DOCSLIB.ORG

Biomeseq: a Quantitative Approach for the Analysis Of

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Biomeseq: a Quantitative Approach for the Analysis Of BIOMESEQ: A QUANTITATIVE APPROACH FOR THE ANALYSIS OF ANIMAL MICROBIOMES AND ITS APPLICATION IN CHARACTERIZING THE MICROBIAL ECOLOGY OF AVIAN SPECIES by Kelly Ann Mulholland A dissertation submitted to the Faculty of the University of Delaware in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Bioinformatics and Systems Biology Spring 2020 © 2020 Kelly A. Mulholland All Rights Reserved BIOMESEQ: A QUANTITATIVE APPROACH FOR THE ANALYSIS OF ANIMAL MICROBIOMES AND ITS APPLICATION IN CHARACTERIZING THE MICROBIAL ECOLOGY OF AVIAN SPECIES by Kelly Ann Mulholland Approved: __________________________________________________________ Cathy H. Wu, Ph.D. Chair of Bioinformatics and Computational Biology Approved: __________________________________________________________ Mark Rieger, Ph.D. Dean of the College of Agriculture and Natural Resources Approved: __________________________________________________________ Douglas J. Doren, Ph.D. Interim Vice Provost for Graduate & Professional Education and Dean of the Graduate College I certify that I have read this dissertation and that in my opinion it meets the academic and professional standard required by the University as a dissertation for the degree of Doctor of Philosophy. Signed: __________________________________________________________ Calvin L. Keeler, Jr., Ph.D. Professor in charge of dissertation I certify that I have read this dissertation and that in my opinion it meets the academic and professional standard required by the University as a dissertation for the degree of Doctor of Philosophy. Signed: __________________________________________________________ Carl Schmidt, Ph.D. Member of dissertation committee I certify that I have read this dissertation and that in my opinion it meets the academic and professional standard required by the University as a dissertation for the degree of Doctor of Philosophy. Signed: __________________________________________________________ Shawn Polson, Ph.D. Member of dissertation committee I certify that I have read this dissertation and that in my opinion it meets the academic and professional standard required by the University as a dissertation for the degree of Doctor of Philosophy. Signed: __________________________________________________________ Timothy Johnson, Ph.D. Member of dissertation committee DEDICATION To my father for the lifetime of love and support you gave me in the short time we shared together. To Tyler for your overflowing love, your uplifting spirit and your unwavering patience after all this time. iv ACKNOWLEDGMENTS I would like to extend my gratitude to several people for their contribution to this work. First, I give my sincere thanks to my advisor and mentor, Dr. Calvin Keeler, for his immeasurable support, advice and guidance throughout this process. His enthusiasm and dedication to his work have been very inspiring to me. I would like to thank my committee members, Dr. Shawn Polson, Dr. Carl Schmidt and Dr. Timothy Johnson for their time and invaluable insight. Thank you to the members of the Keeler Research Group, both past and present. I would especially like to thank Monique for her many contributions to this work and Sharon for sharing her knowledge and insight over the years. I also wish to thank the many friends that I have made during my time in the Bioinformatics Student Association and the EmPOWER mentoring program that have made my time at the University of Delaware so wonderful. I would like to acknowledge the University of Delaware CANR Unique Strengths Dissertation Award and the Agriculture and Food Research Initiative Competitive Grant for the financial support to make this work possible. I am incredibly grateful to all of my family and friends for always believing in me and for their encouragement over these past few years. This dissertation would not have been possible without them. I wish to express my most sincere gratitude to my v partner, Tyler, for being my greatest supporter throughout this entire journey and for all he has done to ensure that I accomplished this goal. It was his love and belief in me that gave me the strength to continue during some of the more difficult times. Thank you to Bob for his guidance and endless support in all of my endeavors. I will always cherish our conversations and laughs over coffee and breakfast. I wish to thank Kathy, David and Kari for their