A Sythethic Lethal Shrna Screen and Genetic Proof of Concept

A SYTHETHIC LETHAL SHRNA SCREEN AND GENETIC PROOF OF CONCEPT

IDENTIFIES RAC1 AS A NOVEL TARGET TO DISRUPT PLEXIFORM

NEUROFIBROMA FORMATION

Julie Ann Mund

Submitted to the faculty of the University Graduate School in partial fulfillment of the requirements for the degree Doctor of Philosophy in the Department of Biochemistry and Molecular Biology, Indiana University

December 2019

Accepted by the Graduate Faculty of Indiana University, in partial fulfillment of the requirements for the degree of Doctor of Philosophy.

Doctoral Committee

______D. Wade Clapp, M.D., Chair

______Mark Goebl, Ph.D.

August 26, 2019

______Maureen Harrington, Ph.D.

______Randy Brutkiewicz, Ph.D.

Julie Ann Mund

iii DEDICATION

To my family and friends who have given me comfort and strength when I needed it most.

iv ACKNOWLEDGEMENT

I would like to first acknowledge Dr. D. Wade Clapp, M.D., who has been my mentor during the pursuit of my Ph.D. His direction and guidance encouraged me to pursue novel experiments and helped shape my career path with an interest in preclinical drug development and translational research. His support in matters both academic and personal was instrumental for my completion of the program and helping me become a better scientist. I would also like to acknowledge the support and guidance of my committee members Mark Goebl, Ph.D., Maureen Harrington, Ph.D., Randy Brutkiewicz,

Ph.D., and the late Grzegorz Nalepa, M.D.

I would like to acknowledge and deeply thank the members of the Clapp laboratory. Without their daily guidance, training, and interaction, much of this work would not have been possible. Having few biochemical assay techniques prior to starting in this lab, I appreciated the patience and grace of Su-Jung Park who taught me the skills necessary to complete my experiments. Her guidance in many matters, including career development, will lead me for many years to come. Thank you for incredible work of the preclinical therapeutics team including Jian Yuan, Li Jiang, Xiaohong Li, Qingbo Lu, and

Bill Dyer under the invaluable leadership of MBP, Waylan Bessler. Our histology wizard Abbi Smith provided my ability to identify plexiform neurofibroma formation with consistent analysis. Thank you to Steven Rhodes for all of the help in the preparation of the manuscript submitted containing some of the data presented herein and teaching me how to use Illustrator significantly raising the quality of my figures. I would also like to acknowledge Eric Hawley and Donna Edwards as fellow graduate students in

v the lab for their help, guidance, friendship and as people in the same trenches throughout this journey of graduate school.

I would also like to acknowledge additional mentors I have had throughout my scientific career. Dr. Michael Murphy, M.D. who believed in a Classical and Near

Eastern Studies major to start up his lab and took the time to train me in all the basic skills and mentored me through my MS. Dr. David Ingram, M.D. whose guidance and passion for research changed the course of my career, for that I will be forever grateful.

Dr. Jamie Case, Ph.D. for his guidance, mentoring, friendship, and love of electronic music. He shaped my life for the better. To the Ingram lab in its many changing forms, thank you for making each day seem less like work and more like vacation. Dr. Karen

Pollok, Ph.D. for her support and mentoring in writing and designing experiments.

Thank you to each of the many additional scientists and friends I have gained in my 14 years at Indiana University School of Medicine.

Finally, I would like to acknowledge the Institutional National Research Service

Award (T32) by Award Number 5T32DK007519-15 for the funding of my graduate studies and this work.

vi Julie Ann Mund

A SYTHETHIC LETHAL SHRNA SCREEN AND GENETIC PROOF OF CONCEPT

IDENTIFIES RAC1 AS A NOVEL TARGET TO DISRUPT PLEXIFORM

NEUROFIBROMA FORMATION

Neurofibromatosis Type 1 (NF1) is a highly penetrant autosomal dominant genetic disorder where mutations in the tumor suppressor gene NF1 leads to decreased neurofibromin. The most debilitating manifestation is the presence of complex multi- lineage Schwann cell-derived plexiform neurofibromas (PN). Historically, little clinical success has been achieved targeting PN through surgery or chemotherapies. I performed an shRNA library screen of patient-derived Schwann cell lines to identify novel therapeutic targets to disrupt PN formation and progression. An shRNA library screen of human kinases and Rho-GTPases was performed in NF1 -/- and paired NF1 competent immortalized Schwann cell lines. Following sequencing, candidates were identified. We previously developed a novel mouse model of NF1 wherein a neural crest specific Postn- cre targeted loxp-flanked Nf1 that replicated the PN found in patients. Additional cohorts of mice were generated with biallelic deletion of Rac1 (Nf1 f/f Rac1 f/f Postn-Cre+; DKO ).

Mice were aged for 9 months and peripheral nerves were harvested and fixed in formalin.

Peripheral nerve size was measured and tumors were identified through blinded analysis of hematoxylin and eosin and Masson’s Trichrome (collagen) stained slides. Rho family members, including RAC1 , were identified as candidates through an shRNA library screen. Genetic disruption of Rac1 in the Schwann cell lineage resulted in the prevention of tumor formation in DKO mice, as observed by peripheral nerve size and histological analysis. I observed an average of 14.8 +/- 2.65 tumors per mouse in the Nf1 f/f Postn-

vii Cre + cohort compared to 0 tumors in the DKO (p<0.0001). Following an shRNA library screen, RAC1 was identified as a candidate to modulate PN formation. Biallelic deletion of Rac1 in vivo prevented PN formation. I demonstrate that a candidate identified in an shRNA library screen can translate to an biological effect in a mouse model of PN.

D. Wade Clapp, M.D., Chair

viii TABLE OF CONTENTS

List of Tables ...... xi List of Figures ...... xii List of Abbreviations ...... xiv Chapter 1: Identification of Downstream Effectors of RAS Signaling in Neurofibromatosis Type 1 ...... 1 INTRODUCTION ...... 1 Neurofibromatosis Type 1 ...... 1 RAS Signaling in NF1 and Oncogenic RAS Mutations ...... 5 Pooled RNAi Screens ...... 7 Kinases and Rho-GTPases in Oncogenic Signaling ...... 9 MATERIALS AND METHODS ...... 11 Cell Lines ...... 11 Generation of Neurofibromin GAP-Related Domain and Non-Targeting Lentiviral Constructs ...... 12 Transduction of 05.5 Schwann Cells with GRD and GFP Non-Targeting Lentivirus ...... 14 Fluorescent Activated Cell Sorting and Expansion of GFP + Cells ...... 14 Proliferation Experiments and Non-Radioactive RAS-Activation Assay ...... 15 Puromycin Selection Kill Curve ...... 16 CFU Analysis on Pooled Rho-GTPase shRNA Library ...... 16 shRNA Library Experiment ...... 17 Analysis of Hits Following Sequencing ...... 17 Validation of RAC1 shRNA Cell Culture and Proliferation Experiments ...... 18 Preparation of Cell Lysates for Western Blot Analysis ...... 19 Western Blot Analysis ...... 19 Primary Antibody List Western Blot ...... 20 Statistical Methods ...... 20 RESULTS ...... 20 Generation of an Isogenic Paired Cell Line ...... 20 Insertion of the GRD of Neurofibromin Decreases RAS Activity in NF1 -/- Immortalized Human Schwann Cells ...... 24 Insertion of the GRD of Neurofibromin Decreases RAS-RAF-MEK-ERK Signaling of in NF1 -/- Immortalized Human Schwann Cells ...... 25 Insertion of the GRD of Neurofibromin Decreases Proliferation in NF1 -/- Immortalized Human Schwann Cells ...... 26 A Functional Genomic Screen Identified That Loss of RAC1 Conferred Growth Restriction in NF1 -/- Schwann Cells ...... 27 RAC1 Knockdown in NF1 -/- Immortalized Human Schwann Cells Reduced Proliferation and Phospho-ERK 1/2 Signaling ...... 34 DISCUSSION ...... 37 Chapter 2: The Role of RAC1 in Schwann Cell Biology and Plexiform Neurofibroma Formation ...... 47 INTRODUCTION ...... 47 RAC1 Signaling in Schwann Cells ...... 47

ix RAC1 Signaling in Tumor Biology ...... 47 Murine Models of Plexiform Neurofibroma Development ...... 48 MATERIALS AND METHODS ...... 50 Animal Study Approval ...... 50 Mice and Genotyping ...... 50 Non-Radioactive RAC-Activation Assay ...... 52 Dorsal Root Ganglion/Nerve Root Neurosphere Cells (DNSCs) Isolation ...... 52 Cell Culture and Proliferation Experiments ...... 53 Mouse Growth Factor Array ...... 53 Preparation of Cell Lysates for Western Blot Analysis ...... 54 Western Blot Analysis ...... 54 Primary Antibody List for Western Blot ...... 55 Microdissection of Nerve Tree and Measurement of Proximal Nerve Volume ....55 Histological Analysis ...... 55 Statistical Methods ...... 56 RESULTS ...... 56 Loss of Rac1 Ameliorates Gain-in-Functions Within the Plexiform Neurofibroma Tumorigenic Cell of Origin ...... 56 Genetic Deletion of Rac1 in Nf1 -null Neural Crest Derived Progenitors Prevents Plexiform Neurofibroma Formation ...... 61 DISCUSSION ...... 67 Appendix A ...... 71 References ...... 197 Curriculum Vitae

x LIST OF TABLES

Table 1. A Pooled Library of Rho-GTPases Selected to Include the Following Clones ...... 30

xi LIST OF FIGURES

Figure 1. Neurofibromin is a GTPase Activating Protein (GAP) for p21RAS…… ….….2

Figure 2. The Sequence of the GAP-Related Domain of Neurofibromin ...... 21

Figure 3. The Vector Map of the Construct to Insert the GRD of Neurofibromin into Patient Derived NF1 -/- Schwann Cells ...... 22

Figure 4. FACS Schematic and GFP Visualization with Fluorescent Microscopy ...... 23

Figure 5. Detection of the GRD in Patient Derived Schwann Cells Transduced with the GRD Insert Construct...... 24

Figure 6. Insertion of the GRD of Neurofibromin Decreases GTP-Bound RAS in NF1 -/- Immortalized Human Schwann cells ...... 25

Figure 7. Insertion of the GRD of Neurofibromin Decreases Phospho-ERK1/2 Signaling ...... 26

Figure 8. Insertion of the GRD of Neurofibromin Decreases Schwann Cell Proliferation ...... 27

Figure 9. Schematic of the Experimental Workflow for the Pooled Human Kinase and Rho-GTPases shRNA Library Screen ...... 29

Figure 10. Colony Forming Units of the Rho-GTPase Library Following Puromycin Selection ...... 30

Figure 11. Pathway Analysis of Hits Observed in Combined shRNA Library Screen .....33

Figure 12. STRING Analysis Links RAC1 with Many Downstream Effectors of Ras ....34

Figure 13. Transduction of RAC1 shRNA Decreases Phospho-ERK1/2 Signaling in NF1 -/- Patient Derived Schwann Cells ...... 35

Figure 14. shRNA Knockdown of RAC1 Modulates Proliferation of Null Schwann Cells ...... 36

Figure 15. Hyperactive RAC1-GTP is Observed in the Trigeminal Nerve of Nf1 flox/flox ;PostnCre + Mice Compared to Their Nf1 flox/flox ;PostnCre - Littermates ...... 56

Figure 16. DNSC Isolation and Culture ...... 57

Figure 17. PCR Validation of Cre-Recombination of DNSCs Following Transduction With Adenovirus ...... 58

xii

Figure 18. Western Blots Analysis Validated Cre-mediated recombination of Nf1 and Rac1 ...... 59

Figure 19. 48 Hour Proliferation of DNSCs ...... 60

Figure 20. Growth Factors in DNSC Conditioned Media Collected from WT, Nf1 -/- and DKO Mice ...... 61

Figure 21. Western Blot Analysis of Trigeminal Nerve Validating the Absence of RAC1 and Neurofibromin in the PostnCre Mouse Model...... 62

Figure 22. Proximal nerve root volume in 8-9 month old Nf1 flox/flox ;PostnCre -, Nf1 flox/flox ;PostnCre +, Nf1 flox/flox ;Rac1 flox/+ ;PostnCre +, and Nf1 flox/flox ;Rac1 flox/flox ;PostnCre + mice...... 63

Figure 23. Plexiform neurofibroma tumors were identified by histopathological examination of nerve tissues micro-dissected from 8-9 month old Nf1 flox/flox ;PostnCre -, Nf1 flox/flox ;PostnCre +, Nf1 flox/flox ;Rac1 flox/+ ;PostnCre +, and Nf1 flox/flox ;Rac1 flox/flox ;PostnCre + mice...... 64

Figure 24. Representative Stained Sections of the Proximal Nerve Trees ...... 66

xiii LIST OF ABBREVIATIONS

AAALAC Association for Assessment and Accreditation of Animal Care International ABL Abelson murine leukemia viral oncogene homolog 1 Ad-Cre Cre Recombinase Adenovirus ADP Adenosine diphosphate AKT Protein Kinase B ANOVA Analysis of variance ARF ADP-ribosylation factor ATP Adenosine triphosphate

BCA Bicinchoninic Acid

CDC42 Cell division control protein 42 homolog CML Chronic myeloid leukemia

DHH Desert hedgehog DMEM Dulbecco’s modified eagle medium DNA Deoxynucleic acid DNSC Dorsal root ganglia (DRG)/nerve root neurospheres DRG Dorsal root ganglia

EDTA Ethylenediaminetetraacetic acid ERK Extracellular signal-regulated kinase

FBS Fetal bovine serum FDA Food and Drug Administration FDR False discovery rate

GAP GTPase activating protein GAPDH Glyceraldehyde-3-phosphate dehydrogenase

xiv GDNF Glial cell line-derived neurotropic factor GDP Guanine diphosphate GEF Guanine exchange factor GFP Green fluorescent protein GEMM Genetically engineered mouse model GRBB2 Growth factor receptor bound protein 2 GRD GAP related domain GTP Guanine triphosphate

H&E Hematoxylin and eosin hTERT Human telomerase catalytic subunit H-RAS Harvey rat sarcoma viral oncogenic homolog

IACUC Institutional Animal Care and Use Committee IGF-1 Insulin-like growth factor 1 IGFBP-2 Insulin-like growth factor binding protein 2 IGFBP-3 Insulin-like growth factor binding protein 3 IGF-R1 Insulin-like growth factor 1 receptor precursor

JMML Juvenile myelocytic myeloid leukemia kDa Kilodalton K-RAS Kirsten rat sarcoma homolog

LIM LIM kinase

MAL MyD88 adapter-like mCdk4 Murine cyclin dependent kinase 4 M-CSF Macrophage colony stimulating factor MEF Murine embryonic fibroblast MEK Mitogen Activated Protein Kinase Kinase

xv MET Tyrosine Kinase Protein Met MAPK Mitogen Activated Protein Kinase Pathway MMP Matrix metalloproteinases MOI Multiplicity of infection MPNST Malignant peripheral nerve sheath tumor

NF1 Neurofibromatosis Type 1 NGF Neuronal growth factor N-RAS Neuroblastoma RAS viral oncogenic homolog

PAK p21 activated kinase PBS Phosphate buffered saline PCR Polymerase chain reaction PDGF-AA Platelet derived growth factor AA PDGF-R Platelet derived growth factor receptor PEI Polyethyleneimine PI3K Phosphoinositide 3-kinase PN Plexiform Neurofibroma PPI Protein-protein interaction PTEN Phosphatase and tensin homolog PVDF Polyvinylidene difluoride

RAB Ras-like proteins in brain RAC-1 Ras-related C3 botulinum toxin substrate 1 RAF Rapidly Accelerated Fibrosarcoma RAN Ras-like nuclear proteins RAS Rat sarcoma RET Rearranged during transfection RHO Ras homologous family RHOA Ras-homolog gene family member A

xvi RNA Ribonucleic acid RNAi RNA interference ROS Reactive oxygen species RTK Receptor tyrosine kinase

SCF Stem cell factor SH3 Src homology 3 domain shRNA Short hairpin RNA siRNA Short interfering RNA SKP Skin-derived precursors S.O.C Super Optimal Broth SOS Son of Sevenless SRC Proto-oncogene tyrosine kinase Src

TRC The RNAi Consortium TRC1 The RNAi Consortium first phase constructs TRC2 The RNAi Consortium second phase constructs

xvii

Chapter 1: Identification of Downstream Effectors of RAS Signaling in

Neurofibromatosis Type 1

INTRODUCTION

Neurofibromatosis Type 1

Neurofibromatosis Type 1 (NF1) is an autosomal dominant cancer predisposition disease affecting approximately 1 out of 3500 individuals with ~50% of patients acquiring a de novo mutation. Mutations in the NF1 tumor suppressor gene lead to constitutively active RAS, a binary molecular switch, through loss of the RAS-GTPase activating protein (GAP), neurofibromin [1,2]. Neurofibromin is a large protein with

2,818 amino acids, however the GAP-related domain (GRD) is 336 amino acids and its reintroduction is sufficient to restore RAS activation, proliferation and cytokine signaling in NF1/Nf1 null cells (Figure 1 ) [1-3]. Previous studies have shown that in response to growth factor signaling, neurofibromin is ubiquitinated and degraded to allow for dynamic regulation of RAS [4]. Targeted sequences immediately surrounding the GRD are necessary for proper degradation of neurofibromin following activation through receptor tyrosine kinase (RTK) signaling. Additionally, it has been reported that neurofibromin is degraded in part or fully depending on the intensity of the stimulus received at the RTK [4]. RAS activation peaks in response to complete neurofibromin degradation following ubiquitination, leading to activated downstream cascades to support growth, proliferation, and anti-apoptosis [4].

Figure 1. Neurofibromin is a GTPase Activating Protein (GAP) for p21RAS.

Neurofibromin accelerates the hydrolyzing of GTP to GDP for p21RAS.

NF1 patients are heterozygous for NF1 , with loss of heterozygosity in various cell lineages leading to a variety of complex and distinct clinical manifestations. Dermal neurofibromas exist with almost 100% penetrance and are neoplastic aberrations that develop in the skin of NF1 patients. These cutaneous neurofibromas arise in puberty and continue to increase in number as patients age and/or during pregnancy indicating a hormonal component to their growth [5-7]. In pregnancy, existing dermal neurofibromas may become larger and some patients have reported their regression following delivery of the neonate [7]. A population of neural crest like stem cells, named skin-derived precursors (SKP), that are present in both human and mouse dermis were discovered by

Miller and colleagues [8-11]. These SKPs have been shown to differentiate along neuronal and glial lineages [8-11]. Additional studies have identified the dermal neurofibroma cell of origin within these SKPs [12]. Skin from the back, neck, or ear is harvested from mice and a standard neurosphere explant assay is utilized allowing for neural stem/progenitor cells to be cultured and ultimately expanded [10, 12]. During the development of the neurosphere explant assay, bone marrow was cultured as a negative

2 control under the same conditions to verify only neural stem/progenitor cells were selected. Neurosphere cultures did not appear in bone marrow cultures indicating the selectivity of the isolation and culture method [12]. Following ex vivo ablation of Nf1 with an adenovirus containing a Cre recombinase, neurosphere cells were implanted into the sciatic nerve of recipient mice. Even though these were skin derived neurospheres, plexiform neurofibromas were observed in 100% of implanted animals [12]. Upon validation of the SKPs ability to generate plexiform neurofibromas, experiments were performed to determine whether SKPs could also reproduce classic dermal neurofibromas. Tamoxifen treatment of SKPs induced Nf1 deletion and were transplanted onto the dorsal/sacral area of mice. Both female and male mice were allowed to cohabitate in the same cages to ensure the female mice became pregnant [12].

Interestingly, only the pregnant female mice developed dermal neurofibromas reconfirming the role of hormonal signaling cascades in the development of these tumors.

Thus, a population within the SKPs are the cell of origin for NF1-associated dermal neurofibromas [12]. Cutaneous neurofibromas have similar make up in cellularity as plexiform neurofibromas which arise from large nerve plexuses.

Similar to the development of dermal neurofibromas, loss of heterozygosity of

NF1 in neural crest derived Schwann cells leads to complete loss of protein expression and drives the development of plexiform neurofibromas. Schwann cells form the myelin sheath around single axons in the peripheral nervous system and increase conduction of signals down the axons. Unlike dermal neurofibromas that develop over time from a loss of post-natal heterozygosity, plexiform neurofibromas are thought to be congenital, progressively increasing in size over the lifetime of the patient. Plexiform neurofibromas

3 emerge in childhood and are slow growing benign tumors in the cranial nerves and large proximal nerve sheaths. These tumors may arise from a single nerve plexus or bundles of multiple nerves allowing them to grow quite large. Even though these tumors are non- malignant, they can compress vital structures and organs leading to disfigurement and disability, and even mortality due to either the compression of vital structures or through transformation to malignant peripheral nerve sheath tumors (MPNST) [13, 14].

Due to their congenital formation, the tumorigenic cell of origin must arise from a subset of neural crest derived Schwann cell precursors [15]. Loss of NF1 occurs early in development and target a subpopulation of Schwann cell precursors that is still unknown in human development. A population of murine derived embryonic dorsal root ganglia (DRG)/nerve root neurospheres (DNSCs) has been identified to contain the plexiform neurofibroma cell of origin [16]. In addition to Schwann cells, plexiform neurofibromas are multi-lineage tumors containing fibroblasts, endothelial cells, perineural cells, and infiltrating immune cells. These cell lineages collaborate to generate highly vascularized benign tumors. Plexiform neurofibromas collectively affect up to

40% of NF1 patients. Due to the location and makeup of these tumors they are unresponsive to traditional chemotherapy and surgical resection is not possible.

Additionally, due to the historical inability to treat plexiform neurofibromas, major lifelong morbidity is observed due to the tumors propagating from large peripheral nerves

[17, 18]. As a result, novel targets are needed to develop or repurpose compounds for the treatment of plexiform neurofibroma formation.

4 RAS Signaling in NF1 and Oncogenic RAS Mutations

Multicellular organisms require strictly controlled pro-growth and survival signals to ensure that cells only reproduce when necessary for the entire organism including times of development, growth, and remodeling such as wound healing. A complex network of signaling cascades regulates these processes. The Rat Sarcoma (RAS) superfamily of small guanine triphosphate hydrolase enzymes (GTPases) is evolutionarily conserved and includes over 150 human members [19, 20]. This superfamily contains 5 families of GTPases (Ras, Rho, Rab, Ran, and Arf) separated into families by sequence homology and similarity of roles within cells [19]. RAS superfamily members are relatively small proteins, approximately 21 kDa in mass and contain both alpha-helices and beta-strands making up their structures [20]. All members act as binary molecular switches with high affinity for guanine triphosphate (GTP) and low intrinsic ability to hydrolyze GTP.

RAS signaling occurs when RAS is bound to GTP. To achieve this, a growth factor binds to an RTK, the receptor becomes phosphorylated allowing it to bind to the adapter protein Growth Factor Receptor Bound Protein 2 (GRB2). The Src homology 3 domain (SH3) of GRB2 then binds to the guanine nucleotide exchange factor (GEF) Son of Sevenless (SOS) activating RAS by replacing the guanine diphosphate (GDP) for a

GTP. RAS GAPs, including neurofibromin, increase the intrinsic rate of hydrolysis of the third phosphate in GTP quenching the downstream protein signaling cascades.

Downstream RAS signaling includes Rapidly Accelerated Fibrosarcoma (RAF) kinase activating the mitogen-activated protein kinase (MAPK) cascade promoting cell growth

[19, 20]. RAS also activates phosphoinositide 3-kinase (PI3K) to phosphorylate protein

5 kinase B (AKT), a key regulator in cell survival [21]. The loss of neurofibromin allows for constitutively-active RAS signaling thus unregulated growth, anti-apoptosis, and proliferation.

NF1 patients are only a small percentage of the people requiring treatment for hyperactive RAS signaling. Genetic and epigenetic changes that influence the expression levels of tumor-suppressor genes, oncogenes, and microRNA genes all drive carcinogenesis [22]. In addition to the loss of RAS-GAPs, including neurofibromin, oncogenic RAS mutations in one of the three homologs (Harvey rat sarcoma viral oncogenic homolog (H-RAS), Kirsten rat sarcoma viral oncogenic homolog (K-RAS), and neuroblastoma RAS viral (v-ras) oncogenic homolog (N-RAS) are present at some level in ~25% of human cancers [22]. All 3 RAS homologs are located on different chromosomes (H-RAS – p arm of chromosome 11; K-RAS p arm of chromosome 12; and

N-RAS p arm of chromosome 1), but their structures are quite similar.

As RAS mutations occur in a wide variety of human cancers including both solid and liquid, the RAS oncogene is likely a driver in carcinogenesis. Mutations in K-RAS are the most common and are prevalent in pancreatic carcinomas, colorectal cancers, and lung cancers [23, 24]. Recently it has been shown up to 90% of pancreatic ductal adenocarcinoma contains an oncogenic K-RAS mutation [24-26]. H-RAS mutations frequently occur in dermatological and head and neck cancers and N-RAS mutations frequently occur in hematological cancers [23]. Each of these mutations creates a gain- in-function leading to constitutively active RAS and unrestricted cell proliferation and pro-growth downstream signaling [22-24, 27].

6 The RAS oncogenes were discovered more than fifty years ago, and yet today they remain undruggable [22]. Targeting RAS directly has been difficult due to the many post translational modifications of RAS and the relatively small size of the binding pocket to which therapeutics could bind RAS with high affinity [27]. Further, a challenge known in RAS effector signaling is its incorporation of redundancy and feedback loops, confounding its direct targeting through small molecule inhibitors [27,

28]. In vitro cell culture assays in NF1/Nf1 heterozygous or nullizygous cells are important to further investigate the role of constitutively active RAS. I present the development of isogenic paired cell lines originating from immortalized patient derived

NF1 -/- Schwann cells. The insertion and validation of the GRD of neurofibromin to decrease hyperactive RAS signaling generates a novel reagent for a subsequent shRNA library screen to investigate novel downstream effectors of RAS in the context of NF1.

Pooled RNAi Screens

The ability to silence large groups of genes individually with pooled RNA interference (RNAi) experiments enables disease-specific and large-scale biological processes to be better understood [29]. There are multiple ways to silence genes in mammalian cells with both short-and long-term techniques. For transient expression loss, short interfering RNAs (siRNAs) may be used. Historically, siRNA experiments are performed in plates and are screened individually. For knockdown of protein expression that can be passaged over time or used in large complex pooled screening approaches, short hairpin RNAs (shRNAs) are generally chosen. Pooled library shRNA experiments offer novel technology in the ability to “barcode” the hits and the integrated hairpins also

7 known as the barcode are able to be sequenced from the genomic DNA [30]. This technique allows for comparison of either a drug treatment and placebo or different genomic cell lines to identify possible differences in expression of various genes in response to treatment condition.

To further help integrate these barcoded hairpins, The RNA interference (RNAi)

Consortium (TRC) was developed to create a library of custom RNAi constructs targeting

15,000 human and murine genes [31]. First phase (TRC1) constructs were developed from the initial RNAi constructs with varying knockdown transduction efficiency.

Second generation TRC2 constructs were validated for high knockdown efficiency and provide a standard for RNAi experiments. It is recommended to use 3-5 TRC1 and

TRC2 hairpin constructs per gene to ensure target knockdown as each hairpin has a different knockdown efficiency [29-31].

Another consideration in performing a pooled screen is to ensure that only one hairpin is allowed to transduce each cell. This requires calculating the transduction viral particles in each library and adding no more than 0.5 particle for every cell [30, 32]. This multiplicity of infection (MOI) of 0.5 allows for some cells to remain non-transduced.

Following transduction with a large library, a selection marker must be used to ensure non-transduced cells have been completely eliminated. Antibiotic markers such as puromycin are common in lentiviral constructs and following proper titration for each cell type are gentle enough not to cause cell death. Fluorescent markers can also be utilized, although clear delineation of dim positive events and negative event may not be observed. Following isolation of genomic DNA, the barcodes are processed with next generation sequencing of the PCR products [32, 33]. Sigma Aldrich has proprietary

8 rights to the TRC1 and TRC2 constructs. Due to the large volume of sequencing, companies including Sigma Aldrich perform all steps from DNA isolation through barcode sequencing and deconvolution.

The past decade has seen a rapid progression of commercially available genomic based library screens. These screens have allowed for the delineation of essential genes in mutant cell lines and even viable drug targets due to the differences observed in sequenced cell lines [33-35]. To identify novel targets in NF1 -/- and GRD corrected cells,

I chose to investigate two families of molecular switches: kinases, a well characterized family with successful oncology clinical responses and the less clinically targeted Rho-

GTPases.

Kinases and Rho-GTPases in Oncogenic Signaling

As patients with Neurofibromatosis type 1 develop constitutively active RAS following loss of heterozygosity in neurofibromin, it is imperative to find downstream cellular targets that are involved in the processes that become upregulated. Cell growth, proliferation, survival, and migration are all controlled through protein kinases. There are 535 human protein kinases with many being implicated in disease, especially carcinogenesis [36]. In 2002, Manning et. al published the first comprehensive report of the human kinases, though only 518 of the now known 535 were identified [37]. They were classified by sequence into conserved families with signaling occurring following phosphorylation of amino acid side chains serine, threonine, and tyrosine [37].

Protein kinases are made up of two domains, a smaller N-terminal section that coordinates ATP binding and a larger C-terminal section that binds to protein substrates

9 and also catalyzes phosphorylation [38]. Posttranslational modification of the kinases is the main way they are regulated and include phosphorylation, binding of a regulatory partner or changes in expression [39]. Phosphorylation of protein kinases is the most common posttranslational modification. Changes in phosphorylation status directly impacts the activity of protein kinases.

Aberrant signaling in protein kinases has long been implicated in many disease states. Over 450 kinases have been shown to correlate with either the development or progression of disease [40]. Many of these kinases have been implicated in either genetic or cancer indications, yet I still do not have a full understanding of kinome biology. This lack of knowledge obscures the effects of low copy number changes or discriminating between gain-of-function and loss-of-function mutations.

Kinase targeting drug therapies have shown great success in the clinic for many types of cancers. Although single kinase targeted small molecules and other therapeutics have shown some success, the cross-targeting effects of the less selective inhibitors seem to provide more efficacy. In response to a single targeted agent, tumors adapt to the loss of the signaling cascade blocked ultimately resuming their growth. Due to this adaptation, quenching multiple targets simultaneously has a more dramatic effect on restricting tumor growth or inducing apoptosis. This is in part due to the mechanism of action of binding to the ATP-binding site of protein kinases. Many ATP-binding sites are conserved between protein kinases leading to multiple off-target effects. Due to the success in targeting kinases, I anticipate discovering additional protein kinases in my shRNA library screen that may ameliorate plexiform neurofibroma formation.

10 Rho-GTPases are binary molecular switches that work in conjunction with protein kinases in signal transduction pathways in eukaryotic cells. The Rho-GTPases alternate between a GTP-bound “on” state and a GDP-bound “off” state [41]. There are 20 mammalian Rho-GTPases and they are implicated in many pathways including regulation of cell polarity, gene transcription, microtubule dynamics, vesicular transport, enzymatic activities, cell morphology, and actin remodeling [41-43]. Although these pathways may seem unrelated, Rho-GTPases participate in 3 broad topics that include morphology, movement, and behavior [43]. The 3 main studied Rho-GTPases are Ras-related C3 botulinum toxin substrate 1 (RAC1), cell division control protein 42 homolog (CDC42), and Ras-homolog gene family member A (RHOA).

Due to their implications across broad signaling networks, the Rho-GTPases are becoming more attractive in oncology research. They have been suggested as potentially useful targets in Ras-driven cancers as anti-neoplastic agents [44], however few in vivo studies have been conducted due to lack of targeted therapeutic agents. I propose to validate the Rho-GTPases as potential targets for the amelioration of plexiform neurofibroma. Large scale investigation of protein kinase and Rho-GTPases networks will provide novel candidates for the treatments of many diseases, including

Neurofibromatosis Type 1.

MATERIALS AND METHODS

Cell Lines

NF1 -/- patient derived immortalized Schwann cell line, 05.5, was generously donated by M.R. Wallace [45]. To ensure low passage, 05.5 Schwann cells were expanded in 10% Fetal Bovine Serum (Sigma) in Dulbecco’s Modified Eagle Medium

11 (Gibco) supplemented with 2% penicillin/streptomycin (Gibco) and 1% Glutamax

(Gibco) (complete 10% DMEM) on tissue culture treated polystyrene 10 cm 3 dishes.

Upon expansion, 05.5 cells were washed 1X with Phosphate Buffered Saline (Corning) and harvested using 2mL of 0.05% trypsin-EDTA (Gibco) at 37ºC and collected into

8mLs of complete 10% DMEM. 20µL of harvested cells were diluted 1:10 with 0.4% trypan blue (Gibco) and counted manually on a glass hemocytometer. Cells were centrifuged for 10 minutes at 700g at room temperature. 1x10 6 05.5 Schwann cells were resuspended in 1mL of 90% FBS and 10% dimethyl sulfoxide and placed into a 2mL cryovial (Corning). Cryovials were placed in a freezing container (Thermo Scientific) to ensure cooling at -1 ºC/minute in a -80ºC freezer. After 48 hours at -80ºC, cryovials were placed in liquid nitrogen for long term storage.

Generation of Neurofibromin GAP-Related Domain and Non-Targeting Lentiviral

Constructs

Lentiviral particles containing the previously published sequence of the GAP- related domain of neurofibromin (GRD) ( Figure 2 ) were purchased from Vector Builder

(Chicago, IL, USA) [3, 4]. A green fluorescent protein (GFP) reporter was also incorporated in the GRD vector. A non-targeting GFP plasmid (Sigma Aldrich) was also purchased and lentiviral particles were made in 293-T cells. Human embryonic kidney

(293-T) cells were plated on tissue culture treated polystyrene 10cm 3 dishes in complete

10% DMEM. Plasmid DNA was diluted to 1ng/µL. 5µL of diluted DNA was added to

TOP10 Competent cells (Invitrogen) and incubated on ice for 30 minutes. Cells were then placed at 42ºC for 30 seconds and then put on ice for 2 minutes. 500µL of Super

12 Optimal Broth (S.O.C.) Media (Invitrogen) was added to the cells and the vial was placed in a shaker for one hour at 37ºC. 20µL of media/cells/DNA was placed on a 0.120g/L ampicillin agar plate with glass beads added to distribute the fluid. Agar plates were put in a 37ºC dry incubator for 16 hours. Two colonies were plucked using a 20µL pipette tip (Rainin) and each was placed in 2mLs of Lennox broth containing ampicillin (1X) in a 14mL round bottom tube (BD) and gently agitated in a shaker for 7 hours at 37ºC. 1mL of the bacteria containing broth was placed in a 1000mL Erlenmeyer flask in 249 mLs of the ampicillin containing Lennox broth and gently agitated in a shaker for 16 hours at

37ºC. Bacterial plasmid DNA was isolated with a PureLink HiPure Plasmid Filter

Maxiprep kit (ThermoFisher Scientific) according to manufacturer’s protocol. Isolated

DNA was resuspended in Tris-EDTA Buffer (ThermoFisher Scientific).

Polyethyleneimine (PEI) mixture was made in a 15mL conical tube with 45µL of PEI and

955µL plain DMEM per DNA containing solution. PEI mixtures were vortexed and set aside. DNA was added so that 10ug was added to 1mL of DMEM with 1ug/plate pcoPE01 (envelope plasmid) and 5ug/plate pCD/NL-BH (packaging plasmid). 1mL of

PEI mixture was added to the DMEM containing the DNA and plasmids, then vortexed and placed at room temperature for 15 minutes in the dark. Complete media was aspirated from the 293T cells and 4mLs of 15% FBS in DMEM without antibiotic was added to each plate. The 2mLs of the PEI and DMEM was added to the 293T cells and incubated overnight at 37ºC. PEI media was aspirated off and 5mLs of complete 10%

DMEM. Transduced cells expressing the GFP construct (GFP +) were identified using a fluorescent microscope. Virus was collected the following day in a 10mL syringe and

13 filtered with a micron syringe filter (Whatmann). Filtered non-targeting virus was aliquoted in 1mL per cryovial and stored at -80ºC.

Transduction of 05.5 Schwann cells with GRD and GFP Non-Targeting Lentivirus

1x10 6 patient-derived 05.5 Schwann cells were seeded on a tissue culture treated polystyrene 10cm 3 dishes in complete 10% DMEM. For the GRD GFP construct,

64.8µL of lentiviral particles (500,000 lentiviral particles, Vector Builder) and 6µL polybrene were added to 5,892µL complete 10% DMEM. For the GFP non-targeting construct, 240µL of lentivirus and 6µL polybrene were added to 5,760µL complete 10%

DMEM. Media was aspirated off the 05.5 Schwann cells and 6mLs of the viral media was added to each plate and incubated at 37ºC overnight. Media was aspirated and 8mLs of complete 10% DMEM was added to each plate. Cell lines were named GRD

(transduced with GRD GFP construct) and Null (transduced with GFP non-targeting construct). Lentiviral titer was determined through CFU-colony assays.

Fluorescent Activated Cell Sorting and Expansion of GFP + Cells

48 hours post transduction, GFP + cells were sorted via fluorescent activated cell sorting. GRD and Null cells were washed 1X with PBS and were harvested with 0.05% trypsin and collected cells were centrifuged at 700g for 10 minutes. GRD and Null cells were resuspended in PBS with 2% FBS. GFP+ cells from each cell line were sorted on a

BD Aria II and collected into 14mL round bottom tubes. Sorted cells were centrifuged at

700g for 10 minutes and resuspended in 10mLs of complete 10% DMEM and plated on a tissue culture treated polystyrene 10cm 3 dish. Null and GRD cells were given fresh

14 media every 3 days and passaged upon confluence. 1x10 6 passage 2 cells were resuspended in 1mL of 90% FBS and 10% dimethyl sulfoxide and placed into a 2mL cryovial (Corning). Cryovials were placed in a freezing container (Thermo Scientific) to ensure cooling at -1 ºC/minute in a -80ºC freezer. After 48 hours at -80ºC, cryovials were placed in liquid nitrogen for long term storage.

Proliferation Experiments and Non-Radioactive RAS-Activation Assay

50,000 Null and GRD cells were plated in complete 10% DMEM in triplicate a 12 well tissue culture treated plate and placed at 37ºC. 48 hours and 72 hours after plating, cells were washed 1X with PBS and then 0.5mL of 0.05% trypsin (Gibco) was added to each well. 0.5mL of complete 10% DMEM was added to stop the trypsin. 20µL of harvested cells from each well were diluted 1:10 with 0.4% trypan blue (Gibco) and counted manually on a glass hemocytometer. In parallel experiments, 1x10 6 Null and

GRD cells were plated in complete 10% DMEM on tissue culture treated polystyrene 10 cm 3 dishes. 24 hours after plating, cell lines were starved in plain DMEM for 16 hours.

Starved cells were washed 2X on ice with cold PBS and collected in 500µL using a Mg 2+ lysis buffer provided in Non-Radioactive RAS-Activation Assay (Millepore 17-218).

Additional plates were stimulated with complete 10% FBS for 5 minutes before being collected in 500µL of Mg 2+ lysis buffer. RAS Activation Assay was performed per manufactures protocol.

15 Puromycin Selection Kill Curve

20,000 Null and GRD cells were plated in each well of a tissue culture treated 24 well plate. 24 hours after plating, puromycin ranging from 0-5µg/mL was added to the complete 10% DMEM. Plates were monitored by inverted microscope at 24 and 48 hours to determine an estimated percent of live cells. At 48 hours, old media was aspirated and fresh puromycin containing media was added to each well. The lowest concentration of puromycin containing media that killed 100% of cells at 72 hours was chosen for subsequent experiments.

CFU Analysis on Pooled Rho-GTPase shRNA Library

100,000 Null cells were seeded per well on a tissue culture treated 6-well in complete 10% DMEM for a total of 18 wells. Human Rho-GTPase shRNA lentiviral particles were thawed on ice and 50µL of each clone was added to a 15mL conical tube and mixed together. 50µL of the mixed library was added to 4,950µL of complete 10%

DMEM containing 8ug/mL polybrene (10 -2). 1 well received polybrene alone.

Additional wells had dilutions from 10 -2 to 10 -9. Cells were transduced for 16 hours and fresh media was given in the morning. 48 hours post transduction, media was replaced with complete 10% DMEM containing 1.5ug/mL of puromycin. Puromycin treatment was continued for 72 hours. Plates were fixed in crystal violet and blue colonies were scored with 10 -6 having distinct colonies and about 20% confluency following puromycin selection. The remaining mixed library was split into 3 cryovials and stored at -80ºC.

16 shRNA Library Experiment

A Human Kinase Library was purchased (CSTVRS-07191316MN; Sigma) including 3200 lentiviral hairpins targeting 501 genes and include non-targeting controls.

The mixed Rho-GTPase library was added to the Human Kinase Library and added together to the seeded cells. 2 25cm 3 tissue culture treated plates were seeded with 5x10 6

Null cells. 3 25cm 3 tissue culture treated plates were seeded with 4x10 6 GRD cells. To ensure 0 or 1 hairpin entered each cell a multiplicity of infection of 0.5 was chosen. Null cells received a total of 2.5x10 6 transduction units and GRD cells received a total of

2x10 6 transduction units. Following overnight transduction, fresh media was added. 48 hours post transduction, media was replaced with complete 10% DMEM containing

1ug/mL of puromycin. Puromycin treatment was continued for 72 hours and then complete 10% DMEM was given to the cells. A plate of non-transduced cells was used in tandem with the shRNA library experiments to ensure 100% cell death observed at 72 hours of puromycin selection. Cells were collected at 72 hours post puromycin selection with half of the cells harvested frozen down in case of a repeat. 3 25cm 3 tissue culture treated plates were seeded with either 5.5x10 6 GRD cells or 4.625x10 6 Null cells post selection and were expanded for a total of 14 days. 10x10 6 GRD cells and Null cells from each replicate were harvested with 0.05% trypsin (Gibco) and were pelleted then sent to

Sigma Aldrich for deconvolution and 1000X coverage sequencing.

Analysis of Hits Following Sequencing

Hits were defined as those genes where at least 20% of all respective hairpins targeting that gene were significantly decreased according to the following criteria: (1) a

17 log fold change of <-2 when comparing Null cells vs GRD, (2) p-adjusted was below the false discovery rate (FDR) <0.1. Pathway enrichment analysis was conducted by using a hypergeometric test of identified possible target genes against 1329 MsigDB v6 canonical pathways, with using the 536 total screened genes as the background and p<0.05 as the cutoff for statistical significance [46]. Full processed sequencing data are available as Appendix A and FASTQ sequencing files are uploaded on Array Express.

Validation of RAC1 shRNA Cell Culture and Proliferation Experiments

1.5x10 6 Null cells were plated in three 10cm 3 tissue culture coated dishes and

0.75x10 6 Rac1shRNA (Sigma, TRCN0000055189) lentiviral particles were added to two dishes overnight. The additional dish of cells was left non-transduced to verify puromycin selection. The following morning, fresh culture media containing 1µg/mL puromycin was added to the plates and replaced after 48 hours. Following 72 hours of puromycin selection, with verification of 100% cell death in the non-transduced plates, media was replaced with standard culture media and the Null+RAC1 cells were expanded for subsequent experiments. 50,000 Null and Null+RAC1 cells were plated in complete

10% DMEM in triplicate a 12 well tissue culture treated plate and placed at 37ºC. 48 hours and 72 hours after plating, cells were washed 1X with PBS and then 0.5mL of

0.05% trypsin (Gibco) was added to each well. 0.5mL of complete 10% DMEM was added to stop the trypsin. 20µL of harvested cells from each well were diluted 1:10 with

0.4% trypan blue (Gibco) and counted manually on a glass hemocytometer.

18 Preparation of Cell Lysates for Western Blot Analysis

1x10 6 Null and GRD cells were plated in complete 10% DMEM on tissue culture treated polystyrene 10 cm 3 dishes. 24 hours after plating, cell lines were starved in plain

DMEM for 16 hours. Cells were stimulated with complete 10% media for 0, 5, 15, or 30 minutes followed by 2X washes with cold PBS on ice. Cells were lysed with 150µL of

X-tractor buffer (Clontech) with Protease Inhibitor Cocktail (Promega) and PhosSTOP

(Roche) and pipetted to 2mL microcentrifuge tubes. Cell lysates were incubated on ice for one hour and were sonicated for a total of 15 seconds at 60% amplitude. Sonication occurred with 5 seconds on followed by 5 seconds off. Cell lysates were centrifuged at

13000rpm for 5 minutes at 4ºC. Supernatant from the lysates was transferred to new microcentrifuge tubes. Additional experiments were conducted where 20µM of MG-132 was added for 6 hours to GRD and Null cells in complete 10% DMEM before cells were harvested as described above.

Western Blot Analysis

Pierce BCA protein assay (Thermo Scientific) was performed per manufactures protocol to determine protein concentrations. 20-30ug of protein for each sample were loaded and run on NuPage 4-12% Bis-Tris Gels (Invitrogen) then transferred to a PVDF membrane overnight. Membranes were blocked for 7 hours in 5% milk and then incubated with primary antibody overnight. Membranes were washed 3X with 0.1%

Tween in PBS and then incubated with horseradish peroxidase linked anti-mouse IgG, anti-rat IgG, or anti-rabbit IgG (GE Healthcare, 1:5000) and signal was visualized using

SuperSignal Chemiluminescence substrate (Thermo Fisher) and developed on film.

19 Primary Antibody List Western Blot

Neurofibromin (Santa Cruz, SC-67), Phospho-ERK 1/2 (Cell Signaling

Technologies, 9101), GAPDH (Cell Signaling Technologies, 5174), GRD of

Neurofibromin (LS-Bio, C177135)

Statistical Methods

Statistical analyses were performed in GraphPad Prism 7.0. As described in the text, Student’s T-test or ANOVA were used with various post-hoc tests to test for differences among the groups.

RESULTS

Generation of an Isogenic Paired Cell Line

Previous studies have shown that insertion of the GRD of neurofibromin is sufficient to restore hyperactive signaling cascades [3, 47]. To generate a novel reagent for use in a downstream shRNA library assay to screen for novel therapeutic targets, I started with a patient derived NF1 -/- immortalized Schwann cell line a pair of isogenic cell lines were created through the insertion of the GRD. An isogenic pair was deemed ideal due normalizing any additional genetic changes between the patient and a wild type line. The GRD sequence I used to create the plasmid has been published by my group and others ( Figure 2 ).

Figure 2. The Sequence of the GAP-Related Domain of Neurofibromin

Initially I tried to use a previously published construct [3, 4], but was unable to visualize any neurofibromin protein and the GFP expression was very weak, barely above the background. As I knew that any non-transduced cells would remain NF1 -/- with increased proliferation and pro-growth signaling, it was important to have clear delineations in GFP + and GFP - cell populations. After trying multiple backbones and various protein tags including the KT3 amino acid sequence that failed to identify GRD transduction, I decided to have the construct developed through Vector Builder.

I generated a new GFP reporter containing construct as downstream experiments needed to use puromycin selection thus a different selection strategy was necessary

(Figure 3 ).

Figure 3. The Vector Map of the Construct to Insert the GRD of

Neurofibromin into Patient Derived NF1 -/- Schwann Cells

A strategy of a T2A:EGFP reporter was chosen as the viral construct was relatively large at 9kB and an 11 amino acid KT3 tag at the end of the GRD as a surrogate for GRD protein expression due to the lack of antibodies able to detect the

GRD fragment itself. 48 hours post transduction, the GRD and Null cell lines were sorted using FACS.

GFP expression was bright and homogeneous in the Null non-targeting construct group with 88.6% GFP + cells ( Figure 4) . GFP expression from the GRD transduced cells was less distinct. A “dim” population (33.4% GFP +) and a “bright” population (9.9%

GFP +) were sorted and expanded in culture ( Figure 4 ). GFP expression was lost in the

“dim” cells and only the “bright” population was used in the subsequent experiments

(Figure 4 ).

Figure 4. FACS Schematic and GFP Visualization with Fluorescent

Microscopy. GFP + cells were isolated via FACS and expanded on tissue culture

treated plates.

In 2018, a new monoclonal mouse antibody was briefly produced that targeted the amino acids within the GRD itself (LS-BIO). It was unknown whether the GRD fragment transduced into the cells would have similar ubiquitination and thus degradation compared to full length neurofibromin. Both GRD and Null cells were treated with the proteasome inhibitor MG-132 to ensure that potential ubiquitination and degradation of the fragment was eliminated. A small amount of the GRD was observed in the GRD transduced protein lysate without treatment with MG-132. As anticipated, GRD protein expression was not observed in the non-MG-132 treated Null cell line. The amount of neurofibromin GRD detected in protein lysates was increased following treatment with

23 MG-132 in the GRD transduced cells and was again not visualized in the non-targeting

GFP transduced cells (Null) ( Figure 5).

Figure 5. Detection of the GRD in Patient Derived Schwann Cells

Transduced with the GRD Insert Construct. Protein lysates of patient derived

Schwann cells transduced with either the non-targeting GFP (Null) cell line or the

GRD insert (GRD) cell line with and without pretreatment with the proteasome

inhibitor MG-132. Increased GRD signal was observed in the GRD cell line

following treatment with MG-132.

Insertion of the GRD of Neurofibromin Decreases RAS activity in NF1 -/-

Immortalized Human Schwann Cells

Following the ability to detect the GRD protein, the next step was to verify the capability of the GRD to influence hyperactive RAS. The activity of the GRD insert was verified in functional and biochemical assays. RAS activation immunoprecipitation (IP) assays were performed to capture the RAF-1 RAS binding domain (RBD). Only active

RAS binds to the RAF-1 RBD agarose beads, thus allowing RAS-GTP to be selected from protein lysates. As expected, the GRD protein lysates had decreased GTP-bound

RAS compared to the Null protein lysates consistent with amelioration of RAS hyperactivation ( Figure 6).

Figure 6. Insertion of the GRD of Neurofibromin Decreases GTP-Bound

RAS in NF1 -/- Immortalized Human Schwann cells. Lentiviral insertion of the

GAP-related domain (GRD) of NF1 in NF1 -/- Schwann cells decrease RAS-GTP

levels as compared to NF1 -/- Schwann cells (Null) transduced with a scramble

non-targeting GFP shRNA construct (Student’s T-test; *p<0.05).

Insertion of the GRD of Neurofibromin Decreases RAS-RAF-MEK-ERK Signaling in NF1 -/- Immortalized Human Schwann Cells

In addition to directly decreasing the amount of GTP-bound RAS, I hypothesized that the insertion of the GRD would have downstream signaling effects. GRD correction decreased RAS effector signaling via the RAS-RAF-MEK cascade as shown by reduction in phospho-ERK1/2 signaling in GRD cells compared to the Null ( Figure 7). Previous experiments demonstrated serum starved WT Schwann cells increase signaling upon stimulation with FBS at 5 minutes [15]. I observed a decreased signal at both 15 minutes and 30 minutes post stimulation demonstrating an attenuation of the RAS-RAF-MEK cascade.

Figure 7. Insertion of the GRD of Neurofibromin Decreases Phospho-

ERK1/2 Signaling. Hyperactive phospho-ERK1/2 signaling is attenuated at 15-

and 30-minutes post stimulation in GRD compared to Null cells (*p<0.05;

**p<0.0022, respectively, One-Way ANOVA).

Insertion of the GRD of Neurofibromin Decreases Proliferation in NF1 -/-

Immortalized Human Schwann Cells

As both RAS and phospho-ERK1/2 signaling were decreased upon insertion of the GRD, I speculated a functional change in the proliferation of cells would be observed.

As anticipated, GRD cells had decreased proliferation at both 48- and 72-hour time points compared to Null cells ( Figure 8) indicating a functional read out to the insertion of the

GRD in NF1 -/- immortalized Schwann cells. Together these results indicated I had successfully developed an isogenic cell pair for use in my combined kinase and Rho-

GTPase shRNA library screen.

Figure 8. Insertion of the GRD of Neurofibromin Decreases Schwann Cell

Proliferation. Schwann cell proliferation is decreased at both 48 hours and 72

hours in GRD transduced cells compared to Null (***p<0.0005; ****p<0.0001,

respectively, One-Way ANOVA).

A Functional Genomic Screen Identified That Loss of RAC1 Conferred Growth

Restriction in NF1 -/- Schwann Cells

A combined kinome and Rho-GTPase wide shRNA library screen was conducted to identify signaling networks essential to the survival of NF1 -/- Schwann cells ( Figure

9). Multiple clones per gene, based on prior work [31], were chosen as transduction efficiency varies from construct to construct. I was most interested in the genes with low or no copy numbers in the Null cell line. Depletion of these clones suggested growth restriction in the context of NF1 nullizygosity. The combined shRNA library includes

3200 shRNA hairpins targeting 501 genes (Table 1 ). The full shRNA sequencing results are found on Array Express.

Puromycin selection was observed for 72 hours with 0-5µg/mL of puromycin added to each well. Media was changed at 48 hours and at 72 hours, all cells in 1µg/mL

27 and higher concentrations had underwent apoptosis. This allowed for the selection of

1µg/mL puromycin to ensure non-transduced cells were eliminated prior to expansion.

Once the puromycin concentration was set, the viral titer of the Rho-GTPases combined library was determined by colony forming unit analysis. Viral particles were combined for all clones and diluted from 10 -2 to 10 -9 and transduced overnight on both the Null and GRD cell lines. Cells were treated for 72 hours using puromycin selection and then plates were stained with crystal violet to determine colony number ( Figure 10 ).

Figure 9. Schematic of the Experimental Workflow for the Pooled Human Kinase and Rho-GTPase shRNA

Library Screen. A combined library of both kinases and Rho-GTPases (purchased from Sigma Aldrich) were chosen

29 to identify novel protein targets from multiple families. Null and GRD transduced cells were plated with the combined

library added to ensure 0-1 shRNA construct per cell. Cells were puromycin selected and expanded before collection

for sequencing and deconvolution. Hairpins that were found in higher numbers in the GRD cells were selected as this

indicated a growth advantage compared to the Null cells.

Figure 10. Colony Forming Units of the Rho-GTPase Library Following

Puromycin Selection. Following puromycin selection, crystal violet colonies

were identified with 10 -6 selected due to the few distinct colonies as compared to

the confluency observed in the lowest dilution.

Table 1. A Pooled Library of Rho-GTPases Selected to Include the Following Clones.

