Bioassay Lipopolysaccharide in a Novel HL-60 Cell to Both Lipoarabinomannan and Confers Responsiveness 152 −1 Soluble CD14

Soluble CD141−152 Confers Responsiveness to Both Lipoarabinomannan and Lipopolysaccharide in a Novel HL-60 Cell Bioassay This information is current as of September 25, 2021. Weiming Yu, Elisa Soprana, Giovanna Cosentino, Manuela Volta, Henri S. Lichenstein, Giovanna Viale and Donata Vercelli J Immunol 1998; 161:4244-4251; ; http://www.jimmunol.org/content/161/8/4244 Downloaded from

References This article cites 43 articles, 29 of which you can access for free at: http://www.jimmunol.org/content/161/8/4244.full#ref-list-1 http://www.jimmunol.org/

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication by guest on September 25, 2021

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 1998 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Soluble CD141–152 Confers Responsiveness to Both Lipoarabinomannan and Lipopolysaccharide in a Novel HL-60 Cell Bioassay1

Weiming Yu,2* Elisa Soprana,2* Giovanna Cosentino,* Manuela Volta,* Henri S. Lichenstein,‡ Giovanna Viale,*† and Donata Vercelli3*

CD14 is a pattern recognition receptor involved in the interaction with multiple ligands, including LPS from Gram-negative bacteria and lipoarabinomannan (LAM) from mycobacteria. While the interactions between LPS and soluble CD14 (sCD14) have been analyzed in detail, LAM/CD14 interactions remain uncharacterized due to the lack of suitable functional assays. We describe herein a novel bioassay for the analysis of CD14/ligand interactions. CD14-negative myeloid HL-60 cells up-regulate endogenous Downloaded from CD14 gene expression when stimulated with LPS in the presence of recombinant soluble CD141–348. Using the HL-60 bioassay, we showed that sCD141–348 confers responsiveness not only to LPS, but also to LAM. The response to LAM, but not that to LPS, was highly dependent on LPS binding protein (LBP). The N-terminal half of CD14 was sufficient to mediate HL-60 responses to LAM, since HL-60 cells responded with similar efficiency when stimulated with LAM and LBP in the presence of sCD141–348 or sCD141–152. Thus, the N-terminal 152 amino acids of CD14 contain the site(s) involved in the interaction with LAM and LBP, as well as the residues required for LAM-dependent CD14 signaling. The Journal of Immunology, 1998, 161: 4244–4251. http://www.jimmunol.org/ D14 is a 55-kDa glycosylphosphatidylinositol (GPI)4- transfer protein that facilitates the binding of LPS to sCD14 or linked glycoprotein that exists in two forms: membrane- mCD14, but does not seem to participate directly in initiating sig- C bound (mCD14), expressed on monocytes/macrophages nal transduction (11, 12). The essential roles of both CD14 and and neutrophils (1, 2), and soluble (sCD14), found at high con- LBP in the response to low concentrations of LPS have been high- centrations (2–6 ␮g/ml) in normal human plasma (3). Membrane- lighted by in vivo studies with knockout animal models (13, 14). bound CD14 serves as the receptor for LPS, the main component Recently, it has been shown that CD14 is able to interact not of the cell wall of Gram-negative bacteria (4). Engagement of only with LPS, but also with an unexpectedly broad range of bac- CD14 by LPS induces a number of biologic responses, including terial products, including lipoarabinomannan (LAM) from Myco- the secretion of inflammatory cytokines (5) that is thought to play bacterium tuberculosis (15), amphiphilic membrane molecules by guest on September 25, 2021 a major role in the pathogenesis of septic shock (6). Furthermore, (16, 17) and peptidoglycan (18) from Staphylococcus aureus, man- we have shown that LPS/CD14 interactions protect primary mac- nuronic acid polymers from Pseudomonas aeruginosa (19, 20), rophages from productive infection by HIV-1 through the induc- rhamnose-glucose polymers from Streptococcus mutans (21), and tion of suppressive factors, most notably C-C chemokines (7). chitosans from arthropods (22). Because of this ability to interact Interestingly, monocytes/macrophages and neutrophils are not with different bacterial products, CD14 is currently viewed as a the only targets of LPS-induced inflammatory responses. Indeed, pattern recognition receptor (15) critically involved in innate im- sCD14 has the ability to confer LPS responsiveness to CD14-neg- mune responses to bacteria (23). Of particular interest is the dem- ative cells, such as endothelial cells, astrocytes, and epithelial cells onstration that CD14 is the receptor involved in the response of (8–10). Sensitive responses of inflammatory cells to LPS require monocyte/macrophages to mycobacterial LAM (15). Anti-CD14 cooperation between CD14 and LPS binding protein (LBP), a lipid Abs blocked LAM-dependent responses of both CD14-bearing THP-1 cells and CD14-transfected 70Z/3 pre-B cells (15). Fur- thermore, CD14 has been shown to mediate the uptake of nonop- *Molecular Immunoregulation Unit, San Raffaele Scientific Institute, and †Depart- ‡ sonized M. tuberculosis by human microglia (24) and the release ment of Biology and Genetics, University of Milan, Milan, Italy; and Amgen, Inc., ␣ Boulder, CO 80301 of TNF- by monocytes isolated from tuberculosis patients (25). ␣ Received for publication March 9, 1998. Accepted for publication June 3, 1998. The capacity of mycobacterial constituents to elicit TNF- secretion by infected macrophages seems to determine the ability of the The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance micro-organism to survive and replicate within the host (26, 27). with 18 U.S.C. Section 1734 solely to indicate this fact. Because of the critical role played by CD14 in the immune 1 This work was supported by the National Tuberculosis Project (Istituto Superiore di response to bacteria, the molecular requirements for LPS/CD14 Sanita´-Ministero della Sanita´), Grant 18 (to D.V.), and by National Institute of Al- interactions have been extensively dissected using a number of lergy and Infectious Diseases, National Institutes of Health Contract NO1-AI-25147. approaches. The U373 bioassay is predicated on the ability of 2 These authors contributed equally to this work. sCD14-containing serum or recombinant sCD14 to confer LPS 3 Address correspondence and reprint requests to Dr. Donata Vercelli, Molecular Immunoregulation Unit, DIBIT, San Raffaele Scientific Institute, Via Olgettina 58, responsiveness to CD14-negative astrocytes (8, 28). Using mu- 20132 Milan, Italy. E-mail address: [email protected] tated and/or truncated sCD14 molecules in the U373 bioassay, it 4 Abbreviations used in this paper: GPI, glycosylphosphatidylinositol; mCD14, mem- was possible to show that the LPS binding site maps to the N- brane CD14; sCD14, soluble CD14; LBP, lipopolysaccharide binding protein; LAM, terminus of CD14 (28) in a region that spans amino acids 57 to 64 lipoarabinomannan; NHS, normal human serum; Ara-LAM, nonmannose-capped lipoarabinomannan; PE, phycoerythrin; GAPDH, glyceraldehyde-3-phosphate and corresponds to the epitope recognized by the neutralizing mAb dehydrogenase. MEM-18 (29, 30). The epitope recognized by another neutralizing