generosity, advice and love over the years. Thank you to Amy for her unparalleled friendship and for making these past few years so enjoyable with our many adventures. I would also like to thank Gibbs for being such a great companion and source of happiness. I am grateful to my father for instilling his work ethic in me and for always encouraging me to achieve my goals no matter how big or small. Although we are unable to celebrate this milestone together, I know that he is immensely proud. Finally, I would like to thank my mother and sisters for all of their support. vi TABLE OF CONTENTS LIST OF TABLES ........................................................................................................ xi LIST OF FIGURES ..................................................................................................... xiii ABSTRACT ................................................................................................................ xvi Chapter 1 INTRODUCTION AND REVIEW OF LITERATURE .................................... 1 1.1 Microbiomes .............................................................................................. 1 1.1.1 Symbiotic Microbial Interactions with Healthy Host and Other Microbes ........................................................................................ 3 1.1.2 Dysbiotic Microbial Interactions with Diseased Host and Other Microbes ........................................................................................ 6 1.2 Respiratory Microbiome ............................................................................ 7 1.2.1 Healthy Mammalian Respiratory Microbiome .............................. 7 1.2.2 Mammalian Respiratory Microbiome Diseases ............................ 9 1.2.3 Avian Respiratory Microbiome ................................................... 11 1.2.4 Multifactorial Avian Respiratory Disease Complex ................... 12 1.3 Advancement of Technology for Detection of Microorganisms ............. 14 1.3.1 Next-Generation Sequencing Technology .................................. 16 1.3.2 16S Ribosomal RNA Sequencing ............................................... 17 1.3.3 Metagenomic Shotgun Sequencing ............................................. 19 1.4 Characterization of the Virome ............................................................... 20 1.4.1 Characterizing the Virome Using a Culture-Independent Approach ..................................................................................... 21 1.4.2 Challenges with Developing Comprehensive Computational Tools for Analysis of the Virome ................................................ 22 1.4.2.1 Quantification of the Virome ........................................ 23 vii 1.4.3 Existing Culture-Independent Tools for Virome Characterization and their Limitations ........................................ 24 1.5 Rationale and Objectives ......................................................................... 25 REFERENCES ................................................................................................. 27 2 BIOMESEQ: A TOOL FOR THE CHARACTERIZATION OF ANIMAL MICROBIOMES FROM METAGENOMIC DATA ...................................... 48 2.1 Summary .................................................................................................. 48 2.2 Introduction ............................................................................................. 49 2.3 Results ..................................................................................................... 52 2.3.1 Design and Development of BiomeSeq ...................................... 52 2.3.2 Validation of BiomeSeq .............................................................. 54 2.3.3 A Longitudinal Study of the Microbial Ecology of a Healthy Broiler Flock ................................................................................ 58 2.3.4 A Comparison of BiomeSeq bacterial results to 16S rRNA Results ......................................................................................... 60 2.4 Discussion ................................................................................................ 60 2.5 Materials and Methods ............................................................................ 66 2.5.1 Quality Trimming and Host Decontamination ............................ 67 2.5.2 Microbial Database Alignment .................................................... 67 2.5.3 Quantification and Output ........................................................... 68 2.5.4 Performance Metrics ................................................................... 69 2.5.5 A Longitudinal Study of the Microbial Ecology of a Healthy Broiler Flock ................................................................................ 71 2.5.6 Comparison of BiomeSeq Bacterial Results to 16S rRNA Results ......................................................................................... 72 REFERENCES ................................................................................................. 85 3 METAGENOMIC ANALYSIS OF THE RESPIRATORY MICROBIOME OF A HEALTHY
