DOCSLIB.ORG

Cb12ca53fbe93fc5f62e4d4cfeff0

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Cb12ca53fbe93fc5f62e4d4cfeff0 Hindawi BioMed Research International Volume 2020, Article ID 5458063, 10 pages https://doi.org/10.1155/2020/5458063 Research Article The Diversity of Midgut Bacteria among Wild-Caught Phlebotomus argentipes (Psychodidae: Phlebotominae), the Vector of Leishmaniasis in Sri Lanka Nayana Gunathilaka ,1 Hirunika Perera,1 Tharaka Wijerathna ,1 Wasana Rodrigo,2 and N. D. A. D. Wijegunawardana 3 1Department of Parasitology, Faculty of Medicine, University of Kelaniya, Ragama, Sri Lanka 2Biotechnology Unit, Industrial Technology Institute, Colombo 07, Sri Lanka 3Department of Bioprocess Technology, Faculty of Technology, Rajarata University of Sri Lanka, Sri Lanka Correspondence should be addressed to Nayana Gunathilaka; [email protected] Received 25 March 2020; Revised 29 June 2020; Accepted 20 July 2020; Published 19 August 2020 Academic Editor: Clara G. de los Reyes-Gavilan Copyright © 2020 Nayana Gunathilaka et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Phlebotomus argentipes is the main suspected vector for leishmaniasis in Sri Lanka. Investigations on the presence of aerobic bacteria in the gut of sand flies which evidence a potential approach to control leishmaniasis transmission through a paratransgenic strategy are still not available for the local sand fly populations. Field-caught unfed female sand flies collected from three selected Medical Officer of Health (MOH) areas (Polpithigama, Maho, and Galgamuwa) in Kurunegala District, Sri Lanka from August to December 2018 were used. Prokaryotic 16S ribosomal RNA partial gene was amplified and sequenced. Morphological identification revealed the presence of only one sand fly species, P. argentipes (n = 1,969). A total of 20 organisms belonging to two phyla (Proteobactericea and Furmicutes) were detected within the gut microbial community of the studied sand fly specimens. This study documents the first-ever observation of Rhizobium sp. in the midgut of P. argentipes. The presence of Bacillus megaterium, which is considered as a nonpathogenic bacterium with potential use for paratransgenic manipulation of P. argentipes suggest that it may be used as a delivery vehicle to block the vectorial transmission of Leishmania parasites. In addition, Serratia marcescens may be used as a potential candidate to block the parasite development in sand fly vectors since it has evidenced antileishmanial activities in previous investigations. Hence, further studies are required to gain full insight into the potential use of this bacterium in the control of Leishmania parasites through paratransgenesis. 1. Introduction could be taken from the environment by feeding or transta- dial passage [3]. Leishmaniasis is a vector-borne disease transmitted through In Sri Lanka, Phlebotomus argentipes is considered the female sand flies (Psychodidae: Phlebotomine), and it is vector for leishmaniasis transmission [4]. Several studies have caused by a unicellular protozoan parasite belonging to the recorded the prevalence of bacterial community in the midgut genus Leishmania. It is considered a neglected tropical sand fly vectors. However, such an investigation has not been disease, and at present, this disease is endemic in 102 coun- conducted in Sri Lanka. The microbial community may be tries [1]. Female sand flies feed on mammalian blood for different from country to country as it depends on the geo- egg development and maturation. As both males and females graphical distribution of insects [5]. Currently, there is no feed on plant nectar as a sugar source, they may acquire plant effective vector control programme against sand flies imple- bacteria [2]. During larval development, they feed on organic mented within the country. Well-planned, integrated vector detritus which may contain a wide range of microorganisms. management practices that combine physical, chemical, and Previous studies have indicated that newly emerged sand flies biological methods are essential for the successful control of were associated with a large amount of bacterial DNA that leishmaniasis through the prevention of transmission. 2 BioMed Research International It is important to emphasize that when considering any tory at the Department of Parasitology, Faculty of Medicine, means of biological control, its effectiveness, ecological University of Kelaniya, Ragama, Sri Lanka. Sand flies were soundness, and sustainability should be determining factors. first immobilized on ice. Each sand fly was sterilized from Most of the available biological control methods focus on kill- 60 seconds in 30 μL of 70% ethanol and rinsed thoroughly ing the insect vector, while other methods such as the sterile using phosphate-buffered saline (PBS) (50 μL of 1x sterile insect technique (SIT), release of insects carrying a dominant PBS (pH 7.3)) prior to dissection. This step was performed lethal (RIDL) [6], and paratransgenesis [7] are also being to confirm that there was no bacterial contamination from tested to suppress the vector