REVIEWS

Telomeres in cancer: tumour suppression and genome instability

John Maciejowski and Titia de Lange Abstract | The shortening of human telomeres has two opposing effects during cancer development. On the one hand, telomere shortening can exert a tumour-suppressive effect through the proliferation arrest induced by activating the kinases ATM and ATR at unprotected chromosome ends. On the other hand, loss of telomere protection can lead to telomere crisis, which is a state of extensive genome instability that can promote cancer progression. Recent data, reviewed here, provide new evidence for the telomere tumour suppressor pathway and has revealed that telomere crisis can induce numerous cancer-relevant changes, including chromothripsis, kataegis and tetraploidization.

ATM Telomeres have an essential role in ensuring that the DNA leads to insufficient chromosome end protection A PI3K‑related protein kinase natural ends of chromosomes are not mistaken for sites and to the activation of the DDR, which will arrest cell that initiates the response to of DNA damage. Telomere function depends on three proliferation and can induce senescence or apoptosis. double-strand breaks, with factors: telomeric DNA, the shelterin complex and the The repression of telomerase in somatic cells and the crucial roles in cell cycle (FIG. 1) regulation and DNA repair. telomerase complex . Human and mouse telo­ resulting telomere proliferation barrier have the hall­ meres are composed of a long double-stranded array marks of a tumour suppressor pathway that ­limits ATR of TTAGGG repeats bound by the six-subunit shelterin tumour cell outgrowth after a delay. New evidence, A PI3K‑related protein kinase complex (BOX 1; FIG. 1). Shelterin represses the DNA reviewed below, argues that telomere shortening indeed that responds to the formation ­damage response (DDR) at telomeres, thereby preventing protects against tumour development. Eventually, how­ of single-stranded DNA, with a ATM ATR crucial role in the response the activation of the kinases and that can induce ever, in incipient cancer cells that lack the pathways to replication stress and cell cycle arrest in response to DNA double-­strand breaks necessary for cell cycle arrest, mounting telomere dys­ double-strand breaks. (DSBs) and other types of DNA damage. In addition, function becomes a source of genomic instability in a shelterin ensures that telomeres are not processed by sev­ stage referred to as telomere crisis1–3. The escape from Non-homologous end non-­homologous joining eral DSB repair pathways, including the telomere crisis requires the activation of telomerase, A major double-strand break end joining (NHEJ) pathway that could lead to chromo­ which reconstitutes telomere function and restores repair pathway that does not some end fusions. Shelterin partially protects telomeres proliferative capacity. The outcome of this scenario is rely on sequence homology by forming the t‑loop structure by which the telomere a telomerase-positive, transformed cell with a heavily and can result in small terminus is hidden (FIG. 1). T‑loops are formed through ­rearranged, but stabilized, genome that has attained new insertions and deletions at the site of repair. strand invasion of the long 3′ overhang at the telo­mere and potentially tumorigenic genetic mutations. end into the double-stranded telo­meric DNA. This 3ʹ Cancer genomes are characterized by extensive overhang is recreated after DNA replication through exo­ chromosome rearrangements that facilitate oncogenic nucleolytic degradation of the 5ʹ ends of the telomeres progression4. The unexpected extent and staggering (FIG. 2a). As a result of this processing and the inability of complexity of these rearrangements, which include DNA polymerases to duplicate the ends of linear DNA deletions and amplifications, translocations, chromo­ molecules, human telomeres shorten by ~50 bps per cell thripsis, kataegis and tetraploidization, has only been division. This telomere attrition can be counteracted by appreciated in recent years5. Although there are many telomerase reverse transcriptase (TERT) (FIG. 1), which potential mechanisms underlying these rearrange­ Laboratory for Cell Biology adds GGTTAG repeats to the ­chromosomal 3ʹ DNA ments6, new data have linked telomere dysfunction to and Genetics, The Rockefeller University, 1230 York ­terminus at the end of the chromosome. a near-­comprehensive list of cancer-relevant genome 2,3,7–9 Avenue, New York, During human development, telomerase activity is alterations , suggesting that telomere crisis contrib­ New York 10065, USA. downregulated through the silencing of TERT, which utes to the genetic disorder that is typical of cancer10. Correspondence to T.d.L. encodes the reverse transcriptase subunit of the com­ Here, we review these new data on the role of telomeres [email protected] plex. As a result, most human somatic cells (with the in genome instability in cancer and discuss new find­ doi:10.1038/nrm.2016.171 exception of certain stem cells) undergo programmed ings pertaining to the role of telomere shortening in Published online 18 Jan 2017 telomere shortening. Eventually, the loss of telomeric tumour suppression.

NATURE REVIEWS | MOLECULAR CELL BIOLOGY VOLUME 18 | MARCH 2017 | 175 ©2017 Mac millan Publishers Li mited, part of Spri nger Nature. All ri ghts reserved.

REVIEWS

Shelterin Telomerase

POT1 TPP1 TERC

TERT • DKC • NOP10 TRF1 TRF2 • NHP2 3′ • GAR1 TIN2 • TCAB1 RAP1 5′ CAAUCCCAAUC -3 TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAG ′ AATCCCAATCCCAATCCCAATCCCAATC-5′

3′ 5′ 3 overhang TTAGGG repeats ′ (50–300 nt) (2–10 kb)

Telomeric DNA

T-loop Figure 1 | Composition and structure of the human telomere system. Human telomeres comprise three components: telomeric DNA, the shelterin complex and the telomerase complex. Telomeric DNANature consists Reviews of a long | Molecular array of Cell Biology double-stranded TTAGGG repeats that culminates in a 50–300 nucleotide (nt) single-stranded 3ʹ overhang. This 3ʹ overhang invades double-stranded telomeric repeats to form a t‑loop structure that is crucial for telomere function. Telomeric DNA protects chromosome ends through its association with the six-subunit shelterin complex. The length of telomeric repeats can be maintained by telomerase, which is composed of telomerase reverse transcriptase (TERT), telomerase RNA template component (TERC) and several accessory proteins (blue). TERT synthesizes telomeric DNA de novo using TERC as a template, whereas the accessory factors contribute to the biogenesis and nuclear trafficking of telomerase. DKC, dyskerin; NHP2, non-histone protein 2; NOP10, nucleolar protein 10; POT1, protection of telomeres 1; RAP1, repressor/activator protein 1; TCAB1, telomerase Cajal body protein 1; TIN2, TRF1‑interacting nuclear factor 2; TRF, telomeric repeat-binding factor.

Tumour suppression by short telomeres human cells23. However, TERC expression can still be a Telomere shortening in human cells has long been limiting factor and the co‑expression of TERT and TERC thought to represent a tumour suppressor mechanism. is needed for robust telomerase catalytic activity in some Although mouse models have previously illustrated this cell types21,24,25. Telomerase activation and the resulting potentially advantageous aspect of telomere attrition, telomere-length maintenance leads to the bypass of recent data now provide evidence for this proliferative senescence and ultimately to cell immortalization23,26,27. barrier in human cancer cells. The programmed silencing of TERT, loss of telo­ merase activity and the resulting shortening of telomeres Silencing of telomerase and telomere shortening. is not a universal phenomenon in mammals. Apparently, Telomerase is a reverse transcriptase that synthesizes this tumour suppressor pathway is restricted to large telomeric DNA de novo using integral RNA as the tem­ animals with a reproductive strategy that requires a long plate and the 3ʹ end of the chromosome as the primer11–17 lifespan28. For example, telomerase activity is repressed in (FIG. 1). The core components of telomerase are the reverse somatic cells of elephants but not in mice. transcriptase TERT and telomerase RNA component In the absence of telomerase, each human telo­ (TERC), which provides the template for the synthesis mere shortens at a rate of 50–100 bps per population of telomeric DNA. Telomerase is associated with a set of doubling­ 29. The rate of telomere attrition is partly due accessory proteins, including dyskerin, nucleolar protein to the inability of DNA polymerases to copy the end of 10 (NOP10), non-histone protein 2 (NHP2), GAR1 and linear DNA (FIG. 2a). The 5ʹ end resection that generates telomerase Cajal body protein 1 (TCAB1), that contrib­ the telomeric 3ʹ overhang contributes substantially to the ute to the biogenesis and trafficking of telomerase inside rate of telomere shortening30 (FIG. 2a). Shelterin governs the nucleus18,19 (for reviews, see REFS 17,20,21). this processing and the formation of the correct struc­ TERT silencing downregulates telomerase activ­ ture of the telomere terminus in mouse cells and most ity in human somatic cells (reviewed in REF. 22). The likely in human cells. The process involves the initiation other components of telomerase, including TERC, are of resection by the shelterin-bound Apollo nuclease, expressed widely; thus, the expression of exogenous further resection by exonuclease 1 (EXO1) and finally TERT is sufficient to activate telomerase in many primary a fill‑in synthesis step mediated by the shelterin-bound

176 | MARCH 2017 | VOLUME 18 www.nature.com/nrm ©2017 Mac millan Publishers Li mited, part of Spri nger Nature. All ri ghts reserved. ©2017 Mac millan Publishers Li mited, part of Spri nger Nature. All ri ghts reserved.

REVIEWS

31–38 (FIG. 2a) Hayflick limit CST (CTC1–STN1–TEN1) complex . Owing Senescent human fibroblasts display the molecu­ 39 The finite proliferation to this regulated terminal sequence loss, the proliferative lar hallmarks of an activated DDR , including ATM potential of primary lifespan of primary human cells (known as the Hayflick and ATR signalling, and nuclear foci containing DNA human cells. limit) is partly determined by how shelterin controls ­damage markers, such as γ-H2AX, p53‑binding pro­ resection and fill‑in at telomeres. It will be interesting to tein 1 (53BP1) and mediator of DNA damage checkpoint determine whether the lifespan of human cells can be protein 1 (MDC1). Upregulation of p53 and induction extended by diminishing the extent of 5ʹ end resection. of the cyclin-dependent kinase (CDK) inhibitors p21 and p16 are also indicators of an activated DDR42,43. Telomere-induced senescence. Loss of telomere function The inactivation of shelterin similarly activates DNA at a few chromosome ends in a cell is sufficient to induce ­damage signalling pathways, results in the upregulation replicative arrest9,39,40 (FIG. 2b). The point at which telo­ of p21 and p16, and leads to the accumulation of DDR mere attrition results in the loss of telomere protection factors at telomeres, thus linking telomere dysfunction at one or a few chromosome ends is dependent on the and senescence39,42. Proof that replicative senescence rate of telomere shortening, the initial telomere length is due to telomere shortening came from the bypass of and, importantly, the length of the shortest telomeres in senescence upon TERT expression23. Furthermore, over­ the cells41. Because human telomeres are heterogeneously expression of the shelterin subunit telomeric repeat-­ sized, several very short telomeres can be present in cells binding factor 2 (TRF2; also known as TERF2) can delay with an apparently ample telomere reserve, which makes the onset of senescence44, arguing that the DDR in senes­ measurements of bulk telomere length an imprecise cence is due to an insufficient loading of shelterin at the ­predictor of cellular proliferative potential. shortened telomeres.

