bioRxiv preprint doi: https://doi.org/10.1101/514570; this version posted January 8, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 Title Page 2 3 Title: WNT/β-CATENIN modulates the axial identity of ES derived human neural crest 4 5 Running title 6 WNT modulates neural crest axial identity

7 8 Authors 9 Gustavo A. Gomez, Maneeshi S. Prasad, Man Wong, Rebekah M. Charney, Patrick B. Shelar, 10 Nabjot Sandhu, James O.S. Hackland, Jacqueline C. Hernandez, Alan W. Leung, Martín I. García- 11 Castro* 12 13 Affiliation 14 School of Medicine Division of Biomedical Sciences, University of California, Riverside, CA 92521, 15 USA 16 * Corresponding Author. E-mail address: [email protected] (M.I. García-Castro) 17 18 ABSTRACT 19 The WNT/β-CATENIN pathway is critical for neural crest (NC) formation. However, the effects of the 20 magnitude of the signal remains poorly defined. Here we evaluate the consequences of WNT 21 magnitude variation in a robust model of human NC formation. This model is based on human 22 embryonic stem cells induced by WNT signaling through the small molecule CHIR9902. In addition 23 to its known effect on NC formation, we find that the WNT signal modulates the anterior-posterior 24 axial identity of NCCs in a dose dependent manner, with low WNT leading to anterior OTX+, HOX- 25 NC, and high WNT leading to posterior OTX-, HOX+ NC. Differentiation tests of posterior NC confirm 26 expected derivatives including posterior specific adrenal derivatives, and display partial capacity to 27 generate anterior ectomesenchymal derivatives. Furthermore, unlike anterior NC, posterior NC 28 transit through a TBXT+/SOX2+ neuromesodermal precursor-like intermediate. Finally, we analyze 29 the contributions of other signaling pathways in posterior NC formation, and suggest a critical role for 30 FGF in survival/proliferation, and a requirement of BMP for NC maturation. As expected RA and 31 FGF are able to modulate HOX expression in the posterior NC, but surprisingly, RA supplementation 32 prohibits anterior, but only reduces, posterior NC formation. This work reveals for the first time that 33 the amplitude of WNT signaling can modulate the axial identity of NC cells in humans. 34 bioRxiv preprint doi: https://doi.org/10.1101/514570; this version posted January 8, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

35 KEY WORDS: neural crest, WNT dosage/magnitude, anterior-posterior axis, HOX genes, 36 human embryonic stem cells. 37 38 INTRODUCTION 39 Neural crest cells (NCCs) are multipotent embryonic cells that are exclusive to vertebrates, 40 and are endowed with a bewildering differentiation potential enabling them to form peripheral 41 neurons and glia, craniofacial bone and cartilage, and sympathoadrenal secretory cells, amongst 42 other derivatives. During development, expression of early NC markers can be observed above the 43 mesoderm, between the non-neural ectoderm (prospective epidermis) and neural plate (prospective 44 CNS). Then NCCs become transiently incorporated into the dorsal aspect of the neural tube, 45 undergo an epithelial-to-mesenchymal transition, delaminate, and emerge as migratory 46 mesenchymal cells that follow stereotypical paths, and finally differentiate near their final locations. 47 The potential of NCCs to generate terminal derivatives appears to be restricted by their antero- 48 posterior origin, with anterior NCCs contributing to ecto-mesenchymal derivatives, while both 49 anterior and posterior NCCs generate melanoblasts, peripheral neurons, and glia. Given the wide 50 range of derivatives that NC contribute to our bodies, it is not surprising that they are at the root of 51 many taxing pathologies globally known as neurocristopathies. 52 NCCs are thought to arise through a classic induction event between neural and non-neural 53 ectoderm, and/or mesoderm and ectoderm, reviewed in (Pla and Monsoro-Burq, 2018; Stuhlmiller 54 and García-Castro, 2012a). However, studies in chick and rabbit point to NC specification during 55 gastrulation, and at least for early anterior NC, were shown to be independent of ectodermal and/or 56 mesodermal contribution (Basch et al., 2006; Betters et al., 2018; Patthey et al., 2009). In Xenopus, 57 while some studies have also alluded to the induction of NC during gastrulation (Li et al., 2009; 58 Mancilla and Mayor, 1996), a recent study instead proposes that NC are not induced, but instead are 59 a lineage that retains the plasticity and core regulatory mechanisms of pluripotent epiblast/stem cells 60 (Buitrago-Delgado et al., 2015). Overwhelming evidence in various model organisms has supported 61 the participation of multiple signaling pathways during early stages of NC development (Pla and 62 Monsoro-Burq, 2018; Stuhlmiller and García-Castro, 2012a). However, the specific roles of these 63 signals in human NC development remains unresolved, despite their significance to health-related 64 issues. 65 Efforts to study NC development in human embryos remain limited (Betters et al., 2010; 66 O’Rahilly and Müller, 2007), due to ethical and technical obstacles. However, a powerful alternative 67 emerged through the use of models of NC based on human embryonic stem cells (hESCs) (Pomp et 68 al., 2005). Initial efforts relied on co-cultures, the use of serum or serum replacement cocktails, and 69 either embryoid bodies or neural rosettes (Bajpai et al., 2010; Brokhman et al., 2008; Curchoe et al., 70 2010; Jiang et al., 2009; Lee et al., 2007; Liu et al., 2012; Rada-Iglesias et al., 2012; Sparks et al., bioRxiv preprint doi: https://doi.org/10.1101/514570; this version posted January 8, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

71 2018). Simpler models where cell density was controlled along with defined media components have 72 enabled a better analysis of contributing factors during human NC development from hESCs (Fukuta 73 et al., 2014; Hackland et al., 2017; Huang et al., 2016; Leung et al., 2016; Menendez et al., 2011). 74 Common to these and other models of NC development is the activation of the WNT/β-CATENIN 75 signaling pathway (Chambers et al., 2012; Fukuta et al., 2014; Hackland et al., 2017; Leung et al., 76 2016; Menendez et al., 2011; Mica et al., 2013), which recapitulates WNT’s known role in NC 77 induction in model organisms (Garcıa-Castro et al., 2002; LaBonne and Bronner-Fraser, 1998; Lewis 78 et al., 2004). 79 The WNT/β-CATENIN pathway ultimately results in the accumulation of β-CATENIN in the 80 nucleus where it modulates the expression of targets of the WNT/β-CATENIN pathway through 81 interactions with transcription factors of the TCF/LEF family (reviewed in (de Jaime-Soguero et al., 82 2018; Nelson and Nusse, 2004). It is noteworthy that WNT/β-CATENIN plays many roles throughout 83 development including early embryonic anterior-posterior axis specification (Loh et al., 2016; 84 Petersen and Reddien, 2009), cellular proliferation (Niehrs and Acebron, 2012), and participates in 85 the formation of neurons, hair cells, mesoderm, and many others cell types (Grigoryan et al., 2008). 86 In hESCs, activation of the WNT/β-CATENIN pathway is known to promote differentiation of 87 endoderm (Naujok et al., 2014), cardiomyocytes (Lian et al., 2012), endothelial cells (Lian et al., 88 2014), and serotonergic neurons (Kirkeby et al., 2012; Lu et al., 2016), amongst others. Such 89 different effects are thought to be triggered by the specific “context” of the signals and responsive 90 cell, which includes additional transcription factors that cooperate with β-CATENIN, epigenetic 91 signals and modulators, and cross-talk with other signaling pathways (Masuda and Ishitani, 2017). 92 Other parameters associated with WNT/β-CATENIN signaling such as the magnitude of the 93 signal and duration are also thought to contribute important inputs to the multifactorial process 94 required to deliver specific output responses of the pathway (Goentoro and Kirschner, 2009; Lee et 95 al., 2003; Rogers and Schier, 2011; Tan et al., 2012). Interestingly, while a role for WNT/β-CATENIN 96 signaling in NC development is well established, our understanding of the effects of time and dosage 97 of the signal in neural crest development remain very limited. 98 In this study, we investigate the effects caused by the magnitude of the WNT signal during 99 human NC formation. We unveil a double bell curve of NC formation mediated by the magnitude of 100 the WNT/β-CATENIN signal, with low and high concentrations leading to anterior and posterior NC 101 formation, respectively. Increasing signal imposes a posterior character in NCCs, as revealed by the 102 induction of posterior identity HOX genes. Interestingly, these posterior NCCs display a mixed 103 differentiation potential, generating peripheral neurons, glia, melanoblasts, in addition to osteoblasts, 104 but unlike anterior NCCs, were not able to differentiate into chondrocytes and adipocytes. Through 105 further interrogation of the formation of posterior NCCs, we find that BMP is required for the bioRxiv preprint doi: https://doi.org/10.1101/514570; this version posted January 8, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

106 generation of posterior NCCs, while FGF signaling appears to regulate proliferation/survival but not 107 the formation of posterior NCCs. Finally, FGF and RA signaling modulate axial character and the 108 expression of HOX genes within posterior NCCs. Together this work demonstrates that modulation 109 of the WNT/β-CATENIN signal promotes the formation of NCCs endowed with different anterior- 110 posterior characteristics. 111 112 RESULTS 113 A bimodal wave of NC formation is produced by increasing the magnitude of WNT signaling 114 We previously reported an effective model of human NC formation that generates anterior 115 NCCs (Leung et al., 2016). In this model, hESCs subjected for 5 days to the WNT agonist 116 CHIR99021 (CHIR) generate >60% cells expressing a wide battery of NC markers, display anterior 117 character, and are able to differentiate into NC-terminal derivatives (Leung et al., 2016). More 118 recently, we explored the effects of temporal variations of the inductive WNT signal on NC formation, 119 and reported that a pulse of CHIR for 2 days, during the start of the differentiation from hESC, leads 120 to a slightly better anterior NC induction rate than the 5-day treatment (G.A.Gomez et al, submitted). 121 To further explore the effect of the magnitude of the WNT signal, we began by assessing the effect 122 of different concentrations of CHIR delivered during the first two days of our NC formation protocol. 123 We initially tested 24 concentrations in 0.5µM increments ranging from 0 to 12µM CHIR, delivered 124 for the first 2 days of the 5 day NC protocol. Fixed cells were then analyzed by immunofluorescence 125 for PAX7 and SOX10. We found high PAX7 and SOX10 expression in cultures receiving 2.5 to 126 3.5µM CHIR, with reduced levels from 4 to 6μM CHIR, and increasing levels for both markers from 127 6.5 to 9µM CHIR, followed by sustained high levels of NC markers from 9.5 to 12µM CHIR (Fig. 1A, 128 and data not shown). Tests with 15 µM CHIR displayed no signal for either PAX7 or SOX10 under 129 these conditions, while few cells survived at 20 and 30µM CHIR (data not shown). These results 130 suggest that under our culture conditions, WNT signaling can trigger efficient NC formation from 131 hESCs at a low dosage, near ~3 µM (2.5 to 3.5 µM) and at a high dosage around ~10µM (7 to 12 132 µM), while intermediate doses between these ranges, or at and above 15µM, do not produce NC. 133 PAX6 has been associated with neuroectoderm fate determination (Zhang et al., 2010). We 134 previously found that during anterior NC formation, cells do not co-express or require PAX6 (Leung 135 et al., 2016). Similarly, SOX10+ NC generated by the 2-day NC protocol with 3, 8 or 10 µM CHIR do 136 not co-express PAX6; however, robust PAX6 expression is seen following transient administration of 137 4 through 6µM CHIR (Fig. 1B, and data not shown), suggesting a switch from NCCs to neural 138 ectoderm progenitors between the low and intermediate levels of WNT activity. 139 To compare the cells generated by low and high WNT activation, we evaluated the 140 percentage of nuclei positively stained for PAX7 and SOX10 at optimal CHIR doses. As reported bioRxiv preprint doi: https://doi.org/10.1101/514570; this version posted January 8, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

141 before, low WNT (3µM CHIR) leads to robust expression of both markers. However, treatment with 142 high WNT (10μM CHIR) results in increments of 10% PAX7+ and 20% SOX10+ nuclei relative to low 143 WNT (3μM CHIR) treatment (Fig. 1C). Reverse transcriptase quantitative PCR (RT-qPCR) analysis 144 of NC genes PAX7, SNAI2, ZIC1, ETS1, FOXD3, and SOX10 were more strongly expressed 145 following the high CHIR (10µM) dose, further suggesting more efficient NC formation with increased 146 magnitude of WNT activation (Fig. 1D). Given these results, we refer to CHIR treatments as low and 147 high WNT for 3µM and 10µM respectively throughout the rest of the manuscript. 148 149 The magnitude of WNT signal dictates axial identity of NCCs 150 Increased levels of WNT/β-CATENIN signaling has been shown to impart a posterior 151 character to multiple cell types (Greco et al., 1996; Kiecker and Niehrs, 2001; Kim et al., 2000; 152 Nordström et al., 2002). Therefore, we examined the axial identity of the NCCs induced by low or 153 high WNT. First, we evaluated expression of genes associated with anterior NC territories OTX2 and 154 DMBX1 by RT-qPCR on day 5. Both genes are induced by low WNT treatment, however, both are 155 considerably repressed in cells exposed to high WNT (Fig. 1D). In agreement with our results, 156 elevated WNT signaling has been shown to result in the downregulation of OTX2 in neural ectoderm 157 (Kudoh et al., 2002; McGrew et al., 1997). Given the possible posteriorizing role of WNT, and the 158 lack of anterior markers OTX2/DMBX1, we decided to assess the expression of posterior HOX 159 genes. We found heterogenous but definite expression of HOXB4 by immunofluorescence in high, 160 but not low, WNT conditions (Fig. 1E). 161 To further examine the modulation of posterior character of the NCCs generated by different 162 doses of WNT, we monitored the transcriptional profile of various HOX genes, HOXB1, HOXB2, 163 HOXB4 and HOXC9 by RT-qPCR. Expression of relatively more anterior HOX genes, HOXB1 and 164 HOXB2 were detected at a concentration of 4μM CHIR with amplitude levels increasing as the dose 165 of CHIR is raised (Fig. 1F). By contrast, HOXB4 first appeared at 7μM CHIR and gradually 166 diminishes as the concentration of CHIR is raised, while HOXC9 appears at 8μM CHIR and 167 increases thereafter (Fig. 1F). Thus, the degree of NC posteriorization is dependent on the 168 magnitude of the WNT stimulus. 169 In agreement with our previous findings, NCCs generated under low WNT treatment (3 µM 170 CHIR) display an anterior NC character (Leung et al., 2016). The down-regulation of anterior genes 171 and up-regulation of posterior HOX genes in NCCs generated with WNT shows that an increased 172 dosage of CHIR can posteriorize the NC population. Hereafter we refer to anterior NC as those 173 derived from low WNT treatment and posterior NC as those generated from high WNT treatment. 174 175 The transition from hESC to NC is accelerated in posterior NCCs bioRxiv preprint doi: https://doi.org/10.1101/514570; this version posted January 8, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