population. Of these, the use of the surface. The final wash of this cleaning procedure was paratransgenic sand flies has emerged recently as a promising used for subsequent dissection analysis. option for the control of leishmaniasis transmission [7]. Female sand flies may ingest macrophages infected with 2.3. Dissection of the Midgut of Sterilized Sand Flies. The ster- amastigotes during feeding on blood meal from an infected ilized specimens were transferred onto a drop of sterilized PBS vertebrate host. Later in the midgut of sand flies, the parasit- placed on a sterile microscope slide separately. The specimens ized cells digest and release amastigotes. The conditions in were dissected under a dissecting microscope, and the midgut the midgut stimulate the transformation of amastigotes into was removed. Genitalia was used to confirm the species iden- flagellated promastigote form. Thus, possible bacteria- tification referring to morphological features [14, 15], and parasite interactions take place between the gut microbial only Phlebotomus argentipes was taken for the present exper- community and parasite [8, 9]. In paratransgenic strategies iment. The midgut of five sand flies were pooled in a 1.5 mL to control insect vectors, symbiotic gut-associated bacteria of sterile microcentrifuge tube containing 150 μL of sterile 1x insects are transformed to express molecules with antiparasitic PBS (pH 7.3) and homogenized using a disposable pestle. activity [10, 11]. The introduction of these transformed organ- The lysate was diluted to 500 μL with 1x PBS. From this stock isms will result in antiparasitic activity in the gut of sand flies solution, a dilution series of the lysate (100-10-9) was prepared. by which means the pathogen’s transmission is prevented. Several studies have reported the presence of aerobic bac- 2.4. Culturing and Isolation of Bacteria. About 100 μL of each teria in the gut of sand flies [12, 13], while a more recent study lysate dilution was plated onto 25 mL of brain heart infusion has claimed that this association between sand flies and (BHI) agar in petri dishes (9 cm in diameter). BHI was picked microbiota may depend on the environment in which they as a nonselective medium to promote the growth of microbes fi including nutritionally fastidious bacteria. Plates were incu- live and may not demonstrate speci city for gut colonization ° to a particular host fly species [7]. Therefore, a first-hand bated in the dark at 28 C for up to 2 weeks under aerobic understanding of which species of gut bacteria are present in conditions. The whole experiment procedure was repeated the local sand fly population in Sri Lanka would be useful to 10 times with 5 midgut pools of P. argentipes. select a candidate species to be used for transformation exper- iments in the future. Hence, the proposed study is aimed at 2.5. Morphological, Biochemical, and Physiological screening the availability of such gut microbiome that may Characterization of Bacteria. A record of the phenotypically have an antiparasitic property or easy transformable species different colonies was used to determine the occurrence of bac- in order to evaluate the effectiveness of a paratransgenic strat- teria in the midgut of each sand fly. These colonies were then egy as a means to control leishmaniasis in Sri Lanka. subcultured to obtain a pure culture. All isolates were differen- tiated by Gram staining, biochemical tests, and morphological ’ 2. Method characterization. Gram s stains, endospore stains, acid fast stains, and motility testing were carried out along with aerobic 2.1. Collection of Sand Flies. Sand flies were collected from and anaerobic growth testing. Oxidase, catalase, acid produc- three selected Medical Officer of Health (MOH) areas (Pol- tion [16], and O/F (oxidative and fermentative) tests were pithigama, Maho, and Galgamuwa) in Kurunegala District carried out to determine physiological characteristics [17, 18]. ° ° (228-333 N, 104-178 E), North Western Province of Sri fi Lanka which is a well-known endemic focus for cutaneous 2.6. Identi cation of Isolated Bacteria by DNA Sequencing. leishmaniasis. It covers a land area of 4,816 km2 in the country Genomic DNA was extracted from individual colonies using with 1,610,299 inhabitants. The district receives an average of a QIAmp DNA Mini Kit (Qiagen GmbH, Hilden, Germany) ’ 2,095 mm of rainfall annually. The average temperature and according to the manufacturer s instructions. Nearly 1000 bp ° fi humidity are 31.7 C and 69.6%, respectively. The major activ- of the bacterial 16S rRNA gene was ampli ed using universal ′ ′ ities of the population are agriculture and animal farming. primers 27F (5 AGAGTTTGATCCTGGCTCAG 3 ) and Cattle-baited net traps (CBNT) were used to collect sand 1492R (5′ TACGGCTACCTTGTTACGACTT 3′) [19]. flies. The trap was set at 7.00 p.m. at each location during Polymerase chain reaction (PCR) amplification was carried August to December 2018 and searched for adult sand flies out using a reaction mixture containing 1x PCR buffer (Invitro- μ fi from 9.00 to 10.00 p.m. and from 4.00 to 5.00 a.m.