Box 1 | The shelterin complex and its functions Shelterin is a complex comprising the following six subunits: telomeric repeat-binding factor 1 (TRF1), TRF2, repressor/ activator protein 1 (RAP1), TRF1‑interacting nuclear factor 2 (TIN2), TPP1 (also known as adrenocortical dysplasia protein homologue) and protection of telomeres 1 (POT1) (see the figure). Shelterin associates with mammalian telomeres, where it regulates various aspects of telomere function175–177. Shelterin is recruited to telomeres through TRF1 and TRF2, which bind to double-stranded telomeric DNA and to TIN2. POT1 binds to single-stranded telomeric DNA and is linked to TRF1 and TRF2 through its binding partner TPP1, which associates with TIN2. RAP1 associates with TRF2. Shelterin maintains telomere length and preserves genome integrity by regulating the access of telomerase to chromosome ends by controlling end-resection at newly replicated telomeres, and by masking telomeres from the DNA damage response (DDR). Specifically, TRF2 represses ATM-dependent DNA damage signalling and classical non- homologous end joining (c‑NHEJ), whereas POT1 is responsible for repressing ATR signalling and cooperates with RAP1 in suppressing homologous recombination. Avoiding the DDR is partially mediated by TRF2‑dependent t‑loop formation. T‑loops are formed through the invasion of the 3ʹ overhang at the telomere end into double-stranded telomeric DNA (FIG. 1), and is thought to prevent ATM activation by masking the chromosome end from the double-strand breaks sensor complex MRE11–RAD50–NBS1 (MRN) and by blocking c‑NHEJ induction by preventing the loading of the Ku70–Ku80 heterodimer on the chromosome end. Repression of ATR signalling by POT1 involves occlusion of the single-stranded DNA sensor replication protein A (RPA). Importantly, this repression depends on the association of POT1 with the rest of shelterin via its interaction with TPP1. Telomere protection is compromised when telomeres become too short to support sufficient shelterin binding. Shelterin also functions to facilitate telomere maintenance by the reverse transcriptase complex telomerase (FIG. 1), which is recruited to telomeres by the shelterin components TPP1 (REFS 178–181) and TIN2 (REFS 182,183). Shelterin also has a role in the regulation of telomerase-mediated telomere length maintenance (reviewed in REF. 184). Several shelterin subunits are negative regulators of telomere length, suggesting that shelterin subunits ‘count’ telomeric repeats to regulate telomerase activity and limit telomere length as part of a cis-acting negative-feedback loop (reviewed in REF. 185). This regulatory pathway may be important in the germ line, in which telomere length needs to be maintained within a narrow range to provide offspring with telomeres that are sufficiently long for normal development and tissue homeostasis, whereas at the same time are sufficiently short to suppress cell transformation by inducing replicative senescence.

TTGGGATTGGGATTGGGAT Telomerase GGA TG inhibition T A Telomerase G G TPP1 recruitment 3′ GATT G Chromosome end protection POT1 • ATM signalling (TRF2) • ATR signalling (POT1) • c-NHEJ (TRF2) TRF2 Telomere TRF1 • alt-NHEJ replication • Homologous TIN2 recombination RAP1 (POT1, RAP1) • 5′ hyper-resection T 5′- TTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGGGTTAGG G T 3′- AATCCCAATCCCAATCCCAATCCCAATCCCAATCCCAATCCCAATC-5′

Nature Reviews | Molecular Cell Biology NATURE REVIEWS | MOLECULAR CELL BIOLOGY VOLUME 18 | MARCH 2017 | 177 ©2017 Mac millan Publishers Li mited, part of Spri nger Nature. All ri ghts reserved. ©2017 Mac millan Publishers Li mited, part of Spri nger Nature. All ri ghts reserved.

REVIEWS

a Lagging-strand DNA synthesis Senescent cells are usually in G1 phase, consistent RNA primer with p53 activation and induction of the CDK inhibitors G-strand p21 and p16. The upregulation of p16 and the accom­ 3′ panying hypophosphorylation of the tumour suppres­ 5′ C-strand sor RB can contribute to telomere-induced senescence. Moreover, inactivation of both the RB and the p53 Leading-strand DNA synthesis responses to dysfunctional telomeres is needed to com­ pletely circumvent this block to proliferation43. Because the complete bypass of telomere shortening-induced senescence in human cells requires the inactivation of multiple pathways, this mechanism of curbing the pro­ liferation of transformed cells is likely to be robust43,45–48. Short (12 nt) 3 By contrast, p53 inactivation alone is sufficient to avoid ′ 49,50 overhang telomere-induced senescence and apoptosis in mice .

No 3′ overhang Telomere shortening, telomerase downregulation and 5′ end resection cancer prevention. Experiments in genetically altered (Apollo, EXO1) 3′ mice support the view that telomere shortening can act 5′ as a strong barrier to tumorigenesis (FIG. 2b). Crosses of 3′ telomerase-deficient mice with various tumour model 5′ mice have demonstrated that critically short telomeres Overhang fill-in (CST complex) limit tumour formation when the p53 pathway is func­ 3′ tional51–55. In addition, the original demonstration that 5 ′ telomerase is active in most human cancers, whereas 3′ 5′ the enzyme is undetectable in normal tissues, suggested that the telomere tumour suppressor pathway may oper­ ate in most cancer types56. However, the upregulation b Normal somatic cells and early in tumorigenesis of telomerase expression could be an irrelevant conse­ Germline and Telomere Tumour quence of transcriptional rewiring during tumorigenesis,­ stem cells shortening suppression perhaps reflecting a stem cell phenotype in cancer. The recent identification of activating mutations in the TERT promoter in several cancer types argues strongly Telomerase Population that these tumours had undergone selection for the silenced doublings activation of telomerase57,58. Similarly, the amplifica­ tion of TERT and other mutations that increase telo­ merase activity in some cancers argue in favour of a selected phenotype59–61. A strong argument in support of the telomere tumour Telomerase A few unprotected suppressor pathway emerged recently from a study of a telomeres large family with a predisposition to melanoma58. A link­ age analysis and high-throughput sequencing identi­ p53, RB DDR fied an activating mutation in the TERT promoter that co‑segregates with disease predisposition. This mutation Apoptosis Senescence (T>G; 57 bp upstream of the transcription start site) Figure 2 | Telomere shortening as a barrier to tumorigenesis. a | The molecular basis creates a binding motif for ETS (E26 transformation-­ of telomere shortening. Incomplete DNA synthesisNature at the Reviews end of the| Molecular lagging strandCell Biology specific) transcription factors. Thus, tissues that express (at the site of the terminal RNA primer) leaves a short 3ʹ overhang. Additional loss of ETS transcription factors are predicted to maintain telo­ telomeric DNA occurs through the processing of the leading-strand ends of telomeres merase activity, presumably resulting in the maintenance to regenerate the 3ʹ overhang, which is necessary for t‑loop formation and the structural of telomere length and the consequent disruption of the integrity of the telomere. This process is carried out by the nuclease Apollo, which is telomere tumour suppressor pathway. bound to telomeric repeat-binding factor 2 (TRF2). Both the leading end and the lagging A similar example is provided by the recently identi­ end of telomeres are further resected by exonuclease 1 (EXO1) to generate transient fied melanoma-predisposing mutations in the gene long overhangs. The CST (CTC1–STN1–TEN1) complex then binds to shelterin and encoding the protection of telomeres 1 (POT1) sub­unit mediates fill‑in synthesis of the cytosine-rich strand (C‑strand) at both ends. b | During of shelterin62,63. These mutations alter POT1 mRNA development, telomerase is switched off through telomerase reverse transcriptase (TERT) silencing. As a result, telomeres experience the gradual attrition described in part a. splicing or compromise the oligonucleotide and/or After numerous population doublings, a few telomeres become too short (yellow) and oligosaccharide-binding folds in the single-stranded lose their protective function. As a result, the kinases ATM and ATR are activated at the DNA-binding domains of POT1. As a consequence, unprotected chromosome ends and this DNA damage response (DDR) signalling induces the ability of POT1 to bind to single-stranded telo­ replicative arrest and senescence or apoptosis. This process limits the proliferative meric DNA is diminished. Carriers of these mutations capacity of incipient cancer cells, thus functioning as a tumour suppressor pathway. have longer telomeres, presumably owing to the loss Cells lacking p53 and RB function can avoid this replicative arrest. of POT1‑mediated inhibition of telomerase (BOX 1).

178 | MARCH 2017 | VOLUME 18 www.nature.com/nrm ©2017 Mac millan Publishers Li mited, part of Spri nger Nature. All ri ghts reserved. ©2017 Mac millan Publishers Li mited, part of Spri nger Nature. All ri ghts reserved.