Rho GTPases TRC Number TRC Version

CDC42 TRCN0000424973 2

CDC42 TRCN0000414500 2

CDC42 TRCN0000417282 2

CDC42 TRCN0000037631 1

CDC42 TRCN0000037633 1

RhoQ (TC10) TRCN0000289570 2

RhoQ (TC10) TRCN0000289569 2

RhoQ (TC10) TRCN0000308154 2

RhoJ (TCL) TRCN0000432315 2

RhoJ (TCL) TRCN0000420432 2

RhoJ (TCL) TRCN0000047603 1

RhoJ (TCL) TRCN0000047605 1

RhoJ (TCL) TRCN0000047607 1

RhoU (Wrch) TRCN0000440900 2

RhoU (Wrch) TRCN0000414240 2

RhoU (Wrch) TRCN0000412393 2

RhoU (Wrch) TRCN0000048653 1

RhoU (Wrch) TRCN0000048655 1

RhoV (Chp) TRCN0000443953 2

RhoV (Chp) TRCN0000430219 2

RhoV (Chp) TRCN0000439797 2

RhoV (Chp) TRCN0000048631 1

RhoV (Chp) TRCN0000048632 1

Rac1 TRCN0000004871 1

Rac1 TRCN0000318432 2

Rac1 TRCN0000318375 2

Rac1 TRCN0000318431 2

Rac2 TRCN0000047277 1

Rac2 TRCN0000291759 2

Rac2 TRCN0000291829 2

Rac2 TRCN0000291757 2

Rac2 TRCN0000291828 2

Rac3 TRCN0000047288 1

Rac3 TRCN0000047291 1

Rac3 TRCN0000047292 1

RhoG TRCN0000048018 1

RhoG TRCN0000048019 1

RhoG TRCN0000048021 1

RhoG TRCN0000048022 1

RhoG TRCN0000048020 1

RhoBTB1 TRCN0000047753 1

RhoBTB1 TRCN0000047756 1

RhoBTB1 TRCN0000047754 1

RhoBTB2 TRCN0000047964 1

RhoBTB2 TRCN0000047967 1

RhoBTB2 TRCN0000424971 2

RhoBTB2 TRCN0000429168 2

RhoBTB3 TRCN0000331173 2

RhoBTB3 TRCN0000291537 2

RhoBTB3 TRCN0000291590 2

RhoH TRCN0000445349 2

RhoH TRCN0000438734 2

RhoH TRCN0000431657 2

RhoH TRCN0000047820 1

RhoH TRCN0000047821 1

RhoA TRCN0000047708 1

RhoA TRCN0000047710 1

RhoA TRCN0000047711 1

RhoB TRCN0000331154 2

RhoB TRCN0000291562 2

RhoB TRCN0000291561 2

RhoB TRCN0000308285 2

RhoB TRCN0000047849 1

RhoC TRCN0000291453 2

RhoC TRCN0000291516 2

RhoC TRCN0000307711 2

Rnd1 TRCN0000047433 1

Rnd1 TRCN0000047436 1

Rnd1 TRCN0000047434 1

Rnd1 TRCN0000047437 1

Rnd2 TRCN0000047438 1

Rnd2 TRCN0000047441 1

Rnd2 TRCN0000047440 1

Rnd3 (RhoE) TRCN0000353657 2

Rnd3 (RhoE) TRCN0000330303 2

Rnd3 (RhoE) TRCN0000330304 2

Rnd3 (RhoE) TRCN0000330305 2

Rnd3 (RhoE) TRCN0000330234 2

RhoD TRCN0000047703 1

RhoD TRCN0000047707 1

RhoD TRCN0000047704 1

RhoF (Rif) TRCN0000048049 1

RhoF (Rif) TRCN0000048050 1

RhoF (Rif) TRCN0000048051 1

I utilized edgeR to identify the hits with a significantly lower observation rate in the NF1 -/- cells versus GRD [48]. Although originally developed for RNA-seq data sets, the open access analysis tool edgeR has become quite useful in large scale shRNA experiments [48]. Data is first summarized into a matrix quantifying both the samples and the genes present from the sequencing data following analysis in the software, plots are generated identifying the fold-change versus hairpin abundance [48]. In total, I identified 211 clones that were selectively depleted in NF1 -/- (Null) Schwann cells as compared to the GRD normalized controls with a log 2 fold change of <-2 and adjusted p- values of <0.1. The random hits ratio was determined by the total number of genes

included in the experiment found in at least one pathway with a significant copy number change divided by the total number of genes found in at least one pathway. Pathway analysis revealed enrichment of Rho GTPase family members, including those involved in Rho cell motility signaling, phosphatase and tensin homolog (PTEN) signaling, RAS signaling, MyD88 adapter-like (MAL) in Rho-mediated activation of SRC, RAC1 cell motility signaling, and phosphoinositide 3 kinase (PI3K) subunit p85 in regulation of actin organization and cell migration. The identified PTEN, RAS, MAL, RAC1, and

PI3K signatures all contained RAC1 (shRNA log fold change=-6.3 in NF1 -/- cells versus

GRD) as a candidate as well as other related genes such as RHOA ( Figure 11).

Figure 11. Pathway Analysis of Hits Observed in Combined shRNA Library

Screen . Pathway analysis of the deconvoluted shRNA library screen hairpins

following sequencing. RAC1 was observed in multiple pathways that were above

the random hits ratio indicating a strong candidate.

RAC1 is also intricately linked to PI3K and RAF/MEK/ERK signaling. STRING analysis verified these effectors as exhibiting known and/or predicted protein interactions with RAC1 ( Figure 12).

Figure 12. STRING Analysis Links RAC1 with Many Downstream Effectors

of RAS. Known binding partners of RAC1 shown in a STRING plot.

Collectively, these data suggested that suppression of RAC1 abrogates gain-in- functions in NF1 -/- Schwann cells mediated through hyperactive RAS signaling. As

RAC1 appeared multiple times, I then decided to pursue an individual knockdown strategy utilizing a RAC1 targeting shRNA.

RAC1 Knockdown in NF1 -/- Immortalized Human Schwann Cells Reduced

Proliferation and Phospho-ERK 1/2 Signaling

To evaluate the role of RAC1 in modulating RAS signaling in NF1 -/- (Null)

Schwann cells, a lentiviral construct was utilized to knockdown RAC1. This generated a

functionally NF1 -/-;RAC1-/- cell line (Null+RAC1 shRNA). Following transduction and puromycin selection, proliferation and Western blot assays were performed. Protein lysates in the Null+RAC1 shRNA treated cells had significantly less phospho-ERK1/2 signaling at both 15-and-30 minutes post stimulation compared to the Null cell lysates

(Figure 13).

Figure 13. Transduction of RAC1 shRNA Decreases Phospho-ERK1/2

Signaling in NF1 -/- Patient Derived Schwann Cells. Hyperactive phospho-

ERK1/2 signaling is decreased at 15- and 30-minutes post stimulation following

shRNA knockdown of RAC1 in patient derived Null cells (***p<0.001,

***p<0.001 respectively, One-Way ANOVA).

Proliferation experiments were performed to compare the Null, GRD, and

Null+RAC1 shRNA cell lines. Cells were plated at normal growth conditions and cells were counted via hemocytometer cell counting. At 48 hours, proliferation was decreased in the Null+RAC1 shRNA cells compared to the Null cells ( Figure 14). Additionally, at

48 hours, the GRD cells proliferated more slowly than both the Null and Null+RAC1

shRNA cells ( Figure 14). At 72 hours, both the GRD and Null+RAC1 shRNA cells were significantly decreased compared to the Null cells ( Figure 14). There was no longer any significant decrease in proliferation between the GRD and the Null+RAC1 cells. Loss of RAC1 in NF1 -/- Schwann cells has functional consequences both in proliferation and phospho-ERK1/2 signaling, validating its potential as a target for plexiform neurofibroma amelioration.

Figure 14. shRNA Knockdown of RAC1 Modulates Proliferation of Null

Schwann Cells. At 48 hours, proliferation of GRD and Null+RAC1 shRNA

transduced Schwann cells was significantly decreased compared to Null

(****p<0.0001; ***p<0.0005, respectively, One-Way ANOVA). There is also a

decrease in the proliferation of GRD Schwann cells compared to those transduced

with Null+RAC1 shRNA (*p<0.05). At 72 hours, proliferation of GRD and

Null+RAC1 shRNA transduced Schwann cells were both significantly decreased

compared to Null (****p<0.0001). There was no difference in proliferation

between the GRD and the Null+RAC1 shRNA transduced Schwann cells.

DISCUSSION

The goal of these experiments was to create an isogenic cell pair with the only difference between them the functionality of neurofibromin to utilize in a combined shRNA library screen. I demonstrate that successful transduction with a GRD-expressing vector designed and purchased from Vector Builder was sufficient to restore hyperactive

RAS itself and downstream effectors. There is strong evidence in my work and previously published studies that differences between NF1/Nf1 sufficient and deficient cell lines are key tools to understand the disease processes in Neurofibromatosis type 1.

I wanted to investigate the role of hyperactive RAS in both NF1/Nf1 sufficient and deficient Schwann cell lines. I performed a second strategy that utilized an NF1 +/+ human immortalized cell line [45] then knocking down NF1 through introduction of an shRNA hairpin. Although I could demonstrate the loss of neurofibromin via Western blot (data not shown) there was no difference in proliferation or phospho-ERK1/2 signaling. I believe this is due to the immortalization process of the human Schwann cells.

Schwann cells were isolated from peripheral nerve samples collected from healthy nerves, NF1 patient nerves, and nerves associated with plexiform neurofibromas where cell culture and expansion occurred prior to immortalization [45]. Immortalization was conducted using multiple lentiviral constructs, first a human telomerase catalytic subunit

(hTERT) and following successful initial transduction, surviving cells then underwent a second lentiviral transduction with murine cyclin dependent kinase (mCdk4) [45]. hTERT was chosen to overcome the replicative senescence and was been shown in some cell types to cause immortalization [50-52]. Loss of mCdk4 allows for the overcoming of

the p16Ink4a mediated stress response and together with hTERT activation allows for the overcoming of replicative senescence [52]. I believe that the immortalization process of the wild type Schwann cells provided growth signals that were not able to be overcome with the additional loss of neurofibromin. These growth signaling cascades allowed for the increases in proliferation and phospho-ERK1/2 signaling I observed.

The insertion of the GRD into the immortalized NF1 -/- Schwann cells was a long and complicated path. I started with cloning a PCR fragment from a previous construct utilized in my lab [3]. I was unable to use the original construct due to the backbone containing puromycin selection and secondary shRNA experiments required a puromycin selection. I decided on fluorescent expression to verify transduced cells and due to the robust nature of the immortalized Schwann cells, expansion post sorting was not a concern. Although the sequence had been verified [3, 4], GFP tags can be problematic given the size of the construct. As shown in Figure 5, even with the GFP:T2A strategy where the mRNA self cleaves, the GFP expression was significantly less bright compared to the non-targeting GFP control transduced into the Null cells. The first strategy I tried was to isolate the plasmid DNA from the original puromycin containing construct and following maxiprep of the cultures, PCR was set up to identify the approximately ~1.5kb fragment of the GRD. The new backbone and PCR product were cut with the restriction enzymes Tth1112 and SacII. Following PCR of the uncut, Tth1112 and SacII, Tth1112 alone, and SacII alone, the samples were run on a gel to determine whether I had successfully generated the correct size of ~8kb. I had the correct size but needed to generate a larger sample volume to purify the band from the agarose gel.

Unfortunately, the PCR product of the GRD was unable to be visualized following restriction enzyme treatment with my usual methods of preparing the samples leading to us changing to a commercially available PCR purification kit. The temperature and lengths of the restriction enzymes were optimized through multiple experiments until I was able to visualize the PCR product post restriction enzyme on the agarose gel. Upon the ability to visualize both the PCR product and backbone post restriction enzyme and validate they were the correct sizes; I could perform the ligation experiments. Following ligation with and without the GRD insert, the plasmid DNA went through transformation again. Following transformation, I selected 10 colonies to increase the likelihood of detecting one or more colonies that had the correct the GRD insertion in the backbone. These experiments also needed significant optimization of the type/amount of restriction enzyme added, length of time to treat the samples with the restriction enzymes, and the amount of DNA per experiment. However, even after weeks of optimization, these experiments indicated that only self-ligated backbone colonies were observed with no colonies having the GRD insert. To prevent self-ligation of the backbone, a pretreatment strategy using calf intestinal phosphatase was utilized. Calf intestinal phosphatase prevents the self-ligation through to prevention of sticky end recombination. Unfortunately, even after several replicates, I was still unable to achieve colonies with a GRD insert and moved to a blunt end experimental design.

The blunt end strategy incorporated different restriction enzymes however I was unable to achieve colonies with the GRD insert. Additionally, I recovered less PCR product from the GRD insert fragment following PCR. To increase my GRD concentration and I moved to a different GRD containing vector (MSCV). Even with

these new strategies and even more restriction enzymes, no colonies containing both the backbone and GRD insert appeared on the ampicillin treated plates post transformation.

After many painful months, a ligation experiment was successful and due to the blunt end ligation, potential colonies were sent for sequencing to verify the correct insertion of the

GRD fragment. Following sequencing a couple of the colonies contained both the correctly oriented GRD insert and the backbone. These colonies were labeled as GRD1-

DDK-IEG. Virus was generated on 293-T cells with the cells appearing green under fluorescent microscopy. The first lot of immortalized human Schwann cells transduced with the GRD1-DDK-IEG viral construct were able to be sorted by FACS on GFP + although only 18,000 cells were collected in the GRD transduced cells. The GRD1-

DDK-IEG construct had an internal ribosome entry site GFP that traditionally allows for brighter GFP expression. The sorted GRD transduced cells had lost their GFP expression by passage 2 and the KT3 amino acid tag was not detected in Western blot analysis. A new experiment was set up and viral transduction was repeated.

A third strategy with a MIEG3 backbone and a KT3 GRD insert was created using EcoR1 and Xhol as restriction enzymes. This allowed for the observation of different PCR fragment sizes following cutting with the enzymes and these sized correlated to whether the GRD insert was placed in the correct or inverted orientation.

The MIEG3 and KT3 GRD insert were ligated and following digestion with SpeI and

Xho1 or BstEII these PCR fragments were observed. These also needed to undergo optimization to determine optimal timing of each restriction enzyme, ligase, and blunting ends with the calf intestinal phosphatase. As the fragments were still incorrect in size, I decided to perform a restriction enzyme experiment to create sticky ends in the MIEG3

backbone by treating with 8 different restriction enzymes. This was done as the exact backbone vector map was not available and the potential sites were unknown.

During this time, many innovative high-fidelity restriction enzymes became commercially available and I ultimately chose AgeI HF and NotI HF as they only had one site where the restriction enzyme was active in my backbone. It was essential to only have one restriction site to linearize the backbone and not split the backbone into multiple fragments. After treating with these restriction enzymes, the fragment size was still larger than the expected GRD insert. There was a single colony with the expected size however the insert was in the wrong orientation following digestion.

It was at this time that I decided to pursue a commercially designed GRD vector to my specifications. Vector Builder allowed us to incorporate the GFP:T2A fluorescent tag and the previously published sequence [3,4] without a puromycin selection.

Following transduction with the viral particles, the GFP + population in the GRD cells were able to be visualized both with flow cytometry and fluorescent microscopy. Upon expansion these cells showed a distinct phenotype compared to their parent NF1 -/-

Schwann cells.

Unlike the wild type immortalized Schwann cells that did not change phenotype with knockdown of NF1 , the immortalized NF1 -/- Schwann cells were able to be modulated with the insertion of the GRD. The transduction of the GRD of neurofibromin was able to normalize the phenotype observed in human NF1 -/- immortalized Schwann cells. The decreasing in RAS-GTP and phospho-ERK signaling demonstrate the GRD is sufficient to cause dramatic effects on constitutively active RAS. Furthermore, I now have a paired cell line to perform large scale RNA interference (RNAi) experiments to

determine whether any downstream effectors of RAS, including both kinases and the

Rho-GTPases provide growth restriction in NF1 -/- Schwann cells.

Large library assays allow for unbiased results to compare genetically different cell types or even drug treatments. The introduction of shRNA hairpins into human immortalized Schwann cells generated targeted gene silencing to identify novel therapeutic candidates. As the shRNA hairpin becomes incorporated into the RNA- induced silencing complex (RISC), the silencing of the gene is stably expressed [49].

Growth restriction occurs when a second genomic hit leads to decreased copy number expression whereas synthetic lethality occurs when a second genomic hit leads to cell death. The combined library requires next generation sequencing to decode the barcoded hairpins that are found in the pelleted cells.

Following validation of my paired NF1 -/- (Null) and GRD insert immortalized human Schwann cell lines for both puromycin selection and determination of the viral particles in the Rho-GTPase library my library screen was sufficiently coordinated to begin the full experiment. The determination of the viral particles in both libraries was an essential step to ensure a proper MOI, decreasing the likelihood of multiple hairpins entering a single cell. The cells were plated at 50% confluency and transduction particles at a MOI of 0.5 were added overnight. When puromycin selection began, a plate of non- transduced cells for each of the Null and GRD were selected to ensure 100% cell death in response to puromycin treatment. This allowed me to be confident that only cells with a hairpin incorporated into the RISC were expanded and sent for sequencing. Allowing the cells to grow for 14 days post puromycin selection was essential to increase the copy numbers of surviving cells.

The shRNA library experiment was performed as technical replicates. Due to the expense of the library hairpins and the large number of viral particles used in each plate, I determined after conversations with Sigma Aldrich that technical replicates were sufficient to achieve significant hits. I plated multiple plates of GRD and Null cells and added the particles to each one following gentle mixing to prevent dissociation of the hairpins. After puromycin selection, the cells were allowed to grow to confluency. Each plate was combined, with one third of the cells cryopreserved in case of a circumstance where the experiment needed to be replicated. The remaining two thirds of the cells were split equally into 3 plates. These plates were then passaged individually for the duration of the experiment, giving us 3 technical replicates of each of the GRD and Null cells. To ensure I had enough coverage in my sequencing, 10x10 6 cells were sent from each technical replicate at 14 days. I was most interested in hits that were increased in the

GRD cells and missing or had low copy numbers in the Null cell lines indicating the secondary loss of the gene was essential for the Null cell lines growth.

I also employed a strategy of a WT immortalized human Schwann cell that was paired with cells from the same origin that had a NF1 shRNA silencing hairpin in the large shRNA library screen. The NF1 knockdown cells were sorted on GFP positivity and expanded. Although I had preliminary data that the WT immortalized Schwann cells had increased proliferation that was not affected by the knockdown of NF1 , I decided to also try this isogenic cell pair in my shRNA library experiment. Due to the additional evidence that there was abrogated phospho-ERK1/2 signaling during the time when the sequencing was performed, I chose to not investigate identified candidates from this set.

I felt the results were not biologically relevant and may induce errors in identifying possible novel targets.

My shRNA screen identified multiple genes which selectively decreased the growth of NF1 -/- human Schwann cells compared to cells transduced with the GRD insert. All potential hits were evaluated due to the roles that protein kinases and Rho-

GTPases play in signaling cascades that lead to cell growth and proliferation. My results indicated multiple kinases that have been independently identified as possible targets in my lab through mass spectrometry kinome analysis including RET, MET, and LYN.

This validated that the hits observed in the screen were possible targets for the treatment of plexiform neurofibromas.

RET (rearranged during transfection) is a receptor tyrosine kinase and a proto- oncogene, however it has not been successful in modulating Schwann cell proliferation and signaling in vitro . Neuronal growth factor (NGF) controls RET signaling through binding of itself or other glial cell line-derived neurotropic factor ligands (GDNF). NGF is essential to dorsal root ganglia survival and differentiation.

The MET proto-oncogene has also been identified as a possible target for the treatment of neurofibromatosis type one. I generated a double knockout mouse with Met and Nf1 floxed out of a population of neural crest precursors starting at embryonic day

10.5. This silenced MET in the tumorigenic cell of origin of plexiform neurofibromas.

Unexpectedly, these mice developed large plexiform neurofibromas. However, due to the early loss of Met , I was unable to determine the cause of the large plexiform neurofibromas. Additional unpublished research performed in my lab determined that treatment with MET inhibitors did not prevent plexiform neurofibroma growth in vivo .

The tyrosine protein kinase LYN is a SRC family member and was an interesting target due to its being a downstream effector of the c-KIT receptor [53]. Imatinib suppressed LYN phosphorylation in chronic myelogenous leukemia (CML) when the cell lines or patients were imatinib sensitive [53]. In resistant patients and cell lines, decreasing LYN signaling through siRNA restored sensitivity to treatment with imatinib

[53]. Imatinib showed promising results in my mouse model of NF1 [15]. Imatinib has been used in the treatment of plexiform neurofibromas with varying degrees of success depending on the location of the tumor and the age of the patient [54].

RAC1 was an interesting hit for us due to its being both a single hit and present in multiple pathways that were enriched. Furthermore, protein-protein interaction (PPI) network analysis implicates RAC1 as a unifying modulator of potential targets identified across a range of pathways. These cross interactions indicate that RAC1 may modulate multiple targets leading to decreases in RAS activity.

Knockdown of RAC1 in Null cells both decreased proliferation and phospho-

ERK1/2 signaling compared to Null cells. Phospho-ERK signaling was decreased at both

15 minutes and 30 minutes following knockdown of RAC1 which is similar to what I observed in the GRD insert cells. This quenching of signal indicates a shorter activation time of the RAS-RAF-MEK-ERK signaling cascade. The serine/threonine kinase, p21- activated kinase (PAK) regulates RAC1 and interacts with multiple nodes of the MAPK pathway. Interestingly, there was no difference between 72-hour proliferation between the Null+RAC1 cells and the cells that received the GRD insert. This provides strong evidence that loss of RAC1 can modulate hyperactive RAS through downstream signaling cascades.

These findings led us to develop a tissue specific double knockout of Nf1 and

Rac1 genetically engineered mouse model. I was interested whether the results observed in cell culture would prevent or ameliorate plexiform neurofibroma formation in vivo .

Chapter 2: The Role of RAC1 in Schwann Cell Biology and Plexiform Neurofibroma

Formation

INTRODUCTION

RAC1 Signaling in Schwann Cells

Given RAC1 was represented in multiple pathways following my combined shRNA screen, I wanted to investigate its role in Schwann cells. Previous studies demonstrated that a conditional knockout of Rac1 arrested Schwann cell myelination and decreased phospho-p21 activated kinase (Pak) and phosphorylated merlin [55]. This may be due to the conditional knockout utilizing a desert hedgehog (Dhh) Cre recombinase that targets Schwann cells lining the axonal projections of both sensory and motor neurons beginning at embryonic day 12.5 (E12.5) [56]. Furthermore, neuronal development relies heavily on RAC1 signaling to ensure proper outgrowth, migration, and plasticity of nerves [57]. Neuronal survival is regulated by RAC1 as it prevents apoptosis mediated neurodegeneration [58-60]. However, in some neurodegenerative diseases such as Huntington’s disease, increases in RAC1 activation leads to increased reactive oxygen species (ROS) production and can interact with mutant huntingtin creating aggregates [61, 62]. Thus, RAC1 has the ability to protect neuronal integrity or contribute to disease progression depending on the specific mutation or cascade effected.

RAC1 Signaling in Tumor Biology

RAC1’s many roles in cell signaling, cell cycle progression, releasing of proangiogenic factors to promote neo-angiogenesis, and gene transcription make it a great target in oncology initiation and metastasis [50, 57, 63-65]. All of these roles can

contribute to a pro-oncogenic environment. Additionally, RAC1 has the ability to release matrix metalloproteinases (MMPs) that may increase cancer cell invasion due to their ability to remodel the extracellular matrix via degradation [66, 67]. Both because of the roles of RAC1 in tumor biology and the specific roles within Schwann cells, I created a tissue specific double knockout of Nf1 and Rac1 to determine how loss of Rac1 in the tumorigenic cell of origin may impact plexiform neurofibroma formation.

Murine Models of Plexiform Neurofibroma Development

In vitro models of disease have provided building blocks to generate hypotheses for the mechanism of regulation and progression. To understand the consequences of constitutively active RAS in the context of NF1, cell culture experiments have focused around two main cell types: bone marrow derived hematopoietic cells and nerve wrapping Schwann cells. Although a mouse model containing a mutant allele of Nf1 was generated in 1994, a model wherein plexiform neurofibromas developed wasn't published until 2008 [15, 68]. Thus, hematopoietic models to study additional known cancers that arise in patients with NF1 have been intensely studied to better understand how constitutively active RAS signaling promotes tumorigenesis. Children with NF1 can develop juvenile myelocytic myeloid leukemia (JMML) upon loss of heterozygosity [69-

71]. Previous work from my lab determined that restoration of the GRD in murine embryonic fibroblast (MEF) cells decreased the proliferation of and colony forming ability compared to Nf1 -/- MEFs [3]. Furthermore, bone marrow derived Nf1 -/- mast cells were grown in culture and increased colony formation was observed compared to GRD transduced mast cells [3]. I also investigated whether the additional genetic loss of Erk1

or Erk2 in Nf1 flox/flox ;MxCre + bone marrow cells was sufficient to rescue the hyperproliferative myeloid progenitors observed in vitro which are consistent with

JMML [70]. Interestingly Erk1/2 knockout mice had diminished cellularity within the bone marrow, with significantly less myeloid cells [69]. When Nf1 flox/flox Erk1 -/-

Erk2 flox/flox ;MxCre + marrow was transplanted into lethally irradiated mice, the hyperproliferative myeloid phenotype and enlarged spleen that was observed in

Nf1 flox/flox ;MxCre + marrow transplanted mice is abrogated [70]. These results indicate that attenuation of ERK1/2 signaling is beneficial to hyperplastic circulating cell populations.

Plexiform neurofibromas arise from loss of heterozygosity of neurofibromin in

Schwann cells. Complete loss of neurofibromin during embryonic development is fatal due to cardiac defects [68]. This discovery led to the development of targeted Lox P-Cre recombinase mouse models to overcome the embryonic lethality [71, 72]. One mouse model of plexiform neurofibroma utilizes the Dhh Cre recombinase to target neurofibromin in Schwann cell precursors [73]. These mice develop plexiform neurofibromas without a heterozygous microenvironment that is observed in patients with

NF1. Additionally, they demonstrated a targeted MEK inhibitor was sufficient to decrease tumor volume validating its use as a preclinical model of novel therapeutics

[73]. A recent study identified the tumorigenic cell of origin for plexiform neurofibromas, a population of cells within Nf1 -/- embryonic dorsal root ganglia/nerve root neurospheres (DNSCs) [16]. These cells when injected into the sciatic nerve become plexiform neurofibromas [16].

My lab has utilized different Cre recombinase models, first with a Krox20 model that required a heterozygous bone marrow transplant following lethal irradiation to

develop plexiform neurofibromas [15]. Later, I incorporated a novel periostin promoter that drives tissue specific expression in neural crest-derived Schwann cell progenitors and a population of cardiac outflow tract endocardial cushion [71, 74]. These mice develop plexiform neurofibromas with 100% penetrance at 6 months of age [74]. It is with this

Nf1 flox/flox ;PostnCre model that I generated cohorts of Nf1 flox/flox ;PostnCre -,

Nf1 flox/flox ;PostnCre +, Nf1 flox/flox Rac1 flox/+ ;PostnCre +, and Nf1 flox/flox Rac1 flox/flox ;PostnCre + mice to test my hypothesis that secondary deletion of RAC1 may impact plexiform neurofibroma formation.

MATERIALS AND METHODS

Animal Study Approval

All animal studies were conducted under the Institutional Animal Care and Use

Committee (IACUC) of Indiana University School of Medicine approved protocol

#10932 in accordance with the U.S. Department of Agriculture’s Animal Welfare Act and the Guide for the Care and Use of Laboratory Animals.

Mice and Genotyping

All mice were housed in an AAALAC accredited facility at the Indiana University

School of Medicine. Mice were maintained on a 12:12 light/dark schedule at 22-24ºC and fed a Teklad Animal Diet. PCR based genotyping was conducted using the following primers and thermocycler programs:

Nf1 floxed and Recombination:

P1: 5’-AATGTGAAATTGGTGTCGA GTAAGGTAACCAC 3’

P2: 5’- TTAAGAGCATCTGCTGCTCTTAGAGGGAA 3’

P3: 5’- TCAG ACTGATTGTTGTACCTGATGGTTGTACC 3’

Program: 94ºC for 5 minutes, 27X (94ºC for 30 seconds, 55ºC for 1 minute, 72ºC for 1 minute) 72ºC for 7 minutes, hold at 4ºC.

Expected PCR Fragment: Flox: 600bp, Recombination: 300bp

Rac1 floxed, WT, and Recombination:

P1:5’- GATGCTTCTAGGGGTGAGCC-3’

P2: 5’-TCCAATCTGTGCTGCCCATC-3’

P3: 5’-CAGAGCTCGAATCCAGAAACTAGTA-3’

Program: 94ºC for 5 minutes, 35X (94ºC for 30 seconds, 54ºC for 1 minute, 72ºC for 1 minute) 72ºC for 7 minutes, hold at 4ºC.

Expected PCR Fragment: FLOX: 242bp, WT: 115bp, Recombination: 140bp

PostnCre:

Forward primer: 5’-ATGTTTAGCTGGCCCAAATG-3’

Reverse primer: 5’-CGACCACTACCAGCAGAACA-3’

Program: 94ºC for 5 minutes, 29X (94ºC for 30 seconds, 54ºC for 30 seconds, 72ºC for

30 seconds) 72ºC for 10 minutes, hold at 4ºC.

Expected PCR Fragment: 450bp

Non-Radioactive RAC-Activation Assay

Trigeminal nerves were isolated from Nf1 flox/flox ;PostnCre + and

Nf1 flox/flox ;PostnCre - mice and were minced in lysis buffer and sonicated followed by centrifugation at 13000rpm for 5 minutes at 4C. Supernatant was transferred to a new microcentrifuge tube and the RAC1 Activation Assay (Non-Radioactive) was performed per protocol (EMD Millepore, 17-283). RAC1-IP was performed in three independent experiments and analyzed statistically as described below.

Dorsal Root Ganglion/Nerve Root Neurosphere Cells (DNSCs) Isolation

Nf1 flox/flox ;PostnCre - and Nf1 flox/flox Rac1 flox/flox ;PostnCre - breeders were established for timed pregnancy experiments as per previously described [16]. Mice were placed together for 1 night and checked for pregnancy at E13.5. Pregnant mothers were euthanized with embryos collected and dissected for nerve roots. Nerve roots from each embryo were digested in collagenase and plated on ultra low adherent plates in complete serum free media (477 mL of Dulbecco’s Modified Eagle Medium: Nutrient Mixture F-

12 (Gibco), 1 mL of 2% heparin (Stem Cell Technologies), 1 mL of 30% glucose made up in DMEM/F12 (Sigma), 0.75 mL of NaHCO3 (Gibco), 0.5 mL of 1M Hepes (Gibco),

5 mL of N2 (Gibco), 5 mL L-Glutamine (Gibco), 5 mL of Na Pyruvate (Gibco) and 5 mL of penicillin/streptomycin; basal DNSC media) supplemented with 20ng/mL epidermal growth factor (Sigma, EGF), 40 ng/mL basic fibroblast growth factor (bFGF), 2% B27 without Vitamin A (Gibco) and 40µg/mL Amphotericin B (Gibco). When all supplements have been added the media is now referred to as complete DNSC media.

Cell Culture and Proliferation Experiments

Mature dorsal root ganglion/nerve root neurospheres (DNSCs) were cultured on plates precoated overnight with 10 µg/mL fibronectin. Media was changed every 3 days and cells were passaged upon confluency at a 1:2 split. DNSCs were cryopreserved in

10% DMSO in 90% DMEM/F12 in 2mL cryovials. Upon confluency, DNSCs were transduced with 5 µL of high titer Cre-eGFP adenovirus (Ad5CMVCre-eGFP HT, UI

Viral Vector Core) or 5 µL of high titer eGFP adenovirus (Ad5CMVeGFP HT, UI Viral

Vector Core) for 3 hours. Transduction was performed up to 3 times to ensure efficient

Cre mediated recombination and validated via PCR. 4 independent experiments were performed on harvested embryos.

50,000 murine primary DNSCs were plated in 12 well plates precoated with 10

µg/mL fibronectin and cells were trypsinized at either 48 or 72 hours and counted using a hemocytometer and 0.5% trypan blue. Proliferation assays were performed in three independent experiments and analyzed statistically as described below.

Mouse Growth Factor Array

1x10 6 Nf1 flox/flox and Nf1 flox/flox Rac1 flox/flox DNSCs post adenovirus transduction

(Nf1 +/+ , Nf1 -/-, and Nf1 -/-Rac1 -/-) were seeded on10cm 3 plates precoated with 10 µg/mL fibronectin. Upon confluency, cells were starved in basal DNSC media. Conditioned media was harvested after 18 hours and centrifuged to eliminate any cellular debris. The cells were harvested in X-tractor lysis buffer and a BCA assay was performed to normalize the conditioned media concentrations. Conditioned media was assessed without delay in the Mouse Growth Factor Array 3 (#AAM-GF-3, Ray Biotech) as per

manufacturer’s protocol. The assay was performed in duplicate in 2 independent experiments for 4 total replicates per genotype.

Preparation of Cell Lysates for Western Blot Analysis

1x10 6 Nf1 +/+ , Nf1 -/-, and Nf1 -/-Rac1 -/- DNSCs were plated in complete DNSC media on 10cm 3 plates precoated with 10 µg/mL fibronectin. 24 hours after plating, cell lines were starved in plain DMEM for 16 hours. Cells were stimulated with complete

10% media for 0, 5, 15, or 30 minutes followed by 2X washes with cold PBS on ice.

Cells were lysed with 150µL of X-tractor buffer (Clontech) with Protease Inhibitor

Cocktail (Promega) and PhosSTOP (Roche) and pipetted to 2mL microcentrifuge tubes.

Cell lysates were incubated on ice for one hour and were sonicated for a total of 15 seconds at 60% amplitude. Sonication occurred with 5 seconds on followed by 5 seconds off. Cell lysates were centrifuged at 13000rpm for 5 minutes at 4ºC. Supernatant from the lysates was transferred to new microcentrifuge tubes.

Western Blot Analysis

Pierce BCA protein assay (Thermo Scientific) was performed per manufactures protocol to determine protein concentrations. 30ug of protein for each sample were loaded and run on NuPage 4-12% Bis-Tris Gels (Invitrogen) then transferred to a PVDF membrane overnight. Membranes were blocked for 7 hours in 5% milk and then incubated with primary antibody overnight. Membranes were washed 3X with 0.1%

Tween in PBS and then incubated with horseradish peroxidase linked anti-mouse IgG,

anti-rat IgG, or anti-rabbit IgG (GE Healthcare, 1:5000) and signal was visualized using

SuperSignal Chemiluminescence substrate (Thermo Fisher) and developed on film.

Primary Antibody List for Western Blot

Neurofibromin (Santa Cruz, SC-67), Phospho-ERK 1/2 (Cell Signaling

Technologies, 9101), GAPDH (Cell Signaling Technologies, 5174), Phospho-AKT (Cell

Signaling Technologies, 4060).

Microdissection of Nerve Tree and Measurement of Proximal Nerve Volume

Immediately following euthanasia, mice were perfused and fixed in 10% neutral buffered formalin. Following decalcification, the lumbosacral spinal nerve tree was then isolated under a dissection microscope. The volume of proximal peripheral nerves was determined using calipers to measure the length and width of dissected tumors (or equivalent region in absence of tumor) in maximal dimension. Volume was then approximated using the formula for the volume of a spheroid = 0.52 × (width) 2 × length.

Histological Analysis

Following volumetric proximal nerve measurements, the nerve trees were dehydrated with graded alcohols, cleared with xylenes, infiltrated with molten paraffin, and embedded in paraffin blocks. Five micron thick sections were cut on a Leica rotary microtome, and stained with hematoxylin and eosin (H&E). Tissue sections were also stained with Masson trichrome to identify collagen. Whole slide images were acquired on an Aperio ScanScope CS.

Statistical Methods

Statistical analyses were performed in GraphPad Prism 7.0. As described in the text,

Student’s T-test or ANOVA were used with various post-hoc tests to test for differences among the groups.

RESULTS

Loss of Rac1 Ameliorates Gain-in-Functions Within the Plexiform Neurofibroma

Tumorigenic Cell of Origin

Following identification and validation of RAC1 in immortalized human cells, I next determined whether Rac1-GTP was increased in the nerve tissues of genetically engineered Nf1 flox/flox ;PostnCre + mice which recapitulate human PNs in both development and histology [74]. GTP-bound Rac1 was immunoprecipitated from trigeminal nerve tissues of Nf1 flox/flox ;PostnCre - (Nf1 +/+ ) and Nf1 flox/flox ;PostnCre + (Nf1 -/-).

Nf1 flox/flox ;PostnCre + mice exhibited significantly increased levels of Rac1-GTP ( Figure

15).

Figure 15. Hyperactive RAC1-GTP is Observed in the Trigeminal Nerve of

Nf1 flox/flox ;PostnCre + Mice Compared to Their Nf1 flox/flox ;PostnCre -

Littermates. At baseline, WT mice had less GTP-bound RAC1 in the trigeminal

nerve compared to Nf1 flox/flox PostnCre + (Nf1 -/-) mice.

A population of dorsal root ganglion (DRG)/nerve root neurosphere cells

(DNSCs) have been shown to contain the tumorigenic cell for PN in mice [16, 74]. To generate my desired genotypes (WT, Nf1 -/- and Nf1 -/-;Rac1 -/- (DKO)) I generated mice with lox p sites flanking either Nf1 or Nf1 and Rac1 . This was essential as loss of Rac1 is embryonic lethal due to lack of proper germ layer formation [75]. I isolated and expanded DNSCs from the Nf1 flox/flox and Nf1 flox/flox ;Rac1 flox/flox e13.5 (embryonic day

13.5) embryos. Genetic ablation of floxed Nf1 and Rac1 alleles was achieved ex vivo via transient infection with Cre-GFP or GFP reporter adenovirus, yielding three resulting genotypes of DNSCs: WT, Nf1 -/- and Nf1 -/-;Rac1 -/- (DKO) ( Figure 16).

Figure 16. DNSC Isolation and Culture. DNSCs are isolated from the nerve

roots of embryonic day 13.5 spinal columns (A). Upon expansion, DNSCs are

passaged on fibronectin to create a monolayer (B) and a GFP reporter adenovirus

to verify Cre recombination.

Recombination of Nf1 and Rac1 was verified by PCR ( Figure 17).

Figure 17. PCR Validation of Cre-Recombination of DNSCs Following

Transduction with Adenovirus. Nf1 flox/flox ;PostnCre - and

Nf1 flox/flox ;Rac1 flox/flox ;PostnCre - DNSCs were isolated and cultured. Following

expansion, cells were transiently infected with a GFP-Cre adenovirus to delete the

floxed alleles or GFP adenovirus as a control. PCR validated Cre recombination.

Western blot assays verified the loss of both neurofibromin and RAC1 in the cells treated with the Cre-GFP adenovirus ( Figure 18). Nf1 -/- DNSCs had hyperactive phospho-ERK1/2 (pERK1/2) following overnight serum starvation at baseline compared to WT cells ( Figure 18). Interestingly, the DKO DNSCs also showed hyperactive pERK1/2 at baseline compared to WT ( Figure 18). This pERK1/2 hyperactivity was also observed post stimulation at 5 mins in both Nf1 -/- and DKO DNSCs compared to WT

(Figure 18). There was no significant difference in pERK1/2 between the DKO and WT

DNSCs 15 minutes post stimulation. DKO DNSCs exhibited decreased pERK1/2 below

Nf1 -/- levels at 15 mins. Phospho-AKT (pAKT) protein expression was elevated at baseline following overnight starvation in the Nf1 -/- DNSCs compared to WT and DKO

DNSCs ( Figure 18). There was no significant difference between any groups at 5 minutes post stimulation. Finally, the WT DNSCs maintained activation of pAKT at 15 minutes compared to the Nf1 -/- DNSCs ( Figure 18).

Figure 18. Western Blots Analysis Validated Cre-mediated recombination of

Nf1 and Rac1 . Nf1 -/- and DKO DNSCs showed hyperactive phospho-ERK1/2 at

baseline and 5 mins post stimulation with 10% FBS in DMEM compared to WT

(*p<0.05 and **p<0.01, respectively). DKO DNSCs exhibited decreased

pERK1/2 at 15 mins post stimulation compared to Nf1 -/- DNSCs (**p<0.01).

Nf1 -/- DNSCs exhibited increased phospho-AKT activation at baseline compared

to WT and DKO DNSCs (**p<0.01, *p<0.05 respectively). There was no

significant difference between any of the groups at 5 mins post stimulation. WT

DNSCs had increased activation of pAKT at 15 minutes compared to the Nf1 -/-

DNSCs (*p<0.05).

In addition to Western blot analysis, proliferation experiments were performed to analyze the functional impact of secondary loss of Rac1. 48 hours post plating, the proliferation of both WT and DKO DNSCs was reduced in comparison to Nf1 -/- DNSCs

(Figure 19).

Figure 19. 48 Hour Proliferation of DNSCs. The proliferative capacity of WT,

Nf1 -/-, and DKO DNSCs was evaluated following adenovirus transduction. WT

and DKO DNSCs had decreased proliferation compared to Nf1 -/- (****p<0.0001

for each pair). There was no difference in proliferation observed between WT

and DKO (p=0.9971).

Conditioned media was collected and assayed for growth factor expression from all 3 cell populations, however no difference was observed between the Nf1 -/- and DKO samples ( Figure 20) .

Figure 20. Growth Factors in DNSC Conditioned Media Collected from WT,

Nf1 -/- and DKO Mice. Conditioned media was harvested and assayed for

cytokine expression.

Genetic Deletion of Rac1 in Nf1-null Neural Crest Derived Progenitors Prevents

Plexiform Neurofibroma Formation.

To evaluate the biological impact of loss of RAC1 on PN formation, I utilized

PostnCre to drive recombination of Nf1 and Rac1 in neural crest derived Schwann cells

[72]. Nf1 flox/flox ;PostnCre + mice routinely acquire multiple PN on proximal spinal nerve roots by 4-5 months of age and are ubiquitously present by 6-7 months of life [74].

Rac1 flox/flox mice were genetically intercrossed with Nf1 flox/flox ;PostnCre + mice to generate the Nf1 flox/flox ;Rac1 flox/+;PostnCre + and Nf1 flox/flox ;Rac1 flox/flox ;PostnCre + mice [72, 74-76].

Trigeminal nerve was collected from all 4 genotypes to verify complete loss of NF1 and/or RAC1 ( Figure 21).

Figure 21. Western Blot Analysis of Trigeminal Nerve Validating the

Absence of RAC1 and Neurofibromin in the PostnCre Mouse Model .

Validation of loss of RAC1 and neurofibromin in trigeminal nerve from PostnCre

mice.

All mice were generated on a C57BL/6J and 129SV mixed strain background.

Strain analysis indicated ~70% C57BL/6J. Mice from all 4 genotypes

(Nf1 flox/flox ;PostnCre -, Nf1 flox/flox ;PostnCre +, Nf1 flox/flox ;Rac1 flox/+;PostnCre +, and

Nf1 flox/flox ;Rac1 flox/flox ;PostnCre +) were aged for 9 months and the spinal cord and proximal nerves were harvested to quantify proximal nerve root volume and tumor number by histopathology. As anticipated, multiple large plexiform neurofibromas were observed in Nf1 flox/flox ;PostnCre + mice with 100% penetrance. Average proximal nerve root volume in PostnCre- mice at 9 months of age was 0.52 ± 0.045 mm3 compared to

Nf1 flox/flox ;PostnCre + 1.34 ± 0.186 mm3 ( Figure 22). Furthermore, proximal nerve root volume in Nf1 flox/flox ;Rac1 flox/flox ;PostnCre + mice at 9 months of age was 0.67 ± 0.058 mm3 compared to Nf1 flox/flox ;PostnCre + 1.34 ± 0.186 mm3 ( Figure 22). The average

proximal nerve root volume in Nf1 flox/flox ;Rac1 flox/flox ;PostnCre + mice at 9 months of age was similar to PostnCre- (ns, Figure 22).

Figure 22. Proximal nerve root volume in 8-9 month old Nf1 flox/flox ;PostnCre -,

Nf1 flox/flox ;PostnCre +, Nf1 flox/flox ;Rac1 flox/+ ;PostnCre +, and

Nf1 flox/flox ;Rac1 flox/flox ;PostnCre + mice. Nerve size between Nf1 flox/flox ;PostnCre -

and Nf1 flox/flox ;PostnCre + was significantly decreased (****p<0.0001). Nerve size

between Nf1 flox/flox ;Rac1 flox/flox ;PostnCre + and Nf1 flox/flox ;PostnCre + was also

significantly reduced (**** p<0.0001). There was no significant difference

between Nf1 flox/flox ;PostnCre - and Nf1 flox/flox ;Rac1 flox/flox ;PostnCre +.

Strikingly, no tumors were observed in the Nf1 flox/flox; Rac1 flox/flox ;PostnCre + group compared to the Nf1 flox/flox;PostnCre + mice that averaged 20 PN per mouse ( Figure 23).

Nf1 flox/flox ;Rac1 flox/flox ;PostnCre + mice had a smaller body size with decreased mobility observed in 30% of the mice which has been previously reported due to impaired nerve myelination caused by genetic ablation of Rac1 [55]. Heterozygous loss of Rac1 was insufficient to significantly decrease proximal nerve root volume or tumor number compared to Nf1 flox/flox;PostnCre + mice.

Figure 23. Plexiform neurofibroma tumors were identified by

histopathological examination of nerve tissues micro-dissected from 8-9

month old Nf1 flox/flox ;PostnCre -, Nf1 flox/flox ;PostnCre +,

Nf1 flox/flox ;Rac1 flox/+ ;PostnCre +, and Nf1 flox/flox ;Rac1 flox/flox ;PostnCre + mice.

Zero tumors were observed in both the Nf1 flox/flox ;PostnCre - and

Nf1 flox/flox ;Rac1 flox/flox ;PostnCre + cohorts. Nf1 flox/flox ;PostnCre + tumor number was

significantly different to both the Nf1 flox/flox ;PostnCre - and

Nf1 flox/flox ;Rac1 flox/flox ;PostnCre + (****p<0.0001 between each pair). No

difference was observed between Nf1 flox/flox ;PostnCre - and

Nf1 flox/flox ;Rac1 flox/flox ;PostnCre +.

Evaluation of hematoxylin and eosin (H&E) stained nerve sections further revealed stark differences in nerve architecture between mouse genotypes. In comparison to Nf1 flox/flox ;PostnCre + nerves which were disrupted and hyperplastic,

Nf1 flox/flox ;Rac1 flox/flox ;PostnCre + mice demonstrated reduced cellularity and linear arrangement of Schwann cells similar to Nf1 flox/flox ;PostnCre - controls ( Figure 24).

Additionally, Masson’s Trichrome staining of Nf1 flox/flox ;PostnCre + nerves showed large collagen deposits (another hallmark feature of PN) which were not present in

Nf1 flox/flox ;PostnCre - or Nf1 flox/flox ;Rac1 flox/flox ;PostnCre + tissues ( Figure 24). The

Nf1 flox/flox ;Rac1 flox/+ ;PostnCre + nerve sections had increased cellularity with collagen deposits similar to the Nf1 flox/flox ;PostnCre + nerves. Collectively, these findings demonstrate a genetic requirement for RAC1 in plexiform neurofibroma tumor formation in vivo.

Figure 24. Representative Stained Sections of the Proximal Nerve Trees. Changes in nerve microarchitecture

observed with H&E stained sections between the four genotypes of mice ( Nf1 flox/flox ;PostnCre -, Nf1 flox/flox ;PostnCre +,

Nf1 flox/flox ;Rac1 flox/+ ;PostnCre +, and Nf1 flox/flox ;Rac1 flox/flox ;PostnCre +). Masson’s Trichrome stained sections show

extracellular matrix collagen. Scale bars are 200µm.

DISCUSSION

A combined kinome and Rho GTPase shRNA screen identified RAC1 as a novel target to ameliorate plexiform neurofibromas. Genetic disruption of RAC1 (Rac1 ) abrogated RAS mediated cellular and biochemical gain-in-functions in human and murine Schwann cells harboring loss of the NF1 tumor suppressor gene in NF1 -/-(Nf1 -/-).

Here, I show that biallelic loss of Rac1 in neural crest derived cells completely prevented

PN tumorigenesis in Nf1 flox/flox ;PostnCre + mice.

Nearly 30% of all human cancers contain RAS activating mutations [77]. These mutations either reduce extrinsically the ability of the GAP to hydrolyze GTP to GDP or reduce the intrinsic rate of GTP hydrolysis leading to increased RAS activation, pro- survival, and growth signaling. Unlike oncogenic RAS mutations, patients with NF1 have normal RAS but are missing neurofibromin leading to RAS hyperactivation.

Mechanism-based therapies to directly target core components of the RAS-GAP molecular switch have been exceedingly difficult to develop [22, 78]. GTP is abundant in cells and RAS binds guanine nucleotides with very high affinity [78]. Thus, inhibition of RAS GTP binding would require compounds with very high binding affinities, well above those of other FDA-approved small molecule inhibitors. Alternative approaches to enhance GTP hydrolysis have also proved challenging due to the structurally constrained interface between the phosphate-binding (P) loop of RAS and GAPs [28, 77]. Thus, therapeutic strategies targeting downstream RAS effectors hold promise in the treatment of NF1 and other RAS driven cancers.

Novel kinase-targeting drug candidates have shown recent success in ameliorating the growth of PN in patients including MAPK kinase (MEK; selumetinib [79]) and ABL,

c-kit, and PDGF-R (Imatinib Mesylate [54]). Even with these successes, a significant subset of patients do not respond to existing therapies. Moreover, no complete responses have been observed to date and tumors often regrow when drug therapy is discontinued.

Thus, additional pharmacotherapies are needed to improve treatment outcomes for NF1 patients with PN.

Rho family GTPases have complex regulation and redundancy in signaling pathways given their many essential roles in coordinating cellular functions.

Additionally, multiple GEFs and GAPS are recognized to spatiotemporally modulate Rho

GTPase signaling [80]. RAC1 is a key node downstream of RAS with crosstalk observed in RAS-RAF-MEK-ERK and AKT signaling. Hyperactivation of RAC1 has been reported in human cancers through a variety of mechanisms, including mutation of RAC1 itself, impaired degradation of RAC1, and increased activation of upstream effectors [81,

82].

Pharmacological strategies to inhibit RAC1 have focused predominantly on disrupting RAC1/GEF interactions. This has been challenging as RAC1, like RAS, has a small binding pocket [66]. A widely used RAC1 specific inhibitor NSC23766, reduced pERK1/2 in a breast cancer cell line in vitro [83]. Unfortunately, these effects were only achieved using high millimolar concentrations of NSC23766. Presently, a RAC1 targeted therapeutic is not clinically available [66]. In part, therapeutic development has been hindered due to few in vivo models available to investigate Rho GTPase-dependent pathways [44].

Genetically engineered mouse models have proven tremendously valuable in elucidating mechanisms of NF1 disease pathogenesis and evaluating novel treatments

[16; 84-88]. Tissue specific models driven by Cre-Lox recombination have been essential for overcoming the embryonic lethality associated with germline, biallelic Nf1 loss due to abnormal cardiac development by E13.5 (embryonic day 13.5) [71, 72, 74,

89]. Similarly, Rac1 is ubiquitously expressed and essential for early embryonic development, leading to lethality by E8 [75]. Recently, an elegant study by Chen et al., identified the PN cell of origin in the nerve roots of E13.5 embryos [16]. Here, I generated mice harboring conditional biallelic inactivation of Nf1 and Rac1

(Nf1 flox/flox Rac1 flox/flox ;PostnCre+ ) in neural crest Schwann cell precursors driven at E10 by PostnCre [72]. Nf1 flox/flox ;PostnCre+ mice develop multiple PN with 100% penetrance by 6 months of life [74]. In the present study, all cohorts were evaluated at 9 months of life, suggesting a total absence of PN in Nf1 flox/flox Rac1 flox/flox ;PostnCre+ mice rather than merely a delay in in tumor formation.

I questioned whether there may be a cell extrinsic effect of Rac1 ablation on disrupting paracrine signaling between the tumorigenic Schwann cells and lineages in the microenvironment. Prior work has shown a key role of cytokines in the recruitment of tumor promoting immune cells into the PN microenvironment [90, 91]. I quantified 30 growth factors in conditioned media, including SCF which via its receptor c-kit is key to tumor initiation [15]. I found that the additional disruption of Rac1 did not alter growth factor secretion compared to disruption of Nf1 alone. Many insulin related growth factors were increased which has been previously reported [92]. Both plexiform neurofibromas and malignant peripheral nerve sheath tumors stain positive for the insulin growth factor receptor (IGF-R) indicating that regardless of malignancy status they can respond to IGF

[92]. Furthermore, insulin related growth factors have been implicated in the

development and progression of many cancers. IGF-1R is additionally interesting due to its role in tissue growth through growth hormone signaling. NF1 patients have profound increases in comorbidities during times of amplified growth hormone expression including adolescence and pregnancy.

Experimental data in genetically engineered murine models and in human plexiform neurofibroma provide strong genetic and pharmacologic evidence that inhibition of MEK-ERK signals is sufficient to attenuate tumor growth [68-70, 73, 79].

My data shows a parallel impact on plexiform neurofibroma tumorigenesis with genetic disruption of Rac1 as well. RAC1 is known to have multiple functions that can promote tumorigenesis including proliferation, migration, tissue invasion, and epithelial mesenchymal transition [41, 42, 58, 82, 83, 93, 94]. I show here that genetic disruption of RAC1 (Rac1 ) in NF1 -/- (Nf1 -/-) Schwann cells strongly modulates proliferation and pERK signaling. However, additional ERK independent roles of RAC1 that modulate

PN development and progression provides the rationale for further development of targeted RAC1 inhibitors.

