The Phosphatase PTPRG Controls FGFR1 Activity and Influences Sensitivity to FGFR Kinase Inhibitors

bioRxiv preprint doi: https://doi.org/10.1101/120204; this version posted March 24, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

1 The phosphatase PTPRG controls FGFR1 activity and influences

2 sensitivity to FGFR kinase inhibitors

4 Michal Kostas1,2,#, Ellen Margrethe Haugsten1,2,#, Yan Zhen1,2,#, Vigdis Sørensen1,2,3, Patrycja

5 Szybowska1,2, Elisa Fiorito1,2, Susanne Lorenz4, Gustavo Antonio de Souza5,6, Antoni

6 Wiedlocha1,2 and Jørgen Wesche1,2,*

9 1 Department of Molecular Cell Biology, Institute for Cancer Research, The Norwegian

10 Radium Hospital, Oslo University Hospital, Montebello, 0379 Oslo, Norway

11 2 Centre for Cancer Biomedicine, Faculty of Medicine, University of Oslo, Montebello, 0379

12 Oslo, Norway

13 3 Department of Core Facilities, Institute for Cancer Research, The Norwegian Radium

14 Hospital, Oslo University Hospital, Montebello, 0379 Oslo, Norway

15 4 Department of Tumor Biology, Institute for Cancer Research, The Norwegian Radium

16 Hospital, Oslo University Hospital, 0379 Oslo, Norway, and the Norwegian Cancer

17 Genomics Consortium, Oslo, Norway

18 5 The Brain Institute, Universidade Federal do Rio Grande do Norte, UFRN, Natal, RN

19 59078, Brazil

20 6 Department of Immunology and Centre for Immune Regulation, Oslo University Hospital

21 HF Rikshospitalet, University of Oslo, Oslo, 0424, Norway

24 # These authors contributed equally to this work.

26 * Author to whom correspondence should be addressed:

28 Jørgen Wesche

29 Tel: +47 22 78 19 31

30 Fax: +47 22 78 18 45

31 Email: [email protected]

35 Running title: PTPRG regulates FGFR signalling and viability

38 Abstract

39 FGFR1 represents an important target for precision medicine and a detailed molecular

40 understanding of the target is important in order to increase the efficacy of FGFR inhibitors.

41 We have here applied proximity labelling of FGFR1 in an osteosarcoma cell line to identify

42 determinants of FGFR1 activity. Many known FGFR interactors were identified (e.g. FRS2,

43 PLC , RSK2, SHC4, SRC), but the data also suggested novel determinants. A strong hit in

44 our screen was the tyrosine phosphatase PTPRG. We show that PTPRG and FGFR1 interact

45 and colocalize at the plasma membrane where PTPRG directly dephosphorylates activated

46 FGFR1. We further show that osteosarcoma cell lines depleted for PTPRG display increased

47 FGFR activity and are hypersensitive to stimulation by FGF1. In addition, PTPRG depletion

48 elevated cell growth and negatively affected the efficacy of FGFR kinase inhibitors. Thus,

49 PTPRG may have future clinical relevance by being a predictor of outcome after FGFR

50 inhibitor treatment.

53 Introduction

54 The fibroblast growth factor receptor (FGFR) family consists of four receptor tyrosine

55 kinases (FGFR1-4), which are composed of an extracellular ligand binding part, a single

56 transmembrane spanning stretch and an intracellular domain containing a tyrosine kinase

57 (Turner and Grose, 2010, Haugsten et al., 2010). Upon ligand (FGF) binding, dimerization

58 causes the receptors to auto-transphosporylate, leading to activation of downstream signalling

59 cascades that regulate many key cellular responses such as proliferation, differentiation and

60 cell migration. Importantly, aberrant FGF signalling is often involved in cancer development

61 (Wesche et al., 2011, Turner and Grose, 2010). FGFR overexpression and activating

62 mutations have recently been demonstrated to play an important role in several types of

63 sarcoma (e.g. osteosarcoma, rhabdomyosarcoma (RMS) and soft tissue sarcoma) (Weekes et

64 al., 2016, Guagnano et al., 2012, Taylor et al., 2009, Chudasama et al., 2016, Zhou et al.,

65 2016). In addition, the FGFR-specific downstream signalling adaptor, the FGFR substrate 2

66 (FRS2), is overexpressed in liposarcoma and render these cells sensitive to FGFR inhibitors

67 (Hanes et al., 2016, Zhang et al., 2013).

68 The incidence of sarcoma in adults is low (approx. 1% of all cancers), but more

69 frequent in children and adolescents (approx. 10%) (Zhou et al., 2016). There is little

70 commercial interest in these small and heterogeneous patient groups, and for the same

71 reasons, they are difficult to investigate and it is challenging to develop better treatments.

72 There are, however, several initiatives to develop drugs specific for FGFRs that possibly

73 could also be used to treat sarcomas with aberrant FGFR signalling (Dieci et al., 2013). Most

74 of these involve the development of specific small-molecular tyrosine kinase inhibitors and

75 some have entered clinical trials for instance in patients with glioma, renal clear cell

76 carcinoma, breast and lung cancer (ClinicalTrials.gov).

77 Unfortunately, in some cases such inhibitors fail even in the presence of the FGFR

78 biomarker, for unknown reasons (Tabernero et al., 2015). There have also been reported

79 effects of FGFR inhibitors in osteosarcoma cells without apparent FGFR aberrations,

80 indicating that other mechanisms for FGFR vulnerability exists (Hanes et al., 2016). To

81 increase the impact of FGFR inhibitors, it is crucial to understand in detail how their action on

82 FGFR signalling and cell viability is determined.

83 As FGFR1 is overexpressed in 18.5% of osteosarcomas with poor response to

84 chemotherapy and constitute a new and important therapeutic target for these patients

85 (Fernanda Amary et al., 2014, Baroy et al., 2016), we wanted to better understand how FGFR

86 signalling is regulated. We, therefore, took advantage of the BioID proximity biotinylation

87 system to identify determinants of FGFR1 signalling in osteosarcoma cells (Roux et al.,

88 2012). Using this approach, we discovered that the tyrosine phosphatase receptor type G

89 (PTPRG) negatively regulates FGFR1 activation in osteosarcoma. Cells depleted for PTPRG

90 exhibit increased activation of FGFR and are more sensitive in mitogenic responses to FGF

91 stimulation. Thus, PTPRG seems to be important for controlling excessive FGFR signalling,

92 which corresponds well with previous reports that implicate PTPRG as a tumour suppressor

93 (LaForgia et al., 1991, Shu et al., 2010). Importantly, we found that PTPRG determines the

94 sensitivity of cells to kinase inhibitors of FGFRs. We believe this may have clinical relevance

95 as clinical cases with overexpressed FGFR1 combined with low expression of PTPRG have

96 been reported.

98 Results

99 Proteomic BioID screen identifies determinants of FGFR1 activity

100 To identify proteins involved in the regulation of FGFR1 signalling in osteosarcoma

101 cells, we performed a BioID screen by fusing a biotin ligase, BirA*, to the C-terminal tail of

102 FGFR1. We recently validated and used this system to investigate signalling and trafficking

103 of the related FGFR4 (Haugsten et al., 2016). When expressed in U2OS cells the biotin ligase

104 biotinylates proteins in its proximity upon addition of biotin. The biotinylated proteins may be

105 isolated by affinity to streptavidin and identified by quantitative LC-MS/MS. Since FGFR1-

106 regulating proteins could be proximal to the receptor both in its inactive or its active state, we

107 included samples of unstimulated and FGF1-stimulated U2OS cells stably expressing FGFR1

108 fused to BirA* (U2OS-R1-BirA*) (see S1 and S2 in Fig. 1A).

109 Control samples included U2OS cells stably expressing FGFR1 wild-type (U2OS-R1,

110 C1 in Fig. 1A) and U2OS cells stably co-expressing FGFR1 wild-type and control, non-fused

111 BirA* (U2OS-R1 + BirA*, C2 in Fig. 1A). Proteins identified in these two conditions were

112 considered as background. As FGFR signalling induces increased expression of certain

113 proteins, increased expression of background proteins in FGF stimulated conditions could

114 erroneously be considered as positive hits. We therefore also included samples of U2OS cells

115 stably co-expressing FGFR1 wild-type and BirA* (U2OS-R1 + BirA*) and stimulated with

116 FGF1 (C3 in Fig. 1A). Such proteins were therefore subtracted from the final list in FGF

117 stimulated conditions.

118 We first investigated whether the fusion of BirA* to FGFR1 could interfere with its

119 functionality (Fig. 1B). After 20 minutes stimulation with FGF1, we detected comparable

120 phosphorylation of the receptors itself, as well as known downstream signalling molecules,

121 such as PLC-γ and ERK1/2. Because, the total FGFR1 antibody used for these western blots

122 recognizes the wild-type receptor better than the tagged version, the staining underestimated

123 the level of FGFR1-BirA* in these cells. Next, we tested whether the FGFR1-BirA* fusion

124 protein is able to bind its ligand FGF1 at the cell surface and undergo endocytosis (Fig. 1C).

125 Cells were kept on ice to facilitate binding of fluorophore-labelled FGF1 (DL550-FGF1) and

126 heated to 37°C to allow internalization. Then, the cells were stained and examined by

127 confocal microscopy. DL550-FGF1 was clearly detected at the cell surface in cells kept on ice

128 and next, after heating to 37°C for 20 minutes, it was detected in intracellular structures

129 colocalizing with EEA1. The results demonstrate that FGFR1-BirA* is able to bind FGF1 and

130 internalize into early endosomes similarly to wild-type receptor (Haugsten et al., 2005).

131 Next, we tested the biotinylation efficiency of the fusion protein (Fig. 1D and Fig. 1

132 supplement 1). In the absence of biotin, little biotinylated proteins were detected in cells

133 expressing FGFR1-BirA*. In the presence of biotin, a smear of bands representing

134 biotinylated proteins was detected on western blotting (Fig. supplement 1) and a strong

135 streptavidin staining was detected in cells by confocal microscopy (Fig. 1D). The streptavidin

136 staining was stronger at the cell periphery close to the plasma membrane. When cells were

137 treated with FGF1, the streptavidin staining was more dispersed in the cytoplasm, probably

138 reflecting the transport of the receptor from the plasma membrane to endosomes upon FGF1

139 stimulation. Biotinylated proteins were barely visible in cells expressing FGFR1 wild-type

140 and treated with biotin. Taken together these data indicate that the FGFR1-BirA* fusion

141 protein is functional and active and efficiently biotinylates proteins in its proximity in the

142 presence of biotin.

143 In the U2OS cells stably co-expressing non-fused BirA* and FGFR1 wild-type, a

144 smear of bands representing biotinylated proteins were detected on western blotting (Fig.

145 supplement 1) indicating that the biotin ligase is active in these cells. These cells express

146 higher amounts of control BirA* than those expressing the FGFR1-BirA* fusion protein,

147 which was an advantage to eliminate false positive hits in the screen.

148 Next, we performed the BioID proximity labelling and analysed affinity-purified

149 biotinylated proteins by LC-MS/MS (Fig. 1A). Since control BirA* is expressed uniformly in

150 the cytosol and the nucleus, it biotinylates proteins in general and by comparing the control

151 conditions with and without FGF1 stimulation, we could obtain an overview of which

152 proteins are induced by FGF signalling in these cells. Proteins significantly enriched more

153 than 10X (p<0.05) in C3 compared to C1 and C2, were considered as proteins with increased

154 expression upon FGF1 signalling (Table S1). Top hits among these were proteins known to be

155 induced by FGF1 signalling, such as the transcription factors JUNB, FOSL1, FOSL2 and

156 JUND (See STRING interaction network, Fig. 1 Supplement 2) (Szklarczyk et al., 2015).

157 Analysing the data using Enrichr and KEGG Pathways applications (Kuleshov et al., 2016),

158 we find enrichment of signalling pathways and, interestingly, induction of Osteoclast

159 differentiation (Fig. 1E), which reflect the cell context of our analysis (osteoesarcoma).

160 Proteins significantly enriched more than 10X (p<0.05) in S1 compared to C1 and C2

161 (Fig 1A) were considered as proteins in proximity of non-stimulated FGFR1 (Table S1),

162 while proteins significantly enriched more than 10X (p<0.05) in S2 compared to C1, C2 and

163 C3 and, in addition enriched compared to S1, were considered as proteins in the proximity of

164 the active receptor (Table S1). Among the proteins enriched in samples of the activated

165 receptor, we identified several well-known FGFR downstream signalling proteins (PLCγ,

166 RSK2 and SHC4) (Mohammadi et al., 1991, Nadratowska-Wesolowska et al., 2014), thereby

167 validating our approach. FRS2 is constitutively bound to FGFR1 (Kouhara et al., 1997) and

168 was accordingly found to be in the proximity of both unstimulated and stimulated receptors.

169 Also SRC, previously found to be important for FGFR signalling and trafficking (Sandilands

170 et al., 2007), was found associated with both unstimulated and activated receptors (See

171 STRING interaction networks Fig. 1 supplements 3 and 4).

172 In the case of unstimulated receptors, the hits were enriched for plasma membrane

173 functions (proteoglycans and adherens junctions) and membrane transport (endocytosis and

174 SNARE interactions) (Fig. 1E), reflecting the known plasma membrane localization and

175 importance of trafficking of the receptors. Stimulated receptors also showed enrichment for

176 membrane transport, but also several signalling pathways (Fig. 1E), as expected.