REVIEWS

Early in tumorigenesis Cancer Continued growth past the senescence barrier can Aneuploid, occur in cells that lack the p53 and RB tumour sup­ Tumour suppression Telomere crisis rearranged genome pressor pathways, rendering their cell cycle transitions

p53 and impervious to inhibition through ATM and ATR sig­ RB loss + nalling. Continued telomere shortening eventually population Telomerase leads to cells with numerous dysfunctional telomeres, doublings reactivation thereby increasing the chance that one dysfunctional telomere becomes fused to another. Consequently, cells in telomere crisis have end‑to‑end fused dicentric chromo­somes, which lead to mitotic mis-segregation and genomic instability. Cells in telomere crisis undergo A few unprotected Many unprotected telomeres chromosome ends frequent cell death. A common assumption is that this loss of viability is driven by chromosome breakage and Dicentric chromosome Telomere healing and genome stabilization mis-segregation, although it may also involve additional telomere deprotection during an extended mitotic arrest • Loss of heterozygosity that occurs in some of the cells71,72. • Translocations • Amplifications Mammalian cells can use two types of end-joining • Chromothripsis, kataegis pathways to repair DSBs: classical NHEJ (c‑NHEJ) and • Tetraploidization alternative NHEJ (alt-NHEJ)73,74. c‑NHEJ relies on the Figure 3 | Telomere crisis. Loss of the RB and p53 tumour suppressor pathways disables Ku70–Ku80 heterodimer and DNA ligase 4 and can the ability of cells to respond with cell cycle arrestNature to ATR Reviews and ATM | Molecular signalling. Cell As the Biology cells either be accurate or result in small deletions. By con­ continue to divide, their telomeres continue to shorten. Once many telomeres become trast, alt-NHEJ, which is mediated by poly(ADP-­ribose) too short to function, the unprotected chromosome ends generate end‑to‑end fusions polymerase 1 (PARP1) and DNA ligase 3, creates­ inser­ and dicentric chromosomes, leading to many forms of genome instability. Ultimately, tions and more extensive deletions. Telomere fusions telomerase reactivation provides a route out of telomere crisis by healing critically formed during telomere crisis in cultured cells are shortened telomeres and improving genomic stability, thereby increasing cell viability. The resulting tumour will have active telomerase and a heavily rearranged genome. ­mediated by alt-NHEJ and exhibit insertion of new sequences at the fusion point75,76. Similarly, alt-NHEJ has been implicated in telomere fusion in human cancer­ 77,78 Because the increased telomere length is present at and in telomere fusions in mouse models79. By con­ birth, these mutations are likely to push the onset of trast, when telomeres are compromised through the senescence to later population doublings, thus post­ loss of TRF2, their repair is carried out by c-NHEJ80–82. poning the tumour-suppressive effects of telomere The ­reason for this difference­ is not yet clear. attrition to a point of irrelevance. However, whether Genome instability in cells undergoing telomere the diminished POT1 function also promotes genome crisis was initially found to give rise to chromosome instability is currently unknown64. gains and losses (aneuploidy), translocations, gene Another observation in support of the telomere loss (manifested as loss of heterozygosity (LOH)) and tumour suppressor pathway is that longer telomere regional amplification through breakage–fusion–bridge length has been associated with an increased risk of (BFB) cycles1,80,83. However, it has recently become B cell lymphoma and chronic lymphocytic leukaemia clear that the repertoire of genomic alterations that can (CLL)65–67. In a recent study, single-nucleotide poly­ be ascribed to telomere crisis is more extensive and morphisms in telomere maintenance genes that are includes ­whole-genome reduplication, chromothripsis associated with telomere length68,69 were examined to and kataegis3,8,9. determine the cancer risk of 95,568 individuals from the general population70. This analysis found that genetic BFB cycles and their associated chromosomal determinants of long telomeres are associated with an ­rearrangements. BFB cycles, first observed more than increased overall cancer risk, especially lung cancer half a century ago by Barbara McClintock84, can occur and melanoma. Collectively, these data are consist­ when dicentric chromosomes (including those formed ent with telomere shortening functioning as a tumour by telomere fusion) break, followed by a second fusion of suppressor pathway. the broken ends in the daughter cell85 (FIG. 4a). Telomere fusions can occur between different chromosomes Telomere crisis and genome instability or between sister chromatids after DNA replication, Although the telomere tumour suppressor pathway may thus leading to different outcomes86. Collectively, BFB be a powerful mechanism to limit cancer development, cycles can lead to three outcomes that are pertinent failure of transformed cells to undergo senescence can to cancer: LOH, non-reciprocal translocations and produce telomere crisis, during which the cell popula­ gene amplification. tion does not expand. In telomere crisis, cells struggle LOH, which is frequent at cancer-relevant loci, can with a high level of genome instability owing to the occur when a dicentric chromosome breaks and one Dicentric chromosomes presence of many dysfunctional telomeres. Activation of the daughter cells inherits a chromosome with a ter­ Abnormal chromosomes with (FIG. 4b) two centromeres that can of telo­merase provides a path out of telomere crisis, minal deletion . Non-reciprocal translocations result from telomere–telomere ­ultimately leading to the formation of a cancer clone could arise when the DNA end of a broken chromo­ fusion. with a heavily rearranged genome (FIG. 3). some invades another chromosome and copies­ part

NATURE REVIEWS | MOLECULAR CELL BIOLOGY VOLUME 18 | MARCH 2017 | 179 ©2017 Mac millan Publishers Li mited, part of Spri nger Nature. All ri ghts reserved. ©2017 Mac millan Publishers Li mited, part of Spri nger Nature. All ri ghts reserved.

REVIEWS

a breakage of such an isochromosome and multiple BFB cycles can then generate amplicons that are organized in inverted repeats91. BFB cycles have been demon­ strated to initiate gene amplification in human cancer Fusion cells and in hamster cells92–94. Moreover, the inverted amplicon arrangements that are typical of BFB cycles have been observed in many cancer types, including Bridge pancreatic cancer, oesophageal cancer, breast cancer and leukaemias91,95–98. Breakage Chromothripsis. Recently, chromothripsis was shown b to be one of the outcomes of experimentally induced Healing by telomere crisis. Chromothripsis is a mutagenic process telomerase Terminal deletion (LOH) whereby one or more chromosomal regions undergo catastrophic shattering in a single event, followed by an apparently haphazard repair of the DNA fragments. Break- induced Non-reciprocal This process results in genomes in which one or few replication translocation chromosome segments are affected by tens to hundreds of genomic rearrangements99. Chromothripsis has been observed in diverse tumour types, especially those with 100,101 a bc Repeated sister fusions/ p53 loss , and several studies have noted an associ­ 91,98,102 a bc BFBs and healing ation between BFB cycles and chromothripsis . Consistent with these associations, chromothripsis was a bc bc bc bc demonstrated to be the result of telomere crisis induced HSR Regional by the inactivation of the shelterin subunit TRF2 in amplification p53-deficient and RB‑deficient epithelial cells3. This study used live-cell imaging to determine the fate of bc c b bc c b bc c b Double dicentric chromosomes formed during telomere crisis minutes and showed that dicentric chromosomes do not break Figure 4 | BFB cycles and chromosomal rearrangements during mitosis. This finding was in agreement with during telomere crisis.Nature a Reviews| Breakage–fusion–bridge | Molecular Cell Biology(BFB) work in yeast cells and a subsequent analysis in human cycles can occur when telomere fusion generates a dicentric cells3,103,104 (FIG. 5a). These dicentric chromosomes invari­ chromosome. During anaphase, the mitotic spindle pulls this ably persist through mitosis and form long chromatin dicentric chromosome towards opposite spindle poles, bridges that connect the daughter cells well into the next thereby generating the widely observed anaphase bridges. G1 phase3. These chromatin bridges contain a nuclear During cell division, the dicentric chromosome undergoes envelope that is contiguous with the nuclear envelop of breakage and the broken ends fuse again, giving rise to another dicentric chromosome. b | BFB cycles can be the connected nuclei. However, when chromatin bridges interrupted by telomerase-mediated telomere healing. are formed, there is frequent rupture of the nuclear envel­ If this process occurs following breakage, it can result in the ope of the connected nuclei, resulting in mixing of the formation of a terminal chromosome deletion and loss of nuclear and cytoplasmic contents. Spontaneous nuclear heterozygosity (LOH). Alternatively, broken chromosomes envelope rupture has been observed in cancer cell lines can be repaired by break-induced replication, yielding a and is frequent in micronuclei105,106. It is not clear how non-reciprocal translocation. Repeated cycles of BFB that chromatin bridges induce nuclear envelope rupturing, occur between sister chromatids can result in regional but lamin depletion from the nuclear envelope may have a Break-induced replication amplification and the generation of a homogeneously role as lamin B1 overexpression suppressed the ruptures, An origin of replication- staining region (HSR) following chromosome staining. independent replication restart and lamin depletion can promote envelope rupture in This HSR consists of multiple amplicons of inverted repeats. 3,105 that is initiated by the invasion Excision of the amplified sequences out of the chromosome cancer cell lines . A second source of nuclear envelope of resected DNA into will generate circular double-minute chromosomes. rupture may be the deformation of the two nuclei con­ homologous sequences. nected by the stretching chromatin bridge. The dicentric Micronuclei chromosome in the bridge seems to exert pulling forces Abnormal, small nuclei of this chromosome through a process called break-­ on the nuclear envelope, perhaps because it is attached to containing one or more induced replication87,88. Non-reciprocal trans­locations the nuclear lamins107. In support of this view, two recent chromosome (fragments); occur during tumorigenesis in mice with shortening studies have shown that cell migration through tight often formed as a result 1 of mitotic chromosome telomeres and are a frequent class of rearrange­ments constrictions induces nuclear envelope rupture in the 89 108,109 segregation defects. in cancer . Sequence analysis of more than 1,000 telo­ squeezed nuclei . mere fusion events has shown that a chromo­some end After persisting for many hours, the chromatin Lamin lacking telomere protection can ­recombine with diverse bridges are resolved by 3ʹ repair exonuclease 1 (TREX1) An intermediate filament chromosome-internal loci90. (FIG. 5b), a highly abundant and widely expressed protein that imparts structural rigidity to the nucleus by Gene amplification can result when the telomere 3ʹ exonuclease that degrades DNA species in the cyto­ 110–113 assembling into a meshwork fusion event involves sister chromatids, thus creating plasm . TREX1 seems to gain access to the chroma­ at the inner nuclear membrane. a large palindrome (FIG. 4b). Subsequent asymmetric tin bridge during nuclear envelope rupture3. The enzyme

180 | MARCH 2017 | VOLUME 18 www.nature.com/nrm ©2017 Mac millan Publishers Li mited, part of Spri nger Nature. All ri ghts reserved. ©2017 Mac millan Publishers Li mited, part of Spri nger Nature. All ri ghts reserved.