APPENDIX A

D1 D2 D3 C1 (05.5 C2 (05.5 C3 (05.5 (05.5 (05.5 (05.5 Clone ID Corrected) Corrected) Corrected) Null) Null) Null) Symbol TRCN0000000259 0 0 0 6 0 68 PDK3 TRCN0000000260 752 1956 2116 874 1846 2305 PDK3 TRCN0000000261 304 339 330 210 355 567 PDK3 TRCN0000000262 57 2 39 75 153 98 PDK3 TRCN0000000354 34 14 40 22 83 117 ACVRL1 TRCN0000000355 33 31 62 100 151 337 ACVRL1 TRCN0000000356 0 81 42 18 47 131 ACVRL1 TRCN0000000357 0 0 0 8 0 0 ACVRL1 TRCN0000000358 0 0 0 0 0 0 BTK TRCN0000000359 306 450 485 697 1054 3291 BTK TRCN0000000360 796 610 1817 645 1351 2817 BTK TRCN0000000361 30 0 35 31 6 21 BTK TRCN0000000362 0 0 0 0 0 0 CDK4 TRCN0000000363 677 2102 694 1548 994 2056 CDK4 TRCN0000000364 45 279 43 93 217 6 CDK4 TRCN0000000365 404 773 283 165 62 919 CDK4 TRCN0000000366 2 442 919 114 223 536 FGFR2 TRCN0000000367 110 527 275 393 473 1000 FGFR2 TRCN0000000368 1724 1150 804 2041 1839 4637 FGFR2 TRCN0000000369 1202 2571 3706 2048 3572 2515 FGFR2 TRCN0000000370 193 126 401 95 335 396 FGFR2 TRCN0000000371 0 53 69 54 77 550 FGFR3 TRCN0000000372 0 0 0 0 0 2 FGFR3 TRCN0000000373 1072 810 503 863 793 1324 FGFR3 TRCN0000000374 666 217 465 2044 3161 3204 FGFR3 TRCN0000000379 356 388 343 55 28 270 INSR TRCN0000000380 0 0 0 0 0 151 INSR TRCN0000000381 0 5 97 37 182 0 INSR TRCN0000000382 1 0 84 59 0 92 INSR TRCN0000000383 6 539 96 867 599 463 JAK3 TRCN0000000384 106 480 300 106 136 124 JAK3 TRCN0000000385 71 1 40 18 4 5 JAK3 TRCN0000000386 207 2 44 31 141 570 JAK3 TRCN0000000387 15 1 22 25 51 63 JAK3 TRCN0000000388 1270 1937 1515 2376 2499 2774 KIT TRCN0000000389 0 5 27 28 9 79 KIT TRCN0000000390 14 0 13 0 26 0 KIT TRCN0000000391 1 0 1 0 3 0 KIT

TRCN0000000392 8 10 18 26 0 13 KIT TRCN0000000393 1066 805 1471 1294 431 2430 MET TRCN0000000395 202 486 470 256 143 537 MET TRCN0000000396 7943 17238 10562 12319 18686 24722 MET TRCN0000000397 2025 1859 2499 1768 991 2981 MET TRCN0000000398 513 889 1150 1827 2317 3013 PHKG2 TRCN0000000399 36 3 114 221 324 487 PHKG2 TRCN0000000400 17 0 23 0 1 10 PHKG2 TRCN0000000401 71 151 172 48 30 152 PHKG2 TRCN0000000402 7 364 15598 9 65 28 RET TRCN0000000403 2974 216 675 102 146 801 RET TRCN0000000404 0 0 57 398 285 459 RET TRCN0000000405 0 0 0 79 1 38 RET TRCN0000000406 2 0 0 0 0 0 RET TRCN0000000407 28 28 1 26 70 45 STK11 TRCN0000000408 242 382 459 160 357 357 STK11 TRCN0000000409 101 42 64 126 192 312 STK11 TRCN0000000410 500 449 320 327 389 519 STK11 TRCN0000000411 282 371 684 212 518 1300 STK11 TRCN0000000412 14 3 20 6 70 104 TEK TRCN0000000413 6 0 2 260 87 282 TEK TRCN0000000414 208 776 1141 769 636 951 TEK TRCN0000000415 8 285 150 818 234 1242 TEK TRCN0000000416 5 140 35 306 316 586 TEK TRCN0000000417 0 44 0 0 0 111 FGFR1 TRCN0000000418 1 14 0 23 0 0 FGFR1 TRCN0000000419 9 4 2 46 6 72 FGFR1 TRCN0000000420 1049 1060 1043 349 1176 977 FGFR1 TRCN0000000421 0 0 0 0 0 0 FGFR1 TRCN0000000422 2870 4344 3398 2717 2814 7305 IGF1R TRCN0000000423 0 45 0 72 379 387 IGF1R TRCN0000000424 4 1306 730 1590 1484 2356 IGF1R TRCN0000000425 1 1 114 15 24 20 IGF1R TRCN0000000426 35 117 352 443 560 636 IGF1R TRCN0000000427 80 0 42 200 95 45 NPR2 TRCN0000000428 43 49 25 48 99 83 NPR2 TRCN0000000429 35 263 213 263 216 390 NPR2 TRCN0000000430 0 0 0 0 0 0 NPR2 TRCN0000000436 0 0 6 9 9 27 ZAP70 TRCN0000000437 3 0 6 5 1 25 ZAP70 TRCN0000000438 258 364 0 1 268 18 ZAP70

TRCN0000000439 4602 2560 1855 2182 3205 4403 ZAP70 TRCN0000000440 137 2 38 73 194 310 ZAP70 TRCN0000000441 0 0 0 0 0 0 ACVR1 TRCN0000000442 311 1 0 0 0 2 ACVR1 TRCN0000000443 1 0 161 43 121 204 ACVR1 TRCN0000000444 2 147 270 288 264 235 ACVR1 TRCN0000000445 3 158 149 467 862 618 ACVR1 TRCN0000000446 360 593 586 32 148 248 ACVR2B TRCN0000000447 1 67 148 105 134 109 ACVR2B TRCN0000000448 60 0 29 0 0 0 ACVR2B TRCN0000000449 0 0 0 0 0 0 ACVR2B TRCN0000000450 158 99 76 3329 4889 7197 ACVR2B TRCN0000000451 897 714 302 545 620 962 BMPR1B TRCN0000000452 0 0 57 0 0 212 BMPR1B TRCN0000000453 133 706 738 397 954 2434 BMPR1B TRCN0000000454 0 0 0 106 150 246 BMPR1B TRCN0000000455 0 16 0 2 32 57 BMPR1B TRCN0000000456 0 64 21 41 0 208 BMPR2 TRCN0000000457 0 0 17 0 8 0 BMPR2 TRCN0000000458 202 50 288 227 275 509 BMPR2 TRCN0000000459 0 0 5 0 0 0 BMPR2 TRCN0000000460 338 244 259 38 0 0 BMPR2 TRCN0000000461 0 0 0 135 172 14 BUB1B TRCN0000000462 26 344 118 114 216 577 BUB1B TRCN0000000463 0 0 2 274 408 434 BUB1B TRCN0000000464 0 116 14 119 59 116 BUB1B TRCN0000000465 319 0 113 20 127 74 BUB1B TRCN0000000466 240 703 1401 423 763 540 CAMK2B TRCN0000000467 52 39 109 312 384 889 CAMK2B TRCN0000000468 226 5014 3927 433 115 1285 CAMK2B TRCN0000000469 2094 1197 1978 1830 2187 4323 CAMK2B TRCN0000000470 1 87 189 202 196 669 CAMK2B TRCN0000000471 7 4 248 20 272 16 CAMK2D TRCN0000000472 426 578 719 1381 3049 1972 CAMK2D TRCN0000000473 1169 11 482 18 1325 806 CAMK2D TRCN0000000474 2 3 145 817 181 680 CAMK2D TRCN0000000475 0 0 0 0 0 0 CAMK2D TRCN0000000476 0 0 0 0 36 0 CAMK2G TRCN0000000477 0 0 0 0 0 0 CAMK2G TRCN0000000478 2 0 41 1 0 0 CAMK2G TRCN0000000479 192 626 393 176 132 275 CAMK2G

TRCN0000000480 0 0 0 0 0 0 CAMK2G TRCN0000000481 0 0 0 0 0 0 CDK3 TRCN0000000482 250 241 316 512 410 698 CDK3 TRCN0000000483 2 3 1 83 50 157 CDK3 TRCN0000000484 0 0 0 26 4 153 CDK3 TRCN0000000485 100 0 1 0 77 61 CDK6 TRCN0000000486 0 0 226 0 11 151 CDK6 TRCN0000000487 550 188 585 1319 2035 3007 CDK6 TRCN0000000488 1480 340 1080 1273 902 1725 CDK6 TRCN0000000489 0 0 38 0 75 12 CDK8 TRCN0000000490 1 0 19 0 9 24 CDK8 TRCN0000000491 35 284 235 420 1 121 CDK8 TRCN0000000492 144 641 1126 753 2277 1542 CDK8 TRCN0000000493 2 0 0 0 0 0 CDK8 TRCN0000000494 0 0 0 0 0 18 CDK9 TRCN0000000495 2 0 1 0 0 0 CDK9 TRCN0000000496 0 1 0 0 0 0 CDK9 TRCN0000000497 4 342 0 134 102 550 CDK9 TRCN0000000498 16 276 148 41 89 254 CDK9 TRCN0000000499 5766 6053 5120 4637 7599 9122 CHEK1 TRCN0000000500 67 131 383 247 369 330 CHEK1 TRCN0000000501 761 1815 2071 6341 2264 2055 CHEK1 TRCN0000000502 61 136 3 186 0 1 CHEK1 TRCN0000000503 432 633 873 2316 2707 3293 CHEK1 TRCN0000000504 758 969 1392 464 510 724 CHUK TRCN0000000505 7 158 357 1599 2039 2420 CHUK TRCN0000000506 0 0 40 8 151 0 CHUK TRCN0000000507 369 826 1118 1011 999 3153 CHUK TRCN0000000508 66 10 43 26 56 116 CHUK TRCN0000000509 372 1018 660 1289 1433 1687 MAPK14 TRCN0000000510 218 1464 1210 1316 2878 2674 MAPK14 TRCN0000000511 238 965 2497 901 2310 3205 MAPK14 TRCN0000000512 73 145 115 53 228 195 MAPK14 TRCN0000000513 2 85 0 0 71 8 MAPK14 TRCN0000000519 0 0 6 0 0 0 DAPK3 TRCN0000000520 132 9 79 89 177 214 DAPK3 TRCN0000000521 909 143 937 572 1023 1833 DAPK3 TRCN0000000522 2 0 0 55 79 134 DAPK3 TRCN0000000523 1101 2005 601 783 891 773 DYRK1A TRCN0000000524 216 223 57 349 187 479 DYRK1A TRCN0000000525 700 1331 2236 1276 948 1580 DYRK1A

TRCN0000000526 0 82 64 40 48 126 DYRK1A TRCN0000000527 3246 4545 5521 3212 5491 6864 DYRK1A TRCN0000000528 2 23 32 68 81 2916 ERN1 TRCN0000000529 123 359 263 485 492 1028 ERN1 TRCN0000000530 1 2 44 128 461 404 ERN1 TRCN0000000531 2 199 198 287 13 264 ERN1 TRCN0000000532 1 333 99 295 316 315 ERN1 TRCN0000000543 177 550 604 973 916 1117 IRAK1 TRCN0000000544 0 0 0 0 14 0 IRAK1 TRCN0000000545 1 0 84 0 12 31 IRAK1 TRCN0000000546 55 50 55 87 195 247 IRAK1 TRCN0000000547 5 71 73 227 762 1077 IRAK1 TRCN0000000548 504 4181 1646 795 697 735 IRAK2 TRCN0000000549 0 1 2 53 237 0 IRAK2 TRCN0000000550 242 118 0 62 55 309 IRAK2 TRCN0000000551 32 44 79 75 127 35 IRAK2 TRCN0000000552 1031 1968 5445 4335 8516 5732 ACVR2A TRCN0000000553 0 263 4 167 2 381 ACVR2A TRCN0000000554 4 414 306 735 735 3067 ACVR2A TRCN0000000555 1294 2670 2648 2862 3019 5256 ACVR2A TRCN0000000556 3 0 76 205 225 181 ACVR2A TRCN0000000557 40 883 344 791 1428 2680 ADRBK1 TRCN0000000558 1 74 344 49 78 338 ADRBK1 TRCN0000000559 0 0 0 14 146 277 ADRBK1 TRCN0000000560 0 0 0 53 0 0 ADRBK1 TRCN0000000561 17 41 18 33 82 67 ADRBK1 TRCN0000000562 326 134 223 211 243 308 AKT2 TRCN0000000563 1652 1982 1505 2053 2684 4608 AKT2 TRCN0000000564 978 1159 967 1440 1412 3379 AKT2 TRCN0000000565 0 0 1 7 24 65 AKT2 TRCN0000000566 1327 527 751 828 1261 4142 AKT2 TRCN0000000567 255 298 258 367 550 330 ARAF TRCN0000000568 2 0 2 14 0 114 ARAF TRCN0000000569 582 3194 1478 470 705 1458 ARAF TRCN0000000570 0 13 57 56 54 79 ARAF TRCN0000000571 1 149 265 0 27 198 ARAF TRCN0000000572 555 555 441 518 960 1997 AXL TRCN0000000573 1 0 4 6 11 24 AXL TRCN0000000574 271 626 51 772 6354 3310 AXL TRCN0000000575 2 249 1 306 1095 783 AXL TRCN0000000576 0 21 12 8 11 6 AXL

TRCN0000000577 0 0 0 0 0 0 CAMK4 TRCN0000000578 0 0 0 0 0 6 CAMK4 TRCN0000000579 790 319 548 528 638 1082 CAMK4 TRCN0000000580 0 0 0 0 0 0 CAMK4 TRCN0000000581 74 91 46 61 195 193 CAMK4 TRCN0000000582 170 250 292 583 1018 844 CDK1 TRCN0000000583 683 838 357 2215 3658 4852 CDK1 TRCN0000000584 113 47 166 183 454 407 CDK1 TRCN0000000585 0 0 6 5 0 15 CDK1 TRCN0000000586 631 61 269 0 314 272 CDK1 TRCN0000000587 0 0 1 0 3 0 CDK2 TRCN0000000588 1 59 69 66 51 237 CDK2 TRCN0000000589 0 5 20 10 76 70 CDK2 TRCN0000000590 117 9 66 46 351 296 CDK2 TRCN0000000591 35 69 36 415 827 1031 CDK2 TRCN0000000592 0 3 63 0 0 108 CDK7 TRCN0000000593 1 0 105 34 0 65 CDK7 TRCN0000000594 616 382 504 338 920 595 CDK7 TRCN0000000595 102 142 134 35 4 39 CDK7 TRCN0000000596 78 6 121 451 148 198 CDK7 TRCN0000000597 33 59 25 54 127 98 CSNK1D TRCN0000000598 334 335 398 277 1086 394 CSNK1D TRCN0000000599 414 1382 1094 560 1534 1805 CSNK1D TRCN0000000600 1134 888 1311 561 1019 587 CSNK1D TRCN0000000601 41 183 107 326 250 729 CSNK1D TRCN0000000602 417 808 1089 507 423 332 CSNK1E TRCN0000000603 745 1482 757 753 914 1113 CSNK1E TRCN0000000604 40 70 69 50 9414 72 CSNK1E TRCN0000000605 0 0 0 89 38 0 CSNK1E TRCN0000000606 3 424 357 382 663 705 CSNK2A1 TRCN0000000607 54 349 3 827 331 637 CSNK2A1 TRCN0000000608 2170 1344 2042 1985 2675 4003 CSNK2A1 TRCN0000000609 409 653 792 429 581 1303 CSNK2A1 TRCN0000000610 680 1148 2087 2163 1051 1681 CSNK2A1 TRCN0000000611 35 50 23 81 131 124 CSNK2A2 TRCN0000000612 0 0 19 0 0 0 CSNK2A2 TRCN0000000613 0 2 6 0 0 1 CSNK2A2 TRCN0000000614 0 180 3 0 0 0 CSNK2A2 TRCN0000000615 0 0 0 8 0 44 CSNK2A2 TRCN0000000616 2 330 91 238 688 281 DDR1 TRCN0000000617 0 0 0 276 327 360 DDR1

TRCN0000000618 0 0 0 2 0 0 DDR1 TRCN0000000619 0 0 108 1 0 0 ERBB3 TRCN0000000620 0 0 0 0 0 0 ERBB3 TRCN0000000621 0 0 0 0 0 280 ERBB3 TRCN0000000622 0 0 0 0 0 0 ERBB3 TRCN0000000623 20 0 42 80 112 223 ERBB3 TRCN0000000624 0 0 0 0 12 0 FES TRCN0000000625 1 0 0 49 0 223 FES TRCN0000000626 4 42 263 1351 1368 2108 FES TRCN0000000627 1 0 24 81 132 215 FES TRCN0000000628 10 0 6 6 10 19 FGFR4 TRCN0000000629 3 4 0 59 92 3 FGFR4 TRCN0000000630 0 0 0 117 247 0 FGFR4 TRCN0000000631 0 48 0 120 68 95 FLT1 TRCN0000000632 353 75 78 1749 1738 3108 FLT1 TRCN0000000633 0 2 3 0 16 9 FLT1 TRCN0000000634 4 26 22 26 98 77 FLT1 TRCN0000000635 0 0 0 20 0 55 FLT1 TRCN0000000636 96 84 105 25 5 408 FLT4 TRCN0000000637 97 59 116 9 7 27 FLT4 TRCN0000000638 0 0 47 250 312 649 FLT4 TRCN0000000639 26 45 17 68 61 121 FLT4 TRCN0000000640 0 173 0 15 0 0 FLT4 TRCN0000000641 227 941 426 238 284 357 STK24 TRCN0000000642 377 380 266 263 439 917 STK24 TRCN0000000643 0 0 0 0 0 28 STK24 TRCN0000000644 227 66 156 2 81 107 STK24 TRCN0000000645 54 40 14 54 24 6 STK24 TRCN0000000646 350 245 97 6 103 202 DYRK3 TRCN0000000647 14636 61 42 60 2 2 DYRK3 TRCN0000000648 6 231 38 636 1284 857 DYRK3 TRCN0000000649 12 21 40 32 63 107 DYRK3 TRCN0000000650 81 178 24 119 180 260 DYRK2 TRCN0000000651 0 0 0 0 0 0 DYRK2 TRCN0000000652 31 162 101 214 182 221 DYRK2 TRCN0000000653 0 0 0 0 0 2 DYRK2 TRCN0000000654 253 123 311 896 1255 952 DYRK2 TRCN0000000655 0 0 0 0 151 232 AURKA TRCN0000000656 0 0 0 0 0 0 AURKA TRCN0000000657 46 0 13 5 0 0 AURKA TRCN0000000658 0 0 1 0 0 0 AURKA

TRCN0000000659 41 233 280 96 32 348 CDC42BPA TRCN0000000660 208 371 429 101 325 103 CDC42BPA TRCN0000000661 209 187 33 265 347 686 CDC42BPA TRCN0000000662 1224 1370 285 839 982 1866 CDC42BPA TRCN0000000663 3 234 6818 157 100 136 CDC42BPA TRCN0000000664 0 0 0 0 0 0 MAP4K3 TRCN0000000665 0 0 0 0 0 0 MAP4K3 TRCN0000000666 312 651 370 239 257 126 MAP4K3 TRCN0000000667 503 809 479 0 0 0 MAP4K3 TRCN0000000676 1 101 0 0 0 6 CAMK1 TRCN0000000677 53 13 3 11 15 20 CAMK1 TRCN0000000678 0 0 6 0 0 0 CAMK1 TRCN0000000679 0 0 0 0 59 0 CAMK1 TRCN0000000680 1 231 156 252 542 257 MAPKAPK5 TRCN0000000681 0 25 49 2 0 0 MAPKAPK5 TRCN0000000682 0 0 0 0 0 83 MAPKAPK5 TRCN0000000683 0 0 0 0 0 0 MAPKAPK5 TRCN0000000684 0 8 22 49 0 36 MAPKAPK5 TRCN0000000685 328 661 248 264 556 932 CDK10 TRCN0000000686 692 1213 430 555 1095 371 CDK10 TRCN0000000687 74 85 244 95 160 218 CDK10 TRCN0000000688 55 96 130 133 105 596 CDK10 TRCN0000000689 0 0 0 30 0 12 CDK10 TRCN0000000690 90 0 0 14 0 158 CASK TRCN0000000691 0 0 1 92 43 70 CASK TRCN0000000692 0 0 0 79 220 235 CASK TRCN0000000693 179 363 546 393 185 320 CASK TRCN0000000694 1749 511 1839 1602 2745 2911 CASK TRCN0000000695 0 0 0 21 15 9 STK16 TRCN0000000696 0 51 6 2 24 70 STK16 TRCN0000000697 0 0 0 0 16 0 STK16 TRCN0000000698 4 522 259 358 410 892 STK16 TRCN0000000699 55 0 38 33 0 20 STK16 TRCN0000000700 8 265 943 475 204 620 CDK13 TRCN0000000701 10 1648 760 1006 1212 2516 CDK13 TRCN0000000702 0 20 15 95 58 110 CDK13 TRCN0000000703 798 462 258 687 551 669 CDK13 TRCN0000000704 70 335 106 163 1 294 CDK13 TRCN0000000705 1 0 0 0 0 0 RIPK1 TRCN0000000706 78 279 260 214 118 50 RIPK1 TRCN0000000707 0 18 38 8 0 0 RIPK1

TRCN0000000708 0 189 0 0 21 84 RIPK1 TRCN0000000709 0 2 0 0 899 467 RIPK1 TRCN0000000710 11 12 391 368 1387 1659 DYRK4 TRCN0000000712 0 0 0 10 0 83 DYRK4 TRCN0000000713 102 169 70 20 84 148 DYRK4 TRCN0000000719 0 114 0 30 0 52 PRPF4B TRCN0000000720 163 5 236 50 186 367 PRPF4B TRCN0000000721 0 0 0 125 149 418 PRPF4B TRCN0000000722 0 236 83 79 0 11 PRPF4B TRCN0000000723 0 47 84 11 0 0 PRPF4B TRCN0000000724 0 28 43 0 42 0 CDKL2 TRCN0000000725 0 87 91 39 2 29 CDKL2 TRCN0000000726 0 0 0 178 2 41 CDKL2 TRCN0000000727 1 162 114 250 2 0 CDKL2 TRCN0000000728 2 59 11 35 9 16 CDKL2 TRCN0000000729 27 51 175 75 88 0 RPS6KB2 TRCN0000000730 0 0 0 0 0 0 RPS6KB2 TRCN0000000731 1 1 0 164 198 696 MAP3K14 TRCN0000000732 63 75 23 0 0 157 MAP3K14 TRCN0000000733 381 681 1004 44 5 457 MAP3K14 TRCN0000000734 388 1 243 273 174 871 MAP3K14 TRCN0000000735 5 333 704 720 845 1318 BRSK2 TRCN0000000736 1339 3771 3652 145 711 821 BRSK2 TRCN0000000737 12 0 41 0 12 12 BRSK2 TRCN0000000738 0 0 0 166 65 322 BRSK2 TRCN0000000739 33 0 0 30 53 85 BRSK2 TRCN0000000740 26 9 2 3 4 27 TNK1 TRCN0000000741 0 0 0 0 0 0 TNK1 TRCN0000000742 0 0 0 0 0 0 TNK1 TRCN0000000743 1 0 40 49 93 104 TNK1 TRCN0000000744 2 297 270 238 102 332 TNK1 TRCN0000000745 5 510 216 243 342 904 CLK3 TRCN0000000746 1 36 10 35 65 35 CLK3 TRCN0000000747 0 0 1 203 0 461 CLK3 TRCN0000000748 2 315 310 355 8 102 CLK3 TRCN0000000749 627 1085 1166 527 788 815 CLK3 TRCN0000000750 104 166 336 118 0 62 CLK2 TRCN0000000751 12 0 0 45 105 496 CLK2 TRCN0000000752 0 1 103 0 0 146 CLK2 TRCN0000000753 0 11 0 0 0 0 CLK2 TRCN0000000754 4 284 139 531 0 175 CLK1

TRCN0000000755 6 2118 752 101 2 952 CLK1 TRCN0000000756 21 91 39 51 99 109 CLK1 TRCN0000000757 1 6 366 94 80 1452 CLK1 TRCN0000000758 3 2 62 0 61 150 CLK1 TRCN0000000759 171 583 300 492 631 858 PLK3 TRCN0000000760 0 0 0 0 0 0 PLK3 TRCN0000000761 0 0 2 0 0 12 PLK3 TRCN0000000762 0 2 40 34 30 36 PLK3 TRCN0000000763 0 67 16 14 35 203 PLK3 TRCN0000000769 95 110 56 214 408 344 PTK2B TRCN0000000770 1414 769 1495 1086 1548 2321 PTK2B TRCN0000000771 59 0 0 0 0 0 PTK2B TRCN0000000772 200 113 136 180 284 281 FLT3 TRCN0000000773 276 8 1000 0 0 46 FLT3 TRCN0000000774 0 0 0 44 78 44 FLT3 TRCN0000000775 98 259 76 419 742 1194 FLT3 TRCN0000000776 0 0 0 0 0 0 AURKB TRCN0000000777 0 0 0 0 0 0 AURKB TRCN0000000778 0 0 0 0 26 0 AURKB TRCN0000000779 58 54 146 135 5654 397 AURKB TRCN0000000780 907 520 1510 605 1922 1773 STK17B TRCN0000000781 1072 630 807 535 776 1356 STK17B TRCN0000000782 0 0 0 0 88 0 STK17B TRCN0000000783 923 753 471 399 514 398 STK17B TRCN0000000784 417 0 142 477 946 958 ALK TRCN0000000785 0 15 20 18 23 47 ALK TRCN0000000786 9323 8834 7211 6224 6097 7443 ALK TRCN0000000787 341 732 579 233 626 867 ALK TRCN0000000788 1 76 0 0 63 105 ALK TRCN0000000789 673 122 1052 1260 1526 2258 BCR TRCN0000000790 528 357 0 1 1 306 BCR TRCN0000000791 84 47 42 92 224 183 BCR TRCN0000000792 0 0 29 0 0 0 BCR TRCN0000000793 62 63 47 62 51 409 BCR TRCN0000000794 157 343 280 23 201 231 BMPR1A TRCN0000000795 2 80 0 0 0 0 BMPR1A TRCN0000000796 2 145 198 606 319 366 BMPR1A TRCN0000000797 0 0 0 100 0 0 BMPR1A TRCN0000000798 229 0 0 2 35 55 BMPR1A TRCN0000000799 0 5 81 27 1 168 BUB1 TRCN0000000800 0 0 0 0 0 0 BUB1

TRCN0000000801 0 0 0 0 0 3 BUB1 TRCN0000000802 92 1697 0 104 496 340 BUB1 TRCN0000000803 177 1028 228 421 39 763 CSK TRCN0000000804 3 359 481 184 189 612 CSK TRCN0000000805 0 0 0 0 0 0 CSK TRCN0000000806 29 268 243 464 521 903 CSK TRCN0000000807 384 275 596 358 633 1240 CSK TRCN0000000808 116 58 20 22 0 14 CSNK1G3 TRCN0000000809 3 0 26 47 260 248 CSNK1G3 TRCN0000000810 0 1 15 0 11 0 CSNK1G3 TRCN0000000811 0 0 0 0 0 0 CSNK1G3 TRCN0000000813 1 14 0 0 0 44 DMPK TRCN0000000814 0 0 0 0 0 0 DMPK TRCN0000000815 2372 537 884 528 318 905 DMPK TRCN0000000816 0 77 82 3 0 30 DMPK TRCN0000000817 0 58 177 203 322 615 EPHB1 TRCN0000000818 219 755 293 497 724 1352 EPHB1 TRCN0000000819 0 0 33 1059 358 145 EPHB1 TRCN0000000820 240 64 0 90 0 1 EPHB1 TRCN0000000821 0 0 56 0 0 0 EPHB1 TRCN0000000822 1074 1708 2039 591 1281 1565 GSK3B TRCN0000000823 684 358 856 1037 1560 1393 GSK3B TRCN0000000824 2852 2728 2936 563 4557 5152 GSK3B TRCN0000000825 0 2 11 0 0 0 LIMK1 TRCN0000000826 2 27 0 141 183 202 LIMK1 TRCN0000000827 1737 2304 1970 2994 4227 4998 MAPK13 TRCN0000000828 0 0 0 167 261 459 MAPK13 TRCN0000000829 0 0 18 2 0 10 MAPK13 TRCN0000000830 1 0 9 18 39 21 TGFBR2 TRCN0000000831 9 521 592 842 1730 888 TGFBR2 TRCN0000000832 0 193 171 55 95 102 TGFBR2 TRCN0000000833 239 197 245 103 120 185 TGFBR2 TRCN0000000834 314 0 0 207 92 15 TGFBR2 TRCN0000000835 247 177 252 300 458 863 ULK1 TRCN0000000836 484 1792 673 34 655 1069 ULK1 TRCN0000000837 609 187 200 197 355 475 ULK1 TRCN0000000838 94 103 110 33 13 50 ULK1 TRCN0000000839 0 0 23 15 15 38 ULK1 TRCN0000000840 0 0 0 0 0 0 GRK5 TRCN0000000841 8 0 0 0 0 0 GRK5 TRCN0000000842 4 196 1 454 1071 997 GRK5

TRCN0000000843 1265 2420 1068 1264 2796 2863 GRK5 TRCN0000000844 0 0 0 0 0 0 PRKCE TRCN0000000845 2 40 42 114 168 52 PRKCE TRCN0000000846 2 473 345 0 59 0 PRKCE TRCN0000000847 0 0 0 0 0 0 PRKCE TRCN0000000848 159 2622 11420 9 3 9 PRKCE TRCN0000000849 16 2 53 49 1 0 MAP3K4 TRCN0000000850 0 0 40 0 21 41 MAP3K4 TRCN0000000851 5 0 2 8 18 23 MAP3K4 TRCN0000000852 82 465 145 16 53 0 MAP3K4 TRCN0000000853 20 26 29 16 40 80 CDC42BPB TRCN0000000854 0 55 63 8 0 0 CDC42BPB TRCN0000000855 120 19 0 11 110 364 CDC42BPB TRCN0000000856 0 0 0 0 0 0 CDC42BPB TRCN0000000857 0 411 216 73 423 262 PRKAA1 TRCN0000000858 212 0 0 10 103 0 PRKAA1 TRCN0000000859 404 0 0 0 0 0 PRKAA1 TRCN0000000860 5 223 321 112 196 321 PRKAA1 TRCN0000000861 0 0 21 0 0 0 PRKAA1 TRCN0000000862 0 0 0 28 0 177 MERTK TRCN0000000863 0 0 3 26 1 809 MERTK TRCN0000000864 0 0 0 0 0 0 MERTK TRCN0000000865 2 6 415 1066 639 702 MERTK TRCN0000000866 703 231 737 507 340 671 MERTK TRCN0000000867 0 8 15 0 23 8 PLK2 TRCN0000000868 0 62 65 24 44 0 PLK2 TRCN0000000869 0 0 6 15 13 0 PLK2 TRCN0000000870 0 158 81 29 99 78 PLK2 TRCN0000000871 279 2 138 393 281 289 TRIO TRCN0000000872 0 0 0 68 0 144 TRIO TRCN0000000873 37 25 31 27 41 29 TRIO TRCN0000000874 0 0 0 0 0 0 TRIO TRCN0000000875 52 61 166 97 41 155 IRAK3 TRCN0000000876 0 0 0 47 22 67 IRAK3 TRCN0000000877 102 110 488 87 93 488 IRAK3 TRCN0000000878 0 0 7 47 31 53 IRAK3 TRCN0000000879 960 606 251 405 990 1383 IRAK3 TRCN0000000880 1 139 58 9 28 63 LATS2 TRCN0000000881 109 28 134 273 76 250 LATS2 TRCN0000000882 2 34 11 73 29 167 LATS2 TRCN0000000883 0 0 0 0 0 13 LATS2

TRCN0000000884 203 290 347 555 684 1228 LATS2 TRCN0000000889 41 84 77 63 49 90 ULK2 TRCN0000000890 264 6 169 56 0 0 ULK2 TRCN0000000891 0 0 58 1 23 0 ULK2 TRCN0000000892 0 54 20 10 37 134 ULK2 TRCN0000000893 0 0 3 0 24 24 ULK2 TRCN0000000894 161 575 359 238 3394 497 SLK TRCN0000000895 90 0 0 3 34 0 SLK TRCN0000000896 207 247 291 415 82 1086 SLK TRCN0000000897 4 156 68 197 241 0 SLK TRCN0000000898 309 271 42 0 0 86 SLK TRCN0000000899 186 149 37 161 158 265 NUAK1 TRCN0000000900 17 168 128 120 474 566 NUAK1 TRCN0000000901 0 0 0 0 0 0 NUAK1 TRCN0000000902 1 121 46 23 97 62 NUAK1 TRCN0000000903 9 720 5358 3702 254 1114 NUAK1 TRCN0000000909 243 546 165 402 574 580 VRK3 TRCN0000000910 0 0 40 38 0 46 VRK3 TRCN0000000911 1 0 0 0 1 0 VRK3 TRCN0000000912 3 154 27 202 162 432 VRK3 TRCN0000000913 0 2 24 0 0 20 BMP2K TRCN0000000914 43 0 11 36 88 52 BMP2K TRCN0000000915 0 0 0 0 0 37 BMP2K TRCN0000000916 0 0 0 0 0 0 BMP2K TRCN0000000917 2 0 149 0 0 352 BMP2K TRCN0000000918 278 426 262 100 253 137 WNK1 TRCN0000000919 3 114 46 26 0 28 WNK1 TRCN0000000920 0 0 0 286 155 610 WNK1 TRCN0000000921 2 200 17 162 324 31 WNK1 TRCN0000000928 45 0 0 11 16 50 NEK9 TRCN0000000929 206 19 824 292 808 1308 NEK9 TRCN0000000930 3 1 99 118 383 1420 NEK9 TRCN0000000931 0 0 0 6 0 0 NEK9 TRCN0000000932 421 958 626 542 686 523 MYLK2 TRCN0000000933 7 0 14 8 1 36 MYLK2 TRCN0000000934 0 0 0 0 0 0 MYLK2 TRCN0000000935 0 0 0 0 5 0 MYLK TRCN0000000936 0 0 78 12 0 121 MYLK TRCN0000000937 0 0 0 0 0 0 MYLK TRCN0000000938 1 10 4 0 30 18 SRMS TRCN0000000939 0 0 0 0 0 0 SRMS

TRCN0000000940 7 131 131 133 202 433 SRMS TRCN0000000941 2 93 417 27 100 380 SRMS TRCN0000000942 4 1660 631 943 26 998 SRMS TRCN0000000943 22 1 97 17 88 74 MAPK9 TRCN0000000944 296 168 401 958 656 1618 MAPK9 TRCN0000000945 2894 4470 3862 3875 5053 8587 MAPK9 TRCN0000000947 0 0 82 45 119 140 MAPK9 TRCN0000000948 0 91 0 79 127 59 NEK2 TRCN0000000949 0 0 0 0 0 0 NEK2 TRCN0000000950 299 649 617 157 266 909 NEK2 TRCN0000000951 15 120 284 117 450 536 NEK2 TRCN0000000952 0 0 2 68 533 172 NEK2 TRCN0000000953 132 1515 1102 1018 654 1756 ROS1 TRCN0000000954 1 105 27 27 4 40 ROS1 TRCN0000000956 91 58 0 44 465 270 ROS1 TRCN0000000957 79 68 107 115 2373 9657 ROS1 TRCN0000000968 45 16 14 0 0 10 ILK TRCN0000000969 2 0 0 119 5 45 ILK TRCN0000000971 1 491 2 144 3 0 ILK TRCN0000000972 0 0 16 0 0 30 ILK TRCN0000000973 2585 5538 5914 4921 3519 4798 STK17A TRCN0000000974 2 502 538 1543 1141 2018 STK17A TRCN0000000975 6252 6867 6564 4099 5578 9843 STK17A TRCN0000000976 89 327 62 78 126 409 STK17A TRCN0000000977 207 167 249 45 40 216 ROCK2 TRCN0000000978 0 21 97 91 390 285 ROCK2 TRCN0000000979 10 10 59 1 65 89 ROCK2 TRCN0000000980 0 55 24 7 26 41 ROCK2 TRCN0000000982 0 0 0 0 95 0 DAPK1 TRCN0000000983 37 94 124 100 166 105 DAPK1 TRCN0000000984 0 37 0 28 7 2 DAPK1 TRCN0000000985 0 0 22 45 203 30 DAPK1 TRCN0000000986 0 0 0 0 0 0 GRK4 TRCN0000000987 1 424 1 75 137 21 GRK4 TRCN0000000988 0 5 377 255 298 250 GRK4 TRCN0000000989 0 307 119 88 354 822 GRK4 TRCN0000000990 44 121 0 0 0 0 GRK4 TRCN0000000991 3 0 2 53 0 0 MAP3K5 TRCN0000000993 12 0 0 0 81 0 MAP3K5 TRCN0000000994 0 0 0 24 2 0 MAP3K5 TRCN0000000995 0 0 4 13 0 8 MAP3K5

TRCN0000000996 1200 379 1543 471 1405 2039 PRKG1 TRCN0000000997 11 2 73 160 548 225 PRKG1 TRCN0000000998 359 1063 1355 987 541 939 PRKG1 TRCN0000000999 12 0 0 1 0 5 MAP3K12 TRCN0000001000 0 0 0 0 0 0 MAP3K12 TRCN0000001001 0 0 0 0 0 0 MAP3K12 TRCN0000001003 0 97 32 37 35 56 MAP3K12 TRCN0000001004 244 726 434 389 385 122 STK39 TRCN0000001005 0 0 0 0 0 0 STK39 TRCN0000001006 32 34 74 103 140 41 STK39 TRCN0000001007 0 3 160 86 48 264 STK39 TRCN0000001008 2 65 4 642 807 491 STK39 TRCN0000001012 18 35 3 12 6 60 MAPK9 TRCN0000001014 2894 4470 3862 3875 5053 8587 MAPK9 TRCN0000001015 43 161 199 428 637 1229 MAPK9 TRCN0000001016 0 0 82 45 119 140 MAPK9 TRCN0000001017 3010 4796 4732 1278 3137 3201 MAPK10 TRCN0000001018 1035 823 955 1257 1208 3028 MAPK10 TRCN0000001019 0 0 0 4 7 0 MAPK10 TRCN0000001020 53 77 76 20 37 150 MAPK10 TRCN0000001037 555 555 441 518 960 1997 AXL TRCN0000001038 1 0 4 6 11 24 AXL TRCN0000001039 271 626 51 772 6354 3310 AXL TRCN0000001040 2 249 1 306 1095 783 AXL TRCN0000001041 0 21 12 8 11 6 AXL TRCN0000001055 0 0 2 0 0 23 MAPK8 TRCN0000001056 171 540 159 405 149 168 MAPK8 TRCN0000001057 1 81 40 475 445 1604 MAPK8 TRCN0000001064 0 0 352 0 0 0 RAF1 TRCN0000001065 0 69 96 31 9 21 RAF1 TRCN0000001066 0 2 66 0 120 83 RAF1 TRCN0000001067 119 164 8 0 0 207 RAF1 TRCN0000001068 0 61 0 47 48 5 RAF1 TRCN0000001079 584 1587 1092 632 954 1437 MAP2K7 TRCN0000001080 553 686 122 1330 1485 2126 MAP2K7 TRCN0000001218 1 0 29 26 61 101 PRKCZ TRCN0000001219 0 42 0 32 30 0 PRKCZ TRCN0000001220 72 69 35 7 30 43 PRKCZ TRCN0000001221 0 0 0 5 2 87 PRKCZ TRCN0000001222 0 0 9 35 0 46 PRKCZ TRCN0000001228 0 3 128 304 1151 1563 SRPK1

TRCN0000001229 1 0 0 106 40 102 SRPK1 TRCN0000001230 1 0 46 74 49 21 SRPK1 TRCN0000001231 1 57 70 0 5 0 SRPK1 TRCN0000001232 292 61 2 85 149 591 SRPK1 TRCN0000001312 43 49 25 48 99 83 NPR2 TRCN0000001313 35 263 213 263 216 390 NPR2 TRCN0000001314 0 0 2 44 94 281 NPR2 TRCN0000001315 0 0 0 0 0 0 NPR2 TRCN0000001321 24 0 0 8 0 1 PKN3 TRCN0000001322 543 410 446 17 1 31 PKN3 TRCN0000001323 388 304 75 71 0 0 PKN3 TRCN0000001324 70 73 53 28 0 81 PKN3 TRCN0000001330 41 233 280 96 32 348 CDC42BPA TRCN0000001331 208 371 429 101 325 103 CDC42BPA TRCN0000001332 209 187 33 265 347 686 CDC42BPA TRCN0000001333 1224 1370 285 839 982 1866 CDC42BPA TRCN0000001334 3 234 6818 157 100 136 CDC42BPA TRCN0000001345 0 14 24 210 89 117 EPHA8 TRCN0000001346 55 11 13 69 48 163 EPHA8 TRCN0000001347 5 35 1 43 23 100 EPHA8 TRCN0000001348 8 0 4 40 48 16 EPHA8 TRCN0000001349 6 409 21 0 6 0 EPHA8 TRCN0000001350 0 0 0 4 0 77 CLK4 TRCN0000001351 3 0 60 284 171 70 CLK4 TRCN0000001352 294 0 167 227 0 508 CLK4 TRCN0000001353 0 0 0 0 68 90 CLK4 TRCN0000001354 0 0 1 6 145 197 MAPK7 TRCN0000001355 94 597 208 878 649 1292 MAPK7 TRCN0000001356 108 547 396 195 572 974 MAPK7 TRCN0000001362 3042 2543 4824 2583 4401 6439 SIK1 TRCN0000001363 0 0 0 1 0 1 SIK1 TRCN0000001364 0 297 144 118 374 1295 SIK1 TRCN0000001366 812 344 39 949 1071 419 SIK1 TRCN0000001367 1 1 106 62 86 115 GRK6 TRCN0000001368 0 31 97 156 99 68 GRK6 TRCN0000001369 156 128 227 400 468 375 GRK6 TRCN0000001370 33 56 3 48 45 127 PRKACA TRCN0000001371 0 6 4 3 0 5 PRKACA TRCN0000001372 41 65 81 24 21 28 PRKACA TRCN0000001373 1 63 0 0 0 0 PRKACA TRCN0000001374 141 392 104 73 83 0 MAPK4

TRCN0000001375 0 0 13 123 0 89 MAPK4 TRCN0000001376 24 2 2 0 1 18 MAPK4 TRCN0000001377 0 0 0 18 1 34 MAPK4 TRCN0000001378 280 554 429 290 144 500 MAPK4 TRCN0000001379 12 396 16390 111 229 136 EIF2AK2 TRCN0000001380 4 1 24 0 0 0 EIF2AK2 TRCN0000001381 0 0 0 0 0 23 EIF2AK2 TRCN0000001382 0 0 0 0 0 0 EIF2AK2 TRCN0000001383 4 8 409 720 1714 1251 EIF2AK2 TRCN0000001384 2 0 15 0 39 0 RPS6KA1 TRCN0000001385 1385 542 173 373 315 1182 RPS6KA1 TRCN0000001386 0 0 0 0 0 26 RPS6KA1 TRCN0000001387 623 129 173 182 121 9 RPS6KA1 TRCN0000001388 316 499 415 668 755 1053 RPS6KA1 TRCN0000001389 0 0 78 89 44 0 MAP2K4 TRCN0000001392 5 102 147 165 174 392 MAP2K4 TRCN0000001393 81 176 94 167 61 96 MAP2K4 TRCN0000001394 0 0 0 0 0 0 RPS6KA3 TRCN0000001395 142 67 106 141 134 141 RPS6KA3 TRCN0000001396 0 89 0 33 2 139 RPS6KA3 TRCN0000001397 4 0 54 143 7 1 RPS6KA3 TRCN0000001398 624 729 49 0 96 236 RPS6KA3 TRCN0000001399 2435 1903 2100 1604 1370 4131 EIF2AK3 TRCN0000001400 0 0 77 114 339 107 EIF2AK3 TRCN0000001401 3 451 5 271 654 1005 EIF2AK3 TRCN0000001402 241 161 97 0 21 49 EIF2AK3 TRCN0000001403 135 0 30 1 83 115 EIF2AK3 TRCN0000001407 834 2361 1107 4430 6221 6529 ERBB4 TRCN0000001408 0 41 0 7 141 10 ERBB4 TRCN0000001409 20885 23126 21179 23694 24214 43363 ERBB4 TRCN0000001410 2451 5669 5917 6963 6057 12403 ERBB4 TRCN0000001411 84 35 41 13 45 42 ERBB4 TRCN0000001412 674 498 274 367 262 430 PRKD3 TRCN0000001413 1521 469 511 457 464 711 PRKD3 TRCN0000001414 0 0 0 85 71 105 PRKD3 TRCN0000001415 1835 3881 519 589 441 595 PRKD3 TRCN0000001416 867 2102 1829 3736 6329 6983 PRKD3 TRCN0000001417 2 216 1 118 263 422 DDR2 TRCN0000001418 0 8 19 27 0 12 DDR2 TRCN0000001419 702 62 352 165 526 633 DDR2 TRCN0000001420 0 279 0 139 407 233 DDR2

TRCN0000001421 0 1 0 0 13 0 DDR2 TRCN0000001422 2058 2841 5346 4420 2942 4739 PDGFRA TRCN0000001423 188 174 99 0 0 54 PDGFRA TRCN0000001424 306 1477 1428 1190 163 864 PDGFRA TRCN0000001425 245 690 646 594 869 1208 PDGFRA TRCN0000001426 147 825 643 1008 819 1017 PDGFRA TRCN0000001427 0 2 336 0 8 234 TRAD TRCN0000001428 1 1 208 75 405 629 TRAD TRCN0000001429 0 42 6 58 0 32 TRAD TRCN0000001430 492 651 711 199 777 203 TRAD TRCN0000001431 862 666 283 612 1222 1472 TRAD TRCN0000001432 2 358 211 835 935 1972 TESK2 TRCN0000001433 0 140 79 204 195 444 TESK2 TRCN0000001434 5 392 251 195 453 217 TESK2 TRCN0000001435 2 229 79 206 93 257 TESK2 TRCN0000001436 1556 653 576 1029 1175 1162 TESK2 TRCN0000001442 1111 3807 987 294 715 334 PSK TRCN0000001443 777 898 1367 838 798 1781 PSK TRCN0000001444 8 152 82 130 169 236 PSK TRCN0000001445 28 123 19 80 105 133 PSK TRCN0000001446 10 1 24 4 0 1 PSK TRCN0000001452 241 897 211 835 612 2550 CAMK1G TRCN0000001453 269 50 79 42 44 34 CAMK1G TRCN0000001454 686 753 268 731 103 526 CAMK1G TRCN0000001455 0 0 0 1 0 3 CAMK1G TRCN0000001456 0 0 0 39 0 62 CAMK1G TRCN0000001466 3 171 0 75 210 233 MAP2K5 TRCN0000001467 0 15 0 2 7 7 MAP2K5 TRCN0000001468 448 511 279 87 175 473 MAP2K5 TRCN0000001469 13756 7725 16859 8105 18761 23012 MAP2K5 TRCN0000001470 316 608 174 476 878 2169 MAP2K5 TRCN0000001471 1 710 0 17 40 0 NEK3 TRCN0000001472 318 1478 795 1635 4199 3957 NEK3 TRCN0000001473 0 0 0 0 1 0 NEK3 TRCN0000001474 0 31 73 664 554 1316 NEK3 TRCN0000001475 381 0 153 143 246 48 NEK3 TRCN0000001476 4 717 0 117 116 798 PDPK1 TRCN0000001477 0 1 78 37 54 354 PDPK1 TRCN0000001478 1 138 158 161 231 576 PDPK1 TRCN0000001479 0 0 0 0 0 0 PDPK1 TRCN0000001480 0 0 4 0 3 3 PDPK1

TRCN0000001481 375 263 397 42 65 263 PKN1 TRCN0000001482 0 161 188 34 159 170 PKN1 TRCN0000001483 0 103 2 86 21 348 PKN1 TRCN0000001484 273 1242 139 597 350 2067 PKN1 TRCN0000001485 0 0 2 85 289 320 PKN1 TRCN0000001486 106 0 51 9 34 27 GRK1 TRCN0000001487 71 0 16 26 110 56 GRK1 TRCN0000001488 2414 1860 3890 5376 4126 4993 GRK1 TRCN0000001489 2 220 221 270 496 692 GRK1 TRCN0000001490 0 23 22 42 11 64 ROR2 TRCN0000001491 1 0 0 0 98 150 ROR2 TRCN0000001492 0 0 0 0 0 37 ROR2 TRCN0000001493 1334 462 598 887 474 871 ROR2 TRCN0000001494 404 18 1343 603 860 370 RPS6KA5 TRCN0000001495 0 0 20 36 75 0 RPS6KA5 TRCN0000001496 264 1 0 300 335 610 RPS6KA5 TRCN0000001497 48 163 256 62 158 133 RPS6KA5 TRCN0000001499 289 453 778 655 571 390 ABL1 TRCN0000001500 26 2 0 547 516 1070 ABL1 TRCN0000001501 797 1843 1249 1924 1586 2201 ABL1 TRCN0000001502 5 133 2 207 1019 721 ABL1 TRCN0000001507 2669 5884 8999 3817 4472 5104 PRKG2 TRCN0000001508 0 91 28 63 59 166 PRKG2 TRCN0000001509 41 2 52 351 557 676 PRKG2 TRCN0000001510 2 28 7 11 0 105 PRKG2 TRCN0000001511 186 163 270 67 217 108 PRKG2 TRCN0000001517 1 40 85 83 65 260 SGK3 TRCN0000001518 0 98 54 129 54 192 SGK3 TRCN0000001519 0 1 0 0 1 98 SGK3 TRCN0000001520 141 0 285 65 65 244 SGK3 TRCN0000001521 5 1 2 37 70 47 SGK3 TRCN0000001525 0 237 95 0 0 14 TAOK3 TRCN0000001526 2 149 136 63 252 96 TAOK3 TRCN0000001527 5 2 14 27 304 3388 TAOK3 TRCN0000001528 24 189 213 19 84 188 TAOK3 TRCN0000001529 46 44 18 176 173 602 TAOK3 TRCN0000001530 97 272 28 33 182 122 WNK3 TRCN0000001531 0 47 45 11 31 0 WNK3 TRCN0000001532 0 86 56 562 28 227 WNK3 TRCN0000001533 0 21 2 42 58 81 WNK3 TRCN0000001534 0 0 0 0 0 30 WNK3

TRCN0000001535 0 14 21 6 23 0 TRIB1 TRCN0000001536 0 0 0 7 0 0 TRIB1 TRCN0000001537 116 241 209 163 121 168 TRIB1 TRCN0000001539 50 1157 1696 2583 2460 7882 TRIB1 TRCN0000001540 10 0 3 15 3 98 SGK196 TRCN0000001541 96 292 5 768 562 962 SGK196 TRCN0000001542 2 374 0 126 475 893 SGK196 TRCN0000001543 395 409 392 81 230 148 SGK196 TRCN0000001544 0 0 31 6 4 4 SGK196 TRCN0000001550 33 59 25 54 127 98 CSNK1D TRCN0000001551 334 335 398 277 1086 394 CSNK1D TRCN0000001552 414 1382 1094 560 1534 1805 CSNK1D TRCN0000001553 1134 888 1311 561 1019 587 CSNK1D TRCN0000001554 0 0 0 0 0 21 MAP3K7 TRCN0000001555 0 1 135 25 4 43 MAP3K7 TRCN0000001556 133 3 187 104 6 35 MAP3K7 TRCN0000001557 0 0 0 0 0 59 MAP3K7 TRCN0000001558 0 2 0 12 0 7 MAP3K7 TRCN0000001564 0 70 42 217 16 1 MARK3 TRCN0000001565 0 311 131 410 752 511 MARK3 TRCN0000001566 1137 1386 1515 829 1456 1370 MARK3 TRCN0000001567 2 0 71 0 73 206 MARK3 TRCN0000001568 20 1 0 2 2 0 MAPK6 TRCN0000001569 0 311 135 20 99 20 MAPK6 TRCN0000001570 157 67 0 0 89 317 MAPK6 TRCN0000001571 354 222 221 284 69 139 MAPK6 TRCN0000001572 36 0 0 24 0 19 RYK TRCN0000001573 0 15 135 78 92 175 RYK TRCN0000001574 0 89 145 151 122 216 RYK TRCN0000001575 482 234 523 53 967 660 RYK TRCN0000001576 929 186 1184 95 286 1180 RYK TRCN0000001577 155 184 352 730 1260 1264 TXK TRCN0000001578 0 0 48 11 34 0 TXK TRCN0000001579 2076 2668 3955 1933 2583 4821 TXK TRCN0000001580 0 0 0 24 38 20 TXK TRCN0000001581 114 2 11 32 74 13 MARK2 TRCN0000001582 272 159 35 247 361 567 MARK2 TRCN0000001583 1 4 5 1 0 0 MARK2 TRCN0000001584 171 328 1117 337 650 1086 MARK2 TRCN0000001585 32 0 0 0 0 41 MARK2 TRCN0000001586 677 908 1150 4474 4449 5713 OXSR1

TRCN0000001587 3 1 61 166 403 473 OXSR1 TRCN0000001588 391 1708 1458 592 446 1688 OXSR1 TRCN0000001589 0 1 0 438 11 1136 OXSR1 TRCN0000001590 227 0 60 267 419 404 CSF1R TRCN0000001591 0 123 70 291 58 241 CSF1R TRCN0000001592 3415 9497 6533 10218 13161 21869 CSF1R TRCN0000001593 0 35 0 80 66 205 FGR TRCN0000001594 78 114 75 0 56 0 FGR TRCN0000001595 61 292 136 984 1796 1868 FGR TRCN0000001596 289 82 283 87 233 249 FGR TRCN0000001597 0 0 0 10 158 65 FGR TRCN0000001598 126 45 0 0 0 152 LCK TRCN0000001599 0 41 27 102 348 166 LCK TRCN0000001600 2 2 210 32 22 60 LCK TRCN0000001601 3 1 4 1 4 70 LCK TRCN0000001602 0 1 39 0 0 3 TIE1 TRCN0000001603 369 2 0 0 205 0 TIE1 TRCN0000001604 13 1036 465 262 784 1149 TIE1 TRCN0000001605 16 77 52 0 29 354 TIE1 TRCN0000001606 30 11 31 0 1 6 TIE1 TRCN0000001607 0 62 153 132 86 147 YES1 TRCN0000001608 407 203 220 43 103 0 YES1 TRCN0000001609 202 44 431 77 156 563 YES1 TRCN0000001610 68 19 0 481 754 1719 YES1 TRCN0000001611 2149 3420 4442 1963 3815 4893 YES1 TRCN0000001612 0 2 0 275 2 58 AKT3 TRCN0000001613 0 0 0 1 0 0 AKT3 TRCN0000001614 1 0 0 176 32 584 AKT3 TRCN0000001615 374 151 63 205 268 652 AKT3 TRCN0000001616 37 0 23 24 53 30 AKT3 TRCN0000001617 0 50 12 0 0 102 PTK2 TRCN0000001618 1 469 107 95 279 519 PTK2 TRCN0000001619 0 2 0 0 2 0 PTK2 TRCN0000001620 4 88 88 90 190 329 PTK2 TRCN0000001621 9 149 110 264 184 409 PTK2 TRCN0000001622 66 288 117 251 376 383 STK4 TRCN0000001623 101 11 25 7 4 20 STK4 TRCN0000001624 0 8 232 44 86 89 STK4 TRCN0000001625 0 0 0 0 0 0 STK4 TRCN0000001626 0 84 191 274 496 2850 STK4 TRCN0000001627 118 888 906 1144 1101 1470 PIM2

TRCN0000001628 481 684 695 812 1108 1372 PIM2 TRCN0000001629 152 9 522 328 350 771 PIM2 TRCN0000001630 465 1270 174 1375 841 1105 PIM2 TRCN0000001631 95 30 106 13 45 4 PIM2 TRCN0000001632 363 683 1154 1810 2111 3871 MAP4K1 TRCN0000001633 23 7 36 18 0 0 MAP4K1 TRCN0000001634 0 0 0 125 115 45 MAP4K1 TRCN0000001635 2 229 269 672 508 1308 MAP4K1 TRCN0000001636 3 53 18 75 27 90 MAP4K1 TRCN0000001642 4064 2301 2226 924 2261 2552 MELK TRCN0000001643 32 7 10 10 0 26 MELK TRCN0000001644 0 0 110 0 117 0 MELK TRCN0000001645 89 411 311 394 165 510 MELK TRCN0000001646 423 720 200 432 635 836 MELK TRCN0000001685 0 0 0 0 0 0 KDR TRCN0000001686 0 0 0 0 0 0 KDR TRCN0000001687 0 0 0 0 0 0 KDR TRCN0000001688 0 0 0 0 0 0 KDR TRCN0000001689 0 0 0 0 0 0 KDR TRCN0000001690 0 88 45 68 27 36 PRKCA TRCN0000001691 0 410 0 340 347 104 PRKCA TRCN0000001692 112 1 66 22 0 83 PRKCA TRCN0000001693 0 172 144 92 172 117 PRKCA TRCN0000001694 6 19 81 43 161 36 PRKCA TRCN0000001695 2 1 2 734 1489 1220 NEK4 TRCN0000001696 57 209 238 37 11 122 NEK4 TRCN0000001697 1712 2384 2426 1656 2477 1314 NEK4 TRCN0000001698 580 270 3153 717 1545 3648 NEK4 TRCN0000001699 90 1 345 152 166 302 NEK4 TRCN0000001701 0 6 640 228 309 156 WEE1 TRCN0000001702 1 43 75 81 41 104 WEE1 TRCN0000001703 2 344 2 315 1002 791 WEE1 TRCN0000001704 0 0 0 0 0 0 WEE1 TRCN0000001705 0 91 1 132 113 491 MOS TRCN0000001706 121 105 82 143 181 2652 MOS TRCN0000001707 0 6 0 0 32 32 MOS TRCN0000001708 0 259 167 43 100 228 PSKH1 TRCN0000001709 1 92 713 47 106 246 PSKH1 TRCN0000001710 114 13 23 15 171 76 PSKH1 TRCN0000001711 11 88 78 10 45 0 PSKH1 TRCN0000001712 39 135 12 88 16 144 PSKH1

