.5 µM reverse primer. Ampliﬁcation was performed using a PCR program (preheating for 5 min at 95 °C, 30 cycles of 30 s each at 95 °C, 15 s at 56.3 °C, 15 s at 72 °C, and hold on at 4 °C). Plasmids were isolated using GeneJET plasmid miniprep kit (Fermentas, U.S.), according to the supplied protocol. The part of the plasmid with the insert was amplified using M13 forward primer (5′-

GTA AAA CGA CGG CCA GT-3′) and M13 reverse primer (5′- AGC GGA TAA CAA TTT

CAC ACA GG-3′), according to the supplied protocol. For each PCR reaction: 5 µL of the plasmid (~ 10 ng µL−1) diluted in water was mixed with 45 µL of PCR Master Mix containing:

−1 1X PCR buffer A, 2.5 mM MgCl2, 0.02 U µL KAPA 2G Robust Hot Start DNA polymerase,

220 µM dNTPs, 0.5 µM forward M13 primer, and 0.5 µM reverse M13 primer. Ampliﬁcation was performed using the PCR program (preheating for 2 min at 95 °C, 30 cycles of 30 s each at

95 °C, 15 s at 60 °C, 15 s at 72 °C, and hold on at 4 °C). Finally, the unpurified PCR product was sequenced at McGill University and Génome Québec Innovation Centre, Montreal, Canada.

Synthetic aptamer clones with and without the FAM label were purchased from (Integrated DNA

Technologies, U.S.).

Flow cytometric binding analysis of the aptamer pools/clones. The affinity of the evolved aptamer pools toward S. enteritidis was measured using FC-500 flow cytometer (Beckman

Coulter Inc., U.S.). The bacteria, 50 × 103 CFU in DPBS, were preincubated with 0.1 mg mL−1 4

of Salmon sperm DNA as a masking single-stranded nucleic acid to suppress the non-specific binding for 15 min at room temp. Afterward, the bacteria were incubated with 100 nM purified

Alexa-488-labeled aptamer pool in 500 µL DPBS buffer for 30 min at 25 °C. Control experiments were performed using the fluorescently labeled ssDNA library in DPBS.

Subsequently, each sample was washed once with 200 mL of DPBS to remove unbound DNA, resuspended in 0.5 mL of DPBS and measured where 30 000 events were recorded. The gate of the intact S. enteritidis in DPBS was used as a negative gate, whereas the fluorescence above the negative gate was considered as the real fluorescence of the Alexa-488 labeled aptamers bound to the bacteria. Finally, data analysis was carried out using Kaluza 1.1 Software.

Preparation of the sensor. Prior to experiments, the gold nanoparticles modified screen-printed carbon electrode (GNPs-SPCE) (L33×W10×H0.5, Dropsens, Spain) was washed thoroughly with deionized nuclease-free water then dried with N2. Subsequently, the electrode was incubated with 1 µM of the HPLC purified detection probe for Salmonella enteritidis with the sequence 5’-/5ThioMC6-D/CTC CTC TGA CTG TAA CCA CGC ACA AAG GCT CGC GCA

TGG TGT GTA CGT TCT TAC AGA GGT -3’ (SENT-9) modified at the 5’ position with a 6- hydroxyhexyl disulfide group (Integrated DNA Technologies, U.S.) in 20 mM Tris-ClO4 buffer, pH 8.6, for 5 days at 4 °C. Finally, the electrode was incubated with ethanolic 0.1 mM 2- mercaptoethanol for 5 min to back-fill the empty spots of the electrode surface, thus reducing the non-specific adsorption onto the surface.