177 A very strong hit in our screen was the tyrosine phosphatases PTPRG (Sorio et al.,

178 1995). Because PTPRG has previously been suggested to be a tumour suppressor (LaForgia et

179 al., 1991), we chose to focus our attention to the possible regulatory role of PTPRG on

180 FGFR1. Interestingly, PTPRG was also found associated with both unstimulated and

181 activated receptor.

182

183 PTPRG interacts and co-localizes with FGFR1 at the plasma membrane

184 To validate the interaction between PTPRG and FGFR1 that was suggested by the

185 BioID screen, we attempted co-immunoprecipitation of the two proteins. FGFR1-BirA* is

186 fused to an HA-tag and U2OS-FGFR1-BirA* cells were transfected with MYC-FLAG-tagged

187 PTPRG, lysed, and then immunoprecipitated with anti-HA antibodies and immunoblotted

188 with anti-FLAG antibodies. The results demonstrated that PTPRG can efficiently be co-

189 immunoprecipitated with FGFR1 indicating a physical interaction between PTPRG and

190 FGFR1 (Fig. 2A).

191 Since PTPRG protein contains an active phosphatase domain, we considered FGFR1

192 as a potential substrate for PTPRG. To test this, we performed an in vitro phosphatase assay

193 using activated FGFR1, which was immunoprecipitated from FGF1-treated U2OS-R1-BirA*

194 cell lysates, and a recombinant PTPRG phosphatase domain in fusion with GST. As a control

195 in the experiment, we also used the recombinant phosphatase domain of PTPN12, which has

196 been shown to dephosphorylate other receptor tyrosine kinases (Sun et al., 2011), and

197 exhibited phosphatase activity towards a non-specific substrate (p-nitrophenyl phosphate,

198 pNPP) comparable to PTPRG (Fig. 2B). After 45 min incubation with 150 nM PTPRG we

199 observed a significant decrease in the level of FGFR1 phosphorylation at Y653/Y654

200 residues, as detected by western blotting, compared to incubation with 2-fold molar excess of

201 GST (Fig. 2C, lane 5 compared to lane 3). Moreover, the dephosphorylation effect was less

202 pronounced (and statistically insignificant) when we used 10-times lower concentration of the

203 enzyme (Fig. 2C, lane 4), showing that the reduction in phospho-FGFR1 level is dependent on

204 PTPRG concentration. We observed no changes in the phosphorylation of Y653/Y654

205 residues in FGFR1 using either 150 nM or 15 nM of PTPN12 (Fig. 2C, lane 6-7), suggesting a

206 substrate specificity in the dephosphorylation of FGFR1 by PTPRG. Moreover, the

207 dephosphorylation effect was not visible in the presence of a tyrosine-phosphatase inhibitor

208 cocktail (Fig. 2C, lane 9-10), confirming that the dephosphorylation directly relies on PTPRG

209 enzymatic activity.

210 To gain insight into where in the cells PTPRG and FGFR1 interact, we used wide-field

211 and structured illumination microscopy to investigate their co-localization. In U2OS-R1 cells

212 expressing PTPRG, FGFR1 and PTPRG co-localized mainly at the plasma membrane in non-

213 stimulated cells (Fig. 2D). Interestingly, at resting conditions FGFR1 and PTPRG strongly co-

214 localized in protrusions of the cells, resembling filopodia and lamellopodia. When cells had

215 been stimulated with FGF1 for one hour, FGFR1 was detected mainly in intracellular

216 vesicular structures, including EEA1 positive endosomes. PTPRG, however, was

217 predominantly observed at the cell surface also after stimulation, suggesting that PTPRG

218 might mainly act on FGFR1 at the plasma membrane (Fig. 2D).

219

220

221 Regulation of FGFR1 autophosphorylation by PTPRG revealed by TIRF

222 PTPRG is a large, transmembrane tyrosine phosphatase with an extracellular part

223 containing a carbonic anhydrase-like (CAH) domain and an intracellular part consisting of

224 one active and one inactive phosphatase domain (Fig. 3A) (Barnea et al., 1993). Mutating the

225 aspartate (D) at positon 1028 to alanine (A) inactivates the phosphatase activity of PTPRG

226 (Zhang et al., 2012).

227 Imaging by total internal reflection microscopy (TIRF), an imaging technique that

228 reveals with high selectivity and clarity structures on, or close to, the cell surface, confirmed

229 the localization of PTPRG at the plasma membrane. We observed a high degree of

230 colocalization with FGFR1, but not with Clathrin Heavy Chain marking clathrin coated pits,

231 which are entry sites for endocytosis (Fig. 3B, upper panel). Upon FGF1 stimulation, a partial

232 shift of FGFR1 into clathrin coated pits was observed. This was not observed for PTPRG,

233 suggesting that PTPRG is not co-endocytosed with FGFR1 (Fig. 3B lower panel).

234 Our biochemical analyses suggested that PTPRG acts directly to dephosphorylate

235 FGFR1 and the plasma membrane localization of PTPRG suggests that it might do so mainly

236 at the plasma membrane. To test this in cells, we used TIRF to monitor autophosphorylated

237 FGFR1 at the plasma membrane. In this experiment, U2OS cells stably expressing FGFR1-

238 GFP (U2OS-R1-GFP) were briefly stimulated with FGF1 before fixation and the activated

239 FGFR1 was detected with anti-FGFR phospho-Tyr653/654 specific antibodies. The

240 stimulation with FGF1 was sufficient to induce a robust activation of FGFR1 (pFGFR1) at the

241 plasma membrane, which was fully inhibited by the FGFR kinase inhibitor PD173074,

242 demonstrating that the observed immunofluorescent signal was specific (Fig. 3C). The cells

243 were also transiently transfected with PTPRG, which had a dramatic effect, almost completely

244 inhibiting the activity of FGFR1 at the plasma membrane. Overexpression of the inactive

245 mutant PTPRG-D1028A however, had no effect on the FGFR1 activity (Fig. 3C).

246 Quantification of the pFGFR1 levels detected by TIRF imaging, showed that overexpression

247 of PTPRG reduced pFGFR1 levels by at least 70% (Fig. 3D). These experiments demonstrate

248 that the enzymatic phosphatase activity of PTPRG counter the autophosphorylation of

249 FGFR1.

250 We then depleted PTPRG in U2OS-R1 cells using siRNA oligonucleotides, which

251 were shown to efficiently deplete PTPRG (Fig. 4A and B). We also constructed PTPRG

252 rescue mutants for siRNA oligo #1 that were resistant to siRNA depletion (PTPRG siRes #1

253 and PTPRG-D1028A siRes #1), (Fig. 4B). When PTPRG was knocked down, we observed a

254 substantial increase in the levels of phosphorylated FGFR1 upon FGF1 stimulation (Fig. 4C).

255 Moreover, using TIRF microscopy we could observe a similar effect at the plasma membrane

256 (Fig. 4D and E). Depletion of PTPRG led to a strong increase in FGF-induced

257 phosphorylation of FGFR1. This demonstrates that endogenous levels of PTPRG negatively

258 regulate FGFR1 autophosphorylation. This effect could be totally reversed by transfecting the

259 cells with the siRNA-resistant version of PTPRG, while the siRNA resistant version of the

260 inactive mutant PTPRG-D1028A was not able to reverse the effect (Fig. 4D and E).

261 Quantification of the pFGFR1 levels detected by TIRF imaging, showed that PTPRG

262 knockdown increased pFGFR1 levels at least twofold (Fig. 4E), demonstrating that PTPRG is

263 a highly efficient phosphatase for activated FGFR1.

264

265 PTPRG downregulates FGFR activation in osteosarcoma cells

266 To further confirm the regulation of FGFR1 autophosphorylation by PTPRG and to

267 analyse how this impinges on down-stream signalling pathways in osteosarcoma cells, we

268 depleted cells for PTPRG using three different siRNAs and probed the activation of FGFR1

269 and its downstream signalling pathways by western blotting using phospho-specific

270 antibodies (Fig. 5).

271 U2OS-R1 cells depleted of PTPRG displayed significantly increased levels of

272 phosphorylated FGFR1 upon FGF1 stimulation for 15-120 minutes compared to control cells

273 (Fig. 5A). Interestingly, also the down-stream signalling molecule PLCγ displayed increased

274 activity when PTPRG was depleted. However, in the case of ERK1/2 activation, we observed

275 no increase after 15 minutes of FGF1 treatment and even a decrease during the later time

276 points.

277 We also evaluated the effect of PTPRG depletion in the osteosarcoma cell line G292,

278 expressing endogenous FGFR1. Efficient knockdown was confirmed by realtime PCR (Fig

279 5B). Since the expression level of FGFR1 is relatively low in this cell line, we

280 immunoprecipitated the receptor using anti-FGFR1 antibodies and protein G coupled beads

281 before analysis of phosphorylation levels by western blotting. Upon 15 minutes of stimulation

282 with FGF1 we observed increased activation of FGFR1 in PTPRG depleted cells (Fig. 5C),

283 which shows that PTPRG can downregulate endogenous FGFR1 and confirms the previous

284 findings.

285 To test if PTPRG also regulates other FGFR family members, we performed

286 experiments using cell lines stably expressing FGFR4 or FGFR2. We observed upregulated

287 autophosphorylation of FGFR4 during 15-120 minutes stimulation by FGF1 in U2OS-R4

288 cells depleted of PTPRG, and a parallel increase of PLCγ phosphorylation (Fig. 5D), whereas

289 no change was observed for ERK1/2 activation (Fig. 5D). PTPRG also regulated FGFR4

290 autophosphorylation in the rhabdomyosarcoma cell line RH30 expressing endogenous FGFR4

291 (Fig. 5-supplement 1A). Also in U2OS cells stably expressing FGFR2, we observed a similar

292 increase in autophosphorylation of the receptor upon depletion of PTPRG (Fig. 5- supplement

293 1B). The results confirm that PTPRG down-regulates autophosphorylation of several FGFR

294 family members and that an excessive activation of FGFRs, due to the loss of PTPRG, can

295 lead to an elevation of downstream signalling pathways.

296

297 PTPRG regulates the biological response to FGF1

298 Since our results demonstrate that PTPRG is responsible for dephosphorylation of

299 activated FGFR, we hypothesized that the phosphatase could possibly alter the balance

300 between phosphorylated and unphosphorylated forms of ligand-bound receptors. To confirm

301 this hypothesis we evaluated the levels of phospho-FGFR1 in PTPRG-depleted osteosarcoma

302 cells stimulated with various concentrations of FGF1.

303 First, we evaluated whether depletion of PTPRG alters the sensitivity of FGFR1

304 towards FGF1 stimulation. After 15 minutes of treatment with 0-20 ng/ml FGF1, the levels of

305 FGFR1 phosphorylation and activation of downstream signalling pathways were analysed by

306 western blotting. We observed increased activation of FGFR1 and PLCγ upon PTPRG

307 knockdown under the applied range of FGF1 stimulation (Fig. 6A). No changes in ERK1/2

308 activation were observed. A detailed quantification of phospho-FGFR1 bands enabled us to

309 detect a significant shift in the FGF1 dose-response curve towards higher pFGFR1 values

310 when PTPRG was depleted (Fig. 6B). This demonstrates that PTPRG decreases the sensitivity

311 of FGFR1 activation in response to FGF1. The effect of PTPRG depletion was more

312 pronounced in parallel with increasing FGF1 concentrations. This agrees with the hypothesis

313 that FGFR1 is a substrate for PTPRG.

314 We also tested whether the increased sensitivity of PTPRG-depleted cells towards

315 FGF1 is biologically relevant. We chose the G292 cell line, expressing endogenous levels of

316 FGFR1, and which growth in serum free media is dependent on FGF1 (Fig. 6C). We found

317 that PTPRG-depleted cells displayed increased viability after treatment with various

318 concentrations of FGF1 for 48 hours (Fig. 6D). We also found that the difference was more

319 pronounced with increasing concentrations of FGF1, in correspondence with the results

320 obtained for analysis of FGFR1 phosphorylation by western blotting (Fig. 6B). Our data

321 indicate that PTPRG restricts the efficiency of the biological response of cells to FGF, and

322 moreover, that down-regulation of PTPRG can serve as an advantage for cancer cells

323 expressing FGFR1, allowing them to respond to lower FGF levels.

324

325 Altered drug sensitivity in cells depleted for PTPRG

326 Given that PTPRG counter the activity of FGFR by dephosphorylation, we wanted to

327 test if PTPRG could influence the action of a small molecule tyrosine kinase inhibitor on

328 FGFR1. Since our data suggest that PTPRG is involved in shifting the balance of receptor

329 autophosphorylation to the inactive, non-phosphorylated state, the phosphatase could also

330 affect kinase inhibition.

331 We first tested increasing concentrations of the FGFR kinase inhibitor AZD4547 on

332 U2OS-R1 cells stimulated with a constant amount of FGF1 (10 ng/ml) and investigated the

333 levels of activated FGFR1 and its downstream signalling molecules by western blotting. We

334 found that PTPRG-depleted cells displayed a higher level of phosphorylated FGFR1 and

335 PLCγ in the presence of the FGFR kinase inhibitor (Fig. 7A). Little effect was observed on

336 ERK activation. Quantification of phospho-FGFR1 bands visualized a shift in the dose-

337 response curve when PTPRG was knocked down (Fig. 7B). These data indicate that higher

338 concentrations of the inhibitor are needed to prevent FGFR1 kinase activity when PTPRG is

339 downregulated.