TRCN0000001713 2 679 351 505 365 623 RAGE TRCN0000001714 0 259 0 0 0 0 RAGE TRCN0000001715 9 580 644 494 991 992 RAGE TRCN0000001716 1063 1059 677 859 2118 2037 RAGE TRCN0000001717 15 0 37 19 28 0 RAGE TRCN0000001718 0 0 0 0 50 25 DAPK2 TRCN0000001719 442 546 572 1953 3220 4438 DAPK2 TRCN0000001720 2258 2329 1861 3633 2148 2639 DAPK2 TRCN0000001721 247 10 146 0 75 206 DAPK2 TRCN0000001722 32 83 77 17 63 86 DAPK2 TRCN0000001723 523 404 545 201 226 202 NEK6 TRCN0000001724 0 0 29 0 0 0 NEK6 TRCN0000001725 567 263 96 66 22 229 NEK6 TRCN0000001726 0 395 196 118 42 36 NEK6 TRCN0000001727 43 26 87 277 71 244 NEK6 TRCN0000001733 107 363 239 147 79 4 MAST2 TRCN0000001734 0 62 11 4 26 27 MAST2 TRCN0000001735 911 933 1419 2135 1351 1206 MAST2 TRCN0000001736 444 1486 1460 2083 1893 5958 MAST2 TRCN0000001743 0 0 0 0 0 0 STYK1 TRCN0000001744 589 1822 924 631 597 445 STYK1 TRCN0000001746 3 46 59 1266 134 433 STYK1 TRCN0000001747 23 5 248 172 406 424 PAK6 TRCN0000001748 0 0 0 0 0 0 PAK6 TRCN0000001749 1 0 2 0 0 0 PAK6 TRCN0000001750 0 0 18 0 0 5 PAK6 TRCN0000001751 0 602 324 96 241 224 PAK6 TRCN0000001752 29 146 188 160 397 275 CAMK1D TRCN0000001753 371 113 2 195 3 237 CAMK1D TRCN0000001754 62 41 69 27 12 22 CAMK1D TRCN0000001755 0 2 23 8 0 18 CAMK1D TRCN0000001756 21 77 8 184 487 575 CAMK1D TRCN0000001772 0 0 0 17 0 0 EPHB4 TRCN0000001773 484 238 250 318 176 196 EPHB4 TRCN0000001774 499 686 211 766 843 1365 EPHB4 TRCN0000001776 4 172 230 1263 602 1600 LATS1 TRCN0000001777 100 114 253 146 287 354 LATS1 TRCN0000001779 226 50 151 46 141 109 LATS1 TRCN0000001780 3 223 305 198 332 952 LATS1 TRCN0000001781 147 156 370 517 613 771 PRKX TRCN0000001782 82 645 348 373 718 429 PRKX

TRCN0000001783 273 0 2 98 0 174 PRKX TRCN0000001784 4 35 128 71 90 1514 PRKX TRCN0000001785 325 304 229 391 380 568 MAK TRCN0000001786 126 322 386 40 132 24 MAK TRCN0000001787 530 721 162 360 646 90 MAK TRCN0000001788 1715 2049 1927 2449 2715 4218 MAK TRCN0000001789 260 870 991 103 513 259 MAK TRCN0000001790 0 41 59 223 306 654 PRKCQ TRCN0000001791 21 95 69 27 64 49 PRKCQ TRCN0000001792 31 54 15 0 136 79 PRKCQ TRCN0000001793 687 739 651 259 822 408 PRKCQ TRCN0000001794 0 0 0 0 0 0 PRKCQ TRCN0000001795 130 0 0 4 36 13 CDK12 TRCN0000001796 0 101 147 252 77 171 CDK12 TRCN0000001797 235 465 893 467 188 598 CDK12 TRCN0000001798 13 0 12 0 0 21 CDK12 TRCN0000001799 514 2282 1830 1198 897 2305 CDK12 TRCN0000001800 94 199 0 88 2606 29 PXK TRCN0000001801 2584 2870 3697 4535 6959 17311 PXK TRCN0000001802 280 226 138 24 11 135 PXK TRCN0000001803 0 162 5 322 875 337 PXK TRCN0000001804 188 468 167 88 142 307 PXK TRCN0000001805 686 1752 806 1649 1218 2014 PBK TRCN0000001806 766 658 1008 897 848 1081 PBK TRCN0000001807 697 1064 358 445 903 27 PBK TRCN0000001808 2 0 53 264 311 436 PBK TRCN0000001809 0 426 457 686 143 443 PBK TRCN0000001810 345 147 283 235 319 476 ACVR1B TRCN0000001811 56 64 114 322 527 531 ACVR1B TRCN0000001812 40 37 0 188 262 388 ACVR1B TRCN0000001813 10 364 517 181 0 344 ACVR1B TRCN0000001814 3 64 44 39 79 108 ACVR1B TRCN0000001815 11 393 199 322 334 1009 STK40 TRCN0000001816 641 7 856 231 311 269 STK40 TRCN0000001817 0 45 36 13 41 31 STK40 TRCN0000001818 3 723 96 474 176 410 STK40 TRCN0000001819 531 1202 622 1003 1082 1395 STK40 TRCN0000001820 47 116 127 257 58 431 CDK10 TRCN0000001822 74 85 244 95 160 218 CDK10 TRCN0000001823 55 96 130 133 105 596 CDK10 TRCN0000001825 3 375 207 93 0 0 ACVR1C

TRCN0000001826 0 0 27 46 378 127 ACVR1C TRCN0000001827 0 0 2 4 0 16 ACVR1C TRCN0000001828 202 6 272 63 0 326 ACVR1C TRCN0000001829 12 260 979 627 331 652 MAP4K4 TRCN0000001830 2116 1736 1592 2365 4340 4591 MAP4K4 TRCN0000001831 0 0 0 58 18 0 MAP4K4 TRCN0000001832 160 101 208 145 438 588 MAP4K4 TRCN0000001835 417 808 1089 507 423 332 CSNK1E TRCN0000001836 0 0 1 1 0 0 CSNK1E TRCN0000001837 229 495 811 321 83 798 CSNK1E TRCN0000001838 745 1482 757 753 914 1113 CSNK1E TRCN0000001842 0 2 313 175 339 122 MYLK3 TRCN0000001843 460 814 1119 1106 775 1217 MYLK3 TRCN0000001844 7 85 12 2032 656 199 MYLK3 TRCN0000001845 419 335 21 782 251 212 MYLK3 TRCN0000001846 51 20 19 10 0 39 MYLK3 TRCN0000001932 777 898 1367 838 798 1781 TAOK2 TRCN0000001933 10 1 24 4 0 1 TAOK2 TRCN0000001934 28 123 19 80 105 133 TAOK2 TRCN0000001935 0 0 87 19 203 174 TAOK2 TRCN0000001936 8 152 82 130 169 236 TAOK2 TRCN0000001937 184 530 71 146 0 0 MAPK10 TRCN0000001938 53 77 76 20 37 150 MAPK10 TRCN0000001939 1035 823 955 1257 1208 3028 MAPK10 TRCN0000001940 3010 4796 4732 1278 3137 3201 MAPK10 TRCN0000001941 623 545 607 689 417 1161 MAPK10 TRCN0000001942 66 3 19 6764 89 551 AAK1 TRCN0000001943 3 338 70 219 392 78 AAK1 TRCN0000001944 282 332 830 380 156 254 AAK1 TRCN0000001945 11 15 6 2 36 59 AAK1 TRCN0000001946 51 0 0 255 315 170 AAK1 TRCN0000001947 36 292 141 70 71 34 PRKD2 TRCN0000001948 585 904 465 430 976 1661 PRKD2 TRCN0000001949 0 0 0 7 0 12 PRKD2 TRCN0000001950 72 0 0 0 143 0 PRKD2 TRCN0000001951 1 73 22 256 188 250 SNRK TRCN0000001952 1390 11 693 270 180 513 SNRK TRCN0000001953 1075 3047 1577 1789 1820 2760 SNRK TRCN0000001954 328 5 162 102 7 221 SNRK TRCN0000001955 1455 2909 4265 2811 4309 4956 SNRK TRCN0000001956 151 153 254 89 262 104 AMHR2

TRCN0000001957 246 179 196 73 19 203 AMHR2 TRCN0000001958 28 38 59 147 90 277 AMHR2 TRCN0000001959 40 19 104 91 131 241 AMHR2 TRCN0000001960 162 369 269 555 216 641 AMHR2 TRCN0000001961 677 756 655 2065 1099 4469 NEK11 TRCN0000001962 1558 535 1063 2114 3402 7213 NEK11 TRCN0000001963 271 800 379 375 1102 692 NEK11 TRCN0000001964 1651 2790 5206 7945 8674 12945 NEK11 TRCN0000001965 210 754 199 409 673 900 NEK11 TRCN0000001966 0 0 39 0 0 0 NEK7 TRCN0000001967 391 2345 936 1464 4067 3523 NEK7 TRCN0000001968 4 140 0 17 114 268 NEK7 TRCN0000001969 1814 2483 3596 2729 3770 7081 NEK7 TRCN0000001970 21 25 30 41 18 37 DCLK2 TRCN0000001971 3 6 0 0 0 0 DCLK2 TRCN0000001972 0 19 77 119 129 179 DCLK2 TRCN0000001973 290 543 295 3683 521 273 DCLK2 TRCN0000001974 261 999 779 195 987 288 DCLK2 TRCN0000001980 475 218 527 242 468 475 CAMKK1 TRCN0000001981 0 6 47 9 0 34 CAMKK1 TRCN0000001982 1 298 56 443 687 1006 CAMKK1 TRCN0000001984 0 0 0 2 16 9 CAMKK1 TRCN0000001985 2170 1344 2042 1985 2675 4003 CSNK2A1 TRCN0000001986 3 424 357 382 663 705 CSNK2A1 TRCN0000001987 680 1148 2087 2163 1051 1681 CSNK2A1 TRCN0000001988 1 6 274 504 134 588 MAP3K10 TRCN0000001989 0 0 77 1 52 0 MAP3K10 TRCN0000001990 0 0 81 125 8 259 MAP3K10 TRCN0000001991 163 114 98 34 78 3166 MAP3K10 TRCN0000001992 275 452 788 595 750 830 NTRK1 TRCN0000001993 0 0 0 0 0 0 NTRK1 TRCN0000001994 1407 1239 1094 1236 1871 1759 NTRK1 TRCN0000001995 8 55 203 151 251 224 NTRK1 TRCN0000001996 2 17 2 1 14 9 NTRK1 TRCN0000001997 0 28 164 115 0 124 PDGFRB TRCN0000001998 943 2 341 705 1088 994 PDGFRB TRCN0000001999 2095 2134 3019 1439 3179 3349 PDGFRB TRCN0000002000 24 0 59 0 39 0 PDGFRB TRCN0000002001 1695 1775 1655 817 809 1953 PDGFRB TRCN0000002002 120 0 97 125 113 85 PRKACB TRCN0000002003 1685 2112 2208 448 717 1415 PRKACB

TRCN0000002004 2 218 197 301 850 356 PRKACB TRCN0000002005 227 1480 936 445 950 983 PRKACB TRCN0000002006 120 44 56 6405 181 351 PRKACB TRCN0000002011 225 47 60 0 119 0 CDKL5 TRCN0000002012 23 39 23 22 45 96 CDKL5 TRCN0000002013 805 371 759 1254 420 958 CDKL5 TRCN0000002014 106 232 244 291 213 1078 CDKL5 TRCN0000002015 0 0 0 0 0 0 CDKL5 TRCN0000002016 321 579 1164 1835 3110 2368 EPHB6 TRCN0000002017 156 137 145 2195 311 668 EPHB6 TRCN0000002018 112 269 268 238 303 651 EPHB6 TRCN0000002024 0 8 250 0 80 61 ROR1 TRCN0000002025 1338 1463 855 770 778 2178 ROR1 TRCN0000002026 17 2 160 674 132 68 ROR1 TRCN0000002027 0 0 0 0 0 153 ROR1 TRCN0000002028 1 0 48 253 193 53 ROR1 TRCN0000002029 0 7 117 246 275 202 ABL2 TRCN0000002030 1 280 1 37 3 123 ABL2 TRCN0000002031 6 0 126 291 228 382 ABL2 TRCN0000002032 53 411 464 166 190 80 ABL2 TRCN0000002033 564 968 928 1109 1299 1080 ABL2 TRCN0000002035 173 1 70 71 133 124 ADRBK2 TRCN0000002036 0 269 0 6 241 8 ADRBK2 TRCN0000002037 0 0 25 54 6 82 ADRBK2 TRCN0000002038 0 7 0 0 0 1 TNK2 TRCN0000002039 51 151 112 38 189 201 TNK2 TRCN0000002040 250 195 503 719 9691 681 TNK2 TRCN0000002041 162 509 589 887 931 530 TNK2 TRCN0000002042 0 97 1 79 0 58 TNK2 TRCN0000002043 1 143 42 41 7 110 MAP3K2 TRCN0000002044 0 0 0 0 0 0 MAP3K2 TRCN0000002045 2 217 546 496 266 0 MAP3K2 TRCN0000002046 1327 4658 1916 2961 9369 8631 MAP3K2 TRCN0000002047 1257 2441 1727 1487 2891 1140 MAP3K2 TRCN0000002053 372 575 509 253 177 636 STK38L TRCN0000002054 902 288 1505 418 2364 1153 STK38L TRCN0000002055 80 984 835 160 225 299 STK38L TRCN0000002056 202 324 98 197 539 863 STK38L TRCN0000002057 427 99 593 249 202 594 STK38L TRCN0000002063 728 1101 306 1208 2076 2740 IRAK4 TRCN0000002064 1879 2140 2159 990 1830 1529 IRAK4

TRCN0000002065 944 1864 284 572 49 194 IRAK4 TRCN0000002066 135 132 88 45 79 270 IRAK4 TRCN0000002067 1054 1221 1551 1016 2813 3246 NLK TRCN0000002068 42 524 254 71 208 221 NLK TRCN0000002069 77 53 163 1256 2167 1564 NLK TRCN0000002070 0 3 35 13 10 31 NLK TRCN0000002071 197 444 174 295 896 1514 NLK TRCN0000002077 4 2 0 177 443 0 STK33 TRCN0000002078 0 0 0 17 0 0 STK33 TRCN0000002079 2319 2032 2033 1964 2887 3810 STK33 TRCN0000002080 0 0 3 2 55 74 STK33 TRCN0000002081 80 286 7704 132 138 278 STK33 TRCN0000002091 4 2 225 295 129 96 STK35 TRCN0000002092 3 188 987 125 244 1308 STK35 TRCN0000002093 704 597 509 469 388 378 STK35 TRCN0000002094 0 16 78 20 11 140 STK35 TRCN0000002095 0 105 75 5 56 19 STK35 TRCN0000002096 24 1 93 63 159 48 CDK15 TRCN0000002097 296 1019 283 681 1496 934 CDK15 TRCN0000002098 0 14 15 75 19 60 CDK15 TRCN0000002099 0 432 206 156 280 196 CDK15 TRCN0000002100 429 247 870 793 1202 1183 CDK15 TRCN0000002110 0 0 62 27 0 0 SGK2 TRCN0000002111 4 369 101 706 386 626 SGK2 TRCN0000002112 0 0 47 107 55 174 SGK2 TRCN0000002113 0 0 0 0 0 0 SGK2 TRCN0000002114 829 1883 861 1737 2201 3480 PAK2 TRCN0000002115 0 197 0 0 0 182 PAK2 TRCN0000002116 0 54 17 30 133 222 PAK2 TRCN0000002117 64 32 0 61 79 74 PAK2 TRCN0000002118 0 0 0 25 0 44 PAK2 TRCN0000002124 184 9 144 329 542 704 PRKD1 TRCN0000002125 2 856 835 12 0 0 PRKD1 TRCN0000002126 157 385 135 554 297 882 PRKD1 TRCN0000002127 34 4 0 89 611 441 PRKD1 TRCN0000002128 1031 629 140 439 1044 1403 PRKD1 TRCN0000002129 2 146 3 112 616 236 VRK1 TRCN0000002130 1963 3403 2924 4508 6260 6570 VRK1 TRCN0000002131 1058 1811 1380 1505 1879 2216 VRK1 TRCN0000002132 0 54 153 27 66 109 VRK1 TRCN0000002133 0 0 0 0 0 0 VRK1

TRCN0000002139 68 0 0 0 0 0 DYRK1B TRCN0000002140 31 0 2 46 65 139 DYRK1B TRCN0000002141 0 0 0 0 0 30 DYRK1B TRCN0000002142 0 27 15 0 0 18 DYRK1B TRCN0000002143 0 0 9 3 6 51 DYRK1B TRCN0000002144 0 0 0 131 0 246 DCLK1 TRCN0000002145 4794 5622 5576 3488 4637 6633 DCLK1 TRCN0000002146 1238 1593 283 715 1432 2068 DCLK1 TRCN0000002147 0 0 4 0 0 0 DCLK1 TRCN0000002148 0 0 0 9 23 42 DCLK1 TRCN0000002154 1 1 4 92 226 1426 GAK TRCN0000002155 0 0 0 27 0 25 GAK TRCN0000002156 233 258 137 64 153 573 GAK TRCN0000002157 28 577 300 1018 366 1311 GAK TRCN0000002158 0 68 0 18 27 140 GAK TRCN0000002159 0 0 0 26 91 250 ROCK1 TRCN0000002160 584 973 72 792 2281 745 ROCK1 TRCN0000002161 98 124 400 27 168 109 ROCK1 TRCN0000002162 1718 1743 1159 1047 1696 1240 ROCK1 TRCN0000002163 65 41 170 144 234 144 ROCK1 TRCN0000002164 165 326 2 267 141 629 MUSK TRCN0000002165 2 270 0 0 0 0 MUSK TRCN0000002166 968 2 212 350 319 257 MUSK TRCN0000002167 2 379 0 558 971 832 MUSK TRCN0000002168 563 1518 1115 1326 1880 2150 PRKAA2 TRCN0000002169 0 0 0 0 0 0 PRKAA2 TRCN0000002170 10 0 0 48 51 87 PRKAA2 TRCN0000002171 0 93 37 23 38 0 PRKAA2 TRCN0000002172 0 174 224 115 240 373 PRKAA2 TRCN0000002173 2 263 74 174 7 1415 STK3 TRCN0000002174 477 121 149 63 451 333 STK3 TRCN0000002175 0 0 0 0 4 58 STK3 TRCN0000002176 0 1 53 0 0 0 STK3 TRCN0000002177 152 46 44 64 171 173 STK3 TRCN0000002178 0 154 155 59 108 116 TYRO3 TRCN0000002179 0 35 0 3 30 43 TYRO3 TRCN0000002180 67 0 66 175 50 221 TYRO3 TRCN0000002181 272 454 334 42 17 0 TYRO3 TRCN0000002187 0 23 0 11 31 21 MAP4K5 TRCN0000002188 26 108 4 148 280 439 MAP4K5 TRCN0000002189 4 246 160 139 236 394 MAP4K5

TRCN0000002190 1733 1833 1784 1095 1425 2005 MAP4K5 TRCN0000002191 0 2 316 0 0 0 MAP4K5 TRCN0000002192 0 0 0 41 191 0 TNNI3K TRCN0000002193 0 2 76 196 11 0 TNNI3K TRCN0000002194 0 0 57 138 0 2 TNNI3K TRCN0000002195 1880 4267 4264 2634 3028 6301 TNNI3K TRCN0000002196 3 7 9 23 14 45 TNNI3K TRCN0000002197 285 5 236 144 373 0 MYO3A TRCN0000002198 0 0 0 0 0 0 MYO3A TRCN0000002199 0 0 0 0 1 2 MYO3A TRCN0000002200 0 1 65 74 0 0 MYO3A TRCN0000002201 0 109 0 29 0 0 MYO3A TRCN0000002207 163 200 29 375 2 328 TSSK3 TRCN0000002208 317 465 999 2835 3997 4827 TSSK3 TRCN0000002209 56 645 207 401 373 1184 TSSK3 TRCN0000002210 1 7 17 5 21 62 TSSK3 TRCN0000002211 2662 5142 5919 712 424 1009 TSSK3 TRCN0000002212 293 888 622 1128 7772 2033 MAPK15 TRCN0000002213 268 82 161 912 639 1129 MAPK15 TRCN0000002214 0 0 0 0 0 43 MAPK15 TRCN0000002215 0 0 2 6 8 2 CDK20 TRCN0000002216 490 1454 406 799 965 3378 CDK20 TRCN0000002217 4 6 657 509 91 538 CDK20 TRCN0000002218 3 32 13 9 17 24 CDK20 TRCN0000002219 0 70 0 61 28 85 MATK TRCN0000002220 0 63 17 131 244 1233 MATK TRCN0000002221 0 8 0 0 3 0 MATK TRCN0000002222 1110 1065 704 199 307 529 MATK TRCN0000002223 0 107 26 110 178 225 MATK TRCN0000002224 490 1235 1503 360 401 1412 PAK1 TRCN0000002225 1 0 0 10 0 119 PAK1 TRCN0000002226 371 455 410 218 313 371 PAK1 TRCN0000002227 0 86 286 24 204 32 PAK1 TRCN0000002233 99 272 291 93 91 184 MAP4K2 TRCN0000002234 0 0 0 0 44 37 MAP4K2 TRCN0000002235 670 0 2 117 1 0 MAP4K2 TRCN0000002236 653 356 830 631 1359 2170 MAP4K2 TRCN0000002237 0 0 13 6 14 23 MAP4K2 TRCN0000002242 574 0 30 88 200 269 NTRK2 TRCN0000002243 4 703 0 54 71 480 NTRK2 TRCN0000002244 0 7 0 33 0 0 NTRK2

100

TRCN0000002245 8 60 212 45 0 95 NTRK2 TRCN0000002246 3 68 5 595 545 1350 NTRK2 TRCN0000002247 0 18 0 0 13 0 TESK1 TRCN0000002248 287 367 171 170 128 139 TESK1 TRCN0000002249 5895 1494 1366 2078 2386 3419 TESK1 TRCN0000002250 0 285 0 0 0 0 TESK1 TRCN0000002251 0 20 16 198 90 385 TESK1 TRCN0000002252 1004 269 657 442 1037 1591 WNK2 TRCN0000002253 0 0 16 0 0 44 WNK2 TRCN0000002254 0 0 0 0 9 0 WNK2 TRCN0000002255 0 0 34 36 111 10 WNK2 TRCN0000002256 0 25 34 73 85 53 WNK2 TRCN0000002257 0 0 1 98 0 0 RIPK3 TRCN0000002258 248 47 167 31 39 113 RIPK3 TRCN0000002259 0 0 0 0 0 0 RIPK3 TRCN0000002260 34 364 151 236 229 267 RIPK3 TRCN0000002261 534 1316 544 685 200 1092 RIPK3 TRCN0000002262 476 1938 2362 853 417 1390 RPS6KA6 TRCN0000002263 1 0 40 15 0 0 RPS6KA6 TRCN0000002264 3 92 2 159 245 490 RPS6KA6 TRCN0000002265 0 0 0 0 0 0 RPS6KA6 TRCN0000002266 197 95 278 2 1141 1479 RPS6KA6 TRCN0000002267 0 0 0 0 0 11 HUNK TRCN0000002268 1080 698 1209 350 470 5 HUNK TRCN0000002269 3 6 187 442 385 1362 HUNK TRCN0000002270 5 470 149 160 248 1453 HUNK TRCN0000002271 301 834 10 265 845 428 HUNK TRCN0000002272 0 27 41 44 77 109 STK32B TRCN0000002273 746 2392 533 407 1385 1404 STK32B TRCN0000002274 0 0 0 8 0 0 STK32B TRCN0000002275 0 0 0 18 13 0 STK32B TRCN0000002276 0 14 12 10 35 27 STK32B TRCN0000002277 2 1 6 14 4935 812 MASTL TRCN0000002278 2 0 6 364 811 871 MASTL TRCN0000002279 379 147 46 145 345 412 MASTL TRCN0000002280 0 4 0 0 0 0 MASTL TRCN0000002281 152 194 8 1017 857 931 MASTL TRCN0000002282 2 0 244 291 266 119 MAPKAPK2 TRCN0000002283 0 0 0 0 0 0 MAPKAPK2 TRCN0000002284 0 45 0 31 175 139 MAPKAPK2 TRCN0000002285 170 26 1 42 49 35 MAPKAPK2

101

TRCN0000002286 911 1097 1116 426 919 952 MAPKAPK2 TRCN0000002287 316 356 100 690 889 924 NEK10 TRCN0000002288 0 0 2 53 108 253 NEK10 TRCN0000002289 1198 1111 1990 484 534 454 NEK10 TRCN0000002290 8 168 10 60 104 51 NEK10 TRCN0000002291 387 1162 452 584 894 1062 NEK10 TRCN0000002292 132 97 111 182 250 248 PDIK1L TRCN0000002293 86 438 0 416 689 776 PDIK1L TRCN0000002294 0 78 73 6 4 44 PDIK1L TRCN0000002295 104 121 433 144 192 27 PDIK1L TRCN0000002296 6 0 1 518 2 0 PDIK1L TRCN0000002297 0 53 27 9 37 94 CAMKK2 TRCN0000002298 134 281 432 202 325 553 CAMKK2 TRCN0000002299 0 2 117 69 73 485 CAMKK2 TRCN0000002300 398 443 212 175 252 535 CAMKK2 TRCN0000002301 1 33 0 74 91 72 CAMKK2 TRCN0000002302 0 0 0 90 84 152 ANKK1 TRCN0000002303 828 930 854 329 787 1310 ANKK1 TRCN0000002304 0 2 2 126 38 39 ANKK1 TRCN0000002305 0 0 5 0 0 0 MAP3K3 TRCN0000002306 7 7 0 5 13 1 MAP3K3 TRCN0000002307 0 0 0 0 0 0 MAP3K3 TRCN0000002308 306 0 0 41 0 0 MAP3K3 TRCN0000002309 0 0 0 0 0 0 NTRK3 TRCN0000002310 113 163 192 206 91 362 NTRK3 TRCN0000002311 0 0 106 7 51 171 NTRK3 TRCN0000002312 0 406 404 0 140 32 NTRK3 TRCN0000002313 0 0 64 0 0 0 NTRK3 TRCN0000002314 511 49 77 203 353 450 PDK2 TRCN0000002315 139 274 348 42 37 155 PDK2 TRCN0000002316 44 212 274 225 0 130 PDK2 TRCN0000002317 0 224 119 0 2 0 PDK2 TRCN0000002318 94 106 613 793 769 953 PDK2 TRCN0000002324 583 585 1083 319 667 1017 PRKCG TRCN0000002325 2 126 294 268 262 543 PRKCG TRCN0000002326 3 10 521 566 513 860 PRKCG TRCN0000002327 0 0 0 0 166 98 PRKCG TRCN0000002328 42 9 74 36 62 199 MAP2K1 TRCN0000002329 10 220 183 31 171 342 MAP2K1 TRCN0000002330 0 0 0 0 0 0 MAP2K1 TRCN0000002331 36 35 42 11 50 13 MAP2K1

102

TRCN0000002332 7 301 298 0 0 75 MAP2K1 TRCN0000002333 173 218 142 177 388 370 AURKC TRCN0000002334 1 252 50 191 100 216 AURKC TRCN0000002335 2 2 114 9 13 35 AURKC TRCN0000002336 0 4 28 0 0 109 AURKC TRCN0000002342 0 2 112 31 13 34 MAP3K6 TRCN0000002343 62 317 135 21 76 82 MAP3K6 TRCN0000002344 320 163 326 293 868 308 MAP3K6 TRCN0000002345 2 0 5 5 51 4377 MAP3K6 TRCN0000002346 0 19 56 29 0 0 MAP3K6 TRCN0000002347 14 47 49 40 53 50 FER TRCN0000002348 0 0 0 41 0 0 FER TRCN0000002349 536 79 105 46 0 56 FER TRCN0000002350 0 0 0 34 146 0 FER TRCN0000002351 7483 33324 1778 2730 2661 5996 FER TRCN0000002361 27 661 850 959 1153 1366 TLK2 TRCN0000002362 3133 1411 885 3114 5468 8484 TLK2 TRCN0000002363 1070 652 849 590 2040 1884 TLK2 TRCN0000002364 0 0 0 0 0 0 TLK2 TRCN0000002365 33 32 73 58 52 248 TLK2 TRCN0000002366 417 765 618 812 1001 1250 CDK14 TRCN0000002367 1088 420 445 491 673 1141 CDK14 TRCN0000002368 0 4 6 1 0 5 CDK14 TRCN0000002369 0 79 11 52 59 26 CDK14 TRCN0000002370 0 0 0 23 77 67 CDK14 TRCN0000002371 55 47 41 23 24 12 PLK4 TRCN0000002372 27 53 151 94 38 58 PLK4 TRCN0000002373 0 0 0 29 102 0 PLK4 TRCN0000002374 411 2995 1065 1121 707 3303 PLK4 TRCN0000002375 662 1191 694 864 920 736 PLK4 TRCN0000002376 692 1946 600 456 2193 747 CDKL3 TRCN0000002377 0 0 0 2 17 32 CDKL3 TRCN0000002378 0 0 97 276 2195 660 CDKL3 TRCN0000002379 524 545 455 172 640 1517 CDKL3 TRCN0000002380 48 634 1301 477 129 1811 CDKL3 TRCN0000002386 0 182 67 243 401 1150 SCYL3 TRCN0000002387 1 0 1 232 4 238 SCYL3 TRCN0000002388 1 0 0 0 1 27 SCYL3 TRCN0000002389 0 0 0 2 0 2 SCYL3 TRCN0000002390 134 204 73 115 86 539 SCYL3 TRCN0000002391 0 67 82 152 0 458 YSK4

103

TRCN0000002392 2 0 91 133 248 5 YSK4 TRCN0000002393 0 0 69 67 246 132 YSK4 TRCN0000002394 12 1747 936 414 828 534 YSK4 TRCN0000002395 383 674 1232 1020 2052 1242 YSK4 TRCN0000002396 65 140 172 110 395 424 BRSK1 TRCN0000002397 6 333 297 304 2615 1774 BRSK1 TRCN0000002398 0 0 61 72 102 167 BRSK1 TRCN0000002399 3 1405 388 90 190 244 BRSK1 TRCN0000002400 1 170 11 55 332 412 BRSK1 TRCN0000002401 0 0 0 0 0 237 MYO3B TRCN0000002402 26 178 34 207 523 471 MYO3B TRCN0000002403 0 0 20 20 65 44 MYO3B TRCN0000002404 4506 7477 7762 1977 2858 5497 MYO3B TRCN0000002405 0 0 102 49 114 6 MYO3B TRCN0000002406 0 7 17 21 52 11 GRK7 TRCN0000002407 186 293 175 87 93 177 GRK7 TRCN0000002408 96 315 155 73 76 168 GRK7 TRCN0000002409 324 302 228 518 917 996 GRK7 TRCN0000002410 848 287 1068 567 297 700 SGK494 TRCN0000002411 0 0 0 0 0 0 SGK494 TRCN0000002412 263 5 180 106 186 598 SGK494 TRCN0000002413 152 21 0 19 203 223 SGK494 TRCN0000002414 300 844 1067 1400 1809 2320 TSSK4 TRCN0000002415 3 2 81 266 259 328 TSSK4 TRCN0000002416 39 54 10 11 43 29 TSSK4 TRCN0000002417 0 2 144 51 7 350 TSSK4 TRCN0000003097 123 161 176 135 81 160 FYN TRCN0000003098 0 1 14 2 24 31 FYN TRCN0000003099 780 295 295 875 1004 8060 FYN TRCN0000003100 0 71 0 24 167 77 FYN TRCN0000003101 0 0 0 0 10 3 FYN TRCN0000003102 38 28 0 6 50 57 JAK1 TRCN0000003103 0 2 143 0 1 0 JAK1 TRCN0000003104 0 0 38 137 4 235 JAK1 TRCN0000003105 204 0 0 0 157 111 JAK1 TRCN0000003106 0 0 1 0 0 0 MST1R TRCN0000003107 2 6 105 123 298 206 MST1R TRCN0000003109 529 1949 1111 1042 219 1786 MST1R TRCN0000003110 0 12 20 7 27 11 MST1R TRCN0000003111 715 396 804 871 1616 1902 PRKAG1 TRCN0000003112 202 238 330 518 259 843 PRKAG1

104

TRCN0000003113 61 777 454 1174 1222 1524 PRKAG1 TRCN0000003114 2 153 0 32 2 0 PRKAG1 TRCN0000003115 391 455 516 260 302 250 PRKAG1 TRCN0000003116 0 0 0 21 0 0 PRKCB TRCN0000003117 201 213 0 23 70 507 PRKCB TRCN0000003118 0 0 14 0 92 0 PRKCB TRCN0000003119 9 252 528 523 512 1199 PRKCB TRCN0000003120 0 25 36 22 57 86 TYK2 TRCN0000003121 0 0 0 28 95 124 TYK2 TRCN0000003122 4 0 7 0 0 2 TYK2 TRCN0000003123 0 0 0 0 0 4 TYK2 TRCN0000003124 90 0 19 54 81 1 TYK2 TRCN0000003130 0 58 78 128 188 141 PRKAB2 TRCN0000003131 2294 1413 2866 1620 2005 1831 PRKAB2 TRCN0000003132 25 48 72 61 38 10 PRKAB2 TRCN0000003133 0 0 0 0 0 0 PRKAB2 TRCN0000003134 14 13 3 47 4 44 PRKAB2 TRCN0000003135 0 0 0 0 0 7 STK10 TRCN0000003136 0 42 144 25 115 1109 STK10 TRCN0000003137 0 0 1 11 33 121 STK10 TRCN0000003138 5 186 545 1011 1405 942 STK10 TRCN0000003139 739 17 838 73 0 14 STK10 TRCN0000003140 5 27 265 662 547 1394 CDK19 TRCN0000003141 251 0 0 0 1 0 CDK19 TRCN0000003142 169 109 103 77 65 123 CDK19 TRCN0000003143 1 0 0 52 263 122 CDK19 TRCN0000003144 3 445 191 735 1030 854 CDK19 TRCN0000003145 2118 3559 3497 3821 4422 7783 PRKAG2 TRCN0000003146 115 255 159 336 533 734 PRKAG2 TRCN0000003147 2 146 0 43 0 0 PRKAG2 TRCN0000003148 57 96 142 98 176 133 PRKAG2 TRCN0000003149 0 0 0 0 0 0 PRKAG2 TRCN0000003154 1 0 0 82 478 1 LTK TRCN0000003155 0 0 0 0 0 0 LTK TRCN0000003156 0 1 0 41 0 0 LTK TRCN0000003157 120 71 133 309 8 7 LTK TRCN0000003158 3 2 165 84 275 520 RPS6KB1 TRCN0000003159 105 20 40 32 0 7 RPS6KB1 TRCN0000003160 100 171 126 264 366 462 RPS6KB1 TRCN0000003161 1 85 72 161 225 347 RPS6KB1 TRCN0000003162 0 0 3 8 7 12 RPS6KB1

105

TRCN0000003163 8 46 26 23 44 163 SYK TRCN0000003164 113 436 161 100 109 18 SYK TRCN0000003165 95 40 165 24 79 133 SYK TRCN0000003166 16 12 7 20 109 8 SYK TRCN0000003167 103 444 283 320 144 361 SYK TRCN0000003168 73 400 144 309 169 156 CDC7 TRCN0000003169 198 429 552 299 330 946 CDC7 TRCN0000003170 1595 1908 1649 2819 2025 2881 CDC7 TRCN0000003171 0 2 590 135 272 452 CDC7 TRCN0000003172 46 657 1841 969 1640 1811 CDC7 TRCN0000003177 2 0 0 273 1074 347 JAK2 TRCN0000003178 493 214 420 174 208 182 JAK2 TRCN0000003179 476 0 0 211 0 131 JAK2 TRCN0000003180 407 1496 1491 1118 800 701 JAK2 TRCN0000003181 0 859 366 226 69 191 JAK2 TRCN0000003182 278 386 120 110 729 941 TBK1 TRCN0000003183 0 0 55 0 1 0 TBK1 TRCN0000003184 232 780 574 864 946 1670 TBK1 TRCN0000003185 25 0 26 7 34 113 TBK1 TRCN0000003186 0 11 17 1 4 20 TBK1 TRCN0000003187 0 0 0 95 75 30 INSRR TRCN0000003188 65 2 388 209 338 380 INSRR TRCN0000003189 1 0 0 48 0 159 INSRR TRCN0000003190 0 35 7 0 38 0 INSRR TRCN0000003191 1110 1685 1261 1276 1487 980 MST4 TRCN0000003192 0 0 0 0 33 0 MST4 TRCN0000003193 1 746 2 188 2 543 MST4 TRCN0000003194 425 308 326 16 199 341 MST4 TRCN0000003195 2733 6698 3552 2742 3283 3076 MST4 TRCN0000003201 0 61 160 20 0 88 HIPK2 TRCN0000003202 0 5 156 213 71 256 HIPK2 TRCN0000003203 11 15 2 47 34 57 HIPK2 TRCN0000003204 4 436 656 338 0 2 HIPK2 TRCN0000003205 0 80 0 13 0 21 NUAK2 TRCN0000003206 326 0 0 54 229 50 NUAK2 TRCN0000003207 952 595 579 571 1125 524 NUAK2 TRCN0000003208 0 91 271 110 0 318 NUAK2 TRCN0000003209 382 181 454 135 568 2 KIAA1804 TRCN0000003210 0 109 122 183 3 0 KIAA1804 TRCN0000003211 0 149 53 0 77 190 KIAA1804 TRCN0000003212 0 0 1 135 214 125 KIAA1804

106

TRCN0000003213 1 0 30 3 0 20 KIAA1804 TRCN0000003214 10 20 0 0 5 19 PSKH2 TRCN0000003215 2 35 14 0 0 0 PSKH2 TRCN0000003216 17 262 240 275 59 185 PSKH2 TRCN0000003217 0 0 0 95 91 79 PSKH2 TRCN0000003218 2323 3360 3447 1107 1395 1939 PSKH2 TRCN0000003219 0 0 0 0 0 0 TSSK2 TRCN0000003220 186 152 108 9 160 42 TSSK2 TRCN0000003221 580 1537 839 1580 1789 2804 TSSK2 TRCN0000003222 2 5 204 164 306 781 TSSK2 TRCN0000003223 0 0 0 0 0 0 TSSK2 TRCN0000003224 1 35 11 0 0 0 MLKL TRCN0000003225 0 0 107 56 114 0 MLKL TRCN0000003226 2 359 272 45 0 1187 MLKL TRCN0000003227 163 168 95 138 108 210 MLKL TRCN0000003228 93 205 464 183 205 438 MLKL TRCN0000003229 0 0 8 55 45 10 TTBK2 TRCN0000003230 1 36 147 86 0 4 TTBK2 TRCN0000003231 0 0 1 68 58 320 TTBK2 TRCN0000003232 48 183 101 98 65 179 TTBK2 TRCN0000003233 340 12 967 148 195 221 TTBK2 TRCN0000003242 2 0 6 0 0 2 PAK3 TRCN0000003243 124 2 135 0 0 27 PAK3 TRCN0000003244 0 2 23 2 73 144 PAK3 TRCN0000003245 0 2 83 0 140 0 PAK3 TRCN0000003246 793 2759 5368 1339 1166 1580 PAK3 TRCN0000003254 583 827 553 610 967 464 HIPK3 TRCN0000003255 0 2 36 0 0 6 HIPK3 TRCN0000003256 158 250 145 534 1352 317 HIPK3 TRCN0000003257 28 0 19 32 71 63 HIPK3 TRCN0000003258 471 285 294 89 511 545 HIPK3 TRCN0000003259 2172 3742 2854 1543 646 1733 RPS6KC1 TRCN0000003260 0 0 0 0 0 0 RPS6KC1 TRCN0000003261 3 4 747 584 419 1031 RPS6KC1 TRCN0000003262 0 0 23 18 54 74 RPS6KC1 TRCN0000003263 0 134 43 88 55 127 RPS6KC1 TRCN0000003264 532 1 2 307 634 1159 ZAK TRCN0000003265 0 0 0 0 60 42 ZAK TRCN0000003266 0 0 0 0 0 25 ZAK TRCN0000003267 0 0 0 0 0 0 ZAK TRCN0000003268 2 3 125 85 219 1 ZAK

107

TRCN0000003274 1248 3089 1181 2785 4949 7996 STK31 TRCN0000003275 1 133 167 35 20 14 STK31 TRCN0000003276 992 2628 1945 1189 997 1309 STK31 TRCN0000003277 4 2 83 5 229 321 STK31 TRCN0000003278 1344 1628 2400 3125 3474 5554 STK31 TRCN0000003279 32 25 16 9 40 39 UHMK1 TRCN0000003280 1369 1040 925 3110 6383 4329 UHMK1 TRCN0000003281 69 38 6 1237 50 2 UHMK1 TRCN0000003282 1501 559 1754 1985 3341 2480 UHMK1 TRCN0000003283 1 0 0 40 0 132 UHMK1 TRCN0000003794 4999 7154 8287 6086 8444 12999 CSNK2B TRCN0000003795 180 613 791 752 452 1527 CSNK2B TRCN0000003796 296 849 289 414 478 1654 CSNK2B TRCN0000003797 734 753 922 661 1162 2585 CSNK2B TRCN0000004770 47 16 69 44 0 0 PRKAB1 TRCN0000004771 10 202 120 119 0 62 PRKAB1 TRCN0000004772 1 147 17 53 43 121 PRKAB1 TRCN0000004773 0 0 0 0 0 0 PRKAB1 TRCN0000004774 13 196 167 223 389 374 PRKAB1 TRCN0000004871 2 734 113 29 46 374 RAC1 TRCN0000005418 0 0 0 71 186 38 RIOK3 TRCN0000005419 306 685 109 515 702 561 RIOK3 TRCN0000005420 1 214 3 265 171 0 RIOK3 TRCN0000005421 992 1579 1294 135 768 434 RIOK3 TRCN0000005422 806 708 1625 1831 2601 1879 RIOK3 TRCN0000006037 59 80 23 40 1 67 PRKCI TRCN0000006039 160 466 168 408 288 493 PRKCI TRCN0000006040 644 5 176 450 481 584 PRKCI TRCN0000006041 32 553 144 203 192 904 PRKCI TRCN0000006043 849 1431 1269 2151 1860 3712 CSNK1A1 TRCN0000006044 186 731 140 0 0 0 CSNK1A1 TRCN0000006045 0 16 1 259 139 561 CSNK1A1 TRCN0000006069 181 1 4 535 163 0 CDKL1 TRCN0000006070 232 253 74 104 119 389 CDKL1 TRCN0000006071 0 130 292 141 44 165 CDKL1 TRCN0000006072 0 17 0 0 0 0 CDKL1 TRCN0000006073 107 28 0 0 41 41 CDKL1 TRCN0000006096 0 0 1 137 365 309 MKNK2 TRCN0000006097 0 5 2 4 2 3 MKNK2 TRCN0000006098 435 253 100 178 147 329 MKNK2 TRCN0000006099 62 63 73 0 0 0 MKNK2

108

TRCN0000006100 5 8 1 0 0 0 MKNK2 TRCN0000006145 0 266 19 79 42 0 MAPK12 TRCN0000006146 0 211 2 40 76 94 MAPK12 TRCN0000006147 0 0 114 151 0 0 MAPK12 TRCN0000006148 0 155 1 79 0 215 MAPK12 TRCN0000006149 2 4 0 2 2 3 MAPK12 TRCN0000006150 0 0 0 0 0 0 MAPK3 TRCN0000006151 10 37 21 51 30 40 MAPK3 TRCN0000006152 33 0 185 137 247 459 MAPK3 TRCN0000006153 83 0 0 74 34 105 MAPKAPK3 TRCN0000006154 872 1342 742 221 585 761 MAPKAPK3 TRCN0000006155 0 67 114 0 41 91 MAPKAPK3 TRCN0000006156 1 0 0 0 0 139 MAPKAPK3 TRCN0000006157 785 2783 2424 1479 1750 3318 MAPKAPK3 TRCN0000006187 118 162 1 150 209 162 PHKA1 TRCN0000006188 372 135 773 246 813 2745 PHKA1 TRCN0000006189 950 201 249 1194 616 2113 PHKA1 TRCN0000006190 0 17 168 54 0 0 PHKA1 TRCN0000006191 6 12 40 51 29 137 PHKA1 TRCN0000006192 0 0 0 0 0 10 PHKA2 TRCN0000006193 389 863 521 397 677 2269 PHKA2 TRCN0000006194 350 620 428 89 102 137 PHKA2 TRCN0000006195 234 217 637 248 705 1187 PHKA2 TRCN0000006196 0 0 0 0 0 0 PHKB TRCN0000006197 145 0 149 0 0 144 PHKB TRCN0000006198 0 2 239 307 598 1480 PHKB TRCN0000006199 72 189 185 437 1073 1414 PHKB TRCN0000006200 0 3 235 263 143 329 PHKB TRCN0000006201 0 263 78 81 291 310 PHKG1 TRCN0000006202 0 0 33 0 0 4 PHKG1 TRCN0000006203 0 0 0 0 0 0 PHKG1 TRCN0000006204 5 46 204 272 67 0 PHKG1 TRCN0000006205 0 1 19 0 34 55 PHKG1 TRCN0000006206 47 0 0 93 214 38 CDK11B TRCN0000006207 3 280 9 260 7 151 CDK11B TRCN0000006208 47 79 0 74 248 247 CDK11B TRCN0000006209 0 6 0 5 5 6 CDK11B TRCN0000006210 31 0 0 100 0 0 CDK11B TRCN0000006211 0 0 0 67 428 45 COL4A3BP TRCN0000006212 1122 2116 574 267 8 1587 COL4A3BP TRCN0000006213 0 0 144 18 463 388 COL4A3BP

109

TRCN0000006214 0 4 238 157 270 41 COL4A3BP TRCN0000006215 2858 4425 2885 1864 3333 4764 COL4A3BP TRCN0000006216 0 77 16 4 46 44 CDK5R1 TRCN0000006217 44 0 0 155 537 446 CDK5R1 TRCN0000006218 770 607 833 574 794 1186 CDK5R1 TRCN0000006219 2 2 99 30 48 0 CDK5R1 TRCN0000006220 4 184 138 627 554 798 CDK5R1 TRCN0000006221 792 1279 676 555 444 4311 EEF2K TRCN0000006222 11 759 546 699 1468 1474 EEF2K TRCN0000006223 370 2 204 48 178 36 EEF2K TRCN0000006224 0 0 0 3 0 0 EEF2K TRCN0000006225 0 1 0 2 415 62 EEF2K TRCN0000006226 0 40 0 6 0 10 KSR1 TRCN0000006227 199 168 247 88 443 303 KSR1 TRCN0000006228 34 159 64 113 231 225 KSR1 TRCN0000006229 3 1 0 12 0 0 KSR1 TRCN0000006230 12 3 9 0 3 5 KSR1 TRCN0000006231 409 0 0 0 192 158 MKNK1 TRCN0000006232 219 120 2 266 207 82 MKNK1 TRCN0000006233 0 67 85 147 20 89 MKNK1 TRCN0000006234 0 0 0 0 0 0 MKNK1 TRCN0000006235 284 271 207 11 30 102 PKMYT1 TRCN0000006236 158 52 371 257 220 456 PKMYT1 TRCN0000006237 0 0 0 0 0 0 PKMYT1 TRCN0000006238 0 0 32 6 58 216 MINK1 TRCN0000006239 1168 795 322 581 514 685 MINK1 TRCN0000006240 0 0 0 0 0 38 MINK1 TRCN0000006241 0 0 0 0 0 0 CDK17 TRCN0000006242 17 159 176 83 1 0 CDK17 TRCN0000006243 0 0 230 0 0 0 CDK17 TRCN0000006244 43 101 0 178 200 291 CDK17 TRCN0000006245 0 112 29 2 512 85 CDK17 TRCN0000006246 0 0 0 0 227 0 PLK1 TRCN0000006247 214 0 0 309 240 1255 PLK1 TRCN0000006248 18 166 29 25 81 32 PLK1 TRCN0000006249 2 232 5 0 43 0 PLK1 TRCN0000006250 0 0 0 0 0 0 PKN2 TRCN0000006251 2 0 1 312 379 692 PKN2 TRCN0000006252 709 122 785 300 456 970 PKN2 TRCN0000006253 0 0 0 0 0 25 PKN2 TRCN0000006254 0 0 0 13 19 0 PKN2

110

TRCN0000006255 0 0 4 0 151 2 PRKDC TRCN0000006256 104 0 117 0 71 191 PRKDC TRCN0000006257 1 0 39 46 65 195 PRKDC TRCN0000006258 128 596 138 803 396 567 PRKDC TRCN0000006259 167 197 194 44 2 45 PRKDC TRCN0000006260 0 47 9 2 102 4 PDK1 TRCN0000006261 0 0 0 0 0 0 PDK1 TRCN0000006262 218 761 1023 235 1768 682 PDK1 TRCN0000006263 177 577 517 375 750 761 PDK1 TRCN0000006264 168 153 140 166 90 99 PDK4 TRCN0000006265 4 126 543 1 0 73 PDK4 TRCN0000006266 0 58 36 0 6 0 PDK4 TRCN0000006267 468 683 1972 1596 1929 1752 PDK4 TRCN0000006268 681 3 368 223 129 137 PDK4 TRCN0000006269 9 460 620 769 1251 1406 STK25 TRCN0000006270 2 0 0 257 284 1 STK25 TRCN0000006271 2 0 118 103 407 96 STK25 TRCN0000006272 898 2132 1721 221 1509 561 STK25 TRCN0000006273 0 9 46 24 0 42 STK25 TRCN0000006274 29 66 41 21 13 46 SRPK2 TRCN0000006275 409 222 92 84 249 270 SRPK2 TRCN0000006276 9981 20040 17683 16501 20214 33768 SRPK2 TRCN0000006277 0 1 0 24 52 108 SRPK2 TRCN0000006278 111 2 204 289 235 245 SRPK2 TRCN0000006284 512 2 180 71 147 253 TAF1 TRCN0000006285 2 527 374 0 315 2 TAF1 TRCN0000006286 0 362 372 290 422 589 TAF1 TRCN0000006287 2 562 474 2023 4255 6931 TAF1 TRCN0000006288 0 0 57 1 2 201 TAF1 TRCN0000006289 0 93 35 0 0 0 BRAF TRCN0000006290 7 231 124 127 84 240 BRAF TRCN0000006291 0 0 0 0 145 0 BRAF TRCN0000006292 19 141 93 40 72 114 BRAF TRCN0000006293 0 0 1 46 6 130 BRAF TRCN0000006294 5 308 44 553 1029 1229 PRKCH TRCN0000006295 61 1 16 87 203 76 PRKCH TRCN0000006296 0 2 43 26 59 0 PRKCH TRCN0000006297 1330 4328 3794 4587 8011 7972 PRKCH TRCN0000006298 818 634 648 735 459 799 PRKCH TRCN0000006303 0 378 0 217 528 602 BRDT TRCN0000006304 389 263 1 21 156 27 BRDT

111

TRCN0000006305 0 0 0 7 1204 920 BRDT TRCN0000006306 2 99 183 262 302 798 BRDT TRCN0000006307 0 0 0 135 89 0 BRDT TRCN0000006308 311 30 340 37 589 178 BRD2 TRCN0000006309 0 42 0 56 7 44 BRD2 TRCN0000006310 144 30 136 12 0 111 BRD2 TRCN0000006311 1503 675 536 2587 6585 4792 BRD2 TRCN0000006312 257 1 0 97 304 0 BRD2 TRCN0000006313 0 0 0 189 108 55 CIT TRCN0000006314 106 675 325 708 722 1533 CIT TRCN0000006315 0 0 0 1 0 0 CIT TRCN0000006316 194 49 191 646 778 1743 CIT TRCN0000006317 0 0 0 0 0 0 CIT TRCN0000006318 0 1 30 0 30 104 FASTK TRCN0000006319 2 152 31 119 527 374 FASTK TRCN0000006320 0 0 1 0 0 0 FASTK TRCN0000006321 0 0 0 57 0 32 FASTK TRCN0000006322 0 0 0 34 43 30 FASTK TRCN0000006323 0 0 0 59 0 0 ICK TRCN0000006324 2 131 228 162 138 194 ICK TRCN0000006325 39 2 55 49 324 451 ICK TRCN0000006326 0 2 1 1 189 222 ICK TRCN0000006327 737 20 155 755 9 1747 ICK TRCN0000006328 622 207 720 526 373 1363 MARK1 TRCN0000006329 558 1551 1665 327 262 667 MARK1 TRCN0000006330 8 23 42 8 111 39 MARK1 TRCN0000006331 32 0 1 6 0 33 MARK1 TRCN0000006332 235 458 0 28 318 615 MARK1 TRCN0000006333 301 231 0 182 769 540 CDK18 TRCN0000006334 62 55 40 39 16 53 CDK18 TRCN0000006335 37 56 102 167 166 196 CDK18 TRCN0000006336 0 0 0 47 43 49 CDK18 TRCN0000006337 20 6 17 51 47 144 CDK18 TRCN0000006343 8 145 112 91 242 262 PRKY TRCN0000006344 133 1 22 7 368 52 PRKY TRCN0000006345 131 197 113 325 244 334 PRKY TRCN0000006346 0 65 6 36 97 186 PRKY TRCN0000006347 0 0 0 0 0 0 RIPK2 TRCN0000006348 426 16 591 228 138 478 RIPK2 TRCN0000006349 133 1070 360 512 864 839 RIPK2 TRCN0000006350 857 0 0 0 36 959 RIPK2

112

TRCN0000006351 21 270 4 391 1351 949 RIPK2 TRCN0000006352 735 737 131 88 346 0 RPS6KA2 TRCN0000006353 450 114 199 2 0 68 RPS6KA2 TRCN0000006354 1 28 14 35 28 11 RPS6KA2 TRCN0000006355 0 95 484 54 298 139 RPS6KA2 TRCN0000006356 114 144 136 34 6 36 TTK TRCN0000006357 879 1142 1724 490 952 2078 TTK TRCN0000006358 0 0 0 27 53 0 TTK TRCN0000006359 61 0 0 0 11 0 BMX TRCN0000006360 4 0 0 59 85 4 BMX TRCN0000006361 0 0 0 24 8 58 BMX TRCN0000006362 2326 2010 1517 2591 1546 4314 BMX TRCN0000006363 79 64 817 390 743 1585 BMX TRCN0000006364 272 90 739 69 91 34 TWF1 TRCN0000006365 338 1239 1336 1742 623 2059 TWF1 TRCN0000006366 0 0 0 0 0 162 TWF1 TRCN0000006367 50 20 0 15 33 3 TWF1 TRCN0000006388 0 93 52 45 225 226 PRKAG3 TRCN0000006389 33 0 2 233 244 430 PRKAG3 TRCN0000006390 472 284 225 340 448 240 PRKAG3 TRCN0000006391 0 407 196 117 143 398 PRKAG3 TRCN0000006398 59 5 79 89 1 1331 EPHA1 TRCN0000006399 1709 2094 2141 729 921 1956 EPHA1 TRCN0000006401 78 214 286 311 358 610 EPHA1 TRCN0000006402 9 388 573 1147 629 1034 EPHA1 TRCN0000006403 6718 12873 11244 9069 11588 15231 EPHA2 TRCN0000006404 0 0 0 5 0 0 EPHA2 TRCN0000006405 322 247 60 341 379 368 EPHA2 TRCN0000006406 2517 1687 2012 3687 1535 3241 EPHA2 TRCN0000006407 19484 28404 21112 30242 39304 59529 EPHA2 TRCN0000006408 469 494 601 614 617 2312 EPHA3 TRCN0000006409 1 31 26 130 118 195 EPHA3 TRCN0000006410 105 2 175 344 146 133 EPHA3 TRCN0000006411 11033 16577 18799 8711 9082 11602 EPHA3 TRCN0000006412 0 68 147 133 176 625 EPHA3 TRCN0000006413 713 1941 2817 666 1337 3329 EPHA5 TRCN0000006414 149 421 322 415 95 1024 EPHA5 TRCN0000006415 164 159 213 110 165 237 EPHA5 TRCN0000006416 4 505 168 116 32 338 EPHA5 TRCN0000006417 65 202 181 85 37 145 EPHA5 TRCN0000006418 692 653 920 1179 1416 2389 EPHA7