REVIEWS

may preferentially attack the DNA in the chromatin Fragmentation of chromatin bridge DNA by TREX1 bridges because they lack the nucleosomes that normally could explain the regional DNA breaks that are typical of repress TREX1 activity3. The exonuclease creates exten­ chromothripsis because only the portion of the dicentric­ sive single-stranded DNA in chromatin bridges, leading chromosome residing inside the chromatin bridge is to an accumulation of the single-stranded DNA-binding attacked by TREX1. Moreover, the repair of these frag­ protein replication protein A (RPA) on the bridges ments in the primary nucleus is consistent with the cata­ (FIG. 5b). The nicks in the double-stranded DNA that strophic, but localized, rearrangements that are observed allow TREX1 to initiate resection were shown to exist in chromothripsis (FIG. 5c). in chromatin bridges114, but their source is unknown. The observation that dicentric chromosomes persist Eventually, TREX1 digestion is thought to resolve the through mitosis intact, suffer extensive fragmentation chromatin bridge once the resection of the Watson and and give rise to chromothripsis is not in conflict with Crick strands of the DNA converges. a telomeric origin of BFB cycles. Chromatin bridges Following chromatin bridge resolution, the remnants can be resolved even in the absence of TREX1, indi­ of the dicentric chromosome are reincorporated back cating that other mechanisms are at work3. Potentially, into the nuclear genome, but continue to be marked by a TREX1‑independent pathway for bridge resolution the presence of RPA, indicating that single-stranded could involve a nuclease that makes a single DSB and DNA persists3. As the RPA mark usually dissipates does not fragment the chromatin in the bridge. Such a within one cell cycle, repair of the fragmented ­dicentric broken dicentric chromosome could initiate BFB cycles chromosome is presumed to occur during this period3. by fusing the broken end with another broken end or, The exact repair pathways that are responsible for after DNA replication, by fusing with the sister chroma­ generating the chromothriptic product have not yet tids. The genome rearrangements induced through this been determined. pathway may become clear from the analysis of genome

a Chromosome end fusion b NE

Chromatin bridge (100–200 μm)

TREX1

Transient NERDI

Dicentric chromosome ssDNA

RPA

Bridge resolution Anaphase bridges No breakage in mitosis (after ~9 h)

Figure 5 | Chromothripsis and kataegis in telomere Fragmented crisis. a | Dicentric chromosomes formed by telomere chromosome arm fusion rarely, if ever, break during mitosis and instead form (RPA) rejoining nucleus chromatin bridges. b | Daughter nuclei connected by chromatin bridges undergo frequent nuclear envelope c Inside the bridge (NE) rupture in interphase (NERDI), resulting in the accumulation of 3ʹ repair exonuclease 1 (TREX1) on Fragmentation bridge DNA. TREX1‑mediated resection of DNA leads to the formation of single-stranded DNA (ssDNA), which is bound by replication protein A (RPA), and bridge resolution. Bridge fragments are internalized into the nucleus where they remain associated with RPA for approximately 24 hours. c | Part of the dicentric Haphazard repair chromosome that is present in the chromatin bridge Chromothripsis undergoes extensive fragmentation followed by haphazard repair, which yields a chromothriptic chromosome in which many original chromosome Kataegis fragments are lost and retained fragments are present in seemingly random order and orientation. Chromothriptic breakpoints are frequently associated with kataegis Lost mutation clusters.

Nature Reviews | Molecular Cell Biology NATURE REVIEWS | MOLECULAR CELL BIOLOGY VOLUME 18 | MARCH 2017 | 181 ©2017 Mac millan Publishers Li mited, part of Spri nger Nature. All ri ghts reserved. ©2017 Mac millan Publishers Li mited, part of Spri nger Nature. All ri ghts reserved.

REVIEWS

Telomere crisis p53, RB Many critically Centrosomes short telomeres 4N S phase S phase

4N Tetraploid cell ATM, ATR CDK1–CYCB Diplochromosomes Telomerase activation Proliferation of a tetraploid clone Chromosome Mitosis losses Hyper-triploid 2N cancer cells

2N

Figure 6 | Tetraploidization during telomere crisis. Telomere crisis can lead to persistent DNA damage signalling when repair fails to join all the unprotected ends and dysfunctional telomeres persist. TheNature persistent Reviews ATM | Molecular and ATR signalling Cell Biology and activation of their downstream effector kinases checkpoint kinase 2 (CHK2) and CHK1, respectively, results in prolonged inhibition of cyclin-dependent kinase 1 (CDK1)–cyclin B (CYCB), thus blocking entry into mitosis. Eventually, cells bypass mitosis, enter a G1‑like state and then undergo a second S phase. The resulting tetraploid cells have diplochromosomes in the first mitosis following endoreduplication. Subsequently, the cells undergo frequent chromosome losses, leading to the hyper-triploid cells that are frequently observed in cancer. The example karyotype shown is from Capan‑2, a hyper-triploid pancreatic cancer cell line (http://www.pawefish.path.cam.ac.uk/PancCellLineDescriptions/Capan-2.html), courtesy of Vorapan Sirivatanauksorn and Paul Edwards.

instability in TREX1‑deficient cells progressing through found at the breakpoints of chromothriptic rearrange­ telomere crisis. ments created by telomere crisis3. A possible explanation Another source of chromothripsis in cancer may for this observation is that the extensive single-stranded be chromosomes that mis-segregate into micronuclei. DNA that accumulates following TREX1‑mediated The chromosome in a micronucleus experiences DNA resection serves as a substrate for APOBEC deaminases. damage, extensive fragmentation and subsequent repair, leading to shattering of the entire chromosome115,116. Telomere-driven tetraploidy. Finally, telomere crisis­ can In addition, it was recently shown that simultaneous TRF2 induce tetraploidization (doubling the set of chromo­ depletion and inhibition of the spindle assembly check­ somes)8,9, which is inferred to be a frequent event point kinase MPS1 can also result in chromothripsis,­ but during the development of human cancers125. Many the precise molecular pathway is not clear117,118. human tumour cell lines have a near-tetraploid or hyper-triploid karyotype, which is indicative of past tetra­ Kataegis. Chromothripsis induced by experimental ploidization125. Tetraploidization can promote tumori­ telo­mere crisis is often accompanied by kataegis (FIG. 5c). genesis9,125–133, and tetraploid cells have a high toler­ance Kataegis is a hypermutation pattern of clustered C>T of chromosome mis-segregation and resilience to and C>G changes at TpC dinucleotides119. Kataegis chromosomal instability134. is thought to result from the activity of the apolipo­ Tetraploidization can be induced in cells that lack protein B mRNA-editing catalytic subunit (APOBEC) the p53 and RB pathways, which have a high load family of enzymes120–122, which can deaminate cytosine of dysfunctional telomeres8,9 (FIG. 6). The mechanism of residues to generate uracil, and therefore act as muta­ tetraploidization involves persistent ATM-dependent tors123. Many APOBECs are active in the cytoplasm, and/or ATR-dependent signalling induced by irrepar­ where they restrict RNA and DNA virus infection, most ably ­damaged telomeres. This signalling leads to a notably HIV, and other parasitic genomes, thereby con­ prolonged G2 phase and ultimately a bypass of mitosis tributing to an innate retroviral defence124. APOBECs and entry into a G1‑like state. A second S phase then preferentially target single-stranded DNA, and can results in whole-genome reduplication and tetraploidy. Hyper-triploid karyotype A genome that contains more produce a cluster of strand-coordinated mutations that Tetraploidization is observed following experimental­ than three (3N) but less than affect cytosine bases in the same (Watson or Crick) inactivation of shelterin and in p53-deficient and four (4N) sets of chromosomes. strand. Consistent with APOBEC activity, kataegis is RB‑deficient human cells undergoing telomere crisis.

182 | MARCH 2017 | VOLUME 18 www.nature.com/nrm ©2017 Mac millan Publishers Li mited, part of Spri nger Nature. All ri ghts reserved. ©2017 Mac millan Publishers Li mited, part of Spri nger Nature. All ri ghts reserved.