Load more

Recommended publications
  • Copyrighted Material
    CHAPTER 1 Viruses and Their Importance CHAPTER 1 AT A GLANCE Viruses infect: • Humans • Other vertebrates • Invertebrates Smallpox1 Bluetongue virus-infected sheep2 Tipula sp. larvae (leatherjackets) infected with invertebrate iridescent virus 1 • Plants • Fungi • Bacteria COPYRIGHTED MATERIAL Escherichia coli Delayed emergence of Damaged potato Mushroom virus X4 cell potato caused by tobacco (spraing) caused by with phage T4 attached5 rattle virus infection3 tobacco rattle virus infection3 1 cc01.indd01.indd 1 118/01/138/01/13 88:14:14 PPMM 2 CHAPTER 1 VIRUSES AND THEIR IMPORTANCE CHAPTER 1 AT A GLANCE (continued) Some viruses are useful: • Phage typing of bacteria • Sources of enzymes • Pesticides • Anti-bacterial agents • Anti-cancer agents • Gene vectors Viruses are parasites; they depend on cells for molecular building blocks, machinery, and energy. Virus particles are small; dimensions range approx. from 20–400 nm. A virus genome is composed of one of the following: double-stranded single-stranded double-stranded single-stranded DNA DNA RNA RNA Photographs reproduced with permission of 1 World Health Organization. 2 From Umeshappa et al . (2011) Veterinary Immunology and Immunopathology , 141, 230. Reproduced by permission of Elsevier and the authors. 3 MacFarlane and Robinson (2004) Chapter 11, Microbe-Vector Interactions in Vector-Borne Diseases , 63rd Symposium of the Society for General Microbiology, Cambridge University Press. Reprinted with permission. 4 University of Warwick. 5 Cornell Integrated Microscopy Center. The presence of viruses is obvious in host organ- 1.1 VIRUSES ARE UBIQUITOUS ON EARTH isms showing signs of disease. Many healthy organisms, however, are hosts of non-pathogenic virus infections, Viruses infect all cellular life forms: eukaryotes (ver- some of which are active, while some are quiescent.
    [Show full text]
  • Entwicklung Einer Software Zur Identifizierung Neuartiger Und
    Entwicklung einer Software zur Identifizierung neuartiger und bekannter Infektionserreger in klinischen Proben Dissertation zur Erlangung des Doktorgrades an der Fakult¨at fur¨ Mathematik, Informatik und Naturwissenschaften Fachbereich Biologie der Universit¨at Hamburg vorgelegt von Malik Alawi Hamburg, 2020 Vorsitzender der Prufungskommission¨ Dr. PD Andreas Pommerening-R¨oser Gutachter Professor Dr. Adam Grundhoff Professor Dr. Stefan Kurtz Datum der Disputation 30. April 2021 Abstract Sequencing of diagnostic samples is widely considered a key technology that may fun- damentally improve infectious disease diagnostics. The approach can not only identify pathogens already known to cause a specific disease, but may also detect pathogens that have not been previously attributed to this disease, as well as completely new, previously unknown pathogens. Therefore, it may significantly increase the level of preparedness for future outbreaks of emerging pathogens. This study describes the development and application of methods for the identification of pathogenic agents in diagnostic samples. The methods have been successfully applied multiple times under clinical conditions. The corresponding results have been published within the scope of this thesis. Finally, the methods were made available to the scientific community as an open source bioinformatics tool. The novel software was validated by conventional diagnostic methods and it was compared to established analysis pipelines using authentic clinical samples. It is able to identify pathogens from different diagnostic entities and often classifies viral agents down to strain level. Furthermore, the method is capable of assembling complete viral genomes, even from samples containing multiple closely related viral strains of the same viral family. In addition to an improved method for taxonomic classification, the software offers functionality which is not present in established analysis pipelines.