176 To better characterize the NC generated with a high WNT dosage, we next explored their 177 differentiation kinetics. To this end, we induced anterior and posterior NCCs, and analyzed the daily 178 acquisition of PAX7 and SOX10. Few SOX10 positive cells appear from day 3 onwards in both 179 conditions (Fig. 1G). However, PAX7 is expressed more robustly on day 3 in posterior NCCs. RT- 180 qPCR analysis of corresponding conditions reveals that in posterior NCCs, other neural plate border 181 specifier genes, PAX3 and MSX1 (Pla and Monsoro-Burq, 2018; Stuhlmiller and García-Castro, 182 2012a), are expressed above basal levels on day 2, a whole 24 hours before their expression is 183 seen in anterior NCCs (Fig. 1H, top row). Thus, increasing the levels of WNT activation to 10μM 184 CHIR leads to a slightly accelerated acquisition of the NC program, but similar to anterior NCCs, the 185 full NC profile arises after 5 days of differentiation. 186 We then evaluated whether posterior NCCs exit the pluripotent state at a similar time as 187 anterior NCCs do. Transcriptional time-course analysis of core pluripotency markers OCT4, NANOG, 188 KLF4 and SOX2 was assessed by RT-qPCR. OCT4 and NANOG follow the same downward trend 189 in both populations, but they are repressed faster in posterior NCCs (Fig. 1H, bottom row). By 190 contrast KLF4 and SOX2 undergo different trajectories. While KLF4 remains unchanged in anterior 191 NCCs through the 5 days, a surge of KLF4 is induced by high WNT on day 1 in posterior NCCs that 192 is diminished below levels seen in hESCs from day 2 onwards. Conversely, SOX2 expression is 193 increased over 2-fold in anterior NCCs during the first 2 days, while in posterior NCCs, SOX2 only 194 rises about 1.5-fold. Overall, we find that hESCs respond to higher WNT stimulus by altering the 195 pluripotency status sooner than when treated with the lower WNT stimulus. 196 To confirm our expectation of elevated canonical WNT activity by high WNT treatment, we 197 monitored the expression of direct targets of β-catenin, SP5 and AXIN2 (Jho et al., 2002; Park et al., 198 2013). The levels of both genes were clearly induced to higher levels during the first 2 days in 10μM 199 over 3µM CHIR treatment. However, at day 3, once CHIR was removed from both conditions, a 200 surprising reversal occurred and stronger levels of AXIN2 and SP5 are seen in 3µM CHIR. (Fig. 1H, 201 last column). Interestingly, it is clear that this higher level of WNT responsive targets from day 3 202 onwards is associated with a lower level of expression of NC-markers in anterior NCCs than 203 posterior NCCs. Therefore, the transient and early high dosage of CHIR (0-2 days), correlates with 204 robust NC formation, as seen by PAX7 and SOX10 immunofluorescence and RT-QPCR for multiple 205 NC markers, along with the expression of WNT response targets. Together these results suggest 206 that a transient strong activation of the canonical WNT/β-catenin pathway during the early facet of 207 differentiation is critical to the robust formation of posterior NCCs. 208 209 Posterior NC induced with high WNT can differentiate into posterior terminal derivatives, and 210 display a partial capacity to contribute to anterior ectomesenchymal derivatives bioRxiv preprint doi: https://doi.org/10.1101/514570; this version posted January 8, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

211 A hallmark of NCCs is their ability to generate a wide range of terminal derivatives. We 212 previously reported that anterior NCCs formed with low WNT generate expected NC-terminal 213 derivatives including melanoblasts, peripheral neurons, glia and ectomesenchymal derivatives 214 (Leung et al., 2016) and G.A.Gomez et al. submitted. We therefore evaluated whether posterior 215 NCCs induced with high WNT (10μM CHIR) can similarly produce terminal derivatives expected of 216 NCCs. We tested their potential to generate peripheral neurons, glia, melanoblasts, and 217 sympathoadrenal derivatives. Simultaneously posterior NCCs were also subjected to the 218 differentiation protocols for 4 anterior ectomesenchymal derivatives including smooth muscle, 219 osteoblasts, adipocytes, and chondrocytes, using specific differentiation protocols for each lineage 220 (Leung et al., 2016). Interestingly, NC generated with high WNT are able to differentiate into 221 peripheral neurons, glia, melanoblasts, and sympathoadrenal derivatives, and failed to generate 222 chondrocytes and adipocytes according to their suspected posterior NC character. However, 223 posterior NCCs also generated smooth muscle, and osteoblasts (Fig. 1I). These results demonstrate 224 that, similar to the anterior NCCs generated with low WNT, posterior NCCs are also multipotent. 225 However, while anterior NCCs are unable to produce sympathoadrenal derivatives, and efficiently 226 generate chondrocytes and adipocytes, posterior NCCs fail to generate the latter and readily 227 produce the former. 228 229 Posterior NCCs require a transient pulse of high WNT stimulus and express molecular 230 markers of NMP-like precursors 231 Having found that the magnitude of WNT/β-CATENIN signaling affects the axial identity of 232 NCCs produced, we tested the effect of different lengths of duration of the high WNT stimulus via 233 10µM CHIR application on NC formation. To this end, hESCs were exposed from the beginning of 234 the regimen to high WNT for 1, 2, 3, 4, or 5 days, and all were analyzed after 5 days. 235 Immunofluorescence for PAX7 and SOX10 suggest that posterior NCCs arise robustly when CHIR is 236 added for the first 2 days, but to a much lower extent if added for the first 3 days. While some PAX7 237 expressing cells appear when stimulated by high WNT for 4 days, minimal SOX10 was found after 238 just one day of treatment, or when treated for 4 or 5 days (Fig. 2A). This is further supported by 239 transcriptional output of PAX3, PAX7, FOXD3, and SOX10, which also exhibit the highest 240 expression levels with 2 days of high WNT treatment (Fig. 2B). 241 Cultures treated with high WNT for 5 days show minimal PAX7 and no SOX10 protein 242 expression, and no RT-qPCR signal for PAX7, FOXD3 and SOX10, but PAX3 transcripts were 243 readily detected. Interestingly, PAX3 is known to be strongly expressed and relevant in neural crest 244 and mesoderm development (Epstein et al., 1995; Plouhinec et al., 2014). Therefore, to explore 245 possible mesoderm fate in these cultures, we monitored the expression of other mesodermal bioRxiv preprint doi: https://doi.org/10.1101/514570; this version posted January 8, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

246 markers on a daily basis by RT-qPCR. Cultures treated with low WNT, regardless of the length of 247 exposure, produced no significant signal for TBXT, MSGN1 and TBX6, similar to High WNT cultures 248 treated for 1, 2 or 3 days. Instead, treatment with High WNT for 4 or 5 days display robust 249 expression of TBXT, MSGN1 and TBX6 (Fig. 2C). Therefore, prolonged high-WNT treatment 250 appears prohibitory for the formation of posterior NC and instead triggers the expression of genes 251 associated with a mesodermal fate. 252 Anterior NCCs produced with low WNT are generated through an intermediate state that 253 does not require nor express PAX6, and while this intermediate progenitor transiently express low 254 levels of TBXT transcripts, no protein is detected (Leung et al., 2016). Interestingly, while exploring 255 the ontogeny of high WNT posterior NCCs, we detected strong expression of TBXT mRNA and 256 protein. TBXT is a known target of WNT/β-CATENIN signaling (Yamaguchi et al., 1999), and a 257 prominent mesodermal marker, expressed robustly in the primitive streak, and in posterior 258 neuromesodermal precursors (NMPs), a stem cell population that produces posterior axial tissues 259 including spinal cord and mesoderm (Henrique et al., 2015). A distinct feature of these NMPs is their 260 co-expression of TBXT and SOX2. Evaluation of high WNT cultures at day 2 of treatment revealed 261 NMP features including mRNA expression of TBXT, MSGN1, NKX1-2, FGF8, CDX1 and CDX2, as 262 well as protein co-expression of SOX2 and TBXT (FIG. 2D-G). These results suggest that posterior 263 NCCs generated by high magnitude of WNT transiently express an NMP-like precursor profile. 264 265 BMP signaling is required for induction of posterior NCCs 266 BMP signaling is also considered a key player in the induction of NC in multiple model 267 organisms (Pla and Monsoro-Burq, 2018; Stuhlmiller and García-Castro, 2012a). Human NC 268 formation models have reported mixed and even contradictory information regarding the contribution 269 of BMP signaling. Some groups require BMP inhibition (Chambers et al., 2012; Mica et al., 2013), 270 but others found BMP inhibition dispensable for NC formation from hPSCs (Fukuta et al., 2014; 271 Huang et al., 2016; Menendez et al., 2011). By contrast, our model of anterior NC formation 272 requires BMP signaling (Leung et al., 2016). We therefore tested whether BMP signaling is also 273 required for posterior NC induction. To this end, we applied the BMP receptor inhibitor DMH1 (Hao 274 et al., 2010) throughout the 5 day posterior NC regimen (2-day high CHIR). Unlike control posterior 275 NC cultures, cells treated with 1μM or 10μM DMH1 do not display PAX7 or SOX10 (Fig. 3A). 276 Interestingly, these cultures reveal a sustained expression of HOXB4 protein by 277 immunofluorescence, suggesting the retention of a posterior character (Fig. 3A). RT-qPCR results 278 also show a reduction in expression of NC markers PAX7, ETS1, FOXD3, and SOX10 in cultures 279 treated with 1 or 10µM DMH1 for 5 days (Fig. 3C). bioRxiv preprint doi: https://doi.org/10.1101/514570; this version posted January 8, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

280 To assess an early requirement of BMP signaling during posterior-NC induction, we 281 deployed DMH1 exclusively for the first 24 hours. DMH1 at a low dose of 1μM for the first 24 hours 282 results in substantially fewer cells expressing SOX10 (Fig. 3A column4, and Fig. 3B), but neither 283 PAX7 or HOXB4 protein were reduced. Similarly, transcripts of PAX7 are not altered in this 284 condition, even though ETS1, FOXD3 and SOX10 are diminished (Fig. 3C). Instead, treatment with 285 10μM DMH1 during the first 24 hours results in a more prominent inhibition of NC, as determined by 286 reduced immunofluorescence of PAX7 and SOX10 (Fig. 3A column1 vs column5, and Fig. 3B), and 287 by transcriptional repression of PAX7, ETS1, FOXD3 and SOX10 (Fig. 3C). Concomitant with NC 288 inhibition, in this condition HOXB4 is still expressed (Fig. 3A, last column). 289 BMP inhibition is a critical instruction during neural development (Chang and Harland, 2007; 290 Linker and Stern, 2004), and is able to redirect anterior NC to neural precursors (Leung et al., 2016). 291 We therefore tested whether posterior-NC cultures were shifted to a neuronal precursor fate upon 292 BMP inhibition by measuring the expression of PAX6 and SOX1, two prominent neuronal precursor 293 genes. Cells treated with DMH1 for 5 days were evaluated by RT-qPCR, and show that compared 294 with minimal expression in 10μM CHIR, both markers are highly induced by BMP inhibition (Fig. 3, 295 right). Conversely, both PAX6 and SOX1 are mildly induced by 1 day treatment with 1μM DMH1, 296 but more definitively induced by BMP inhibition with 10μM DMH1. These results suggest that BMP 297 signaling is critical during posterior-NC formation, and its inhibition shifts the fate of the cultures 298 towards a neuronal precursor identity. 299 We further tested the temporal contribution of BMP signaling to posterior NC formation by 300 interrogating its possible requirement at later time points under the high WNT posterior-NC regimen 301 by delivering the DMH1 inhibitor for 24-hour lapses from days 1 to 2, 2 to 3, 3 to 4, and 4 to 5. 302 Similar to the BMP inhibition on day 0-1, DMH1 delivered on days 1 to 2, and 2 to 3 lead to complete 303 loss of SOX10 expression (Fig. 3D). However, the requirement for BMP was subsequently reduced, 304 since few SOX10 expressing cells emerge when DMH1 was added on days 3 to 4, and a more 305 complete restoration is seen when DMH1 is added on days 4 to 5. Instead, PAX7 expression 306 displays a different dynamic under DMH1 treatment. While cells with BMP inhibition during these 307 later time points display fewer PAX7 cells than controls, their expression is still detectable. These 308 results indicate that BMP signaling is required for posterior NC formation during the first 3 days, and 309 that its inhibition during any 24-hour window during this period is sufficient to prevent the formation 310 of mature posterior NCCs, but not enough to completely prevent the expression of markers 311 associated with earlier stages of NC development, such as PAX7. 312 313 FGF signaling plays a passive role in the induction of posterior NCCs bioRxiv preprint doi: https://doi.org/10.1101/514570; this version posted January 8, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