anti-CD14 mAb, 3C10, is in the region between amino acids 7 and that introduces an EcoRI site immediately 3Ј of the codon for amino acid 14 and defines yet another functional domain required for cellular 152 of CD14 (underlined). The two amplification products were digested signaling, but not LPS binding (31). with HindIII and XbaI or with HindIII and EcoRI, isolated on agarose gels, and cloned into the corresponding sites of pcDNA3 wild-type or pcDNA3- By contrast, the U373 bioassay was not suitable for the analysis myc. The latter was provided by Dr. Maria Guttinger (San Raffaele Scien- of LAM/CD14 interactions because U373 cells do not respond to tific Institute) and was obtained by PCR-mediated insertion of a cassette LAM/sCD14 complexes even in the presence of LBP (32) (G. encoding the 9E10.2 epitope of human c-myc (GAGCAAAAGCTCATT Cosentino, unpublished observation). In an attempt to establish an TCTGAAGAGGACTTGAATTGA) (33) in-frame with an EcoRI site. The sequences of all resulting plasmids were verified by the dideoxynucleotide in vitro assay to characterize sCD14/LAM interactions, we tested chain termination/extension method using the Sequenase version 2.0 kit several human CD14-negative cells lines for their ability to re- (U.S. Biochemical Corp., Cleveland, OH). spond to LPS and/or LAM in a serum-dependent fashion. We show For expression, the vectors containing sCD14 cDNA were transiently herein that myeloid HL-60 cells up-regulate the expression of the transfected into COS-7 cells using DEAE-dextran. After transfection, the endogenous CD14 gene when stimulated with LPS or LAM in the cells were cultured overnight in DMEM/10% FCS, then washed three times with ice-cold PBS and maintained in serum-free DMEM. Supernatants presence of serum or recombinant sCD14. The N-terminal 152 were collected every 3 days, and the concentration of sCD14 released by amino acids of human CD14 are sufficient to impart responsive- transfected COS-7 cells was assessed by ELISA (see below). The presence ness to both ligands in this novel bioassay. of sCD14 in the supernatants of transfected COS-7 cells (conditioned medium) was further confirmed by metabolic labeling, followed by immuno- Materials and Methods precipitation with anti-CD14 mAb 3C10 or anti-c-myc mAb 9E10.2 (for sCD141–152 myc) and SDS-PAGE analysis. Supernatants from COS-7 cells Cells and reagents transfected with an empty pcDNA3 vector (mock supernatants) were used Downloaded from HL-60 cells were grown in RPMI 1640 supplemented with 10% FCS (Bi- as negative controls in all experiments. ologic Industries, Beit Haemek, Israel), 2 mM glutamine, 100 U/ml peni- ELISA for sCD14 quantitation cillin, and 100 ␮g/ml streptomycin. COS-7 cells were cultured in DMEM/ high glucose supplemented with 2 mM glutamine, 1% nonessential amino The concentrations of sCD14 , sCD14 , and sCD14 re- Ϫ 1–348 1–152 1–152 myc acids, 5 ϫ 10 5 M ␤-ME, and 10% FCS. LPS from Salmonella minnesota leased by COS-7 cells transfected with the sCD14 expression vectors were (wild-type) purified by gel filtration, normal human serum (NHS), and assessed by a sandwich ELISA. Ninety-six-well plates (Maxisorp, Nunc, cycloheximide were purchased from Sigma (St. Louis, MO). Polymyxin B Roskilde, Denmark) were coated with anti-CD14 mAb 3C10 (20 ␮g/ml in sulfate was purchased from Calbiochem (La Jolla, CA). Purified mycobac- 0.1 M carbonate buffer, pH 9.0) for2hat37°C, washed with PBS/0.05% http://www.jimmunol.org/ terial LAM (nonmannose-capped LAM (Ara-LAM) isolated from a rapidly Tween 20, and blocked with PBS/5% BSA/0.05% Tween 20 for2hat growing Mycobacterium species, and mannose-capped LAM isolated from 37°C. After washing, the samples were added and incubated overnight at M. tuberculosis Erdman) was provided by Drs. J. Belisle and P. J. Brennan 4°C in a humidified chamber. After extensive washing, biotinylated anti- ␮ (Colorado State University, Fort Collins, CO). Purified recombinant CD14 mAb 63D3 or MEM-18 (2 g/ml) was added to detect sCD141–348 sCD14 and LBP were prepared as previously described (11). or sCD141–152 and sCD141–152 myc, respectively. Following a 2-h incuba- Anti-CD14 mAbs 3C10 (IgG2b, TIB-228, American Type Culture Col- tion at 37°C, the wells were washed extensively and incubated with acetyl- lection (ATCC), Manassas, VA) and 63D3 (IgG1, ATCC HB-44) directed avidin/biotinylated peroxidase complexes (1/2000 in PBS/1% BSA/0.05% against distinct epitopes of human CD14, anti-Fc␥R2/CD32 mAb IV.3 Tween 20; BioSPA). A substrate solution (ortho-phenylenediamine dihy- (IgG2b, ATCC HB-217), anti-myc tag mAb 9E10.2 (IgG1, ATCC CRL- drochloride, Sigma) dissolved in 0.05 M phosphate-citrate buffer and 1729), and an IgG1 isotype control (ATCC HB-236, mouse anti-human

mixed with 30% hydrogen peroxide was then added to the wells. The by guest on September 25, 2021 IgE) were puriﬁed from ascites by afﬁnity chromatography on protein G- reaction was stopped after a 20-min incubation at room temperature by