113

TRCN0000006419 244 177 267 179 225 456 EPHA7 TRCN0000006420 1168 23 1098 200 176 273 EPHA7 TRCN0000006421 338 463 476 543 691 957 EPHA7 TRCN0000006422 73 61 86 23 34 136 EPHB2 TRCN0000006423 0 1 38 176 349 2 EPHB2 TRCN0000006424 1 1 52 58 53 356 EPHB2 TRCN0000006425 1 0 0 43 101 84 EPHB2 TRCN0000006426 1 14 211 32 18 207 EPHB2 TRCN0000006427 2674 1088 2286 2025 2362 2713 EPHB3 TRCN0000006428 0 0 0 8 0 160 EPHB3 TRCN0000006429 462 422 634 211 395 432 EPHB3 TRCN0000006430 1383 835 530 781 1496 1877 EPHB3 TRCN0000006431 2541 864 525 424 1680 1137 PTK7 TRCN0000006432 182 514 240 10 1 18 PTK7 TRCN0000006433 171 183 3 252 0 466 PTK7 TRCN0000006434 405 874 332 287 225 735 PTK7 TRCN0000006435 62 141 428 170 139 647 PTK7 TRCN0000006986 0 0 41 88 50 10 STK36 TRCN0000006987 31 352 185 196 681 481 STK36 TRCN0000006988 163 389 50 107 122 119 STK36 TRCN0000006989 5490 5206 4594 5374 9259 7922 STK36 TRCN0000006990 797 162 202 685 455 1667 STK36 TRCN0000006991 1329 1079 1216 507 993 796 CDC2L2 TRCN0000006992 794 1080 184 755 1372 1232 CDC2L2 TRCN0000006993 0 0 0 0 0 0 CDC2L2 TRCN0000006994 460 844 832 152 73 213 CDC2L2 TRCN0000006995 0 4 99 215 220 230 CDC2L2 TRCN0000006996 488 632 723 98 189 3438 HIPK4 TRCN0000006997 321 40 362 322 291 457 HIPK4 TRCN0000006998 285 1140 480 447 248 519 HIPK4 TRCN0000006999 0 193 152 84 195 0 HIPK4 TRCN0000007000 0 0 24 34 94 206 HIPK4 TRCN0000007005 698 1101 1934 1228 593 267 MAP2K2 TRCN0000007006 271 111 189 122 33 29 MAP2K2 TRCN0000007007 0 72 168 39 62 61 MAP2K2 TRCN0000007008 5 249 2 413 107 486 MAP2K2 TRCN0000007019 970 300 766 4158 5920 8376 WNK4 TRCN0000007020 79 830 309 283 143 843 WNK4 TRCN0000007021 369 322 0 110 186 283 WNK4 TRCN0000007022 0 29 0 211 358 683 WNK4 TRCN0000007023 1 106 0 20 6 132 WNK4

114

TRCN0000007024 26 1060 133 91 127 1340 CSNK1A1L TRCN0000007025 85 21 0 3 106 145 CSNK1A1L TRCN0000007026 0 106 61 342 6 408 CSNK1A1L TRCN0000007027 645 104 0 105 3 110 CSNK1A1L TRCN0000007028 0 0 51 57 26 86 CSNK1A1L TRCN0000007038 0 77 0 0 35 192 LRRK1 TRCN0000007039 125 2 21 91 113 149 LRRK1 TRCN0000007040 563 144 707 290 1087 513 LRRK1 TRCN0000007041 16 12 27 20 26 127 LRRK1 TRCN0000007042 0 244 3 142 416 135 LRRK1 TRCN0000007043 0 0 0 23 31 16 STK32C TRCN0000007044 0 6 5 3 15 0 STK32C TRCN0000007045 0 0 0 0 0 0 STK32C TRCN0000007046 182 111 138 373 398 650 STK32C TRCN0000007047 0 0 0 47 183 147 STRADA TRCN0000007048 14 4 19 0 41 1 STRADA TRCN0000007049 338 481 463 76 47 239 STRADA TRCN0000007050 0 0 0 0 0 0 STRADA TRCN0000007051 0 61 59 145 2 49 STRADA TRCN0000007052 3 5 87 65 482 404 PASK TRCN0000007053 6 183 153 591 910 1626 PASK TRCN0000007054 313 1818 1400 1189 579 1490 PASK TRCN0000007055 192 110 167 94 69 176 PASK TRCN0000007056 127 339 348 0 227 228 TLK1 TRCN0000007057 118 2 69 204 276 228 TLK1 TRCN0000007058 45 11 33 32 39 72 TLK1 TRCN0000007059 2589 5856 5596 2233 5250 7497 TLK1 TRCN0000007060 0 0 0 50 0 0 TLK1 TRCN0000007061 0 0 0 9 61 25 KSR2 TRCN0000007062 384 2 113 4001 150 136 KSR2 TRCN0000007063 17 30 29 8 12 0 KSR2 TRCN0000007064 0 0 0 99 210 62 KSR2 TRCN0000007065 492 1325 558 244 328 428 KSR2 TRCN0000007067 0 0 9 3 29 66 SRPK3 TRCN0000007068 165 516 461 712 739 1725 SRPK3 TRCN0000007069 0 60 0 0 132 2 MGC42105 TRCN0000007070 0 38 27 72 62 72 MGC42105 TRCN0000007071 1575 2020 1829 2361 3012 5635 MGC42105 TRCN0000007072 51 16 65 47 249 65 STRADB TRCN0000007074 33 25 29 46 34 33 STRADB TRCN0000007075 728 2196 2027 623 856 1144 STRADB

115

TRCN0000007076 461 245 569 888 1660 2315 STRADB TRCN0000007077 22 354 242 863 984 1012 TBCK TRCN0000007078 410 542 686 231 228 305 TBCK TRCN0000007079 2363 5288 3890 1308 1083 1437 TBCK TRCN0000007080 1753 655 1931 1142 1440 1539 TBCK TRCN0000007081 831 376 264 263 611 972 TBCK TRCN0000007082 0 61 69 66 70 325 RPS6KL1 TRCN0000007083 40 105 144 252 281 404 RPS6KL1 TRCN0000007085 76 262 128 438 570 837 RPS6KL1 TRCN0000007087 276 980 537 657 839 1541 NEK8 TRCN0000007088 0 2 71 17 2 191 NEK8 TRCN0000007089 0 0 11 3 0 0 NEK8 TRCN0000007090 0 0 0 22 29 0 NEK8 TRCN0000007091 73 3 0 4 59 33 NEK8 TRCN0000007100 114 0 200 1 195 56 PINK1 TRCN0000007101 29 44 1 13 33 2 PINK1 TRCN0000007102 4 990 888 3 43 0 MAP3K13 TRCN0000007103 0 0 4 1 2 0 MAP3K13 TRCN0000007104 0 0 0 20 23 81 MAP3K13 TRCN0000007105 308 572 421 475 217 728 MAP3K13 TRCN0000007106 1898 1914 2891 2126 4608 2521 MAP3K13 TRCN0000007107 22 12 12 7 10 45 PAK7 TRCN0000007108 32 2 123 64 210 223 PAK7 TRCN0000007109 48 24 234 256 54 267 PAK7 TRCN0000007110 2 179 192 259 116 618 PAK7 TRCN0000007111 2 98 43 156 369 850 PAK7 TRCN0000007123 2008 1117 1281 849 755 2199 SCYL1 TRCN0000007124 0 0 70 264 2 162 SCYL1 TRCN0000007125 158 155 77 49 68 276 SCYL1 TRCN0000007126 0 0 96 0 32 42 SCYL1 TRCN0000007127 0 0 0 28 98 44 STK32A TRCN0000007128 7 2 1 7 0 5 STK32A TRCN0000007129 445 798 438 892 542 1348 STK32A TRCN0000007130 640 4717 1209 559 496 881 STK32A TRCN0000007131 41 118 68 14 60 85 STK32A TRCN0000007132 1 0 0 5 72 5 RIPK4 TRCN0000007133 297 572 585 686 796 1360 RIPK4 TRCN0000007134 2 188 82 71 58 58 RIPK4 TRCN0000007135 49 2 94 62 197 148 RIPK4 TRCN0000007136 25 30 46 86 115 182 RIPK4 TRCN0000007142 1 0 13 79 138 145 TRIB2

116

TRCN0000007143 0 0 0 15 0 0 TRIB2 TRCN0000007144 0 10 10 0 3 5 TRIB2 TRCN0000007145 1 5 198 192 401 536 TRIB2 TRCN0000007147 6 1038 1325 170 308 203 SCYL2 TRCN0000007148 0 9 67 44 3 41 SCYL2 TRCN0000007149 18 141 0 13 0 0 SCYL2 TRCN0000007150 0 0 1 16 31 21 SCYL2 TRCN0000007151 0 4 3 8 13 7 SCYL2 TRCN0000007156 2 1 1 1 1202 545 MARK4 TRCN0000007157 0 75 13 52 23 130 MARK4 TRCN0000007158 164 259 258 54 107 0 MARK4 TRCN0000007159 7 4 82 811 687 572 MARK4 TRCN0000007160 156 0 186 330 402 1045 MARK4 TRCN0000007161 0 0 0 205 0 87 HIPK1 TRCN0000007162 5 9 360 67 435 741 HIPK1 TRCN0000007163 96 361 360 293 432 775 HIPK1 TRCN0000007164 294 1233 1985 1642 2843 3421 HIPK1 TRCN0000007165 138 765 474 504 1788 914 HIPK1 TRCN0000007325 0 264 0 0 142 179 NPR1 TRCN0000007326 4 78 0 3 14 44 NPR1 TRCN0000007327 0 56 48 333 23 310 NPR1 TRCN0000007328 204 301 145 1 84 254 NPR1 TRCN0000007329 37 271 102 283 311 484 NPR1 TRCN0000009819 2 8 293 2 2 381 AKT2 TRCN0000009820 3 1182 262 81 0 0 AKT2 TRCN0000009826 3 74 16 37 55 8 CHEK1 TRCN0000009827 0 0 0 0 0 36 CHEK1 TRCN0000009828 0 1 0 4 3 3 CHEK1 TRCN0000009835 9 3 7 6 8 16 ERBB3 TRCN0000009836 1 0 0 0 3 3 ERBB4 TRCN0000009850 86 152 312 223 1411 299 MET TRCN0000009851 0 0 0 0 0 0 MET TRCN0000009863 20 83 109 25 51 157 RET TRCN0000009864 254 1377 818 2314 2443 1621 RET TRCN0000009866 0 1 0 2 2 1 SGK1 TRCN0000009867 467 811 182 178 468 961 SGK1 TRCN0000009876 111 0 4 426 701 765 CDK4 TRCN0000009877 0 0 0 1 0 0 CDK6 TRCN0000009878 0 0 58 0 124 385 CDK6 TRCN0000009885 104 335 499 109 174 16 PRKAR1A TRCN0000009886 350 0 2 223 115 62 FLT3

117

TRCN0000009887 102 256 214 290 366 636 FLT3 TRCN0000009888 0 0 0 0 0 0 FLT3 TRCN0000009935 2964 4181 4028 4627 5236 8708 BTK TRCN0000009936 0 0 0 77 1 123 BTK TRCN0000009938 349 634 321 168 346 518 BTK TRCN0000009942 8 654 1242 1081 1999 877 CHEK1 TRCN0000009944 0 0 22 17 24 126 DAPK3 TRCN0000009945 818 1531 1135 229 199 617 DAPK3 TRCN0000009946 584 441 170 252 180 191 CHEK1 TRCN0000009947 0 0 0 57 31 0 CHEK1 TRCN0000009948 15 83 89 88 64 267 CHEK1 TRCN0000009949 0 86 0 21 44 60 CHEK1 TRCN0000009954 0 0 100 163 1 6 DAPK3 TRCN0000009955 0 0 0 3 15 49 CSNK1E TRCN0000009957 1552 1847 1604 1490 1863 2785 CSNK1E TRCN0000009958 4 110 85 151 149 265 DAPK3 TRCN0000009959 0 0 0 0 27 0 DAPK3 TRCN0000009960 684 1064 671 575 1064 908 CAMK4 TRCN0000009961 0 0 0 3 8 0 CAMK4 TRCN0000009962 3715 6224 4825 8675 11067 19488 CAMK4 TRCN0000009963 20 62 100 85 45 83 CAMK4 TRCN0000009964 3081 4565 3532 3874 49523 11175 CAMK4 TRCN0000009965 229 495 811 321 83 798 CSNK1E TRCN0000009966 0 0 17 0 0 40 CSNK1E TRCN0000009967 0 5 38 42 38 52 HCK TRCN0000009968 0 0 0 5 0 0 HCK TRCN0000009969 547 464 158 1052 765 2049 HCK TRCN0000009970 0 0 95 33 0 26 HCK TRCN0000009971 0 169 30 6 80 69 HCK TRCN0000009972 0 0 29 98 0 87 MAPK11 TRCN0000009973 4 172 31 43 38 116 MAPK13 TRCN0000009974 0 0 51 5 26 0 MAP2K3 TRCN0000009975 107 27 5 35 58 94 MAP2K3 TRCN0000009976 0 237 22 38 0 146 MAPK11 TRCN0000009977 0 0 0 0 1 0 MAPK11 TRCN0000009978 368 287 209 88 306 266 MAPK13 TRCN0000009979 0 78 45 119 96 380 MAPK13 TRCN0000009980 916 563 256 2 596 52 MAPK13 TRCN0000009981 0 12 92 80 111 42 MAPK13 TRCN0000009982 48 23 115 48 22 70 TEC TRCN0000009983 24 889 591 764 626 777 TEC

118

TRCN0000009984 0 0 0 0 15 43 TEC TRCN0000009985 0 0 8 104 61 123 MAP2K3 TRCN0000009986 0 0 5 0 0 0 MAP2K3 TRCN0000009987 0 0 41 10 32 8 MAP2K6 TRCN0000009988 340 3 113 124 411 415 MAP2K6 TRCN0000009989 0 43 0 0 1 38 MAP2K6 TRCN0000009990 2 32 52 185 62 78 MAP2K6 TRCN0000009991 2 0 215 217 115 74 MAP2K6 TRCN0000009992 6 8 11 0 5 15 TEC TRCN0000009993 623 1587 885 214 329 259 TEC TRCN0000009994 0 7 0 2 4 18 CAMK1 TRCN0000009996 101 92 204 9 127 143 CSK TRCN0000009997 32 47 50 81 79 108 TXK TRCN0000009998 536 564 414 765 1401 827 TXK TRCN0000009999 0 3 49 0 33 101 TXK TRCN0000010000 1 21 22 178 142 250 CAMK1 TRCN0000010001 9 12 2 1 15 18 CAMK1 TRCN0000010002 443 1 74 33 11 151 CAMK1 TRCN0000010003 2 1 8 15 46 83 CSK TRCN0000010004 0 141 1 23 41 0 YES1 TRCN0000010005 1 373 3 76 160 565 YES1 TRCN0000010006 0 3 470 245 0 120 YES1 TRCN0000010007 47 0 29 7 55 0 CSK TRCN0000010008 218 207 193 115 93 82 CSK TRCN0000010009 18 13 48 32 36 287 CSK TRCN0000010010 0 8 0 11 0 0 MAP3K8 TRCN0000010011 203 36 54 0 24 13 MAP3K8 TRCN0000010012 69 14 43 27 40 97 MAP3K8 TRCN0000010013 0 54 0 15 0 0 MAP3K8 TRCN0000010014 0 0 0 6 9 38 MAP3K8 TRCN0000010015 0 0 0 0 0 0 YES1 TRCN0000010019 318 656 89 8 0 79 YES1 TRCN0000010020 0 4 107 0 195 213 ITK TRCN0000010021 0 252 334 196 236 446 ITK TRCN0000010022 104 158 121 127 176 321 ITK TRCN0000010023 2539 3328 1721 4352 4504 7331 ITK TRCN0000010026 0 0 46 39 0 23 PRKG1 TRCN0000010027 0 0 0 0 0 0 IKBKE TRCN0000010030 319 1777 809 1750 3161 1435 PRKG1 TRCN0000010032 46 19 103 56 107 195 PRKG1 TRCN0000010033 434 1996 719 349 490 637 PRKG1

119

TRCN0000010034 8 24 46 202 203 220 IKBKE TRCN0000010035 25 0 2 20 68 81 IKBKE TRCN0000010036 0 0 0 0 0 6 IKBKE TRCN0000010037 2 0 48 19 24 55 IKBKE TRCN0000010039 308 317 271 25 1 1115 MAPK1 TRCN0000010040 251 147 195 38 334 33 MAPK1 TRCN0000010041 46 1 98 434 1150 1576 MAPK1 TRCN0000010049 0 21 26 6 10 6 MAPK1 TRCN0000010050 0 0 0 0 2 42 MAPK1 TRCN0000010051 3 198 128 0 90 45 MAPK14 TRCN0000010052 0 0 2 305 78 539 MAPK14 TRCN0000010053 7851 9017 11331 11913 14763 19940 MAPK14 TRCN0000010054 0 0 10 0 0 52 MAPK14 TRCN0000010056 68 48 107 53 179 122 PHKG2 TRCN0000010065 0 42 92 59 366 699 PHKG2 TRCN0000010068 8 23 15 0 6 15 PHKG2 TRCN0000010069 0 10 19 143 115 352 PHKG2 TRCN0000010074 93 0 42 193 503 577 CDK6 TRCN0000010075 0 4 70 0 33 1 BLK TRCN0000010081 0 6 0 10 182 32 CDK6 TRCN0000010082 2150 3953 1898 1470 3173 4145 CDK6 TRCN0000010083 0 0 0 0 0 19 BLK TRCN0000010084 0 0 0 0 4 5 DDR1 TRCN0000010085 0 0 0 0 0 265 DDR1 TRCN0000010086 0 0 0 0 0 0 BLK TRCN0000010087 25 0 4 66 4 54 BLK TRCN0000010094 0 0 0 0 0 0 DDR1 TRCN0000010095 102 21 0 0 0 81 FRK TRCN0000010096 0 2 28 30 17 63 FRK TRCN0000010097 2 161 0 106 438 429 FRK TRCN0000010098 0 0 0 0 0 0 FRK TRCN0000010101 0 0 27 0 56 0 LYN TRCN0000010104 2 864 4 63 2 39 LYN TRCN0000010105 0 0 4 80 4 0 LYN TRCN0000010106 81 0 98 64 131 278 LYN TRCN0000010107 0 1 0 32 4 350 LYN TRCN0000010113 4 1077 447 263 89 428 PRKCZ TRCN0000010114 680 1364 1047 68 1541 486 PRKCZ TRCN0000010115 347 388 48 167 2 178 PIM1 TRCN0000010116 0 0 0 0 0 0 PIM1 TRCN0000010117 0 0 0 0 0 0 PIM1

120

TRCN0000010118 0 0 0 0 0 0 PIM1 TRCN0000010119 0 13 21 10 47 0 PIM1 TRCN0000010121 1422 1476 1219 138 374 439 PRKCZ TRCN0000010139 0 2 11 22 3 26 STK19 TRCN0000010140 0 0 19 0 0 0 STK19 TRCN0000010141 154 16 1 6 0 0 STK19 TRCN0000010149 0 0 0 0 0 0 STK19 TRCN0000010150 63 88 68 67 73 185 STK19 TRCN0000010151 143 61 106 70 105 169 ACVR1B TRCN0000010152 0 0 10 27 4 0 ACVR1B TRCN0000010153 2 394 13 0 119 0 EPHA4 TRCN0000010154 51 2 99 32 63 65 STK17B TRCN0000010155 1072 630 807 535 776 1356 STK17B TRCN0000010156 0 0 0 0 0 0 STK17B TRCN0000010157 0 0 0 0 0 0 STK17B TRCN0000010158 0 0 21 0 62 16 STK17B TRCN0000010159 108 42 44 40 0 56 ACVR1B TRCN0000010160 345 147 283 235 319 476 ACVR1B TRCN0000010161 156 63 135 71 76 228 EPHA4 TRCN0000010162 1 90 61 6 69 1 AKT1 TRCN0000010163 0 0 0 0 0 163 AKT1 TRCN0000010164 0 0 0 0 8 0 EPHA4 TRCN0000010165 0 0 0 24 0 0 EPHA4 TRCN0000010171 0 0 0 4 0 0 AKT1 TRCN0000010174 0 0 0 0 0 0 AKT1 TRCN0000010175 0 31 20 26 21 43 LCK TRCN0000010176 0 0 0 4 0 0 LCK TRCN0000010177 364 460 417 583 420 1386 LCK TRCN0000010178 20 84 205 105 58 180 LCK TRCN0000010181 1 1 1 1 0 3 AKT3 TRCN0000010183 0 0 0 6 14 1 BCKDK TRCN0000010184 5 1 0 57 3 378 AKT3 TRCN0000010185 0 0 0 1 0 0 AKT3 TRCN0000010186 51 150 35 49 1 0 AKT3 TRCN0000010187 4 2 90 0 0 42 AKT3 TRCN0000010192 0 0 0 0 0 14 BCKDK TRCN0000010193 0 0 0 0 1 1 PRKCD TRCN0000010194 0 30 72 54 143 92 PRKCD TRCN0000010195 0 0 0 30 23 0 BCKDK TRCN0000010196 0 46 12 16 0 82 BCKDK TRCN0000010197 0 0 8 11 1 0 PAK4

121

TRCN0000010198 606 892 609 327 1683 1279 PAK4 TRCN0000010199 0 74 32 65 32 49 PAK4 TRCN0000010200 32 80 119 15 66 20 PAK4 TRCN0000010201 1 0 0 0 0 0 PAK4 TRCN0000010202 1 95 151 111 506 349 PRKCD TRCN0000010203 0 0 23 40 160 0 PRKCD TRCN0000010204 0 0 1 174 119 394 VRK2 TRCN0000010205 0 100 66 240 172 538 VRK2 TRCN0000010206 0 0 0 0 0 0 VRK2 TRCN0000010207 0 2 0 40 43 0 VRK2 TRCN0000010208 120 687 1058 216 312 660 VRK2 TRCN0000010209 764 1371 1357 1168 1997 3577 CHEK2 TRCN0000010210 1050 1192 1466 1621 2214 3395 CHEK2 TRCN0000010211 7182 10151 7527 13905 18234 25145 CHEK2 TRCN0000010212 335 1147 726 531 830 997 CHEK2 TRCN0000010213 1 0 18 24 24 29 CHEK2 TRCN0000010214 4 154 84 165 266 155 STK38 TRCN0000010215 20 0 0 0 0 1 STK38 TRCN0000010216 1741 1608 1591 1752 2747 4333 STK38 TRCN0000010228 0 72 127 41 174 93 VRK3 TRCN0000010229 0 0 12 273 252 204 EIF2AK1 TRCN0000010230 0 0 147 0 66 29 EIF2AK1 TRCN0000010231 78 72 0 0 20 0 EIF2AK1 TRCN0000010232 0 0 0 2 1 4 EIF2AK1 TRCN0000010233 3 132 241 79 149 245 EIF2AK1 TRCN0000010234 0 0 0 0 0 1 VRK3 TRCN0000010235 219 312 348 273 487 666 VRK3 TRCN0000010236 1 35 0 55 224 116 VRK3 TRCN0000010237 0 0 0 16 31 101 LIMK2 TRCN0000010238 0 0 0 1 0 0 RET TRCN0000010239 0 0 0 7 38 117 RET TRCN0000010240 1 0 0 4 95 40 LIMK2 TRCN0000010241 173 0 0 0 0 0 LIMK2 TRCN0000010242 7 296 11372 46 41 59 LIMK2 TRCN0000010248 222 217 84 101 226 302 RET TRCN0000010249 534 339 658 269 209 315 CDK16 TRCN0000010250 20 114 27 52 149 113 CDK16 TRCN0000010251 0 0 0 9 0 0 CDK16 TRCN0000010252 0 0 0 79 1 38 RET TRCN0000010253 3 218 95 192 115 557 CAMKV TRCN0000010254 0 0 0 0 0 19 CAMKV

122

TRCN0000010255 0 0 0 0 7 5 CAMKV TRCN0000010256 20 30 22 4 0 0 CAMKV TRCN0000010257 182 516 430 492 453 959 CAMKV TRCN0000010258 0 13 0 1 0 9 CDK16 TRCN0000010259 0 202 55 0 285 111 CDK16 TRCN0000010261 10 5 0 48 111 49 MAPK7 TRCN0000010262 0 0 11 7 0 11 MAPK7 TRCN0000010271 114 172 44 95 147 210 MAPK7 TRCN0000010272 4 6 15 13 1 0 SGK3 TRCN0000010273 3 193 82 157 374 695 SGK3 TRCN0000010274 0 98 54 129 54 192 SGK3 TRCN0000010275 0 0 0 0 0 80 MAPK7 TRCN0000010276 1081 899 1841 2367 6836 8134 MAPK9 TRCN0000010277 0 40 0 0 0 0 MAPK9 TRCN0000010278 134 253 24 131 167 614 MAPK9 TRCN0000010279 1 391 58 979 875 1058 MAPK9 TRCN0000010280 25 9 10 0 6 7 MAPK9 TRCN0000010281 0 9 41 0 10 28 SGK3 TRCN0000010282 0 2 11 13 137 90 SGK3 TRCN0000010283 0 0 18 0 0 48 CAMK2A TRCN0000010284 87 155 125 80 62 148 CAMK2A TRCN0000010285 0 0 0 26 0 16 CAMK2A TRCN0000010286 0 0 81 31 19 14 CAMK2A TRCN0000010292 3 401 48 49 6 136 AKT3 TRCN0000010299 2289 4894 4575 866 903 1923 ATM TRCN0000010300 0 1 0 0 0 0 ATR TRCN0000010301 0 0 0 0 2 0 ATR TRCN0000010302 7 669 350 41 409 636 ATR TRCN0000010307 461 3 126 184 362 187 BUB1 TRCN0000010308 3 532 0 146 219 123 BUB1 TRCN0000010309 375 737 1342 1548 1396 2213 BUB1 TRCN0000010312 410 489 457 363 634 1044 CHEK2 TRCN0000010313 84 14 68 124 4 0 CHEK2 TRCN0000010314 94 1 7 11 43 143 CHEK2 TRCN0000010329 0 0 1 0 0 0 EGFR TRCN0000010339 1327 3184 2862 3819 4528 6946 GSK3A TRCN0000010340 0 0 0 0 0 0 GSK3A TRCN0000010341 0 0 0 0 0 380 ERBB2 TRCN0000010342 1 0 1 0 0 0 ERBB2 TRCN0000010343 1 0 2 0 1 1 ERBB2 TRCN0000010344 0 4 1 2 1 3 ERBB3

123

TRCN0000010345 168 816 461 25 83 2 ERBB4 TRCN0000010361 316 896 1242 1405 835 1138 IGF1R TRCN0000010379 0 0 2 143 6 43 MET TRCN0000010413 983 398 2114 293 5 713 PDPK1 TRCN0000010414 0 0 0 0 0 0 PDPK1 TRCN0000010423 0 0 0 0 2 5 RET TRCN0000010426 0 49 0 18 46 24 RPS6KA1 TRCN0000010427 412 559 1130 276 101 715 RPS6KA1 TRCN0000010429 393 474 1431 451 981 949 RPS6KA3 TRCN0000010432 0 139 34 317 348 0 SGK1 TRCN0000010441 0 0 2 0 187 0 TGFBR1 TRCN0000010442 0 0 0 0 0 0 TGFBR1 TRCN0000010443 0 0 0 4 0 0 TGFBR1 TRCN0000010444 0 0 9 0 0 102 TGFBR2 TRCN0000010445 0 0 0 0 0 0 TGFBR2 TRCN0000010446 0 0 0 1 1 1 TGFBR2 TRCN0000010469 0 0 0 1 0 0 CDK2 TRCN0000010470 262 208 76 10 178 78 CDK2 TRCN0000010471 6 112 1 516 876 3076 CDK2 TRCN0000010472 0 0 0 0 0 0 CDK4 TRCN0000010473 45 91 0 22 166 6 CDK6 TRCN0000010495 0 202 0 0 17 0 MAP2K4 TRCN0000010496 0 0 0 16 12 166 MAP2K4 TRCN0000010519 217 766 636 525 1375 1622 ACVRL1 TRCN0000010520 2 4 143 71 156 240 CDK4 TRCN0000010521 4 599 11 289 235 476 FGFR3 TRCN0000010523 57 70 2 76 132 101 INSR TRCN0000010525 227 396 390 763 1077 1167 CDK3 TRCN0000010527 35 237 282 202 143 616 IRAK2 TRCN0000010528 0 0 0 21 0 0 DDR1 TRCN0000010529 273 0 144 86 55 2 FES TRCN0000010530 79 761 218 155 476 350 FGFR4 TRCN0000010531 2 176 180 3 248 219 FGFR4 TRCN0000010532 74 99 71 21 139 107 DYRK3 TRCN0000010533 0 1 64 0 128 0 AURKA TRCN0000010534 0 28 5 52 69 62 MAP4K3 TRCN0000010539 0 139 0 0 237 379 RPS6KB2 TRCN0000010540 0 0 0 29 1 15 RPS6KB2 TRCN0000010541 2499 822 1178 25910 4478 5325 RPS6KB2 TRCN0000010542 3 313 104 0 119 0 MAP3K14 TRCN0000010543 0 214 442 90 55 50 CLK2

124

TRCN0000010544 41 326 319 138 357 227 PTK2B TRCN0000010545 235 458 203 303 542 793 PTK2B TRCN0000010546 25 0 0 3 11 31 FLT3 TRCN0000010547 2 0 2 32 128 50 AURKB TRCN0000010548 109 299 162 81 413 645 STK17B TRCN0000010549 2 1 5 89 177 555 BUB1 TRCN0000010550 0 0 0 0 0 0 CSNK1G3 TRCN0000010551 0 0 0 0 0 0 GSK3B TRCN0000010552 1 112 496 98 16 120 GSK3B TRCN0000010553 35 0 0 120 87 75 LIMK1 TRCN0000010554 0 9 16 152 0 82 LIMK1 TRCN0000010555 0 0 37 8 0 0 LIMK1 TRCN0000010556 0 2 238 0 0 0 MAPK13 TRCN0000010557 85 103 443 30 52 207 GRK5 TRCN0000010558 0 309 243 134 117 400 MAP3K4 TRCN0000010559 1499 1457 2455 2510 4911 3839 CDC42BPB TRCN0000010560 47 79 40 204 172 437 PLK2 TRCN0000010561 0 54 82 99 100 110 TRIO TRCN0000010563 22577 17571 31326 736 691 1345 VRK3 TRCN0000010564 1 62 0 2 238 46 NEK9 TRCN0000010566 2 573 109 1 0 213 MYLK2 TRCN0000010567 983 556 209 851 706 1375 MYLK TRCN0000010568 841 654 919 110 0 575 MYLK TRCN0000010569 3 3 95 30 27 10 STK17A TRCN0000010580 77 169 72 87 1 171 MAPK8 TRCN0000010581 32 133 118 207 194 237 MAPK8 TRCN0000010586 0 209 0 378 133 273 MAP2K7 TRCN0000010587 44 0 56 62 59 91 MAP2K7 TRCN0000010588 0 0 0 0 0 0 MAP2K7 TRCN0000010603 80 0 42 200 95 45 NPR2 TRCN0000010605 2 214 203 332 291 513 CLK4 TRCN0000010606 7 1087 2721 275 1156 766 CSNK1G1 TRCN0000010607 0 0 0 43 180 271 CSNK1G1 TRCN0000010608 0 45 43 21 19 22 CSNK1G1 TRCN0000010609 0 46 0 37 0 0 CSNK1G1 TRCN0000010610 226 2 7 164 23 21 CSNK1G1 TRCN0000010611 216 223 57 349 187 479 DYRK1A TRCN0000010612 700 1331 2236 1276 948 1580 DYRK1A TRCN0000010613 0 82 64 40 48 126 DYRK1A TRCN0000010614 0 0 0 10 41 45 DYRK1A TRCN0000010615 0 0 0 0 0 0 DYRK1A

125

TRCN0000010617 267 831 386 430 602 1417 MAPK7 TRCN0000010618 2 203 76 0 73 180 GRK6 TRCN0000010619 254 0 434 32 0 0 GRK6 TRCN0000010620 1603 4697 3337 6432 9128 9780 PRKACA TRCN0000010624 196 220 316 584 786 1826 GRK1 TRCN0000010625 0 0 0 0 0 0 ROR2 TRCN0000010626 142 2 17 6219 8 108 ABL1 TRCN0000010632 1 2 40 0 3 37 LMTK2 TRCN0000010633 32 0 0 0 64 87 LMTK2 TRCN0000010634 1 31 21 33 1128 38 LMTK2 TRCN0000010635 544 2272 346 829 2854 2996 LMTK2 TRCN0000010636 43 69 138 18 14 30 LMTK2 TRCN0000010640 33 0 4 0 8 0 CSNK1D TRCN0000010641 0 2 151 0 5 182 MARK3 TRCN0000010642 195 305 372 1357 1687 1699 MAPK6 TRCN0000010643 0 0 1 7 0 0 OXSR1 TRCN0000010644 1018 1631 1671 598 1805 860 CSF1R TRCN0000010645 0 0 20 8 5 149 CSF1R TRCN0000010648 191 115 199 99 53 162 MOS TRCN0000010649 241 421 954 516 937 1513 MOS TRCN0000010650 2 0 0 48 0 0 MAST2 TRCN0000010651 33 543 0 211 47 597 EPHB4 TRCN0000010652 2451 2797 3641 2135 2838 4326 PRKX TRCN0000010653 176 176 215 382 427 1036 CDK10 TRCN0000010670 33 0 0 0 3 0 PRKD2 TRCN0000010671 0 101 102 50 124 74 NEK7 TRCN0000010672 409 653 792 429 581 1303 CSNK2A1 TRCN0000010673 54 349 3 827 331 637 CSNK2A1 TRCN0000010674 30 249 479 348 73 16 MAP3K10 TRCN0000010676 95 271 187 277 302 590 EPHB6 TRCN0000010677 53 445 468 203 100 219 EPHB6 TRCN0000010678 0 0 12 7 63 44 ADRBK2 TRCN0000010679 13585 28620 17527 20471 26459 28203 IRAK4 TRCN0000010682 268 205 352 1094 1489 1617 SGK2 TRCN0000010683 2 13 1 30 2 50 MUSK TRCN0000010691 72 44 100 31 90 253 ANKK1 TRCN0000010692 239 561 1350 362 345 763 MAP3K3 TRCN0000010693 2 46 157 129 282 175 PRKCG TRCN0000010694 67 71 7 41 25 123 AURKC TRCN0000010696 122 207 176 310 970 899 GRK7 TRCN0000010698 0 131 126 68 159 213 TSSK4

126

TRCN0000010760 0 64 0 18 38 102 JAK1 TRCN0000010761 1021 1726 1817 897 955 1983 PRKCB TRCN0000010765 170 150 30 60 127 322 INSRR TRCN0000010766 419 892 686 1164 1598 2955 HIPK2 TRCN0000010767 3 15 18 14 5 7 NUAK2 TRCN0000010818 0 1 1 0 0 2 CSNK2B TRCN0000010990 0 0 1 1 0 0 CSNK1A1 TRCN0000010997 15 4 20 15 28 32 MAPK3 TRCN0000010998 33 94 52 66 24 179 MAPK3 TRCN0000011000 770 935 627 473 408 1009 PHKA2 TRCN0000011002 13 2 107 179 198 411 PKMYT1 TRCN0000011003 38 67 160 55 55 75 PKMYT1 TRCN0000011004 224 721 971 1068 686 1546 MINK1 TRCN0000011005 66 40 8 37 58 32 MINK1 TRCN0000011006 0 20 0 0 0 0 PLK1 TRCN0000011007 2 276 139 968 600 581 PDK1 TRCN0000011010 94 107 0 102 214 346 RPS6KA2 TRCN0000011011 567 237 94 96 8 161 TTK TRCN0000011012 250 656 444 404 715 656 TTK TRCN0000011014 1625 2981 2558 2658 4920 5638 PRKAG3 TRCN0000011019 0 0 16 9 0 34 EPHA7 TRCN0000011020 39 0 8 24 0 33 EPHB3 TRCN0000011062 538 0 212 5 406 120 MAP2K2 TRCN0000011064 0 0 17 48 43 95 STK32C TRCN0000011065 82 24 26 25 6 40 PASK TRCN0000011066 4 217 20 127 134 157 SRPK3 TRCN0000011067 0 0 33 126 0 112 SRPK3 TRCN0000011068 281 138 93 142 316 140 MGC42105 TRCN0000011069 0 0 159 0 91 94 MGC42105 TRCN0000018327 3 42 40 775 1117 549 ERBB3 TRCN0000018328 4 258 613 422 847 348 ERBB4 TRCN0000018331 26 118 487 129 0 454 IGF1R TRCN0000018332 377 1385 1506 1967 4021 5223 INSR TRCN0000018364 0 0 4 0 1 0 CDK4 TRCN0000018369 1 0 1 1 3 7 PRKAR1A TRCN0000018915 95 56 102 139 123 325 IKBKB TRCN0000018916 0 0 23 14 108 123 IKBKB TRCN0000018917 88 448 319 295 393 279 IKBKB TRCN0000018918 90 290 233 258 682 1168 IKBKB TRCN0000018919 250 485 195 202 95 548 IKBKB TRCN0000021374 0 0 34 210 79 20 BRD3

127

TRCN0000021375 2402 3010 2111 1610 2650 1573 BRD3 TRCN0000021376 200 504 312 426 187 890 BRD3 TRCN0000021378 1081 978 980 986 1632 2833 BRD3 TRCN0000021384 0 58 0 19 62 78 EPHA10 TRCN0000021385 0 30 149 17 132 66 EPHA10 TRCN0000021386 0 0 29 22 0 3 EPHA10 TRCN0000021387 0 243 91 64 141 454 EPHA10 TRCN0000021388 15 50 33 39 36 69 EPHA10 TRCN0000021389 192 0 0 0 0 0 ALPK2 TRCN0000021390 538 695 543 341 10459 3654 ALPK2 TRCN0000021391 0 0 7 0 20 0 ALPK2 TRCN0000021394 0 0 8 8 173 0 ADCK2 TRCN0000021396 0 0 25 0 0 0 ADCK2 TRCN0000021397 0 0 42 0 53 35 ADCK2 TRCN0000021398 0 0 0 14 68 146 ADCK2 TRCN0000021404 11 951 359 1027 29 568 MAP3K15 TRCN0000021406 0 0 0 0 2 0 MAP3K15 TRCN0000021407 687 1236 1280 779 1253 2641 MAP3K15 TRCN0000021408 55 1 54 53 70 173 MAP3K15 TRCN0000021409 5 2 44 47 36 22 NEK5 TRCN0000021410 10 43 9 159 149 87 NEK5 TRCN0000021411 0 1 2 4 0 31 NEK5 TRCN0000021412 4 673 1210 0 2 668 NEK5 TRCN0000021413 0 0 152 20 25 143 NEK5 TRCN0000021419 0 32 13 1 18 36 TWF2 TRCN0000021421 0 0 0 0 0 0 TWF2 TRCN0000021422 0 210 5 130 36 79 TWF2 TRCN0000021423 0 23 31 16 69 137 TWF2 TRCN0000021424 563 813 817 816 1319 2113 BRD4 TRCN0000021426 33 59 42 4 6 10 BRD4 TRCN0000021428 162 29 48 202 62 98 BRD4 TRCN0000021459 217 593 357 1489 1558 2430 LRRK2 TRCN0000021460 65 168 95 145 46 4 LRRK2 TRCN0000021461 70 408 342 220 184 127 LRRK2 TRCN0000021462 2987 4630 4059 1127 1755 1559 LRRK2 TRCN0000021463 0 57 4 108 0 468 LRRK2 TRCN0000021464 0 25 0 28 192 346 CDK5 TRCN0000021465 488 304 121 120 277 169 CDK5 TRCN0000021466 0 0 20 20 51 84 CDK5 TRCN0000021467 0 40 52 0 22 14 CDK5 TRCN0000021468 2 0 0 85 0 0 CDK5

128

TRCN0000021469 0 38 1 15 70 15 CDC42BPG TRCN0000021470 83 198 510 213 125 469 CDC42BPG TRCN0000021471 147 330 698 110 327 398 CDC42BPG TRCN0000021472 387 2759 1516 1854 2345 3317 CDC42BPG TRCN0000021473 117 197 140 10 0 25 CDC42BPG TRCN0000021474 1 1 1 87 111 137 ALPK1 TRCN0000021475 518 559 540 407 530 614 ALPK1 TRCN0000021476 844 1467 1916 2022 4156 10884 ALPK1 TRCN0000021477 117 431 169 36 40 29 ALPK1 TRCN0000021478 1559 4058 2211 4184 5317 5489 ALPK1 TRCN0000021479 0 0 2 2 3 2 ADCK5 TRCN0000021480 0 0 0 0 0 0 ADCK5 TRCN0000021481 1159 12 477 498 577 1619 ADCK5 TRCN0000021482 49 0 95 180 17 180 ADCK5 TRCN0000021483 0 70 0 41 0 39 ADCK5 TRCN0000021494 3076 1471 3225 7441 10219 13465 MAP3K9 TRCN0000021495 31 27 218 47 221 183 MAP3K9 TRCN0000021496 11 0 31 10 4 33 MAP3K9 TRCN0000021497 0 0 92 66 0 0 MAP3K9 TRCN0000021498 286 417 666 316 683 833 MAP3K9 TRCN0000021499 0 0 0 0 0 0 ADCK1 TRCN0000021500 580 1056 963 669 779 1758 ADCK1 TRCN0000021501 23 178 392 7124 23753 991 ADCK1 TRCN0000021502 0 2 157 282 870 601 ADCK1 TRCN0000021503 1782 1810 1751 2720 4727 5542 ADCK1 TRCN0000021514 2 368 202 628 231 431 RPS6KA4 TRCN0000021515 6649 7045 5313 8319 10154 12514 RPS6KA4 TRCN0000021516 0 0 0 0 0 0 RPS6KA4 TRCN0000021517 29 0 24 19 75 130 RPS6KA4 TRCN0000021518 4253 3117 4077 2350 6555 5786 RPS6KA4 TRCN0000021520 1072 463 3012 325 477 1106 CDKL4 TRCN0000021521 1 419 1 126 1 478 CDKL4 TRCN0000021522 0 0 0 0 0 0 CDKL4 TRCN0000021523 0 0 1 182 86 251 CDKL4 TRCN0000021524 0 0 12 0 8 35 ALPK3 TRCN0000021525 56 179 92 65 100 174 ALPK3 TRCN0000021526 0 28 0 25 96 203 ALPK3 TRCN0000021527 220 585 465 313 817 1219 ALPK3 TRCN0000021528 0 0 0 0 0 22 ALPK3 TRCN0000021529 3881 8045 8494 5609 11280 15177 GSG2 TRCN0000021530 0 0 0 0 2 0 GSG2

129

TRCN0000021531 0 0 4 0 137 106 GSG2 TRCN0000021532 224 2272 1691 864 1884 2533 GSG2 TRCN0000021533 1 0 1 14 276 171 GSG2 TRCN0000021544 3223 2516 1345 2400 3517 4409 MAST1 TRCN0000021545 383 974 576 8 0 75 MAST1 TRCN0000021546 1 0 0 0 31 1 MAST1 TRCN0000021547 2 1 0 47 2 0 MAST1 TRCN0000021548 6 461 206 503 1751 2010 MAST1 TRCN0000021549 1362 865 1173 1509 1943 2501 PTK6 TRCN0000021550 214 95 42 148 170 108 PTK6 TRCN0000021551 117 300 248 151 513 273 PTK6 TRCN0000021552 13 54 123 105 146 310 PTK6 TRCN0000021553 2 11 38 5 53 21 PTK6 TRCN0000021559 42 115 75 55 71 132 TRPM7 TRCN0000021560 80 1145 320 154 330 496 TRPM7 TRCN0000021561 1711 1463 3027 675 1360 766 TRPM7 TRCN0000021562 0 89 0 33 26 22 TRPM7 TRCN0000021563 0 0 0 0 0 0 TRPM7 TRCN0000021564 312 0 141 285 1407 903 MAP3K11 TRCN0000021565 1 196 173 198 396 549 MAP3K11 TRCN0000021566 0 14 12 4 1 70 MAP3K11 TRCN0000021567 0 35 99 7 69 75 MAP3K11 TRCN0000021568 275 325 462 260 615 363 MAP3K11 TRCN0000021569 0 0 0 75 2 22 PNCK TRCN0000021570 0 0 55 0 0 10 PNCK TRCN0000021571 51 98 151 65 47 79 PNCK TRCN0000021572 110 2 84 10 0 23 PNCK TRCN0000021573 30 83 58 59 159 67 PNCK TRCN0000021579 2623 11035 4513 3222 3533 6709 NEK1 TRCN0000021580 903 510 718 764 899 3553 NEK1 TRCN0000021581 5 1250 98 154 140 50 NEK1 TRCN0000021582 846 1122 1155 1053 980 1882 NEK1 TRCN0000021583 113 11545 135 207 209 165 NEK1 TRCN0000021584 1 292 415 322 146 514 TRPM6 TRCN0000021585 191 195 155 225 591 77 TRPM6 TRCN0000021586 719 425 1181 2088 1623 3057 TRPM6 TRCN0000021587 3618 933 428 3364 1215 2531 TRPM6 TRCN0000021588 90 88 10 22 2 75 TRPM6 TRCN0000021599 0 7 233 339 37 578 OBSCN TRCN0000021600 2722 2472 4011 4207 4512 7785 OBSCN TRCN0000021601 405 264 344 316 261 631 OBSCN

130

TRCN0000021602 0 36 0 8 19 26 OBSCN TRCN0000021603 0 2 38 2 3 14 OBSCN TRCN0000022144 283 3343 2533 2302 3887 6111 IKBKG TRCN0000022145 0 0 8 0 0 9 IKBKG TRCN0000022146 84 273 270 69 36 127 IKBKG TRCN0000022147 0 0 0 205 65 62 IKBKG TRCN0000022148 0 25 0 31 34 11 IKBKG TRCN0000022354 34 17 61 39 34 37 PRKACG TRCN0000022355 0 0 0 0 0 3 PRKACG TRCN0000022356 296 51 2 187 32 220 PRKACG TRCN0000022357 1 149 310 45 224 967 PRKACG TRCN0000022358 0 0 14 70 0 216 PRKACG TRCN0000037394 0 81 0 17 0 2 SBK1 TRCN0000037395 97 81 133 133 203 227 SBK1 TRCN0000037396 0 216 0 209 322 896 SBK1 TRCN0000037397 0 62 10 7 0 24 SBK1 TRCN0000037398 0 0 1 1 260 79 SBK1 TRCN0000037399 1059 3322 2040 947 1172 3141 RIOK1 TRCN0000037400 6 8 118 1244 571 1463 RIOK1 TRCN0000037401 1 2 403 72 104 11 RIOK1 TRCN0000037403 15 912 759 2887 2821 6811 RIOK1 TRCN0000037404 195 224 21 368 825 825 TRIB3 TRCN0000037405 2 163 60 172 156 362 TRIB3 TRCN0000037406 2 215 0 160 28 203 TRIB3 TRCN0000037407 0 0 0 0 63 0 TRIB3 TRCN0000037408 0 0 20 13 209 128 TRIB3 TRCN0000037409 0 0 0 5 1 50 SMG1 TRCN0000037410 119 0 35 47 247 64 SMG1 TRCN0000037411 2 0 0 309 587 682 SMG1 TRCN0000037412 406 0 33 56 0 141 SMG1 TRCN0000037413 0 0 58 213 356 175 SMG1 TRCN0000037414 26 82 81 60 39 85 PIM3 TRCN0000037415 350 825 617 572 991 1412 PIM3 TRCN0000037416 1133 685 821 108 254 446 PIM3 TRCN0000037417 0 0 0 1 0 16 PIM3 TRCN0000037418 0 0 0 0 0 0 PIM3 TRCN0000037444 380 267 0 2 0 1 MYLK4 TRCN0000037445 1126 2373 1240 808 1589 1030 MYLK4 TRCN0000037446 133 15 78 36 83 4758 MYLK4 TRCN0000037447 0 167 53 110 173 13 MYLK4 TRCN0000037448 2640 1410 2058 1873 2080 4318 MYLK4

131

TRCN0000037450 2 484 178 210 655 377 SIK3 TRCN0000037451 8633 3835 8923 4063 5573 9160 SIK3 TRCN0000037452 2 42 133 323 454 1040 SIK3 TRCN0000037453 161 117 39 159 150 197 SIK3 TRCN0000037459 482 239 207 253 481 528 TSSK6 TRCN0000037460 279 322 595 439 1 273 TSSK6 TRCN0000037461 76 6 61 43 92 200 TSSK6 TRCN0000037462 1950 1569 621 284 907 1143 TSSK6 TRCN0000037463 513 370 633 436 677 676 TSSK6 TRCN0000037464 3029 3230 3109 3040 5803 6179 TSSK1B TRCN0000037465 0 0 0 0 0 10 TSSK1B TRCN0000037466 194 861 637 636 832 2887 TSSK1B TRCN0000037467 0 46 23 0 0 63 TSSK1B TRCN0000037468 312 581 106 280 599 672 TSSK1B TRCN0000037469 0 0 0 0 0 0 TEX14 TRCN0000037470 1127 379 681 2 2 1 TEX14 TRCN0000037471 2 358 0 0 0 0 TEX14 TRCN0000037472 0 254 0 3 239 58 TEX14 TRCN0000037473 1 47 5 25 8 33 TEX14 TRCN0000037479 74 4 88 0 42 21 TTN TRCN0000037480 0 36 1 4 2 0 TTN TRCN0000037481 0 0 25 18 0 0 TTN TRCN0000037482 0 0 68 19 68 9 TTN TRCN0000037483 0 46 48 42 73 121 TTN TRCN0000037489 445 258 233 468 342 480 NRK TRCN0000037490 16 29 52 7 26 0 NRK TRCN0000037491 0 19 0 0 14 0 NRK TRCN0000037492 4 172 375 420 486 515 NRK TRCN0000037493 0 0 0 84 35 1 NRK TRCN0000037494 0 0 0 0 0 177 SIK2 TRCN0000037495 49 0 27 0 0 0 SIK2 TRCN0000037496 0 0 31 0 0 0 SIK2 TRCN0000037497 0 0 0 7 2 0 SIK2 TRCN0000037498 0 94 0 0 0 0 SIK2 TRCN0000037499 2 1086 389 244 0 1113 TAF1L TRCN0000037500 3281 5161 3770 1676 5237 2267 TAF1L TRCN0000037501 0 0 104 114 2 309 TAF1L TRCN0000037502 312 2441 1085 843 485 1279 TAF1L TRCN0000037503 3 387 240 326 706 1153 TAF1L TRCN0000037504 0 0 0 0 0 0 RIOK2 TRCN0000037505 51 131 53 39 210 150 RIOK2

132

TRCN0000037506 0 2 0 28 196 0 RIOK2 TRCN0000037507 1 34 26 190 284 649 RIOK2 TRCN0000037508 0 0 0 1 2 453 RIOK2 TRCN0000037509 0 0 8 3 2 1 DSTYK TRCN0000037510 0 0 2 157 3 0 DSTYK TRCN0000037511 0 73 27 4 0 33 DSTYK TRCN0000037512 0 1 0 0 100 0 DSTYK TRCN0000037513 253 270 2 209 967 1155 DSTYK TRCN0000037514 0 0 0 125 38 400 TNIK TRCN0000037515 696 8 971 195 366 1881 TNIK TRCN0000037517 0 20 0 0 0 13 TNIK TRCN0000037518 0 103 0 282 2 65 TNIK TRCN0000037519 3 2 0 0 359 1 TP53RK TRCN0000037520 2 0 47 22 363 115 TP53RK TRCN0000037521 0 0 15 0 29 0 TP53RK TRCN0000037522 120 83 48 12 59 35 TP53RK TRCN0000037523 3 496 161 2 972 305 TP53RK TRCN0000037524 1357 2187 3112 2494 2809 1924 TAOK1 TRCN0000037526 9 1 0 6 3 7 TAOK1 TRCN0000037527 7 194 130 331 580 301 TAOK1 TRCN0000037528 0 69 97 1 0 0 TAOK1 TRCN0000037529 0 60 12 7 0 0 PKDCC TRCN0000037530 53 0 151 10 0 0 PKDCC TRCN0000037531 0 0 0 0 28 0 PKDCC TRCN0000037532 865 905 1308 736 760 1482 PKDCC TRCN0000037533 501 1 0 0 204 238 PKDCC TRCN0000037534 5763 10876 8502 6938 28349 10560 TTBK1 TRCN0000037535 0 0 0 16 0 48 TTBK1 TRCN0000037536 3 351 359 341 643 698 TTBK1 TRCN0000037537 210 392 365 318 525 843 TTBK1 TRCN0000037538 4 2 1 703 1580 2258 TTBK1 TRCN0000037544 104 391 318 193 133 317 CKS2 TRCN0000037545 0 0 4 37 184 114 CKS2 TRCN0000037546 0 0 0 42 13 145 CKS2 TRCN0000037547 0 0 0 14 0 23 CKS2 TRCN0000037548 8 524 585 1194 236 972 CKS2 TRCN0000037569 0 11 0 37 0 0 CALM1 TRCN0000037570 130 108 74 164 299 611 CALM1 TRCN0000037571 5 152 6154 6 2 14 CALM1 TRCN0000037572 7 52 79 89 53 130 CALM1 TRCN0000037573 0 0 0 12 51 26 CALM1

133

TRCN0000037631 839 734 202 326 796 2161 CDC42SE2 TRCN0000037633 0 0 0 0 1 1 CDC42SE2 TRCN0000037804 0 0 0 87 1 189 PRKAR2A TRCN0000037805 1753 1043 2466 929 1510 1458 PRKAR2A TRCN0000037806 0 8 0 134 190 205 PRKAR2A TRCN0000037807 1 0 134 91 0 88 PRKAR2A TRCN0000037808 4 2 45 183 510 866 PRKAR2A TRCN0000037814 1 6 270 32 0 0 PRKAR2B TRCN0000037815 1 3 68 1 7 0 PRKAR2B TRCN0000037817 308 300 279 0 49 2 PRKAR2B TRCN0000037818 527 1275 1085 799 1078 1852 PRKAR2B TRCN0000037874 0 0 0 0 0 0 MAST4 TRCN0000037875 431 178 322 195 228 218 MAST4 TRCN0000037876 2 165 2 288 91 1159 MAST4 TRCN0000037877 78 2 17 57 81 15 MAST4 TRCN0000037878 573 341 440 119 200 394 MAST4 TRCN0000037899 0 0 0 0 0 0 CALM3 TRCN0000037900 0 156 0 0 0 2 CALM3 TRCN0000037901 0 10 40 31 14 7 CALM3 TRCN0000037902 0 90 0 74 554 556 CALM3 TRCN0000037903 0 0 0 0 0 32 CALM3 TRCN0000037919 3 2 334 281 341 1778 CKS1B TRCN0000037920 42 242 216 259 287 366 CKS1B TRCN0000037921 0 194 212 38 32 204 CKS1B TRCN0000037922 0 0 0 0 0 0 CKS1B TRCN0000037923 72 0 3 101 178 0 CKS1B TRCN0000038149 338 393 320 319 612 699 SRC TRCN0000038150 0 0 0 14 46 74 SRC TRCN0000038151 197 337 128 132 106 289 SRC TRCN0000038152 0 0 37 0 2 0 SRC TRCN0000038654 6 3 32 939 1672 1002 ATM TRCN0000038655 0 0 0 0 4 0 ATM TRCN0000038656 2 553 228 296 1028 355 ATM TRCN0000038657 37 0 0 0 0 15 ATM TRCN0000038658 92 438 528 503 330 5448 ATM TRCN0000038659 1911 1325 695 250 375 1297 MAPK15 TRCN0000038660 1 15 0 7 64 740 MAPK15 TRCN0000038661 0 24 75 138 319 516 MAPK15 TRCN0000038662 58 36 31 127 72 176 MAPK15 TRCN0000038663 0 4 30 39 147 258 MAPK15 TRCN0000038669 104 109 3 81 77 33 CSNK1G2