340 Next, we tested whether the disturbance in FGFR kinase inhibition, as a result of

341 depleted PTPRG, translates into efficiency of the inhibitor to decrease cell growth. We

342 knocked down PTPRG in G292 cells before stimulation with 10 ng/ml FGF1 in the presence

343 of various concentrations of AZD4547. The experiment was performed using serum-free

344 media to allow the cell growth to be dependent solely on FGF1. We found that PTPRG-

345 depleted cells exhibited elevated viability after 48 hours of FGF1 treatment in the presence of

346 AZD4547 (Fig. 7C). The difference was dependent on the concentration of the inhibitor,

347 being more pronounced at lower concentrations. Our findings suggest that higher

348 concentrations of FGFR inhibitors are necessary to control FGFR activity in cells with low

349 levels of PTPRG. Importantly, this effect would imply an advantage for cancer cells lacking

350 PTPRG and serve as a possible resistance-mechanism to FGFR inhibitors.

351 To explore among different cancer types the frequency of cases where at least one

352 FGFR is amplified and PTPRG is deleted, TCGA data generated by the TCGA Research

353 Network (http://cancergenome.nih.gov/) was investigated. Specific gene information was

354 extracted from 11 studies showing frequent FGFR amplifications by using the cBioportal

355 (http://www.cbioportal.org/) (Gao et al., 2013, Cerami et al., 2012). The results show that the

356 frequency of cases with amplified receptor and deleted PTPRG is between 0.2-0.9% and is

357 frequently found across many different cancer types (Fig. 7D). In total, 18 cases of the

358 combination FGFR amplification/PTPRG deletion was identified in the 11 studies

359 investigated, clearly demonstrating the relevance of our findings in human cancer.

360

361

362 DISCUSSION

363 FGFR inhibitors are now entering the clinic and it is crucial to understand how tumour

364 cells respond to this treatment (Dieci et al., 2013). We show here that PTPRG, a membrane

365 bound tyrosine phosphatase, is an important modulator of FGFR tyrosine kinase activity. We

366 demonstrate that PTPRG counter the activity of FGFR1 by direct dephosphorylation of the

367 autoactivated, tyrosine phosphorylated FGFR1. The activity of PTPRG is also a determinant

368 of the efficacy of FGFR inhibitors. We found that lowering the levels of PTPRG by specific

369 siRNAs protected tumour cells against the clinically relevant FGFR kinase inhibitor

370 AZD4547. It is therefore possible that PTPRG levels in cancer cells could be a predictor of

371 outcome of FGFR kinase inhibition. Our data suggest that in clinical trials using FGFR

372 inhibitors the level of PTPRG should be determined, in order to test the possibility that in

373 tumours with low levels of PTPRG, kinase inhibitors may not be as efficient as in cells with

374 normal levels of PTPRG. This may be particularly important when treating tumours with low

375 doses of kinase inhibitors, which is normally the case since these inhibitors are associated

376 with severe toxicity (e.g. hyperphosphatemia and tissue calcification) (Dieci et al., 2013).

377 Interestingly, we observed a difference in the response of two downstream signalling

378 pathways to PTPRG depletion. While the activity of PLCγ, similarly to that of FGFR, was

379 upregulated, ERK phosphorylation was mainly unchanged, and even reduced at later time

380 points. The reason for this phenomenon could be that the MAPK pathway is subjected to

381 several layers of both positive and negative regulation that may buffer for increased activity

382 of the receptor. This may also imply that viability in osteosarcoma cells is modulated by other

383 signalling pathways than the MAPK pathway.

384 Our studies suggest that PTPRG’s main cellular localization is at the cell surface and

385 that it is inefficiently endocytosed compared to the FGF1/FGFR1 activated complex.

386 Concurrently, we find that PTPRG levels profoundly affect FGFR1 activity at the early

387 timepoints (minutes) after FGF1 stimulation, which initiates at the plasma membrane. We

388 also find that PTPRG levels affect FGFR1 and downstream signalling events even 2 hours

389 after the initial stimulation, and that this translates into biological effects such as cell viability

390 several days after onset of FGF1 stimulation. It is not known in detail how the FGFR1 activity

391 is affected by its subcellular localization, i.e. whether the rate of FGFR1 autophosphorylation

392 is maintained or reduced after transfer from the plasma membrane to the endosomal

393 membrane. Possibly, PTPRG levels exert a long term effect on FGFR1 activity mainly by

394 regulating its initial activation rate.

395 Sarcoma cells were here used to study the regulation of FGFR1, but it is likely that

396 PTPRG also dephosphorylates FGFR1 in other cell types. For example, FGFR1 is

397 overexpressed in breast cancers and is an attractive target with several clinical trials under

398 way. Interestingly, TCGA data show that PTPRG is deleted and mutated in a subset of breast

399 cancer patients (Fig 7D). Intriguingly, there are also reported cases where FGFR1 is

400 overexpressed and PTPRG deleted, which could possibly be a particular bad combination for

401 the patient. We also show that FGFR1 becomes hypersensitive to its ligand when PTPRG is

402 down-regulated. It is therefore possible that FGFR1 can be aberrantly activated by low levels

403 of ligand in the tumour microenvironment causing tumorigenic growth without

404 overexpression or mutation of the receptor itself.

405 We show in this study that also other FGFR members (FGFR2 and FGFR4) are

406 regulated by PTPRG. FGFR2 is activated by mutations and is an attractive target in

407 endometrial cancer, and FGFR4 is a potential drug target in rhabdomyosarcoma. The

408 identification of PTPRG as a potent regulator of FGFR activity may therefore have broad

409 consequences in cancer therapy.

410 We used BioID to investigate proximal proteins to FGFR1 that could potentially

411 regulate FGFR signalling. The advantage of this method is that the biotinylation occurs in

412 living cells and that the biotin tag makes it easier to pull down transient interactors and

413 transmembrane proteins that may be difficult to detect in classic pull-down assays (Roux et

414 al., 2013). Indeed, PTPRG has not been found in any previous studies where FGFRs have

415 been co-precipitated. Thus, as shown here, BioID may be used to find important interactors

416 that have not been found with the standard methods.

417 We have here concentrated our efforts on PTPRG, but we believe our proteomic data

418 may be a resource for further studies of the regulation of FGFR signalling. For instance, in

419 FGF1-stimulated cells, we identified known downstream effectors of activated FGFR (e.g.

420 PLC , RSK2 and SHC4), but we also uncovered members of other signalling pathways (Fig.

421 1 supplement 4 and Table S1). For instance, we found several members of the interferon-

422 stimulated gene family, which may play a role in immunity. We also identified two cyclins

423 (CCNE1, CCNB2) suggesting that FGFR1 may interact directly with these cell cycle

424 regulators to stimulate proliferation. As we also have shown recently for FGFR4(Haugsten et

425 al., 2016), BioID revealed association with the FGFRs and a number of proteins involved in

426 vesicular trafficking, reflecting the importance of intracellular transport for these receptors.

427 Analysing proteins whose expression was induced by FGF1 signalling, we found several

428 proteins that may confer negative feedback (Table S1). Examples include A2M, which has

429 previously been shown to bind the ligand FGF2 and thereby blocking its interaction with the

430 receptors and the heparan sulfate proteoglycan CD44 that has been shown to regulate FGFR

431 action. We also noticed a protein that has been shown to be a feedback inhibitor for EGFR

432 family members (ERRFI1), which may possibly play a similar role for FGFRs. Finally, we

433 also identified a phosphate transporter (SLC20A1) that may be involved in the reabsorption of

434 phosphate mediated by FGFR signalling (Prie and Friedlander, 2010). This may indicate a

435 more direct activation of phosphate transporters than previously anticipated.

436 It is known that PTPRG has other targets than FGFR1 (Cheung et al., 2015), but it

437 remains an interesting question if additional tyrosine phosphatases are involved in directly

438 regulating the activity of FGFR1. Indeed, two additional tyrosine phosphatases were

439 discovered through our screen, while only PTPRG was among the top hits. However, the very

440 strong effect of PTPRG knockdown on FGFR activity observed in our studies, indicates that

441 PTPRG is a major regulator of FGFR, and also indicates that there may be less redundancy

442 among phosphatases than anticipated. This also implies that cells with low expression of

443 PTPRG may be particularly vulnerable to excessive FGFR activity, which could lead to more

444 aggressive cancer. We therefore believe that it will be important to study PTPRG as a

445 predictor of outcome for disease caused by FGFRs.

446

447

448 Methods

449

450 Antibodies and compounds

451 The following antibodies were used: rabbit anti-FGFR1 (ab76464), and rabbit anti-

452 Clathrin heavy chain (ab21679) from Abcam; rabbit anti-FGFR1 (2144-1) from Epitomics;

453 mouse anti-phospho-FGFR (Tyr653/654) (#3476), rabbit anti-DYKDDDDK (FLAG) tag

454 (#2368), rabbit anti-phospho-PLCγ (Tyr783) (#14008), mouse anti-phospho-ERK1/2

455 (Thr202/Tyr204) (#9106) from Cell Signaling Technology; mouse anti-γ-tubulin (T6557), and

456 mouse anti-FLAG M2 antibody (F-1804) from Sigma-Aldrich; mouse anti-EEA1 (610456)

457 from BD transduction laboratories; rabbit anti-phospho-PLCγ (Tyr783) (sc-12943-R) from

458 Santa Cruz Biotechnology; rabbit anti-HA epitope tag (600-401-384) from Rockland; mouse

459 anti-MYC Tag (05-724) from Merck Millipore, human anti-EEA1 antiserum was a gift from

460 B. H. Toh (Monash University), HRP-Streptavidin (016-030-084), Alexa488-Streptavidin

461 (016-540-084) and all secondary antibodies from Jackson Immuno-Research Laboratories.

462 Protease inhibitor cocktail tablets (ethylenediaminetetraacetic acid (EDTA)-free,

463 complete) were from Roche Diagnostics. DyLight 550 NHS Ester, Ez-link Sulfo-NHS-SS-

464 biotin, PierceTM anti-HA magnetic beads and Dynabeads G protein were from Thermo

465 Scientific. Hoechst 33342 was purchased from Life Technologies. Streptavidin Sepharose

466 High Performance was from GE Healthcare Life Sciences. Mowiol, biotin, heparin,

467 PD173074, active human PTPRG catalytic domain (SRP0223), active human PTPN12

468 catalytic domain (SRP5073), p-nitrophenyl phosphate (pNPP) and phosphatase inhibitors

469 were from Sigma-Aldrich. AZD4547 was purchased from SelleckChem. FGF1 was prepared

470 as previously described (Wesche et al., 2005). FGF1 was labeled with DyLight 550 following

471 the manufacturer's procedures. Recombinant GST, expressed in E. coli and purified using

472 GSH Sepharose Fast Flow (GE Healthcare), was kindly provided by Dr. Coen Campsteijn

473 from the Department of Molecular Cell Biology, Institute for Cancer Research, Oslo

474 University Hospital.

475

476 Plasmids and siRNAs

477 pcDNA3.1-FGFR1-BirA* was made by cloning a PCR fragment containing the

478 FGFR1 open reading frame and AgeI-HF and BamHI-HF flanking sites into pcDNA3.1

479 MCS-BirA*(R118G)-HA cut with AgeI-HF and BamHI-HF using pcDNA3-hFGFR1 as a

480 template (Haugsten et al., 2005). pcDNA3.1 MCS-BirA(R118G)-HA was a gift from Kyle

481 Roux (Addgene plasmid # 36047) (Roux et al., 2012). Construction of the pcDNA3.1/Zeo-

482 BirA* was described previously (Haugsten et al., 2016). pEGFP-FGFR1 was made by cloning

483 a PCR fragment containing the FGFR1 open reading frame and XhoI and ApaI flanking sites

484 into pEGFP-N1 cut with XhoI and ApaI using pcDNA3-hFGFR1 as template. pCMV6-Entry

485 vector containing PTPRG-MYC-FLAG was purchased from Origene (RC_218964). PTPRG

486 mutants were produced by site-directed mutagenesis using Pfu I HF (Agilent) with specific

487 primers, followed by DpnI (New England Biolabs) treatment. PTPRG inactivating mutation

488 (D1028A) was introduced with the primer 5’-

489 TACACAGTGGCCTGCCATGGGAGTTCCCG-3’, while the primer 5’-

490 CATTAGCCATGTCTCACCCGATAGTCTATATTTATTTCGGGTCCAGGCCGTGTGTC

491 GGAACGAC-3’ was used to mutate 7 nucleotides and obtain siRNA-Resistant PTPRG

492 (siRes#1 PTPRG) in both wild-type and D1028A mutant PTPRG. D1028A and siRes mutants

493 were verified by sequencing. These plasmids are resistant to siRNA oligo s11549 (#1)

494 PTPRG Silencer® Select. Silencer® Select siRNA oligos targeting PTPRG; s11549 (#1),

495 s11550 (#2) and s11551 (#3), siRNA oligos targeting FGFR1 (s5177) and Silencer® select

496 Negative Control No. 2 siRNA (scr) (4390846) were purchased from Life Technologies.

497

498 Cells and transfection

499 To obtain U2OS cells stably expressing FGFR1-BirA* (U2OS-R1-BirA*), FGFR1-

500 GFP (U2OS-R1-GFP) and FGFR2 (U2OS-R2) and U2OS-R1 stably expressing BirA*

501 (U2OS-R1 + BirA*), Fugene liposomal transfection reagent was used according to the

502 manufacturer’s protocol. Clones were selected with 1 mg/ml geneticin (U2OS-R1-BirA*,

503 U2OS-R1-GFP and U2OS-R2) or 0.2 mg/ml Zeocin (U2OS-R1 + BirA*). Clones were

504 chosen based on their receptor/BirA* expression levels analysed by immunofluorescence and

505 western blotting. U2OS cells stably expressing FGFR1 has been described previously

506 (Haugsten et al., 2008). The G292 and RH30 cell lines were generous gifts from Prof. Ola

507 Myklebost (Department of Tumor Biology, The Norwegian Radium Hospital). U2OS and

508 G292 cells were propagated in DMEM or RPMI (respectively) supplemented with 10% fetal

509 bovine serum, 100 U/ml penicillin, and 100 μg/ml streptomycin in a 5% CO2 atmosphere at

510 37°C.