Electrochemical measurements. Electrochemical studies, including cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS) were performed with an electrochemical analyzer (CH Instruments 660D, TX, U.S.) connected to a personal computer. All measurements

were carried out at room temperature in an enclosed and grounded Faraday cage. A conventional three-electrode configuration printed on a ceramic substrate; including a GNPs-SPCE electrode as the working electrode, carbon counter electrode, and a silver pseudo-reference electrode. A three-electric contacts edge connector was used to connect the screen-printed electrode with the potentiostat (Dropsens, Spain). The open-circuit or rest-potential of the system was measured prior to all electrochemical experiments to prevent sudden potential-related changes in the self- assembled monolayer. CV experiments were performed at a scan rate of 100 mV s−1 in the potential range from −600 to 800 mV. EIS measurements were conducted in the frequency range of 100 kHz to 0.1 Hz, at a formal potential of 250 mV and AC amplitude of 5 mV. The measured

EIS spectra were analyzed with the help of equivalent circuit using ZSimpWin 3.22 (Princeton

Applied Research, U.S.) and the data were presented in Nyquist plots. Electrochemical measurements were performed in 20 mM Tris-ClO4 buffer (pH 8.6), containing 2.5 mM of potassium ferrocyanide and 2.5 mM of potassium ferricyanide. Importantly, all measurements were repeated for a minimum of three times with separate electrodes to obtain statistically meaningful results.

Table S1. DNA sequences of clones isolated from the 7th pool and showing the highest affinity to S. enteritidis.

Clone Sequence

CTCCTCTGACTGTAACCACGCACAAAGGCTCGCGCATGGTGTGTACGTTCTT SENT-1 ACAGAGGTGCATAGGTAGTCCAGAAGCC

CTCCTCTGACTGTAACCACGTCGGCAACAAGGTCACCCGGAGAAGATCGGTG SENT-2 GTCAAACTGCATAGGTAGTCCAGAAGCC

CTCCTCTGACTGTAACCACGTATACGCGCTTGCCCCTTAGTCATACGAACTGA SENT-3 TTCAATCGCATAGGTAGTCCAGAAGCC

CTCCTCTGACTGTAACCACGTGCCGCTAAACGCCGGCTCATCGTTATGCTTTT SENT-4 CATTGCAGCATAGGTAGTCCAGAAGCC

CTCCTCTGACTGTAACCACGTAACGTACCAAAATGTTGGATTGGATGTTGTA SENT-5 CTGGGTTGCATAGGTAGTCCAGAAGCC

TCGGCAACAAGGTCACCCGGAGAAGATCGGTGGTCAAACTGCATAGGTAGT SENT-6 CCAGAAGCC

CTCCTCTGACTGTAACCACGTATACGCGCTTGCCCCTTAGTCATACGAACTGA SENT-7 TTCAATC

CTCCTCTGACTGTAACCACGAACGATTCAAGAACTGTTGGTTGTCGGCTTATT SENT-8 TTCGCCA

CTCCTCTGACTGTAACCACGCACAAAGGCTCGCGCATGGTGTGTACGTTCTT SENT-9* ACAGAGGT

TACCAAAATGTTGGATTGGATGTTGTACTGGGTTGCATAGGTAGTCCAGAAG SENT-10 CC

*used for a the preparation of the aptasensor

Table S2. Equivalent circuit element values for the developed impedimetric aptasensor based on SENT-9, in the presence of increasing concentrations of S. enteritidis

0.5 Concentration Rs (Ω) CPE (µF) n RCT (Ω) W (µF ) of the S. enteritidis (CFU mL‒1) 1 × 103 160.05 2.83 0.89 6793 230.15 (0.07) (0.09) (0.003) (59.4) (10.68) 0.5 × 104 159.75 3.85 0.88 7818.5 330.2 (0.07) (0.11) (0.002) (241.12) (21.21) 1 × 104 159 3.87 0.87 8940 319.75 (0.14) (0.07) (0.0004) (86.27) (5.3) 0.5 × 105 162.25 2.59 0.9 9706 474.15 (0.07) (0.08) (0.003) (415.78) (38.96) 1 × 105 159 2.58 0.91 10475 522.75 (0) (0.04) (0.0005) (431.34) (2.62) a The values in parentheses represent the standard deviations from at least three electrode measurements.