Sepharose (HiTrap Protein G, Pharmacia, Uppsala, Sweden). Purified anti- adding2MH2SO4. OD was read at 492 nm. Purified recombinant sCD14 CD14 mAb MEM-18 (IgG1) and FITC-conjugated goat anti-mouse Ig (11) was used as a standard. This assay readily detects Ն2 ng/ml of human were purchased from Caltag (San Francisco, CA) and Becton Dickinson sCD14. (Mountain View, CA), respectively. Anti-CD54 mAb 14D2D12 (IgG1) was a gift from Dr. Ruggero Pardi (San Raffaele Scientific Institute, Milan, Formation of LPS/LAM-sCD14 complexes Italy). The Abs were biotinylated using ⑀-caproylamido-biotin-N-hydroxy- succinimide ester (BioSPA, Milan, Italy). Phycoerythrin (PE)-conjugated Complexes of LPS or LAM with sCD14 were formed before each exper- iment and were obtained by incubating LPS or LAM (2 ␮g/ml) with serum- streptavidin was purchased from PharMingen (San Diego, CA). The en- ␮ dotoxin content of all cell culture reagents was assessed by the Limulus free COS-7 supernatants containing sCD141–348 (2.4 g/ml) overnight at amoebocyte lysate assay (BioWhittaker, Walkersville, MD) and was al- 37°C (12) in the absence of LBP. The complexes were then added to HL-60 ways Ͻ0.125 endotoxin units/ml. cells at different dilutions, as indicated in the figure legends. HL-60 bioassay Construction and expression of sCD141–348, sCD141–152, and 5 sCD141–152 myc HL-60 cells were resuspended at 6 ϫ 10 cells/ml in RPMI 1640–1% Nutridoma NS (Boehringer Mannheim, Mannheim, Germany; serum-free Deletion of the eight C-terminal amino acids of CD14 involved in GPI medium) and stimulated for 24 to 48 h as detailed in Results. In preliminary anchor attachment has been shown to result in the production of a sCD14 experiments, we found that polymyxin B at a concentration of 15 ␮g/ml molecule, sCD14 (11). To obtain sCD14 , we designed primers 1–348 1–348 completely blocked the effects of LPS even when the latter was added at (forward, 5Ј-GGCTGGAACAGGTGCCTAAA; reverse, 5Ј-TGCTCTA concentrations as high as 1 ␮g/ml. Polymyxin B (15 ␮g/ml) was therefore GAGCACTATTACAGCACCAGGGTTCCCGA, nucleotides 1103–1122 added to all experiments performed with LAM. and 1327–1344 of GenBank accession no. X06882) that amplify the 3Ј end Membrane-bound CD14 expression was detected by direct immunoflu- of CD14 DNA, introducing two stop codons and an XbaI site after the orescence, as previously described (34). Briefly, HL-60 cells in staining codon for amino acid 348 in mature CD14 (underlined). For PCR ampli- buffer (RPMI 1640/10% dialyzed NHS containing 0.01% sodium azide) fication, a pcDNA1 vector (Invitrogen, San Diego, CA) containing full- were incubated with biotinylated 63D3 mAb or isotype control (5 ␮g/ml) length human CD14 cDNA cloned in the HindIII and XbaI sites was used for 40 min at 4°C in the presence of anti-Fc␥R2/CD32 mAb IV.3 (10 as template. The fragment thus amplified was digested with PvuII and ␮g/ml). Cells were then washed and incubated with PE-conjugated strepta- XbaI, and pcDNA1-hCD14 was digested with HindIII and PvuII. The two vidin (1/300) for 30 min. CD54 expression was detected by indirect im- DNA fragments were isolated on agarose gels and ligated into the HindIII munofluorescence using mAb 14D2D12 followed by FITC-conjugated and XbaI sites of pcDNA3 (Invitrogen). Soluble CD14 was generated 1–152 goat anti-mouse Ig. Cells were then extensively washed and fixed in 2% by PCR amplification using pcDNA1-hCD14 as template, and primers 5Ј- paraformaldehyde. The percentages of positive cells and mean fluorescence CCCAAGCTTGGGACCATGGAGCGCGCGTCCTGC (that introduces a intensity were analyzed on a FACScan (Becton Dickinson) by gating on HindIII site upstream of the codon for amino acid 1 in mature CD14; the living cell population, as defined by forward and side light scatter. underlined) and 5Ј-TGCTCTAGAGCACTATTAGCCTGGCTTGAGC CACTG (that introduces two stop codons and an XbaI site downstream of CD14 immunoprecipitation the codon for amino acid 152 in CD14; underlined). sCD141–152 myc was PCR-amplified using the upstream primer designed for sCD141–152, and a HL-60 cells stimulated with preformed LPS/sCD141–348 complexes for downstream primer 5Ј-ATGCAGAATTCGCCTGGCTTGAGCCACTG 24 h were washed and resuspended in methionine/cysteine-free RPMI 4246 MOLECULAR ANALYSIS OF CD14/LAM INTERACTIONS

1640 supplemented with 1% Nutridoma NS. LPS/sCD141–348 complexes were then readded, together with 35S cell labeling mix (Amer- sham, Aylesbury, U.K.; 250 ␮Ci). The cells were cultured for 24 h, collected, and lysed on ice with immunoprecipitation buffer (1% Non- idet P-40, 20 mM HEPES (pH 7.3), 150 mM NaCl, and 2.5 mM EDTA) containing 1 mM PMSF and leupeptin, pepstatin A, antipain, and chy- mostatin (Sigma; all at 1 ␮g/ml) for 30 min. Lysates were spun at 14,000 rpm for 15 min at 4°C in a microcentrifuge. The supernatants were then transferred to a new microcentrifuge tube and precleared overnight with normal mouse serum (1 ␮l) and protein G-agarose beads (Boehringer Mannheim; 40 ␮l). After a short spin, each supernatant was immunoprecipitated with mAb 63D3 or isotype control (5 ␮g) and protein G-agarose beads, mixing gently at 4°C for 6 h. The beads were then extensively washed in immunoprecipitation buffer, resuspended in sam- ple buffer, boiled for 5 min, and cooled on ice. The samples were resolved by SDS-PAGE on a 9% reducing gel and autoradiographed using Kodak Biomax MS ﬁlms (Eastman Kodak, Rochester, NY). The relative intensity of the bands was measured by densitometry using a Phospho- rImager (Molecular Dynamics, Sunnyvale, CA).