    [Show full text]
  • Nucleotide Amino Acid Size (Nt) #Orfs Marnavirus Heterosigma Akashiwo Heterosigma Akashiwo RNA Heterosigma Lang Et Al
    Supplementary Table 1: Summary of information for all viruses falling within the seven Marnaviridae genera in our analyses. Accession Genome Genus Species Virus name Strain Abbreviation Source Country Reference Nucleotide Amino acid Size (nt) #ORFs Marnavirus Heterosigma akashiwo Heterosigma akashiwo RNA Heterosigma Lang et al. , 2004; HaRNAV AY337486 AAP97137 8587 One Canada RNA virus 1 virus akashiwo Tai et al. , 2003 Marine single- ASG92540 Moniruzzaman et Classification pending Q sR OV 020 KY286100 9290 Two celled USA ASG92541 al ., 2017 eukaryotes Marine single- Moniruzzaman et Classification pending Q sR OV 041 KY286101 ASG92542 9328 One celled USA al ., 2017 eukaryotes APG78557 Classification pending Wenzhou picorna-like virus 13 WZSBei69459 KX884360 9458 One Bivalve China Shi et al ., 2016 APG78557 Classification pending Changjiang picorna-like virus 2 CJLX30436 KX884547 APG79001 7171 One Crayfish China Shi et al ., 2016 Beihai picorna-like virus 57 BHHQ57630 KX883356 APG76773 8518 One Tunicate China Shi et al ., 2016 Classification pending Beihai picorna-like virus 57 BHJP51916 KX883380 APG76812 8518 One Tunicate China Shi et al ., 2016 Marine single- ASG92530 Moniruzzaman et Classification pending N OV 137 KY130494 7746 Two celled USA ASG92531 al ., 2017 eukaryotes Hubei picorna-like virus 7 WHSF7327 KX884284 APG78434 9614 One Pill worm China Shi et al ., 2016 Classification pending Hubei picorna-like virus 7 WHCC111241 KX884268 APG78407 7945 One Insect China Shi et al ., 2016 Sanxia atyid shrimp virus 2 WHCCII13331 KX884278 APG78424 10445 One Insect China Shi et al ., 2016 Classification pending Freshwater atyid Sanxia atyid shrimp virus 2 SXXX37884 KX883708 APG77465 10400 One China Shi et al ., 2016 shrimp Labyrnavirus Aurantiochytrium single Aurantiochytrium single stranded BAE47143 Aurantiochytriu AuRNAV AB193726 9035 Three4 Japan Takao et al.
    [Show full text]
  • Pdf Available
    Virology 554 (2021) 89–96 Contents lists available at ScienceDirect Virology journal homepage: www.elsevier.com/locate/virology Diverse cressdnaviruses and an anellovirus identifiedin the fecal samples of yellow-bellied marmots Anthony Khalifeh a, Daniel T. Blumstein b,**, Rafaela S. Fontenele a, Kara Schmidlin a, C´ecile Richet a, Simona Kraberger a, Arvind Varsani a,c,* a The Biodesign Center for Fundamental and Applied Microbiomics, School of Life Sciences, Center for Evolution and Medicine, Arizona State University, Tempe, AZ, 85287, USA b Department of Ecology & Evolutionary Biology, Institute of the Environment & Sustainability, University of California Los Angeles, Los Angeles, CA, 90095, USA c Structural Biology Research Unit, Department of Clinical Laboratory Sciences, University of Cape Town, 7925, Cape Town, South Africa ARTICLE INFO ABSTRACT Keywords: Over that last decade, coupling multiple strand displacement approaches with high throughput sequencing have Marmota flaviventer resulted in the identification of genomes of diverse groups of small circular DNA viruses. Using a similar Anelloviridae approach but with recovery of complete genomes by PCR, we identified a diverse group of single-stranded vi­ Genomoviridae ruses in yellow-bellied marmot (Marmota flaviventer) fecal samples. From 13 fecal samples we identified viruses Cressdnaviricota in the family Genomoviridae (n = 7) and Anelloviridae (n = 1), and several others that ware part of the larger Cressdnaviricota phylum but not within established families (n = 19). There were also circular DNA molecules identified (n = 4) that appear to encode one viral-like gene and have genomes of <1545 nts. This study gives a snapshot of viruses associated with marmots based on fecal sampling.