511 siRNA transfection was performed using Lipofectamine RNAiMAX Transfection

512 Reagent (Invitrogen, Life Technologies) according to the manufacturer’s protocol. 10 nM of

513 siRNA was used and the experiments were performed 72 hours after transfection. Transient

514 expression of different plasmids was performed by transfecting cells with plasmid DNA using

515 Fugene 6 Transfection Reagent (Roche Diagnostics) according to the manufacturer’s protocol.

516

517 Mass Spectrometry

518 Affinity capture of biotinylated proteins, sample preparation and mass spectrometry

519 was performed as previously described (Haugsten et al., 2016).

520 Experimental design and statistical rationale of the MS analysis: Six individual

521 experiments were performed; three experiments consisting of samples C1 (U2OS-R1 cells),

522 C2 (U2OS-R1 stably transfected with BirA*) and C3 (U2OS-R1 cells stably transfected with

523 BirA* and stimulated with FGF1) and three experiments consisting of samples C1 (U2OS-R1

524 cells), S1 (U2OS-R1-BirA*) and S2 (U2OS-R1-BirA* stimulated with FGF1). All three

525 samples in each of the six individual experiments were run three times (n=3 for LC

526 variability, n=9 total number of replicates combined, in the case of C1: n=6 for LC variability,

527 n=18 total number of replicates combined). In the case of one of the three experiments for C3

528 (U2OS-R1 cells stably transfected with BirA* and stimulated with FGF1) only one replicate

529 was run (n=3 for LC viability, n=7 total number of replicates combined). The mean IBAQ

530 values were calculated for each protein in each sample (C1, C2, C3, S1 and S2). Proteins

531 identified in C1 were considered as background and the means of C3, S1 and S2 were

532 compared to that of C1. Proteins were removed from the list if they were not significantly

533 enriched at least ten times compared to C1 (p<0.05, two-tailed t test). Proteins identified in C2

534 were considered as BirA* background and the means of C3, S1 and S2 were next compared to

535 that of C2. Proteins were removed from the list if they were not significantly enriched at least

536 ten times compared to C2 (p<0.05, two-tailed t test). Proteins significantly enriched ten times

537 or more in C3 compared to C1 and C2 were considered as proteins with potentially induced

538 expression by FGF1 stimulation (p<0.05, two-tailed t test). Proteins significantly enriched ten

539 times or more in S1 compared to C1 and C2 were considered as proteins in proximity to

540 FGFR1. S2 was in addition to being compared to C1 and C2 also compared to C3 and

541 proteins were removed from the list if they were not significantly enriched at least ten times

542 compared to C3 (p<0.05, two-tailed t test). Proteins significantly enriched ten times or more

543 in S2 compared to C1, C2, and C3 were considered as proteins in proximity to active FGFR1.

544 The mass spectrometry proteomics data have been deposited to the ProteomeXchange

545 Consortium via the PRIDE (Vizcaino et al., 2016) partner repository with the dataset

546 identifier PXD006157. (Username: [email protected], Password: 76TXQbfY)

547

548 Western blotting

549 After indicated treatment, cells were lysed in lysis buffer supplemented with protease

550 and phosphatase inhibitors or directly in sample buffer and the lysates were then loaded for

551 SDS-PAGE (4-20% gradient) and afterwards transferred to a PVDF membrane (Bio-Rad) for

552 western blotting. Blots were developed with SuperSignal West Dura Extended

553 Chemiluminescent Substrate (Thermo Scientific) and detected using Gel Doc (Bio-Rad).

554 Western blots were quantified using the Gel analysis function in Image J (Schneider et al.,

555 2012).

556

557 RNA isolation, cDNA synthesis and quantitative real-time polymerase reaction (qRT-

558 PCR)

559 Total RNA was isolated from cell lysate using RNeasy plus minikit and the QIAcube

560 robot (Qiagen) according to the manufacturer’s protocol. Then 0.5-1 mg of RNA was used for

561 cDNA synthesis using iScript cDNA synthesis kit. Quantitative real-time PCR was performed

562 using QuantiTect SYBR Green PCR kit, cDNA template and the following QuantiTect

563 primers: PTPRG (QT00060116) and Succinate dehydrogenase (SDHA) (QT00059486). The

564 qRT-PCR was run and analysed using the Lightcycler 480 (Roche). Cycling conditions were

565 5 minutes at 95oC followed by 45 cycles 10 seconds at 95oC, 20 seconds at 60oC and 10

566 seconds at 72oC. Gene amplification was normalized to the expression of SDHA.

567

568 Co-immunoprecipitation assays

569 After indicated treatment, the cells were lysed in lysis buffer supplemented with

570 protease and phosphatase inhibitors. Cell lysates were then subjected to immunprecipitation

571 reactions with indicated antibody immobilized to Dyneabeads Protein G or with PierceTM

572 anti-HA magnetic beads. After washing, protein complexes were eluted in sample buffer,

573 separated by SDS-PAGE and analysed by western blotting.

574

575 In vitro phosphatase assay

576 The enzymatic activity of recombinant PTPRG (catalytic domain, residues 801-1147)

577 and PTPN12 (catalytic domain, residues 1-355) was probed by a standard colorimetric assay

578 using p-nitrophenyl phosphate (pNPP) as substrate (Lorenz, 2011). The initial reaction rate

579 was monitored colorimetrically (Abs. at 405 nm) within the first 10 min of reaction, where the

580 data fell in the linear range. The reaction buffer and 300 nM GST in reaction buffer served as

581 control to exclude substrate self-degradation and the effect of potential impurities related to

582 the GST fusion protein purification system. One unit of phosphatase activity (1 U) was

583 defined as the amount of enzyme that hydrolyses 1 nmol of pNPP in 1 min at 30oC in 50 µl

584 reaction volume. Molar extinction coefficient of the reaction product (pNP) was assumed as

585 18000 M-1cm-1.

586 After indicated treatment, U2OS-R1-BirA* cells were lysed in lysis buffer

587 supplemented with protease and phosphatase inhibitors. Cell lysates were then subjected to

588 immunprecipitation with PierceTM anti-HA magnetic beads (Thermo Scientific), which were

589 subsequently washed with lysis buffer without phosphatase inhibitors and incubated at 37oC

590 with indicated recombinant phosphatases with addition of 2 mM DTT. The control samples

591 were incubated with recombinant GST or in the presence of phosphatase inhibitor cocktail, as

592 indicated in the figure legend. The immunoprecipitates were then eluted in sample buffer,

593 separated by SDS-PAGE and analysed by western blotting.

594

595 Light microscopy

596 For confocal microscopy, cells grown on coverslips were treated as indicated and fixed

597 in 4% formaldehyde. The cells were then permeabilized with 0.1% triton X-100, stained with

598 indicated antibodies and mounted in mowiol. Confocal images were acquired with a 63×

599 objective on Zeiss LSM 780 and Zeiss LSM 710 confocal microscopes (Jena, Germany).

600 Images were prepared with Zeiss LSM Image Browser and CorelDRAW11 (Ottawa, Canada).

601 For wide-field (WF) microscopy and structured illumination microscopy (SIM),

602 U2OS-R1 cells were grown on 1.5H glass coverslips and transiently transfected with plasmid

603 encoding MYC/FLAG-tagged PTPRG or PTPRG-D1028A using Fugene 6 (according to the

604 producers procedures), for approx. 20 hours. The cells were serum starved for two hours

605 (DMEM with penicillin and streptomycin but without serum), and then either fixed

606 immediately or incubated with FGF1 (200 ng/ml) and heparin (10 U/ml) for 1 hour and then

607 fixed.

608 For total internal reflection fluorescence (TIRF) microscopy, U2OS-R1-GFP cells

609 were grown in glass bottom culture dishes (MatTek). The cells were transfected with plasmid

610 encoding MYC/FLAG-tagged PTPRG or PTPRG-D1028A or siRNA resistant versions of

611 these (using Fugene 6) for 20 hours. Next, the cells were serum-starved for 2 hours and

612 stimulated for 10 min with FGF1 and heparin, FGF1 and heparin in the presence of

613 PD173074 (including 30 min pretreatment with PD173074), or no FGF1, and then the cells

614 were fixed. In some cases, the cells were also transfected with scrambled siRNA or siRNA

615 against PTPRG (siRNA #1) two days prior to plasmid transfection.

616 Next, cells were fixed in 4 % formaldehyde (Sigma-Aldrich) in PBS (10 minutes at

617 room temperature). The fixed cells were permeabilized with 0.05% saponin in PBS and

618 stained with indicated combinations of primary antibodies diluted in PBS with 0.05%

619 saponin, and anti-mouse/rabbit/human secondary antibodies labelled with Alexa Fluor 488,

620 Alexa Fluor 568, or Alexa Fluor 647. Cells/coverslips for WF/SIM were also stained with

621 Hoechst33342 and mounted on object slides with SlowFade Diamond Antifade Mountant

622 (ThermoFisher). Stained cells for TIRF microscopy were maintained and imaged in PBS.

623 Wide-field, SIM, and TIRF imaging was performed on a Deltavision OMX V4

624 microscope (Applied Precision, Inc., Issaquah, WA) using an Olympus ×60 NA 1.42 Plan

625 Apochromat objective for WF imaging and SIM, and an Olympus x60 NA 1.49 Plan Apo

626 TIRF objective for TIRF imaging. The OMX is further equipped with an InSightSSI™

627 illumination module used for WF imaging, 405 nm, 488 nm, 568 nm, and 642 nm laserlines

628 that were used for SIM and TIRF imaging, a Ring-TIRF module, and three cooled sCMOS

629 cameras.

630 For WF imaging, z-stacks covering the whole cell were recorded with a z-spacing of

631 250 nm. For SIM, z-stacks were recorded with a z-spacing of 125 nm and for each focal

632 plane, 15 raw images (five phases for three different angular orientations of the illumination

633 pattern) were captured. WF images were deconvolved, SIM images were reconstructed, and

634 all images were aligned using Softworx software (Applied Precision, Inc., Issaquah, WA).

635 All TIRF images were captured using the same channel specific settings for Ring-

636 TIRF diameter, laser intensity and exposure. The phospho-FGFR1 signal was quantified using

637 Fiji/ImageJ software as follows; Cells were selected for quantification based on GFP intensity

638 (indicating average/normal FGFR1 levels), and identified as untransfected or transfected with

639 PTPRG/PTPRG-D1028A based on FLAG-staining. ROI’s were defined by drawing the

640 outline of selected cells, and the mean pixel value over an ROI in the phospho-FGFR1

641 specific channel was taken as the measure of the phospho-FGFR1 signal intensity of a cell.

642 Images were subjected to background subtraction by a value set for each experiment. Data

643 presented are the mean values of three or four independent experiments where 15-30 cells

644 were measured for each condition in each experiment.

645 Further processing of images for presentations (projections, volume views, contrast

646 adjustments, montages) were done using Fiji/ImageJ software.

647

648 Cell viability assay

649 The cells were treated with indicated siRNAs and reseeded into 96-well plates the day

650 before stimulation with FGF1 in serum-free medium, supplemented with 20 U/ml heparin,.

651 The cells were treated with FGF1 72 hours after siRNA treatment. Cell viability was

652 measured 48 h after stimulation using CellTiter-Glo assay (Promega). In the case of FGFR1

653 knockdown, cells were treated with FGFR1 siRNA or control siRNA (scr) for 72 hours.

654 During the last 48 hours the cells were treated with 100 ng/ml FGF1 in the presence of 10

655 U/ml heparin. Cell viability was then measured using CellTiter-Glo assay.

656

657 Statistical rationale

658 Data arised from series of three or more independent experiments as stated in figure

659 legends. Results with p<0.05 were considered statistically significant. Time-course and dose-

660 response data series were analysed using two-way ANOVA. Single end-point assay data were

661 analysed using one-way repeated measures (RM) ANOVA followed by Tukey post hoc test.

662 For all experiments, the tests were performed on log transformed raw data. The tests were

663 performed using GraphPad Prism 5 (GraphPad Software) or Sigma plot (Systat Software).