314 Together with WNT and BMP, the FGF signaling pathway has also been implicated in NC 315 formation (Betters et al., 2018; Leung et al., 2016; Stuhlmiller and García-Castro, 2012b; Yardley 316 and García-Castro, 2012), and FGF is also known to play an important role in axis specification, 317 particularly contributing to posteriorization (Villanueva et al., 2002). FGF signaling is thought to 318 actively promote early stages of anterior NC specification (Leung et al., 2016; Stuhlmiller and 319 García-Castro, 2012b), but has been proposed to play a passive role in the appearance of posterior 320 NCCs (Martínez-Morales et al., 2011). 321 To determine whether FGF signaling is required for posterior NC induction, we exposed high 322 WNT cultures to 0.2μM or 2μM of PD173074 (PD17) (Bansal et al., 2003), a potent FGF receptor 323 inhibitor for 5 days. Compared with posterior NCCs generated by CHIR treatment alone, fewer cells 324 survived upon 0.2μM PD17 treatment, but strong PAX7 and SOX10 expression is noted by 325 immunofluorescence in the remaining cells (Fig. 4A). Analysis of immunofluorescence data reveals 326 a mild reduction in the proportion of PAX7 positive (10CH (97.27+1.13%) vs 0-5D PD 327 (91.92+2.16%)) and SOX10 positive (10CH (96.06+1.77%) vs 0-5D PD: (84.72+6.40%)) cells in 328 posterior NCCs inhibited with 0.2μM PD17 (Fig. 4B). Treatment with 2μM PD17 lead to severe 329 reductions in cell numbers that prevented further analysis, although a clear lack of PAX7 and SOX10 330 expression are noted. RT-qPCR analysis of high WNT cultures exposed to 0.2μM PD17 for 5 days 331 (5D) reveals a 50% reduction in FOXD3 and SOX10 and ~30% in PAX7 and ETS1 (Fig. 4C, left). To 332 validate the modulation of FGF signaling by PD17, we assessed the expression of known direct 333 targets of FGF, DUSP6 and SPRY2 (Ekerot et al., 2008; Minowada et al., 1999). Compared with 334 control posterior NCCs (CH), DUSP6 and SPRY2 expression are reduced by 70% and 50% 335 respectively in FGF inhibited cells (Fig. 4C, right). 336 Since cell survival is compromised by prolonged FGF inhibition, we tested whether inhibiting 337 FGF during the first 24 hours (0-1day PD17) would affect NC induction, as seen with BMP. We 338 treated hESCs with the 2D High WNT regimen and with 0.2μM or 2μM of PD17 during the first day, 339 and analyzed cultures at the end of day 5. Cell viability was not affected by 24-hour treatment with 340 0.2μM PD17, and the expression of PAX7 and SOX10 remained unchanged relative to 2D High- 341 CHIR controls as determined by immunostaining (Fig. 4A, 4B). RT-qPCR for PAX7, ETS1, FOXD3 342 and SOX10 in these cultures further confirms no deleterious effect on NC formation after 24-hour 343 FGF inhibition (Fig. 4C). In contrast, 2μM PD17 treatment during the first day, was again confounded 344 by low cell survival. However, the few surviving cells reveal expression of PAX7 and SOX10 positive 345 cells, although at notably reduced proportions (Fig. 4B, right). Overall, this data suggests that FGF 346 signaling promotes cellular viability during posterior NC formation, but the cell population that 347 survives do acquire NC character. bioRxiv preprint doi: https://doi.org/10.1101/514570; this version posted January 8, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

348 Given the known role of FGF signaling in axis specification, we tested whether FGF is 349 required to impart posterior character. To that end, we performed immunofluorescence for HOXB4 in 350 posterior NC cultures treated with PD17. FGF inhibition for 5 days with the “mild” dose of 0.2 µM 351 PD17 led to a reduction in cells expressing HOXB4 while the “strong” dose, 2µM PD17, led to a stark 352 loss of HOXB4 expression upon FGF inhibition for both durations tested (Fig. 4A). Instead FGF 353 inhibition with the lower dose of 0.2µM PD17 for the first day lead to an apparent increase in HOXB4 354 expression. These results suggest that following a mild short inhibition of FGF signaling, high-CHIR 355 induced NCCs maintain posterior character. Instead, a mild long inhibition (0.2uM for 5 days) as well 356 as a short but strong inhibition (2uM for 1 day) of FGF signaling allow NC formation, but repress the 357 expression of posterior character genes like HOXB4. 358 359 Vitamin A (the precursor of RA) is not required for NC induction or posteriorization, while 360 exogenous RA alters axial identity but inhibits NC formation 361 Retinoic Acid (RA) signaling has been linked with posteriorization of embryonic tissues and 362 neural crest (Fattahi et al., 2016; Fukuta et al., 2014; Huang et al., 2016; Mica et al., 2013); 363 specifically, addition of RA promotes the expression of vagal identity HOX genes in NC cultures. It 364 has been proposed that RA and FGF exert antagonistic effects to modulate the anterior-posterior 365 character of the neural tube and NCCs (Cunningham et al., 2015; Diez del Corral et al., 2003; 366 Olivera-Martinez and Storey, 2007). We therefore examined whether RA signaling modulates NC 367 formation and their axial character in our human model. One approach used to reduce RA signaling 368 has been to deprive cells of vitamin A, a precursor for RA (Kam et al., 2012). The basal induction 369 media used in our NC protocol contains Vitamin A. Therefore, we evaluated whether anterior and 370 posterior NCCs generated via low and high WNT (3 and 10µM CHIR respectively) are altered by the 371 presence or absence of Vitamin A. Both PAX7 and SOX10 are expressed at normal levels and 372 proportions in anterior NCCs in conditions containing (+) or lacking (-) Vitamin A, and a slight but 373 insignificant reduction was noted in NCCs produced by the high CHIR dose (Fig. 5A). 374 Transcriptional readouts for ETS1 and SOX10 further confirm that omission of vitamin A does not 375 affect anterior NCCs but results in a slight reduction in posterior NCCs (Fig. 5B, left). Interestingly, 376 Vitamin A depletion had no effect on the expression of HOX genes in anterior NC, but triggered a 377 slight, although not statistically significant, increase of the expression of HOXB4 and HOXC9 378 expression in posterior NCCs. This is suggestive of a slight contribution of Vitamin A to the known 379 role of RA in the promotion of expression of vagal anterior-posterior axis in the posterior NCCs (Fig. 380 5B, right). 381 Next, we tested the role of RA in our model by supplying all-trans-RA (RA) under our culture 382 conditions. To this end, we first assessed conditions upon which RA could induce HOXB4 383 expression, and found that RA treatment from 1-5 days produced optimal results (data not shown). bioRxiv preprint doi: https://doi.org/10.1101/514570; this version posted January 8, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

384 Next, we added either DMSO (0 RA), 1μM, or 10μM RA on days 1-5 to anterior and posterior NC 385 formation cultures (cells treated for 2 days with 3μM or 10μM CHIR). Surprisingly, we found that the 386 addition of RA to anterior NC cultures blocked NC formation, while instead RA addition to posterior 387 NC cultures appears to increase PAX7 protein while considerably reducing SOX10 expression (Fig. 388 5C, right). RT-qPCR analysis confirmed that RA treatment down-regulates other NC markers 389 including SNAI2, ETS1, FOXD3 and SOX10 in both CHIR treatment conditions, with slightly more 390 resistant expression under the high WNT regimen (Fig. 5D). RA administration induced robust 391 HOXB4 protein expression in NO CHIR, and 3μM CHIR cultures, but in 10µM CHIR cultures a mild 392 reduction of HOXB4 was noted (Fig. 5C, left). By QPCR, HOXB4 transcripts are elevated in 3µM 393 CHIR condition upon RA treatment, but no evidence of HOXC9 expression was found. Instead when 394 RA is added to 10µM CHIR cultures, no significant change is seen for HOXB4, but HOXC9 is 395 reduced (Fig. 5F). Confirmation of RA activity is found in the dose dependent up-regulation of the 396 feedback regulator of RA, CYP26A1 (Loudig et al., 2000) in both 3 and 10μM CHIR conditions (Fig. 397 5E). However, the expression of CRABP2, another putative target of RA (Aström et al., 1992), was 398 not changed under these conditions. Altogether this suggests that activation of RA signaling under 399 these conditions modulates axial character, but antagonizes the NC developmental program. 400 401 DISCUSSION 402 The WNT/β-CATENIN pathway is known to play a critical role in neural crest formation in 403 multiple model organisms (Garcıa-Castro et al., 2002; Saint-Jeannet et al., 1997) and reviewed in 404 (Pla and Monsoro-Burq, 2018; Stuhlmiller and García-Castro, 2012a), and in human models based 405 on PSCs (Chambers et al., 2012; Denham et al., 2015; Fukuta et al., 2014; Hackland et al., 2017; 406 Leung et al., 2016; Menendez et al., 2011; Mica et al., 2013). Simultaneously, this pathway has 407 instrumental roles in fate decisions of many other cell types. The wide range of responses elicited by 408 the WNT/β-CATENIN pathway rely on the availability and sensitivity of a growing number of 409 molecular collaborations that embody the context of the signal. These modulators of specificity 410 include the specific LEF/TCF cofactors, their splice isoforms, other transcription factors, chromatin 411 modifiers, non-coding RNAs and physical parameters such as the initial timing, length of exposure, 412 and concentration of the WNT signal (Goentoro and Kirschner, 2009; Lee et al., 2003; Masuda and 413 Ishitani, 2017; Rogers and Schier, 2011; Tan et al., 2012). 414 Here we focus on the effect of varying the magnitude of the WNT/β-CATENIN signaling 415 activity on NC formation, aiming to better characterize a key and understudied element of the 416 signaling process. To our knowledge, this is the first time the magnitude of the WNT/β-CATENIN 417 pathway has been addressed in human NC development. We report a bimodal curve of NC 418 formation in response to WNT/β-CATENIN magnitude, with low and high (but not medium or higher) bioRxiv preprint doi: https://doi.org/10.1101/514570; this version posted January 8, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

419 WNT leading to anterior and posterior NC formation. The response of hESCs to WNT magnitude in 420 NC formation and posteriorization provide an intriguing paradigm for modeling the effects of different 421 parameters in the WNT response. It was recently suggested that WNT parameters should modulate 422 the fold levels of β-CATENIN in order to provide distinct effects (Goentoro and Kirschner, 2009) . 423 Here we observe a gradual modulation NC posteriorization through gradual HOX gene expression 424 being triggered by relatively small changes in the concentration of the GSK3β inhibitor CHIR, which 425 are difficult to envision as a causative translation to drastic fold changes of β-CATENIN, thus 426 deserving further analysis. 427 We also report that in our system, posterior NCCs emerge through progenitors that resemble 428 NMPs, noted by co-expression of TBXT+/SOX2+ cells. Furthermore, in this context, BMP signaling 429 is required for both anterior and posterior NC formation, while FGF is required for anterior NC fate 430 acquisition, the posterior NC identity is less dependent on FGF signaling. Finally, FGF and RA 431 contribute with WNT signaling to modulate HOX expression and thus the axial character of posterior 432 NCCs. This study reinforces the importance of the WNT/β-CATENIN signaling pathway in the 433 induction of NCCs in humans and reveal that the parameters of magnitude and duration of exposure 434 to WNT/β-CATENIN not only induces NCCs but can simultaneously alter the axial identity. 435 436 WNT/β-CATENIN promotes NC formation and its magnitude sets their axial identity 437 The experiments presented here suggest that hESCs can adopt distinct axial NC character 438 guided by WNT parameters. With a low WNT signal generating head/anterior NC formation bearing 439 midbrain markers, and instead, a transient high WNT signal generating gradually more posterior 440 NCCs. These posterior NCCs are derived from TBXT/SOX2 expressing progenitors which acquire 441 progressively more posterior HOX gene expression according to the magnitude of the WNT signal. 442 The robust and immediate induction of CDX factors by high WNT further supports the notion that 443 WNTs set up the axial identity of posterior NCCs, since WNT/β-CATENIN signaling induces CDX 444 expression (Ikeya and Takada, 2001; Sanchez-Ferras et al., 2012; Shimizu et al., 2005) and CDX2 445 mediates NCC induction via PAX3, MSX1, FOXD3, and potentially other factors (Sanchez-Ferras et 446 al., 2016; Sanchez-Ferras et al., 2012) 447 The low-WNT response might be related to the known role of WNT/β-CATENIN during early 448 development with initial contribution to axial specification and head formation (Fossat et al., 2011; 449 Heasman et al., 1994; Lemaire et al., 1995; McMahon and Moon, 1989; Smith and Harland, 1991; 450 Sokol et al., 1991). While a second wave of WNT takes part in gastrulation, and displays apparent 451 short gradients from the node/anterior primitive streak (Loh et al., 2016; Morkel et al., 2003; 452 Steinhart and Angers, 2018). We propose that posteriorly, transient WNT levels would be bioRxiv preprint doi: https://doi.org/10.1101/514570; this version posted January 8, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