Semiquantitative RT-PCR

Total RNA was isolated as described by Chomczynski (35), and cDNA was Downloaded from synthesized and subjected to semiquantitative RT-PCR as previously described (34). For each PCR reaction, one primer was 5Ј-labeled using [␥-32P]dATP and T4 kinase polymerase (Life Technologies, Grand Island, NY; 5 U/10 pmol of primer) and added in a 1:10 molar ratio with cold primer. CD14 transcripts were detected as a 470-bp band amplified by forward primer (5Ј-GGTGCCGCTGTGTAGGAAAGAA) and reverse Ј primer (5 -GTGCCGGTTATCTTTAGGTCCTC; nucleotides 78–99 and http://www.jimmunol.org/ 613–635 of GenBank accession no. X06882). As a control, a 438-bp band corresponding to GAPDH transcripts was amplified using appropriate primers (5Ј-GGGAAGGTGAAGGTCGGAGTC and 5Ј-CTGATGATCT TGAGGCTGTTG; nucleotides 1456–1476 and 3818–3848 of GenBank accession no. J04038). Amplification was performed on a thermocycler (Omnigene, Hybaid, Teddington, U.K.) for 20 cycles (1 min each at 94, 62, and 74°C) for CD14 transcripts and for 15 cycles (1 min each at 94, 60, and FIGURE 1. LPS induces serum-dependent expression of mCD14 in 74°C) for the GAPDH control. The number of amplification cycles was ␮ such that the maximum signal intensity for a set of samples was within the HL-60 cells. HL-60 cells were incubated for 24 h with LPS (1 g/ml) and ␮ linear portion of a product-vs-template amplification curve. NHS (10%; A); LPS (1 g/ml), NHS (10%), and cycloheximide (100 ng/

ml; B); or LPS (1 ␮g/ml) and serum-free medium (C). The mCD14 ex- by guest on September 25, 2021 pression was analyzed by immunofluorescence using biotinylated mAb Results 63D3 or isotype control, followed by PE-conjugated streptavidin. The data LPS induces serum-dependent expression of CD14 in HL-60 are representative of five separate experiments. The percentages of CD14- cells positive HL-60 cells are indicated in each panel. We (7) and others (36, 37) have previously shown that LPS up- regulates the expression of its receptor, mCD14, on human monocytes/macrophages. To determine whether LPS also up-regulates tion of recombinant LBP (100 ng/ml). A comparable response was mCD14 on an mCD14-negative cell line, we treated the human obtained by adding LPS in the presence of NHS (10%). myelocytic leukemia cell line HL-60 with LPS (1 ␮g/ml) in the The ability of sCD14 to mediate LPS-dependent induction presence of NHS. Immunofluorescence analysis with anti-CD14 1–348 of CD14 at the protein level was also assessed by immunoprecipi- mAb 63D3 showed that a 24-h incubation with LPS resulted in tation. HL-60 cells were metabolically labeled with [35S]methi- vigorous expression of mCD14 (Fig. 1A). Induction of CD14 ex- onine and cysteine, and CD14 was immunoprecipitated with anti- pression by LPS required de novo protein synthesis because it was CD14 mAb 63D3. Figure 3A shows the presence of a 55-kDa band completely abrogated by the addition of cycloheximide (100 ng/ corresponding to CD14 in lysates from HL-60 cells stimulated ml; Fig. 1B). In addition, up-regulation occurred in the presence of with LPS and sCD14 for 24 h, but not from cells incubated NHS but not in serum-free conditions (Fig. 1C). This result sug- 1–348 with either stimulus alone. The CD14 band was specific, since it gests that the signal delivered by LPS to HL-60 cells is mediated was absent in samples immunoprecipitated with a control mAb by a serum component(s). (data not shown). Semiquantitative RT-PCR was used to show that induction of CD14 protein was due to enhanced CD14 mRNA The response of HL-60 cells to LPS is mediated by sCD141–348 expression. Figure 3B shows that high levels of CD14 mRNA were sCD14 has been shown to retain LPS binding capacity and to con- expressed in HL-60 cells stimulated with both LPS and

fer LPS responsiveness to mCD14-negative cells (8–10). We sCD141–348, but not in cells treated with individual stimuli. Similar therefore asked whether the serum component required for the results were obtained by Northern blot analysis (data not shown). LPS-dependent induction of endogenous CD14 expression in Together these data show that expression of mCD14 on LPS-

HL-60 cells was sCD14. For our experiments, we used sCD141–348 treated HL-60 cells reﬂects induction of the endogenous CD14 that was transiently expressed in COS-7 cells. Figure 2 shows that gene. mCD14 was undetectable on HL-60 cells stimulated for 24 h with Interestingly, CD14 was not the only gene triggered by stimu-

LPS or sCD141–348 alone in serum-free conditions. By contrast, lation with LPS, sCD141–348, and LBP. Figure 4 shows that ex- the combination of LPS (100 ng/ml) and sCD14 (1.2 ␮g/ml) in- pression of CD54 was undetectable on unstimulated HL-60 cells, duced mCD14 expression that was further enhanced by the addi- but was strongly up-regulated after a 3-day incubation. The Journal of Immunology 4247 Downloaded from

FIGURE 2. The response of HL-60 cells to LPS is mediated by sCD141–348. HL-60 cells were stimulated for 24 h with LPS (100 ng/ml) and/or ␮ sCD141–348 (1.2 g/ml) in the absence or the presence of LBP (100 ng/ml) in serum-free conditions. As a control, HL-60 cells were stimulated with LPS (100 ng/ml) and NHS (10%). The mCD14 expression was analyzed by immunoﬂuorescence as described in Figure 1. The data are representative of four separate experiments. The percentages of CD14-positive HL-60 cells are indicated in each panel. http://www.jimmunol.org/

HL-60 cells respond to mycobacterial LAM in the presence of Figure 5 shows that HL-60 cells incubated for 24 h with LAM ␮ sCD141–348 and LBP (100 ng/ml) and sCD141–348 (1.2 g/ml) expressed low levels of mCD14. However, addition of sCD14 and recombinant LBP The observation that LPS and sCD14 induced mCD14 on HL-60 1–348 (100 ng/ml) resulted in a striking up-regulation of mCD14 by cells suggested that this assay could also be used to test for inter- LAM. No response was detectable upon treatment with either actions between sCD14 and other bacterial ligands. Mycobacterial sCD14 or LAM alone (data not shown). Expression of LAM has been shown to act as a CD14 ligand (15) and to trigger 1–348 mCD14 was always induced upon stimulation with LAM and NHS important biologic responses, such as monokine release (25) and uptake of mycobacteria (24). Because the LAM signaling system (10%), but varied in intensity depending on the batch of NHS. by guest on September 25, 2021 appears to require a receptor component whose expression is re- RT-PCR analysis conﬁrmed that the expression of mCD14 in stricted to cells of hemopoietic origin (32), and HL-60 cells rep- HL-60 cells stimulated with LAM, sCD141–348, and LBP was par- resent myelomonocytic precursors (38), we reasoned that alleled by a marked increase in the level of CD14 mRNA. A weak induction of CD14 RNA was consistently observed in cells incu- sCD141–348 might mediate LAM-dependent responses in our novel HL-60 bioassay. All experiments were performed with Ara-LAM, bated with LAM and sCD141–348 without LBP, but not in cells because mannose-capped LAM had negligible biologic activity exposed to either stimulus alone (data not shown).