664

665 Acknowledgments

666 We thank Dr. Coen Campsteijn, Prof. Ola Myklebost and Prof. Claudio Sorio for sharing

667 reagents and Prof. Knut Liestøl for guidance on the statistics. This work was supported by the

668 the Research Council of Norway through its Centers of Excellence funding scheme (project

669 number 179571) and the Norwegian Cancer Society. J.W. holds a Researcher fellowship

670 (project 5756681), E.M.H a Career fellowship (project 6842225), M.K. a Postdoctoral

671 fellowship (project 734183) and E.F. a Postdoctoral fellowship (project 5756681) from the

672 Norwegian Cancer Society. All MS data was collected at the Proteomics Core Facility,

673 Rikshospitalet, which is funded by the Norwegian South-East Health Authority.

674

675 Competing interests

676 The authors have no competing interests to declare.

677

678 References

679

680 BARNEA, G., SILVENNOINEN, O., SHAANAN, B., HONEGGER, A. M., CANOLL, P. 681 D., D'EUSTACHIO, P., MORSE, B., LEVY, J. B., LAFORGIA, S., HUEBNER, K. & 682 ET AL. 1993. Identification of a carbonic anhydrase-like domain in the extracellular 683 region of RPTP gamma defines a new subfamily of receptor tyrosine phosphatases. 684 Mol Cell Biol, 13, 1497-506. 685 BAROY, T., CHILAMAKURI, C. S. R., LORENZ, S., SUN, J. C., BRULAND, O. S., 686 MYKLEBOST, O. & MEZA-ZEPEDA, L. A. 2016. Genome Analysis of 687 Osteosarcoma Progression Samples Identifies FGFR1 Overexpression as a Potential 688 Treatment Target and CHM as a Candidate Tumor Suppressor Gene. Plos One, 11. 689 CERAMI, E., GAO, J. J., DOGRUSOZ, U., GROSS, B. E., SUMER, S. O., AKSOY, B. A., 690 JACOBSEN, A., BYRNE, C. J., HEUER, M. L., LARSSON, E., ANTIPIN, Y., 691 REVA, B., GOLDBERG, A. P., SANDER, C. & SCHULTZ, N. 2012. The cBio 692 Cancer Genomics Portal: An Open Platform for Exploring Multidimensional Cancer 693 Genomics Data. Cancer Discovery, 2, 401-404. 694 CHEUNG, A. K. L., IP, J. C. Y., CHU, A. C. H., CHENG, Y., LEONG, M. M. L., KO, J. M. 695 Y., SHUEN, W. H., LUNG, H. L. & LUNG, M. L. 2015. PTPRG suppresses tumor 696 growth and invasion via inhibition of Akt signaling in nasopharyngeal carcinoma. 697 Oncotarget, 6, 13434-13447. 698 CHUDASAMA, P., RENNER, M., STRAUB, M., MUGHAL, S. S., HUTTER, B., 699 KOSALOGLU, Z., SCHWESSINGER, R., SCHEFFLER, M., ALLDINGER, I., 700 SCHIMMACK, S., PERSIGEHL, T., KOBE, C., JAGER, D., VON KALLE, C., 701 SCHIRMACHER, P., BECKHAUS, M. K., WOLF, S., HEINING, C., GROSCHEL, 702 S., WOLF, J., BRORS, B., WEICHERT, W., GLIMM, H., SCHOLL, C., 703 MECHTERSHEIMER, G., SPECHT, K. & FROHLING, S. 2016. Targeting fibroblast 704 growth factor receptor 1 for treatment of soft-tissue sarcoma. Clin Cancer Res. 705 DIECI, M. V., ARNEDOS, M., ANDRE, F. & SORIA, J. C. 2013. Fibroblast growth factor 706 receptor inhibitors as a cancer treatment: from a biologic rationale to medical 707 perspectives. Cancer Discov., 3, 264-279. 708 FERNANDA AMARY, M., YE, H., BERISHA, F., KHATRI, B., FORBES, G., 709 LEHOVSKY, K., FREZZA, A. M., BEHJATI, S., TARPEY, P., PILLAY, N., 710 CAMPBELL, P. J., TIRABOSCO, R., PRESNEAU, N., STRAUSS, S. J. & 711 FLANAGAN, A. M. 2014. Fibroblastic growth factor receptor 1 amplification in 712 osteosarcoma is associated with poor response to neo-adjuvant chemotherapy. Cancer 713 Med, 3, 980-7. 714 GAO, J. J., AKSOY, B. A., DOGRUSOZ, U., DRESDNER, G., GROSS, B., SUMER, S. O., 715 SUN, Y. C., JACOBSEN, A., SINHA, R., LARSSON, E., CERAMI, E., SANDER, C. 716 & SCHULTZ, N. 2013. Integrative Analysis of Complex Cancer Genomics and 717 Clinical Profiles Using the cBioPortal. Science Signaling, 6. 718 GUAGNANO, V., KAUFFMANN, A., WOHRLE, S., STAMM, C., ITO, M., BARYS, L., 719 PORNON, A., YAO, Y., LI, F., ZHANG, Y., CHEN, Z., WILSON, C. J., BORDAS, 720 V., LE, D. M., GAITHER, L. A., BORAWSKI, J., MONAHAN, J. E., 721 VENKATESAN, K., BRUMMENDORF, T., THOMAS, D. M., GARCIA- 722 ECHEVERRIA, C., HOFMANN, F., SELLERS, W. R. & GRAUS-PORTA, D. 2012.

723 FGFR genetic alterations predict for sensitivity to NVP-BGJ398, a selective pan- 724 FGFR inhibitor. Cancer Discov., 2, 1118-1133. 725 HANES, R., GRAD, I., LORENZ, S., STRATFORD, E. W., MUNTHE, E., REDDY, C. C., 726 MEZA-ZEPEDA, L. A. & MYKLEBOST, O. 2016. Preclinical evaluation of potential 727 therapeutic targets in dedifferentiated liposarcoma. Oncotarget. 728 HAUGSTEN, E. M., MALECKI, J., BJORKLUND, S. M., OLSNES, S. & WESCHE, J. 729 2008. Ubiquitination of fibroblast growth factor receptor 1 is required for its 730 intracellular sorting but not for its endocytosis. Mol Biol Cell, 19, 3390-403. 731 HAUGSTEN, E. M., SORENSEN, V., BRECH, A., OLSNES, S. & WESCHE, J. 2005. 732 Different intracellular trafficking of FGF1 endocytosed by the four homologous FGF 733 receptors. J Cell Sci, 118, 3869-81. 734 HAUGSTEN, E. M., SORENSEN, V., KUNOVA BOSAKOVA, M., DE SOUZA, G. A., 735 KREJCI, P., WIEDLOCHA, A. & WESCHE, J. 2016. Proximity Labeling Reveals 736 Molecular Determinants of FGFR4 Endosomal Transport. J Proteome Res, 15, 3841- 737 3855. 738 HAUGSTEN, E. M., WIEDLOCHA, A., OLSNES, S. & WESCHE, J. 2010. Roles of 739 fibroblast growth factor receptors in carcinogenesis. Mol Cancer Res, 8, 1439-52. 740 KOUHARA, H., HADARI, Y. R., SPIVAK-KROIZMAN, T., SCHILLING, J., BAR-SAGI, 741 D., LAX, I. & SCHLESSINGER, J. 1997. A lipid-anchored Grb2-binding protein that 742 links FGF-receptor activation to the Ras/MAPK signaling pathway. Cell, 89, 693-702. 743 KULESHOV, M. V., JONES, M. R., ROUILLARD, A. D., FERNANDEZ, N. F., DUAN, Q., 744 WANG, Z., KOPLEV, S., JENKINS, S. L., JAGODNIK, K. M., LACHMANN, A., 745 MCDERMOTT, M. G., MONTEIRO, C. D., GUNDERSEN, G. W. & MA'AYAN, A. 746 2016. Enrichr: a comprehensive gene set enrichment analysis web server 2016 update. 747 Nucleic Acids Res, 44, W90-7. 748 LAFORGIA, S., MORSE, B., LEVY, J., BARNEA, G., CANNIZZARO, L. A., LI, F., 749 NOWELL, P. C., BOGHOSIAN-SELL, L., GLICK, J., WESTON, A. & ET AL. 750 1991. Receptor protein-tyrosine phosphatase gamma is a candidate tumor suppressor 751 gene at human chromosome region 3p21. Proc Natl Acad Sci U S A, 88, 5036-40. 752 LORENZ, U. 2011. Protein tyrosine phosphatase assays. Curr Protoc Immunol, Chapter 11, 753 Unit 11 7. 754 MOHAMMADI, M., HONEGGER, A. M., ROTIN, D., FISCHER, R., BELLOT, F., LI, W., 755 DIONNE, C. A., JAYE, M., RUBINSTEIN, M. & SCHLESSINGER, J. 1991. A 756 tyrosine-phosphorylated carboxy-terminal peptide of the fibroblast growth factor 757 receptor (Flg) is a binding site for the SH2 domain of phospholipase C-gamma 1. 758 Mol.Cell Biol., 11, 5068-5078. 759 NADRATOWSKA-WESOLOWSKA, B., HAUGSTEN, E. M., ZAKRZEWSKA, M., 760 JAKIMOWICZ, P., ZHEN, Y., PAJDZIK, D., WESCHE, J. & WIEDLOCHA, A. 761 2014. RSK2 regulates endocytosis of FGF receptor 1 by phosphorylation on serine 762 789. Oncogene, 33, 4823-36. 763 PRIE, D. & FRIEDLANDER, G. 2010. Genetic disorders of renal phosphate transport. N 764 Engl J Med, 362, 2399-409. 765 ROUX, K. J., KIM, D. I. & BURKE, B. 2013. BioID: A Screen for Protein-Protein 766 Interactions. Curr.Protoc.Protein Sci., 74, 19-19. 767 ROUX, K. J., KIM, D. I., RAIDA, M. & BURKE, B. 2012. A promiscuous biotin ligase 768 fusion protein identifies proximal and interacting proteins in mammalian cells. J.Cell 769 Biol., 196, 801-810. 770 SANDILANDS, E., AKBARZADEH, S., VECCHIONE, A., MCEWAN, D. G., FRAME, M. 771 C. & HEATH, J. K. 2007. Src kinase modulates the activation, transport and signalling 772 dynamics of fibroblast growth factor receptors. EMBO Rep., 8, 1162-1169.

773 SCHNEIDER, C. A., RASBAND, W. S. & ELICEIRI, K. W. 2012. NIH Image to ImageJ: 25 774 years of image analysis. Nature Methods, 9, 671-675. 775 SHU, S. T., SUGIMOTO, Y., LIU, S., CHANG, H. L., YE, W., WANG, L. S., HUANG, Y. 776 W., YAN, P. & LIN, Y. C. 2010. Function and regulatory mechanisms of the 777 candidate tumor suppressor receptor protein tyrosine phosphatase gamma (PTPRG) in 778 breast cancer cells. Anticancer Res, 30, 1937-46. 779 SORIO, C., MENDROLA, J., LOU, Z., LAFORGIA, S., CROCE, C. M. & HUEBNER, K. 780 1995. Characterization of the receptor protein tyrosine phosphatase gene product PTP 781 gamma: binding and activation by triphosphorylated nucleosides. Cancer Res, 55, 782 4855-64. 783 SUN, T., ACETO, N., MEERBREY, K. L., KESSLER, J. D., ZHOU, C., MIGLIACCIO, I., 784 NGUYEN, D. X., PAVLOVA, N. N., BOTERO, M., HUANG, J., BERNARDI, R. J., 785 SCHMITT, E., HU, G., LI, M. Z., DEPHOURE, N., GYGI, S. P., RAO, M., 786 CREIGHTON, C. J., HILSENBECK, S. G., SHAW, C. A., MUZNY, D., GIBBS, R. 787 A., WHEELER, D. A., OSBORNE, C. K., SCHIFF, R., BENTIRES-ALJ, M., 788 ELLEDGE, S. J. & WESTBROOK, T. F. 2011. Activation of multiple proto- 789 oncogenic tyrosine kinases in breast cancer via loss of the PTPN12 phosphatase. Cell, 790 144, 703-18. 791 SZKLARCZYK, D., FRANCESCHINI, A., WYDER, S., FORSLUND, K., HELLER, D., 792 HUERTA-CEPAS, J., SIMONOVIC, M., ROTH, A., SANTOS, A., TSAFOU, K. P., 793 KUHN, M., BORK, P., JENSEN, L. J. & VON MERING, C. 2015. STRING v10: 794 protein-protein interaction networks, integrated over the tree of life. Nucleic Acids 795 Res, 43, D447-52. 796 TABERNERO, J., BAHLEDA, R., DIENSTMANN, R., INFANTE, J. R., MITA, A., 797 ITALIANO, A., CALVO, E., MORENO, V., ADAMO, B., GAZZAH, A., ZHONG, 798 B., PLATERO, S. J., SMIT, J. W., STUYCKENS, K., CHATTERJEE-KISHORE, M., 799 RODON, J., PEDDAREDDIGARI, V., LUO, F. R. & SORIA, J. C. 2015. Phase I 800 Dose-Escalation Study of JNJ-42756493, an Oral Pan-Fibroblast Growth Factor 801 Receptor Inhibitor, in Patients With Advanced Solid Tumors. Journal of Clinical 802 Oncology, 33, 3401-+. 803 TAYLOR, J. G., CHEUK, A. T., TSANG, P. S., CHUNG, J. Y., SONG, Y. K., DESAI, K., 804 YU, Y., CHEN, Q. R., SHAH, K., YOUNGBLOOD, V., FANG, J., KIM, S. Y., 805 YEUNG, C., HELMAN, L. J., MENDOZA, A., NGO, V., STAUDT, L. M., WEI, J. 806 S., KHANNA, C., CATCHPOOLE, D., QUALMAN, S. J., HEWITT, S. M., 807 MERLINO, G., CHANOCK, S. J. & KHAN, J. 2009. Identification of FGFR4- 808 activating mutations in human rhabdomyosarcomas that promote metastasis in 809 xenotransplanted models. J.Clin.Invest, 119, 3395-3407. 810 TURNER, N. & GROSE, R. 2010. Fibroblast growth factor signalling: from development to 811 cancer. Nat.Rev.Cancer, 10, 116-129. 812 VIZCAINO, J. A., CSORDAS, A., DEL-TORO, N., DIANES, J. A., GRISS, J., LAVIDAS, 813 I., MAYER, G., PEREZ-RIVEROL, Y., REISINGER, F., TERNENT, T., XU, Q. W., 814 WANG, R. & HERMJAKOB, H. 2016. 2016 update of the PRIDE database and its 815 related tools. Nucleic Acids Research, 44, D447-D456. 816 WEEKES, D., KASHIMA, T. G., ZANDUETA, C., PERURENA, N., THOMAS, D. P., 817 SUNTERS, A., VUILLIER, C., BOZEC, A., EL-EMIR, E., MILETICH, I., PATINO- 818 GARCIA, A., LECANDA, F. & GRIGORIADIS, A. E. 2016. Regulation of 819 osteosarcoma cell lung metastasis by the c-Fos/AP-1 target FGFR1. Oncogene, 35, 820 2852-61. 821 WESCHE, J., HAGLUND, K. & HAUGSTEN, E. M. 2011. Fibroblast growth factors and 822 their receptors in cancer. Biochem J, 437, 199-213.