453 experienced by young NC progenitors, which distance themselves from the WNT source, 454 node/anterior PS, as gastrulation continues in later stages of development. 455 It is intriguing that SOX10+/PAX7+ NCCs can be formed from pluripotent cells in an apparent 456 bimodal wave with optimal doses of low ~3μM, and high ~10µM CHIR generating anterior 457 (OTX2+/DMBX1+, HOX-) and posterior (OTX2-/DMBX1-, HOX+) NC, with intervening (4-6µM) and 458 higher (>15µM) doses at which NCCs are not produced. At very high CHIR concentrations, few if 459 any cells survived (data not shown). Instead at ~5μM CHIR, healthy cultures display abundant 460 PAX6+ cells, that are negative for PAX7 and SOX10 expression, perhaps indicative of a neural 461 precursor fate. We previously found that expression of PAX6+ cells does not precede the acquisition 462 of NC markers, and that NC is not hampered by PAX6 knock down in our anterior NC model (Leung 463 et al., 2016). Our finding that the low dose of CHIR forms NCCs devoid of HOX expression, while 464 concentrations from 6.5 to 10μM CHIR generates HOX+ posterior NC, unveils a switch between 465 anterior and posterior NC mediated by WNT. Furthermore, WNT signaling is able to gradually 466 regulate the expression of HOX genes in the posterior NC in a concentration dependent manner. 467 The WNT pathway has been shown to play a role in early NC formation (Garcıa-Castro et al., 2002; 468 Saint-Jeannet et al., 1997), and is known to modulate the axial identity of neural tissues (McGrew et 469 al., 1995; Michaelidis and Lie, 2008). However, until today, no study had characterized the additional 470 role WNT signaling plays in setting the axial identity of NCCs. 471 472 NC formation and WNT signaling during embryonic development. 473 The bimodal response of hESCs to WNT/β-CATENIN magnitude is intriguing. Here hESCs of 474 presumed identical pluripotency were exposed to different doses of CHIR for the same duration, 475 resulting in distinct populations of NCCs. In the embryo, we assume that anterior and posterior NC 476 arise at different time points, and in distinct locations, enabling the contribution of a wide range of 477 factors to provide a unique context for each NC fate. Still, it seems worthwhile to evaluate if some 478 aspects of a bimodal wave of NC formation triggered by WNT is at play in vivo. 479 Different WNT ligands and receptors are expressed throughout the anterior-posterior body 480 plan, but these are subject to complex regulation that do not translate to homogenous activation of 481 their signals. Expression profiles for some WNT/β-CATENIN targets like AXIN2 and SP5, as well as 482 β-CATENIN reporter models, suggest a weaker early WNT signal anteriorly and a stronger signal 483 posteriorly slightly later, with a gap in WNT activity seen along the anterior-posterior axis for several 484 of these (Harrison et al., 2000; Jho et al., 2002; Maretto et al., 2003; Moro et al., 2012). NCCs are 485 normally considered to arise throughout the entire axis of the neural tube, except from the anterior 486 forebrain. Previous suggestions of gaps in NCCs along the anterior-posterior axis focused on 487 Rhombomeres 3 and 5, pointing to cell death and migratory paths as possible models to explain bioRxiv preprint doi: https://doi.org/10.1101/514570; this version posted January 8, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

488 these gaps. Interestingly, multiple expression patterns for NC markers in diverse studies, offer a 489 distinct gap between the midbrain and the hindbrain signal (Khudyakov and Bronner-Fraser, 2009; 490 Sakai and Wakamatsu, 2005). It is known that NC that have emigrated from the neural tube can 491 move antero-posteriorly at its most dorsal locations (Kulesa and Fraser, 1998), potentially hiding 492 possible areas where gaps in NC formation may exist; further studies are needed to better assess 493 this possibility. 494 495 Putative additional players triggered by CHIR99021 496 CHIR99021 has been used extensively as a WNT agonist since it has a high affinity for 497 GSK3 kinase, and at the low dose of ~3μM, CHIR is highly specific (Ring et al., 2003). We previously 498 showed that WNT3A or CHIR could both trigger NC development from hPSC, and demonstrated that 499 this process depends on β-CATENIN for NC formation under our low-WNT anterior NC formation 500 conditions (Leung et al., 2016). However, at the high dose of ~10μM a few other kinases may also 501 be inhibited by CHIR (Wagner et al., 2016). Of these, Wagner et. al. reported that 19 are inhibited 502 over 50% of their activity, 6 of which are inhibited more than 70%. However, none of these have 503 been reported to play an active role in NC formation, but whether CHIR promotes NC formation by 504 inhibition of these other kinases will require further investigation. Furthermore, WNT/FZD/LRP6 505 inhibition of GSK3 is known to trigger at least two other responses independent of the WNT/β- 506 CATENIN pathway, namely the WNT/STOP and WNT/TOR pathways which modify broad protein 507 stability and translation respectively. It is likely that CHIR might trigger similar responses, and thus it 508 is worth evaluating their role in NC formation. In addition, GSK3 kinases have multiple targets and 509 modify various signaling pathways beyond the canonical WNT/β-CATENIN pathway (Acebron et al., 510 2014; Taelman et al., 2010), and whether any such additional GSK3 targets contribute to human NC 511 formation remains possible and unexplored. 512 513 Effects of other signaling pathways in posterior NC generated via high WNT (CHIR) 514 In embryos, WNT, FGF and RA signals promote early stages of posteriorization by 515 repressing anterior gene regulatory circuits and simultaneously promoting posterior programs 516 (Andoniadou et al., 2011; Kudoh et al., 2002; Lagutin et al., 2003; McGrew et al., 1997; Shimizu et 517 al., 2006). At the open neural plate regions of embryos undergoing primary neurulation, WNTs and 518 FGFs are the main signaling pathways responsible for neural and mesoderm induction medially 519 (Henrique et al., 2015; Wilson et al., 2009) whereas WNT, and intermediate levels of BMPs, and 520 FGF provide critical inputs for generation of NCs at the neural plate border (Selleck et al., 1998; 521 Stuhlmiller and García-Castro, 2012b; Yardley and García-Castro, 2012), and high levels of BMPs 522 promote ectoderm specification (Wilson and Hemmati-Brivanlou, 1995). In Xenopus embryos, bioRxiv preprint doi: https://doi.org/10.1101/514570; this version posted January 8, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

523 intermediate BMP levels are thought to trigger neural plate border formation, which is posteriorized 524 by WNT, FGF and RA signaling pathways, giving rise to prospective NCCs (Villanueva et al., 2002). 525 Human NCCs formed from PSCs have been successfully posteriorized by supplementation with 526 BMPs, FGF and RA (Denham et al.; Fattahi et al., 2016; Fukuta et al., 2014; Huang et al., 2016; 527 Mica et al., 2013). It was therefore important to assess if these other pathways could also modulate 528 the character of NC under high WNT conditions. 529 The role of BMP signaling in NC development in vivo and in vitro has proved particularly 530 difficult to tease apart. Gradients providing an intermediate level of BMP signaling have been 531 proposed as critical in Xenopus NC formation, however this has not been found in amniotes. 532 Furthermore, some hESC models of NC formation have reported that it is necessary to inhibit BMP 533 signaling during NC formation, while others dispensed with the inhibition of BMP (Chambers et al., 534 2012; Mica et al., 2013). Instead, we previously reported that BMP signaling is required in our low- 535 WNT anterior NC formation model, and suggested that its function is dispensable for the initial 536 events triggered by WNT, but that it is required thereafter (Leung et al., 2016). Here we report that 537 BMP signaling is also required under the high WNT paradigm of posterior NC formation, since a 538 continuous 5-day BMP inhibition completely blocks NC formation. Instead, mild inhibition with either 539 a low or high concentrations of the BMP inhibitor DMH1 during the first 24 hours leads to moderate 540 and complete blockade of SOX10 expression, but surprisingly has a minimal or mild effect on PAX7 541 expression. These results support a model in which WNT initiates hESC differentiation towards the 542 NC lineage, and that BMP signaling is required slightly later for the acquisition of more mature traits. 543 This perspective is in alignment with experiments performed with avian embryos (Garcıa-Castro et 544 al., 2002; Liem et al., 1997; Patthey et al., 2009; Patthey and Gunhaga, 2014; Selleck et al., 1998; 545 Villanueva et al., 2002). 546 We previously reported that in the context of low WNT stimulus, FGF inhibition had a 547 deleterious effect on anterior human NC induction (Leung et al., 2016). By contrast, the high WNT 548 regimen which induces posterior NC is only modestly reduced by FGF inhibition, as shown here. 549 Similarly, while FGF inhibition prevents NC formation of anterior NC (Betters et al., 2018; Leung et 550 al., 2016; Stuhlmiller and García-Castro, 2012b; Yardley and García-Castro, 2012) , FGF inhibition 551 in posterior regions of chicken embryos does not prevent NC formation (Martínez-Morales et al., 552 2011), supporting the possibility that there are differences in the role played by FGF in anterior and 553 posterior NC in humans. Our group has developed an independent approach to generate posterior 554 NCCs in which FGF inhibition also fails to prevent NC formation (J.O.S.Hackland et. al. manuscript 555 submitted). This further supports the idea that FGF plays a passive role in posterior NC induction. 556 FGF addition has been shown to upregulate HOX genes in NCCs, but this treatment reduced the 557 output of NCCs induced (Mica et al., 2013). bioRxiv preprint doi: https://doi.org/10.1101/514570; this version posted January 8, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

558 Here we assessed whether RA signaling affects NC formation in our human model. We find 559 that omission of vitamin A has no effect on anterior or posterior NC formation, and HOX genes are 560 still expressed in posterior NCCs, indicating that RA is neither required for NC formation, or the 561 posteriorization elicited by WNT signaling. Avian studies have reported that Vitamin A deficiency is 562 required for NC migration, and possibly formation (Martínez-Morales et al., 2011). By contrast, 563 mouse knockouts for one of the RA synthesis enzymes, RALDH2 -/- that display clear defects in 564 posterior identity of cells of the caudal hindbrain, seem to still form NC (Niederreither et al., 2000). 565 NC markers are also expressed in NCCs with pan RAR αβγ KOs (Dupé and Pellerin, 2009), 566 suggesting that RA is not required for the formation of the NC populations studied here. Conversely, 567 while RA supplementation in other systems of NC differentiation from hPSCs have posteriorized 568 NCCs (Fattahi et al., 2016; Fukuta et al., 2014; Huang et al., 2016; Mica et al., 2013), in the system 569 presented here, RA prevents NC formation. A potential reason for these discrepancies includes the 570 possibility that exogenous RA can quench β-CATENIN (Vijayasurian Easwaran and Byers, 1999), 571 but this is context dependent, since in some instances RA and β-CATENIN are co-activators (Liu et 572 al., 2002; Tice et al., 2002). Another possibility is that exogenous RA can modulate FGF (Stavridis 573 et al., 2010), and in conditions where RA activity is elevated, FGF inhibition would prevent activation 574 of the NC program. Since addition of RA to low WNT conditions does not posteriorize NCCs as seen 575 at high doses of WNT alone, it is unlikely that increased magnitude of WNT signaling imparts 576 posterior character to NCCs by activation of endogenous RA. 577 578 Neuromesodermal progenitors and posterior NC 579 Interestingly, unlike anterior NCCs, which do not express genes associated with mesoderm 580 like TBXT, NCCs induced by high WNT do result in the transient and robust activation of TBXT, in 581 what resembles neuromesodermal progenitor intermediates. Indeed, we find that unlike prospective 582 anterior NCCs, the precursors of posterior NCCs in our culture conditions co-express TBXT and 583 SOX2, as well as NKX1-2, MSGN1, FGF8, CDX1, and CDX2, suggesting that they transit through a 584 precursor resembling axial neuro-mesodermal precursors or NMPs (Henrique et al., 2015). 585 It was recently shown that NMPs produced from hPSCs in vitro have the potential to 586 generate NCCs (Frith et al., 2018), and in a manuscript submitted elsewhere by Hackland et al. we 587 have found that posterior NC generated in a xeno-free (BSA free, and using N2 instead of B27 588 supplement, and under modulated BMP) platform are also derived from a similar axial progenitor. 589 Some recent evidence from lineage tracing experiments in chick and mice favor the contribution of 590 NMPs to NCCs (Cambray and Wilson, 2007; McGrew et al., 2008; Wymeersch et al., 2016). 591 However, the expression profile of the early NC specifier Pax7 in chick embryos labels the whole 592 posterior open neural plate border, surrounding the NMPs, and thus if these cells were to contribute bioRxiv preprint doi: https://doi.org/10.1101/514570; this version posted January 8, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

593 to the neural folds laterally, they would be joining a neural fold already containing prospective NCCs 594 (Pax7+ cells). Alternatively, the NMPs could contribute to the most posterior region of the neural fold, 595 below the existing Pax7+cells. Future lineage tracing approaches with greater emphasis on studying 596 the contribution of NMPs to NCCs are warranted to address this question. 597 598 Differentiation potential of posterior NC 599 Our posterior NCCs generate melanoblasts, peripheral neurons and glia, and trunk specific 600 sympathoadrenal lineage derivatives. Simultaneously, our posterior NC also generate 601 ectomesenchymal derivatives which are more often associated with anterior character like 602 osteocytes and smooth muscle (Leung et al., 2016). However, unlike anterior NCCs, posterior NCCs 603 were not able to generate chondrocytes or adipocytes. In multiple in vitro experiments, posterior 604 NCCs display unexpected extended potential associated with anterior NCCs (Abzhanov et al., 2003; 605 Dupin et al., 2018; McGonnell and Graham, 2002). It seems that the culture conditions for 606 differentiation reveal a wider potential for NCCs in vitro than in in vivo, and thus it appears that the 607 inductive signals in vitro are more persuasive or stronger than those present in vivo. It is therefore 608 critical for future experiments to address minimal signal conditions in culture that effectively 609 differentiate NC into their derivatives according to their axial identity, which might reveal meaningful 610 differences related to in vivo potential. 611 Although forced expression of anterior specific gene networks can drive posterior NCCs to 612 differentiate to anterior restricted ectomesenchymal lineages (Simoes-Costa and Bronner, 2016), in 613 vitro differentiation of ectomesenchymal derivatives from trunk NCCs is possible, but chondrocytes 614 differentiation from trunk NCCs occurs with limited yields (Abzhanov et al., 2003; Dupin et al., 2018). 615 616 CONCLUSION 617 Here we present evidence implicating the WNT/β-CATENIN pathway as a prime instructor of 618 the NC fate whose magnitude and temporal window of activation can dictate NC axial identity. In 619 this context, BMP operates secondary to WNT signaling, FGF has a role in cell survival and/or 620 proliferation but not NC fate acquisition, and RA is not required for either NC formation or axial 621 identity, while addition of exogenous RA derails NC formation. This study offers insights into the 622 parameters that are relevant for human NC formation, and sheds light on the inputs that produce 623 NCCs with distinct anterior-posterior identity. 624 625 MATERIALS AND METHODS 626 RT-qPCR 627 Total RNA was collected in TRIzol (Thermo Fisher Scientific), cDNA was prepared with Applied 628 Biosystems High Capacity cDNA Reverse Transcription Kit (Fisher Scientific), and RT-qPCR was bioRxiv preprint doi: https://doi.org/10.1101/514570; this version posted January 8, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