(data not shown). A role for contaminating LPS was ruled out by Notably, the addition of LAM, sCD141–348, and LBP up-regu- adding polymyxin B (15 ␮g/ml) in all experiments. lated not only mCD14, but also CD54 expression on HL60 cells

FIGURE 3. LPS-dependent induction of CD14 expression in HL-60 cells reﬂects activation of the endogenous CD14 gene. A, HL-60 cells were ␮ ␮ prestimulated in serum-free medium for 24 h using sCD141–348 alone (1.2 g/ml), LPS (1 g/ml) and supernatants from mock-transfected COS-7 cells, ␮ ␮ 35 or complexes of LPS (1 g/ml) and sCD141–348 (1.2 g/ml). After metabolic labeling with [ S]methionine/cysteine, the cells were lysed and immunoprecipitated with anti-CD14 mAb 63D3 and protein G-agarose beads. The samples were resolved by SDS-PAGE on a 9% reducing gel. B, HL-60 cells were stimulated in serum-free medium, as indicated in A, or in the presence of NHS with or without LPS (100 ng/ml) for 24 h. Expression of CD14 mRNA was assessed by semiquantitative RT-PCR. CD14 transcripts were detected as a 470-bp band. A 438-bp band corresponding to GAPDH transcripts was ampliﬁed as a control. 4248 MOLECULAR ANALYSIS OF CD14/LAM INTERACTIONS

FIGURE 4. HL-60 cells express CD54 upon stimulation with LPS or LAM, sCD141–348, and LBP. HL-60 cells were incubated with LPS (100 ng/ml) ␮ ␮ ␮ or Ara-LAM (1 g/ml), sCD141–348 (1.2 g/ml), and LBP (100 ng/ml) for 3 days in serum-free conditions. Polymyxin B (15 g/ml) was added to the samples containing LAM. CD54 expression was assessed by indirect immunoﬂuorescence using mAb 14D2D12. The data are representative of two experiments. The percentages of CD54-positive HL-60 cells are indicated in each panel.

(Fig. 4). Together, these results indicate that the combination of timal amounts of LBP (100 ng/ml) were present (Fig. 6, bottom

sCD141–348 and LBP renders HL-60 cells fully responsive to panel). LAM. Downloaded from sCD141–152 contains the site(s) required for the response of Interactions of LAM and LPS with sCD141–348 and LBP HL-60 cells to LAM and LBP

To compare the abilities of LAM and LPS to interact with The N-terminal half of CD14 (CD141–152) is known to mediate sCD141–348 and LBP, we stimulated HL-60 cells in serum-free responses to LPS both when expressed as a soluble molecule (28) conditions with increasing concentrations of the bacterial ligands and when expressed on the membranes of transfected cells (18,

␮ http://www.jimmunol.org/ in the presence of constant concentrations of sCD141–348 (1.6 g/ 42). Therefore, we asked whether this portion of CD14 is sufﬁcient ml) and LBP (100 ng/ml). Figure 6 (top panel) shows that both to mediate HL-60 responses to LAM as well. For these experi-

LAM and LPS dose-dependently up-regulated mCD14 on HL-60 ments, we produced two forms of sCD14: sCD141–152, truncated at cells. Since the average molecular mass of LAM (39) is approxi- amino acid 152, and sCD141–152 myc, in which sCD141–152 is fused mately 10 times that of LPS (40), on a molar basis the two ligands with the 9E10.2 epitope of human c-myc (33) at the C-terminus.

were comparably efﬁcient in stimulating HL-60 cells. However, a Figure 7 (left panel) shows that addition of either sCD141–348 or dramatic difference between LAM and LPS became apparent when sCD141–152 in the presence of optimal LBP concentrations (100 HL-60 cells were treated with preformed complexes containing ng/ml) supported a strong response to LPS (100 ng/ml). The re-

LAM or LPS and sCD141–348 in the absence of LBP. Indeed, sponse was still vigorous, although somewhat lower, in the ab- by guest on September 25, 2021 LAM/sCD141–348 complexes induced a modest response, detect- sence of LBP (data not shown). The presence of the c-myc tag did ␮ able only at the highest concentration of LAM tested (5 g/ml). By not affect the ability of sCD141–152 to trigger HL-60 responses. contrast, LPS/sCD141–348 complexes stimulated HL-60 cells quite Indeed, the dose-response curve was similar for the three proteins, efﬁciently, although LBP appeared to be required for maximal re- particularly in the microgram range that corresponds to physio- sponsiveness. These results indicate that in the HL-60 bioassay, logic concentrations of sCD14 (3). These results demonstrate that

responses induced by LAM, but not by LPS, are critically depen- sCD141–152 retains full activity in the HL-60 bioassay. In addition, dent on the presence of LBP. This hypothesis was conﬁrmed by HL-60 cells responded efﬁciently when stimulated with LAM

stimulating HL-60 cells with LAM or LPS (100 ng/ml) in the (100 ng/ml) in the presence of sCD141–152 or sCD141–152 myc and ␮ presence of sCD141–348 (1.6 g/ml) and increasing concentrations LBP (100 ng/ml; Fig. 7, right panel), whereas no signiﬁcant re- of LBP. Figure 6 (center panel) shows that the LBP dose-response sponse was detected in the absence of LBP (data not shown).

curves for LAM and LPS differ by at least 2 orders of magnitude Again, the dose-response curves were similar for sCD141–348 and at the lowest LBP concentrations and become comparable only sCD141–152, with or without the c-myc tag. Similar curves were when LBP is added at the concentrations found in normal human also obtained using a lower concentration of LBP (10 ng/ml; plasma (Ͻ0.5 ␮g/ml) (41). By contrast, LAM and LPS (100 ng/ml) data not shown). The response of HL-60 cells to the bacterial li-

showed nearly equivalent requirements for sCD141–348 when op- gands was due to sCD141–152 and not to irrelevant proteins in the