823 WESCHE, J., MALECKI, J., WIEDLOCHA, A., EHSANI, M., MARCINKOWSKA, E., 824 NILSEN, T. & OLSNES, S. 2005. Two nuclear localization signals required for 825 transport from the cytosol to the nucleus of externally added FGF-1 translocated into 826 cells. Biochemistry, 44, 6071-6080. 827 ZHANG, K., CHU, K., WU, X., GAO, H., WANG, J., YUAN, Y. C., LOERA, S., HO, K., 828 WANG, Y., CHOW, W., UN, F., CHU, P. & YEN, Y. 2013. Amplification of FRS2 829 and activation of FGFR/FRS2 signaling pathway in high-grade liposarcoma. Cancer 830 Res, 73, 1298-307. 831 ZHANG, W. D., SAVELIEVA, K. V., TRAN, D. T., POGORELOV, V. M., CULLINAN, E. 832 B., BAKER, K. B., PLATT, K. A., HU, S., RAJAN, I., XU, N. H. & LANTHORN, T. 833 H. 2012. Characterization of PTPRG in Knockdown and Phosphatase-Inactive Mutant 834 Mice and Substrate Trapping Analysis of PTPRG in Mammalian Cells. Plos One, 7. 835 ZHOU, W. Y., ZHENG, H., DU, X. L. & YANG, J. L. 2016. Characterization of FGFR 836 signaling pathway as therapeutic targets for sarcoma patients. Cancer Biol Med, 13, 837 260-8. 838 839

840 Figure legends

841

842 Figure 1. A BioID proteomic screen for determinants of FGFR1 activity in osteosarcoma

843 cells. (A) A schematic presentation of the BioID experiment. Upon addition of biotin to cells,

844 proteins in close proximity to the BirA* tag will be biotinylated. Biotinylated proteins are

845 then isolated by Streptavidin pulldown and identified by quantitative LC MS/MS. The

846 following five conditions are compared: C1 (Control 1): U2OS cells stably expressing wild-

847 type FGFR1 (U2OS-R1), C2 (Control 2): U2OS cells stably coexpressing wild-type FGFR1

848 and BirA* (U2OS-R1 + BirA*), C3 (Control 3): U2OS cells stably coexpressing wild-type

849 FGFR1 and BirA* stimulated with FGF1 (U2OS-R1 + BirA* + FGF1), S1 (Sample 1): U2OS

850 cells stably expressing FGFR1 fused to BirA* (U2OS-R1-BirA*), S2 (Sample 2): U2OS cells

851 stably expressing FGFR1 fused to BirA* (U2OS-R1-BirA*) and stimulated with FGF1.

852 Biotin is added in all conditions. Addition of FGF1 induces activation of the receptor and its

853 downstream signalling (indicated in yellow). Proteins identified in C1 and C2 represent the

854 background while proteins identified in C3 represent proteins with induced expression upon

855 FGF1 stimulation. Proteins identified in S1 represent proteins in proximity to unstimulated

856 FGFR1 while proteins identified in S2 represents proteins in proximity to FGF1-activated

857 FGFR1. Proteins in proximity to the receptor are indicated by dark green and proteins further

858 away from the receptor are indicated in light green. Proteins with increased expression upon

859 FGF1 stimulation are indicated in blue. (B) U2OS-R1 cells or U2OS-R1-BirA* cells were

860 starved for 3 hours in serum free media before stimulation for 20 minutes with 100 ng/ml

861 FGF1 in the presence of heparin (20 U/ml). Cells were then lysed and the cellular material

862 was analysed by SDS-PAGE and western blotting using the indicated antibodies. A p in front

863 of the name of the antibody indicates that it recognizes the phosphorylated form of the

864 protein. Note that the total FGFR1 antibody recognizes the tagged version of FGFR1

865 (FGFR1-BirA*) less efficient than the wild-type receptor. A representative western blot is

866 shown. (C) U2OS-R1-BirA* cells were allowed to bind DL550-FGF1 at 4°C in the presence

867 of heparin and then washed (to remove excess DL550-FGF1) and either fixed directly (0 min)

868 or incubated for 20 min at 37°C before fixation (20 min). Fixed cells were stained with anti-

869 EEA1 antibody and Hoechst and examined by confocal microscopy. Representative cells are

870 shown. Scale bar 5 μm. (D) U2OS-R1-BirA* and U2OS-R1 cells were either left untreated or

871 treated with 50 mM biotin and/or 100 ng/ml FGF1 in the presence of 10 U/ml heparin as

872 indicated for 24 hours. The cells were then fixed and stained with anti FGFR1 antibody,

873 Alexa 488 streptavidin and Hoechst. Merged images are shown in the bottom panel.

874 Representative cells are shown. Scale bar 5 μm. (E) KEGG pathways analyses were applied

875 to the three datasets using Enrichr (http://amp.pharm.mssm.edu/Enrichr/)(Kuleshov et al.,

876 2016).

877

878 Figure 2. PTPRG binds and dephosphorylates FGFR1. (A) U2OS-R1-BirA* and U2OS-

879 R1 cells were transfected with PTPRG-MYC-FLAG plasmid for 24 hours. U2OS-R1-BirA*

880 cells not transfected with PTPRG were included as a control. Cells were then starved for 2

881 hours and left untreated or treated with 10 ng/ml FGF1 in the presence of 20 U/ml heparin for

882 15 minutes. After that, the cells were lysed and the lysates were subjected to

883 immunoprecipitation using anti-HA magnetic beads followed by SDS-PAGE and western

884 blotting with indicated antibodies. R1-BirA* is fused to an HA-tag in the C-terminal end. A

885 representative western blot is shown. (B) Phosphatase activity of recombinant GST-PTPRG

886 (catalytic domain) and GST-PTPN12 (catalytic domain) was estimated using pNPP assay. 2-

887 fold molar excess of GST was used as a control. The initial rate of pNPP hydrolysis was

888 measured colorimetrically (Abs. at 405 nm) during the first 10 min of reaction. The graph and

889 table represent the mean ± SD of three independent experiments. (C) U2OS-R1-BirA* cells

890 were serum-starved for 2 hours and then treated with 10 ng/ml FGF1 in the presence of 10

891 U/ml heparin for 15 minutes, lysed and the lysate was subjected to immunoprecipitation using

892 anti-HA-tag antibodies. R1-BirA* is fused to an HA-tag in the C-terminal end. The beads

893 containing immunoprecipitated FGFR1-BirA* were washed with lysis buffer without

894 phosphatase inhibitor and subjected to on-beads dephosphorylation using indicated

895 phosphatases or GST for 45 min, in the presence or absence of phosphatase inhibitors. After

896 the incubation with phosphatases the immunoprecipiteted receptors were released from the

897 beads and analysed by SDS-PAGE followed by western blotting using anti-pFGFR

898 (Y653/Y654) antibodies. Western blots were quantified and bands corresponding to

899 phosphorylated FGFR1 (pFGFR) were normalized to total FGFR1 immunoprecipitated and

900 presented as fraction of GST without phosphatase inhibitors. The graph represents the mean ±

901 SD of three independent experiments. The data were analysed using one-way RM ANOVA

902 followed by Tukey post hoc test. ***p ≤ 0.001, ns - not-significant. (D) U2OS-R1 cells were

903 transfected with PTPRG-MYC-FLAG, starved for 2 hours and either left untreated or treated

904 with 200 ng/ml FGF1 and 10 U/ml heparin for 1 hour. The cells were fixed and stained with

905 anti-FLAG, anti-FGFR1, anti-EEA1 antibodies and fluorophore (AF488, AF568, or AF647)

906 labeled secondary antibodies and Hoechst. The cells were imaged in conventional wide-field

907 mode and by SIM. Shown are Maximum Intensity Projections of whole cells (all z-sections)

908 for deconvolved wide-field images, and a single selected optical section for SIM images,

909 while all SIM z-sections were used for the 3D volume view, which was rotated 90° (side-

910 view). Stippled lined squares indicate a region of the cell that is shown in a different mode in

911 the panel below. Representative cells are shown. Scale bars 4 µm.

912

913 Figure 3. PTPRG counters FGFR1 autophosphorylation (A) Schematic presentation of

914 PTPRG. PTPRG is a transmembrane protein with an extracellular carbonic anhydrase-like

915 domain (CAH) and a fibronectin type III-like domain (FNIII). The intracellular part contains

916 two protein tyrosine phosphatase domains (PTP) of which only one is active (indicated in

917 orange). The other is called a pseudo-PTP. Mutation of aspartic acid 1028 to alanine

918 inactivates the phosphatase activity. (B) U2OS-R1-GFP cells transfected with PTPRG-myc-

919 FLAG (for 20 hours), serum starved for 2 hours, and unstimulated (-) or stimulated with

920 FGF1 for 15 min (FGF1), were fixed and stained with anti-myc and anti-Clathrin heavy chain,

921 and imaged by TIRF. Merged images are overlays of PTPRG in blue, FGFR-GFP in green,

922 and Clathrin in red. Blue and green overlay appears cyan. Green and red overlay appears

923 yellow. Images were deconvolved and representative cells are shown. Scale bar 4 m.(C)

924 U2OS-R1-GFP cells were transfected with MYC-FLAG-tagged PTPRG or PTPRG-D1028A

925 (for 20 hours), starved for 2 hours, and stimulated (or not) with FGF1 in the presence of

926 heparin for 10 minutes (in one case in the presence of FGFR1 tyrosine kinase inhibitor

927 PD173074) and then fixed and stained with anti-FLAG, anti-pFGFR1 (Y653/Y654), and

928 fluorophore labeled secondary antibodies. The cells were imaged by TIRF and representative

929 cells are shown. Merged images are overlays of PTPRG in blue, pFGFR1 in red, and FGFR1-

930 GFP in green. Stippled lines indicate cells transfected with PTPRG or PTPRG-D1028A. Scale

931 bars 8 µm. (D) The signal intensities for pFGFR1 in PTPRG-transfected or -untransfected

932 cells were measured for 15-30 cells for each condition in three independent experiments and

933 is presented as the mean values ± SD where values had been normalized to the signal intensity

934 of untransfected cells stimulated with FGF1. The data were analysed using one-way RM

935 ANOVA followed by Tukey post hoc test. ***p ≤ 0.001, **p ≤ 0.01, ns - not-significant.

936

937 Figure 4. PTPRG knockdown increases FGFR1 autophosphorylation. (A) U2OS-R1 cells

938 transfected with indicated siRNAs for 72 hours were lysed and RNA isolation, cDNA

939 synthesis and qRT-PCR were performed as described in materials and methods. The amount

940 of mRNA was calculated relative to the housekeeping gene SDHA and is expressed as

941 fraction of scr. The histograms represent the mean + SD of three independent experiments.