Load more

Recommended publications
  • Identification and Sequence Analyses of Novel Lipase Encoding Novel
    Shahinyan et al. BMC Microbiology (2017) 17:103 DOI 10.1186/s12866-017-1016-4 RESEARCH ARTICLE Open Access Identification and sequence analyses of novel lipase encoding novel thermophillic bacilli isolated from Armenian geothermal springs Grigor Shahinyan1, Armine Margaryan1,2, Hovik Panosyan2 and Armen Trchounian1,2* Abstract Background: Among the huge diversity of thermophilic bacteria mainly bacilli have been reported as active thermostable lipase producers. Geothermal springs serve as the main source for isolation of thermostable lipase producing bacilli. Thermostable lipolytic enzymes, functioning in the harsh conditions, have promising applications in processing of organic chemicals, detergent formulation, synthesis of biosurfactants, pharmaceutical processing etc. Results: In order to study the distribution of lipase-producing thermophilic bacilli and their specific lipase protein primary structures, three lipase producers from different genera were isolated from mesothermal (27.5–70 °C) springs distributed on the territory of Armenia and Nagorno Karabakh. Based on phenotypic characteristics and 16S rRNA gene sequencing the isolates were identified as Geobacillus sp., Bacillus licheniformis and Anoxibacillus flavithermus strains. The lipase genes of isolates were sequenced by using initially designed primer sets. Multiple alignments generated from primary structures of the lipase proteins and annotated lipase protein sequences, conserved regions analysis and amino acid composition have illustrated the similarity (98–99%) of the lipases with true lipases (family I) and GDSL esterase family (family II). A conserved sequence block that determines the thermostability has been identified in the multiple alignments of the lipase proteins. Conclusions: The results are spreading light on the lipase producing bacilli distribution in geothermal springs in Armenia and Nagorno Karabakh.
    [Show full text]
  • Biochemical Characterization and 16S Rdna Sequencing of Lipolytic Thermophiles from Selayang Hot Spring, Malaysia
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Available online at www.sciencedirect.com ScienceDirect IERI Procedia 5 ( 2013 ) 258 – 264 2013 International Conference on Agricultural and Natural Resources Engineering Biochemical Characterization and 16S rDNA Sequencing of Lipolytic Thermophiles from Selayang Hot Spring, Malaysia a a a a M.J., Norashirene , H., Umi Sarah , M.H, Siti Khairiyah and S., Nurdiana aFaculty of Applied Sciences, Universiti Teknologi MARA, 40450 Shah Alam, Selangor, Malaysia. Abstract Thermophiles are well known as organisms that can withstand extreme temperature. Thermoenzymes from thermophiles have numerous potential for biotechnological applications due to their integral stability to tolerate extreme pH and elevated temperature. Because of the industrial importance of lipases, there is ongoing interest in the isolation of new bacterial strain producing lipases. Six isolates of lipases producing thermophiles namely K7S1T53D5, K7S1T53D6, K7S1T53D11, K7S1T53D12, K7S2T51D14 and K7S2T51D19 were isolated from the Selayang Hot Spring, Malaysia. The sampling site is neutral in pH with a highest recorded temperature of 53°C. For the screening and isolation of lipolytic thermopiles, selective medium containing Tween 80 was used. Thermostability and the ability to degrade the substrate even at higher temperature was proved and determined by incubation of the positive isolates at temperature 53°C. Colonies with circular borders, convex in elevation with an entire margin and opaque were obtained. 16S rDNA gene amplification and sequence analysis were done for bacterial identification. The isolate of K7S1T53D6 was derived of genus Bacillus that is the spore forming type, rod shaped, aerobic, with the ability to degrade lipid.