134

TRCN0000038670 352 221 518 90 88 155 CSNK1G2 TRCN0000038671 0 0 0 11 4 12 CSNK1G2 TRCN0000038672 1656 3593 4588 2829 3032 9950 CSNK1G2 TRCN0000038673 4 4 2 18 12 25 CSNK1G2 TRCN0000038674 18 898 2371 507 946 829 MTOR TRCN0000038675 140 732 460 179 132 773 MTOR TRCN0000038676 2 0 1 604 172 2 MTOR TRCN0000038677 0 437 318 295 1039 439 MTOR TRCN0000038678 140 7 0 10 0 148 MTOR TRCN0000038679 4 500 804 803 536 755 GSK3A TRCN0000038680 0 0 0 19 37 135 GSK3A TRCN0000038681 90 56 26 23 36 55 GSK3A TRCN0000038682 1 6 182 0 313 158 GSK3A TRCN0000038683 1 363 249 205 647 1727 GSK3A TRCN0000039564 3214 6143 3832 1188 668 957 GSK3B TRCN0000039565 1 3 1 1 0 4 GSK3B TRCN0000039613 6 173 188 215 946 1140 ATR TRCN0000039614 2 0 0 0 0 216 ATR TRCN0000039615 0 0 0 0 0 0 ATR TRCN0000039616 5 225 114 424 1115 1130 ATR TRCN0000039617 2367 1842 1836 989 2647 1548 ATR TRCN0000039633 69 12 0 1 65 186 EGFR TRCN0000039634 0 2 234 50 0 0 EGFR TRCN0000039635 259 207 208 233 230 550 EGFR TRCN0000039636 0 0 0 0 0 0 EGFR TRCN0000039648 4 727 0 350 170 445 CDK4 TRCN0000039673 1 29 97 248 263 207 IGF1R TRCN0000039674 0 1 21 64 1 28 IGF1R TRCN0000039675 0 2 42 59 113 0 IGF1R TRCN0000039676 2145 416 6017 2379 5146 5289 IGF1R TRCN0000039677 0 0 0 7 0 7 IGF1R TRCN0000039688 774 2226 1399 2477 3965 5188 ERBB4 TRCN0000039689 55 78 18 70 40 215 ERBB4 TRCN0000039690 325 2387 991 899 1180 2904 ERBB4 TRCN0000039691 1 0 0 1 45 12 ERBB4 TRCN0000039692 4732 2374 14417 10319 9547 12519 ERBB4 TRCN0000039698 0 0 0 0 118 0 INSR TRCN0000039699 58 0 0 28 0 18 INSR TRCN0000039700 1 243 188 182 182 226 INSR TRCN0000039701 788 1100 1449 1112 1309 2679 INSR TRCN0000039702 1471 775 854 978 2228 1055 INSR

135

TRCN0000039703 1361 201 99 212 0 0 FLT3 TRCN0000039704 477 1534 1962 1261 1885 2754 FLT3 TRCN0000039705 493 3 608 721 2689 1461 FLT3 TRCN0000039706 455 648 986 147 0 284 FLT3 TRCN0000039707 1194 1046 86 901 414 249 FLT3 TRCN0000039743 1235 2947 2203 379 902 1296 CDK6 TRCN0000039744 42 51 61 45 941 92 CDK6 TRCN0000039745 0 0 0 0 0 0 CDK6 TRCN0000039746 357 800 1265 1300 1005 1840 CDK6 TRCN0000039747 0 47 12 7 0 0 CDK6 TRCN0000039753 199 208 437 217 199 786 RPS6KA1 TRCN0000039754 4 3 4 417 406 223 RPS6KA1 TRCN0000039755 247 0 2 449 375 251 RPS6KA1 TRCN0000039763 5 0 0 17 33 56 GSK3A TRCN0000039764 285 511 357 452 351 606 GSK3A TRCN0000039765 3 346 259 834 770 708 GSK3A TRCN0000039766 1 0 0 46 49 48 GSK3A TRCN0000039767 1 39 0 2 113 116 GSK3A TRCN0000039773 0 125 0 151 203 265 TGFBR1 TRCN0000039774 785 432 1225 1007 1233 1201 TGFBR1 TRCN0000039775 12 69 77 124 121 246 TGFBR1 TRCN0000039776 0 0 189 1 163 139 TGFBR1 TRCN0000039777 1 0 0 2 132 290 TGFBR1 TRCN0000039778 0 5 47 16 76 353 PDPK1 TRCN0000039779 10896 22931 18363 23335 38022 47498 PDPK1 TRCN0000039782 1 140 392 21 539 122 PDPK1 TRCN0000039783 0 0 0 0 0 0 MTOR TRCN0000039784 0 0 0 9 0 0 MTOR TRCN0000039785 4 199 8123 40 3 6 MTOR TRCN0000039786 0 8 0 0 30 0 MTOR TRCN0000039787 185 251 725 501 553 838 MTOR TRCN0000039793 19 50 50 7 64 26 AKT1 TRCN0000039794 35 59 37 16 71 78 AKT1 TRCN0000039796 243 202 307 170 210 188 AKT1 TRCN0000039853 171 454 702 784 398 1720 CHEK1 TRCN0000039855 3 12 955 425 2 367 CHEK1 TRCN0000039856 0 0 0 0 0 0 CHEK1 TRCN0000039857 462 0 0 129 586 471 CHEK1 TRCN0000039878 0 0 0 30 0 440 ERBB2 TRCN0000039881 0 13 19 4 17 36 ERBB2 TRCN0000039882 252 605 435 433 195 290 ERBB2

136

TRCN0000039888 5 433 283 0 0 0 AKT3 TRCN0000039889 0 2 0 133 1231 2 AKT3 TRCN0000039890 227 820 118 49 233 1574 AKT3 TRCN0000039891 4 428 1767 637 169 583 AKT3 TRCN0000039892 704 3 0 94 304 81 AKT3 TRCN0000039898 0 0 0 0 1 5 ABL1 TRCN0000039899 120 293 267 558 679 789 ABL1 TRCN0000039900 1103 1220 291 660 1470 2152 ABL1 TRCN0000039901 86 0 0 5 23 16 ABL1 TRCN0000039902 406 444 600 185 306 305 ABL1 TRCN0000039913 0 0 2 15 205 425 MAP2K4 TRCN0000039914 343 1308 1033 2077 3517 4224 MAP2K4 TRCN0000039915 23 128 25 59 123 101 MAP2K4 TRCN0000039916 280 4157 4379 1624 1930 860 MAP2K4 TRCN0000039917 48 2 0 34 15 13 MAP2K4 TRCN0000039938 215 223 230 140 367 416 PRKAR1A TRCN0000039939 1 63 23 186 188 556 PRKAR1A TRCN0000039942 0 0 0 7 3 4 PRKAR1A TRCN0000039944 39 170 271 255 753 703 CHEK2 TRCN0000039945 126 26 72 19 76 81 CHEK2 TRCN0000039946 1532 1330 1700 1288 1762 2169 CHEK2 TRCN0000039947 1789 1843 1786 1353 1816 2258 CHEK2 TRCN0000039948 224 1313 1804 698 657 576 ATM TRCN0000039949 14 0 0 12 0 29 ATM TRCN0000039950 212 720 232 341 488 795 ATM TRCN0000039951 28 103 142 84 125 130 ATM TRCN0000039952 1162 2233 1615 440 1711 1080 ATM TRCN0000039958 0 12 49 60 41 98 CDK2 TRCN0000039959 0 2 0 0 0 698 CDK2 TRCN0000039960 521 1525 13 13 0 0 CDK2 TRCN0000039961 376 260 223 204 343 196 CDK2 TRCN0000039962 40 162 62 252 199 178 CDK2 TRCN0000039968 0 171 4 56 383 152 AKT2 TRCN0000039969 0 100 0 20 52 56 AKT2 TRCN0000039970 175 370 282 109 199 245 AKT2 TRCN0000039971 0 2 65 43 0 0 AKT2 TRCN0000039998 0 0 66 227 0 2 GSK3B TRCN0000039999 905 3686 1652 6 652 177 GSK3B TRCN0000040000 0 0 0 0 0 0 GSK3B TRCN0000040001 0 0 0 0 0 0 GSK3B TRCN0000040002 0 0 123 28 0 0 GSK3B

137

TRCN0000040008 897 86 396 128 1046 316 TGFBR2 TRCN0000040009 618 2 274 0 148 620 TGFBR2 TRCN0000040010 2 94 3 39 0 0 TGFBR2 TRCN0000040011 1119 1418 662 200 466 655 TGFBR2 TRCN0000040012 0 1 6 7 0 0 TGFBR2 TRCN0000040024 41 2 19 141 67 238 RET TRCN0000040026 0 2 0 1 36 188 RET TRCN0000040027 360 2344 863 0 1 0 RET TRCN0000040044 210 430 437 285 230 552 MET TRCN0000040047 0 0 0 0 0 3 MET TRCN0000040108 0 0 0 0 0 0 ERBB3 TRCN0000040109 0 0 2 35 1 92 ERBB3 TRCN0000040110 1445 2726 2881 2522 2369 5008 ERBB3 TRCN0000040112 0 0 30 74 0 88 ERBB3 TRCN0000040144 13 0 8 5 9 31 RPS6KA3 TRCN0000040145 0 0 2 103 0 443 RPS6KA3 TRCN0000040146 134 11 765 564 190 786 RPS6KA3 TRCN0000040147 0 104 24 146 24 72 RPS6KA3 TRCN0000040153 391 1926 903 1182 2633 2261 BUB1 TRCN0000040154 271 242 406 1199 382 986 BUB1 TRCN0000040155 522 1342 1248 928 1069 1408 BUB1 TRCN0000040156 161 4 166 0 189 362 BUB1 TRCN0000040157 615 589 866 466 449 1192 BUB1 TRCN0000040173 1 168 0 143 174 590 SGK1 TRCN0000040174 1767 4504 3097 2396 3170 4055 SGK1 TRCN0000040175 221 785 386 285 797 369 SGK1 TRCN0000040176 47 86 20 75 111 113 SGK1 TRCN0000040177 305 171 54 1123 0 344 SGK1 TRCN0000045258 117 132 190 86 88 152 CDK5R2 TRCN0000045259 74 181 245 50 47 312 CDK5R2 TRCN0000045260 81 161 149 79 54 155 CDK5R2 TRCN0000045261 29142 26954 15707 423 633 1452 CDK5R2 TRCN0000045262 0 175 100 234 190 448 CDK5R2 TRCN0000047277 181 308 179 106 347 644 RAC2 TRCN0000047288 313 366 434 27 0 0 RAC3 TRCN0000047291 57 175 318 91 199 115 RAC3 TRCN0000047292 0 0 76 13 43 46 RAC3 TRCN0000047433 0 54 0 15 1 136 RND1 TRCN0000047434 148 125 97 257 48 409 RND1 TRCN0000047436 794 1372 1462 807 985 1867 RND1 TRCN0000047437 4 6 69 22 1 285 RND1

138

TRCN0000047438 0 0 0 0 0 0 RND2 TRCN0000047440 30 227 0 299 218 458 RND2 TRCN0000047441 2 2 109 138 454 65 RND2 TRCN0000047603 87 56 141 11 11 7 RHOJ TRCN0000047605 3261 4910 4161 1260 1135 2107 RHOJ TRCN0000047607 0 49 50 4 4 120 RHOJ TRCN0000047703 0 8 10 1 2 4 RHOD TRCN0000047704 634 1336 1572 681 825 1057 RHOD TRCN0000047707 17 26 11 16 16 10 RHOD TRCN0000047708 209 2 2 237 0 57 RHOA TRCN0000047710 160 0 0 0 0 60 RHOA TRCN0000047711 933 12 14 227 338 895 RHOA TRCN0000047743 589 284 848 518 635 1154 RAB32 TRCN0000047744 0 0 75 15 0 56 RAB32 TRCN0000047745 458 301 3 611 213 975 RAB32 TRCN0000047746 1 96 29 31 27 50 RAB32 TRCN0000047747 210 4 156 152 108 582 RAB32 TRCN0000047753 171 1283 335 255 214 531 RHOBTB1 TRCN0000047754 2 282 641 132 2 368 RHOBTB1 TRCN0000047756 318 674 32 310 498 1970 RHOBTB1 TRCN0000047820 268 564 408 179 144 167 RHOH TRCN0000047821 92 8 28 0 0 108 RHOH TRCN0000047849 1 147 14 67 62 71 RHOB TRCN0000047964 604 955 1008 1444 1573 1833 RHOBTB2 TRCN0000047967 1 198 0 99 1 186 RHOBTB2 TRCN0000048018 2 632 1841 399 181 387 RHOG TRCN0000048019 59 20 93 73 144 143 RHOG TRCN0000048020 113 165 169 128 288 138 RHOG TRCN0000048021 0 0 42 0 0 0 RHOG TRCN0000048022 0 0 0 0 21 0 RHOG TRCN0000048049 175 1 199 22 0 74 RHOF TRCN0000048050 696 1109 1431 943 385 863 RHOF TRCN0000048051 328 512 257 307 484 722 RHOF TRCN0000048208 0 150 80 270 303 550 KALRN TRCN0000048209 56 38 59 23 70 80 KALRN TRCN0000048210 0 1 65 0 0 0 KALRN TRCN0000048211 225 1183 409 220 531 280 KALRN TRCN0000048212 1 0 0 54 454 0 KALRN TRCN0000048631 155 100 166 1 187 45 RHOV TRCN0000048632 958 121 506 442 1555 1340 RHOV TRCN0000048653 356 195 280 310 68 212 RHOU

139

TRCN0000048655 1178 1423 708 340 379 766 RHOU TRCN0000052563 0 254 113 273 76 85 PRKAR1B TRCN0000052564 1 27 108 34 57 47 PRKAR1B TRCN0000052565 0 119 32 0 97 49 PRKAR1B TRCN0000052566 973 1227 1518 1714 4669 3861 PRKAR1B TRCN0000052567 1 4 0 0 1 0 PRKAR1B TRCN0000052578 2 113 13 486 405 41 CALM2 TRCN0000052579 2 422 180 654 340 376 CALM2 TRCN0000052580 0 0 1 116 51 0 CALM2 TRCN0000052581 2 407 941 554 759 863 CALM2 TRCN0000052582 4 235 427 860 1281 1762 CALM2 TRCN0000055425 145 1 74 18 15 14 BTK TRCN0000055426 818 1531 1135 229 199 617 DAPK3 TRCN0000055428 0 78 45 119 96 380 MAPK13 TRCN0000055429 536 564 414 765 1401 827 TXK TRCN0000055430 443 1 74 33 11 151 CAMK1 TRCN0000055432 434 1996 719 349 490 637 PRKG1 TRCN0000055433 8 23 15 0 6 15 PHKG2 TRCN0000055434 364 460 417 583 420 1386 LCK TRCN0000055435 1 0 4 0 0 0 CDK6 TRCN0000055436 0 0 0 30 209 209 DDR1 TRCN0000055437 648 665 474 782 589 920 AKT3 TRCN0000078649 3 174 0 0 0 1 EIF2AK4 TRCN0000078650 398 306 357 329 420 809 EIF2AK4 TRCN0000078651 849 4388 210 8417 8791 11787 EIF2AK4 TRCN0000078652 0 0 165 159 13 122 EIF2AK4 TRCN0000082448 497 428 319 435 379 1263 C9orf96 TRCN0000082449 158 32 101 96 36 133 C9orf96 TRCN0000082450 1507 127 555 830 759 921 C9orf96 TRCN0000082451 524 494 1082 429 715 1099 C9orf96 TRCN0000082452 65 47 205 206 61 275 C9orf96 TRCN0000121062 1381 1774 1067 173 1201 930 YES1 TRCN0000121063 0 75 77 33 109 93 YES1 TRCN0000121064 141 301 264 41 108 0 YES1 TRCN0000121065 300 70 0 0 73 34 YES1 TRCN0000121066 0 0 0 17 0 33 YES1 TRCN0000121067 0 0 0 14 0 0 EGFR TRCN0000121068 0 108 47 193 1 140 EGFR TRCN0000121069 268 523 239 412 227 1191 EGFR TRCN0000121070 2390 4128 3722 3449 5379 6469 EGFR TRCN0000121071 0 1 49 0 0 20 EGFR

140

TRCN0000121072 0 0 0 0 31 0 PLK1 TRCN0000121073 99 168 28 81 263 251 PLK1 TRCN0000121074 0 67 47 90 4 0 PLK1 TRCN0000121075 1 305 469 1 121 168 PLK1 TRCN0000121077 915 690 1159 382 234 132 PLK4 TRCN0000121078 869 4388 5351 4056 3396 3759 PLK4 TRCN0000121079 4 2 199 552 931 1509 PLK4 TRCN0000121080 0 74 118 35 29 0 PLK4 TRCN0000121081 41 439 290 419 139 532 PLK4 TRCN0000121082 0 0 0 0 0 0 DDR1 TRCN0000121083 0 1 179 79 0 52 DDR1 TRCN0000121084 154 70 222 2 140 190 DDR1 TRCN0000121085 71 301 279 222 167 362 DDR1 TRCN0000121086 0 0 0 2 3 14 DDR1 TRCN0000121087 1262 453 3 146 1 587 MET TRCN0000121088 1283 3222 201 31 208 353 MET TRCN0000121089 0 0 0 0 0 0 MET TRCN0000121090 0 0 0 17 17 49 MET TRCN0000121091 540 22 2 75 201 270 MET TRCN0000121092 443 567 483 1270 1603 3074 ROCK1 TRCN0000121093 3 0 29 34 31 154 ROCK1 TRCN0000121094 1 3 25 409 150 474 ROCK1 TRCN0000121095 1 2 66 45 124 89 ROCK1 TRCN0000121096 4105 5973 3862 3428 5986 3684 ROCK1 TRCN0000121097 0 0 0 101 0 50 ABL1 TRCN0000121098 181 765 429 384 1005 1024 ABL1 TRCN0000121099 0 1 37 132 167 180 ABL1 TRCN0000121100 0 0 23 26 6 86 ABL1 TRCN0000121101 141 0 15 122 91 27 ABL1 TRCN0000121102 0 0 0 0 0 0 FGFR1 TRCN0000121103 84 56 101 24 51 101 FGFR1 TRCN0000121104 119 61 47 97 610 1094 FGFR1 TRCN0000121105 0 0 0 0 0 1 FGFR1 TRCN0000121106 0 37 0 29 0 0 FGFR1 TRCN0000121107 505 3602 1909 1359 5720 15750 TXK TRCN0000121108 6 950 9 696 436 1604 TXK TRCN0000121109 2308 1285 2241 2006 2410 3384 TXK TRCN0000121110 0 23 0 0 0 0 TXK TRCN0000121111 12 1777 785 1289 1084 949 TXK TRCN0000121112 1 0 0 0 1 1 TIE1 TRCN0000121113 2725 2916 3511 3673 6413 3464 TIE1

141

TRCN0000121114 0 0 0 0 69 6 TIE1 TRCN0000121115 72 139 191 240 188 140 TIE1 TRCN0000121116 83 106 28 29 199 62 TIE1 TRCN0000121117 146 153 2 59 72 7 DDR2 TRCN0000121118 54 0 18 17 10 43 DDR2 TRCN0000121119 1063 250 2154 6 153 153 DDR2 TRCN0000121120 6 427 0 2 2 1 DDR2 TRCN0000121121 0 0 15 7 20 0 DDR2 TRCN0000121123 0 2 122 185 73 180 INSR TRCN0000121124 0 4 385 0 133 122 INSR TRCN0000121125 610 1686 2851 4 370 3 INSR TRCN0000121126 0 1 1 6 4 9 INSR TRCN0000121127 1 230 2 37 34 0 PTK2 TRCN0000121128 8 168 1375 361 659 247 PTK2 TRCN0000121129 0 2 180 0 56 116 PTK2 TRCN0000121130 1 183 66 142 88 14 PTK2 TRCN0000121131 11669 8181 9126 7280 9952 10157 PTK2 TRCN0000121132 457 3236 4147 2819 1680 2375 IGF1R TRCN0000121133 50 36 44 18 17 6 IGF1R TRCN0000121134 0 0 0 13 70 179 IGF1R TRCN0000121135 3 450 84 406 518 311 IGF1R TRCN0000121136 281 1846 1047 1517 1245 3423 IGF1R TRCN0000121137 0 4 185 2 173 0 IRAK1 TRCN0000121138 37 24 58 86 145 155 IRAK1 TRCN0000121139 62 0 90 175 55 191 IRAK1 TRCN0000121140 5 3 6 6 7 13 IRAK1 TRCN0000121141 24 27 13 67 71 105 IRAK1 TRCN0000121142 0 1 17 29 2 11 JAK1 TRCN0000121143 0 0 19 0 0 0 JAK1 TRCN0000121144 0 7 2 22 0 25 JAK1 TRCN0000121145 204 0 0 47 82 33 JAK1 TRCN0000121146 0 0 2 0 0 0 JAK1 TRCN0000121147 353 585 1660 772 710 948 MST1R TRCN0000121148 1 0 0 14 2 153 MST1R TRCN0000121149 0 0 0 79 101 149 MST1R TRCN0000121150 250 898 1656 1421 2322 2344 MST1R TRCN0000121151 88 223 35 169 197 35 MST1R TRCN0000121159 378 258 512 607 1060 1417 MST1R TRCN0000121160 815 543 805 802 1333 1117 MST1R TRCN0000121161 0 0 0 0 48 1 MST1R TRCN0000121162 0 0 0 12 0 19 DDR1

142

TRCN0000121163 0 0 0 0 0 0 DDR1 TRCN0000121165 507 962 925 555 428 965 DDR1 TRCN0000121166 1 732 99 150 22 290 DDR1 TRCN0000121168 293 640 582 183 267 302 ABL1 TRCN0000121169 4 370 717 404 522 676 ABL1 TRCN0000121170 1484 982 1278 732 593 1607 ABL1 TRCN0000121172 804 1569 2520 1431 1392 2334 DDR2 TRCN0000121173 2010 1281 2123 2292 2050 4711 DDR2 TRCN0000121174 522 370 297 416 1114 953 DDR2 TRCN0000121175 350 109 418 305 335 526 DDR2 TRCN0000121176 1199 1317 1407 522 451 531 DDR2 TRCN0000121177 0 0 0 0 0 26 TXK TRCN0000121178 1797 4451 655 598 390 1300 TXK TRCN0000121179 0 0 0 8 6 31 TXK TRCN0000121180 0 0 0 19 0 0 TXK TRCN0000121181 498 569 731 443 735 1973 TXK TRCN0000121182 0 0 0 0 0 1 FGFR1 TRCN0000121183 0 161 65 6 98 120 FGFR1 TRCN0000121185 0 2 103 0 0 0 FGFR1 TRCN0000121186 0 92 0 0 1 0 FGFR1 TRCN0000121187 0 0 0 0 0 0 TIE1 TRCN0000121188 103 427 384 313 228 747 TIE1 TRCN0000121189 1 13 87 40 10 141 TIE1 TRCN0000121191 0 509 0 0 138 398 TIE1 TRCN0000121192 2354 1947 1441 925 3476 1941 IGF1R TRCN0000121193 2 3 424 139 133 145 IGF1R TRCN0000121195 1212 1674 552 1450 2175 2343 IGF1R TRCN0000121196 1285 1097 2265 408 1384 1230 IGF1R TRCN0000121198 48 1 2 84 235 129 PLK4 TRCN0000121199 1 11 414 351 371 228 PLK4 TRCN0000121200 595 0 219 185 0 0 PLK4 TRCN0000121201 754 1247 694 856 1135 1410 PLK4 TRCN0000121202 605 165 115 159 98 459 EGFR TRCN0000121203 196 237 229 123 160 207 EGFR TRCN0000121204 214 377 121 17 355 0 EGFR TRCN0000121205 3825 4576 2746 2960 4465 4231 EGFR TRCN0000121206 20 0 0 5 17 12 EGFR TRCN0000121207 0 0 0 0 0 25 PTK2 TRCN0000121209 13 1722 16 231 818 234 PTK2 TRCN0000121211 0 642 104 708 419 1155 PTK2 TRCN0000121212 2921 4690 5160 3514 6057 7695 JAK1

143

TRCN0000121213 4420 5415 3082 5838 6725 5752 JAK1 TRCN0000121214 0 2 156 316 2 195 JAK1 TRCN0000121215 0 77 65 36 53 18 JAK1 TRCN0000121216 407 21 1831 331 0 390 JAK1 TRCN0000121217 0 0 0 12 46 26 INSR TRCN0000121218 38 42 100 25 78 74 INSR TRCN0000121219 0 19 3 198 245 211 INSR TRCN0000121220 487 371 638 481 927 999 INSR TRCN0000121221 3 467 438 823 274 865 INSR TRCN0000121222 0 0 0 0 8 0 PLK1 TRCN0000121223 55 0 31 18 17 45 PLK1 TRCN0000121224 26 162 14 260 21337 428 PLK1 TRCN0000121226 408 313 331 292 102 656 PLK1 TRCN0000121227 2 0 164 324 19 228 YES1 TRCN0000121228 1043 2681 2999 1159 3176 2081 YES1 TRCN0000121229 0 0 0 0 0 0 YES1 TRCN0000121230 0 0 0 0 0 88 YES1 TRCN0000121231 1 2 30 78 295 269 YES1 TRCN0000121232 614 375 486 1437 1676 3105 MET TRCN0000121233 2 200 64 195 4 549 MET TRCN0000121234 632 2035 560 1190 1470 2743 MET TRCN0000121235 1 7 0 0 1 11 MET TRCN0000121237 0 0 0 38 0 42 IRAK1 TRCN0000121238 145 451 225 64 145 313 IRAK1 TRCN0000121239 0 0 0 0 0 33 IRAK1 TRCN0000121240 943 2146 1446 373 126 771 IRAK1 TRCN0000121242 1 431 0 43 0 129 YES1 TRCN0000121243 0 0 2 0 360 77 YES1 TRCN0000121244 0 5 4 6 0 0 YES1 TRCN0000121245 1 50 0 39 293 243 YES1 TRCN0000121246 1 50 127 208 373 392 YES1 TRCN0000121247 6 361 294 849 255 397 MET TRCN0000121248 0 0 0 46 45 85 MET TRCN0000121249 0 4 0 289 1 585 MET TRCN0000121250 0 0 19 8 4 1 MET TRCN0000121251 0 4 192 1 0 149 MET TRCN0000121252 788 241 498 1732 387 2512 MST1R TRCN0000121253 0 102 129 73 22 84 MST1R TRCN0000121254 0 0 0 0 0 0 MST1R TRCN0000121255 219 40 74 60 8 77 MST1R TRCN0000121256 6 514 490 418 664 325 MST1R

144

TRCN0000121257 3 0 0 0 0 184 PLK4 TRCN0000121258 2 367 352 187 181 375 PLK4 TRCN0000121259 0 0 0 0 0 0 PLK4 TRCN0000121260 0 0 0 0 0 80 PLK4 TRCN0000121261 283 312 130 193 373 484 PLK4 TRCN0000121262 429 135 2 754 1743 1204 DDR2 TRCN0000121263 235 425 411 408 680 789 DDR2 TRCN0000121264 8941 9456 8807 5428 8663 9663 DDR2 TRCN0000121266 1 91 111 3 126 261 DDR2 TRCN0000121267 2 276 0 135 49 60 TIE1 TRCN0000121268 63 56 12 43 0 105 TIE1 TRCN0000121269 2728 941 1129 2318 3101 2474 TIE1 TRCN0000121270 0 0 20 0 0 25 TIE1 TRCN0000121271 462 236 626 375 633 442 TIE1 TRCN0000121272 42 130 19 73 67 73 JAK1 TRCN0000121274 1 0 0 40 171 232 JAK1 TRCN0000121275 0 0 0 0 0 0 JAK1 TRCN0000121276 0 0 0 14 0 0 JAK1 TRCN0000121277 0 72 0 31 0 68 ABL1 TRCN0000121278 0 0 0 0 0 0 ABL1 TRCN0000121279 405 112 236 238 807 1049 ABL1 TRCN0000121280 131 82 240 138 142 533 ABL1 TRCN0000121281 380 1543 1210 417 429 871 ABL1 TRCN0000121282 500 200 910 1876 2424 3011 INSR TRCN0000121283 239 108 113 25 0 138 INSR TRCN0000121284 4560 5757 5807 6540 7573 13724 INSR TRCN0000121286 240 198 32 98 479 345 INSR TRCN0000121287 0 0 0 0 0 0 TXK TRCN0000121288 0 0 0 418 11 165 TXK TRCN0000121289 50 117 124 73 217 157 TXK TRCN0000121290 54974 2928 4822 5340 2221 6280 TXK TRCN0000121291 75 55 146 40 86 99 TXK TRCN0000121292 118 12 198 4 10 51 DDR1 TRCN0000121293 33 0 1 122 19 108 DDR1 TRCN0000121294 1 8 36 20 34 21 DDR1 TRCN0000121295 0 0 0 0 0 0 DDR1 TRCN0000121296 3 2 3 335 761 732 DDR1 TRCN0000121297 525 1598 655 701 523 560 IGF1R TRCN0000121298 124 2 15 129 2 137 IGF1R TRCN0000121299 917 886 965 405 430 647 IGF1R TRCN0000121300 2716 1842 2851 3591 2923 2996 IGF1R

145

TRCN0000121301 1 0 0 76 10 72 IGF1R TRCN0000121303 0 12 10 4 11 2 IRAK1 TRCN0000121304 146 280 451 90 102 294 IRAK1 TRCN0000121305 388 452 666 322 350 187 IRAK1 TRCN0000121306 1254 2003 1047 100 0 147 IRAK1 TRCN0000121307 267 350 401 42 51 106 FGFR1 TRCN0000121308 127 78 123 106 207 233 FGFR1 TRCN0000121309 1773 3862 2718 2474 3544 3731 FGFR1 TRCN0000121310 389 851 1257 370 1455 1043 FGFR1 TRCN0000121311 0 0 150 282 91 395 FGFR1 TRCN0000121312 0 1 0 5 274 0 ROCK1 TRCN0000121314 0 0 0 0 0 0 ROCK1 TRCN0000121315 1324 1114 1669 1821 1357 5290 ROCK1 TRCN0000121316 0 21 25 28 9 91 ROCK1 TRCN0000121317 70 2001 2138 1202 3784 2469 PTK2 TRCN0000121318 48 0 36 10 257 100 PTK2 TRCN0000121319 0 0 0 0 0 0 PTK2 TRCN0000121320 143 508 717 644 697 760 PTK2 TRCN0000121321 171 125 46 8 46 72 PTK2 TRCN0000121322 0 9 20 8 11 0 PLK1 TRCN0000121323 29 732 272 1245 409 1140 PLK1 TRCN0000121324 372 153 237 143 369 29 PLK1 TRCN0000121325 3 56 311 64 29 125 PLK1 TRCN0000121326 88 189 208 60 160 512 PLK1 TRCN0000121327 1196 1730 2483 709 1971 1459 EGFR TRCN0000121328 669 1092 1420 789 1584 1862 EGFR TRCN0000121329 1 222 61 0 291 0 EGFR TRCN0000121330 460 950 389 638 1442 1447 EGFR TRCN0000121331 0 0 0 7 23 0 EGFR TRCN0000147669 450 500 701 432 462 752 ERN2 TRCN0000174056 175 370 282 109 199 245 AKT2 TRCN0000179143 173 326 211 46 41 132 ERN2 TRCN0000180418 92 17 20 67 90 117 ERN2 TRCN0000194651 0 0 0 0 0 2 CSNK1A1 TRCN0000194654 16 1880 760 2838 975 700 CDK17 TRCN0000194655 0 0 70 340 118 363 PRKACB TRCN0000194657 1796 977 2 506 1230 2336 PTK2B TRCN0000194658 527 650 517 1115 2099 2874 PKMYT1 TRCN0000194660 307 3 256 420 634 1068 PRKCH TRCN0000194661 3217 2962 1543 2438 3896 3457 PRKG2 TRCN0000194664 2 138 1 193 381 193 NUAK2

146

TRCN0000194666 4 686 600 585 4 779 SGK3 TRCN0000194668 218 214 325 66 554 427 ACVR1 TRCN0000194669 6 617 282 283 80 916 BMPR2 TRCN0000194670 967 548 1053 1215 874 2969 FLT1 TRCN0000194671 111 49 131 19 74 84 PAK2 TRCN0000194672 27 173 195 143 217 319 PDK1 TRCN0000194673 7 613 780 1121 1005 912 PRKAR2B TRCN0000194674 451 294 23 3113 297 615 TXK TRCN0000194677 529 100 865 1012 1538 2148 CDK13 TRCN0000194681 1293 1845 834 496 370 444 NLK TRCN0000194682 878 571 160 443 905 896 RIOK2 TRCN0000194684 0 202 251 1440 934 981 CAMKK2 TRCN0000194685 0 167 506 1520 1085 887 CAMK2A TRCN0000194686 76 88 122 77 36 42 ATM TRCN0000194689 269 38 37 65 127 113 PRKD1 TRCN0000194690 0 0 0 0 0 0 MAP4K3 TRCN0000194693 923 531 828 944 1087 1729 TGFBR1 TRCN0000194697 2 6 182 65 328 146 MAK TRCN0000194698 64 20 185 518 1215 555 MAP4K5 TRCN0000194700 1489 1262 1588 1591 1450 2391 CDKL3 TRCN0000194701 3126 1189 1208 248 210 165 STRADB TRCN0000194702 4 269 459 920 1287 1002 GSG2 TRCN0000194709 3 1 1 228 160 36 BLK TRCN0000194711 56 140 40 149 281 250 MAPK6 TRCN0000194712 771 621 363 603 927 1203 TTN TRCN0000194713 317 211 68 171 228 593 STK24 TRCN0000194715 482 647 282 139 273 52 MAP3K13 TRCN0000194716 108 130 164 125 154 232 MAP3K13 TRCN0000194717 42 0 0 0 0 0 MAP3K13 TRCN0000194718 1 0 0 0 0 140 EPHA3 TRCN0000194719 7 292 1 109 32 211 PRKDC TRCN0000194720 4 26 0 1 47 94 LMTK2 TRCN0000194721 680 547 619 461 1413 2232 KSR2 TRCN0000194722 93 103 75 97 52 78 TSSK4 TRCN0000194724 0 1 249 56 0 120 BMPR2 TRCN0000194726 149 764 0 2 0 0 PRKAR2B TRCN0000194729 655 1040 914 483 807 978 PRKG1 TRCN0000194730 1 3 167 207 0 60 IRAK3 TRCN0000194732 1531 2827 1211 302 714 288 CDK19 TRCN0000194734 1348 879 961 1505 2974 1789 TNNI3K TRCN0000194735 2983 1895 2101 1427 2501 2006 SCYL3

147

TRCN0000194736 0 0 0 0 0 0 RET TRCN0000194737 151 710 329 390 943 1245 TBCK TRCN0000194738 1397 2243 2379 1701 4547 4333 SGK3 TRCN0000194741 0 0 0 0 0 107 BUB1B TRCN0000194743 293 137 0 46 393 164 PDPK1 TRCN0000194744 142 1 6 69 1 5 PRKACA TRCN0000194745 836 967 2485 932 1299 1459 PRKACG TRCN0000194746 2563 4042 1792 2094 4021 5574 STK24 TRCN0000194747 145 110 181 95 45 121 RIOK3 TRCN0000194748 7 1329 394 247 447 420 FLT3 TRCN0000194749 143 224 341 280 142 414 BMPR1A TRCN0000194750 2 0 4 0 0 2 ILK TRCN0000194753 3950 4030 3571 4298 6457 7037 MAP4K5 TRCN0000194754 246 928 358 1177 1510 1526 EIF2AK1 TRCN0000194755 74 34 51 79 157 110 LATS2 TRCN0000194758 459 1 11 113 131 69 TBCK TRCN0000194759 295 1140 1375 805 138 1191 MAPK9 TRCN0000194760 251 268 269 467 1657 1334 JAK3 TRCN0000194762 2 135 68 120 1 183 PHKA1 TRCN0000194764 157 80 109 53 402 568 EIF2AK2 TRCN0000194766 1336 327 1019 1172 2052 4495 RPS6KB1 TRCN0000194767 1095 1388 2821 3038 2612 2686 TTN TRCN0000194768 0 4 324 84 222 78 DYRK3 TRCN0000194769 128 834 197 1475 1093 2032 STK19 TRCN0000194770 348 164 450 698 803 814 PTK6 TRCN0000194773 1023 1289 1575 1555 1264 1883 WNK2 TRCN0000194775 1529 1331 2686 2842 4185 6391 DSTYK TRCN0000194778 238 651 817 1224 2050 2149 BRSK1 TRCN0000194779 179 1178 3 792 1943 1026 ACVR1C TRCN0000194783 16 597 437 169 81 417 PRKACA TRCN0000194786 1170 1869 1884 2193 3164 3827 ITK TRCN0000194789 0 0 0 113 34 1 SMG1 TRCN0000194790 366 448 1904 1256 2542 1500 SNRK TRCN0000194796 1198 1286 1160 1606 3571 3501 CAMK2A TRCN0000194797 316 1288 782 326 549 222 CAMK2A TRCN0000194798 1 0 0 0 13 142 TTBK2 TRCN0000194800 12 39 388 946 370 1960 NRK TRCN0000194804 270 78 37 114 227 214 CDK13 TRCN0000194805 2 1 0 9 50 83 BMPR1A TRCN0000194806 172 1976 1644 648 1305 1341 RPS6KA3 TRCN0000194808 515 2309 805 901 1356 1599 PDK3

148

TRCN0000194809 0 0 0 23 0 127 PRKAB2 TRCN0000194810 1351 1387 929 749 909 2122 PRKG1 TRCN0000194813 1887 1765 1971 404 478 618 TNNI3K TRCN0000194815 142 354 3 269 247 248 STK40 TRCN0000194816 121 900 475 1064 641 1035 ATM TRCN0000194820 1241 1840 2745 667 871 1564 MAPK14 TRCN0000194823 0 3 0 527 1537 890 MAPKAPK5 TRCN0000194824 10 1047 237 320 826 796 FER TRCN0000194826 0 0 1 244 1 0 STK39 TRCN0000194827 15 445 489 353 213 744 SMG1 TRCN0000194828 474 11 546 916 776 1884 NEK3 TRCN0000194831 0 50 31 0 9 12 PRKAG1 TRCN0000194832 420 844 389 1905 2479 4683 CDC42BPA TRCN0000194836 61 630 125 292 403 966 ROCK2 TRCN0000194837 6 21 14 6 14 19 PRKAB2 TRCN0000194839 2084 10002 5181 3078 6537 5459 HIPK3 TRCN0000194840 5 947 67 184 1 0 STK4 TRCN0000194841 420 1139 1055 1641 1537 1965 MERTK TRCN0000194842 1 198 0 28 49 1 PASK TRCN0000194845 6 50 277 43 5 317 SIK3 TRCN0000194846 0 32 51 6 23 130 MLKL TRCN0000194847 1506 466 1440 1476 2478 3026 INSR TRCN0000194848 396 349 987 2149 2923 3155 KIT TRCN0000194849 0 8 0 1 17 17 MAPK14 TRCN0000194850 956 2388 2957 1329 1057 3142 FLT4 TRCN0000194851 20 3 283 191 4 534 RPS6KA3 TRCN0000194854 163 271 586 165 448 117 ROCK1 TRCN0000194855 285 307 315 433 484 396 PDGFRA TRCN0000194856 2178 2936 1738 1142 1523 2403 STK38 TRCN0000194857 327 492 84 535 138 74 AAK1 TRCN0000194858 4 268 279 596 534 556 CAMK1G TRCN0000194859 27 103 45 185 134 495 CSNK1G1 TRCN0000194860 1 0 97 48 106 204 MAPK8 TRCN0000194861 547 8 472 423 1029 1095 ATM TRCN0000194862 3 19 145 180 358 461 MAP3K15 TRCN0000194864 0 1 45 0 0 0 BMPR1B TRCN0000194865 161 173 172 52 157 644 BUB1B TRCN0000194866 271 0 25 136 1 310 CDK6 TRCN0000194868 3 1443 1259 80 34 107 CDK2 TRCN0000194871 1 7 795 67 135 32 NEK4 TRCN0000194872 419 1608 2294 339 312 652 STK17B

149

TRCN0000194873 5 79 116 1115 2164 1496 EPHA7 TRCN0000194874 0 0 11 35 651 1302 ROCK2 TRCN0000194875 216 1097 4 153 2451 306 PDK3 TRCN0000194880 2 838 127 0 3 1 TNNI3K TRCN0000194881 455 427 648 238 741 434 CDK16 TRCN0000194883 4 89 92 294 308 641 ALPK2 TRCN0000194884 1142 2161 1008 1905 3496 3582 NEK7 TRCN0000194885 8239 16459 12335 13713 12700 26978 MYO3B TRCN0000194890 0 0 6 0 1 0 PHKA2 TRCN0000194891 477 219 183 323 414 680 GRK4 TRCN0000194893 0 0 0 104 0 0 CDK6 TRCN0000194895 2 267 83 118 455 406 BRDT TRCN0000194896 1413 1152 714 1029 1729 1896 CSNK2A2 TRCN0000194897 3 303 1 230 108 146 CDK17 TRCN0000194898 196 1210 258 571 1099 1994 TTK TRCN0000194900 63 806 281 174 435 351 RIOK3 TRCN0000194903 2 191 0 102 158 30 ROCK1 TRCN0000194904 22 331 436 476 279 167 CDC42BPB TRCN0000194905 4 0 28 0 134 54 STK32B TRCN0000194906 465 1495 1268 402 706 1302 MARK1 TRCN0000194908 2 294 129 26 0 71 STK31 TRCN0000194909 109 49 29 140 95 47 MAP3K9 TRCN0000194911 3845 5802 4739 2000 1699 2361 GRK7 TRCN0000194913 0 2 67 53 135 62 CDK20 TRCN0000194918 3 216 248 244 137 12 SRPK1 TRCN0000194919 612 1115 328 363 633 894 TTK TRCN0000194920 175 100 68 81 88 172 ACVR1B TRCN0000194921 1 1 2 254 83 687 RPS6KA3 TRCN0000194922 1 1 87 279 437 153 MAP3K4 TRCN0000194923 4647 2732 4928 2817 4126 8042 WNK2 TRCN0000194925 23 6 8 72 112 178 PXK TRCN0000194926 285 145 90 55 488 150 TAOK1 TRCN0000194928 2 274 123 63 208 97 MAP3K9 TRCN0000194930 86 142 386 124 609 290 SGK494 TRCN0000194932 94 134 60 26 132 188 MAP3K15 TRCN0000194937 269 437 165 491 1031 1384 NEK4 TRCN0000194938 0 66 243 0 0 0 TXK TRCN0000194939 1126 1022 969 909 781 1072 CDC42BPA TRCN0000194943 327 215 0 31 163 0 ROCK1 TRCN0000194944 14 0 52 69 61 154 PTK2 TRCN0000194945 173 61 457 108 359 922 CHEK2

150

TRCN0000194947 0 0 0 0 0 0 STK39 TRCN0000194948 500 1325 503 990 794 2851 RET TRCN0000194949 4 716 172 405 299 328 NEK3 TRCN0000194950 0 0 0 0 0 0 BMX TRCN0000194951 0 36 273 62 28 194 TXK TRCN0000194952 0 0 0 51 0 0 STK17B TRCN0000194953 1 1 0 23 0 0 BCR TRCN0000194954 444 986 512 581 733 817 EPHA5 TRCN0000194956 6212 8070 6299 1245 3727 3351 ROCK2 TRCN0000194957 1 1 36 31 0 124 SGK1 TRCN0000194964 0 0 0 0 0 0 NEK7 TRCN0000194965 1151 154 0 444 9 1524 MAPK10 TRCN0000194966 10 1 125 296 266 60 SGK3 TRCN0000194969 4426 3757 4548 3888 5745 8011 ATM TRCN0000194971 1 0 0 0 70 124 AXL TRCN0000194972 141 335 152 249 704 401 ERBB3 TRCN0000194974 0 1 0 55 80 190 CDK5 TRCN0000194975 1133 2649 1409 392 1328 1303 MAP3K8 TRCN0000194976 8422 13260 12173 10946 18429 24842 MAK TRCN0000194977 1 3 104 224 423 2 CDK14 TRCN0000194978 1116 1741 1453 239 34 775 TEX14 TRCN0000194979 11 619 685 1244 527 817 MAPK10 TRCN0000194982 4 338 731 258 98 68 CDC42BPA TRCN0000194984 0 2 3 183 468 307 PTK2 TRCN0000194985 1 0 0 1 179 1 PRKDC TRCN0000194988 14 901 586 1036 1156 1812 CAMKV TRCN0000194989 789 0 77 136 205 57 NEK8 TRCN0000194990 1 11 0 10 0 25 ACVR2A TRCN0000194991 664 395 673 656 696 731 ACVR2A TRCN0000194992 248 578 702 545 1029 1189 TGFBR2 TRCN0000194995 2 63 2 0 1 0 TLK1 TRCN0000194996 0 46 10 3 0 0 STK39 TRCN0000195003 0 0 0 0 3 69 CDK2 TRCN0000195004 1 350 388 128 446 363 CKS1B TRCN0000195007 44 135 19 36 172 138 MAP4K3 TRCN0000195009 8 310 538 264 1050 1249 RIOK3 TRCN0000195010 405 884 1088 196 320 1066 CLK3 TRCN0000195011 423 989 941 1031 797 1028 PRKAB2 TRCN0000195013 2 442 206 235 148 351 PRKAB2 TRCN0000195014 1 7 174 106 522 490 PTK2 TRCN0000195015 55 51 0 39 16 18 PRKCH

151

TRCN0000195016 206 1232 245 60 238 444 SLK TRCN0000195023 843 1722 477 76 649 473 SGK3 TRCN0000195025 133 0 1 0 0 0 CHEK1 TRCN0000195027 0 38 0 22 28 65 TEC TRCN0000195029 0 0 0 59 117 39 CASK TRCN0000195030 111 53 35 213 89 140 CASK TRCN0000195031 26 126 110 40 6 30 CSK TRCN0000195032 0 1 140 2 499 354 ABL2 TRCN0000195033 0 16 0 1 87 65 PRKG2 TRCN0000195035 4 43 54 137 106 147 ULK2 TRCN0000195036 356 4852 1513 352 1376 1410 MYO3A TRCN0000195037 0 134 64 82 278 219 MAP2K2 TRCN0000195038 506 841 1108 98 2 1133 NEK10 TRCN0000195039 586 129 926 0 0 0 TAF1L TRCN0000195041 109 0 1 34 62 301 CAMK2D TRCN0000195044 96 0 15 60 186 183 PRKACA TRCN0000195047 4556 7236 9135 5159 5456 9960 SRPK1 TRCN0000195049 0 1 0 17 186 287 AURKA TRCN0000195051 0 0 0 0 0 22 EPHA7 TRCN0000195052 114 540 566 344 432 699 MAP4K2 TRCN0000195053 2759 2030 4524 4549 5105 4630 MAP3K8 TRCN0000195054 304 222 2 135 156 212 GAK TRCN0000195055 1421 223 8 276 318 399 GAK TRCN0000195056 1 249 146 31 86 160 MAK TRCN0000195057 193 27 97 75 57 468 CDC42BPB TRCN0000195058 1 340 0 0 26 83 VRK2 TRCN0000195060 345 73 70 14 1 122 LMTK2 TRCN0000195063 1 167 137 98 0 171 MARK3 TRCN0000195064 1411 1426 397 2083 2386 2601 CASK TRCN0000195065 132 247 542 48 52 92 CDK13 TRCN0000195066 250 205 99 196 282 408 BRAF TRCN0000195067 1469 435 894 1065 1262 2443 EPHA5 TRCN0000195069 47 148 82 75 110 152 CDK19 TRCN0000195070 141 100 220 226 140 358 CDKL3 TRCN0000195071 0 0 0 51 0 211 ZAK TRCN0000195075 1 124 548 602 1172 1448 TP53RK TRCN0000195076 0 1 22 34 2 52 MYO3B TRCN0000195078 5 534 500 454 107 998 TAF1L TRCN0000195081 776 357 474 487 704 1015 ACVR1 TRCN0000195082 21 1020 718 2353 1211 2138 KDR TRCN0000195083 94 1030 734 1014 1066 1247 TGFBR2

152

TRCN0000195085 0 0 17 0 0 1 MAP4K3 TRCN0000195088 226 196 267 1163 1235 2125 PRKG1 TRCN0000195089 4 88 0 387 222 120 SLK TRCN0000195090 147 0 0 0 0 129 NLK TRCN0000195094 6 1040 285 82 544 545 STRADB TRCN0000195096 2643 3648 4231 4723 5962 8031 STK32A TRCN0000195097 1287 2211 2316 2524 2948 4293 SGK2 TRCN0000195100 618 422 437 734 805 1355 CASK TRCN0000195104 0 40 1 26 1 59 CALM3 TRCN0000195106 1 221 155 121 254 377 TRIO TRCN0000195108 1 21 50 0 0 58 KIT TRCN0000195109 2842 2965 3517 1712 510 2440 RPS6KB1 TRCN0000195111 0 0 0 46 193 0 MKNK1 TRCN0000195112 0 2 70 164 73 152 ILK TRCN0000195114 714 255 971 2109 2348 2999 NTRK2 TRCN0000195116 283 182 454 56 3 205 AAK1 TRCN0000195120 958 837 529 2108 2524 1931 MAPK1 TRCN0000195124 570 677 316 1091 1396 1612 BRDT TRCN0000195126 0 0 0 0 15 0 PRKACB TRCN0000195127 267 207 3 40 346 363 PRKD1 TRCN0000195129 429 0 2 12 0 121 MAPKAPK5 TRCN0000195130 1 219 289 134 82 242 RIPK1 TRCN0000195132 4 4 317 157 1 779 PDGFRA TRCN0000195133 825 360 507 744 271 565 STK4 TRCN0000195134 310 820 758 1745 823 1549 ULK2 TRCN0000195135 953 973 724 750 941 1814 TEX14 TRCN0000195136 222 308 163 453 131 1186 ERN2 TRCN0000195139 718 588 388 1062 1806 1840 CDK1 TRCN0000195140 0 31 149 12 0 97 CDK1 TRCN0000195141 491 463 138 251 45 373 FLT4 TRCN0000195142 0 1 24 174 181 373 PAK3 TRCN0000195143 77 1 0 38 14 49 PRKAR1B TRCN0000195148 1414 1704 3030 995 642 1492 CDK14 TRCN0000195150 1484 1899 2209 2683 3772 6499 PXK TRCN0000195152 714 1254 1648 233 1300 552 HIPK1 TRCN0000195153 1143 1607 2616 1335 3024 3349 SGK3 TRCN0000195156 2260 2944 773 395 15 928 BMPR2 TRCN0000195160 825 119 224 740 614 761 TAF1 TRCN0000195161 5 6 526 421 994 702 EIF2AK3 TRCN0000195162 27 117 26 20 40 57 EIF2AK3 TRCN0000195164 31 14 54 36 95 106 IRAK3

153

TRCN0000195166 0 2 0 478 155 839 MELK TRCN0000195167 3 21 8 9 18 12 MYO3A TRCN0000195168 0 0 1 60 3 90 MAPK10 TRCN0000195169 769 1134 1184 845 1631 1177 C9orf96 TRCN0000195172 1 2 65 63 0 92 MAPK6 TRCN0000195173 2979 6212 8976 8792 11968 8572 DYRK4 TRCN0000195176 0 0 0 0 0 0 PRKG1 TRCN0000195178 0 0 0 70 9 365 PSKH2 TRCN0000195179 183 122 453 249 75 276 MAPK9 TRCN0000195180 11 197 92 1267 1316 1649 CSNK1A1L TRCN0000195181 53 0 41 80 35 149 TTBK2 TRCN0000195185 1077 446 567 925 1262 848 KDR TRCN0000195186 451 463 152 560 1157 1071 PRKAG1 TRCN0000195187 38 192 26 0 108 37 RIOK3 TRCN0000195188 429 606 476 368 681 1360 PKMYT1 TRCN0000195193 478 131 352 200 451 358 SGK3 TRCN0000195194 4 173 694 886 557 2 TSSK4 TRCN0000195197 307 376 562 549 894 1506 BUB1B TRCN0000195200 3 2 1 189 4 389 PRKACB TRCN0000195201 4 566 1 343 128 576 CDC7 TRCN0000195202 4 4 123 36 134 20 ROCK1 TRCN0000195204 280 330 325 168 421 403 CDK14 TRCN0000195206 504 1238 719 1388 1361 2322 CDKL3 TRCN0000195207 149 1023 358 282 963 556 STYK1 TRCN0000195208 271 116 246 97 316 309 RPS6KA2 TRCN0000195209 0 0 0 0 0 0 CDK16 TRCN0000195211 485 144 745 338 393 275 PDIK1L TRCN0000195214 265 153 34 292 52 305 CDK17 TRCN0000195222 73 18 44 109 103 159 CHEK2 TRCN0000195223 65 62 81 45 24 82 GSK3A TRCN0000195224 134 0 3 217 192 102 CAMK1D TRCN0000195225 0 332 0 77 27 277 NEK10 TRCN0000195226 757 2007 3058 3764 5407 4480 KIT TRCN0000195229 199 311 95 261 446 574 MKNK1 TRCN0000195230 0 10 21 11 0 5 CLK2 TRCN0000195232 616 3608 1306 640 1384 1868 TESK2 TRCN0000195235 2 309 3 627 171 1137 PHKB TRCN0000195236 756 234 3 365 3 572 KDR TRCN0000195237 3 176 273 314 501 242 PRKAG1 TRCN0000195238 1274 3164 2849 2105 3488 5749 PRKCZ TRCN0000195240 0 2 34 99 303 346 TEC

154

TRCN0000195241 231 200 157 192 393 364 PTK2B TRCN0000195242 8761 18100 18680 10504 10916 19446 STK17B TRCN0000195243 578 710 820 745 769 1581 AKT3 TRCN0000195244 590 1095 1194 987 1227 1921 TYRO3 TRCN0000195245 3277 3438 1044 2049 3654 3460 BRD4 TRCN0000195250 2 6 411 8 0 363 PRKCA TRCN0000195251 1 1 0 0 0 114 PRKD1 TRCN0000195252 2 29 24 13 43 1 MAP4K3 TRCN0000195255 180 69 88 170 0 0 STK17B TRCN0000195259 2 56 104 115 12 134 MAPK11 TRCN0000195260 2 274 44 203 72 94 TAF1 TRCN0000195264 120 0 25 121 179 142 VRK2 TRCN0000195265 4 273 605 189 203 136 EIF2AK1 TRCN0000195269 153 675 915 48 166 68 NRK TRCN0000195272 1332 1193 1727 774 2083 2127 FER TRCN0000195273 77 2 126 109 344 361 MOS TRCN0000195275 376 866 649 1 34 60 PRKD3 TRCN0000195277 33 94 98 168 85 243 STK33 TRCN0000195284 143 2 271 85 62 106 PRKAR2B TRCN0000195285 71 2 52 353 253 96 MAPK6 TRCN0000195286 1 240 141 96 3 82 MAPK11 TRCN0000195288 802 1247 437 918 814 2248 DYRK4 TRCN0000195289 739 1505 983 901 2304 1723 EPHA5 TRCN0000195291 0 0 2 375 2 0 TRAD TRCN0000195292 239 227 258 535 337 349 TRIO TRCN0000195293 5 182 1 569 366 1349 MYO3A TRCN0000195298 297 435 1057 977 827 1291 NRK TRCN0000195299 2848 3935 3496 3168 4157 6651 STK11 TRCN0000195302 1 0 192 133 0 2 PRKAR1B TRCN0000195303 268 523 239 412 227 1191 EGFR TRCN0000195311 298 224 245 387 602 1322 SGK196 TRCN0000195314 1 246 32 261 403 577 SGK494 TRCN0000195315 167 158 0 95 558 2 CSNK1A1L TRCN0000195317 1 2 36 91 0 0 C9orf96 TRCN0000195320 38 39 57 47 93 143 CDK2 TRCN0000195322 19 24 9 31 34 27 PRKCA TRCN0000195324 0 0 113 0 1 204 PTK7 TRCN0000195325 0 19 3 10 8 3 TTN TRCN0000195326 968 3095 3964 233 155 1487 MAPKAPK5 TRCN0000195327 2 0 0 0 2 140 PLK3 TRCN0000195329 121 1630 490 350 247 140 RPS6KA5