FIGURE 5. HL-60 cells respond to LAM in the presence of sCD141–348 and LBP. HL-60 cells were stimulated for 24 h with Ara-LAM (100 ng/ml) and ␮ sCD141–348 (1.2 g/ml) in the absence (left panel) or the presence (center panel) of LBP (100 ng/ml) in serum-free conditions. As a control, HL-60 cells were stimulated with Ara-LAM (100 ng/ml) and NHS (10%) (right panel). Polymyxin B was added to all samples at 15 ␮g/ml. The mCD14 expression was analyzed by immunoﬂuorescence as described in Figure 1. The data are representative of four separate experiments. The percentages of CD14-positive HL-60 cells are indicated in each panel. The Journal of Immunology 4249

fection. However, LAM/CD14 interactions have not been dissected due to the lack of suitable in vitro assays. Indeed, the U373 bioassay that takes advantage of the ability of sCD14 to confer LPS responsiveness to mCD14-negative astrocytoma cells (8, 28) was not applicable in the case of LAM (32) (G.C., unpublished observation). The HL-60 bioassay herein described provides a novel and powerful tool to deﬁne the requirements for CD14-mediated responses to LAM in a myeloid cell system. Our data demonstrate that the N-terminal 152 amino acids of human sCD14 are sufﬁcient to induce HL-60 cells to respond not only, as expected (28, 42), to LPS, but also to LAM. However, there is a striking difference in the requirements for the responses to the two ligands; whereas HL-60 cells were highly sensitive to

stimulation with preformed complexes of LPS and sCD141–152 in the absence of LBP, no significant response to LAM was observed unless LBP was added at concentrations within the physiologic range. Although LBP is known to interact with bacterial products other than LPS (e.g., ␤1–4-linked D-mannuronic acid derived from P. aeruginosa (20)), our findings were unexpected because re- Downloaded from sponses of mCD14-negative cells to sCD14 and LPS do not usu- ally require LBP. The reason for the strict LBP dependency of LAM-induced responses in the HL-60 bioassay is unclear at the moment. Were the affinity of sCD14 for LAM much lower than that for

LPS, LBP-mediated transfer of LAM to sCD14 would become http://www.jimmunol.org/ critical for the timely formation of an active LAM-containing complex. However, the experimental conditions of the HL-60 bioassay (overnight preincubation of LAM and sCD14 at 37°C to achieve complex formation, incubation of the cells with the stimulants for 24–48 h) should favor efﬁcient binding between sCD14 and its ligand, circumventing at least in part the need for LBP (12). Thus, we are inclined to believe that the LBP dependency of LAM-induced responses does not simply result from a low afﬁnity in LAM/sCD14 interactions. by guest on September 25, 2021 One hypothesis to explain our data is that because the HL-60 bioassay measures ligand-induced cellular activation, rather than

FIGURE 6. Interactions of LAM and LPS with sCD141–348 and LBP. Top simple binding of the sCD14/ligand complex, the LBP requirement panel, HL-60 cells were stimulated for 24 h in serum-free conditions using for LAM-dependent, but not LPS-dependent, responses might re- ␮ sCD141–348 (1.6 g/ml), LBP (100 ng/ml), and increasing concentrations of flect a difference in the cell surface receptor(s) involved in trig- Ara-LAM (black squares) or LPS (black circles), or alternatively with com- gering the cellular response upon stimulation with the two ligands. plexes of sCD14 (1.2 ␮g/ml) and Ara-LAM (open squares) or LPS (open 1–348 In this model, complexes of LPS and sCD14 would be sufficient to circles) (1 ␮g/ml). Center panel, HL-60 cells were stimulated for 24 h in serum-free conditions using Ara-LAM (black squares) or LPS (black circles), engage the still unidentified receptor that mediates cell activation ␮ in the absence of mCD14 (43), whereas a different receptor would sCD141–348 (1.6 g/ml), and increasing concentrations of LBP. Bottom panel, HL-60 cells were stimulated for 24 h in serum-free conditions using Ara-LAM recognize a ternary complex containing LBP, sCD14, and LAM. (black squares) or LPS (black circles), LBP (100 ng/ml), and increasing con- We are currently testing the hypothesis that such a complex is ␮ centrations of sCD141–348. Polymyxin B (15 g/ml) was added to all samples formed. containing LAM. The mCD14 expression after stimulation was analyzed by An alternative hypothesis is that the HL-60 cell receptor that immunofluorescence as described in Figure 1. The data are representative of interacts with LPS/sCD14 complexes might recognize LAM/ three separate experiments. sCD14 complexes as well, but only in the conformation that the latter achieve when LBP is part of the complex. In this other model, LBP would not interact directly with the receptor, but COS-7 supernatants, since supernatants from mock-transfected would be instrumental in conferring the appropriate conformation cells did not up-regulate mCD14 (data not shown). Furthermore, to the LAM/sCD14 complex. The finding that both myeloid HL-60 identical results were obtained adding equivalent concentrations of cells and astrocytoma U373 cells respond to LPS and sCD14, but sCD14 purified by affinity chromatography on an anti-myc 1–152 myc only HL-60 cells respond to LAM, sCD14, and LBP, seems to tag mAb-protein G column (data not shown). Thus, the N-terminal favor the two-receptor hypothesis. It is possible that only cells of 152 amino acids of CD14 contain the site(s) involved in the in- hemopoietic origin possess all the components of the signal trans- teraction with LAM and LBP as well as the residues required for duction machinery required for the LAM-containing complex to LAM-dependent CD14 signaling. bind and induce cellular activation (32). An additional and not necessarily distinct issue is whether the Discussion ability of CD14 to interact differently with different bacterial li- The interactions between LAM and CD14 are likely to play an gands and LBP reflects the existence of selective binding sites on important role in the pathogenesis of mycobacteria-induced dis- the CD14 molecule. The interaction of CD14 with LAM, LPS (28, ease and in the ability of the host to successfully contain the in- 42), peptidoglycan (18), or products of S. aureus (16) requires the 4250 MOLECULAR ANALYSIS OF CD14/LAM INTERACTIONS Downloaded from

FIGURE 7. sCD141–152 is sufﬁcient to mediate the responses of HL-60 cells to LAM and LBP. HL-60 cells were stimulated for 24 h in serum-free conditions using LPS (left panel) or Ara-LAM (right panel), both at 100 ng/ml, and recombinant LBP (100 ng/ml) in the presence of increasing

␮ http://www.jimmunol.org/ concentrations of sCD141–348 (circles), sCD141–152 (squares), or sCD141–152 myc (triangles). Polymyxin B (15 g/ml) was added to all samples containing LAM. The expression of mCD14 was analyzed by immunoﬂuorescence as described in Figure 1. The data are representative of three separate experiments.