REVIEWS

The prevalence of telomere crisis in cancer. Telomere embryonic stem cells prevented TERT silencing upon crisis may be a frequent event during the development differentiation and resulted in increased telomerase of human epithelial cancers, which initially lack telo­ activity that counters telomere shortening25. merase. Shorter telomeres are frequently observed in TERT promoter mutations are not the only mech­ cancer relative to their adjacent normal tissue135–142. anism by which telomerase activity can be restored Anaphase bridges, which can be formed by telomere– or enhanced. In neuroblastoma, telomerase activity is telomere fusion, have been observed in human cancer increased by recurrent genomic rearrangements that samples, including in early-stage colorectal tumours52. pair the TERT coding sequence with strong enhancer However, a consideration of anaphase bridges may over­ elements, thereby defining a subgroup of patients with estimate the level of telomere dysfunction because they poor prognoses60. However, in many human cancers, the could also result from other defects, including errors in mechanism by which telomerase is upregulated is yet DNA decatenation143 and cohesin resolution144. to be determined. Furthermore, although most human Telomere crisis in breast cancer has been particu­ cancers (~90%) escape telomere crisis by activating larly well documented. An analysis of genome instabil­ telomerase56, a significant minority of cancers use an ity and other features associated with telomere crisis, alternative telomere maintenance system, referred to including anaphase and chromatin bridges, suggests as alternative lengthening of telomeres (ALT)161. ALT is that transition through telomere crisis in breast cancer associated with mutations in the chromatin remodeller occurs during progression from usual ductal ­hyperplasia α-thalassaemia/mental retardation syndrome X-linked (UDH) to ductal carcinoma in situ (DCIS)145. This (ATRX) both in vitro and in several human cancers, phen­omenon is consistent with the higher rate of including glioblastomas162–165. The observations that chromo­some aber­rations in DCIS than in UDH146, the TERT promoter mutations are usually mutually exclu­ shortened telomeres found in DCIS147 and the activation sive with mutations in ATRX support the notion that of telomerase­ in DCIS148. ALT may provide a telomerase­ -independent escape from Methods to directly detect the scars of prior telo­ telomere crisis166,167. mere crisis in cancer genomes have now been devel­ oped75,149,150. The telomere–telomere fusions that are Telomere dysfunction following telomerase activation. typical of telomere crisis can be detected with a PCR- The types and severity of genome instability induced based assay that uses correctly oriented primers situated by dysfunctional telomeres can vary between transient in the subtelomeric DNA of two (or more) chromo­ and persistent telomere dysfunction. In mouse models, some ends75,150. Using this approach, evidence for past continued telomere dysfunction can constrain cancer telomere crisis has been obtained in CLL as well as in progression, whereas telomerase reactivation allevi­ breast cancer,­ colorectal adenomas and other solid ates intratumoural DNA damage and leads to more tumours75,77,78. In colorectal cancer, telomere fusion ­aggressive tumour progression and metastasis168. occurs during the adenoma–carcinoma transition and However, some telomere dysfunction may persist may also be present before the occurrence of most even after telomerase activation and exit from telomere somatic mutations78. These studies have also revealed crisis. Changes in telomere length can occur owing to Anaphase bridges a prognostic value to stratifying patients according to stochastic telomere loss, as has been demonstrated in DNA bridges that connect the length of the shortest telomeres — as determined by squamous cell and bladder cell carcinoma cell lines169,170, chromatin masses undergoing a PCR assay that measures individual telomere lengths and ongoing telomere dysfunction has been found in separation during anaphase — and the likelihood that telomere fusions will take cancer cells with ALT162,171. Telomere loss at individual and can be observed with 151,152 conventional DNA place . In CLL and invasive ductal carcinoma of the chromosome ends is sufficient to produce many of the staining techniques. breast, overall survival is shorter when the telomeres are rearrangements seen in telomere crisis and in cancer, in a size range expected to result in telomere fusions151,152. including amplifications, LOH, translocations, chromo­ Usual ductal hyperplasia some non-disjunction during mitosis, and the formation­ A benign overgrowth of cells 170,172 that line the ducts or milk Telomerase activation. Telomerase activation is often of isochromosomes and ring chromosomes . Even glands and is associated accomplished through mutations in the TERT pro­ limited telomere dysfunction can wreak havoc on the with an elevated risk of moter57,58. These mutations are the most common genome because instability at individual chromosome breast cancer. mutations in non-coding sequences in cancer and are ends can be transferred to other chromosomes through found in a long, and almost certainly growing, list of non-reciprocal translocations172,173. Telomeres in human Ductal carcinoma in situ 153–158 135 A noninvasive, early form of ­cancers . Similar to the inherited TERT promoter cancer are often shorter than in normal tissues . It is breast cancer characterized mutations, the sporadic mutations (–57A>C, –124C>T possible that this setting of short telomere length reflects by proliferative, malignant and –146C>T) occur near the transcription start site selection for a telomere length distribution that affords cells that are confined to where they create de novo binding sites for ETS tran­ a low level of genome instability­ without diminishing the milk duct. scription factors. An analysis of these mutations in cell viability. Alternative lengthening urothelial cancers showed that they are correlated with of telomeres higher levels of TERT mRNA and protein levels and Perspectives A telomere lengthening enzymatic activity and with greater telomere length159. An attractive feature of telomere crisis as a source of mechanism that relies on In glioblastomas, sporadic TERT mutations were shown genome instability in cancer is its transient nature. homologous recombination- mediated DNA copying to activate transcription by enabling the recruitment of A mutator phenotype is favoured when extrinsic or to counteract telomere the transcription factor GA-binding protein α-chain intrinsic forces demand the generation of variants. shortening. (GABPA)160. Introduction of these mutations into This process can enable cancer cell populations to adapt

NATURE REVIEWS | MOLECULAR CELL BIOLOGY VOLUME 18 | MARCH 2017 | 183 ©2017 Mac millan Publishers Li mited, part of Spri nger Nature. All ri ghts reserved. ©2017 Mac millan Publishers Li mited, part of Spri nger Nature. All ri ghts reserved.

REVIEWS

Chromoplexy ­rapidly to new challenges presented by shifting environ­ crisis is probably not comprehensive. For example, telo­ A class of complex DNA ments. However, persistence of a mutator phenotype mere crisis may contribute to chromoplexy, in which rearrangements frequently comes at a cost because most mutations are deleteri­ chains of translocations link several chromosomes in a observed in prostate cancer, ous to cellular fitness. The brief, or at least transient, temporally constrained event174. Bioinformatic methods which is characterized by multiple chromatin episode of genomic instability offered by dysfunctional to detect the remnants of telomere–telomere fusions in rearrangements that arise in a telomeres avoids a persistent mutator phenotype that entire cancer genome sequencing data sets need to be highly interdependent manner. might hamper cell proliferation10. Ultimately, telomer­ developed to fully understand the relationship between ase reactivation provides a route out of telomere crisis, chromosome fusion events and consequent chromo­ stabilizing the genome and rescuing cellular fitness. some rearrangements. Future studies will help to reveal Although much has been learned in recent years the mechanisms underlying the complexity of the cancer about the role of telomere crisis in cancer development, genome, and with continued investment, these insights many basic questions remain. The current list of known may be translated into valuable prognostic indicators genome rearrangements in cancer that follow telomere and more effective treatments.