    [Show full text]
  • Viral Diversity in Oral Cavity from Sapajus Nigritus by Metagenomic Analyses
    Brazilian Journal of Microbiology (2020) 51:1941–1951 https://doi.org/10.1007/s42770-020-00350-w ENVIRONMENTAL MICROBIOLOGY - RESEARCH PAPER Viral diversity in oral cavity from Sapajus nigritus by metagenomic analyses Raissa Nunes dos Santos1,2 & Fabricio Souza Campos2,3 & Fernando Finoketti1,2 & Anne Caroline dos Santos1,2 & Aline Alves Scarpellini Campos1,2,3 & Paulo Guilherme Carniel Wagner2,4 & Paulo Michel Roehe 1,2 & Helena Beatriz de Carvalho Ruthner Batista2,5 & Ana Claudia Franco1,2 Received: 20 January 2020 /Accepted: 25 July 2020 / Published online: 11 August 2020 # Sociedade Brasileira de Microbiologia 2020 Abstract Sapajus nigritus are non-human primates which are widespread in South America. They are omnivores and live in troops of up to 40 individuals. The oral cavity is one of the main entry routes for microorganisms, including viruses. Our study proposed the identification of viral sequences from oral swabs collected in a group of capuchin monkeys (n = 5) living in a public park in a fragment of Mata Atlantica in South Brazil. Samples were submitted to nucleic acid extraction and enrichment, which was followed by the construction of libraries. After high-throughput sequencing and contig assembly, we used a pipeline to identify 11 viral families, which are Herpesviridae, Parvoviridae, Papillomaviridae, Polyomaviridae, Caulimoviridae, Iridoviridae, Astroviridae, Poxviridae,andBaculoviridae, in addition to two complete viral genomes of Anelloviridae and Genomoviridae. Some of these viruses were closely related to known viruses, while other fragments are more distantly related, with 50% of identity or less to the currently available virus sequences in databases. In addition to host-related viruses, insect and small vertebrate-related viruses were also found, as well as plant-related viruses, bringing insights about their diet.
    [Show full text]
  • Table S1. Primers Used for PCR Amplification
    Table S1. Primers used for PCR amplification Name Primer Sequence (5’-3’) Gene target Taxon target Reference First PCR round DGGE analysis FGPH19 TACGGCAARGGTGGNATHG nifH Diazotrophic (Simonet et al. 1991) POLR ATSGCCATCATYTCRCCGGA nifH Diazotrophic (Poly et al. 2001) 799F AACMGGATTAGATACCCKG 16S rRNA Bacteria (Chelius and Triplett 2001) 1492R TACGGYTACCTTGTTACGACTT 16S rRNA Bacteria (Chelius and Triplett 2001) F203α CCGCATACGCCCTACGGGGGAAAGATTTAT 16S rRNA Alphaproteobacteria (Gomes et al. 2001) F948β CGCACAAGCGGTGGATGA 16S rRNA Betaproteobacteria (Gomes et al. 2001) F243HCG GGATGAGCCCGCGGCCTA 16S rRNA Actinobacteria (Heuer et al. 1997) BACF GGGAAACCGGGGCTAATACCGGAT 16S rRNA Firmicutes (Garbeva et al. 2003) Second PCR round DGGE analysis POLF-GC CGCCCGCCGCGCCCCGCGCCCGGCCCGCCCCCG nifH Diazotrophic (Poly et al. 2001) CCCCTGCGAYCCSAARGCBGACTC AQER GACGATGTAGATITCCTG nifH Diazotrophic (Poly et al. 2001) F968-GC CGCCCGGGGCGCGCCCCGGGCGGGGCGGGGGC 16S rRNA Bacteria (Heuer et al. 1999) ACGGGGGGAACGAAGAACCTTAC R1401 CGGTGTGTACAAGACCC 16S rRNA Bacteria (Heuer et al. 1997) qPCR analysis POLR ATSGCCATCATYTCRCCGGA nifH Diazotrophic (Poly et al. 2001) POLF TGCGAYCCSAARGCBGACTC nifH Diazotrophic (Poly et al. 2001) 6S-27F AGAGTTTGATCCTGGCTCAG 16S rRNA Bacteria Bulgari et al., 2014 338R GCTGCCTCCCGTAGGAGT 16S rRNA Bacteria Bulgari et al., 2014 Table 2. Primers used for Ion Torrent pyrosequencing analysis. Primer Primer sequence (5´-3´) Reference 967F-PP CNACGCGAAGAACCTTANC (Jünemann et al. 2012) 967F-UC1 CAACGCGAAAAACCTTACC (Jünemann et al. 2012) 967F-UC2 CAACGCGCAGAACCTTACC (Jünemann et al. 2012) 967F-UC3 ATACGCGARGAACCTTACC (Jünemann et al. 2012) 967F-AQ CTAACCGANGAACCTYACC (Jünemann et al. 2012) 1046R CGACAGCCATGCANCACCT (Jünemann et al. 2012) 1046R-PP CGACAACCATGCANCACCT (Jünemann et al. 2012) 1046R-AQ1 CGACGGCCATGCANCACCT (Jünemann et al. 2012) 1046R-AQ2 CGACGACCATGCANCACCT (Jünemann et al. 2012) Table S3. Alpha diversity indices. Statistical analysis of the total endophytic and diazotrophic endophytic bacterial community associated with sweet sorghum cv.