155

TRCN0000195330 942 2729 2770 1373 2183 2664 TNK2 TRCN0000195331 0 0 0 0 0 0 DSTYK TRCN0000195335 934 1668 1318 2346 2323 4948 HUNK TRCN0000195337 0 0 0 0 0 0 OBSCN TRCN0000195339 69 248 324 28 62 147 SRC TRCN0000195341 5 2 84 553 206 278 RPS6KB1 TRCN0000195342 0 45 16 17 13 10 ULK1 TRCN0000195343 0 16 18 29 42 159 MKNK1 TRCN0000195348 1069 2085 1915 1047 1257 2513 SNRK TRCN0000195353 3 4 11 12 19 12 AXL TRCN0000195355 458 467 184 27 34 113 CDK18 TRCN0000195356 0 1 26 0 1 23 MKNK1 TRCN0000195357 0 3 257 94 294 56 TLK1 TRCN0000195360 0 0 0 0 0 0 STK40 TRCN0000195361 30 16 15 10 12 9 ERN2 TRCN0000195362 1 0 0 3 0 0 SGK494 TRCN0000195363 92 292 69 71 181 499 NRK TRCN0000195364 0 0 0 9 1 0 MAST4 TRCN0000195366 113 78 139 319 558 494 CLK2 TRCN0000195367 0 0 0 0 0 0 PLK3 TRCN0000195368 1257 2575 1928 1779 2792 3643 ACVR1B TRCN0000195370 3 80 192 246 725 1464 ABL2 TRCN0000195372 1 3 25 20 12 16 NUAK2 TRCN0000195374 1 0 0 0 7 0 KSR2 TRCN0000195381 0 0 0 0 0 13 PRKCB TRCN0000195382 4834 6920 4800 3501 4578 9424 AURKC TRCN0000195383 36 60 50 70 96 105 MAP3K7 TRCN0000195385 166 229 117 58 139 36 MST1R TRCN0000195386 9 38 22 2 0 5 PRKAG1 TRCN0000195387 30 244 207 32 104 111 RYK TRCN0000195389 88 16 108 81 119 163 ACVR1B TRCN0000195390 2 46 15 61 20 199 ROR2 TRCN0000195392 580 1122 1279 213 164 939 HUNK TRCN0000195393 1 0 1 68 0 28 DSTYK TRCN0000195394 0 1 113 66 0 84 FGFR1 TRCN0000195395 20 12 40 7 22 31 ZAK TRCN0000195397 3098 1626 944 1450 1831 2562 STK40 TRCN0000195400 145 146 258 68 0 25 PRKCG TRCN0000195406 2311 2652 3365 2103 3051 4442 VRK1 TRCN0000195408 0 0 0 17 0 42 PRKCD TRCN0000195410 225 68 59 276 362 776 PAK6

156

TRCN0000195411 188 78 0 79 87 0 CAMK1G TRCN0000195414 67 33 72 0 0 36 BLK TRCN0000195415 86 325 290 121 22 24 WEE1 TRCN0000195420 524 356 89 133 201 368 NEK11 TRCN0000195421 0 0 0 48 1 71 PRKACA TRCN0000195423 1060 3076 1165 1055 1831 1888 PDGFRA TRCN0000195426 0 0 0 8 0 38 RET TRCN0000195427 0 0 0 0 0 157 MAP2K2 TRCN0000195429 103 26 112 136 44 347 JAK3 TRCN0000195431 45 4 668 31 281 246 CALM2 TRCN0000195434 117 817 399 632 9578 255 WEE1 TRCN0000195439 149 916 116 994 994 1238 TLK1 TRCN0000195440 0 1 91 1 235 132 STK39 TRCN0000195445 2 22 3 20 14 63 EPHA8 TRCN0000195451 37 53 58 131 92 508 BRDT TRCN0000195452 1 45 0 9 2 0 MAPKAPK3 TRCN0000195453 0 0 0 5 0 14 MTOR TRCN0000195454 128 1 0 17 95 486 STK4 TRCN0000195455 2 980 316 169 142 112 DAPK2 TRCN0000195456 1341 39 534 239 607 789 STK32B TRCN0000195461 0 0 1 22 0 5 PHKB TRCN0000195462 365 130 225 1141 85 516 CAMK2D TRCN0000195463 422 840 505 529 947 1096 CDK8 TRCN0000195464 0 217 1 46 213 5 PTK7 TRCN0000195465 0 0 0 1 0 0 SYK TRCN0000195466 0 0 23 26 35 69 CDK5R2 TRCN0000195468 45 25 12 14 20 44 PRKCQ TRCN0000195469 211 3 237 1 3 244 PLK2 TRCN0000195470 149 208 555 287 39 283 TRAD TRCN0000195472 1687 1020 1673 1612 2045 3319 MAPK1 TRCN0000195473 16 97 243 243 342 597 CAMKK2 TRCN0000195474 482 823 1175 286 425 454 ATM TRCN0000195477 113 254 73 78 197 175 ULK1 TRCN0000195478 1706 3625 2327 902 921 930 CLK3 TRCN0000195480 0 0 0 0 0 0 NEK10 TRCN0000195482 269 246 1 355 206 0 CSNK1E TRCN0000195483 0 0 0 8 5 15 NUAK2 TRCN0000195484 0 9 0 0 0 2 CDK4 TRCN0000195486 36 31 0 0 0 0 ACVR1 TRCN0000195489 0 0 21 45 0 0 FLT3 TRCN0000195490 3 395 0 52 374 124 EPHA5

157

TRCN0000195491 617 498 351 632 872 1212 PRKDC TRCN0000195493 547 518 188 479 332 590 MAP3K7 TRCN0000195497 0 0 0 0 0 0 ACVRL1 TRCN0000195499 1 221 0 47 111 138 CKS2 TRCN0000195500 119 170 54 160 45 105 PAK1 TRCN0000195502 0 0 0 0 0 0 RAF1 TRCN0000195503 1 1 4 670 91 413 RIOK3 TRCN0000195511 62 6 11 40 0 25 NEK4 TRCN0000195513 453 626 260 246 420 938 CDK5 TRCN0000195515 468 353 353 248 294 522 PASK TRCN0000195517 4 2 250 166 412 3 MAPK1 TRCN0000195518 0 0 0 7 0 21 STRADA TRCN0000195520 79 0 0 0 15 43 IRAK2 TRCN0000195521 2233 1372 3042 6340 8217 9735 TNK2 TRCN0000195522 1 31 54 40 39 85 BRSK1 TRCN0000195524 1 0 0 11 50 28 C9orf96 TRCN0000195527 350 481 598 825 1093 2280 PDK2 TRCN0000195531 1 33 105 0 20 56 CAMK1D TRCN0000195532 0 0 0 0 0 0 MAP3K7 TRCN0000195533 364 2022 1480 1175 1384 1620 MAP3K7 TRCN0000195537 4 360 312 228 330 365 CSNK1G3 TRCN0000195539 0 0 1 70 0 179 NTRK2 TRCN0000195540 6 2 127 126 27 0 STK4 TRCN0000195541 231 544 100 520 1259 1723 BRD3 TRCN0000195542 0 33 54 37 115 78 DAPK2 TRCN0000195543 2 98 238 177 190 329 TNNI3K TRCN0000195545 0 0 2 181 1 0 STK31 TRCN0000195548 409 1276 1253 436 539 1418 PAK3 TRCN0000195549 163 141 10 90 12 98 AURKA TRCN0000195552 800 119 350 219 438 807 ADRBK2 TRCN0000195556 441 854 894 1538 1073 1270 GRK6 TRCN0000195557 0 66 27 161 52 316 CDC42BPA TRCN0000195559 3 37 0 55 45 104 PRKCQ TRCN0000195565 546 487 495 237 245 500 OBSCN TRCN0000195566 2115 2209 1945 2003 2993 2043 TSSK2 TRCN0000195567 565 777 73 313 223 5 MYLK TRCN0000195569 0 0 0 1 0 0 KSR2 TRCN0000195570 110 88 67 92 120 50 FGFR3 TRCN0000195571 0 0 2 56 38 47 ACVR2B TRCN0000195572 0 0 0 0 0 0 MAP3K10 TRCN0000195575 122 155 240 76 397 253 MAP4K5

158

TRCN0000195576 209 802 598 1150 1514 1305 VRK3 TRCN0000195579 78 161 78 98 237 253 TBCK TRCN0000195585 763 1236 1696 1673 1626 2109 TAOK2 TRCN0000195586 66 271 117 214 160 437 TYRO3 TRCN0000195587 0 0 4 0 16 27 CHEK2 TRCN0000195588 88 57 138 42 47 71 CHEK2 TRCN0000195590 0 5 66 31 105 313 ADCK1 TRCN0000195591 6 20 32 31 13 42 EPHA8 TRCN0000195592 638 634 729 332 866 1154 MYLK TRCN0000195593 166 27 0 154 206 294 MGC42105 TRCN0000195594 675 655 440 101 592 475 CDK8 TRCN0000195595 0 0 0 31 44 43 CKS1B TRCN0000195596 257 177 82 1017 1341 1237 CDC42BPA TRCN0000195598 6 4 47 3 22 17 PRKCD TRCN0000195599 283 459 378 723 2018 1479 MAP4K5 TRCN0000195600 738 1060 371 74 48 29 PRKAG3 TRCN0000195604 1 60 43 0 2 1 AXL TRCN0000195606 1 296 51 98 295 126 TGFBR2 TRCN0000195607 1 1 260 257 39 644 MAPKAPK5 TRCN0000195608 0 0 0 0 0 0 BCR TRCN0000195609 3502 2009 3473 2693 4555 7603 BRAF TRCN0000195610 182 152 1 10 20 36 EIF2AK3 TRCN0000195611 103 78 160 83 45 287 PTK2 TRCN0000195612 0 69 108 67 40 249 MINK1 TRCN0000195613 0 0 5 3 10 1 PXK TRCN0000195614 8 337 288 210 229 138 TSSK2 TRCN0000195615 1 18 19 2 36 19 TSSK2 TRCN0000195616 2 1 298 137 1 234 PDIK1L TRCN0000195618 177 3 181 42 178 96 INSR TRCN0000195619 1 102 0 0 52 0 CAMK2D TRCN0000195622 0 0 0 6 0 46 GRK1 TRCN0000195624 108 3 214 68 225 226 DYRK4 TRCN0000195626 128 6 518 101 572 596 TGFBR1 TRCN0000195627 214 429 472 390 1227 394 TAOK2 TRCN0000195631 1 0 0 9 5 9 RAGE TRCN0000195635 1076 3206 2619 1468 1877 2447 INSR TRCN0000195636 1 1 0 12 0 1 PAK1 TRCN0000195637 229 3 48 48 84 221 STK24 TRCN0000195638 11 314 182 781 667 816 CDK13 TRCN0000195641 469 716 755 611 460 2082 TNNI3K TRCN0000195643 213 330 116 227 41 258 RET

159

TRCN0000195646 2 0 13 114 61 622 RAF1 TRCN0000195647 445 425 291 313 470 470 TNK2 TRCN0000195648 251 187 175 37 299 373 STK38 TRCN0000195649 4 98 114 431 226 756 TP53RK TRCN0000195652 2116 3752 2170 4865 5520 11319 STK40 TRCN0000195655 288 806 456 93 494 643 TNK1 TRCN0000195656 0 34 44 83 113 111 STK19 TRCN0000195660 392 111 63 652 219 352 BMPR1B TRCN0000195661 0 0 0 59 46 0 CSNK1G2 TRCN0000195662 0 99 131 20 104 358 PRKCH TRCN0000195665 708 777 324 663 913 1564 CSNK1A1L TRCN0000195667 245 188 1 381 66 0 STRADA TRCN0000195669 0 0 1 0 0 0 ACVR2B TRCN0000195673 115 49 60 53 47 118 TYRO3 TRCN0000195674 319 825 1396 991 1412 1736 LATS2 TRCN0000195680 384 1349 1458 736 1525 1909 ACVR1B TRCN0000195683 101 543 2 515 815 1206 FGFR1 TRCN0000195685 0 190 57 0 85 0 TEX14 TRCN0000195686 96 83 59 43 8 144 GSG2 TRCN0000195690 2 22 10 64 24 77 EPHA2 TRCN0000195694 1 331 92 312 926 227 MAP3K9 TRCN0000195696 0 23 46 12 5 6 ANKK1 TRCN0000195697 0 0 0 48 102 0 MAP3K15 TRCN0000195698 2126 3591 4527 3610 6551 5041 CAMK2D TRCN0000195703 0 0 36 42 41 127 DYRK3 TRCN0000195708 0 0 0 3 0 0 CKS2 TRCN0000195709 0 8 0 66 31 149 FES TRCN0000195715 5 267 78 200 287 432 CAMK1D TRCN0000195722 0 173 18 31 79 1 BCR TRCN0000195724 1 117 0 75 1 511 MAP4K1 TRCN0000195726 2 122 348 29 743 168 RPS6KA4 TRCN0000195729 3 5 0 16 17 8 SMG1 TRCN0000195730 183 3 145 63 1 130 SIK3 TRCN0000195732 764 929 693 1561 1516 2352 ATM TRCN0000195733 1 2 0 11 3 5 PRKCB TRCN0000195734 7445 11511 9766 16948 21063 29176 EPHA2 TRCN0000195739 376 982 1131 913 511 1853 LATS1 TRCN0000195740 1399 697 624 730 1545 1598 STYK1 TRCN0000195741 10 592 964 1053 702 1187 AAK1 TRCN0000196243 341 141 103 20 188 331 NEK4 TRCN0000196244 0 78 61 113 159 215 ACVR1B

160

TRCN0000196246 0 64 1 4 76 22 TNNI3K TRCN0000196249 2232 2154 1996 1638 1669 2107 PRKD3 TRCN0000196250 127 179 163 711 362 473 TRIO TRCN0000196252 0 134 400 561 770 619 PHKA2 TRCN0000196253 96 166 263 278 358 757 BMPR2 TRCN0000196255 1101 881 1533 1457 1746 2498 RYK TRCN0000196261 1 0 125 0 2 0 CDK6 TRCN0000196262 0 0 13 29 30 33 PDGFRB TRCN0000196263 90 47 0 2 58 513 PRKACB TRCN0000196264 0 0 0 24 77 0 RAF1 TRCN0000196266 1 3 163 81 23 128 MAP4K3 TRCN0000196268 363 137 654 471 579 853 LATS1 TRCN0000196270 1 1 153 17 165 376 PDK3 TRCN0000196271 60 1504 1484 390 780 2022 ITK TRCN0000196272 0 0 0 0 0 0 PDGFRA TRCN0000196273 517 1350 2239 649 997 1567 MELK TRCN0000196275 0 0 117 0 235 124 SMG1 TRCN0000196276 2218 7681 5954 4850 6280 9995 SIK2 TRCN0000196277 46 0 0 57 93 106 ADCK1 TRCN0000196278 1 112 0 189 156 692 RIOK1 TRCN0000196279 86 0 0 0 0 0 MYLK TRCN0000196281 0 47 0 0 0 49 MAPK9 TRCN0000196283 3 153 218 473 257 592 TTBK2 TRCN0000196284 69 59 0 48 16 44 TTBK2 TRCN0000196287 237 2 126 37 0 0 CSNK1A1 TRCN0000196291 34 63 4 2 278 305 ACVR1B TRCN0000196293 289 400 724 722 1033 1031 TGFBR1 TRCN0000196298 6349 15272 13755 13427 16952 21396 EPHA3 TRCN0000196299 0 0 0 27 5 28 NTRK2 TRCN0000196300 51 567 429 893 2321 2302 PRKCH TRCN0000196303 1343 1682 1962 2393 2174 4939 MAPK10 TRCN0000196304 82 324 76 117 150 246 MAPK8 TRCN0000196309 0 0 0 151 0 182 TGFBR1 TRCN0000196310 0 80 39 1 297 0 PTK2 TRCN0000196312 92 903 884 1178 1702 1511 NLK TRCN0000196314 266 731 232 511 368 922 PAK6 TRCN0000196315 6 90 47 40 0 140 MAPK9 TRCN0000196316 21 50 81 121 170 251 NEK10 TRCN0000196317 0 0 0 0 0 0 MLKL TRCN0000196320 0 0 0 41 4 120 MAPK14 TRCN0000196323 0 0 0 0 9 15 PRKCB

161

TRCN0000196324 670 451 786 424 349 1347 RYK TRCN0000196325 289 885 363 1062 1998 3026 AURKC TRCN0000196326 0 250 134 1163 855 1168 TGFBR1 TRCN0000196327 0 0 106 0 0 3 MERTK TRCN0000196328 274 217 54 178 177 165 PRKDC TRCN0000196329 182 1075 423 255 652 865 SLK TRCN0000196332 252 3 128 610 952 1415 CAMKV TRCN0000196333 1002 709 831 1828 2331 1873 UHMK1 TRCN0000196335 9 521 128 620 1057 1549 ATM TRCN0000196336 69 0 0 97 0 0 BUB1B TRCN0000196337 0 0 1 12 0 112 CDK6 TRCN0000196340 1 0 1 142 99 189 PRKAR1A TRCN0000196342 137 38614 375 91 11 16 RPS6KB1 TRCN0000196344 0 30 7 0 0 0 MAP3K13 TRCN0000196345 472 888 1042 718 492 1033 RPS6KA5 TRCN0000196348 930 1635 1226 1551 2390 3070 FER TRCN0000196349 1141 2030 2421 452 1000 1033 CDK14 TRCN0000196352 332 65 1 0 6 184 NLK TRCN0000196355 0 1 144 66 137 384 SGK196 TRCN0000196357 0 0 0 12 11 14 ALPK2 TRCN0000196359 0 0 0 0 0 0 ACVR1C TRCN0000196364 4 553 2 110 34 420 MAPK6 TRCN0000196365 23 0 0 0 8 0 TXK TRCN0000196366 1939 2802 2073 1679 3128 4495 ALK TRCN0000196368 2 1 2 2 4 25 EIF2AK1 TRCN0000196369 0 54 78 6 38 8 PAK6 TRCN0000196370 631 1396 844 666 1056 1112 MAPK10 TRCN0000196371 1 261 137 31 118 147 MAPK8 TRCN0000196372 10 1063 109 210 195 342 NEK10 TRCN0000196373 3 272 339 185 154 325 TAF1L TRCN0000196375 190 187 248 204 174 489 GRK4 TRCN0000196378 4247 7994 5138 4226 4279 7255 TTK TRCN0000196379 499 214 663 1316 464 1487 PLK1 TRCN0000196380 156 98 408 340 476 589 BCKDK TRCN0000196383 0 215 0 0 0 0 RAGE TRCN0000196385 0 128 202 0 156 114 MAST1 TRCN0000196386 490 1903 691 1005 1558 3311 SIK2 TRCN0000196387 1 0 0 4 0 17 DSTYK TRCN0000196388 0 0 0 0 0 0 RPS6KA2 TRCN0000196389 7 316 335 61 122 96 RPS6KA2 TRCN0000196393 101 92 199 104 114 66 ACVR1C

162

TRCN0000196395 208 8860 90 78 144 103 SRC TRCN0000196396 0 20 0 0 5 0 PHKB TRCN0000196398 1 54 21 202 1128 156 KDR TRCN0000196399 189 744 654 27 490 279 PRKCB TRCN0000196400 1011 1838 1511 886 1221 1668 EIF2AK2 TRCN0000196401 1220 2304 1566 249 262 470 SYK TRCN0000196403 2 56 333 361 4 310 CSNK1G3 TRCN0000196404 1324 2203 1748 2982 3334 5531 MERTK TRCN0000196405 0 0 0 0 27 0 TLK1 TRCN0000196408 0 117 0 0 0 0 MELK TRCN0000196411 965 183 7 93 2 257 SIK3 TRCN0000196412 933 818 1336 926 1725 2112 SGK3 TRCN0000196417 0 0 49 74 50 31 CALM3 TRCN0000196419 103 81 45 226 359 217 MAK TRCN0000196420 1 1 254 0 0 0 MELK TRCN0000196422 1406 2766 2792 2592 4023 3006 TNNI3K TRCN0000196424 0 0 0 0 1 3 MYO3A TRCN0000196426 370 667 455 271 310 469 NEK11 TRCN0000196427 143 6941 18058 1247 1635 1616 TP53RK TRCN0000196430 432 500 188 221 1151 1078 MAP3K15 TRCN0000196431 5088 4335 4068 3651 5829 7319 IRAK2 TRCN0000196433 80 0 45 20 43 125 PDPK1 TRCN0000196434 1 451 2 538 1 630 PRKAR1A TRCN0000196438 879 252 76 199 59 14 RPS6KA6 TRCN0000196439 1 155 106 274 417 557 HUNK TRCN0000196440 1287 3253 2335 1581 1182 1913 TNIK TRCN0000196443 300 3 139 5 142 2 MET TRCN0000196445 1 1 54 97 167 269 BMX TRCN0000196448 528 585 505 671 1661 2479 CDK17 TRCN0000196451 513 593 590 143 242 342 TAOK1 TRCN0000196452 186 12 212 333 372 467 STK33 TRCN0000196455 532 747 1133 514 1126 1225 CDK9 TRCN0000196456 18 47 17 73 123 123 MARK3 TRCN0000196461 172 76 165 168 73 184 TXK TRCN0000196462 426 72 46 43 146 121 BMPR1A TRCN0000196463 45 96 37 473 340 411 GAK TRCN0000196464 2 100 0 16 238 30 PRKAB2 TRCN0000196470 0 38 0 6 0 0 UHMK1 TRCN0000196471 219 158 41 136 11 142 ANKK1 TRCN0000196472 982 1525 1064 1231 1647 1726 MAPK14 TRCN0000196473 8 1328 740 571 791 857 CALM2

163

TRCN0000196474 491 382 835 627 1011 679 RYK TRCN0000196475 708 452 185 484 359 355 SRPK1 TRCN0000196477 386 33 50 347 996 517 EPHA7 TRCN0000196478 84 1 56 14 19 82 MAPKAPK3 TRCN0000196479 5 1 8 9 29 82 RPS6KA5 TRCN0000196480 2 0 17 53 202 198 ROCK2 TRCN0000196481 31 149 237 444 469 562 AKT3 TRCN0000196486 125 500 79 115 302 189 DAPK2 TRCN0000196487 1 5 309 162 1 79 AAK1 TRCN0000196489 0 34 1 32 0 102 STK32B TRCN0000196492 137 47 108 66 348 651 EPHA8 TRCN0000196493 7 283 389 446 412 1977 CSNK1G1 TRCN0000196494 1 0 0 0 0 14 CAMKV TRCN0000196496 1708 4889 2771 3320 2655 4824 TEX14 TRCN0000196498 516 339 580 300 618 688 CDK15 TRCN0000196500 4 332 140 535 167 1031 TAF1L TRCN0000196501 856 1112 1297 816 1342 1803 SGK3 TRCN0000196502 18 162 57 6809 23744 125 NRK TRCN0000196504 0 32 13 17 0 58 KIT TRCN0000196505 214 2 140 80 384 152 GRK4 TRCN0000196506 0 2 117 10 498 231 DYRK1A TRCN0000196507 1 0 1 191 1 405 ACVR2A TRCN0000196508 394 648 620 1223 732 1757 CALM2 TRCN0000196511 1535 271 2110 474 279 243 CDK17 TRCN0000196512 299 221 34 365 91 59 PRKACA TRCN0000196513 1 1 77 73 39 3 MAP2K5 TRCN0000196514 729 1235 705 182 168 108 CDC42BPA TRCN0000196518 5 48 87 1 583 974 MAP3K8 TRCN0000196520 0 701 621 132 181 574 AKT3 TRCN0000196521 0 0 0 2 1 0 AKT3 TRCN0000196522 271 1 67 45 491 508 NTRK2 TRCN0000196524 2461 1713 2297 3670 5513 8953 STK38 TRCN0000196526 1 3 256 51 45 0 RPS6KA6 TRCN0000196527 373 152 1121 809 2308 2160 HUNK TRCN0000196528 1 174 39 50 101 390 CDK19 TRCN0000196529 0 0 0 6 0 0 DSTYK TRCN0000196530 0 0 162 45 23 157 STRADB TRCN0000196537 925 2122 2339 1672 1692 2730 KIT TRCN0000196539 1257 2116 549 1661 2040 1522 CDK11B TRCN0000196540 0 1 175 0 1 73 MARK3 TRCN0000196541 255 1216 1063 100 850 340 MARK3

164

TRCN0000196542 167 411 236 257 474 758 CDC7 TRCN0000196543 492 2220 604 887 877 1069 CDC7 TRCN0000196546 104 152 139 74 190 182 EPHA3 TRCN0000196547 0 0 10 9 24 0 STK39 TRCN0000196549 1 0 0 0 58 0 RPS6KA6 TRCN0000196552 228 429 165 229 119 696 NEK11 TRCN0000196553 96 0 18 17 50 50 RIOK1 TRCN0000196554 393 628 810 240 266 69 SGK196 TRCN0000196555 431 591 660 1162 1026 1710 STK31 TRCN0000196562 0 0 0 0 0 28 SGK1 TRCN0000196563 1203 2587 3235 810 1307 1804 TNNI3K TRCN0000196564 70 42 107 272 205 471 SNRK TRCN0000196569 0 2 129 0 0 4 CDK8 TRCN0000196570 27 268 108 43 157 143 IRAK2 TRCN0000196571 0 0 0 0 118 271 ACVR2A TRCN0000196572 587 30 430 382 323 686 RIOK3 TRCN0000196573 572 562 57 134 122 244 EPHB2 TRCN0000196574 5 266 255 520 568 656 BRD3 TRCN0000196575 38 89 65 71 98 208 MAP3K9 TRCN0000196576 38 746 21 187 435 632 BRD4 TRCN0000196578 0 34 1 36 431 104 PHKA1 TRCN0000196579 345 711 888 1379 1062 1631 MAPK11 TRCN0000196581 1935 2687 3117 2018 6731 6262 CLK3 TRCN0000196583 237 0 0 52 43 0 PLK2 TRCN0000196584 0 0 0 0 22 43 TESK2 TRCN0000196585 268 537 442 1 0 1 RPS6KA6 TRCN0000196591 1607 3219 1444 2183 1148 4448 CSNK1G3 TRCN0000196593 1 3 228 369 303 619 PRKD3 TRCN0000196594 5 359 94 0 2 61 PXK TRCN0000196595 30 104 120 145 138 103 STYK1 TRCN0000196597 642 2122 2056 1778 1460 2800 CDK15 TRCN0000196598 1036 2566 2494 3638 3323 5104 SGK494 TRCN0000196600 5 250 272 200 438 370 BMX TRCN0000196602 548 696 507 1935 2590 3222 CDK1 TRCN0000196603 165 204 153 84 291 157 CDK1 TRCN0000196604 95 2 77 24 183 214 CASK TRCN0000196606 0 12 102 135 88 243 RIPK1 TRCN0000196610 1230 1250 1915 3816 4896 7243 EIF2AK3 TRCN0000196613 2 2 66 29 205 42 MARK4 TRCN0000196619 1 0 0 0 834 479 PHKA1 TRCN0000196620 344 1112 1370 571 537 692 TTK

165

TRCN0000196622 211 440 375 117 79 512 TAOK2 TRCN0000196624 1 5 3 14 6 69 CALM3 TRCN0000196625 3 5 431 532 776 646 PRKCD TRCN0000196626 148 183 66 35 76 29 LMTK2 TRCN0000196630 619 572 163 1009 298 1370 CSNK1G1 TRCN0000196631 20 67 82 48 22 35 MAP3K9 TRCN0000196633 285 0 133 83 184 146 ACVR1C TRCN0000196634 589 305 691 481 487 1177 MAP3K15 TRCN0000196635 39 231 53 118 239 243 PDK1 TRCN0000196638 416 1992 549 2821 2774 2623 WEE1 TRCN0000196639 587 2 170 276 381 362 CDC42BPA TRCN0000196640 0 83 97 337 62 168 STK17B TRCN0000196641 2 95 47 0 0 0 MAP4K2 TRCN0000196642 0 0 0 0 0 0 RPS6KA3 TRCN0000196645 1335 831 1233 950 2021 1613 SNRK TRCN0000196648 46 186 116 14 13 130 STK31 TRCN0000196650 71 119 0 52 148 108 PRKD1 TRCN0000196651 0 0 1 24 12 53 TEC TRCN0000196652 198 540 118 278 351 483 STK24 TRCN0000196653 32 27 56 41 54 71 RIOK3 TRCN0000196654 200 45 154 98 133 115 FLT3 TRCN0000196655 1871 2693 2415 2880 4479 5285 MTOR TRCN0000196656 95 266 445 477 554 549 JAK2 TRCN0000196657 27 1 51 0 0 46 TNIK TRCN0000196658 6 348 42 119 0 152 STYK1 TRCN0000196660 268 678 469 124 104 193 UHMK1 TRCN0000196661 0 293 0 133 1 283 ATM TRCN0000196663 0 42 41 0 23 5 CSNK2A2 TRCN0000196664 0 0 0 17 0 0 PRKACB TRCN0000196666 3513 4213 5376 4258 4542 8088 ROCK1 TRCN0000196668 324 99 150 0 2 57 PLK2 TRCN0000196672 4 0 0 7 129 11 RIOK2 TRCN0000196674 1 234 130 260 412 683 MAP3K7 TRCN0000196675 67 643 65 221 46 229 GRK4 TRCN0000196680 50 59 19 9 5 86 PRKAR2B TRCN0000196681 0 32 0 0 28 0 TRAD TRCN0000196682 3 0 0 37 0 16 SLK TRCN0000196683 1 0 1 135 285 143 CDK19 TRCN0000196684 754 636 863 278 193 230 RIOK2 TRCN0000196685 66 146 80 116 74 142 MET TRCN0000196686 129 163 6 24 0 0 PHKA2

166

TRCN0000196687 0 0 0 0 0 0 PHKB TRCN0000196690 226 94 52 151 240 375 CDK2 TRCN0000196698 354 125 167 357 120 190 CDK4 TRCN0000196701 2 76 0 146 171 152 PHKA2 TRCN0000196702 698 1080 744 1030 1766 1153 CDK8 TRCN0000196703 8 4 258 58 0 29 BRDT TRCN0000196704 125 0 0 0 0 0 CDK11B TRCN0000196705 0 0 1 8 5 0 CDK11B TRCN0000196710 14 40 18 29 111 95 NEK4 TRCN0000196713 0 903 112 62 86 268 EPHA7 TRCN0000196715 43 161 48 0 42 114 PRKD3 TRCN0000196718 810 1190 475 267 979 536 EIF2AK1 TRCN0000196722 0 100 101 47 100 220 NEK7 TRCN0000196725 1158 400 886 976 1462 1907 IRAK2 TRCN0000196726 0 0 0 0 0 0 FLT1 TRCN0000196727 101 1 79 153 170 457 PAK2 TRCN0000196728 262 320 61 170 53 191 PDK1 TRCN0000196729 220 32 201 185 272 559 PDK1 TRCN0000196730 1 254 2 195 71 25 PRKCA TRCN0000196731 3 105 7 45 0 34 MAPK6 TRCN0000196732 1 103 11 0 0 0 AURKA TRCN0000196733 117 772 672 477 800 712 BMPR1A TRCN0000196736 1456 4155 4258 1368 621 1465 EIF2AK1 TRCN0000196737 1160 1856 1355 655 835 1836 HUNK TRCN0000196738 233 102 241 156 293 329 CDKL3 TRCN0000196740 0 0 29 166 320 225 RIOK1 TRCN0000196741 188 123 20 18 36 58 MLKL TRCN0000196743 0 20 49 7 2 43 CSNK1A1 TRCN0000196744 1 300 1 298 736 170 CSNK1E TRCN0000196745 4 2 134 341 207 376 CSNK2A2 TRCN0000196747 29 261 425 236 225 260 CLK2 TRCN0000196748 1340 1880 2693 1644 2334 3721 LATS1 TRCN0000196751 2 0 1 796 273 1147 TRIO TRCN0000196752 2 173 0 33 304 208 ULK2 TRCN0000196753 1 0 0 232 125 277 ULK2 TRCN0000196754 0 55 20 34 35 0 ZAK TRCN0000196756 3207 1613 3739 2182 1915 3432 TRIB3 TRCN0000196757 266 396 659 43 344 510 MARK4 TRCN0000196758 601 490 983 392 653 908 PINK1 TRCN0000196759 0 4 19 0 0 6 MAPK9 TRCN0000196760 123 1265 1335 1106 1062 2631 STK32A

167

TRCN0000196761 65 1 47 48 0 0 MLKL TRCN0000196765 146 299 142 382 203 496 ACVR1B TRCN0000196766 299 360 613 274 502 631 RPS6KA5 TRCN0000196767 1777 2270 1005 1554 1386 1746 EPHA3 TRCN0000196768 0 0 0 0 71 0 ITK TRCN0000196770 416 583 634 880 745 1470 TRIO TRCN0000196773 0 1 0 2 124 0 ULK2 TRCN0000196774 476 594 956 675 774 1127 TNIK TRCN0000196775 0 0 0 0 0 0 MINK1 TRCN0000196777 140 68 103 32 154 82 CDKL3 TRCN0000196780 312 1124 201 1317 1355 1029 MARK1 TRCN0000196781 3 713 186 578 525 485 SGK196 TRCN0000196783 2236 1512 1981 503 482 1335 MYO3B TRCN0000196786 56 6 190 42 69 82 INSR TRCN0000196788 0 0 0 0 0 0 CHEK1 TRCN0000196789 198 176 187 419 353 437 IRAK2 TRCN0000196793 0 0 0 2 4 2 ROCK2 TRCN0000196794 0 15 0 4 78 104 GAK TRCN0000196796 3 189 99 180 159 247 RPS6KA6 TRCN0000196798 875 650 630 207 247 489 TNIK TRCN0000196800 4 189 417 76 381 411 TRPM6 TRCN0000196802 8051 12602 11352 7439 8877 11568 TAOK1 TRCN0000196804 0 3 103 189 186 1 CDK16 TRCN0000196805 0 14 0 5 12 13 TP53RK TRCN0000196806 3 406 642 500 371 604 CSNK1A1L TRCN0000196807 336 38 38 55 82 116 PDIK1L TRCN0000196809 58 496 329 147 261 259 FGFR3 TRCN0000196812 1712 3097 3460 1784 2503 4421 AURKC TRCN0000196813 0 5 235 249 51 145 TTK TRCN0000196815 881 961 1747 292 100 1062 ROR2 TRCN0000196816 114 48 173 249 259 599 MAP3K8 TRCN0000196818 162 419 45 482 280 507 MARK1 TRCN0000196819 190 218 466 664 1424 2385 STK33 TRCN0000196820 0 0 0 0 0 0 MAPK8 TRCN0000196821 0 0 21 26 80 152 MLKL TRCN0000196824 26 0 0 44 53 29 MET TRCN0000196825 233 272 64 119 104 0 PHKG2 TRCN0000196826 189 671 554 455 451 468 SBK1 TRCN0000196827 12 1040 1475 497 752 1492 CALM2 TRCN0000196828 309 446 694 488 311 625 TTN TRCN0000196830 270 3 66 124 26 275 EPHA3

168

TRCN0000196832 1 40 3 0 0 255 STK4 TRCN0000196833 245 225 400 258 570 362 CDK14 TRCN0000196835 1 68 0 33 97 161 ADCK2 TRCN0000196836 146 378 49 385 145 465 ALPK2 TRCN0000196839 884 885 522 699 478 631 CHEK1 TRCN0000196841 2 2 2 5 3 16 PRKCB TRCN0000196844 915 2170 2024 1453 1392 2538 BRAF TRCN0000196845 5 4 211 386 252 199 EPHA5 TRCN0000196846 1896 2375 2830 1982 2229 4612 CDC42BPB TRCN0000196847 0 16 5 8 17 9 PRKG1 TRCN0000196849 209 4 223 89 12 246 SMG1 TRCN0000196850 1 71 8 23 0 0 MAPK8 TRCN0000196851 148 407 472 70 198 629 TAF1L TRCN0000196853 224 3 213 62 0 182 DYRK3 TRCN0000196855 68 129 186 222 78 187 JAK2 TRCN0000196857 0 55 0 0 0 0 TRAD TRCN0000196858 171 1 117 2 301 66 TLK1 TRCN0000196862 0 0 0 0 25 6 ZAK TRCN0000196866 1 55 0 145 329 253 MET TRCN0000196868 0 69 0 0 188 110 PHKA1 TRCN0000196869 66 353 74 0 169 413 PIM1 TRCN0000196872 1 1 1 151 75 2 PRKD1 TRCN0000196874 1419 1512 2119 1129 2526 2426 ACVR1B TRCN0000196875 1076 1560 2406 994 1765 1153 BMPR1A TRCN0000196878 0 0 0 0 0 0 VRK2 TRCN0000196882 3 286 123 333 422 253 TNIK TRCN0000196884 146 1 50 151 1 271 STRADB TRCN0000196887 1 197 89 178 130 114 SGK2 TRCN0000196891 114 0 0 10 44 89 PDK1 TRCN0000196892 590 1308 839 851 163 1009 PRKAR2B TRCN0000196893 0 2 0 0 0 0 CDC42BPA TRCN0000196894 618 769 526 390 623 1167 CAMK1 TRCN0000196896 1068 1111 1183 2023 4509 5150 CDK13 TRCN0000196897 250 282 712 465 849 412 CSNK1G3 TRCN0000196898 532 6 540 395 104 724 TAF1 TRCN0000196899 0 0 0 0 15 180 MAP3K8 TRCN0000196903 1 0 0 1 200 198 LMTK2 TRCN0000196907 956 957 762 1263 2039 2406 GSG2 TRCN0000196908 45 81 94 31 139 105 PHKG2 TRCN0000196909 0 183 195 129 47 376 PRKCA TRCN0000196910 271 632 428 557 891 2002 WEE1

169

TRCN0000196911 1510 1960 1571 767 1040 1887 DYRK4 TRCN0000196912 0 33 44 16 9 38 PTK6 TRCN0000196913 2 5 13 4 8 12 EPHA8 TRCN0000196915 7116 3307 3187 4475 1711 2710 STK33 TRCN0000196917 17 26 1 46 205 426 PTK2B TRCN0000196918 476 1306 291 1062 1597 1934 BRAF TRCN0000196919 1 103 78 2 53 77 ROR2 TRCN0000196920 0 0 0 0 0 0 MAP3K6 TRCN0000196922 10 168 102 0 16 0 MAP3K4 TRCN0000196926 1 49 1 78 69 155 CLK3 TRCN0000196928 3 1 195 462 991 590 PDGFRA TRCN0000196931 1 62 34 3 0 1 NEK8 TRCN0000196932 3 350 0 2 221 42 FES TRCN0000196933 0 20 0 121 9 61 PDPK1 TRCN0000196935 2 0 38 39 139 29 PLK3 TRCN0000196937 782 901 677 875 1454 28672 ADRBK2 TRCN0000196938 589 950 658 20 55 3 INSRR TRCN0000196939 0 2 1 0 38 93 ZAK TRCN0000196940 14 27 68 0 19 62 CAMK1G TRCN0000196941 77 579 431 192 282 355 TAOK1 TRCN0000196943 656 623 724 481 1436 1920 JAK3 TRCN0000196944 215 169 95 13 39 177 IRAK2 TRCN0000196945 0 20 27 36 12 9 AXL TRCN0000196946 4985 6988 6820 4187 5437 9142 CDK11B TRCN0000196948 0 0 0 15 19 25 ULK1 TRCN0000196952 761 918 1001 142 86 313 MERTK TRCN0000196954 0 0 0 0 0 0 RAGE TRCN0000196955 319 227 36 347 355 272 SIK2 TRCN0000196956 0 171 44 174 118 208 MAPK7 TRCN0000196958 0 0 25 0 6 0 RIPK1 TRCN0000196960 2 215 121 42 41 122 PRKD3 TRCN0000196963 0 0 0 17 0 24 PKN3 TRCN0000196964 4 7 8 2 4 7 PRKAG3 TRCN0000196966 17 181 0 100 331 506 ATM TRCN0000196967 4 108 233 512 668 1166 CAMK2D TRCN0000196969 0 0 0 1 1 0 RAF1 TRCN0000196970 0 85 32 32 68 171 CDC7 TRCN0000196975 3 184 81 156 61 310 PRKG2 TRCN0000196977 1 1 11 2 0 2 PKN3 TRCN0000196979 20 74 97 161 161 386 CSNK1G1 TRCN0000196981 1 15 0 0 0 0 RIOK1

170

TRCN0000196985 0 0 0 31 1 426 TSSK4 TRCN0000196986 160 393 77 198 67 323 CDK4 TRCN0000196988 1 50 57 0 7 0 CSNK1E TRCN0000196989 641 547 433 473 539 900 CAMK1 TRCN0000196991 0 205 84 65 25 19 MAP2K2 TRCN0000196992 167 0 0 17 46 22 CAMKK2 TRCN0000196993 29 75 113 191 405 340 UHMK1 TRCN0000196996 0 128 116 25 64 15 MAP2K4 TRCN0000197007 24 2 10 42 12 53 CDK11B TRCN0000197008 6 829 588 823 427 587 CSNK2A2 TRCN0000197010 0 0 0 0 0 0 PAK1 TRCN0000197012 0 0 0 0 0 0 EIF2AK2 TRCN0000197014 182 0 2 453 469 391 FLT3 TRCN0000197018 1 5 0 0 0 18 LMTK2 TRCN0000197019 0 0 0 0 0 0 CDK19 TRCN0000197020 726 710 971 359 1004 875 VRK3 TRCN0000197021 101 99 125 78 53 68 VRK3 TRCN0000197023 0 0 0 5 22 59 TRPM6 TRCN0000197031 199 0 88 175 226 168 TGFBR2 TRCN0000197033 185 109 192 70 146 263 MKNK1 TRCN0000197035 129 41 19 0 48 0 PRKCQ TRCN0000197036 0 21 16 15 64 98 MAP4K5 TRCN0000197037 64 168 208 217 481 1007 CSNK1G1 TRCN0000197038 2 22 4 0 1 23 MARK4 TRCN0000197039 39 324 83 31 333 255 TBCK TRCN0000197041 36 95 0 45 82 91 CDK4 TRCN0000197044 605 167 730 418 173 172 PRKG2 TRCN0000197045 0 6 12 45 27 49 TNNI3K TRCN0000197046 0 0 0 2 0 0 PRKAG3 TRCN0000197047 1 0 32 3 2 59 PXK TRCN0000197048 81 70 34 16 8 55 ADCK1 TRCN0000197050 1932 2758 2043 19 106 69 SGK494 TRCN0000197055 66 163 114 94 55 58 MAPK13 TRCN0000197056 0 13 0 0 0 5 TGFBR2 TRCN0000197057 363 523 611 841 643 1451 ACVR1B TRCN0000197058 105 62 16 0 27 0 LATS2 TRCN0000197061 46 399 442 110 156 408 ALPK2 TRCN0000197062 0 0 0 10 11 2 STRADA TRCN0000197064 67 224 307 107 159 231 GRK4 TRCN0000197065 144 335 225 413 329 180 IRAK2 TRCN0000197066 47 7 0 32 31 19 SRPK1

171

TRCN0000197067 197 46 123 33 92 194 WEE1 TRCN0000197070 308 5 323 329 443 529 EPHA7 TRCN0000197072 0 0 0 22 0 20 PAK6 TRCN0000197073 3 272 63 36 20 192 RIOK1 TRCN0000197074 69 81 0 2 157 35 ADCK5 TRCN0000197076 0 0 0 6 0 20 CSNK1G2 TRCN0000197077 0 0 0 0 0 0 MAP2K5 TRCN0000197078 1701 2538 2158 2489 4915 11552 MAP2K4 TRCN0000197079 2 1 19 19 139 150 MERTK TRCN0000197082 185 173 132 19 221 315 ADCK1 TRCN0000197083 48 189 239 73 172 258 PINK1 TRCN0000197089 237 538 103 348 1027 744 PDK2 TRCN0000197090 177 602 609 641 618 1476 TEC TRCN0000197091 1430 1150 503 649 597 2002 DYRK4 TRCN0000197094 1 121 287 169 86 402 PTK6 TRCN0000197098 0 0 0 0 0 0 CDK4 TRCN0000197102 0 0 0 0 0 20 TNK1 TRCN0000197104 337 476 377 34 122 29 ITK TRCN0000197105 57 70 50 10 11 3 PRKG2 TRCN0000197109 31 119 0 1 12 27 STK32B TRCN0000197110 0 0 0 15 15 0 NEK11 TRCN0000197111 0 2 8 83 147 174 TBCK TRCN0000197115 1473 3146 2447 363 528 563 RAF1 TRCN0000197117 0 0 39 15 0 95 MAP4K2 TRCN0000197118 4 1 1 0 0 0 MTOR TRCN0000197120 0 3 0 8 16 6 ADRBK2 TRCN0000197121 195 238 190 218 455 677 FER TRCN0000197122 1 0 5 99 315 15 MAP4K5 TRCN0000197125 182 99 25 0 0 0 CAMK1D TRCN0000197126 0 0 41 0 8 6 RET TRCN0000197127 381 104 359 1092 612 1513 BLK TRCN0000197131 1223 1430 1453 1402 2097 2100 EPHA2 TRCN0000197132 0 0 1 8 1 0 FGR TRCN0000197133 120 187 32 165 305 649 ADRBK1 TRCN0000197134 0 25 0 22 0 0 VRK1 TRCN0000197138 0 0 0 2 0 5 EPHA8 TRCN0000197139 2 0 6 30 15 12550 CAMKV TRCN0000197141 3 495 86 292 4 107 BMPR1B TRCN0000197142 0 120 20 82 57 56 BUB1B TRCN0000197146 21 1 23 56 84 132 PRKAG1 TRCN0000197147 435 179 702 389 231 318 PTK7

172

TRCN0000197148 171 336 242 65 100 711 MAPKAPK5 TRCN0000197149 0 0 0 1 47 0 RIOK3 TRCN0000197150 2 39 6 166 135 248 MTOR TRCN0000197151 0 17 0 0 25 0 PDK3 TRCN0000197152 222 120 146 354 115 489 PRKDC TRCN0000197154 452 583 1174 442 975 519 ADCK1 TRCN0000197155 43 122 61 530 246 744 CAMK1G TRCN0000197163 0 0 0 2 23 31 PHKA2 TRCN0000197164 1 42 18 21 18 33 BRDT TRCN0000197167 93 89 88 33 127 77 KDR TRCN0000197170 0 0 0 4 1 63 EIF2AK2 TRCN0000197173 0 0 2 0 1 53 RPS6KA3 TRCN0000197175 0 0 13 9 0 0 MAP3K6 TRCN0000197177 396 1121 1020 665 1178 1632 ADRBK2 TRCN0000197178 105 42 35 57 113 119 VRK2 TRCN0000197179 161 249 733 411 247 571 MAP4K5 TRCN0000197181 0 122 30 90 189 247 CSNK1A1L TRCN0000197182 0 53 28 29 46 104 NEK3 TRCN0000197183 105 173 83 6 48 224 TTBK2 TRCN0000197186 0 1 2 0 0 0 NEK3 TRCN0000197187 191 197 429 130 235 127 FGFR3 TRCN0000197188 0 89 95 16 79 97 PIM1 TRCN0000197189 5 253 199 112 144 59 TNK1 TRCN0000197190 1 0 76 16 154 399 STK19 TRCN0000197191 203 682 530 384 638 1003 ADRBK2 TRCN0000197192 62 227 277 122 116 196 WNK2 TRCN0000197195 0 3 19 216 114 450 PHKB TRCN0000197197 0 17 0 0 0 0 EIF2AK3 TRCN0000197200 0 6 8 11 25 14 PLK2 TRCN0000197202 695 1076 1293 71 48 230 DYRK1A TRCN0000197204 252 414 440 991 953 1922 MAP2K4 TRCN0000197205 33 37 52 49 0 7 CLK2 TRCN0000197206 0 49 192 0 0 53 PDK3 TRCN0000197207 0 0 0 2 0 0 NTRK2 TRCN0000197209 800 220 518 812 1660 3342 MAP4K5 TRCN0000197210 1618 1289 2081 213 271 345 TNNI3K TRCN0000197211 155 210 348 197 363 181 RIOK2 TRCN0000197212 200 248 368 576 568 1684 TRIB3 TRCN0000197215 0 0 0 57 1 1 CAMK2A TRCN0000197216 10 3 1 0 3 0 PRKCQ TRCN0000197217 0 0 30 41 56 11 ACVR1C

173

TRCN0000197218 294 719 400 575 604 1063 BMPR2 TRCN0000197219 0 0 0 0 22 158 MKNK1 TRCN0000197222 28 0 102 0 0 0 CDK16 TRCN0000197223 392 1456 836 757 1056 1219 MYLK3 TRCN0000197228 501 890 1018 620 1815 1164 CDK5R2 TRCN0000197229 5 28 37 11 31 23 PLK3 TRCN0000197230 635 756 324 530 1361 1413 JAK2 TRCN0000197233 3 31 31 64 43 28 STK38 TRCN0000197234 286 146 48 75 121 261 ADCK2 TRCN0000197236 0 0 0 0 22 28 CDK2 TRCN0000197237 1 265 1 98 214 209 MAP3K10 TRCN0000197238 0 0 0 0 10 0 PAK1 TRCN0000197239 0 198 135 3 127 153 PHKA1 TRCN0000197241 0 0 30 92 83 52 RPS6KB1 TRCN0000197242 79 43 60 127 28 80 SYK TRCN0000197243 0 0 0 0 0 9 FLT3 TRCN0000197244 0 0 0 57 0 0 MAP3K6 TRCN0000197245 2 193 0 148 54 0 MAP4K5 TRCN0000197246 349 589 407 248 349 251 MAP4K5 TRCN0000197250 0 0 0 98 0 0 RIOK2 TRCN0000197254 26 11 42 13 98 154 CDK16 TRCN0000197256 64 344 13 2219 284 1268 C9orf96 TRCN0000197257 88 0 0 19 0 1 SYK TRCN0000197261 44 0 0 0 1 32 MAP2K4 TRCN0000197262 609 1466 1256 755 10973 1396 MAP3K13 TRCN0000197263 97 293 1088 85 139 493 SIK3 TRCN0000197264 2 68 42 147 517 488 MAPK7 TRCN0000197265 132 293 312 534 152 318 AKT3 TRCN0000197266 0 0 0 0 0 16 BLK TRCN0000197268 227 64 27 179 1 146 MINK1 TRCN0000197269 0 2 51 38 56 55 PKDCC TRCN0000197273 47 299 426 141 96 171 DYRK3 TRCN0000197277 157 345 512 536 553 920 PDK2 TRCN0000197278 0 0 0 0 0 0 MKNK1 TRCN0000197282 1 6 10 8 6 12 CAMK1D TRCN0000197284 129 389 535 0 0 137 NUAK2 TRCN0000197285 221 177 33 91 165 229 MAPK1 TRCN0000197287 1 56 107 0 0 19 PDIK1L TRCN0000199009 259 277 224 173 191 386 CKS1B TRCN0000199011 0 16 4 5 22 10 PIM1 TRCN0000199013 4 2 3 1 8 0 MKNK1

174

TRCN0000199015 0 0 0 1 3 1 RPS6KA4 TRCN0000199016 97 132 80 61 126 154 CLK3 TRCN0000199017 0 0 0 2 19 3 ALK TRCN0000199018 0 2 134 101 469 459 CSK TRCN0000199019 48 117 61 189 180 2881 CDK5 TRCN0000199020 7 0 29 12 46 5 TNK2 TRCN0000199023 70 99 58 121 162 199 TTBK1 TRCN0000199027 0 212 1 1 69 88 CHEK1 TRCN0000199029 0 41 103 60 1 123 PIM1 TRCN0000199031 0 0 1 3 3 3 CSK TRCN0000199032 0 18 2 0 1 5 DMPK TRCN0000199033 5 236 115 37 122 113 GAK TRCN0000199034 157 1 56 107 18 71 PTK6 TRCN0000199036 49 19 50 84 137 59 BRD3 TRCN0000199037 15 8 27 2 4 9 MARK1 TRCN0000199039 29 57 27 9 47 56 SCYL1 TRCN0000199043 83 43 231 93 184 435 MAP2K2 TRCN0000199044 1 2 4 5 2 1 TSSK6 TRCN0000199045 228 210 139 109 173 156 BRSK1 TRCN0000199046 0 0 5 21 68 42 MYLK TRCN0000199047 22 14 14 6 19 18 GRK7 TRCN0000199048 904 624 1340 1273 1451 2055 CKS1B TRCN0000199049 0 0 0 0 0 0 PHKA1 TRCN0000199050 0 0 5 73 124 199 PRKCZ TRCN0000199051 0 0 0 12 58 80 PRKY TRCN0000199052 6 8 6 6 7 10 RPS6KA1 TRCN0000199054 1 0 28 9 3 15 MAP4K2 TRCN0000199055 0 3 30 11 10 0 MAP3K6 TRCN0000199061 0 0 3 2 0 0 FES TRCN0000199066 156 112 86 98 57 97 HIPK3 TRCN0000199069 0 2 0 0 0 2 STK32B TRCN0000199072 0 0 0 0 0 0 PSKH2 TRCN0000199074 1 0 0 0 37 0 MGC42105 TRCN0000199078 0 0 0 0 0 0 RPS6KA4 TRCN0000199079 0 0 0 3 0 0 EPHB2 TRCN0000199080 114 358 205 27 140 36 HIPK3 TRCN0000199084 13 1 1 5 6 20 PASK TRCN0000199087 0 1 1 9 1 3 NEK7 TRCN0000199090 61 0 22 24 0 161 CAMKK2 TRCN0000199091 0 0 0 0 0 0 ADCK5 TRCN0000199094 0 19 0 8 0 5 GRK6