1. Artandi, S. E. et al. Telomere dysfunction promotes 18. Darzacq, X. et al. Stepwise RNP assembly at the site 37. Wu, P., van Overbeek, M., Rooney, S. & de Lange, T. non-reciprocal translocations and epithelial cancers of H/ACA RNA transcription in human cells. J. Cell Apollo contributes to G overhang maintenance in mice. Nature 406, 641–645 (2000). Biol. 173, 207–218 (2006). and protects leading-end telomeres. Mol. Cell 39, Demonstrates that telomere attrition in 19. Kiss, T., Fayet-Lebaron, E. & Jády, B. E. Box H/ACA 606–617 (2010). p53-mutant mice promotes epithelial cancers small ribonucleoproteins. Mol. Cell 37, 597–606 38. Kasbek, C., Wang, F. & Price, C. M. Human TEN1 through the formation of chromosome (2010). maintains telomere integrity and functions in rearrangements. 20. Schmidt, J. C. & Cech, T. R. Human telomerase: genome‑wide replication restart. J. Biol. Chem. 288, 2. Artandi, S. E. & DePinho, R. A. Telomeres and biogenesis, trafficking, recruitment, and activation. 30139–30150 (2013). telomerase in cancer. Carcinogenesis 31, 9–18 Genes Dev. 29, 1095–1105 (2015). 39. d’Adda di Fagagna, F. et al. A DNA damage checkpoint (2010). 21. Hockemeyer, D. & Collins, K. Control of telomerase response in telomere-initiated senescence. Nature 3. Maciejowski, J., Li, Y., Bosco, N., Campbell, P. J. action at human telomeres. Nat. Struct. Mol. Biol. 22, 426, 194–198 (2003). & de Lange, T. Chromothripsis and kataegis induced 848–852 (2015). Finds that telomeres in senescent cells exhibit by telomere crisis. Cell 163, 1641–1654 (2015). 22. Shay, J. W. Role of telomeres and telomerase in aging the hallmarks of DNA DSBs. Shows that dicentric chromosomes formed during and cancer. Cancer Discov. 6, 584–593 (2016). 40. Zou, Y., Sfeir, A., Gryaznov, S. M., Shay, J. W. telomere crisis persist through mitosis, are 23. Bodnar, A. G. et al. Extension of life-span by & Wright, W. E. Does a sentinel or a subset of short fragmented by TREX1 in G1 phase and give rise introduction of telomerase into normal human cells. telomeres determine replicative senescence? to chromothripsis and kataegis. Science 279, 349–352 (1998). Mol. Biol. Cell 15, 3709–3718 (2004). 4. Hanahan, D. & Weinberg, R. A. Hallmarks of cancer: Establishes a causal relationship between telomere 41. Hemann, M. T., Strong, M. A., Hao, L. Y. the next generation. Cell 144, 646–674 (2011). shortening and cellular senescence. & Greider, C. W. The shortest telomere, not average 5. Yates, L. R. & Campbell, P. J. Evolution of the cancer 24. Cristofari, G. & Lingner, J. Telomere length telomere length, is critical for cell viability and genome. Nat. Rev. Genet. 13, 795–806 (2012). homeostasis requires that telomerase levels are chromosome stability. Cell 107, 67–77 (2001). 6. Willis, N. A., Rass, E. & Scully, R. Deciphering limiting. EMBO J. 25, 565–574 (2006). 42. Takai, H., Smogorzewska, A. & de Lange, T. DNA the code of the cancer genome: mechanisms 25. Chiba, K. et al. Cancer-associated TERT promoter damage foci at dysfunctional telomeres. Curr. Biol. 13, of chromosome rearrangement. Trends Cancer 1, mutations abrogate telomerase silencing. eLife 4, 1549–1556 (2003). 217–230 (2015). e07918 (2015). 43. Jacobs, J. J. L. & de Lange, T. Significant role for 7. O’Hagan, R. C. et al. Telomere dysfunction provokes 26. Ramirez, R. D. et al. Putative telomere-independent p16INK4a in p53‑independent telomere-directed regional amplification and deletion in cancer genomes. mechanisms of replicative aging reflect inadequate senescence. Curr. Biol. 14, 2302–2308 (2004). Cancer Cell 2, 149–155 (2002). growth conditions. Genes Dev. 15, 398–403 (2001). 44. Karlseder, J., Smogorzewska, A. & de Lange, T. Demonstrates that tumours with telomere 27. Vaziri, H. & Benchimol, S. Reconstitution of Senescence induced by altered telomere state, not dysfunction have higher levels of genome telomerase activity in normal human cells leads to telomere loss. Science 295, 2446–2449 (2002). instability, with frequent amplifications elongation of telomeres and extended replicative life 45. Shay, J. W., Pereira-Smith, O. M. & Wright, W. E. A role and deletions. span. Curr. Biol. 8, 279–282 (1998). for both RB and p53 in the regulation of human cellular 8. Davoli, T., Denchi, E. L. & de Lange, T. Persistent 28. Gomes, N. M. V. et al. Comparative biology of senescence. Exp. Cell Res. 196, 33–39 (1991). telomere damage induces bypass of mitosis and mammalian telomeres: hypotheses on ancestral states 46. Hara, E., Tsurui, H., Shinozaki, A., Nakada, S. tetraploidy. Cell 141, 81–93 (2010). and the roles of telomeres in longevity determination. & Oda, K. Cooperative effect of antisense‑Rb and Finds that persistent telomere dysfunction and Aging Cell 10, 761–768 (2011). antisense‑p53 oligomers on the extension of life span consequent DNA damage signalling lead to bypass 29. Harley, C. B., Futcher, A. B. & Greider, C. W. Telomeres in human diploid fibroblasts, TIG‑1. Biochem. Biophys. of mitosis and tetraploidization. shorten during ageing of human fibroblasts. Nature Res. Commun. 179, 528–534 (1991). 9. Davoli, T. & de Lange, T. Telomere-driven 345, 458–460 (1990). 47. Shay, J. W., Wright, W. E., Brasiskyte, D. tetraploidization occurs in human cells undergoing Demonstrates that the telomeres of human & Van der Haegen, B. A. E6 of human crisis and promotes transformation of mouse cells. fibroblasts shorten during growth in culture. papillomavirus type 16 can overcome the M1 stage Cancer Cell 21, 765–776 (2012). 30. Huffman, K. E., Levene, S. D., Tesmer, V. M., of immortalization in human mammary epithelial Reports that telomere-driven tetraploidy occurs Shay, J. W. & Wright, W. E. Telomere shortening cells but not in human fibroblasts. Oncogene 8, in human cells during telomere crisis. is proportional to the size of the G‑rich telomeric 1407–1413 (1993). 10. de Lange, T. Telomere-related genome instability 3ʹ‑overhang. J. Biol. Chem. 275, 19719–19722 48. Brown, J. P., Wei, W. & Sedivy, J. M. Bypass of in cancer. Cold Spring Harb. Symp. Quant. Biol. 70, (2000). senescence after disruption of p21CIP1/WAF1 gene 197–204 (2005). 31. Miyake, Y. et al. RPA-like mammalian Ctc1–Stn1–Ten1 in normal diploid human fibroblasts. Science 277, 11. Blackburn, E. H. & Collins, K. Telomerase: an RNP complex binds to single-stranded DNA and protects 831–834 (1997). enzyme synthesizes DNA. Cold Spring Harb. Perspect. telomeres independently of the Pot1 pathway. 49. Chin, L. et al. p53 deficiency rescues the adverse Biol. 3, a003558 (2011). Mol. Cell 36, 193–206 (2009). effects of telomere loss and cooperates with telomere 12. Lingner, J. et al. Reverse transcriptase motifs in 32. Surovtseva, Y. V. et al. Conserved telomere dysfunction to accelerate carcinogenesis. Cell 97, the catalytic subunit of telomerase. Science 276, maintenance component 1 interacts with STN1 527–538 (1999). 561–567 (1997). and maintains chromosome ends in higher eukaryotes. Shows that p53 is activated during telomere crisis to 13. Hamma, T. & Ferré-D’Amaré, A. R. The box H/ACA Mol. Cell 36, 207–218 (2009). induce growth arrest and suppress transformation. ribonucleoprotein complex: interplay of RNA and 33. Huang, C., Dai, X. & Chai, W. Human Stn1 protects 50. Smogorzewska, A. & de Lange, T. Different telomere protein structures in post-transcriptional RNA telomere integrity by promoting efficient lagging- damage signaling pathways in human and mouse cells. modification. J. Biol. Chem. 285, 805–809 (2010). strand synthesis at telomeres and mediating C‑strand EMBO J. 21, 4338–4348 (2002). 14. Nakamura, T. M. et al. Telomerase catalytic subunit fill‑in. Cell Res. 22, 1681–1695 (2012). 51. Greenberg, R. A. et al. Short dysfunctional telomeres homologs from fission yeast and human. Science 277, 34. Dai, X. et al. Molecular steps of G‑overhang impair tumorigenesis in the INK4aΔ2/3 cancer-prone 955–959 (1997). generation at human telomeres and its function mouse. Cell 97, 515–525 (1999). 15. Meyerson, M. et al. hEST2, the putative human in chromosome end protection. EMBO J. 29, 52. Rudolph, K. L., Millard, M., Bosenberg, M. W. telomerase catalytic subunit gene, is up‑regulated 2788–2801 (2010). & DePinho, R. A. Telomere dysfunction and evolution in tumor cells and during immortalization. Cell 90, 35. Wu, P., Takai, H. & de Lange, T. Telomeric 3’ overhangs of intestinal carcinoma in mice and humans. 785–795 (1997). derive from resection by Exo1 and Apollo and fill‑in Nat. Genet. 28, 155–159 (2001). 16. Feng, J. et al. The RNA component of human by POT1b‑associated CST. Cell 150, 39–52 (2012). 53. Qi, L. et al. Short telomeres and ataxia-telangiectasia telomerase. Science 269, 1236–1241 (1995). 36. Wang, F. et al. Human CST has independent functions mutated deficiency cooperatively increase telomere 17. Egan, E. D. & Collins, K. Biogenesis of telomerase during telomere duplex replication and C‑strand fill‑in. dysfunction and suppress tumorigenesis. Cancer Res. ribonucleoproteins. RNA 18, 1747–1759 (2012). Cell Rep. 2, 1096–1103 (2012). 63, 8188–8196 (2003).

184 | MARCH 2017 | VOLUME 18 www.nature.com/nrm ©2017 Mac millan Publishers Li mited, part of Spri nger Nature. All ri ghts reserved. ©2017 Mac millan Publishers Li mited, part of Spri nger Nature. All ri ghts reserved.