629 performed with SYBR Premix Ex Taq II (Clontech) on an Applied Biosystems Step One Plus system. 630 Fold-Changes were evaluated by the ΔΔ-Ct method and plotted on Excel or Graphpad prism. qPCR 631 primers used: 632 FORWARD REVERSE 633 BACTIN TGAACCCCAAGGCCAACCGC GACCCCGTCACCGGAGTCCA 634 RPL27 ATCGCCAAGAGATCAAAGATAA TCTGAAGACATCCTTATTGACG 635 SOX10 CCTTCATGGTGTGGGCTC CGCTTGTCACTTTCGTTCAG 636 PAX7 TGACAGCTTCATGAATCCGG GATGGAGAAGTCAGCCTGTG 637 PAX3 GGCTTTCAACCATCTCATTCCCG GTTGAGGTCTGTGAACGGTGCT638 FOXD3 GCATCTGCGAGTTCATCAGC CGTTGAGTGAGAGGTTGTGG 639 MSX1 GCTCGTCAAAGCCGAGAG ACGGTTCGTCTTGTGTTTGC 640 SNAI2 CAGACCCTGGTTGCTTCAAG GAGCCCTCAGATTTGACCTG 641 ETS1 GGAGATGGCTGGGAATTCAAAC ACGGCTCAGTTTCTCATAATTCATC642 OCT4. GAGAAGGAGAAGCTGGAGCA CTTCTGCTTCAGGAGCTTGG 643 NANOG GATTTGTGGGCCTGAAGAAA CAGATCCATGGAGGAAGGAA 644 KLF4 ACCCACACAGGTGAGAAACC ATGCTCGGTCGCATTTTTGG 645 SOX2 TCAAGCGGCCCATGAATGCC AGCCGCTTAGCCTCGTCGAT 646 AXIN2 CGGGAGCCACACCCTTCT TGGACACCTGCCAGTTTCTTT 647 SP5 CTTCGGGTGTCCATGCCTC GTGCGGTCCTGGAGAAAGG 648 ZIC1 GTCCTACACGCATCCCAGTT GCGATAAGGAGCTTGTGGTC 649 OTX2 GAGAGGAGGTGGCACTGAAAA GTTGTTGGCGGCACTTAGC 650 DMBX1 ATGTGGTGATGCGTGAGAGG GCTGTTCCTTCTGCAGGCTA 651 HOXB1 GTTAAGAGAAACCCACCCAAGAC GGAACTCCTTTTCCAGTTCTGTC652 HOXB2 GCAGTCCCAGGCCATCTG CGCCACGTCTCCTTCTCC 653 HOXB4 TACCCCTGGATGCGCAAAGTTC TGGTGTTGGGCAACTTGTGG 654 HOXC5 ACAGATTTACCCGTGGATGAC AGTGAGGTAGCGGTTAAAGTG HOXC9 AGCACAAAGAGGAGAAGGC CGTCTGGTACTTGGTGTAGG 655 EGR2 TTTGACCAGATGAACGGAGTG GCCCATGTAAGTGAAGGTCTG 656 CDX1 CACAATCCGGCGGAAATCAG TTCTTGTTCACTTTGCGCTCC CDX2 GGAACCTGTGCGAGTGGAT TGAAACTCCTTCTCCAGCTCC 657 TBXT CCTTCAGCAAAGTCAAGCTCACC TGAACTGGGTCTCAGGGAAGCA 658 MSGN1 AACCTGCGCGAGACTTTCC ACAGCTGGACAGGGAGAAGA TBX6 TGCGGCAGCCTGTGTCT GTGCATGGAGTGCAGGATCA 659 DUSP6 AGCCAAGCAATGTACCAAGACA CAGTTTTTCCCTGAGGCCATTTC660 SRY2 GTCACTCCAGCAGGCTTAGAA GCACATCGCAGAAAGAAGAGAAT NKX1-2 TCCGCATCCTCCTCCTCTTC GAAAGATGCCAGCTCCAGGG 661 FGF8 GCAGCGCTGTGTAGTTGTTC ACAAGAAGGGGAAGCTGATCG662 PAX6 CACCTACAGCGCTCTGCCGC CCCGAGGTGCCCATTGGCTG 663 664 Immunofluorescence 665 Cells were fixed in 4% paraformaldehyde, rinsed in PBS, permeabilized with 0.4% triton X100, 666 blocked with 4% fetal bovine serum and incubated with primaries overnight. Alexa Fluor conjugated 667 secondary antibodies (Invitrogen) were used at 1:2000 dilution. Antibodies used: Mouse anti- 668 SOX10 (Santa Cruz Biotechnology, SC271163), 1:200. Mouse anti-PAX7 (1:50), mouse anti-PAX6 669 (1:100), Rat anti-HOXB4 (1:200) (Developmental Studies Hybridoma Bank). Mouse anti-SMOOTH 670 MUSCLE ACTIN (Sigma, A2547) 1:500. Mouse anti-PERIPHERIN (Santa Cruz, sc-377093), 1:200. bioRxiv preprint doi: https://doi.org/10.1101/514570; this version posted January 8, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

671 Mouse anti- βTUBULIN (Santa Cruz, sc-365791), 1:300. Mouse anti-ASCL1 (Santa Cruz, sc- 672 374104), 1:100. Mouse anti-HOXC9 (Santa Cruz, sc-81100), 1:500. Mouse anti-GATA3 (Santa 673 Cruz, sc-268), 1:100. Mouse anti-VIMENTIN (Sigma-Millpore, MAB3400), 1:1000. Rabbit anti-S100β 674 (abcam, ab52642) 1:200. Goat anti-MITF (R&D systems, AF5769) 1:100. 675 Microscopy 676 Images were captured on a Nikon eclipse 80i microscope on a Spot SE camera and software, or on 677 an inverted Nikon Eclipse Ti microscope with NIS Elements software. All images were compiled and 678 adjusted in Adobe Photoshop CS5. 679 Cell Counts 680 Immunofluorescence images taken on the NIKON eclipse 80i were converted to nd2 format and 681 counted on NIS-Elements AR Analysis software (version 4.6). Nuclei were counted by clustered 682 method at 5px/spot, at a typical diameter of 10μm, with variable contrast levels and dark objects 683 removed. 684 Statistics 685 Statistical analysis of cell counts and RT-qPCR was performed on Prism7.0 (GraphPad Software, 686 San Diego, CA). All experiments were performed with a sample size of n = 3 independent cultures, 687 immunofluorescence images are representative of 1 of these. RT-qPCR was performed from 688 separate wells and 3 technical replicates were assessed for each of 3 independent cultures. 689 Neural Crest Differentiation 690 Human embryonic stem cells line H1 (WA01) obtained from WiCell Research Institute, Inc. (Madison 691 WI, USA), was maintained in mTeSR1 (Stem Cell Technologies) on matrigel coated dishes at 37°C

692 in 5% CO2, 5% O2 and passaged regularly with Dispase (Stem Cell Technologies) or Versene 693 (Thermo Fisher Scientific). For NC differentiation, hESCs were collected 4 to 5 days after last 694 passage at 80% to 90% confluency. Cells were first rinsed 3 times in 1X PBS Ca+ and Mg+ free 695 (Thermo Scientific, Cat. No. 14190144), then dissociated in Accutase (Stem Cell Technologies) for 4

696 minutes 30 seconds at 37°C in 5% CO2, 5% O2. Accutase was immediately quenched with warmed 697 1X DMEM/F12 (Invitrogen, Cat. No. 17504-044) containing 10μM Rock Inhibitor, Y-27632 (Tocris, 698 Cat. No. 1254), then cells were centrifuged 1200 RPM for 4 minutes at room temperature. 1X 699 DMEM/F12 was discarded leaving cell pellet intact, then replaced with NC Induction media [1X 700 DMEM/F12 (Invitrogen Cat. No. 11320), 1X serum-free B27 supplement (Invitrogen, Cat. No. 17504- 701 044), 1X Glutamax (Thermo fisher scientific, Cat. No. 35050061), 0.5% BSA (Sigma, A7979)] 702 containing 10μM Y-27632. hESC clusters were further dissociated to single cells mechanically by 703 trituration through a 5mL serological pipette a total of 20 times. Cells were counted on a 704 hemocytometer, diluted to an optimal seeding density of 20 X 103 cells/cm2 per culture vessel, then 705 seeded on culture vessels pre-coated with Matrigel (BD Matrigel hESC-qualified Matrix Cat. No. bioRxiv preprint doi: https://doi.org/10.1101/514570; this version posted January 8, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

706 354277). CHIR99021 (Tocris, Cat. No. 4423) was added to cells in induction media during 707 trituration prior to seeding. Note, induction efficiency is sensitive to the CHIR99021 concentration 708 CHIR used, which varies depending on the different lots of CHIR99021, resuspension, pipetting, 709 etc., Optimal inductions in the low WNT were obtained with variable ranges between ~2.5μM – 3μM, 710 but we report all results at 3μM for consistency. 10μM Rock Inhibitor, Y-27632, was added from 711 days 0-2 in all cases and left out of induction media during the remainder of culture. Induction media

712 was changed daily until day of collection for further analysis. Cells were cultured at 37°C in 5% CO2,

713 5% O2 throughout the procedure. 714 Terminal differentiation of neural crest derivatives 715 All protocols were adapted and derived from Studer lab group, except chondrocyte differentiation. 716 (Chambers et al., 2012; Lee et al., 2007; Mica et al., 2013) and noted in (G.A.Gomez et al, 717 submitted). 718 719 Acknowledgements 720 We thank the University of California Riverside, Stem Cell Core for the use of the Nikon eclipse Ti 721 microscope. 722 723 Author Contributions 724 Conceptualization: G.A.G. and M.I.G.C.; Funding & Resources: M.I.G.C; Performed Experiments: 725 G.A.G.; Experimental support: M.S.P., M.W., J.O.S.H., A.W.L., R.M.C., P.B.S., N.S., J.C.H.; Data 726 Analysis: G.A.G, M.I.G.C.; Writing, review & editing: G.A.G., and M.I.G.C. 727 728 Competing interests 729 The authors declare no competing financial interests. 730 731 Funding 732 This research was supported by funding from the National Institutes of Health National Institute of 733 Dental and Craniofacial Research, 5R01DE017914-10 734 735 736 References 737 738 Abzhanov, A., Tzahor, E., Lassar, A. B. and Tabin, C. J. (2003). Dissimilar regulation of cell 739 differentiation in mesencephalic (cranial) and sacral (trunk) neural crest cells in vitro. 740 Development 130, 4567-4579. 741 Acebron, S. P., Karaulanov, E., Berger, B. S., Huang, Y.-L. and Niehrs, C. (2014). Mitotic wnt 742 signaling promotes protein stabilization and regulates cell size. Molecular cell 54, 663-674. 743 Andoniadou, C. L., Signore, M., Young, R. M., Gaston-Massuet, C., Wilson, S. W., Fuchs, E. 744 and Martinez-Barbera, J. P. (2011). HESX1- and TCF3-mediated repression of Wnt/β- bioRxiv preprint doi: https://doi.org/10.1101/514570; this version posted January 8, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