942 ***p ≤ 0.001. (B) Cells transfected with indicated siRNAs for 18 hours were transfected with

943 MYC-FLAG-tagged PTPRG or siRNA-Resistant PTPRG (PTPRG siRes #1). 24 hours later

944 cells were lysed and the lysates were subjected to SDS-PAGE followed by western blotting

945 using denoted antibodies. A representative western blot is shown. (C) U2OS-R1 cells were

946 treated with PTPRG siRNAs (#1-#3) or control siRNA (scr) for 72 hours. The cells were then

947 serum-starved for 2 hours before stimulation with 10 ng/ml FGF1 in the presence of 10 U/ml

948 heparin for 15 minutes. Next, the cells were lysed and the lysates were subjected to SDS-

949 PAGE followed by western blotting using denoted antibodies. A representative western blot is

950 shown. (D) U2OS-R1-GFP cells were transfected with control (scr) or PTPRG-specific

951 siRNA (siRNA #1) for a total of 72 hours, transfected with MYC-FLAG-tagged siRNA

952 resistant PTPRG (PTPRG siRes #1) or PTPRG-D1028A (PTPRG-D1028A siRes #1), for 20

953 hours. The cells were then starved for 2 hours, and stimulated (or not) with FGF1 in the

954 presence of heparin for 10 minutes and then fixed and stained with anti-FLAG, and anti-

955 phospho-FGFR (pFGFR) and fluorophore labeled secondary antibodies. The cells were

956 imaged by TIRF and representative cells are shown. Merged images are overlays of PTPRG

957 in blue, pFGFR in red, and FGFR1-GFP in green. Scale bars 8 µm. (E) The signal intensities

958 for pFGFR in PTPRG-transfected or -untransfected cells were measured for 15-30 cells for

959 each condition in four independent experiments and is presented as the mean values ± SD

960 where values had been normalized to the signal intensity of cells that were transfected with

961 PTPRG-specific siRNA, but not expressing tagged PTPRG, and stimulated with FGF1. The

962 data were analysed using one-way RM ANOVA followed by Tukey post hoc test. ***p ≤

963 0.001, **p ≤ 0.01, ns - not-significant.

964

965 Figure 5. Increased FGFR1 signalling upon PTPRG knockdown. (A) U2OS-R1 cells

966 were treated with PTPRG siRNAs (#1-#3) or control siRNA (scr) for 72 hours. Then the cells

967 were serum-starved for 2 hours followed by stimulation with 10 ng/ml FGF1 in the presence

968 of 10 U/ml heparin for various time points. The cells were then lysed and the lysates were

969 subjected to SDS-PAGE followed by western blotting using denoted antibodies. The western

970 blots were quantified and bands corresponding to phosphorylated proteins were normalized to

971 total FGFR1 or loading control (γ-tubulin) (as indicated) and presented as fraction of scr, at

972 15 minutes stimulation time point. Means ± SEM of three independent experiments are

973 presented on the graphs. The time-course series were analysed together using two-way

974 ANOVA. ***p ≤ 0.001, **p ≤ 0.01, *p ≤ 0.05. (B) G292 cells transfected with indicated

975 siRNAs for 72 hours were lysed and RNA isolation, cDNA synthesis and qRT-PCR were

976 performed as described in materials and methods. The amount of mRNA was calculated

977 relative to the housekeeping gene SDHA and is expressed as fraction of scr. The histograms

978 represent the mean + SD of three independent experiments. **p ≤ 0.01. (C) G292 cells were

979 left untreated or treated with 10 ng/ml FGF1 in the presence of 10 U/ml heparin for 20

980 minutes. The cells were then lysed and the cell lysates were subjected to immunoprecipitation

981 using anti-FGFR1 antibody followed by SDS-PAGE and western blotting with indicated

982 antibodies. Quantification of western blots are shown below. Bands corresponding to

983 phosphorylated FGFR1 (pFGFR) were normalized to total FGFR1. The graph represents the

984 mean + SD of three independent experiments. **p ≤ 0.01. (D) U2OS-R4 cells were treated as

985 in (A), lysed and the lysates were subjected to SDS-PAGE followed by western blotting using

986 denoted antibodies. The western blots were quantified and bands corresponding to

987 phosphorylated proteins were normalized to total FGFR1 or loading control (γ-tubulin) (as

988 indicated) and presented as fraction of scr, at 15 minutes stimulation time point. Means ±

989 SEM of three independent experiments are presented in the graphs. The time-course series

990 were analysed together using two-way ANOVA. ***p ≤ 0.001, **p ≤ 0.01, *p ≤ 0.05.

991

992

993 Figure 6. PTPRG regulates cellular sensitivity to FGF1. (A) U2OS-R1 cells were treated

994 with siRNAs against PTPRG (#1) or control siRNA (scr) for 72 hours. Then the cells were

995 serum-starved for 2 hours and stimulated with various concentrations of FGF1 in the presence

996 of 10 U/ml heparin for 15 minutes, lysed and the lysates were subjected to SDS-PAGE

997 followed by western blotting using denoted antibodies. A representative western blot is

998 shown. (B) Western blots were quantified and bands corresponding to phosphorylated FGFR1

999 (pFGFR) were normalized to loading control (γ-tubulin) and presented as fraction of scr, 10

1000 ng/ml stimulation. The graph represents the mean ± SEM of three independent experiments.

1001 The concentration series were analysed together using two-way ANOVA. **p ≤ 0.01. (C)

1002 G292 cells were left untreated or treated with FGFR1 siRNA or control siRNA (scr) for 72 h.

1003 During the last 48 hours the cells were treated with 100 ng/ml FGF1 in the presence of 10

1004 U/ml heparin. Cell viability was then measured using CellTiter-Glo assay. The obtained data

1005 were normalized to non-transfected cells, stimulated with FGF1. Three technical replicates for

1006 each condition were included in each experiment. The graph represents the mean + SD of four

1007 independent experiments. ***p ≤ 0.001, *p ≤ 0.05. A representative western blot showing the

1008 knockdown efficiency of FGFR1 after 72 hours are presented to the right. (D) G292 cells

1009 were treated with PTPRG siRNA (#1) or control siRNA (scr) for 72 hours and then stimulated

1010 with different concentrations of FGF1 in the presence of 10 U/ml heparin for 48 hours. Cell

1011 viability was then measured using CellTiter-Glo assay. Four technical replicates for each

1012 condition were included in each experiment. The obtained data were normalized to scr, 12.5

1013 ng/ml FGF1 and presented in the graph as means ± SEM of 4 independent experiments. The

1014 fitted curve represents non-linear regression analysis using Hill equation (dose-response with

1015 variable slope). The concentration series were analysed together using two-way ANOVA. **p

1016 ≤ 0.01.

1017

1018

1019 Figure 7. PTPRG influences the efficiency of FGFR inhibitors. (A) U2OS-R1 cells were

1020 treated with siRNAs against PTPRG (#1) or control siRNA (scr) for 72 hours, serum-starved

1021 for 2 hours and stimulated with 10 ng/ml FGF1 in the presence of 10 U/ml heparin and

1022 various concentrations of AZD4547 for 15 minutes. The cells were then lysed and the lysates

1023 were subjected to SDS-PAGE followed by western blotting using denoted antibodies. A

1024 representative western blot is shown. (B) Western blots were quantified and bands

1025 corresponding to phosphorylated FGFR1 (pFGFR) were normalized to loading control (γ-

1026 tubulin) and presented as fraction of scr, 10 ng/ml stimulation. The graph represents the mean

1027 ± SEM of three independent experiments. The fitted curve represents non-linear regression

1028 analysis using Hill equation (dose-response with variable slope). The inhibitor concentration

1029 series were analysed together using two-way ANOVA. *p ≤ 0.05. (C) G292 cells were treated

1030 with PTPRG siRNA (#1) or control siRNA (scr) for 72 hours and then stimulated with 10

1031 ng/ml FGF1 in the presence of 10 U/ml heparin and various concentrations of AZD4547 for

1032 48 hours. Cell viability was then measured using CellTiter-Glo assay. Four technical

1033 replicates for each condition were included in each experiment. The obtained data were

1034 normalized to scr without inhibitors and presented in the graph as means ± SEM of three

1035 independent experiments. The fitted curve represents non-linear regression analysis using Hill

1036 equation (dose-response with variable slope). The inhibitor concentration series were analysed

1037 together using two-way ANOVA. *p ≤ 0.05. (D) The graph shows the frequency of

1038 amplifications of the different FGFRs, deletions of PTPRG and the frequency of cases where

1039 at least one receptor is amplified and PTPRG is deleted. The figure is based on data generated

1040 by the TCGA Research Network (http://cancergenome.nih.gov/). The frequency is calculated

1041 according to the total number of cases for each study: KRCCC (Kidney Renal Clear Cell

1042 Carcinoma, 448 cases), PLC (Pan-Lung Cancer, 1144 cases), LSCC (Lung squamous cell

1043 carcinoma, 504 cases), BIC (Breast Invasive Carcinoma, 482 cases and 1105 cases), PC

1044 (Pancreatic Cancer, 109 cases), BUC (Bladder Urothelial Carcinoma, 127 cases), UCEC

1045 (Uterine Corpus Endometrial Carcinoma, 242 cases), Sarcoma (243 cases), HNSCC (Head

1046 and Neck Squamous Cell Carcinoma, 504 and 279 cases).

1047 Supplementary Figure legends

1048 Figure 1 – figure supplement 1. BioID of FGFR1 in osteosarcoma cells. U2OS-R1 cells,

1049 U2OS-R1-BirA* cells or U2OS-R1 cells coexpressing BirA* (U2OS-R1 + BirA*) were left

1050 untreated or treated with 50 mM biotin and/or 100 ng/ml FGF1 in the presence of 10 U/ml

1051 heparin as indicated for 24 hours. The cells were then lysed and the cellular material was

1052 analysed by SDS-PAGE and western blotting using the indicated antibodies. A representative

1053 western blot is shown.

1054

1055 Figure 1 – figure supplement Table 1. Proteins identified by quantitative LC MS/MS.

1056

1057 Figure 1 – figure supplement 2. STRING interaction network. Version 10.0 of the

1058 STRING database was used (http://string-db.org/)(Szklarczyk et al., 2015) to investigate

1059 protein-protein interactions and construct an interaction network map for hits from the dataset

1060 of FGF1-induced expression (C3). Only known interactions from experiments and databases

1061 were included and a high confidence interaction score (> 0.7) was applied.

1062

1063 Figure 1 – figure supplement 3. STRING interaction network. The dataset for proteins

1064 associated with unstimulated FGFR1 (S1) was subjected to the same analysis as in Fig. 1-

1065 figure supplement 2.

1066

1067 Figure 1 – figure supplement 4. STRING interaction network. The dataset for proteins

1068 associated with FGF1-stimulated FGFR1 (S2) was subjected to the same analysis as in Fig. 1-

1069 figure supplement 2.

1070

1071 Figure 5 – figure supplement 1. (A) RH30 cells were treated with PTPRG siRNAs (#1-#3)

1072 or control siRNA (scr) for 72 hours. The cells were then serum-starved for 2 hours before

1073 stimulation with FGF1 in the presence heparin for 15 minutes. Next, the cells were lysed and

1074 the lysates were subjected to SDS-PAGE followed by western blotting using denoted

1075 antibodies. A representative western blot is shown. (B) U2OS-R2 cells were treated with

1076 PTPRG siRNAs (#1-#3) or control siRNA (scr) for 72 hours. The cells were then serum-

1077 starved for 2 hours before stimulation with FGF1 in the presence heparin for 15-30 minutes.

1078 Next, the cells were lysed and the lysates were subjected to SDS-PAGE followed by western

1079 blotting using denoted antibodies. A representative western blot is shown.

1080

Figure 1 A C1: C2: C3: S1: S2: Cells: U2OS-R1 U2OS-R1 + BirA* U2OS-R1 + BirA* U2OS-R1-BirA* U2OS-R1-BirA* Stim.: - - FGF1 - FGF1 FGFR1 FGF1 FGFR1-BirA* FGF1 Biotin

Cytosol

BirA*

B U2OS- U2OS- C R1-BirA* R1 FGF1 EEA1 Merge FGF1 100 ng/ml: - + - + kDa FGFR1 150

100 0 min

pFGFR 150 100 FGF1 EEA1 Merge pPLC-γ 150

pERK1/2 37 20 min 50 γ-tubulin

D E U2OS-R1-BirA* U2OS-R1-BirA* U2OS-R1-BirA* U2OS-R1 - Biotin Biotin + FGF1 Biotin + FGF1 FGF1-induced protein expression (C3): Streptavidin Streptavidin Streptavidin Streptavidin MAPK signalling pathway Osteoclast differentiation Rap1 signalling pathway Ras signalling pathway Apoptosis Associated with unstimulated FGFR1 (S1): FGFR1 FGFR1 FGFR1 FGFR1 Preoteoglycans in cancer Endocytosis Adherens junction Rap1 signalling pathway SNARE interactions in vesicular transport

KEGG pathways Associated with FGF1-stimulated FGFR1 (S2): Merge Merge Merge Merge Glioma SNARE interactions in vesicular transport Neurotrophin signalling pathway Progesterone-mediated oocyte maturation mTOR signalling pathway

0 1 2 Enrichment (-z-score) bioRxiv preprint doi: https://doi.org/10.1101/120204; this version posted March 24, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

Figure 2 A U2OS-R1-BirA* U2OS-R1 B 8 ** ** - PTPRG-FLAG 6 Activity [U/µg] ±SD FGF1 10 ng/ml: - - - PTPRG 0.402 ±0.147 + + + kDa 4 IP:HA PTPN12 0.431 ±0.134 FLAG 250 150 M 2 µ [ pNNP/min]

FGFR1 150 0 Activity [U/nmol] ±SD

v 0 Lysate 250 PTPRG 26.4 ±9.62 FLAG M 150 n nM GST PTPN12 28.3 ±8.81 γ-tubulin 50 Buffer 150 150