    [Show full text]
  • Patterns of Horizontal Gene Transfer Into the Geobacillus Clade
    Imperial College London London Institute of Medical Sciences Patterns of Horizontal Gene Transfer into the Geobacillus Clade Alexander Dmitriyevich Esin September 2018 Submitted in part fulfilment of the requirements for the degree of Doctor of Philosophy of Imperial College London For my grandmother, Marina. Without you I would have never been on this path. Your unwavering strength, love, and fierce intellect inspired me from childhood and your memory will always be with me. 2 Declaration I declare that the work presented in this submission has been undertaken by me, including all analyses performed. To the best of my knowledge it contains no material previously published or presented by others, nor material which has been accepted for any other degree of any university or other institute of higher learning, except where due acknowledgement is made in the text. 3 The copyright of this thesis rests with the author and is made available under a Creative Commons Attribution Non-Commercial No Derivatives licence. Researchers are free to copy, distribute or transmit the thesis on the condition that they attribute it, that they do not use it for commercial purposes and that they do not alter, transform or build upon it. For any reuse or redistribution, researchers must make clear to others the licence terms of this work. 4 Abstract Horizontal gene transfer (HGT) is the major driver behind rapid bacterial adaptation to a host of diverse environments and conditions. Successful HGT is dependent on overcoming a number of barriers on transfer to a new host, one of which is adhering to the adaptive architecture of the recipient genome.
    [Show full text]
  • Insecticidal Activity of Bacteria from Larvae Breeding Site with Natural Larvae Mortality: Screening of Separated Supernatant and Pellet Fractions
    pathogens Article Insecticidal Activity of Bacteria from Larvae Breeding Site with Natural Larvae Mortality: Screening of Separated Supernatant and Pellet Fractions Handi Dahmana 1,2 , Didier Raoult 1,2, Florence Fenollar 2,3 and Oleg Mediannikov 1,2,* 1 IRD, AP-HM, MEPHI, Aix Marseille University, 13005 Marseille, France; [email protected] (H.D.); [email protected] (D.R.) 2 IHU-Méditerranée Infection, 13005 Marseille, France; fl[email protected] 3 IRD, AP-HM, SSA, VITROME, Aix Marseille University, 13005 Marseille, France * Correspondence: [email protected]; Tel.: +33-(0)4-13-73-24-01; Fax: +33-(0)4-13-73-24-02 Received: 15 May 2020; Accepted: 17 June 2020; Published: 18 June 2020 Abstract: Mosquitoes can transmit to humans devastating and deadly pathogens. As many chemical insecticides are banned due to environmental side effects or are of reduced efficacy due to resistance, biological control, including the use of bacterial strains with insecticidal activity, is of increasing interest and importance. The urgent actual need relies on the discovery of new compounds, preferably of a biological nature. Here, we explored the phenomenon of natural larvae mortality in larval breeding sites to identify potential novel compounds that may be used in biological control. From there, we isolated 14 bacterial strains of the phylum Firmicutes, most of the order Bacillales. Cultures were carried out under controlled conditions and were separated on supernatant and pellet fractions. The two fractions and a 1:1 mixture of the two fractions were tested on L3 and early L4 Aedes albopictus. Two concentrations were tested (2 and 6 mg/L).