745 catenin targets is required for normal development of the anterior forebrain. Development 746 138, 4931-4942. 747 Aström, A., Pettersson, U. and Voorhees, J. J. (1992). Structure of the human cellular retinoic 748 acid-binding protein II gene. Early transcriptional regulation by retinoic acid. Journal of 749 Biological Chemistry 267, 25251-25255. 750 Bajpai, R., Chen, D. A., Rada-Iglesias, A., Zhang, J., Xiong, Y., Helms, J., Chang, C.-P., Zhao, 751 Y., Swigut, T. and Wysocka, J. (2010). CHD7 cooperates with PBAF to control multipotent 752 neural crest formation. Nature 463, 958-962. 753 Bansal, R., Magge, S. and Winkler, S. (2003). Specific inhibitor of FGF receptor signaling: FGF-2- 754 mediated effects on proliferation, differentiation, and MAPK activation are inhibited by 755 PD173074 in oligodendrocyte-lineage cells. Journal of Neuroscience Research 74, 486-493. 756 Basch, M. L., Bronner-Fraser, M. and García-Castro, M. I. (2006). Specification of the neural crest 757 occurs during gastrulation and requires Pax7. Nature 441, 218-222. 758 Betters, E., Charney, R. M. and García-Castro, M. I. (2018). Early specification and development 759 of rabbit neural crest cells. Developmental Biology. 760 Betters, E., Liu, Y., Kjaeldgaard, A., Sundström, E. and García-Castro, M. I. (2010). Analysis of 761 early human neural crest development. Developmental Biology 344, 578-592. 762 Brokhman, I., Lina, G.-Z., Oz, P., Aharonowiz, M., Reubbinoff, B. E. and Goldstein, R. S. (2008). 763 Peripheral sensory neurons differentiate from neural precursors derived from human 764 embryonic stem cells. Differentiation 76, 145-155. 765 Buitrago-Delgado, E., Nordin, K., Rao, A., Geary, L. and LaBonne, C. (2015). 766 NEURODEVELOPMENT. Shared regulatory programs suggest retention of blastula-stage 767 potential in neural crest cells. Science 348, 1332-1335. 768 Cambray, N. and Wilson, V. (2007). Two distinct sources for a population of maturing axial 769 progenitors. Development 134, 2829-2840. 770 Chambers, S. M., Qi, Y., Mica, Y., Lee, G., Zhang, X.-J., Niu, L., Bilsland, J., Cao, L., Stevens, 771 E., Whiting, P., et al. (2012). Combined small-molecule inhibition accelerates developmental 772 timing and converts human pluripotent stem cells into nociceptors. Nature Biotechnology 30, 773 715-720. 774 Chang, C. and Harland, R. M. (2007). Neural induction requires continued suppression of both 775 Smad1 and Smad2 signals during gastrulation. Development 134, 3861-3872. 776 Cunningham, T. J., Brade, T., Sandell, L. L., Lewandoski, M., Trainor, P. A., Colas, A., Mercola, 777 M. and Duester, G. (2015). Retinoic Acid Activity in Undifferentiated Neural Progenitors Is 778 Sufficient to Fulfill Its Role in Restricting Fgf8 Expression for Somitogenesis. PLoS ONE 10, 779 e0137894. 780 Curchoe, C. L., Maurer, J., McKeown, S. J., Cattarossi, G., Cimadamore, F., Nilbratt, M., 781 Snyder, E. Y., Bronner-Fraser, M. and Terskikh, A. V. (2010). Early acquisition of neural 782 crest competence during hESCs neuralization. PLoS ONE 5, e13890. 783 de Jaime-Soguero, A., de Oliveira, W. A. and Lluis, F. (2018). The Pleiotropic Effects of the 784 Canonical Wnt Pathway in Early Development and Pluripotency. Genes 9, 93. 785 Denham, M., Hasegawa, K., Menheniott, T., Rollo, B., Zhang, D., Hough, S., Alshawaf, A., 786 Febbraro, F., Ighaniyan, S., Leung, J., et al. (2015). Multipotent Caudal Neural Progenitors 787 Derived from Human Pluripotent Stem Cells That Give Rise to Lineages of the Central and 788 Peripheral Nervous System. Stem cells (Dayton, Ohio) 33, 1759-1770. 789 Denham, M., Hasegawa, K., Menheniott, T., Stem, B. R. and 2015 Multipotent caudal neural 790 progenitors derived from human pluripotent stem cells that give rise to lineages of the central 791 and peripheral nervous system. Wiley Online Library. 792 Diez del Corral, R., Olivera-Martinez, I., Goriely, A., Gale, E., Maden, M. and Storey, K. (2003). 793 Opposing FGF and retinoid pathways control ventral neural pattern, neuronal differentiation, 794 and segmentation during body axis extension. Neuron 40, 65-79. 795 Dupé, V. and Pellerin, I. (2009). Retinoic acid receptors exhibit cell-autonomous functions in cranial 796 neural crest cells. Developmental Dynamics 238, 2701-2711. bioRxiv preprint doi: https://doi.org/10.1101/514570; this version posted January 8, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

797 Dupin, E., Calloni, G. W., Coelho-Aguiar, J. M. and Le Douarin, N. M. (2018). The issue of the 798 multipotency of the neural crest cells. Developmental Biology. 799 Ekerot, M., Stavridis, M. P., Delavaine, L., Mitchell, M. P., Staples, C., Owens, D. M., Keenan, I. 800 D., Dickinson, R. J., Storey, K. G. and Keyse, S. M. (2008). Negative-feedback regulation 801 of FGF signalling by DUSP6/MKP-3 is driven by ERK1/2 and mediated by Ets factor binding 802 to a conserved site within the DUSP6/MKP-3 gene promoter. Biochemical Journal 412, 287- 803 298. 804 Epstein, J. A., Lam, P., Jepeal, L., Maas, R. L. and Shapiro, D. N. (1995). Pax3 inhibits myogenic 805 differentiation of cultured myoblast cells. Journal of Biological Chemistry 270, 11719-11722. 806 Fattahi, F., Steinbeck, J. A., Kriks, S., Tchieu, J., Zimmer, B., Kishinevsky, S., Zeltner, N., Mica, 807 Y., El-Nachef, W., Zhao, H., et al. (2016). Deriving human ENS lineages for cell therapy and 808 drug discovery in Hirschsprung disease. Nature 531, 105-109. 809 Fossat, N., Jones, V., Khoo, P.-L., Bogani, D., Hardy, A., Steiner, K., Mukhopadhyay, M., 810 Westphal, H., Nolan, P. M., Arkell, R., et al. (2011). Stringent requirement of a proper level 811 of canonical WNT signalling activity for head formation in mouse embryo. Development 138, 812 667-676. 813 Frith, T. J., Granata, I., Wind, M., Stout, E., Thompson, O., Neumann, K., Stavish, D., Heath, P. 814 R., Ortmann, D., Hackland, J. O., et al. (2018). Human axial progenitors generate trunk 815 neural crest cells in vitro. eLife 7. 816 Fukuta, M., Nakai, Y., Kirino, K., Nakagawa, M., Sekiguchi, K., Nagata, S., Matsumoto, Y., 817 Yamamoto, T., Umeda, K., Heike, T., et al. (2014). Derivation of mesenchymal stromal cells 818 from pluripotent stem cells through a neural crest lineage using small molecule compounds 819 with defined media. PLoS ONE 9, e112291. 820 Garcıa-Castro, M. n. I., Marcelle, C. and Bronner-Fraser, M. (2002). Ectodermal Wnt Function as 821 a Neural Crest Inducer. Science 297, 848-851. 822 Goentoro, L. and Kirschner, M. W. (2009). Evidence that fold-change, and not absolute level, of 823 beta-catenin dictates Wnt signaling. Molecular cell 36, 872-884. 824 Greco, T. L., Takada, S., Newhouse, M. M., McMahon, J. A., McMahon, A. P. and Camper, S. A. 825 (1996). Analysis of the vestigial tail mutation demonstrates that Wnt-3a gene dosage 826 regulates mouse axial development. Genes & Development 10, 313-324. 827 Grigoryan, T., Wend, P., Klaus, A. and Birchmeier, W. (2008). Deciphering the function of 828 canonical Wnt signals in development and disease: conditional loss- and gain-of-function 829 mutations of beta-catenin in mice. Genes & Development 22, 2308-2341. 830 Hackland, J. O. S., Frith, T. J. R., Thompson, O., Marin Navarro, A., García-Castro, M. I., Unger, 831 C. and Andrews, P. W. (2017). Top-Down Inhibition of BMP Signaling Enables Robust 832 Induction of hPSCs Into Neural Crest in Fully Defined, Xeno-free Conditions. Stem Cell 833 Reports 9, 1043-1052. 834 Hao, J., Ho, J. N., Lewis, J. A., Karim, K. A., Daniels, R. N., Gentry, P. R., Hopkins, C. R., 835 Lindsley, C. W. and Hong, C. C. (2010). In VivoStructure−Activity Relationship Study of 836 Dorsomorphin Analogues Identifies Selective VEGF and BMP Inhibitors. ACS Chemical 837 Biology 5, 245-253. 838 Harrison, S. M., Houzelstein, D., Dunwoodie, S. L. and Beddington, R. S. (2000). Sp5, a new 839 member of the Sp1 family, is dynamically expressed during development and genetically 840 interacts with Brachyury. Developmental Biology 227, 358-372. 841 Heasman, J., Crawford, A., Goldstone, K., Garner-Hamrick, P., Gumbiner, B., McCrea, P., 842 Kintner, C., Noro, C. Y. and Wylie, C. (1994). Overexpression of cadherins and 843 underexpression of beta-catenin inhibit dorsal mesoderm induction in early Xenopus 844 embryos. Cell 79, 791-803. 845 Henrique, D., Abranches, E., Verrier, L. and Storey, K. G. (2015). Neuromesodermal progenitors 846 and the making of the spinal cord. Development 142, 2864-2875. 847 Huang, M., Miller, M. L., McHenry, L. K., Zheng, T., Zhen, Q., Ilkhanizadeh, S., Conklin, B. R., 848 Bronner, M. E. and Weiss, W. A. (2016). Generating trunk neural crest from human 849 pluripotent stem cells. Scientific Reports 6, 19727. bioRxiv preprint doi: https://doi.org/10.1101/514570; this version posted January 8, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

850 Ikeya, M. and Takada, S. (2001). Wnt-3a is required for somite specification along the 851 anteroposterior axis of the mouse embryo and for regulation of cdx-1 expression. 852 Mechanisms of Development 103, 27-33. 853 Jho, E.-h., Zhang, T., Domon, C., Joo, C.-K., Freund, J.-N. and Costantini, F. (2002). Wnt/beta- 854 catenin/Tcf signaling induces the transcription of Axin2, a negative regulator of the signaling 855 pathway. Molecular and Cellular Biology 22, 1172-1183. 856 Jiang, X., Gwye, Y., McKeown, S. J., Bronner-Fraser, M., Lutzko, C. and Lawlor, E. R. (2009). 857 Isolation and characterization of neural crest stem cells derived from in vitro-differentiated 858 human embryonic stem cells. Stem cells and development 18, 1059-1070. 859 Kam, R. K. T., Deng, Y., Chen, Y. and Zhao, H. (2012). Retinoic acid synthesis and functions in 860 early embryonic development. Cell & bioscience 2, 11. 861 Khudyakov, J. and Bronner-Fraser, M. (2009). Comprehensive spatiotemporal analysis of early 862 chick neural crest network genes. Developmental Dynamics 238, 716-723. 863 Kiecker, C. and Niehrs, C. (2001). A morphogen gradient of Wnt/beta-catenin signalling regulates 864 anteroposterior neural patterning in Xenopus. Development 128, 4189-4201. 865 Kim, C. H., Oda, T., Itoh, M., Jiang, D., Artinger, K. B., Chandrasekharappa, S. C., Driever, W. 866 and Chitnis, A. B. (2000). Repressor activity of Headless/Tcf3 is essential for vertebrate 867 head formation. Nature 407, 913-916. 868 Kirkeby, A., Grealish, S., Wolf, D. A., Nelander, J., Wood, J., Lundblad, M., Lindvall, O. and 869 Parmar, M. (2012). Generation of Regionally Specified Neural Progenitors and Functional 870 Neurons from Human Embryonic Stem Cells under Defined Conditions. CellReports 1, 703- 871 714. 872 Kudoh, T., Wilson, S. W. and Dawid, I. B. (2002). Distinct roles for Fgf, Wnt and retinoic acid in 873 posteriorizing the neural ectoderm. Development 129, 4335-4346. 874 Kulesa, P. M. and Fraser, S. E. (1998). Neural crest cell dynamics revealed by time-lapse video 875 microscopy of whole embryo chick explant cultures. Developmental Biology 204, 327-344. 876 LaBonne, C. and Bronner-Fraser, M. (1998). Neural crest induction in Xenopus: evidence for a 877 two-signal model. Development 125, 2403-2414. 878 Lagutin, O. V., Zhu, C. C., Kobayashi, D., Topczewski, J., Shimamura, K., Puelles, L., Russell, 879 H. R. C., McKinnon, P. J., Solnica-Krezel, L. and Oliver, G. (2003). Six3 repression of Wnt 880 signaling in the anterior neuroectoderm is essential for vertebrate forebrain development. 881 Genes & Development 17, 368-379. 882 Lee, E., Salic, A., Krüger, R., Heinrich, R. and Kirschner, M. W. (2003). The roles of APC and 883 Axin derived from experimental and theoretical analysis of the Wnt pathway. PLoS Biology 1, 884 E10. 885 Lee, G., Kim, H., Elkabetz, Y., Al Shamy, G., Panagiotakos, G., Barberi, T., Tabar, V. and 886 Studer, L. (2007). Isolation and directed differentiation of neural crest stem cells derived 887 from human embryonic stem cells. Nature Biotechnology 25, 1468-1475. 888 Lemaire, P., Garrett, N. and Gurdon, J. B. (1995). Expression cloning of Siamois, a Xenopus 889 homeobox gene expressed in dorsal-vegetal cells of blastulae and able to induce a complete 890 secondary axis. Cell 81, 85-94. 891 Leung, A. W., Murdoch, B., Salem, A. F., Prasad, M. S., Gomez, G. A. and García-Castro, M. I. 892 (2016). WNT/β-catenin signaling mediates human neural crest induction via a pre-neural 893 border intermediate. Development 143, 398-410. 894 Lewis, J. L., Bonner, J., Modrell, M., Ragland, J. W., Moon, R. T., Dorsky, R. I. and Raible, D. 895 W. (2004). Reiterated Wnt signaling during zebrafish neural crest development. 896 Development 131, 1299-1308. 897 Li, B., Kuriyama, S., Moreno, M. and Mayor, R. (2009). The posteriorizing gene Gbx2 is a direct 898 target of Wnt signalling and the earliest factor in neural crest induction. Development 136, 899 3267-3278. 900 Lian, X., Bao, X., Al-Ahmad, A., Liu, J., Wu, Y., Dong, W., Dunn, K. K., Shusta, E. V. and 901 Palecek, S. P. (2014). Efficient differentiation of human pluripotent stem cells to endothelial 902 progenitors via small-molecule activation of WNT signaling. Stem Cell Reports 3, 804-816. bioRxiv preprint doi: https://doi.org/10.1101/514570; this version posted January 8, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