REVIEWS

54. Qi, L., Strong, M. A., Karim, B. O., Huso, D. L. 74. Smogorzewska, A., Karlseder, J., Holtgreve-Grez, H., 97. Waddell, N. et al. Whole genomes redefine the & Greider, C. W. Telomere fusion to chromosome Jauch, A. & de Lange, T. DNA ligase IV‑dependent mutational landscape of pancreatic cancer. Nature breaks reduces oncogenic translocations and tumour NHEJ of deprotected mammalian telomeres in G1 518, 495–501 (2015). formation. Nat. Cell Biol. 7, 706–711 (2005). and G2. Curr. Biol. 12, 1635–1644 (2002). 98. Nones, K. et al. Genomic catastrophes frequently arise 55. Feldser, D. M. & Greider, C. W. Short telomeres limit 75. Capper, R. et al. The nature of telomere fusion in esophageal adenocarcinoma and drive tumor progression in vivo by inducing senescence. and a definition of the critical telomere length in tumorigenesis. Nat. Commun. 5, 5224 (2014). Cancer Cell 11, 461–469 (2007). human cells. Genes Dev. 21, 2495–2508 (2007). 99. Stephens, P. J. et al. Massive genomic rearrangement 56. Kim, N. W. et al. Specific association of human 76. Oh, S. et al. DNA ligase III and DNA ligase IV carry out acquired in a single catastrophic event during cancer telomerase activity with immortal cells and cancer. genetically distinct forms of end joining in human development. Cell 144, 27–40 (2011). Science 266, 2011–2015 (1994). somatic cells. DNA Repair 21, 97–110 (2014). Reports the discovery of chromothripsis using 57. Huang, F. W. et al. Highly recurrent TERT promoter 77. Lin, T. T. et al. Telomere dysfunction and fusion next-generation sequencing. mutations in human melanoma. Science 339, during the progression of chronic lymphocytic 100. Rausch, T. et al. Genome sequencing of pediatric 957–959 (2013). leukemia: evidence for a telomere crisis. Blood 116, medulloblastoma links catastrophic DNA Uses whole-genome sequencing in melanomas to 1899–1907 (2010). rearrangements with TP53 mutations. Cell 148, identify activating mutations in the TERT promoter. Shows that telomere shortening and fusions in 59–71 (2012). 58. Horn, S. et al. TERT promoter mutations in familial CLL increase with advanced disease and correlate 101. Jones, M. J. K. & Jallepalli, P. V. Chromothripsis: and sporadic melanoma. Science 339, 959–961 with large-scale genome rearrangements. chromosomes in crisis. Dev. Cell 23, 917 (2012). (2013). 78. Jones, R. E. et al. Escape from telomere-driven crisis 102. Garsed, D. W. et al. The architecture and evolution Identifies activating mutations in the TERT is DNA ligase III dependent. Cell Rep. 8, 1063–1076 of cancer neochromosomes. Cancer Cell 26, 653–667 promoter through an analysis of melanoma-prone (2014). (2014). families. 79. Maser, R. S. et al. DNA-dependent protein kinase 103. Lopez, V. et al. Cytokinesis breaks dicentric 59. Beroukhim, R. et al. The landscape of somatic catalytic subunit is not required for dysfunctional chromosomes preferentially at pericentromeric copy‑number alteration across human cancers. telomere fusion and checkpoint response in the regions and telomere fusions. Genes Dev. 29, Nature 463, 899–905 (2010). telomerase-deficient mouse. Mol. Cell. Biol. 27, 322–336 (2015). 60. Peifer, M. et al. Telomerase activation by genomic 2253–2265 (2007). 104. Pampalona, J. et al. Chromosome bridges maintain rearrangements in high-risk neuroblastoma. Nature 80. Roger, L. et al. Extensive telomere erosion in the kinetochore–microtubule attachment throughout 526, 700–704 (2015). initiation of colorectal adenomas and its association mitosis and rarely break during anaphase. PLoS ONE 61. Valentijn, L. J. et al. TERT rearrangements are with chromosomal instability. J. Natl Cancer Inst. 105, 11, e0147420 (2016). frequent in neuroblastoma and identify aggressive 1202–1211 (2013). 105. Vargas, J. D., Hatch, E. M., Anderson, D. J. tumors. Nat. Genet. 47, 1411–1414 (2015). 81. Celli, G. B. & de Lange, T. DNA processing is not & Hetzer, M. W. Transient nuclear envelope rupturing 62. Robles-Espinoza, C. D. et al. POT1 loss‑of‑function required for ATM-mediated telomere damage during interphase in human cancer cells. Nucleus 3, variants predispose to familial melanoma. Nat. Genet. response after TRF2 deletion. Nat. Cell Biol. 7, 88–100 (2012). 46, 478–481 (2014). 712–718 (2005). 106. Hatch, E. M., Fischer, A. H., Deerinck, T. J. & Links germline, loss-of-function variants of 82. Celli, G. B., Denchi, E. L. & de Lange, T. Ku70 Hetzer, M. W. Catastrophic nuclear envelope collapse POT1 to melanoma susceptibility and increased stimulates fusion of dysfunctional telomeres yet in cancer cell micronuclei. Cell 154, 47–60 (2013). telomere length. protects chromosome ends from homologous 107. Guelen, L. et al. Domain organization of human 63. Shi, J. et al. Rare missense variants in POT1 recombination. Nat. Cell Biol. 8, 885–890 (2006). chromosomes revealed by mapping of nuclear lamina predispose to familial cutaneous malignant melanoma. 83. Riboni, R. et al. Telomeric fusions in cultured human interactions. Nature 453, 948–951 (2008). Nat. Genet. 46, 482–486 (2014). fibroblasts as a source of genomic instability. 108. Raab, M. et al. ESCRT III repairs nuclear envelope Reports the identification of unrelated, Cancer Genet. Cytogenet. 95, 130–136 (1997). ruptures during cell migration to limit DNA damage melanoma-prone families that carry variants 84. McClintock, B. The behavior in successive nuclear and cell death. Science 352, 7611–7362 (2016). of POT1 and show increased telomere lengths. divisions of a chromosome broken at meiosis. 109. Denais, C. M. et al. Nuclear envelope rupture and 64. Pinzaru, A. M. et al. Telomere replication stress Proc. Natl Acad. Sci. USA 25, 405–416 (1939). repair during cancer cell migration. Science 352, 1–8 induced by POT1 inactivation accelerates 85. Gisselsson, D. et al. Chromosomal breakage- (2016). tumorigenesis. Cell Rep. 15, 2170–2184 (2016). fusion‑bridge events cause genetic intratumor 110. Lindahl, T., Gally, J. A. & Edelman, G. M. Properties of 65. Machiela, M. J. et al. Genetic variants associated heterogeneity. Proc. Natl Acad. Sci. USA 97, deoxyribonuclease 3 from mammalian tissues. J. Biol. with longer telomere length are associated with 5357–5362 (2000). Chem. 244, 5014–5019 (1969). increased lung cancer risk among never-smoking 86. Murnane, J. P. Telomeres and chromosome instability. 111. Höss, M. et al. A human DNA editing enzyme women in Asia: a report from the female lung cancer DNA Repair 5, 1082–1092 (2006). homologous to the Escherichia coli DnaQ/MutD consortium in Asia. Int. J. Cancer 137, 311–319 87. Llorente, B., Smith, C. E. & Symington, L. S. protein. EMBO J. 18, 3868–3875 (1999). (2015). Break‑induced replication: what is it and what is it for? 112. Mazur, D. J. & Perrino, F. W. Structure and expression Assesses telomere length using telomere Cell Cycle 7, 859–864 (2008). of the TREX1 and TREX2 3ʹ−5ʹ exonuclease genes. length-associated single-nucleotide 88. Anand, R. P., Lovett, S. T. & Haber, J. E. Break-induced J. Biol. Chem. 276, 14718–14727 (2001). polymorphisms and finds that longer telomere DNA replication. Cold Spring Harb. Perspect. Biol. 5, 113. Rice, G. I., Rodero, M. P. & Crow, Y. J. Human disease length is associated with increased risk of a010397 (2013). phenotypes associated with mutations in TREX1. non-Hodgkin lymphoma. 89. Shih, I. M. et al. Evidence that genetic instability J. Clin. Immunol. 35, 235–243 (2015). 66. Machiela, M. J. et al. Genetically predicted longer occurs at an early stage of colorectal tumorigenesis. 114. Gisselsson, D. et al. Telomere dysfunction triggers telomere length is associated with increased risk Cancer Res. 61, 818–822 (2001). extensive DNA fragmentation and evolution of of B‑cell lymphoma subtypes. Hum. Mol. Genet. 25, 90. Liddiard, K. et al. Sister chromatid telomere fusions, complex chromosome abnormalities in human 1663–1676 (2016). but not NHEJ-mediated inter-chromosomal telomere malignant tumors. Proc. Natl Acad. Sci. USA 98, 67. Ojha, J. et al. Genetic variation associated with longer fusions, occur independently of DNA ligases 3 and 4. 12683–12688 (2001). telomere length increases risk of chronic lymphocytic Genome Res. 26, 588–600 (2016). 115. Crasta, K. et al. DNA breaks and chromosome leukemia. Cancer Epidemiol. Biomarkers Prev. 25, Uses single molecule analysis to demonstrate pulverization from errors in mitosis. Nature 482, 1043–1049 (2016). that a single dysfunctional telomere can fuse 53–58 (2012). Shows that an inherited predisposition for longer with diverse non-telomeric loci. 116. Zhang, C.‑Z. et al. Chromothripsis from DNA damage telomeres is associated with an increased risk 91. Li, Y. et al. Constitutional and somatic rearrangement in micronuclei. Nature 522, 179–184 (2015). of CLL. of chromosome 21 in acute lymphoblastic leukaemia. 117. Santaguida, S., Tighe, A., D’Alise, A. M., Taylor, S. S. 68. Mangino, M. et al. Genome-wide meta-analysis points Nature 508, 102 (2014). & Musacchio, A. Dissecting the role of MPS1 in to CTC1 and ZNF676 as genes regulating telomere Uses whole-genome sequencing to show that, in chromosome biorientation and the spindle checkpoint homeostasis in humans. Hum. Mol. Genet. 21, leukaemia, dicentric chromosomes formed by through the small molecule inhibitor reversine. J. Cell 5385–5394 (2012). telomere fusion or a Robertsonian translocation Biol. 190, 73–87 (2010). 69. Walsh, K. M. et al. Variants near TERT and TERC may precipitate chromothripsis. 118. Mardin, B. R. et al. A cell-based model system links influencing telomere length are associated with high- 92. Lo, A. W. I. et al. DNA amplification by breakage/ chromothripsis with hyperploidy. Mol. Syst. Biol. 11, grade glioma risk. Nat. Genet. 46, 731–735 (2014). fusion/bridge cycles initiated by spontaneous telomere 828–828 (2015). 70. Rode, L., Nordestgaard, B. G. & Bojesen, S. E. Long loss in a human cancer cell line. Neoplasia 4, 119. Nik-Zainal, S. et al. Mutational processes molding the telomeres and cancer risk among 95 568 individuals 531–538 (2002). genomes of 21 breast cancers. Cell 149, 979–993 from the general population. Int. J. Epidemiol. 45, 93. Ma, C., Martin, S., Trask, B. & Hamlin, J. L. Sister (2012). 1634–1643 (2016). chromatid fusion initiates amplification of the 120. Roberts, S. A. et al. Clustered mutations in yeast and 71. Hayashi, M. T., Cesare, A. J., Fitzpatrick, J. A. J., dihydrofolate reductase gene in Chinese hamster cells. in human cancers can arise from damaged long single- Lazzerini Denchi, E. & Karlseder, J. A telomere- Genes Dev. 7, 605–620 (1993). strand DNA regions. Mol. Cell 46, 424–435 (2012). dependent DNA damage checkpoint induced by 94. Smith, K. A., Gorman, P. A., Stark, M. B., Groves, R. P. 121. Roberts, S. A. et al. An APOBEC cytidine deaminase prolonged mitotic arrest. Nat. Struct. Mol. Biol. 19, & Stark, G. R. Distinctive chromosomal structures are mutagenesis pattern is widespread in human cancers. 387–394 (2012). formed very early in the amplification of CAD genes Nat. Genet. 45, 970–976 (2013). 72. Hayashi, M. T., Cesare, A. J., Rivera, T. & Karlseder, J. in Syrian hamster cells. Cell 63, 1219–1227 (1990). 122. Chan, K. et al. An APOBEC3A hypermutation Cell death during crisis is mediated by mitotic 95. Bignell, G. R. et al. Architectures of somatic signature is distinguishable from the signature of telomere deprotection. Nature 522, 492–496 genomic rearrangement in human cancer amplicons background mutagenesis by APOBEC3B in human (2015). at sequence-level resolution. Genome Res. 17, cancers. Nat. Genet. 47, 1067–1072 (2015). 73. Boboila, C., Alt, F. W. & Schwer, B. Classical and 1296–1303 (2007). 123. Harris, R. S., Petersen-Mahrt, S. K. & alternative end-joining pathways for repair of 96. Campbell, P. J. et al. The patterns and dynamics of Neuberger, M. S. RNA editing enzyme APOBEC1 lymphocyte-specific and general DNA double-strand genomic instability in metastatic pancreatic cancer. and some of its homologs can act as DNA mutators. breaks. Adv. Immunol. 116, 1–49 (2012). Nature 467, 1113 (2010). Mol. Cell 10, 1247–1253 (2002).

NATURE REVIEWS | MOLECULAR CELL BIOLOGY VOLUME 18 | MARCH 2017 | 185 ©2017 Mac millan Publishers Li mited, part of Spri nger Nature. All ri ghts reserved. ©2017 Mac millan Publishers Li mited, part of Spri nger Nature. All ri ghts reserved.