    [Show full text]
  • Variability of Rrna Operon Copy Number and Growth Rate Dynamics of Bacillus Isolated from an Extremely Oligotrophic Aquatic Ecosystem
    ORIGINAL RESEARCH published: 05 January 2016 doi: 10.3389/fmicb.2015.01486 Variability of rRNA Operon Copy Number and Growth Rate Dynamics of Bacillus Isolated from an Extremely Oligotrophic Aquatic Ecosystem Jorge A. Valdivia-Anistro1, Luis E. Eguiarte-Fruns1, Gabriela Delgado-Sapién2, Pedro Márquez-Zacarías3, Jaime Gasca-Pineda1, Jennifer Learned4, James J. Elser4, Gabriela Olmedo-Alvarez5 and Valeria Souza1* 1 Laboratorio de Evolución Molecular y Experimental, Departamento de Ecología Evolutiva, Instituto de Ecología, Universidad Nacional Autónoma de México, Coyoacán, Mexico, 2 Laboratorio de Genómica Bacteriana, Departamento de Microbiología y Parasitología, Facultad de Medicina, Universidad Nacional Autónoma de México, Coyoacán, Mexico, 3 School of Biology, Georgia Institute of Technology, Atlanta, GA, USA, 4 School of Life Sciences, Arizona State University, Tempe, AZ, USA, 5 Laboratorio de Bacteriología Molecular, Departamento de Ingeniería Genética, CINVESTAV – Unidad Irapuato, Irapuato, Mexico The ribosomal RNA (rrn) operon is a key suite of genes related to the production Edited by: of protein synthesis machinery and thus to bacterial growth physiology. Experimental Roland Hatzenpichler, evidence has suggested an intrinsic relationship between the number of copies of this California Institute of Technology, USA operon and environmental resource availability, especially the availability of phosphorus Reviewed by: (P), because bacteria that live in oligotrophic ecosystems usually have few rrn operons Sebastian Kopf, Princeton University, USA and a slow growth rate. The Cuatro Ciénegas Basin (CCB) is a complex aquatic Albert Leopold Mueller, ecosystem that contains an unusually high microbial diversity that is able to persist Stanford University, USA under highly oligotrophic conditions. These environmental conditions impose a variety *Correspondence: Valeria Souza of strong selective pressures that shape the genome dynamics of their inhabitants.
    [Show full text]
  • Evaluation of Cellulases and Xylanases Production from Bacillus Spp
    Kafkas Univ Vet Fak Derg Kafkas Universitesi Veteriner Fakultesi Dergisi 25 (1): 39-46, 2019 ISSN: 1300-6045 e-ISSN: 1309-2251 Journal Home-Page: http://vetdergikafkas.org Research Article DOI: 10.9775/kvfd.2018.20280 Online Submission: http://submit.vetdergikafkas.org Evaluation of Cellulases and Xylanases Production from Bacillus spp. Isolated from Buffalo Digestive System Ahmad RAZA 1,2 Saira BASHIR 1,2,a Romana TABASSUM 1,2 1 National Institute for Biotechnology and Genetic Engineering (NIBGE), P.O. Box 577, Jhang Road, Faisalabad 38000, PAKISTAN 2 Pakistan Institute of Engineering and Applied Sciences (PIEAS), Islamabad 44000, PAKISTAN a ORCID: 0000-0002-7016-2131 Article ID: KVFD-2018-20280 Received: 31.05.2018 Accepted: 18.09.2018 Published Online: 18.09.2018 How to Cite This Article Raza A, Bashir S, Tabassum R: Evaluation of cellulases and xylanases production from Bacillus spp. isolated from buffalo digestive system.Kafkas Univ Vet Fak Derg, 25 (1): 39-46, 2019. DOI: 10.9775/kvfd.2018.20280 Abstract Cellulases and xylanases have high industrial demand due to their paramount importance in biological processes. The present study was aimed to evaluate the fiber degrading potential of Bacillus spp. isolated from buffalo digestive system. A total of fourteen isolates from rumen and eight isolates from dung were screened on carboxymethyl cellulose (CMC; 1%) agar plates, showing clear zone of CMC hydrolysis. All screened isolates were confirmed by targeting the 16S rRNA gene, sequencing and phylogenetic analysis. The enzyme activity index (EAI) of all screened isolates was calculated and it was observed that BR28 (Bacillus subtilis), BR96 (Bacillus amyloliquefaciens), BD69 (Bacillus tequilensis) and BD92 (Bacillus sonorensis) exhibit 2.11, 2.05, 2.56 and 2.45 EAI, respectively.