PTPRGPTPN12 C Input 3.5% IP: HA

nM nM nM nM PTP inhibitors 15 15 150 nM 15 nM 150 1.5 *** GST PTPRGPTPRGPTPN12PTPN12 GST 150 PTPRGPTPRG ns PTP inhibitors: ------++ + - 1.0 FGF1 10 ng/ml: + +++++++ + kDa pFGFR 150 0.5 pFGFR/FGFR1 FGFR1 150 Lane: 1 2 3 4 5 6 7 8 9 10 0.0 M nM pERK1/2 GST GST 15 n 37 150 γ-tubulin 50 PTPRG PTPN12 15 nM PTPRG 15 nM PTPRG 150 nMPTPN12 150 nM PTPRG

D PTPRG FGFR1 EEA1 Merge

Whole cell projection

PTPRG FGFR1 EEA1 Merge -

Single z-section SIM

3D view 90o PTPRG FGFR1 EEA1 Merge

Whole cell projection

PTPRG FGFR1 EEA1 Merge FGF1 1h

Single z-section SIM bioRxiv preprint doi: https://doi.org/10.1101/120204; this version posted March 24, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

Figure 3 A B PTPRG PTPRG FGFR1-GFP CHC Merge zoom

CAH - FNIII

PTPRG FGFR1-GFP CHC Merge zoom PTP D1028A

Pseudo- FGF1 PTP

C D

ns 1.2 - ** *** ** 1.0 PTPRG pFGFR FGFR1-GFP Merge 0.8

0.6 pFGFR

FGF1 0.4

PTPRG pFGFR FGFR1-GFP Merge 0.2

0.0 FGF1: - + + + + FGF1

PD173074 PTPRG PD173074 PTPRG pFGFR FGFR1-GFP Merge PTPRG-D1028A FGF1

PTPRG-D1028A pFGFR FGFR1-GFP Merge bioRxiv preprint doi: https://doi.org/10.1101/120204; this version posted March 24, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

Figure 4

A B C *** Stimulation time: 0 15 min *** *** siRNA: scr #1 #2 #3 scr #1 #2 #3 1.01 FGF1 10 ng/ml: - - - - + + + + kDa PTPRG 150 PTPRG siRes #1 pFGFR

siRNA: - scr #1 #2 #3 scr #1 kDa 150 0.50.5 FGFR1 FLAG 250 mRNA levels mRNA 150 50 150 γ-tubulin 0.00 γ-tubulin 1 2 3 siRNA: scrscr #1 #2 #3

D PTPRG siRes #1 pFGFR FGFR1-GFP Merge E

1.2 ns

- *** scr ** *** 1.0

0.8 PTPRG siRes #1 pFGFR FGFR1-GFP Merge

0.6 *** pFGFR

scr 0.4 FGF1

0.2 PTPRG siRes #1 pFGFR FGFR1-GFP Merge 0.0 scr siRNA #1 FGF1: - + + + + FGF1 siRNA #1 siRNA

PTPRG-D1028A pFGFR FGFR1-GFP Merge PTPRG siRes #1 siRes #1

PTPRG-D1028A siRes #1 FGF1 siRNA #1 siRNA bioRxiv preprint doi: https://doi.org/10.1101/120204; this version posted March 24, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

Figure 5 A U2OS-R1 cells: Stimulation time:0 15 min 60 min 120 min siRNA: scr #1 #2 #3 scr #1 #2 #3 scr #1 #2 #3 scr #1 #2 #3

FGF1 10 ng/ml: - - - - + + + + + + + + + + + + kDa 150 pFGFR

FGFR1 100

pPLCγ 150

pERK1/2 37 γ-tubulin 50 10 4 4 scr scr scr

8 ** ** #1 ** 3 #1 3 #1 * #2 #2 #2 **

6 -t -t #3 2 #3 2 ubulin #3

4 γ/γ ubulin 1 1 2 pFGFR/FGFR1 pPLC /γ pERK1/2 0 0 0 0 30 60 90 120 0 30 60 90 120 0 30 60 90 120 FGF1 [min] FGF1 [min] FGF1 [min]

B C G292 cells: IP: FGFR1 - 10 ng/ml FGF1 G292 cells: siRNA: scr #1 #2 #3 scr #1 #2 #3 kDa ** ** pFGFR 150 ** 100 150 1.01 FGFR1 100 ** ** 0.50.5 3 **

2 mRNA levels mRNA 2

0.00 11 siRNA: scr #11 #22 #33 scr (Rel. to scr)

pFGFR/FGFR1 0 0 r c 1 2 3 s cr fgf 1 fgf 2 fgf 3 fgf s D U2OS-R4 cells: Stimulation time:0 15 min 60 min 120 min siRNA: scr #1 #2 #3 scr #1 #2 #3 scr #1 #2 #3 scr #1 #2 #3 FGF1 10 ng/ml: - - - - + + + + + + + + + + + + kDa kDa pFGFR 100

FGFR4 100

pPLCγ 150

pERK1/2 37 γ-tubulin 50

scr scr scr ** ***

#1 #1 ** #1 * #2 3 #2 ** 4 1.0 #2 -t

#3 -t #3 #3 ubulin /γ 2 ubulin γ/γ 2 0.5

pFGFR/FGFR4 1 pPLC pERK1/2

0 0 0.0 0 30 60 90 120 0 30 60 90 120 0 30 60 90 120 FGF1 [min] FGF1 [min] FGF1 [min] bioRxiv preprint doi: https://doi.org/10.1101/120204; this version posted March 24, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

Figure 6 A FGF1 [ng/ml]: 20 10 5 2.5 1.25 0.625 0.312 0 siRNA: scr #1 scr #1 scr #1 scr #1 scr #1 scr #1 scr #1 scr #1 kDa 150 pFGFR

150 FGFR1

pPLCγ 150

pERK1/2 37

50 γ-tubulin

B C 4 *** scr *** *** * 3 #1 ** 1.0 scr FGFR1 siRNA

2ubulin 0.5 FGFR1

1 viability Cell

γ -t pFGFR/ γ-tubulin 0 0.0 0.1 1 10 100 FGF1: - + - + - + FGF1 [ng/ml] scr FGFR1 siRNA D 1.50 scr

1.25 #1 ** 1.00 0.75 0.50 Cell viability Cell 0.25 0.00 0.01 0.1 1 10 100 FGF1 [ng/ml] bioRxiv preprint doi: https://doi.org/10.1101/120204; this version posted March 24, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

Figure 7 A AZD4547[nM]: 0 0 100 50 25 12.5 6.25 3.125 1.562 0.781 0.391 0.195 siRNA: scr #1 scr #1 scr #1 scr #1 scr #1 scr #1 scr #1 scr #1 scr #1 scr #1 scr #1 scr #1 FGF1 10 ng/ml: - - + + + + + + + + + + + + + + + + + + + + + + kDa 150 pFGFR

150 FGFR1

pPLCγ 150

pERK1/2 37

γ-tubulin 50

B C 3.5 scr 1.2 scr * * 3.0 #1 1.0 #1 2.5 0.8 2.0 ubulin 0.6 1.5 1.0 0.4 Cell viability Cell

γ -t pFGFR/ 0.5 0.2 0.0 0.0 0.1 1 10 100 1 10 100 1000 AZD4547 [nM] AZD4547 [nM]

D 30%

20% PTPRGPTPRG del +del + FGFRFGFR amp amp

PTPRGPTPRG del del

Frequency FGFR4FGFR4 amp amp 10% FGFR3FGFR3 amp amp

FGFR2FGFR2 amp amp

FGFR1FGFR1 amp amp

BIC (TCGA) BUC (TCGA) LSCC (TCGA)BIC (Nat 2012) UCEC (TCGA) KRCCC (TCGA) Sarcoma (TCGA)HNSCC (TCGA) PLC (Nat Genet 2016) PC (Nat Com 2015) HNSCC (Nat 2016) PLC (Nat Genet 2016) bioRxiv preprint doi: https://doi.org/10.1101/120204; this version posted March 24, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

Figure 1 - figure supplement 1

U2OS-R1- U2OS-R1 U2OS-R1 BirA* + BirA* Biotin: - + + - + + - + + FGF1: - - + - - + - - + kDa 250

150 100 75 Streptavidin 50

25 20

250

150 100 HA 75 50 37

γ-tubulin 50 bioRxiv preprint doi: https://doi.org/10.1101/120204; this version posted March 24, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

Figure 1 - figure supplement 2 CELF1 NAV3 GPATCH4 WDR43 FAM134A CKAP4 LMNA NUS1 MCL1 PLEC RRS1 AIFM1 VPS54 RQCD1 SLC16A1 DGKD RACGAP1 KCNN4 MBOAT7 LMAN1 EMD CD44 FNDC3A DAZAP1 SRPR SRSF10 HMOX2 RPN1 C7orf50 ARHGAP25 TIAM1 PIGU SAV1

NIPBL SRPRB

DOCK4 HNRNPH3 MAFF RAB10 RAP1B

FRMD4B OSBPL8 FOSL2 TMEM214

HBB JUND CPEB4 NSF ATP2B1 PTPN1

FAM98A TRAF1 CSPG4 GOLT1B JUNB HBA1

FOSL1 LAT2 CKAP2L RELB EGFR

ABCD3 ERRFI1 HSPE1 FGF1 FRMD4A MAX

BLOC1S6 DDRGK1 Transcription factors FMNL1 UFL1 EPN2 AUP1 UBE2J1 PREB FAM54B USE1 IL1A C19orf10 EPB49 FAM177A1 FKBP2 ANTXR2 SOX17 STK11IP MIA3 SGPL1 HM13 C11orf57 ETS1 ESM1 PRR5L PNPLA6 bioRxiv preprint doi: https://doi.org/10.1101/120204; this version posted March 24, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

Figure 1 - figure supplement 3 PTPRG POR NHS ISG15 CNKSR2 PRR16 RPS6KA3 NPHP4 C11orf49 PPP1R15B ARHGEF11 ABI3 IGF2R SERPINA1 ARHGEF26 OCLN MINK1 ZNF14 LPHN2 TMEM109 LGMNLGM EPB41L3 CHMP6 TENC1 BAIAP2 SPTBN2 APBA2 PLEKHA1 LMTK2 SLC4A7 PRRT3 LAT2 CXADR FAM171A1

RABL3 CASK MCAM PALM PRR11 SLC12A2 SLC39A10 EPS8 SLC12A7 VRK2 USP6NL CDC42EP1 ESYT2 DST PRR14L DLG1 FARP1 STBD1 ATP2B1 SENP2 UBIAD1 EPN2 SCRIB TFRC TRIP11 APC EGFR STEAP3 GBP5 HSPE1 MET PARP9 GOSR2 CDC42EP3 RHBDD2 SLC30A1 BET1L BCAP31

PTPN13 YES1 PTPN1 BET1 ZFC3H1 ELFN2 SLC35F2 STX5

SH3BP4 WIZ EPHA2 VAMP3 FCHO2 EFNB1 ARF6 CSPG4 PLCD3 VAMP2 TENM2 VAPB CAV1CAV1 HBS1L DCBLD2 PIP5K1C TIAM1 MYO1C DGKD C19orf26 MTMR10

PLCD1 SRC CD44 FARP2 FAU TMEM214 STXBP6 VANGL1 ZDHHC8 OSBPL8 TBC1D23 DSG2 SHB C2CD4C SRPR PVRL3 AGFG2 SPECC1 NUMB EHD3 KIDINS220 EFR3A RASA3 FRS2 UTRN KIAA1211L AGAP1 FMNL1 KCNN4 LSR DAG1 ERBB2IP CDC42EP4 PPP1R16A ZDHHC5 OTUD6B FGFR1FGFR1 SLC9A3R2 FAM171B HSPB3 FLOT1 CNGB3 RAPH1 RELL1 BAI1

EBAG9 FMNL3 ANKRD26 TAP1 KRIT1 JPH1 MRRF MYOF CDC42BPA SGMS1 ROR2 EPB41L4B FPGS ELOVL1 EMD TULP3 MARK3 EFCAB4B GPR176 SLC1A5 CDCA3 USP35 KIAA0754 bioRxiv preprint doi: https://doi.org/10.1101/120204; this version posted March 24, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

Figure 1 - figure supplement 4

ADAM19 TMEM51 IDO1 XIRP1 UNC5B LGMN TBC1D8

ITPKC ZFPL1 STIM2 RABL3

RPS6KA3 EPN2 TP53I11

VAMP2 TAP1 GBP5 PLCG1 RPS6KA1

CNGB3 SHC4 COTL1 STX6

TRIB1 ISG15 VAMP44 BET1L CCNB2

BET1 OAS1 CCNE1 EBAG9 ISG20 SLC20A1

GGA2 VANGL1 A2M GOLGB1 VGLL4 ELOVL1 S100A2 DDX60 bioRxiv preprint doi: https://doi.org/10.1101/120204; this version posted March 24, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license.

Figure 5 - figure supplement 1

A RH30 cells: Stimulation time: 0 15 min siRNA: scr #1 #2 #3 scr #1 #2 #3 FGF1 10 ng/ml: - - - - + + + + kDa

IB: pFGFR 150

150 pPLC

pERK 37

FGFR4 150

B U2OS-R2 cells: Stimulation time: 0 15 min 30 min siRNA: scr #1 #2 #3 scr #1 #2 #3 scr #1 #2 #3 FGF1 10 ng/ml: - - - - + + + + + + + + kDa 150 IB: pFGFR

FGFR2 100

pPLC-γ 150

pERK 37

γ-tubulin 50