903 Lian, X., Hsiao, C., Wilson, G., Zhu, K., Hazeltine, L. B., Azarin, S. M., Raval, K. K., Zhang, J., 904 Kamp, T. J. and Palecek, S. P. (2012). Robust cardiomyocyte differentiation from human 905 pluripotent stem cells via temporal modulation of canonical Wnt signaling. Proceedings of the 906 National Academy of Sciences of the United States of America 109, E1848-1857. 907 Liem, K. F., Tremml, G. and Jessell, T. M. (1997). A role for the roof plate and its resident 908 TGFbeta-related proteins in neuronal patterning in the dorsal spinal cord. Cell 91, 127-138. 909 Linker, C. and Stern, C. D. (2004). Neural induction requires BMP inhibition only as a late step, and 910 involves signals other than FGF and Wnt antagonists. Development 131, 5671-5681. 911 Liu, Q., Spusta, S. C., Mi, R., Lassiter, R. N. T., Stark, M. R., Höke, A., Rao, M. S. and Zeng, X. 912 (2012). Human neural crest stem cells derived from human ESCs and induced pluripotent 913 stem cells: induction, maintenance, and differentiation into functional schwann cells. Stem 914 cells translational medicine 1, 266-278. 915 Liu, T., Lee, Y.-N., Malbon, C. C. and Wang, H.-y. (2002). Activation of the beta-catenin/Lef-Tcf 916 pathway is obligate for formation of primitive endoderm by mouse F9 totipotent 917 teratocarcinoma cells in response to retinoic acid. Journal of Biological Chemistry 277, 918 30887-30891. 919 Loh, K. M., van Amerongen, R. and Nusse, R. (2016). Generating Cellular Diversity and Spatial 920 Form: Wnt Signaling and the Evolution of Multicellular Animals. Developmental Cell 38, 643- 921 655. 922 Loudig, O., Babichuk, C., White, J., Abu-Abed, S., Mueller, C. and Petkovich, M. (2000). 923 Cytochrome P450RAI(CYP26) Promoter: A Distinct Composite Retinoic Acid Response 924 Element Underlies the Complex Regulation of Retinoic Acid Metabolism. Molecular 925 Endocrinology 14, 1483-1497. 926 Lu, J., Zhong, X., Liu, H., Hao, L., Huang, C. T.-L., Sherafat, M. A., Jones, J., Ayala, M., Li, L. 927 and Zhang, S. C. (2016). Generation of serotonin neurons from human pluripotent stem 928 cells. Nature Biotechnology 34, 89-94. 929 Mancilla, A. and Mayor, R. (1996). Neural crest formation in Xenopus laevis: mechanisms of Xslug 930 induction. Developmental Biology 177, 580-589. 931 Maretto, S., Cordenonsi, M., Dupont, S., Braghetta, P., Broccoli, V., Hassan, A. B., Volpin, D., 932 Bressan, G. M. and Piccolo, S. (2003). Mapping Wnt/beta-catenin signaling during mouse 933 development and in colorectal tumors. Proceedings of the National Academy of Sciences of 934 the United States of America 100, 3299-3304. 935 Martínez-Morales, P. L., del Corral, R. D., Olivera-Martinez, I., Quiroga, A. C., Das, R. M., 936 Barbas, J. A., Storey, K. G. and Morales, A. V. (2011). FGF and retinoic acid activity 937 gradients control the timing of neural crest cell emigration in the trunk. The Journal of Cell 938 Biology, jcb.201011077. 939 Masuda, T. and Ishitani, T. (2017). Context-dependent regulation of the β-catenin transcriptional 940 complex supports diverse functions of Wnt/β-catenin signaling. Journal of Biochemistry 161, 941 9-17. 942 McGonnell, I. M. and Graham, A. (2002). Trunk neural crest has skeletogenic potential. Current 943 Biology 12, 767-771. 944 McGrew, L. L., Hoppler, S. and Moon, R. T. (1997). Wnt and FGF pathways cooperatively pattern 945 anteroposterior neural ectoderm in Xenopus. Mechanisms of Development 69, 105-114. 946 McGrew, L. L., Lai, C. J. and Moon, R. T. (1995). Specification of the anteroposterior neural axis 947 through synergistic interaction of the Wnt signaling cascade with noggin and follistatin. 948 Developmental Biology 172, 337-342. 949 McGrew, M. J., Sherman, A., Lillico, S. G., Ellard, F. M., Radcliffe, P. A., Gilhooley, H. J., 950 Mitrophanous, K. A., Cambray, N., Wilson, V. and Sang, H. (2008). Localised axial 951 progenitor cell populations in the avian tail bud are not committed to a posterior Hox identity. 952 Development 135, 2289-2299. 953 McMahon, A. P. and Moon, R. T. (1989). Ectopic expression of the proto-oncogene int-1 in 954 Xenopus embryos leads to duplication of the embryonic axis. Cell 58, 1075-1084. bioRxiv preprint doi: https://doi.org/10.1101/514570; this version posted January 8, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