    [Show full text]
  • Antioxidant Activity and Mineral Content of Rocket (Eruca Sativa) Plant from Italian and Bulgarian Origins
    ANTIOXIDANT ACTIVITY AND MINERAL CONTENT OF ROCKET (ERUCA SATIVA) PLANT FROM ITALIAN AND BULGARIAN ORIGINS Georgi Matev1,2, Petya Dimitrova2, Nadezhda Petkova3, Ivan Ivanov3 and Dasha Mihaylova4* Address(es): 1 Executive Environment Agency (ExEA), Regional Laboratory - Plovdiv, Bulgaria. 2 Department of Analytical Chemistry and Physicochemistry, University of Food Technologies, Plovdiv, Bulgaria. 3 Department of Organic Chemistry and Inorganic Chemistry, University of Food Technologies, Plovdiv, Bulgaria. 4 Department of Biotechnology, University of Food Technologies, Plovdiv, Bulgaria. *Corresponding author: [email protected] doi: 10.15414/jmbfs.2018.8.2.756-759 ARTICLE INFO ABSTRACT Received 3. 5. 2018 Rocket plant (Eruca sativa) is a green leafy vegetable with significant levels of bioactive active components. Although, this plant is Revised 31. 7. 2018 known in Bulgaria, scanty data concerning chemical composition of representatives with Bulgarian origin is available. The aim of this Accepted 7. 8. 2018 study was to evaluate and to compare the biological potential of Italian and Bulgarian rockets in terms of their antioxidant activity, total Published 1. 10. 2018 phenolic content and total hydroxycinnamic acid derivatives. The micro- and macro elements were evaluated as well. The highest content of total phenolic content was detected in Bulgarian rocket – 4.45 mg gallic acid equivalent per g dry weight, while in Italian samples dominated the total hydroxycinnamic acid derivatives – 1.52 mg chlorogenic acid equivalent per g dry weight. The antioxidant Regular article activity was not significantly different in both samples. The presence Co and Al was reported for the first time, as in our study their values were higher in a rocket from Italian origin (75.6 and 595 mg/kg).
    [Show full text]
  • Analysis of Bacteria Associated with Honeys of Different Geographical
    RESEARCH ARTICLE Analysis of bacteria associated with honeys of different geographical and botanical origin using two different identification approaches: MALDI-TOF MS and 16S rDNA PCR technique 1 1 1,2 1,2 Paweø PomastowskiID *, Michaø ZøochID , Agnieszka Rodzik , Magda Ligor , Markus Kostrzewa3, Bogusøaw Buszewski1,2 a1111111111 1 Interdisciplinary Center for Modern Technologies, Nicolaus Copernicus University in Torun, Torun, Poland, 2 Department of Environmental Chemistry and Bioanalytics, Faculty of Chemistry, Nicolaus Copernicus a1111111111 University in Torun, Torun, Poland, 3 Bruker Daltonik GmbH, Bremen, Germany a1111111111 a1111111111 * [email protected] a1111111111 Abstract In the presented work identification of microorganisms isolated from various types of honeys OPEN ACCESS was performed. Martix-assisted laser desorption/ionization time-of-flight mass spectrometry Citation: Pomastowski P, Zøoch M, Rodzik A, Ligor (MALDI-TOF MS) and 16S rDNA sequencing were applied to study environmental bacteria M, Kostrzewa M, Buszewski B (2019) Analysis of bacteria associated with honeys of different strains.With both approches, problematic spore-forming Bacillus spp, but also Staphylococ- geographical and botanical origin using two cus spp., Lysinibacillus spp., Micrococcus spp. and Brevibacillus spp were identified. How- different identification approaches: MALDI-TOF MS ever, application of spectrometric technique allows for an unambiguous distinction between and 16S rDNA PCR technique. PLoS ONE 14(5): species/species groups e.g.B. subtilis or B. cereus groups. MALDI TOF MS and 16S rDNA e0217078. https://doi.org/10.1371/journal. pone.0217078 sequencing allow for construction of phyloproteomic and phylogenetic trees of identified bacterial species. Furthermore, the correlation beetween physicochemical properties, geo- Editor: Doralyn S. Dalisay, University of San Agustin, PHILIPPINES graphical and botanical origin and the presence bacterial species in honey samples were investigated.