    [Show full text]
  • Cystic Fibrosis Mice Develop Spontaneouschronic Bordetella
    ISSN 2470-3176 SciO p Forschene n HUB for Sc i e n t i f i c R e s e a r c h Journal of Infectious Pulmonary Diseases Research Article Volume: 3.2 Open Access Received date: 11 Oct 2017; Accepted date: 28 Cystic Fibrosis Mice Develop Spontaneous Oct 2017; Published date: 02 Nov 2017. Chronic Bordetella Airway Infections Citation: Darrah R, Bonfield T, LiPuma JJ, Litman P, Hodges CA, et al. (2017) Cystic Fibrosis Mice Darrah R1*, Bonfield T2, LiPuma JJ3, Litman P1, Hodges CA4, Jacono F5 and Develop Spontaneous Chronic Bordetella Airway Drumm M6 Infections. J Infect Pulm Dis 3(2): doi http://dx.doi. org/10.16966/2470-3176.128 1Frances Payne Bolton School of Nursing, Case Western Reserve University, Cleveland Ohio, USA 2Department of Pediatrics, Case Western Reserve University, Cleveland Ohio, USA Copyright: © 2017 Darrah R, et al. This is an 3Department of Pediatrics and Communicable Diseases, University of Michigan Medical School, Ann open-access article distributed under the terms Arbor, Michigan, USA of the Creative Commons Attribution License, 4Departments of Radiology, Biomedical Engineering, and Pediatrics, Case Western Reserve University, which permits unrestricted use, distribution, and Cleveland Ohio, USA reproduction in any medium, provided the original 5Department of Medicine, Case Western Reserve University, and Louis Stokes VA Cleveland Medical author and source are credited. Center, USA 6Departments of Pediatrics and Genetics Genome Sciences, Case Western Reserve University, Cleveland Ohio, USA *Corresponding author: Rebecca Darrah, Frances Payne Bolton School of Nursing, Case Western Reserve University, Cleveland Ohio, USA, Tel: 216-368-4911; E-mail: [email protected] Abstract Chronic pulmonary disease and infection is the primary cause of morbidity and mortality in people with cystic fibrosis (CF).
    [Show full text]
  • Genetic Content and Evolution of Adenoviruses Andrew J
    Journal of General Virology (2003), 84, 2895–2908 DOI 10.1099/vir.0.19497-0 Review Genetic content and evolution of adenoviruses Andrew J. Davison,1 Ma´ria Benko´´ 2 and Bala´zs Harrach2 Correspondence 1MRC Virology Unit, Institute of Virology, Church Street, Glasgow G11 5JR, UK Andrew Davison 2Veterinary Medical Research Institute, Hungarian Academy of Sciences, H-1581 Budapest, [email protected] Hungary This review provides an update of the genetic content, phylogeny and evolution of the family Adenoviridae. An appraisal of the condition of adenovirus genomics highlights the need to ensure that public sequence information is interpreted accurately. To this end, all complete genome sequences available have been reannotated. Adenoviruses fall into four recognized genera, plus possibly a fifth, which have apparently evolved with their vertebrate hosts, but have also engaged in a number of interspecies transmission events. Genes inherited by all modern adenoviruses from their common ancestor are located centrally in the genome and are involved in replication and packaging of viral DNA and formation and structure of the virion. Additional niche-specific genes have accumulated in each lineage, mostly near the genome termini. Capture and duplication of genes in the setting of a ‘leader–exon structure’, which results from widespread use of splicing, appear to have been central to adenovirus evolution. The antiquity of the pre-vertebrate lineages that ultimately gave rise to the Adenoviridae is illustrated by morphological similarities between adenoviruses and bacteriophages, and by use of a protein-primed DNA replication strategy by adenoviruses, certain bacteria and bacteriophages, and linear plasmids of fungi and plants.