REVIEWS

124. Harris, R. S. & Dudley, J. P. APOBECs and virus 147. Meeker, A. K. et al. Telomere shortening occurs in 167. Eckel-Passow, J. E. et al. Glioma groups based on restriction. Virology 480, 131–145 (2015). subsets of normal breast epithelium as well as in situ 1p/19q, IDH, and TERT promoter mutations in tumors. 125. Davoli, T. & de Lange, T. The causes and consequences and invasive carcinoma. Am. J. Pathol. 164, 925–935 N. Engl. J. Med. 372, 2499–2508 (2015). of polyploidy in normal development and cancer. (2004). 168. Ding, Z. et al. Telomerase reactivation following Annu. Rev. Cell Dev. Biol. 27, 585–610 (2011). 148. Herbert, B. S., Wright, W. E. & Shay, J. W. Telomerase telomere dysfunction yields murine prostate tumors 126. Shackney, S. E. et al. Model for the genetic evolution and breast cancer. Breast Cancer Res. 3, 146–149 with bone metastases. Cell 148, 896–907 (2012). of human solid tumors. Cancer Res. 49, 3344–3354 (2001). 169. Sprung, C. N., Sabatier, L. & Murnane, J. P. Telomere (1989). 149. Baird, D. M., Rowson, J., Wynford-Thomas, D. dynamics in a human cancer cell line. Exp. Cell Res. 127. Galipeau, P. C. et al. 17p (p53) allelic losses, 4N & Kipling, D. Extensive allelic variation and ultrashort 247, 29–37 (1999). (G2/tetraploid) populations, and progression to telomeres in senescent human cells. Nat. Genet. 33, 170. Fouladi, B., Sabatier, L., Miller, D., Pottier, G. & aneuploidy in Barrett’s esophagus. Proc. Natl Acad. 203–207 (2003). Murnane, J. P. The relationship between spontaneous Sci. USA 93, 7081–7084 (1996). 150. Tanaka, H. et al. Telomere fusions in early human telomere loss and chromosome instability in a human 128. Olaharski, A. J. et al. Tetraploidy and chromosomal breast carcinoma. Proc. Natl Acad. Sci. USA 109, tumor cell line. Neoplasia 2, 540–554 (2000). instability are early events during cervical 14098–14103 (2012). 171. Murnane, J. P., Sabatier, L., Marder, B. A. carcinogenesis. Carcinogenesis 27, 337–343 (2006). 151. Lin, T. T. et al. Telomere dysfunction accurately & Morgan, W. F. Telomere dynamics in an immortal 129. Zack, T. I. et al. Pan-cancer patterns of somatic copy predicts clinical outcome in chronic lymphocytic human cell line. EMBO J. 13, 4953–4962 (1994). number alteration. Nat. Genet. 45, 1134–1140 leukaemia, even in patients with early stage disease. 172. Sabatier, L., Ricoul, M., Pottier, G. & Murnane, J. P. (2013). Br. J. Haematol. 167, 223 (2014). The loss of a single telomere can result in instability 130. Nguyen, H. G. et al. Deregulated Aurora‑B induced 152. Simpson, K. et al. Telomere fusion threshold identifies of multiple chromosomes in a human tumor cell line. tetraploidy promotes tumorigenesis. FASEB J. 23, a poor prognostic subset of breast cancer patients. Mol. Cancer Res. 3, 139–150 (2005). 2741–2748 (2009). Mol. Oncol. 9, 1186–1193 (2015). 173. Gascoigne, K. E. & Cheeseman, I. M. Induced 131. Duelli, D. M. et al. A virus causes cancer by inducing 153. Heidenreich, B., Rachakonda, P. S., Hemminki, K. dicentric chromosome formation promotes genomic massive chromosomal instability through cell fusion. & Kumar, R. TERT promoter mutations in cancer rearrangements and tumorigenesis. Chromosome Res. Curr. Biol. 17, 431–437 (2007). development. Curr. Opin. Genet. Dev. 24, 30–37 21, 407–418 (2013). 132. Ganem, N. J., Storchová, Z. & Pellman, D. Tetraploidy, (2014). 174. Baca, S. C. et al. Punctuated evolution of prostate aneuploidy and cancer. Curr. Opin. Genet. Dev. 17, 154. Killela, P. J. et al. TERT promoter mutations occur cancer genomes. Cell 153, 666–677 (2013). 157–162 (2007). frequently in gliomas and a subset of tumors derived 175. Palm, W. & de Lange, T. How shelterin protects 133. Fujiwara, T. et al. Cytokinesis failure generating from cells with low rates of self-renewal. Proc. Natl mammalian telomeres. Annu. Rev. Genet. 42, tetraploids promotes tumorigenesis in p53‑null cells. Acad. Sci. USA 110, 6026 (2013). 301–334 (2008). Nature 437, 1043–1047 (2005). 155. Kinde, I. et al. TERT promoter mutations occur early 176. Schmutz, I. & de Lange, T. Shelterin. Curr. Biol. 26, 134. Dewhurst, S. M. et al. Tolerance of whole-genome in urothelial neoplasia and are biomarkers of early R397–R399 (2016). doubling propagates chromosomal instability and disease and disease recurrence in urine. Cancer Res. 177. Lazzerini Denchi, E. & Sfeir, A. Stop pulling my strings accelerates cancer genome evolution. Cancer Discov. 73, 7162–7167 (2013). — what telomeres taught us about the DNA damage 4, 175–185 (2014). 156. Remke, M. et al. TERT promoter mutations are highly response. Nat. Rev. Mol. Cell Biol. 17, 364–378 135. de Lange, T. et al. Structure and variability of human recurrent in SHH subgroup medulloblastoma. (2016). chromosome ends. Mol. Cell. Biol. 10, 518–527 Acta Neuropathol. 126, 917–929 (2013). 178. Xin, H. et al. TPP1 is a homologue of ciliate TEBP-β (1990). 157. Quaas, A. et al. Frequency of TERT promoter and interacts with POT1 to recruit telomerase. Nature 136. Hastie, N. D. et al. Telomere reduction in human mutations in primary tumors of the liver. 445, 559–562 (2007). colorectal carcinoma and with ageing. Nature 346, Virchows Arch. 465, 673–677 (2014). 179. Nandakumar, J. et al. The TEL patch of telomere 866–868 (1990). 158. Weinhold, N., Jacobsen, A., Schultz, N., Sander, C. protein TPP1 mediates telomerase recruitment 137. Furugori, E. et al. Telomere shortening in gastric & Lee, W. Genome-wide analysis of noncoding and processivity. Nature 492, 285–289 (2013). carcinoma with aging despite telomerase activation. regulatory mutations in cancer. Nat. Genet. 46, 180. Nandakumar, J. & Cech, T. R. Finding the end: J. Cancer Res. Clin. Oncol. 126, 481–485 (2000). 1160–1165 (2014). recruitment of telomerase to telomeres. Nat. Rev. Mol. 138. Mehle, C., Ljungberg, B. & Roos, G. Telomere 159. Borah, S. et al. TERT promoter mutations and Cell Biol. 14, 69–82 (2013). shortening in renal cell carcinoma. Cancer Res. 54, telomerase reactivation in urothelial cancer. Science 181. Sexton, A. N. et al. Genetic and molecular 236–241 (1994). 347, 1006–1010 (2015). identification of three human TPP1 functions in 139. Takagi, S. et al. Telomere shortening and the 160. Bell, R. J. A. et al. The transcription factor GABP telomerase action: recruitment, activation, and clinicopathologic characteristics of human colorectal selectively binds and activates the mutant TERT homeostasis set point regulation. Genes Dev. 28, carcinomas. Cancer 86, 1431–1436 (1999). promoter in cancer. Science 348, 1036–1039 1885–1899 (2014). 140. Sommerfeld, H. J. et al. Telomerase activity: (2015). 182. Abreu, E. et al. TIN2‑tethered TPP1 recruits human a prevalent marker of malignant human prostate 161. Pickett, H. A. & Reddel, R. R. Molecular mechanisms telomerase to telomeres in vivo. Mol. Cell. Biol. 30, tissue. Cancer Res. 56, 218–222 (1996). of activity and derepression of alternative lengthening 2971–2982 (2010). 141. Meeker, A. K. et al. Telomere shortening is an early of telomeres. Nat. Struct. Mol. Biol. 22, 875–880 183. Frank, A. K. et al. The shelterin TIN2 subunit mediates somatic DNA alteration in human prostate (2015). recruitment of telomerase to telomeres. PLoS Genet. tumorigenesis. Cancer Res. 62, 6405–6409 (2002). 162. Lovejoy, C. A. et al. Loss of ATRX, genome instability, 11, e1005410 (2015). 142. Meeker, A. K. et al. Telomere length abnormalities and an altered DNA damage response are hallmarks 184. Greider, C. W. Regulating telomere length from the occur early in the initiation of epithelial carcinogenesis. of the alternative lengthening of telomeres pathway. inside out: the replication fork model. Genes Dev. 30, Clin. Cancer Res. 10, 3317–3326 (2004). PLoS Genet. 8, e1002772 (2012). 1483–1491 (2016). 143. Clarke, D. J., Johnson, R. T. & Downes, C. S. 163. Schwartzentruber, J. et al. Driver mutations in 185. Smogorzewska, A. & de Lange, T. Regulation of Topoisomerase II inhibition prevents anaphase histone H3.3 and chromatin remodelling genes telomerase by telomeric proteins. Annu. Rev. Biochem. chromatid segregation in mammalian cells in paediatric glioblastoma. Nature 482, 226–231 73, 177–208 (2004). independently of the generation of DNA strand (2012). breaks. J. Cell Sci. 105, 563–569 (1993). 164. Heaphy, C. M. et al. Altered telomeres in tumors with Acknowledgements 144. Hauf, S., Waizenegger, I. C. & Peters, J. M. Cohesin ATRX and DAXX mutations. Science 333, 425 (2011). The authors thank S. Yu and the de Lange laboratory for cleavage by separase required for anaphase and 165. Heaphy, C. M. et al. Prevalence of the alternative discussions and help with this manuscript. The authors’ work cytokinesis in human cells. Science 293, 1320–1323 lengthening of telomeres telomere maintenance is supported by grants from the US National Institutes (2001). mechanism in human cancer subtypes. Am. J. Pathol. of Health (CA181090, AG016642 and K99CA212290), 145. Chin, K. et al. In situ analyses of genome instability 179, 1608–1615 (2011). the STARR Cancer Consortium and the Breast Cancer in breast cancer. Nat. Genet. 36, 984–988 (2004). 166. Ceccarelli, M. et al. Molecular profiling reveals Research Foundation. 146. O’Connell, P. et al. Analysis of loss of heterozygosity biologically discrete subsets and pathways of in 399 premalignant breast lesions at 15 genetic loci. progression in diffuse glioma. Cell 164, 550–563 Competing interests statement J. Natl Cancer Inst. 90, 697–703 (1998). (2016). The authors declare no competing interests.

186 | MARCH 2017 | VOLUME 18 www.nature.com/nrm ©2017 Mac millan Publishers Li mited, part of Spri nger Nature. All ri ghts reserved.