N-terminal 152 amino acids of the protein. However, important ithelial cells is mediated by lipopolysaccharide-binding protein and soluble differences seem to exist among the modes of binding and/or in- CD14. Proc. Natl. Acad. Sci. USA 90:2744. 10. Haziot, A., G. W. Rong, J. Silver, and S. M. Goyert. 1993. Recombinant soluble teraction. Distinct residues in CD14 are known to be selectively CD14 mediates the activation of endothelial cells by lipopolysaccharide. J. Im- involved in the recognition of different LPS ligands, such as LPS munol. 151:1500. from Escherichia coli vs LPS from Porphyromonas gingivalis 11. Hailman, E., H. S. Lichenstein, M. M. Wurfel, D. S. Miller, D. A. Johnson, M. Kelley, L. A. Busse, M. M. Zukowski, and S. D. Wright. 1994. Lipopoly- (44). Similar, but not identical, sequences are critical for the re- saccharide (LPS)-binding protein accelerates the binding of LPS to CD14. J. Exp. by guest on September 25, 2021 sponses of CD14 transfectants to LPS and peptidoglycan (18). On Med. 179:269. the other hand, the response of CD14-transfected murine pre-B 12. Hailman, E., T. Vasselon, M. Kelley, L. A. Busse, M. C.-T. Hu, H. S. Lichenstein, P. A. Detmers, and S. D. Wright. 1996. Stimulation of mac- cells to peptidoglycan (18) and those of U373 cells to S. aureus rophages and neutrophils by complexes of lipopolysaccharide and soluble CD14. products and sCD14 (16) are both LBP independent, unlike LAM- J. Immunol. 156:4384. induced HL-60 cell activation. It will be interesting to determine 13. Haziot, A., E. Ferrero, F. Ko¨ntgen, N. Hijiya, S. Yamamoto, J. Silver, C. L. Stewart, and S. M. Goyert. 1996. Resistance to endotoxin shock and re- whether the CD14 residues involved in LAM recognition differ duced dissemination of Gram-negative bacteria in CD14-deﬁcient mice. Immu- from those already identiﬁed for other ligands, and whether dif- nity 4:407. ferent sites on sCD14 are engaged in the presence of LBP. 14. Jack, R. S., X. Fan, M. Bernheiden, G. Rune, M. Ehlers, A. Weber, G. Kirsch, R. Mentel, B. Fu¨rll, M. Freudenberg, G. Schmitz, F. Stelter, and C. Schu¨tt. 1997. Lipopolysaccharide-binding protein is required to combat a murine Gram-nega- References tive bacterial infection. Nature 389:742. 15. Pugin, J., D. Heumann, A. Tomasz, V. V. Kravchenko, Y. Akamatsu, 1. Haziot, A., S. Chen, E. Ferrero, M. G. Low, R. Silber, and S. M. Goyert. 1988. M. Nishijima, M. P. Glauser, P. S. Tobias, and R. J. Ulevitch. 1994. CD14 is a The monocyte differentiation antigen, CD14, is anchored to the cell membrane by pattern recognition receptor. Immunity 1:509. a phosphatidylinositol linkage. J. Immunol. 141:547. 16. Kusunoki, T., E. Hailman, T. S.-C. Juan, H. S. Lichenstein, and S. D. Wright. 2. Simmons, D. L., S. Tan, D. G. Tenen, A. Nicholson-Weller, and B. Seed. 1989. 1995. Molecules from Staphylococcus aureus that bind CD14 and stimulate in- Monocyte antigen CD14 is a phospholipid anchored membrane protein. Blood nate immune responses. J. Exp. Med. 182:1673. 73:284. 17. Kusunoki, T., and S. D. Wright. 1996. Chemical characteristics of Staphylococ- 3. Bazil, V., V. Horejsi, M. Baudys, H. Kristofova, J. L. Strominger, V. Kostka, and cus aureus molecules that have CD14-dependent cell-stimulating activity. J. Im- I. Hilgert. 1986. Biochemical characterization of a soluble form of the 53-kDa munol. 157:5112. monocyte surface antigen. Eur. J. Immunol. 16:1583. 18. Gupta, D., T. N. Kirkland, S. Viriyakosol, and R. Dziarski. 1996. CD14 is a 4. Wright, S. D., R. A. Ramos, P. S. Tobias, R. J. Ulevitch, and J. C. Mathison. cell-activating receptor for bacterial peptidoglycan. J. Biol. Chem. 271:23310. 1990. CD14, a receptor for complexes of lipopolysaccharide (LPS) and LPS 19. Espevik, T., M. Otterlei, G. SkjS´k-Braek, L. Ryan, S. D. Wright, and A. Sundan. binding protein. Science 249:1431. 1993. The involvement of CD14 in stimulation of cytokine production by uronic 5. Dentener, M. A., V. Bazil, E. J. U. Von Asmuth, M. Ceska, and W. A. Buurman. acid polymers. Eur. J. Immunol. 23:255. 1993. Involvement of CD14 in lipopolysaccharide-induced tumor necrosis fac- ´ tor-␣, IL-6 and IL-8 release by human monocytes and alveolar macrophages. 20. Gullstein Jahr, T., L. Ryan, A. Sundan, H. S. Lichenstein, G. SkjSk-Braek, and J. Immunol. 150:2885. T. Espevik. 1997. Induction of tumor necrosis factor production from monocytes 6. Landmann, R., A. M. Reber, S. Sansano, and W. Zimmerli. 1996. Function of stimulated with mannuronic acid polymers and involvement of lipopolysaccha- soluble CD14 in serum from patients with septic shock. J. Infect. Dis. 173:661. ride-binding protein, CD14, and bactericidal/permeability-increasing factor. In- 7. Verani, A., G. Scarlatti, M. Comar, E. Tresoldi, S. Polo, M. Giacca, P. Lusso, fect. Immun. 65:89. A. G. Siccardi, and D. Vercelli. 1997. C-C chemokines released by LPS-stimu- 21. Soell, M., E. Lett, F. Holveck, M. Scholler, D. Wachsmann, and J. Klein. 1995. lated human macrophages suppress HIV-1 infection in both macrophages and T Activation of human monocytes by streptococcal rhamnose glucose polymers is cells. J. Exp. Med. 185:805. mediated by CD14 antigen, and mannan binding protein inhibits TNF-␣ release. 8. Frey, E. A., D. S. Miller, T. G. Jahr, A. Sundan, V. Bazil, T. Espevik, J. Immunol. 154:851. B. B. Finlay, and S. D. Wright. 1992. Soluble CD14 participates in the response 22. Otterlei, M., K. M. VS´rum, L. Ryan, and T. Espevik. 1994. Characterization of of cells to lipopolysaccharide. J. Exp. Med. 176:1665. binding and TNF-␣-inducing ability of chitosans on monocytes: the involvement 9. Pugin, J., C.-C. Schu¨rer-Maly, D. Leturcq, A. Moriarty, R. J. Ulevitch, and of CD14. Vaccine 12:825. P. S. Tobias. 1993. Lipopolysaccharide activation of human endothelial and ep- 23. Wright, S. D. 1995. CD14 and innate recognition of bacteria. J. Immunol. 155:6. The Journal of Immunology 4251