955 Menendez, L., Yatskievych, T. A., Antin, P. B. and Dalton, S. (2011). Wnt signaling and a Smad 956 pathway blockade direct the differentiation of human pluripotent stem cells to multipotent 957 neural crest cells. Proceedings of the National Academy of Sciences of the United States of 958 America 108, 19240-19245. 959 Mica, Y., Lee, G., Chambers, S. M., Tomishima, M. J. and Studer, L. (2013). Modeling neural 960 crest induction, melanocyte specification, and disease-related pigmentation defects in 961 hESCs and patient-specific iPSCs. CellReports 3, 1140-1152. 962 Michaelidis, T. M. and Lie, D. C. (2008). Wnt signaling and neural stem cells: caught in the Wnt 963 web. Cell and tissue research 331, 193-210. 964 Minowada, G., Jarvis, L. A., Chi, C. L., Neubüser, A., Sun, X., Hacohen, N., Krasnow, M. A. and 965 Martin, G. R. (1999). Vertebrate Sprouty genes are induced by FGF signaling and can cause 966 chondrodysplasia when overexpressed. Development 126, 4465-4475. 967 Morkel, M., Huelsken, J., Wakamiya, M., Ding, J., van de Wetering, M., Clevers, H., Taketo, M. 968 M., Behringer, R. R., Shen, M. M. and Birchmeier, W. (2003). Beta-catenin regulates 969 Cripto- and Wnt3-dependent gene expression programs in mouse axis and mesoderm 970 formation. Development 130, 6283-6294. 971 Moro, E., Ozhan-Kizil, G., Mongera, A., Beis, D., Wierzbicki, C., Young, R. M., Bournele, D., 972 Domenichini, A., Valdivia, L. E., Lum, L., et al. (2012). In vivo Wnt signaling tracing 973 through a transgenic biosensor fish reveals novel activity domains. Developmental Biology 974 366, 327-340. 975 Naujok, O., Diekmann, U. and Lenzen, S. (2014). The generation of definitive endoderm from 976 human embryonic stem cells is initially independent from activin A but requires canonical 977 Wnt-signaling. Stem cell reviews 10, 480-493. 978 Nelson, W. J. and Nusse, R. (2004). Convergence of Wnt, beta-catenin, and cadherin pathways. 979 Science 303, 1483-1487. 980 Niederreither, K., Vermot, J., Schuhbaur, B., Chambon, P. and Dollé, P. (2000). Retinoic acid 981 synthesis and hindbrain patterning in the mouse embryo. Development 127, 75-85. 982 Niehrs, C. and Acebron, S. P. (2012). Mitotic and mitogenic Wnt signalling. The EMBO Journal 31, 983 2705-2713. 984 Nordström, U., Jessell, T. M. and Edlund, T. (2002). Progressive induction of caudal neural 985 character by graded Wnt signaling. Nature neuroscience 5, 525-532. 986 O’Rahilly, R. and Müller, F. (2007). The development of the neural crest in the human. Journal of 987 anatomy 211, 335-351. 988 Olivera-Martinez, I. and Storey, K. G. (2007). Wnt signals provide a timing mechanism for the FGF- 989 retinoid differentiation switch during vertebrate body axis extension. Development 134, 2125- 990 2135. 991 Park, D.-S., Seo, J.-H., Hong, M., Bang, W., Han, J.-K. and Choi, S.-C. (2013). Role of Sp5 as an 992 essential early regulator of neural crest specification in xenopus. Developmental Dynamics 993 242, 1382-1394. 994 Patthey, C., Edlund, T. and Gunhaga, L. (2009). Wnt-regulated temporal control of BMP exposure 995 directs the choice between neural plate border and epidermal fate. Development 136, 73-83. 996 Patthey, C. and Gunhaga, L. (2014). Signaling pathways regulating ectodermal cell fate choices. 997 Experimental Cell Research 321, 11-16. 998 Petersen, C. P. and Reddien, P. W. (2009). Wnt signaling and the polarity of the primary body axis. 999 Cell 139, 1056-1068. 1000 Pla, P. and Monsoro-Burq, A. H. (2018). The Neural Border: Induction, Specification and 1001 Maturation of the territory that generates Neural Crest cells. Developmental Biology. 1002 Plouhinec, J.-L., Roche, D. D., Pegoraro, C., Figueiredo, A. L., Maczkowiak, F., Brunet, L. J., 1003 Milet, C., Vert, J.-P., Pollet, N., Harland, R. M., et al. (2014). Pax3 and Zic1 trigger the 1004 early neural crest gene regulatory network by the direct activation of multiple key neural crest 1005 specifiers. Developmental Biology 386, 461-472. bioRxiv preprint doi: https://doi.org/10.1101/514570; this version posted January 8, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1006 Pomp, O., Brokhman, I., Ben-Dor, I., Reubinoff, B. and Goldstein, R. S. (2005). Generation of 1007 peripheral sensory and sympathetic neurons and neural crest cells from human embryonic 1008 stem cells. Stem cells (Dayton, Ohio) 23, 923-930. 1009 Rada-Iglesias, A., Bajpai, R., Prescott, S., Brugmann, S. A., Swigut, T. and Wysocka, J. (2012). 1010 Epigenomic annotation of enhancers predicts transcriptional regulators of human neural 1011 crest. Cell Stem Cell 11, 633-648. 1012 Ring, D. B., Johnson, K. W., Henriksen, E. J., Nuss, J. M., Goff, D., Kinnick, T. R., Ma, S. T., 1013 Reeder, J. W., Samuels, I., Slabiak, T., et al. (2003). Selective Glycogen Synthase Kinase 1014 3 Inhibitors Potentiate Insulin Activation of Glucose Transport and Utilization In Vitro and In 1015 Vivo. Diabetes 52, 588-595. 1016 Rogers, K. W. and Schier, A. F. (2011). Morphogen gradients: from generation to interpretation. 1017 Annual review of cell and developmental biology 27, 377-407. 1018 Saint-Jeannet, J. P., He, X., Varmus, H. E. and Dawid, I. B. (1997). Regulation of dorsal fate in the 1019 neuraxis by Wnt-1 and Wnt-3a. Proceedings of the National Academy of Sciences of the 1020 United States of America 94, 13713-13718. 1021 Sakai, D. and Wakamatsu, Y. (2005). Regulatory mechanisms for neural crest formation. Cells, 1022 tissues, organs 179, 24-35. 1023 Sanchez-Ferras, O., Bernas, G., Farnos, O., Touré, A. M., Souchkova, O. and Pilon, N. (2016). 1024 A direct role for murine Cdx proteins in the trunk neural crest gene regulatory network. 1025 Development 143, 1363-1374. 1026 Sanchez-Ferras, O., Coutaud, B., Djavanbakht Samani, T., Tremblay, I., Souchkova, O. and 1027 Pilon, N. (2012). Caudal-related homeobox (Cdx) protein-dependent integration of canonical 1028 Wnt signaling on paired-box 3 (Pax3) neural crest enhancer. The Journal of biological 1029 chemistry 287, 16623-16635. 1030 Selleck, M. A., García-Castro, M. I., Artinger, K. B. and Bronner-Fraser, M. (1998). Effects of Shh 1031 and Noggin on neural crest formation demonstrate that BMP is required in the neural tube 1032 but not ectoderm. Development 125, 4919-4930. 1033 Sheng, N., Xie, Z., Wang, C., Bai, G., Zhang, K., Zhu, Q., Song, J., Guillemot, F., Chen, Y.-G., 1034 Lin, A., et al. (2010). Retinoic acid regulates bone morphogenic protein signal duration by 1035 promoting the degradation of phosphorylated Smad1. Proceedings of the National Academy 1036 of Sciences of the United States of America 107, 18886-18891. 1037 Shimizu, T., Bae, Y.-K. and Hibi, M. (2006). Cdx-Hox code controls competence for responding to 1038 Fgfs and retinoic acid in zebrafish neural tissue. Development 133, 4709-4719. 1039 Shimizu, T., Bae, Y.-K., Muraoka, O. and Hibi, M. (2005). Interaction of Wnt and caudal-related 1040 genes in zebrafish posterior body formation. Developmental Biology 279, 125-141. 1041 Simoes-Costa, M. and Bronner, M. E. (2016). Reprogramming of avian neural crest axial identity 1042 and cell fate. Science 352, 1570-1573. 1043 Smith, W. C. and Harland, R. M. (1991). Injected Xwnt-8 RNA acts early in Xenopus embryos to 1044 promote formation of a vegetal dorsalizing center. Cell 67, 753-765. 1045 Sokol, S., Christian, J. L., Moon, R. T. and Melton, D. A. (1991). Injected Wnt RNA induces a 1046 complete body axis in Xenopus embryos. Cell 67, 741-752. 1047 Sparks, N. R. L., Martinez, I. K. C., Soto, C. H. and Zur Nieden, N. I. (2018). Low Osteogenic Yield 1048 in Human Pluripotent Stem Cells Associates with Differential Neural Crest Promoter 1049 Methylation. Stem cells (Dayton, Ohio) 36, 349-362. 1050 Stavridis, M. P., Collins, B. J. and Storey, K. G. (2010). Retinoic acid orchestrates fibroblast 1051 growth factor signalling to drive embryonic stem cell differentiation. Development 137, 881- 1052 890. 1053 Steinhart, Z. and Angers, S. (2018). Wnt signaling in development and tissue homeostasis. 1054 Development 145, dev146589. 1055 Stuhlmiller, T. J. and García-Castro, M. I. (2012a). Current perspectives of the signaling pathways 1056 directing neural crest induction. Cellular and molecular life sciences : CMLS 69, 3715-3737. 1057 ---- (2012b). FGF/MAPK signaling is required in the gastrula epiblast for avian neural crest induction. 1058 Development 139, 289-300. bioRxiv preprint doi: https://doi.org/10.1101/514570; this version posted January 8, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1059 Taelman, V. F., Dobrowolski, R., Plouhinec, J.-L., Fuentealba, L. C., Vorwald, P. P., Gumper, I., 1060 Sabatini, D. D. and De Robertis, E. M. (2010). Wnt signaling requires sequestration of 1061 glycogen synthase kinase 3 inside multivesicular endosomes. Cell 143, 1136-1148. 1062 Tan, C. W., Gardiner, B. S., Hirokawa, Y., Layton, M. J., Smith, D. W. and Burgess, A. W. 1063 (2012). Wnt signalling pathway parameters for mammalian cells. PLoS ONE 7, e31882. 1064 Tice, D. A., Szeto, W., Soloviev, I., Rubinfeld, B., Fong, S. E., Dugger, D. L., Winer, J., Williams, 1065 P. M., Wieand, D., Smith, V., et al. (2002). Synergistic induction of tumor antigens by Wnt-1 1066 signaling and retinoic acid revealed by gene expression profiling. Journal of Biological 1067 Chemistry 277, 14329-14335. 1068 Vijayasurian Easwaran, M. P. S. and Byers, S. (1999). Cross-regulation of β-catenin–LEF/TCF 1069 and retinoid signaling pathways. Current Biology 9, 1415-1419. 1070 Villanueva, S., Glavic, A., Ruiz, P. and Mayor, R. (2002). Posteriorization by FGF, Wnt, and 1071 retinoic acid is required for neural crest induction. Developmental Biology 241, 289-301. 1072 Wagner, F. F., Bishop, J. A., Gale, J. P., Shi, X., Walk, M., Ketterman, J., Patnaik, D., Barker, D., 1073 Walpita, D., Campbell, A. J., et al. (2016). Inhibitors of Glycogen Synthase Kinase 3 with 1074 Exquisite Kinome-Wide Selectivity and Their Functional Effects. ACS Chemical Biology 11, 1075 1952-1963. 1076 Wilson, P. A. and Hemmati-Brivanlou, A. (1995). Induction of epidermis and inhibition of neural 1077 fate by Bmp-4. Nature 376, 331-333. 1078 Wilson, V., Olivera-Martinez, I. and Storey, K. G. (2009). Stem cells, signals and vertebrate body 1079 axis extension. Development 136, 1591-1604. 1080 Wymeersch, F. J., Huang, Y., Blin, G., Cambray, N., Wilkie, R., Wong, F. C. K. and Wilson, V. 1081 (2016). Position-dependent plasticity of distinct progenitor types in the primitive streak. eLife 1082 5, e10042. 1083 Yamaguchi, T. P., Takada, S., Yoshikawa, Y., Wu, N. and McMahon, A. P. (1999). T (Brachyury) 1084 is a direct target of Wnt3a during paraxial mesoderm specification. Genes & 1085 Development 13, 3185-3190. 1086 Yardley, N. and García-Castro, M. I. (2012). FGF signaling transforms non-neural ectoderm into 1087 neural crest. Developmental Biology 372, 166-177. 1088 Zhang, X., Huang, C. T., Chen, J., Pankratz, M. T., Xi, J., Li, J., Yang, Y., Lavaute, T. M., Li, X.- 1089 J., Ayala, M., et al. (2010). Pax6 is a human neuroectoderm cell fate determinant. Cell Stem 1090 Cell 7, 90-100. 1091 1092 1093 1094 1095 1096 1097 1098 1099 1100 1101 1102 1103 Figure Legends 1104 Fig. 1. Axial identity of NCCs formed from hESCs is dependent on WNT magnitude, and 1105 posterior NCCs retain NC differentiation potential 1106 (A) Immunofluorescence (IF) expression of PAX7 (red) and SOX10 (green) on day 5 after 0-2 day 1107 treatment with CHIR at defined concentrations. bioRxiv preprint doi: https://doi.org/10.1101/514570; this version posted January 8, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1108 (B) IF expression of PAX6 (red) and SOX10 (green) on day 5 after 0-2 day treatment with CHIR at 1109 defined concentrations. 1110 (C) Average percentage of nuclei expressing PAX7 and SOX10 on day 5 by IF. Error bars are + 1111 SEM and *reflects p<0.05 by t-test. 1112 (D) RT-qPCR expression levels of NC genes ZIC1, ETS1, FOXD3 (left) and PAX7, SNAI2, SOX10 1113 (center); and anterior NCs OTX2, DMBX1 (right) on day 5 at CHIR concentrations indicated on the x- 1114 axis. Fold change is relative to hESC and normalized by housekeeping genes. Error bars are + 1115 SEM, and data was evaluated by student t-test with each condition tested against the NO CHIR 1116 condition * p<0.05 **p<0.05 ***p<0.005 1117 (E) IF expression of HOXB4 (red) at 3μM CHIR and 10μM CHIR. 1118 (F) RT-qPCR on day 5 for cultures ranging from 3 thru 10μM CHIR, assessing HOXB1, HOXB2, 1119 HOXB4 and HOXC9 with fold change graphed relative to ESCs and normalized by housekeeping 1120 genes. Error bars represent + SEM. 1121 (G) IF of time-course images of PAX7 (red) and SOX10 (green) after 0-2 Day treatment with either 1122 3μM CHIR (top row) or 10μM CHIR (bottom row). Each column represents a different day of culture 1123 following hESC dissociation and seeding on D0, with a day defined as 24 hours. 1124 (H) RT-qPCR expression levels of neural crest markers PAX3, MSX1, PAX7, SOX10 (top row, 1125 columns 1-4), pluripotency markers OCT4, NANOG, KLF4, SOX2 (bottom row, columns 1-4) or WNT 1126 response markers AXIN2, SP5 (column 5) after NO CHIR (black) 3μM CHIR (blue) or 10μM CHIR 1127 (red) treatment on days 0-2 of culture. Fold change is relative to hESC and normalized by 1128 housekeeping genes. Error bars are + SEM. 1129 (I) Terminal derivatives obtained from day 5 NCCs induced with 10μM CHIR. Osteoblasts stained 1130 with Von Kossa stain,and IF stains for Smooth Muscle, α-SMA (red) & Vimentin (green); Peripheral 1131 Neurons, Peripherin (green) & β-Tubulin (red); Glia, S100β (green) & DAPI (blue); Melanoblasts, 1132 SOX10 (green) & MITF (red). 1133 Nuclei stained with DAPI (blue) where indicated. Scale bars: 225μm in A, and 100μm in B, E, G. 1134 1135 Fig. 2. Prolonged treatment with CHIR re-directs the fate of NCCs toward paraxial mesoderm 1136 progenitors. 1137 (A) IF expression on day 5 of PAX7 (red) and SOX10 (green) following treatment with 10μM CHIR 1138 for the duration designated at the top of each image, nuclei were counterstained with DAPI. 1139 (B) RT-qPCR evaluation of neural crest markers PAX3, PAX7, FOXD3 and SOX10 on day5 for NO 1140 CHIR controls, CON, and 3μM or 10μM CHIR for durations indicated on the x-axis. Fold change is 1141 relative to hESC and normalized by housekeeping genes. bioRxiv preprint doi: https://doi.org/10.1101/514570; this version posted January 8, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1142 (C) RT-qPCR for mesoderm genes TBXT, MSGN1 and TBX6 on day 5 following treatment with 1143 either 3μM or 10μM CHIR for the durations indicated on x-axis. Student t-test was used to compare 1144 fold changes between the two doses in matching days of treatment, * p<0.05 ***p<0.005 1145 ****p<0.0005. 1146 (D) IF expression of SOX2 (red) and TBXT (green) during the first 3 days in NO CHIR and 2 day 1147 treatment with 10μM CHIR. 1148 (Sheng et al., 2010) Daily RT-qPCR for genes associated with NMPs, TBXT, MSGN1, NKX1-2, 1149 FGF8, CDX1, CDX2. Error bars are + SEM, statistical significance was evaluated by t-test between 1150 treated and un-treated groups for each corresponding day *p<0.05, **p <0.005, ***p<0.0005, 1151 ****p<0.00005. 1152 Nuclei stained with DAPI (blue). Scale bar: 100μm 1153 1154 Fig. 3. Induction of posterior NCCs requires BMP signaling. 1155 (A) IF expressoin of PAX7 (red) and SOX10 (green) in top row, and HOXB4 (red) in bottom row on 1156 day 5 after 0-2 day 10μM CHIR treatment; 10μM CHIR plus 0-5 day addition of 1μM DMH1 (column 1157 2) or 10μM DMH1 (column3); or 10μM CHIR plus 0-1 day addition of 1μM DMH1 (column4) or 10μM 1158 DMH1 (column5). 1159 (B) Average percentage of nuclei expressing PAX7 or SOX10 on day 5 in 10μM CHIR without or 1160 with 0-1 day 1μM or 10μM DMH1. Error bars are + SEM and differences were evaluated by t-test 1161 relative to 10μM CHIR, ****p<0.00005. 1162 (C) RT-qPCR analysis on day 5 for experimental conditions defined in panel A: 10μM CHIR 1163 treatment on days 0-2 and either 1μM or 10μM DMH1 for 0-5 days or on 0-1 day only. NC genes 1164 PAX7, ETS1, FOXD3, SOX10 (left), and neural precursor genes PAX6 and SOX1 (right). Data is 1165 presented for experimental conditions relative to levels in 10μM CHIR. Errors bars represent + SEM. 1166 Statistics evaluated by one-way ANOVA and changes relative to 10μM CHIR are noted, *p<0.05, 1167 **p<0.005 1168 (D) IF expression of PAX7 (red) and SOX10 (green) of cultures analyzed on day 5. All conditions 1169 received 10μM CHIR on days 0-2 and addition of 10μM DMH1 on the days indicated above each 1170 image. 1171 Nuclei stained with DAPI (blue). Scale bars: 100μm 1172 1173 Fig. 4. FGF plays a passive role in the induction of posterior NCCs. 1174 (A) IF expression of PAX7 (red), SOX10 (green) in top row, and HOXB4 (red) in bottom row, of day 5 1175 cultures treated with 0-2 days 10μM CHIR, or supplemented with 0.2μM PD173074, PD17 (column bioRxiv preprint doi: https://doi.org/10.1101/514570; this version posted January 8, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1176 2) or 2μM PD17 (column 3) from 0-5 days, and 0.2μM PD17 (column 4) or 2μM PD17 (column 5) on 1177 day 1 (0-1D). 1178 (B) Average percentage of nuclei expressing PAX7 or SOX10 on day 5 by IF in 10μM CHIR without 1179 or with 0-5D PD17 (left) or 0-1D PD17 (right). Error bars are + SEM and differences were evaluated 1180 by t-test, * p<0.05, ** p<0.05. 1181 (C) RT-qPCR on day 5 for three conditions, 10μM CHIR, 10μMCHIR plus 0.2μM PD17 from 0-5 1182 days, and 10μM CHIR plus 0.2μM PD17 on day 0-1. NC genes evaluated SOX10, PAX7, FOXD3, 1183 ETS1 (left), and FGF response genes DUSP6 and SPRY2 (right). Fold change values are 1184 represented relative to 10μM CHIR on day 5. Error bars are + SEM, statistical significance was 1185 evaluated by t-test for each condition relative to 10μM CHIR **p <0.005, ***p<0.0005. 1186 Nuclei stained with DAPI (blue). Scale bars: 100μm 1187 1188 Fig. 5. RA is neither necessary for NC induction or posteriorization in high WNT conditions. 1189 (A) IF expression of PAX7 (red) and SOX10 (green), on day 5 in basal media containing (+) or 1190 lacking (-) Vitamin A (Vit.A). 1191 (B) RT-qPCR on day 5 for SOX10, ETS1, HOXB4 and HOXC9 in basal media with (+) or without (-) 1192 Vit.A after 0-2 day treatment with 3μM or 10μM CHIR. Fold changes are relative to ESCs and 1193 normalized by housekeeping genes. 1194 (C) IF expression of HOXB4 (red) in left 3 columns, and PAX7 (red) and SOX10 (green) in right 2 1195 columns on day 5 in cultures treated with NO CHIR, 3μM CHIR or 10μM CHIR on days 0-2 and 1196 either DMSO (0 RA), 1μM RA or 10μM RA on days 1-5. 1197 (D-F) RT-qPCR on day 5 in 3μM or 10μM CHIR with DMSO (0μM), 1μM, or 10μM RA for (D) NC 1198 genes SNAI2, SOX10 (left) and ETS1, FOXD3 (right). (E) RA response genes CRABP2 and 1199 CYP26A1. (F) Posterior identity HOXB4, HOXC9. Fold changes are relative to ESCs and normalized 1200 by housekeeping genes. Error bars are + SEM, statistical significance was evaluated by t-test for 1201 each condition relative to either 3μM CHIR or 10μM CHIR *p<0.05, **p <0.005, ***p<0.0005, 1202 ****p<0.00005. 1203 Nuclei stained with DAPI (blue). Scale bars: 100μm 1204 1205 bioRxiv preprint doi: https://doi.org/10.1101/514570; this version posted January 8, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. bioRxiv preprint doi: https://doi.org/10.1101/514570; this version posted January 8, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. bioRxiv preprint doi: https://doi.org/10.1101/514570; this version posted January 8, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. bioRxiv preprint doi: https://doi.org/10.1101/514570; this version posted January 8, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. bioRxiv preprint doi: https://doi.org/10.1101/514570; this version posted January 8, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.