    [Show full text]
  • On the Stability of Sequences Inserted Into Viral Genomes Anouk Willemsen1,*,† and Mark P
    Virus Evolution, 2019, 5(2): vez045 doi: 10.1093/ve/vez045 Review article On the stability of sequences inserted into viral genomes Anouk Willemsen1,*,† and Mark P. Zwart2,*,‡ 1Laboratory MIVEGEC (UMR CNRS IRD University of Montpellier), Centre National de la Recherche Scientifique (CNRS), 911 Avenue Agropolis, BP 64501, 34394 Montpellier cedex 5, France and 2Netherlands Institute of Ecology (NIOO-KNAW), Postbus 50, 6700 AB, Wageningen, The Netherlands *Corresponding author: E-mail: [email protected]; [email protected] †http://orcid.org/0000-0002-8511-3244 ‡http://orcid.org/0000-0003-4361-7636 Abstract Viruses are widely used as vectors for heterologous gene expression in cultured cells or natural hosts, and therefore a large num- ber of viruses with exogenous sequences inserted into their genomes have been engineered. Many of these engineered viruses are viable and express heterologous proteins at high levels, but the inserted sequences often prove to be unstable over time and are rapidly lost, limiting heterologous protein expression. Although virologists are aware that inserted sequences can be unstable, processes leading to insert instability are rarely considered from an evolutionary perspective. Here, we review experimental work on the stability of inserted sequences over a broad range of viruses, and we present some theoretical considerations concerning insert stability. Different virus genome organizations strongly impact insert stability, and factors such as the position of insertion can have a strong effect. In addition, we argue that insert stability not only depends on the characteristics of a particular genome, but that it will also depend on the host environment and the demography of a virus population.
    [Show full text]
  • Isolation of Scopulariopsis Brevicaulis from Wistar Rats
    Etlik Vet Mikrobiyol Derg, 2020; 31 (2): 196-200 Case Report doi: https://doi.org/10.35864/evmd.768818 Olgu Sunumu Case report: Isolation of Scopulariopsis brevicaulis from Wistar Rats Özlem Şahan Yapıcıer1* , Mehmet Kaya2 , Zeki Erol3 , Dilek Öztürk4 1,2,4 Faculty of Veterinary Medicine, Mehmet Akif Ersoy University, Department of Microbiology, Burdur, TURKEY 3 Mehmet Akif Ersoy University, Experimental Animal Production and Experimental Research Center, Burdur, TURKEY Geliş Tarihi / Received: 13.07.2020, Kabul tarihi / Accepted: 07.12.2020 Abstract: Scopulariopsis brevicaulis is a saprophytic fungus that has wide geographic distribution. This study de- scribes a case of hair loss and skin lesions observed in male and female Wistar rats due to Scopulariopsis brevicaulis infection in Turkey. Skin scrapings and hair samples from three male and two female rats were provided by the Experimental Animal Production and Experimental Research Center of Mehmet Akif Ersoy University to the Faculty of Veterinary Medicine, Department of Microbiology Laboratory in Burdur for analysis in July 2019. Microbiological methods were used for species identification andScopulariopsis brevicaulis was isolated from all of the samples. The rats completely recovered without treatment and had no recurrence of clinical signs at one month post-sampling. This study is the first report ofS. brevicaulis causing an infection in Wistar rats in Turkey. Keywords: Laboratory animals, mycological examination, rats, saprophyte, Scopulariopsis sp Olgu sunumu: Wistar Ratlarından Scopulariopsis brevicularis izolasyonu Özet: Scopulariopsis brevicaulis, geniş coğrafi dağılımı olan saprofitik bir mantardır. Bu olgu, Türkiye’deki erkek ve dişi Wistar ratlarında Scopulariopsis brevicaulis infeksiyonuna bağlı olarak gözlenen tüy kaybı ve deri lezyonlarını tanımlamaktadır.