24. Peterson, P. K., G. Gekker, S. Hu, W. S. Sheng, W. R. Anderson, R. J. Ulevitch, 34. Cosentino, G., E. Soprana, C. P. Thienes, A. G. Siccardi, G. Viale, and P. S. Tobias, K. V. Gustafson, T. W. Molitor, and C. C. Chao. 1995. CD14 D. Vercelli. 1995. IL-13 downregulates CD14 expression and TNF-␣ secretion in receptor-mediated uptake of nonopsonized Mycobacterium tuberculosis by hu- human monocytes. J. Immunol. 155:3145. man microglia. Infect. Immun. 63:1598. 35. Chomczynski, P., and N. Sacchi. 1987. Single-step method of RNA isolation by 25. Zhang, Y., M. Doerfler, T. C. Lee, B. Guillemin, and W. N. Rom. 1993. Mech- acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162: anisms of stimulation of interleukin-1␤ and tumor necrosis factor-␣ by Myco- 156. bacterium tuberculosis components. J. Clin. Invest. 91:2076. 26. Kindler, V., A.-P. Sappino, G. E. Grau, P.-F. Piguet, and P. Vassalli. 1989. The 36. Marchant, A., J. Duchow, J.-P. Delville, and M. Goldman. 1992. Lipopolysac- inducing role of tumor necrosis factor in the development of bactericidal gran- charide induces up-regulation of CD14 molecule on monocytes in human whole ulomas during BCG infection. Cell 56:731. blood. Eur. J. Immunol. 22:1663. 27. Flynn, J. L., M. M. Goldstein, J. Chan, K. J. Triebold, K. Pfeffer, 37. Landmann, R., H.-P. Knopf, S. Link, S. Sansano, R. Schumann, and C. J. Lowenstein, R. Schreiber, T. W. Mak, and B. R. Bloom. 1995. Tumor W. Zimmerli. 1996. Human monocyte CD14 is upregulated by lipopolysaccha- ␣ necrosis factor- is required in the protective immune response against Myco- ride. Infect. Immun. 64:1762. bacterium tuberculosis in mice. Immunity 561. 28. Juan, T. S.-C., M. J. Kelley, D. A. Johnson, L. A. Busse, E. Hailman, 38. Rigby, W. F. C., L. Shen, E. D. Ball, and M. F. Fanger. 1985. 1,25-Dihydroxyvi- S. D. Wright, and H. S. Lichenstein. 1995. Soluble CD14 truncated at amino acid tamin D3 induces a myelomonocytic phenotype with enhanced effector cell func- 152 binds lipopolysaccharide (LPS) and enables cellular response to LPS. J. Biol. tion in the HL-60 promyelocytic cell line. Mol. Immun. 22:567. Chem. 270:1382. 39. Khoo, K.-H., A. Dell, H. R. Morris, P. J. Brennan, and D. Chatterjee. 1995. 29. Juan, T. S.-C., E. Hailman, M. J. Kelley, L. A. Busse, E. Davy, C. J. Empig, Inositol phosphate capping of the nonreducing termini of lipoarabinomannan L. O. Narhi, S. D. Wright, and H. S. Lichenstein. 1995. Identification of a lipo- from rapidly growing strains of Mycobacterium. J. Biol. Chem. 270:12380. polysaccharide binding domain in CD14 between amino acids 57 and 64. J. Biol. 40. Tobias, P. S., K. Soldau, J. A. Gegner, D. Mintz, and R. J. Ulevitch. 1995. Chem. 270:5219. Lipopolysaccharide binding protein-mediated complexation of lipopolysaccha- 30. McGinley, M. D., L. O. Narhi, M. J. Kelley, E. Davy, J. Robinson, M. F. Rohde, ride with soluble CD14. J. Biol. Chem. 270:10482. S. D. Wright, and H. S. Lichenstein. 1995. CD14: physical properties and identification of an exposed site that is protected by lipopolysaccharide. J. Biol. Chem. 41. Schumann, R. R., S. R. Leung, G. W. Flaggs, P. W. Gray, S. D. Wright, 270:5213. J. C. Mathison, P. S. Tobias, and R. J. Ulevitch. 1990. Structure and function of Downloaded from 31. Juan, T. S.-C., E. Hailman, M. J. Kelley, S. D. Wright, and H. S. Lichenstein. lipopolysaccharide binding protein. Science 249:1429. 1995. Identification of a domain in soluble CD14 essential for lipopolysaccharide 42. Viriyakosol, S., and T. N. Kirkland. 1996. The N-terminal half of membrane (LPS) signaling but not LPS binding. J. Biol. Chem. 270:17237. CD14 is a functional cellular lipopolysaccharide receptor. Infect. Immun. 64:653. 32. Savedra, R., R. L. Delude, R. R. Ingalls, M. J. Fenton, and D. T. Golenbock. 43. Ulevitch, R. J., and P. S. Tobias. 1995. Receptor-dependent mechanisms of cell 1996. Mycobacterial lipoarabinomannan recognition requires a receptor that shares components of the endotoxin signaling system. J. Immunol. 157:2549. stimulation by bacterial endotoxin. Annu. Rev. Immunol. 13:437. 33. Evan, G. I., G. K. Lewis, G. Ramsay, and J. M. Bishop. 1985. Isolation of 44. Shapiro, R. A., M. D. Cunningham, K. Ratcliffe, C. Seachord, J. Blake,

monoclonal antibodies specific for human c-myc proto-oncogene product. Mol. J. Bajorath, A. Aruffo, and R. P. Darveau. 1997. Identification of CD14 residues http://www.jimmunol.org/ Cell. Biol. 5:3610. involved in specific lipopolysaccharide recognition. Infect. Immun. 65:293. by guest on September 25, 2021