    [Show full text]
  • Evaluating Efficacy of Plant Growth Promoting Rhizobacteria for Promoting Growth and Preventing Disease in Both Fish and Plants
    Evaluating Efficacy of Plant Growth Promoting Rhizobacteria for Promoting Growth and Preventing Disease in both Fish and Plants by Malachi Astor Williams A dissertation submitted to the Graduate Faculty of Auburn University in partial fulfillment of the requirements for the Degree of Doctor of Philosophy Auburn, Alabama May 2, 2020 Keywords: PGPR, disease control, Probiotic, Bacillus spp., Nile Tilapia, Channel Catfish Copyright 2020 by Malachi Astor Williams Approved by Mark R. Liles, Chair, Professor of Biological Sciences Joseph W. Kloepper, Professor of Entomology and Plant Pathology Jeffery S. Terhune, Associate Professor of Fisheries, Aquaculture and Aquatic Sciences Scott R. Santos, Professor of Biological Sciences Abstract Plant growth promoting rhizobacteria (PGPR), are bacteria residing within the rhizosphere of a plant, that elicit health benefits to the plant (Kloepper and Schroth, 1978; Kloepper et al., 2004). To understand the growth promoting and disease-inhibiting activities of PGPR strains, the genomes of 12 different PGPR strains affiliated with the B. subtilis group were sequenced. These B. subtilis strains exhibited high genomic diversity, whereas the genomes of Bacillus amyloliquefaciens strains (a member of the B. subtilis group) and B. velezensis strains (formerly B. amyloliquefaciens subsp. plantarum, now a part of the B. amyloliquefaciens clade (Fan et. al., 2017)) are highly conserved. A total of 2,839 genes were consistently present within the core genome of B. velezensis. Comparative genomic analyses of B. amyloliquefaciens and B. velezensis strains identified conserved genes that have been linked with biological control and colonization of roots or leaves. There were 73 genes uniquely associated with B. velezensis strains with predicted functions related to signaling, transportation, secondary metabolite production, and carbon source utilization.
    [Show full text]
  • Insecticidal Activity of Bacteria from Larvae Breeding Site with Natural Larvae Mortality: Screening of Separated Supernatant and Pellet Fractions
    pathogens Article Insecticidal Activity of Bacteria from Larvae Breeding Site with Natural Larvae Mortality: Screening of Separated Supernatant and Pellet Fractions Handi Dahmana 1,2 , Didier Raoult 1,2, Florence Fenollar 2,3 and Oleg Mediannikov 1,2,* 1 IRD, AP-HM, MEPHI, Aix Marseille University, 13005 Marseille, France; [email protected] (H.D.); [email protected] (D.R.) 2 IHU-Méditerranée Infection, 13005 Marseille, France; fl[email protected] 3 IRD, AP-HM, SSA, VITROME, Aix Marseille University, 13005 Marseille, France * Correspondence: [email protected]; Tel.: +33-(0)4-13-73-24-01; Fax: +33-(0)4-13-73-24-02 Received: 15 May 2020; Accepted: 17 June 2020; Published: 18 June 2020 Abstract: Mosquitoes can transmit to humans devastating and deadly pathogens. As many chemical insecticides are banned due to environmental side effects or are of reduced efficacy due to resistance, biological control, including the use of bacterial strains with insecticidal activity, is of increasing interest and importance. The urgent actual need relies on the discovery of new compounds, preferably of a biological nature. Here, we explored the phenomenon of natural larvae mortality in larval breeding sites to identify potential novel compounds that may be used in biological control. From there, we isolated 14 bacterial strains of the phylum Firmicutes, most of the order Bacillales. Cultures were carried out under controlled conditions and were separated on supernatant and pellet fractions. The two fractions and a 1:1 mixture of the two fractions were tested on L3 and early L4 Aedes albopictus. Two concentrations were tested (2 and 6 mg/L).