    [Show full text]
  • The Viruses of Wild Pigeon Droppings
    The Viruses of Wild Pigeon Droppings Tung Gia Phan1,2, Nguyen Phung Vo1,3,A´ kos Boros4,Pe´ter Pankovics4,Ga´bor Reuter4, Olive T. W. Li6, Chunling Wang5, Xutao Deng1, Leo L. M. Poon6, Eric Delwart1,2* 1 Blood Systems Research Institute, San Francisco, California, United States of America, 2 Department of Laboratory Medicine, University of California San Francisco, San Francisco, California, United States of America, 3 Pharmacology Department, School of Pharmacy, Ho Chi Minh City University of Medicine and Pharmacy, Ho Chi Minh, Vietnam, 4 Regional Laboratory of Virology, National Reference Laboratory of Gastroenteric Viruses, A´ NTSZ Regional Institute of State Public Health Service, Pe´cs, Hungary, 5 Stanford Genome Technology Center, Stanford, California, United States of America, 6 Centre of Influenza Research and School of Public Health, University of Hong Kong, Hong Kong SAR Abstract Birds are frequent sources of emerging human infectious diseases. Viral particles were enriched from the feces of 51 wild urban pigeons (Columba livia) from Hong Kong and Hungary, their nucleic acids randomly amplified and then sequenced. We identified sequences from known and novel species from the viral families Circoviridae, Parvoviridae, Picornaviridae, Reoviridae, Adenovirus, Astroviridae, and Caliciviridae (listed in decreasing number of reads), as well as plant and insect viruses likely originating from consumed food. The near full genome of a new species of a proposed parvovirus genus provisionally called Aviparvovirus contained an unusually long middle ORF showing weak similarity to an ORF of unknown function from a fowl adenovirus. Picornaviruses found in both Asia and Europe that are distantly related to the turkey megrivirus and contained a highly divergent 2A1 region were named mesiviruses.
    [Show full text]
  • THE ROLE of BOVINE ADENOVIRUS-3 PROTEIN V (Pv) in VIRUS REPLICATION
    THE ROLE OF BOVINE ADENOVIRUS-3 PROTEIN V (pV) IN VIRUS REPLICATION A Thesis Submitted to the Faculty of Graduate Studies and Research in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy in the Department of Veterinary Microbiology University of Saskatchewan Saskatoon By Xin Zhao © Copyright Xin Zhao, June 2016. All rights reserved PERMISSION TO USE In presenting this thesis in partial fulfillment of the requirements for a postgraduate degree from the University of Saskatchewan, I agree that the libraries of this university may make it freely available for inspection. I further agree that permission for copying of this thesis in any manner, whole or in part, for scholarly purposes may be granted by the professors who supervised my thesis work or in their absence, the Head of the Department or the Dean of the college in which my thesis work was done. It is understood that any copying or publication or use of this thesis or parts thereof for financial gain shall not be allowed without any written permission. It is also understood that due recognition shall be given to me and to the University of Saskatchewan in any scholarly use which may be made of any material in my thesis. Request for permission to copy or to make other use of material in this thesis in whole or part should be addressed to: Head of the Department of Veterinary Microbiology University of Saskatchewan, Saskatoon, Saskatchewan, S7N 5B4 i ABSTRACT Bovine adenovirus type 3 (BAdV-3), which is a non-enveloped icosahedral particle with a double-stranded DNA genome of 34,446 base pair, has been developed as a vaccine vector.
    [Show full text]