    [Show full text]
  • Analysis of Anoxybacillus Genomes from the Aspects of Lifestyle Adaptations, Prophage Diversity, and Carbohydrate Metabolism
    Analysis of Anoxybacillus Genomes from the Aspects of Lifestyle Adaptations, Prophage Diversity, and Carbohydrate Metabolism Kian Mau Goh1*, Han Ming Gan2, Kok-Gan Chan3, Giek Far Chan4, Saleha Shahar1, Chun Shiong Chong1, Ummirul Mukminin Kahar1, Kian Piaw Chai1 1 Faculty of Biosciences and Medical Engineering, Universiti Teknologi Malaysia, Skudai, Johor, Malaysia, 2 Monash School of Science, Monash University Sunway Campus, Petaling Jaya, Selangor, Malaysia, 3 Division of Genetics and Molecular Biology, Institute of Biological Sciences, Faculty of Science, University of Malaya, Kuala Lumpur, Malaysia, 4 School of Applied Science, Temasek Polytechnic, Singapore Abstract Species of Anoxybacillus are widespread in geothermal springs, manure, and milk-processing plants. The genus is composed of 22 species and two subspecies, but the relationship between its lifestyle and genome is little understood. In this study, two high-quality draft genomes were generated from Anoxybacillus spp. SK3-4 and DT3-1, isolated from Malaysian hot springs. De novo assembly and annotation were performed, followed by comparative genome analysis with the complete genome of Anoxybacillus flavithermus WK1 and two additional draft genomes, of A. flavithermus TNO-09.006 and A. kamchatkensis G10. The genomes of Anoxybacillus spp. are among the smaller of the family Bacillaceae. Despite having smaller genomes, their essential genes related to lifestyle adaptations at elevated temperature, extreme pH, and protection against ultraviolet are complete. Due to the presence of various competence proteins, Anoxybacillus spp. SK3-4 and DT3-1 are able to take up foreign DNA fragments, and some of these transferred genes are important for the survival of the cells. The analysis of intact putative prophage genomes shows that they are highly diversified.
    [Show full text]
  • Assessment of Biotechnological Potentials of Strains Isolated from Repasso Olive Pomace in Tunisia
    Annals of Microbiology (2019) 69:1177–1190 https://doi.org/10.1007/s13213-019-01499-y ORIGINAL ARTICLE Assessment of biotechnological potentials of strains isolated from repasso olive pomace in Tunisia Leila Jmeii 1,4 & Leila Soufi1 & Nabil Abid3 & Mouna Mahjoubi1 & Sevastianos Roussos2 & Hadda I. Ouzari 5 & Ameur Cherif1 & Haikel Garna1 Received: 1 February 2019 /Accepted: 10 July 2019 /Published online: 10 August 2019 # Università degli studi di Milano 2019 Abstract Purpose The agri-food industry generates significant amounts of byproducts, among them repasso olive pomace (ROP) which are rejected and can constitute a serious environmental problem. Our study aimed to investigate the diversity of microbiota isolated from ROP and screen for their biotechnological potentials. Methods A collection of 102 strains (88 bacteria and 14 fungi) was obtained from a ROP sample. The diversity of the bacterial collection was evaluated by amplification of the internal transcribed spacers between the 16S and the 23S rRNA genes (ITS- PCR) and by 16S rRNA sequencing. Fungal identification was performed by polymerase chain reaction (PCR) amplification of the ITS1–5.8S–ITS2 ribosomal DNA region. The specific enzymatic screening of the detected microorganisms was tested. Result Partial 16S rRNA gene sequencing performed on 44 isolates showed a high level of identity with known strains. Fungal strains identification showed that they belong to four families: Trichocomaceae, Pleurostomataceae, Mucoraceae,and Bionectriaceae. Our results demonstrated that Gram-positive bacteria were mostly active, particularly for protease, lipase, amylase, cellulase laccase, and for biosurfactant production. From the 88 isolated bacteria, Firmicutes were the most prevalent and microdiverse. Bacillus and Paenibacillus, together with some other Gram-negative bacteria such as Pseudocitrobacter anthropi,andAcinetobacter johnsonii showed significant hydrolytic activities and biosurfactant production.
    [Show full text]