175

TRCN0000199096 241 279 224 390 314 960 PRKACG TRCN0000199097 489 647 357 170 320 721 PRKAR1B TRCN0000199098 69 162 321 207 372 493 PRKAR1B TRCN0000199100 59 86 90 243 136 280 EGFR TRCN0000199101 0 0 0 0 0 0 BCKDK TRCN0000199102 0 0 0 0 0 0 MAP3K4 TRCN0000199104 2 195 31 69 1 160 CDK20 TRCN0000199108 1 315 0 54 0 39 MAP3K10 TRCN0000199109 0 0 33 0 0 0 CDC42BPB TRCN0000199114 185 153 32 161 61 52 CDK6 TRCN0000199115 0 3 2 2 2 6 ADRBK1 TRCN0000199116 4 0 3 311 655 475 ARAF TRCN0000199119 1 4 7 12 20 36 CALM3 TRCN0000199121 108 101 448 172 255 174 OBSCN TRCN0000199123 0 6 0 6 24 20 PKDCC TRCN0000199124 1 38 37 64 38 140 STK32A TRCN0000199128 84 58 55 49 17 40 CDK3 TRCN0000199130 345 151 114 111 154 276 SGK1 TRCN0000199131 186 463 279 322 718 892 TNK2 TRCN0000199132 60 16 53 100 123 163 RPS6KL1 TRCN0000199134 320 308 168 405 551 1015 MAPK15 TRCN0000199135 0 37 0 79 17 53 MAPK15 TRCN0000199136 0 9 0 16 15 0 KSR2 TRCN0000199138 45 107 60 91 169 230 ACVRL1 TRCN0000199142 78 78 20 87 12 71 CDC42BPB TRCN0000199146 3 159 80 53 63 166 SRPK3 TRCN0000199147 10 6 2 4 23 2 MELK TRCN0000199148 0 0 1 66 11 104 TRIB3 TRCN0000199153 72 79 56 101 251 259 MAST4 TRCN0000199157 321 0 36 104 111 17 IRAK3 TRCN0000199158 2 0 1 7 0 0 MARK4 TRCN0000199159 0 0 0 69 60 141 MAPK15 TRCN0000199160 1 60 14 49 56 82 CAMKK1 TRCN0000199164 6 12 2 7 9 20 EPHB6 TRCN0000199165 68 117 63 139 62 71 GSK3A TRCN0000199168 2 0 0 5 4 7 SRMS TRCN0000199170 0 46 0 21 23 9 CSNK2B TRCN0000199172 18 46 120 27 135 124 EIF2AK2 TRCN0000199173 2 0 0 0 0 0 ULK1 TRCN0000199174 0 1 50 27 0 0 EGFR TRCN0000199176 0 1 0 1 2 4 SCYL1

176

TRCN0000199181 5 46 4 48 99 95 PTK7 TRCN0000199184 1 139 83 68 107 32 NEK7 TRCN0000199186 0 35 0 100 237 105 SRC TRCN0000199187 1 211 86 46 29 30 CDK9 TRCN0000199188 75 2 78 90 93 115 DYRK1A TRCN0000199189 0 0 0 3 0 7 CLK2 TRCN0000199190 48 38 118 0 1 42 PKMYT1 TRCN0000199193 6 5 0 2 1 3 PINK1 TRCN0000199194 177 27 2 62 17 49 PSKH2 TRCN0000199195 0 29 11 72 136 107 STK11 TRCN0000199199 53 150 109 49 39 106 EPHA2 TRCN0000199200 0 1 0 17 14 18 BCKDK TRCN0000199201 1 32 93 74 0 70 SCYL3 TRCN0000199230 1 5 3 2 3 0 PRKCG TRCN0000199231 0 37 20 0 57 12 MAPK13 TRCN0000199232 0 0 0 0 1 0 CDK10 TRCN0000199234 303 316 200 215 1378 1158 TESK2 TRCN0000199237 0 0 0 0 0 0 MKNK2 TRCN0000199239 1219 1408 1230 86 70 69 GSK3A TRCN0000199242 22 53 43 48 63 94 STK11 TRCN0000199244 0 0 0 31 0 3 ARAF TRCN0000199245 1 0 71 100 222 408 FES TRCN0000199246 0 0 0 0 0 34 MST1R TRCN0000199247 0 0 0 0 0 0 EPHB6 TRCN0000199250 173 28 61 16 25 31 WNK2 TRCN0000199251 90 383 264 313 283 565 IRAK3 TRCN0000199253 213 0 34 113 1 187 PASK TRCN0000199255 0 0 1 57 273 2 PINK1 TRCN0000199256 0 0 0 2 0 7 ADCK2 TRCN0000199258 0 99 101 32 91 33 JAK3 TRCN0000199259 415 1023 1235 276 537 949 DYRK1A TRCN0000199263 0 0 0 5 0 4 MAPK4 TRCN0000199288 0 0 0 0 0 0 AURKA TRCN0000199289 101 83 0 23 34 49 CDK10 TRCN0000199290 68 32 10 34 57 47 PLK1 TRCN0000199291 2 1 4 13 3 4 PKN3 TRCN0000199292 18 0 0 4 0 0 INSRR TRCN0000199294 163 805 1022 483 571 722 SCYL3 TRCN0000199295 1 92 162 92 341 990 SRMS TRCN0000199296 45 340 437 490 1301 1387 CAMKK1 TRCN0000199297 0 0 0 0 19 5 CDK20

177

TRCN0000199298 6 8 6 3 1 0 CSNK1G2 TRCN0000199305 3 1 5 8 6 13 MAP4K2 TRCN0000199308 0 0 0 13 39 1 FGFR1 TRCN0000199312 1 39 12 16 76 2 NEK8 TRCN0000199313 106 124 22 269 330 574 SRC TRCN0000199314 0 0 0 9 0 0 CDK9 TRCN0000199315 0 0 0 4 8 14 LIMK1 TRCN0000199316 14 63 11 48 37 61 STK19 TRCN0000199322 351 801 649 219 642 783 PHKA1 TRCN0000199323 0 0 0 0 0 0 MTOR TRCN0000199324 17 45 27 10 20 14 RPS6KL1 TRCN0000199327 6 170 132 193 395 330 MET TRCN0000199331 166 52 201 134 169 388 PRKY TRCN0000199332 0 0 0 0 0 0 VRK1 TRCN0000199333 139 985 630 11 214 357 MKNK1 TRCN0000199334 0 22 103 132 228 234 PTK2B TRCN0000199337 0 0 0 0 5 1 TESK2 TRCN0000199338 3 336 54 0 0 14 PKN3 TRCN0000199340 0 1 41 20 20 83 STK32C TRCN0000199342 327 1088 1625 506 1426 2103 TSSK4 TRCN0000199345 1 93 40 0 18 23 IRAK2 TRCN0000199346 0 1 115 0 0 1 PHKA1 TRCN0000199347 0 0 38 40 6 138 MAPK11 TRCN0000199349 146 591 774 712 874 1422 DMPK TRCN0000199350 407 132 67 624 653 987 FGR TRCN0000199351 70 221 108 92 84 147 TNIK TRCN0000199355 648 2396 826 639 884 413 TP53RK TRCN0000199357 7 0 3 0 0 4 C9orf96 TRCN0000199362 2 102 112 64 82 264 BMX TRCN0000199364 3 2 0 191 356 379 ERBB3 TRCN0000199366 0 0 0 4 1 3 GRK1 TRCN0000199367 43 0 16 0 0 5 STK24 TRCN0000199368 69 13 73 62 67 179 TNK1 TRCN0000199371 82 51 19 182 130 111 INSRR TRCN0000199373 0 104 125 42 0 0 MAST1 TRCN0000199378 121 24 127 84 55 31 TSSK6 TRCN0000199379 146 54 0 125 314 150 GRK7 TRCN0000199380 0 0 0 0 0 14 STK32C TRCN0000199383 0 1 0 147 242 364 RPS6KA1 TRCN0000199387 0 3 2 0 0 0 EGFR TRCN0000199388 90 262 222 53 74 85 BCKDK

178

TRCN0000199389 0 0 26 26 11 0 BCKDK TRCN0000199390 2 22 17 69 129 42 TSSK2 TRCN0000199393 3 0 0 2 10 3 CKS2 TRCN0000199394 92 81 204 97 183 177 PAK1 TRCN0000199395 1 0 0 0 0 0 PAK2 TRCN0000199396 444 142 102 328 485 215 PDGFRB TRCN0000199397 0 10 0 1 0 0 CDK5 TRCN0000199398 1 5 2 7 4 8 VRK2 TRCN0000199400 20 19 15 8 7 33 PRKAG3 TRCN0000199402 9 114 5424 7 15 5 TSSK6 TRCN0000199403 0 0 36 60 0 0 ALPK2 TRCN0000199404 0 0 0 0 0 0 SIK1 TRCN0000199408 0 0 0 0 2 0 ADRBK1 TRCN0000199410 31 13 19 18 44 57 CDK18 TRCN0000199411 142 0 27 170 229 83 PRKAR1A TRCN0000199412 1 168 53 28 42 30 CDC42BPB TRCN0000199414 1 0 0 119 0 130 MAP2K2 TRCN0000199415 0 0 0 0 10 0 BRSK1 TRCN0000199417 2 1 54 193 263 192 MGC42105 TRCN0000199420 0 0 5 3 2 7 FLT4 TRCN0000199422 932 763 784 873 868 1327 PRKCG TRCN0000199423 5 27 6 10 39 17 GRK1 TRCN0000199424 1 0 1 6 9 4 DMPK TRCN0000199425 5 206 467 83 62 29 GSK3A TRCN0000199426 0 3 2 4 5 4 TSSK6 TRCN0000199427 2 0 1 0 4 5 BRD4 TRCN0000199430 0 0 0 0 0 0 MAP2K5 TRCN0000199433 8 0 13 45 46 32 TTBK1 TRCN0000199434 0 0 0 2 0 0 MAPK1 TRCN0000199437 0 0 3 0 0 0 MAPK4 TRCN0000199438 1376 1323 1183 671 1106 1704 MAPK13 TRCN0000199439 0 4 74 17 140 259 RPS6KA1 TRCN0000199443 0 0 1 0 0 0 SCYL3 TRCN0000199446 0 55 2 0 0 4 PINK1 TRCN0000199450 26 10 42 3 14 9 CSNK2B TRCN0000199453 22 88 15 65 66 29 MAPKAPK3 TRCN0000199455 227 0 126 115 102 44 BRD3 TRCN0000199456 0 0 0 0 0 0 PKN3 TRCN0000199459 525 1159 952 874 1173 2142 BRD4 TRCN0000199460 0 3 0 0 0 0 TSSK4 TRCN0000199464 90 33 117 59 83 161 DYRK1A

179

TRCN0000199465 0 0 0 0 0 0 ARAF TRCN0000199466 1 4 3 3 5 3 CSNK1E TRCN0000199467 0 2 0 0 23 0 MST1R TRCN0000199469 0 0 0 25 2 0 PRKCZ TRCN0000199471 0 9 2 6 6 14 PLK1 TRCN0000199475 21 6 9 3 5 9 FGFR1 TRCN0000199481 0 0 3 7 0 5 BMPR1B TRCN0000199483 0 0 0 0 10 0 PRKAR1A TRCN0000199484 30 24 67 13 1 26 CAMK1 TRCN0000199485 0 0 15 16 29 51 RPS6KA4 TRCN0000199486 23 31 12 58 15 71 TAF1 TRCN0000199490 13 2 7 24 11 17 STK19 TRCN0000199497 613 637 730 105 120 220 LIMK1 TRCN0000199500 0 4 0 3 3 1 CSK TRCN0000199502 21 3 24 15 22 62 SGK1 TRCN0000199503 83 11 0 29 13 63 TESK2 TRCN0000199504 0 20 29 26 21 5 MYLK TRCN0000199506 31 77 63 139 190 209 MAST4 TRCN0000199511 0 0 0 0 2 1 MST1R TRCN0000199512 77 37 90 22 96 87 PHKA1 TRCN0000199513 84 12 40 31 29 44 RPS6KB2 TRCN0000199516 3 1 3 1 3 6 SGK2 TRCN0000199518 0 0 0 9 8 13 PRKY TRCN0000199519 937 1409 1081 544 439 745 GRK1 TRCN0000199520 70 0 26 20 11 186 CDK5R2 TRCN0000199522 0 0 30 72 167 83 PRKX TRCN0000199526 0 0 0 7 0 4 ADCK5 TRCN0000199527 0 6 0 7 16 28 MYLK3 TRCN0000199528 0 19 1 3 0 0 ACVRL1 TRCN0000199529 0 0 0 0 0 0 ACVR2B TRCN0000199531 0 63 1 12 15 5 PAK3 TRCN0000199532 23 11 29 58 0 109 EGFR TRCN0000199533 0 12 15 11 16 13 TYRO3 TRCN0000199537 518 258 264 564 914 1082 INSRR TRCN0000199538 135 161 188 232 269 509 MAST1 TRCN0000199542 1 0 0 12 88 39 FLT1 TRCN0000199544 0 0 11 0 0 3 PRKCG TRCN0000199546 517 5 1015 348 704 509 CDK5R2 TRCN0000199547 0 112 77 179 90 203 PRKX TRCN0000199548 125 45 112 79 469 261 ABL2 TRCN0000199551 0 0 8 0 0 3 PRKCD

180

TRCN0000199552 15 7 42 5 16 24 SRPK3 TRCN0000199554 117 190 40 13 11 17 MINK1 TRCN0000199555 7 131 29 47 353 351 VRK3 TRCN0000199556 0 81 0 0 0 0 SCYL3 TRCN0000199559 31 31 34 21 98 56 TSSK6 TRCN0000199562 505 1749 473 357 291 1490 CAMK2A TRCN0000199563 1 0 15 39 92 52 CDK3 TRCN0000199565 0 7 0 0 0 0 PTK7 TRCN0000199566 0 0 0 4 5 23 SYK TRCN0000199569 23 16 34 39 68 100 MOS TRCN0000199570 113 90 146 101 74 293 LATS2 TRCN0000199572 0 33 18 2 16 22 PKDCC TRCN0000199575 23 49 21 36 23 33 MAPK11 TRCN0000199576 0 0 0 12 0 34 MAPK13 TRCN0000199577 0 0 8 7 4 8 CDK10 TRCN0000199578 0 0 0 0 0 0 PKMYT1 TRCN0000199579 108 1 44 115 258 235 EPHB6 TRCN0000199581 9 4 0 5 0 0 ILK TRCN0000199582 0 0 0 0 0 0 FGR TRCN0000199584 335 306 180 281 616 474 CDC42BPB TRCN0000199585 1 1 2 5 4 13 SRPK3 TRCN0000199586 0 1 6 9 22 32 MAST1 TRCN0000199588 3 0 1 1 4 6 SIK1 TRCN0000199591 2 148 92 166 96 382 CKS2 TRCN0000199592 0 0 1 0 0 0 CDK18 TRCN0000199593 0 1 1 0 2 0 PDK2 TRCN0000199596 1 0 0 12 72 121 PRKX TRCN0000199597 1 22 3 4 3 11 RAGE TRCN0000199599 234 151 188 37 133 214 GRK7 TRCN0000199600 1 150 32 120 118 39 MGC42105 TRCN0000199601 0 31 36 2 20 59 CAMKK1 TRCN0000199602 114 12 5 4 1 13 ADCK5 TRCN0000199609 12 28 87 67 3385 106 PRKACG TRCN0000199610 152 267 162 109 263 257 MAP2K5 TRCN0000199613 102 156 84 68 172 119 IRAK3 TRCN0000199614 56 43 55 4 8 19 MKNK2 TRCN0000199618 0 9 218 2 40 64 STK32A TRCN0000199619 2 17 17 16 7 37 KSR2 TRCN0000199622 0 7 6 0 18 0 INSR TRCN0000199623 36 51 21 19 46 93 SBK1 TRCN0000199624 344 389 823 971 1033 1395 CDK3

181

TRCN0000199625 51 29 2 35 161 273 FLT1 TRCN0000199628 82 125 72 49 11 68 PAK3 TRCN0000199629 4 387 323 198 198 162 ALK TRCN0000199630 11 3 6 4 0 5 TAOK2 TRCN0000199631 3 1 0 1 1 1 PLK1 TRCN0000199635 2 8 59 19 17 1 SRMS TRCN0000199636 13 16 9 17 84 31 CAMKK1 TRCN0000199637 0 0 24 0 1 19 SIK1 TRCN0000199639 0 0 0 0 0 0 PLK1 TRCN0000199640 10 18 15 18 12 20 CDC42BPB TRCN0000199641 512 924 788 576 1049 1804 MAPK7 TRCN0000199642 1 1 2 0 0 0 GRK7 TRCN0000199649 109 182 89 261 305 693 SBK1 TRCN0000199650 97 121 47 36 65 47 ACVR2B TRCN0000199652 0 0 1 0 0 1 CDK5 TRCN0000199653 66 79 65 101 105 114 FGR TRCN0000199654 0 3 0 2 0 2 PRKCQ TRCN0000199656 119 328 428 785 503 520 INSRR TRCN0000199659 0 0 1 13 14 19 BMPR1B TRCN0000199663 35 1 47 60 38 110 CDC42BPB TRCN0000199667 19 27 49 67 79 100 IRAK2 TRCN0000199668 57 118 133 12 4 43 CSNK1E TRCN0000199669 857 577 1079 767 722 1072 FLT4 TRCN0000199671 14 0 11 0 0 8 MAPK11 TRCN0000199673 8 5 12 2 5 1 EPHB2 TRCN0000199676 32 30 26 39 0 57 MAST4 TRCN0000199678 50 40 17 30 17 46 PHKG2 TRCN0000199679 114 103 96 82 51 285 PRKCZ TRCN0000199682 33 11 24 24 36 17 TRPM6 TRCN0000199684 0 0 0 0 0 1 TRIB3 TRCN0000199687 0 0 0 1 0 0 MAPK15 TRCN0000199688 1 43 0 84 0 61 CDK15 TRCN0000199689 57 156 17 126 187 251 SIK1 TRCN0000199691 71 33 29 54 20 52 LIMK1 TRCN0000199694 30 89 69 93 55 121 MAPK11 TRCN0000199697 200 467 320 145 284 255 SGK1 TRCN0000199698 1 0 0 6 0 53 ADCK2 TRCN0000199699 0 0 0 20 68 0 PDIK1L TRCN0000199702 11 212 339 390 224 463 SBK1 TRCN0000199705 0 0 0 0 0 0 RPS6KB2 TRCN0000199707 0 0 0 0 0 0 SRPK3

182

TRCN0000199708 0 0 0 3 15 29 MKNK2 TRCN0000199710 18 39 9 54 37 5 CSNK1A1 TRCN0000199711 35 46 55 32 80 169 CDK18 TRCN0000199712 258 162 411 360 376 569 PIM1 TRCN0000199713 695 408 685 683 1078 1597 LATS1 TRCN0000199714 0 0 0 0 0 37 MAP4K1 TRCN0000199716 1 8 31 26 8 7 PASK TRCN0000199722 189 225 389 70 68 83 MYLK3 TRCN0000199726 53 16 27 2 6 13 CDK3 TRCN0000199727 0 0 2 0 2 0 GRK6 TRCN0000199729 0 1 0 0 0 5 CDK5R2 TRCN0000199730 0 0 3 10 1 12 TNK1 TRCN0000199731 0 0 0 3 0 7 BCR TRCN0000199734 12 13 9 4 10 7 WNK2 TRCN0000199736 113 118 72 29 103 208 MGC42105 TRCN0000199737 161 117 320 626 851 657 SIK1 TRCN0000199740 20 11 9 26 49 73 MAPK11 TRCN0000199741 0 0 1 0 2 0 RIPK1 TRCN0000199743 82 142 149 22 45 23 TNIK TRCN0000199744 2 6 4 6 0 0 RPS6KA2 TRCN0000199747 0 0 0 1 0 1 CDK15 TRCN0000199748 52 71 16 89 37 198 STK32C TRCN0000199750 0 1 0 1 3 2 SBK1 TRCN0000199751 0 0 1 4 0 2 LIMK1 TRCN0000199752 33 34 86 261 226 417 MAPK13 TRCN0000199753 14 19 22 44 14 27 AURKC TRCN0000199754 83 200 254 223 399 343 PKMYT1 TRCN0000199756 4 0 0 0 0 0 MAPKAPK3 TRCN0000199757 126 0 0 0 0 0 ABL2 TRCN0000199758 0 1 8 3 0 9 MAP4K1 TRCN0000199759 215 158 123 74 170 230 MAP4K1 TRCN0000199760 0 0 0 0 0 0 MAST1 TRCN0000199762 0 0 0 1 0 1 SRMS TRCN0000199764 26 7 0 1 7 16 JAK3 TRCN0000199765 1 7 5 3 1 1 CSNK1G2 TRCN0000199766 465 672 595 469 782 805 CSNK1A1 TRCN0000199769 13 0 11 4 11 5 RPS6KA1 TRCN0000199770 0 5 15 16 24 25 RPS6KA4 TRCN0000199771 2 12 10 3 6 13 PTK2B TRCN0000199772 232 232 151 167 361 493 MOS TRCN0000199774 17 8 9 6 9 8 STK38

183

TRCN0000199775 1 0 0 0 1 0 CDK20 TRCN0000199777 6 0 12 16 35 81 ZAP70 TRCN0000199778 2 2 94 535 533 493 ZAP70 TRCN0000199780 0 0 0 0 2 0 CDK9 TRCN0000199781 6 48 14 7 22 49 BLK TRCN0000199782 35 113 103 70 105 107 PRKACG TRCN0000199784 84 167 450 230 245 735 MOS TRCN0000199785 114 446 267 140 107 159 HIPK3 TRCN0000199787 0 12 21 13 46 33 GSG2 TRCN0000199788 78 19 19 64 23 60 HIPK1 TRCN0000199789 99 0 10 31 11 106 CAMKK1 TRCN0000199790 0 0 18 1 16 8 ANKK1 TRCN0000199791 8 8 9 14 7 19 MYLK3 TRCN0000199795 0 13 20 13 0 2 ZAP70 TRCN0000199796 0 0 0 0 0 40 CHEK1 TRCN0000199797 0 0 0 0 0 0 ADRBK1 TRCN0000199800 0 52 30 0 82 35 MAP2K5 TRCN0000199801 0 5 2 2 0 0 ULK1 TRCN0000199803 10 0 27 15 12 67 PRKX TRCN0000199806 0 0 10 5 0 0 TNIK TRCN0000199810 141 264 46 208 344 466 OBSCN TRCN0000199812 0 0 0 2 2 1 NEK8 TRCN0000199813 313 137 128 145 88 359 ACVR2B TRCN0000199817 1 3 1 0 2 3 MAPK4 TRCN0000199818 2 0 3 0 5 6 PRKY TRCN0000199819 31 10 8 6 8 37 EPHB2 TRCN0000199822 6 59 18 29 13 21 BRD3 TRCN0000199826 2 6 10 11 10 16 CSNK1G2 TRCN0000199828 0 140 0 1 66 104 PRKY TRCN0000199829 0 4 11 6 0 0 SRPK1 TRCN0000199830 157 500 193 102 57 209 MAPKAPK3 TRCN0000199832 0 53 8 37 131 171 GSK3A TRCN0000199834 8 4 7 4 10 23 ANKK1 TRCN0000199836 2 0 5 5 1 3 ACVRL1 TRCN0000199837 80 0 33 53 20 58 FGFR3 TRCN0000199839 5 86 96 23 2 143 ZAP70 TRCN0000199840 0 1 45 6 0 4 PHKA1 TRCN0000199841 0 4 3 12 18 7 VRK1 TRCN0000199842 0 0 0 20 1 30 CSK TRCN0000199844 0 0 24 0 0 0 TRIB3 TRCN0000199845 2 654 463 301 163 535 RPS6KL1

184

TRCN0000199846 0 0 0 13 3 16 RPS6KL1 TRCN0000199849 121 587 137 239 132 288 SGK2 TRCN0000199853 0 0 0 0 0 0 PTK6 TRCN0000199854 0 0 0 2 4 4 VRK3 TRCN0000199855 1 0 0 5 11 3 MKNK2 TRCN0000199859 0 0 0 24 18 0 PDGFRB TRCN0000199861 0 150 88 10 0 110 RIOK3 TRCN0000199862 13 10 9 4 10 26 PLK3 TRCN0000199863 78 2 165 327 371 571 ILK TRCN0000199867 0 14 1 0 3 0 SGK3 TRCN0000199872 1 35 23 19 48 46 ACVR1 TRCN0000199873 0 0 30 0 0 98 CSNK2B TRCN0000199876 0 0 0 5 0 0 LIMK1 TRCN0000199878 33 29 20 0 7 17 RPS6KB2 TRCN0000199879 27 9 16 0 7 4 ALK TRCN0000199883 0 8 5 9 8 14 PAK6 TRCN0000199884 1 1 0 1 1 1 SCYL1 TRCN0000199886 32 463 253 546 838 776 MST1R TRCN0000199888 0 0 11 11 9 33 ROR2 TRCN0000199890 0 117 43 0 0 1 TYRO3 TRCN0000199891 0 8 120 7 41 118 PHKG2 TRCN0000199892 58 80 50 77 86 107 CDK9 TRCN0000199893 0 39 50 5 18 24 CSNK2B TRCN0000199897 2 67 262 103 121 224 MOS TRCN0000199899 0 26 147 20 17 105 MAP4K1 TRCN0000199900 0 0 0 4 0 4 NUAK2 TRCN0000199902 0 0 0 8 19 75 MYLK3 TRCN0000199905 1 199 65 226 351 468 FLT4 TRCN0000199908 0 0 0 0 0 0 CDK10 TRCN0000199911 21 28 1 42 0 24 CALM3 TRCN0000199913 162 45 90 73 128 177 STK11 TRCN0000199914 0 0 0 25 0 25 CKS2 TRCN0000199917 0 13 0 0 28 0 PRKCG TRCN0000199920 0 13 0 0 0 0 ABL2 TRCN0000199923 5 3 1 0 1 5 SRPK3 TRCN0000199924 0 0 0 0 0 0 FGFR1 TRCN0000199926 27 1 21 37 86 129 MARK4 TRCN0000199927 18 62 96 87 49 244 BRSK1 TRCN0000199928 172 234 210 150 156 271 SRMS TRCN0000199929 36 151 120 102 36 203 CDK15 TRCN0000199934 4 392 123 160 234 525 TEC

185

TRCN0000199935 3 6 6 22 24 24 CDC42BPA TRCN0000199939 0 0 0 0 0 0 AAK1 TRCN0000199940 222 245 120 178 410 368 TNIK TRCN0000199941 43 12 17 2 0 13 STK40 TRCN0000199947 16 59 66 27 28 38 DYRK3 TRCN0000199950 0 0 0 18 0 27 CDK18 TRCN0000199951 0 0 0 0 2 3 TAOK2 TRCN0000199953 0 0 0 0 1 0 TRPM6 TRCN0000199956 87 101 41 110 244 291 SCYL1 TRCN0000199957 64 207 57 71 56 21 MAPK15 TRCN0000199959 1 0 3 6 5 1 ZAP70 TRCN0000199960 740 583 475 913 806 1147 CSNK2B TRCN0000199962 39 106 109 58 89 64 CAMK1 TRCN0000199963 0 0 24 39 81 33 CDK10 TRCN0000199966 0 1 51 56 2454 1025 FGR TRCN0000199968 34 337 940 109 135 378 DAPK2 TRCN0000199969 495 1285 1028 542 1152 1569 TRPM6 TRCN0000199970 5 9 22 4916 172 7169 TTBK1 TRCN0000199972 556 277 965 1578 1413 3714 BRD4 TRCN0000199975 2 0 0 0 1 4 HIPK1 TRCN0000199976 122 324 171 2 17 14 STK32C TRCN0000199977 2 24 10 51 21 52 CDK20 TRCN0000199980 254 499 5111 252 372 494 CDK8 TRCN0000199981 41 288 166 78 194 336 ARAF TRCN0000199983 1 99 68 77 2 74 ILK TRCN0000199986 31 0 6 58 15 95 PLK2 TRCN0000199990 0 2 2 4 6 3 SGK2 TRCN0000199991 2 160 58 28 115 61 STK32C TRCN0000199992 0 0 0 0 0 39 ARAF TRCN0000199993 76 513 411 384 113 734 ERBB3 TRCN0000199994 16 22 29 17 6 8 GRK6 TRCN0000199997 0 1 59 378 177 252 AURKC TRCN0000199998 172 149 81 59 0 69 DMPK TRCN0000200004 0 75 178 10 91 183 CDK3 TRCN0000200005 0 1 83 21 0 141 MAPK4 TRCN0000200006 1 1 0 219 118 231 RIPK1 TRCN0000200010 279 35 199 123 48 170 TTBK1 TRCN0000200011 0 4 4 20 0 50 OBSCN TRCN0000200012 1 344 343 169 449 432 TSSK2 TRCN0000200013 1 46 0 34 72 232 STRADA TRCN0000204889 0 28 0 29 0 0 PDGFRB

186

TRCN0000204891 0 0 0 0 0 0 ACVRL1 TRCN0000204899 5 12 19 2 15 19 PDPK1 TRCN0000204901 0 0 0 0 0 0 MAP3K10 TRCN0000204909 169 24 12 0 1 245 MAP3K6 TRCN0000204910 78 155 354 220 374 449 SIK2 TRCN0000204914 903 1471 994 436 597 974 EPHB6 TRCN0000204915 958 1142 1217 2362 5809 2841 ERBB3 TRCN0000204918 0 0 0 9 0 6 ADRBK1 TRCN0000217949 100 239 92 222 641 563 CAMK2G TRCN0000217973 89 544 21 108 228 564 CAMK2G TRCN0000218028 0 0 0 43 0 57 TEX14 TRCN0000218029 158 0 0 59 0 62 NEK9 TRCN0000218040 1615 591 811 1892 2811 3631 KALRN TRCN0000218042 0 0 0 0 0 0 CDK7 TRCN0000218047 0 1 0 31 0 0 ACVR1B TRCN0000218057 1 19 0 79 385 265 EPHA8 TRCN0000218088 81 147 29 0 22 42 BRSK1 TRCN0000218097 0 0 25 0 0 139 RIPK2 TRCN0000218128 70 2303 3615 554 1214 1210 TBCK TRCN0000218136 1 287 0 45 100 305 CAMK2G TRCN0000218146 0 0 0 0 1 0 CLK2 TRCN0000218172 175 329 220 0 0 93 EPHA5 TRCN0000218195 3 6 0 1 7 0 RIPK2 TRCN0000218202 0 0 0 12 6 10 BMP2K TRCN0000218210 1 14 162 43 116 181 LYN TRCN0000218291 0 0 0 0 0 0 LIMK2 TRCN0000218303 1 132 213 86 30 129 CDK3 TRCN0000218315 0 33 67 11 21 33 GSG2 TRCN0000218323 6 0 62 31 0 278 WEE1 TRCN0000218326 0 0 0 3 4 0 RIPK2 TRCN0000218328 1 1 0 41 102 0 ABL2 TRCN0000218353 0 19 0 8 0 0 WNK3 TRCN0000218391 0 0 2 41 0 0 CDK7 TRCN0000218392 82 249 68 0 0 0 ERBB3 TRCN0000218404 0 0 0 0 0 0 MAP3K14 TRCN0000218411 0 0 27 10 3 1 RPS6KA2 TRCN0000218425 1 8 557 93 17 196 STK19 TRCN0000218428 0 0 71 78 47 23 STK10 TRCN0000218445 0 0 0 0 0 0 ERBB3 TRCN0000218466 5 0 0 11 1 50 STK33 TRCN0000218467 1 2 104 44 2 735 TEX14

187

TRCN0000218557 4 128 188 100 64 81 FLT1 TRCN0000218636 1 134 101 62 101 26 BRAF TRCN0000218685 0 27 25 72 163 342 LYN TRCN0000218695 0 86 101 45 128 97 SRPK3 TRCN0000218815 0 0 0 0 0 0 ABL2 TRCN0000218831 220 78 67 87 339 0 TEX14 TRCN0000218967 138 1 33 5 13 22 ALPK2 TRCN0000218998 59 2 112 0 0 52 OXSR1 TRCN0000219020 1 0 0 0 0 16 ERBB3 TRCN0000219074 5 25 175 335 252 314 WEE1 TRCN0000222765 201 27 83 254 128 632 EIF2AK4 TRCN0000226387 1 32 0 28 6 13 CAMK2G TRCN0000226388 142 345 330 30 76 44 CAMK2G TRCN0000226391 0 28 1 42 32 157 STK19 TRCN0000226392 0 22 94 0 38 0 STK19 TRCN0000226393 0 118 0 0 0 0 STK19 TRCN0000226394 0 50 639 469 233 661 STK19 TRCN0000226395 259 743 876 299 2 561 ACVR1B TRCN0000226396 202 265 380 197 486 764 ACVR1B TRCN0000226397 0 17 68 0 0 26 ACVR1B TRCN0000226398 0 0 356 0 1 197 ACVR1B TRCN0000226424 87 88 659 377 742 1104 WEE1 TRCN0000226425 1 5 0 5 1 31 WEE1 TRCN0000226426 6 854 219 47 293 299 WEE1 TRCN0000226431 0 0 0 0 0 0 NEK9 TRCN0000226432 0 0 0 0 0 0 NEK9 TRCN0000226433 0 0 0 10 0 0 NEK9 TRCN0000226434 0 0 0 0 0 0 NEK9 TRCN0000226438 1 169 0 0 23 0 BMP2K TRCN0000226439 494 1331 204 2440 1988 3942 BMP2K TRCN0000226440 0 0 0 96 1 0 BMP2K TRCN0000226444 2 140 0 0 0 289 TBCK TRCN0000226445 3 488 1008 157 64 944 TBCK TRCN0000226446 89 31 48 555 466 682 TBCK TRCN0000226447 0 0 0 18 0 94 TBCK TRCN0000226448 35 38 80 39 155 107 BRSK1 TRCN0000226449 1 16 16 15 29 24 BRSK1 TRCN0000226450 496 1535 959 647 994 922 BRSK1 TRCN0000226451 37 0 64 0 76 81 BRSK1 TRCN0000229970 0 0 0 245 0 23 CLK2 TRCN0000229971 0 10 21 11 0 5 CLK2

188

TRCN0000229972 0 0 8 5 0 16 CLK2 TRCN0000229973 0 41 2 45 92 55 CLK2 TRCN0000229974 0 69 0 0 0 0 STK33 TRCN0000229975 0 32 355 1 1 174 STK33 TRCN0000229976 0 0 0 13 0 163 STK33 TRCN0000229977 633 485 371 382 488 2469 STK33 TRCN0000229999 0 0 0 0 0 0 WNK3 TRCN0000230000 29 47 16 6 8 28 WNK3 TRCN0000230001 0 0 0 9 26 121 WNK3 TRCN0000230002 0 226 169 2 29 0 WNK3 TRCN0000230030 233 86 36 37 288 170 EPHA8 TRCN0000230031 0 0 0 0 0 34 EPHA8 TRCN0000230032 137 47 108 66 348 651 EPHA8 TRCN0000230033 2 5 13 4 8 12 EPHA8 TRCN0000230075 211 46 0 25 33 171 GSG2 TRCN0000230076 0 12 21 13 46 33 GSG2 TRCN0000230077 540 447 57 617 1261 1438 GSG2 TRCN0000230078 56 205 3 35 2 89 GSG2 TRCN0000230079 0 47 85 28 0 61 RPS6KA2 TRCN0000230080 0 13 37 69 62 82 RPS6KA2 TRCN0000230081 4 119 236 207 474 692 RPS6KA2 TRCN0000230082 1 28 14 35 28 11 RPS6KA2 TRCN0000230091 100 0 1 110 3 73 ERBB3 TRCN0000230092 10 603 424 561 263 833 ERBB3 TRCN0000230101 0 0 0 203 128 0 EPHA5 TRCN0000230102 57 365 138 137 280 323 EPHA5 TRCN0000230103 26 50 35 27 29 20 EPHA5 TRCN0000230104 41 194 131 58 60 63 EPHA5 TRCN0000230134 1977 1517 1920 523 407 1651 TEX14 TRCN0000230135 0 19 0 0 0 0 TEX14 TRCN0000230255 474 233 2 202 259 305 RIPK2 TRCN0000230256 0 0 0 0 0 0 RIPK2 TRCN0000230426 0 0 0 0 0 0 MAP3K14 TRCN0000230427 0 0 0 13 0 0 MAP3K14 TRCN0000230428 0 0 0 1 2 0 MAP3K14 TRCN0000230429 172 19 32 360 333 242 MAP3K14 TRCN0000230559 108 97 56 39 145 413 ALPK2 TRCN0000230560 0 0 92 40 0 0 ALPK2 TRCN0000230561 375 703 1260 512 727 613 ALPK2 TRCN0000230562 0 16 0 2 96 0 ALPK2 TRCN0000230666 0 32 0 20 17 23 STK10

189

TRCN0000230667 2 23 0 3 2 20 STK10 TRCN0000230668 42 270 28 140 315 333 STK10 TRCN0000230669 0 156 496 606 526 1162 STK10 TRCN0000230770 0 0 0 0 0 0 ABL2 TRCN0000230771 23 8391 31 7 8 30 ABL2 TRCN0000230772 280 183 193 322 386 352 ABL2 TRCN0000230833 0 0 0 0 0 19 FLT1 TRCN0000230834 160 368 501 235 429 325 FLT1 TRCN0000230835 323 647 417 435 951 809 FLT1 TRCN0000230836 0 230 0 41 0 0 FLT1 TRCN0000230901 1 0 12 27 73 41 LYN TRCN0000230902 0 4 57 0 1 0 LYN TRCN0000230903 340 494 491 255 179 1085 LYN TRCN0000230908 0 0 2 41 28 0 CDK7 TRCN0000230909 262 206 173 133 106 315 CDK7 TRCN0000230910 15 393 352 69 53 1 CDK7 TRCN0000230926 0 0 0 0 0 0 CDK3 TRCN0000230927 20 0 0 34 10 61 CDK3 TRCN0000230928 0 0 0 33 13 55 CDK3 TRCN0000230929 114 187 112 116 202 115 CDK3 TRCN0000231129 0 2 36 46 0 114 BRAF TRCN0000231130 0 0 0 0 0 21 BRAF TRCN0000231131 1 0 0 0 0 48 BRAF TRCN0000231132 0 2 3 3 0 23 BRAF TRCN0000231462 0 0 0 1 0 167 BTK TRCN0000231463 0 0 0 0 0 0 BTK TRCN0000231464 0 0 18 44 0 40 BTK TRCN0000231465 96 16 58 22 121 274 BTK TRCN0000231466 0 0 17 67 106 83 BTK TRCN0000231467 1 193 0 245 174 734 PHKG2 TRCN0000231468 0 0 0 2 0 0 PHKG2 TRCN0000231469 1 22 9 1097 1663 1800 PHKG2 TRCN0000231470 0 0 0 5 0 0 PHKG2 TRCN0000231471 0 0 0 0 0 0 PHKG2 TRCN0000231472 0 318 0 12 0 0 FRK TRCN0000231473 2 652 4 859 549 1461 FRK TRCN0000231474 1 0 0 49 117 192 FRK TRCN0000231475 0 0 0 0 0 0 FRK TRCN0000231476 0 0 0 2 105 0 FRK TRCN0000231510 0 0 0 0 0 0 MAP3K10 TRCN0000231511 72 0 49 49 216 595 MAP3K10

190

TRCN0000231512 0 0 0 9 4 1 MAP3K10 TRCN0000231513 30 249 479 348 73 16 MAP3K10 TRCN0000231519 16 20 1 4 9 6 PTK2B TRCN0000231520 0 51 108 110 243 208 PTK2B TRCN0000231521 0 0 0 11 9 15 PTK2B TRCN0000231522 0 24 0 0 36 53 PTK2B TRCN0000231523 0 0 0 120 0 21 PTK2B TRCN0000231524 1 20 6 54 12 75 TYRO3 TRCN0000231525 201 370 401 123 264 105 TYRO3 TRCN0000231526 0 0 0 21 0 59 TYRO3 TRCN0000231527 78 121 457 0 38 0 TYRO3 TRCN0000231528 2 0 94 312 507 779 TYRO3 TRCN0000231538 0 0 0 0 0 0 NUAK2 TRCN0000231539 0 0 0 3 0 6 NUAK2 TRCN0000231540 0 193 2 19 0 82 NUAK2 TRCN0000231541 0 0 0 15 0 112 NUAK2 TRCN0000231542 0 0 33 102 216 115 NUAK2 TRCN0000231580 0 0 0 0 1 0 CSNK2B TRCN0000231581 0 0 0 0 0 0 CSNK2B TRCN0000231582 0 0 0 0 0 7 CSNK2B TRCN0000231583 0 0 0 0 0 0 CSNK2B TRCN0000231584 0 0 0 0 0 0 CSNK2B TRCN0000231644 30 165 0 24 186 153 EPHA2 TRCN0000231645 0 0 0 0 0 0 EPHA2 TRCN0000231646 0 0 0 7 37 20 EPHA2 TRCN0000231647 322 247 60 341 379 368 EPHA2 TRCN0000231648 0 230 1 423 481 1181 EPHA2 TRCN0000231654 2 214 38 0 0 0 MAP3K12 TRCN0000231655 0 0 0 23 0 124 MAP3K12 TRCN0000231656 0 0 0 0 0 0 MAP3K12 TRCN0000231657 0 0 0 0 72 49 MAP3K12 TRCN0000231658 0 0 0 0 0 0 MAP3K12 TRCN0000231662 1 0 8 42 5 0 ROS1 TRCN0000231663 0 0 0 6 0 0 ROS1 TRCN0000231664 499 741 186 470 431 2576 ROS1 TRCN0000231665 1 1 120 0 1 0 ROS1 TRCN0000231666 0 103 0 18 0 0 ROS1 TRCN0000231671 74 23 142 74 60 93 CAMK1G TRCN0000231672 1 4 229 107 71 108 CAMK1G TRCN0000231674 12 0 1 9 5 13 CAMK1G TRCN0000231675 0 2 2 90 325 341 CAMK1G

191

TRCN0000231681 463 255 19 168 168 118 MAP3K10 TRCN0000231934 0 0 27 0 0 9 CDK5R1 TRCN0000231935 0 16 26 18 69 0 CDK5R1 TRCN0000231936 71 338 394 366 483 777 CDK5R1 TRCN0000231937 0 0 0 10 0 0 CDK5R1 TRCN0000231938 0 51 4 158 10 159 CDK5R1 TRCN0000231939 0 0 5 4 0 26 FASTK TRCN0000231940 53 116 92 70 86 163 FASTK TRCN0000231941 0 0 0 0 0 1 FASTK TRCN0000231942 0 0 0 0 0 0 FASTK TRCN0000231943 0 0 0 77 1 0 FASTK TRCN0000232032 24 111 34 50 73 130 ADCK5 TRCN0000232033 39 19 24 8 110 63 ADCK5 TRCN0000232034 49 0 95 180 17 180 ADCK5 TRCN0000232035 1 122 267 297 186 296 ADCK5 TRCN0000232036 8 24 47 4 80 152 ADCK5 TRCN0000233485 0 13 388 408 311 574 DCLK1 TRCN0000233486 479 6 966 1 12 0 DCLK1 TRCN0000233487 0 65 28 10 124 52 DCLK1 TRCN0000233488 0 34 13 41 139 180 DCLK1 TRCN0000233489 2 112 67 130 67 18 DCLK1 TRCN0000233490 0 0 0 0 0 0 PLK3 TRCN0000233491 0 0 0 0 0 0 PLK3 TRCN0000233492 0 0 4 1 28 39 PLK3 TRCN0000233493 0 0 0 0 0 0 PLK3 TRCN0000233511 0 0 0 0 0 0 PRKCA TRCN0000233512 0 0 0 0 0 0 PRKCA TRCN0000233513 64 32 0 48 125 215 PRKCA TRCN0000233514 0 2 67 0 0 0 PRKCA TRCN0000233515 0 0 0 6 0 55 PRKCA TRCN0000233516 0 2 23 28 181 100 TAOK2 TRCN0000233517 0 61 0 52 55 160 TAOK2 TRCN0000233518 50 249 44 41 104 39 TAOK2 TRCN0000233519 0 0 0 0 66 0 TAOK2 TRCN0000234322 1 0 0 0 0 0 SRPK3 TRCN0000234323 0 0 60 0 39 0 SRPK3 TRCN0000234324 0 29 0 0 76 33 SRPK3 TRCN0000234325 0 19 0 16 8 71 SRPK3 TRCN0000234366 9 0 0 0 0 55 KALRN TRCN0000234367 0 0 0 3 23 20 KALRN TRCN0000234368 0 2 17 43 1 35 KALRN

192

TRCN0000234369 0 52 0 26 0 53 KALRN TRCN0000234386 0 0 0 0 0 0 LIMK2 TRCN0000234387 1 2 69 92 0 95 LIMK2 TRCN0000234388 1 205 231 95 235 406 LIMK2 TRCN0000234389 30 0 10 0 0 0 LIMK2 TRCN0000234390 0 0 0 9 45 92 OXSR1 TRCN0000234391 0 218 334 10 0 0 OXSR1 TRCN0000234392 4 0 114 10 2 58 OXSR1 TRCN0000234393 0 0 0 22 129 0 OXSR1 TRCN0000234560 0 0 0 0 0 0 GRK5 TRCN0000234561 1 0 52 45 51 97 GRK5 TRCN0000234562 0 0 0 0 0 0 GRK5 TRCN0000234563 0 0 0 0 0 0 GRK5 TRCN0000234678 9 53 13 21 122 243 IKBKE TRCN0000234679 0 0 0 0 33 22 IKBKE TRCN0000234680 0 174 159 0 0 18 IKBKE TRCN0000234681 105 153 66 0 39 0 IKBKE TRCN0000234682 0 0 0 25 41 0 IKBKE TRCN0000234731 3 232 46 577 408 354 TNIK TRCN0000234732 668 2602 1450 280 28 528 TNIK TRCN0000234733 0 16 0 0 16 0 TNIK TRCN0000234734 476 594 956 675 774 1127 TNIK TRCN0000234735 4 112 0 121 386 210 TNIK TRCN0000234792 1 81 0 62 0 127 PDPK1 TRCN0000234793 0 0 4 0 3 3 PDPK1 TRCN0000234794 0 0 0 0 0 0 PDPK1 TRCN0000234795 0 29 0 117 0 55 PDPK1 TRCN0000234843 480 6 13 156 305 891 EEF2K TRCN0000234844 2 0 0 2 84 12 EEF2K TRCN0000234845 0 0 79 1 0 1 EEF2K TRCN0000234846 1 205 319 347 801 439 EEF2K TRCN0000234847 0 20 12 49 41 51 EEF2K TRCN0000234968 0 74 7 19 124 61 RIPK3 TRCN0000234969 3 0 7 0 13 2 RIPK3 TRCN0000234970 0 0 4 0 0 0 RIPK3 TRCN0000234971 0 14 35 0 0 0 RIPK3 TRCN0000234972 16 0 22 0 29 18 RIPK3 TRCN0000234983 89 84 34 108 61 182 MAPK4 TRCN0000234984 0 0 0 0 0 0 MAPK4 TRCN0000234985 48 0 0 0 0 0 MAPK4 TRCN0000234986 0 0 1 3 0 0 MAPK4

193

TRCN0000234987 0 2 0 349 2 37 MAPK4 TRCN0000235410 0 0 6 0 269 63 LTK TRCN0000235411 1932 1775 1873 1004 1523 2362 LTK TRCN0000235412 0 66 9 8 0 218 LTK TRCN0000235413 0 0 0 2 42 45 LTK TRCN0000235414 96 47 93 24 20 82 LTK TRCN0000235451 41 6 12 0 60 0 EPHB6 TRCN0000235452 1 0 1 8 1 0 EPHB6 TRCN0000235453 130 153 105 162 178 337 EPHB6 TRCN0000235454 0 0 130 32 0 116 EPHB6 TRCN0000235455 4 466 1014 171 116 235 EPHB6 TRCN0000235471 0 0 0 0 0 0 CDK12 TRCN0000235472 0 1 27 198 0 43 CDK12 TRCN0000235527 0 125 85 0 0 0 ERN1 TRCN0000235528 0 2 0 0 0 1 ERN1 TRCN0000235529 2 0 0 45 22 134 ERN1 TRCN0000235530 0 0 0 0 0 0 ERN1 TRCN0000235531 212 489 190 1516 743 4412 ERN1 TRCN0000235646 0 0 0 13 53 139 EPHA10 TRCN0000235647 13 37 15 20 28 31 EPHA10 TRCN0000235648 0 0 0 12 0 0 EPHA10 TRCN0000235649 0 194 74 155 67 46 EPHA10 TRCN0000236228 0 0 0 0 0 0 IKBKG TRCN0000236229 175 191 119 35 385 450 IKBKG TRCN0000236230 0 73 30 5 0 49 IKBKG TRCN0000236231 0 0 0 0 0 0 IKBKG TRCN0000236232 0 1 0 21 19 0 IKBKG TRCN0000237811 0 0 1 2 17 26 CDK12 TRCN0000237812 1 4 385 92 0 91 CDK12 TRCN0000237813 49 297 283 190 1075 698 CDK12 TRCN0000237849 0 2 79 1 0 0 MATK TRCN0000237850 24 323 100 1 168 75 MATK TRCN0000237851 59 53 20 36 30 90 MATK TRCN0000237852 115 266 106 64 66 69 MATK TRCN0000238781 0 0 0 12 0 4 PDPK1 TRCN0000238787 0 0 0 46 40 134 PLK3 TRCN0000238791 0 0 0 0 17 0 TAOK2 TRCN0000238793 0 0 0 22 157 0 GRK5 TRCN0000244338 55 0 18 41 76 118 EPHA10 TRCN0000244900 28 5 22 33 75 43 CHUK TRCN0000244901 56 718 1896 2 290 184 CHUK

194

TRCN0000244902 2 1 0 0 77 67 CHUK TRCN0000244903 0 0 0 103 15 235 CHUK TRCN0000244904 0 0 0 0 265 230 CHUK TRCN0000244935 0 0 0 0 0 0 SMG1 TRCN0000244936 1 2 93 435 0 0 SMG1 TRCN0000244937 79 46 170 46 1 58 SMG1 TRCN0000244938 0 73 263 152 266 619 SMG1 TRCN0000244939 0 0 0 0 0 0 SMG1 TRCN0000244954 37 2 33 22 0 102 TESK1 TRCN0000244955 12 0 18 11 0 5 TESK1 TRCN0000244956 176 194 209 16 29 109 TESK1 TRCN0000244957 2 1 0 53 37 38 TESK1 TRCN0000244958 5895 1494 1366 2078 2386 3419 TESK1 TRCN0000244974 0 0 0 0 0 0 ACVR2A TRCN0000244975 0 1 58 29 29 181 ACVR2A TRCN0000244976 0 31 52 9 27 2505 ACVR2A TRCN0000244977 0 0 31 284 224 87 ACVR2A TRCN0000244978 0 0 0 8 4 37 ACVR2A TRCN0000245106 0 0 0 0 4 0 ATM TRCN0000245107 0 0 9 130 155 189 ATM TRCN0000245108 0 0 0 25 0 156 ATM TRCN0000245109 0 30 1 0 0 15 ATM TRCN0000245110 0 0 0 0 159 0 ATM TRCN0000246157 1 0 0 60 0 44 HIPK3 TRCN0000246158 0 0 0 0 0 0 HIPK3 TRCN0000246159 0 290 95 0 17 242 HIPK3 TRCN0000246160 672 1561 276 405 2090 2071 HIPK3 TRCN0000246161 0 3 61 0 47 49 HIPK3 TRCN0000246182 0 3 0 0 1 0 TTN TRCN0000246183 1 0 2 270 718 1600 TTN TRCN0000246184 0 0 0 0 0 0 TTN TRCN0000246185 0 0 13 2 0 70 TTN TRCN0000246186 2 0 89 63 201 20 TTN TRCN0000289569 90 350 71 82 303 242 RHOQ TRCN0000289570 42 538 83 154 102 317 RHOQ TRCN0000291453 16 0 21 6 107 36 RHOC TRCN0000291516 187 94 464 267 429 411 RHOC TRCN0000291537 0 0 0 0 0 0 RHOBTB3 TRCN0000291561 2 2 10 2 4 17 RHOB TRCN0000291562 1 147 14 67 62 71 RHOB TRCN0000291590 17 27 41 25 29 18 RHOBTB3

195

TRCN0000291757 0 55 0 153 78 277 RAC2 TRCN0000291759 181 308 179 106 347 644 RAC2 TRCN0000291828 2 237 188 33 39 155 RAC2 TRCN0000291829 7 0 2 108 135 1373 RAC2 TRCN0000307711 6 879 325 85 1540 1544 RHOC TRCN0000308154 34 0 14 133 143 6 RHOQ TRCN0000308285 3 203 153 97 86 1 RHOB TRCN0000318375 0 2 0 0 203 3 RAC1 TRCN0000318431 443 113 60 46 0 0 RAC1 TRCN0000318432 24 345 333 203 168 272 RAC1 TRCN0000330234 1 4 117 115 163 2 RND3 TRCN0000330303 353 128 386 125 1351 1342 RND3 TRCN0000330304 457 45 37 219 468 542 RND3 TRCN0000330305 5 15 12 20 1 23 RND3 TRCN0000331154 436 381 319 296 319 482 RHOB TRCN0000331173 202 27 231 190 53 163 RHOBTB3 TRCN0000353657 2 206 67 0 0 0 RND3 TRCN0000412393 403 702 238 280 1 267 RHOU TRCN0000414240 3 1 1 0 0 0 RHOU TRCN0000414500 0 23 1 3 1 30 CDC42SE2 TRCN0000417282 0 16 8 18 18 29 CDC42SE2 TRCN0000420432 1 21 0 2 26 3 RHOJ TRCN0000424971 12 37 4 20 23 13 RHOBTB2 TRCN0000424973 0 38 3 39 0 23 CDC42SE2 TRCN0000429168 14 9 7 9 7 18 RHOBTB2 TRCN0000430219 54 34 0 47 77 188 RHOV TRCN0000431657 9 0 23 18 20 49 RHOH TRCN0000432315 0 1 130 84 34 289 RHOJ TRCN0000438734 11 13 11 318 58 420 RHOH TRCN0000439797 3 69 49 122 80 105 RHOV TRCN0000440900 7 6 17 40 111 168 RHOU TRCN0000443953 2 0 0 0 0 0 RHOV TRCN0000445349 0 0 0 0 0 0 RHOH

196

REFERENCES

1. Wallace, M. R., Marchuk, D. A., Andersen, L. B., Letcher, R., Odeh, H. M.,

Saulino, A. M., Fountain, J. W., Brereton, A., Nicholson, J., Mitchell, A. L., and et al.

(1990) Type 1 neurofibromatosis gene: identification of a large transcript disrupted in three NF1 patients. Science 249, 181-186

2. Viskochil, D., Buchberg, A. M., Xu, G., Cawthon, R. M., Stevens, J., Wolff, R.

K., Culver, M., Carey, J. C., Copeland, N. G., Jenkins, N. A., and et al. (1990) Deletions and a translocation interrupt a cloned gene at the neurofibromatosis type 1 locus. Cell 62,

187-192

3. Hiatt, K. K., Ingram, D. A., Zhang, Y., Bollag, G., and Clapp, D. W. (2001)

Neurofibromin GTPase-activating protein-related domains restore normal growth in Nf1-

/- cells. J Biol Chem 276, 7240-7245

4. Martin, G. A., Viskochil, D., Bollag, G., McCabe, P. C., Crosier, W. J., Haubruck,

H., Conroy, L., Clark, R., O'Connell, P., Cawthon, R. M., and et al. (1990) The GAP- related domain of the neurofibromatosis type 1 gene product interacts with ras p21. Cell

63, 843-849

5. Stephen, A. G., Esposito, D., Bagni, R. K., and McCormick, F. (2014) Dragging ras back in the ring. Cancer Cell 25, 272-281

6. Cichowski, K., Santiago, S., Jardim, M., Johnson, B. W., and Jacks, T. (2003)

Dynamic regulation of the Ras pathway via proteolysis of the NF1 tumor suppressor.

Genes Dev 17, 449-454

7. Ferner, R. E. (2007) Neurofibromatosis 1. Eur J Hum Genet 15, 131-138

197

8. Lakkis, M. M., and Tennekoon, G. I. (2000) Neurofibromatosis type 1. I. General overview. J Neurosci Res 62, 755-763

9. Roth, T. M., Petty, E. M., and Barald, K. F. (2008) The role of steroid hormones in the NF1 phenotype: focus on pregnancy. Am J Med Genet A 146A, 1624-1633

10. Toma, J. G., Akhavan, M., Fernandes, K. J., Barnabe-Heider, F., Sadikot, A.,

Kaplan, D. R., and Miller, F. D. (2001) Isolation of multipotent adult stem cells from the dermis of mammalian skin. Nat Cell Biol 3, 778-784

11. Fernandes, K. J., McKenzie, I. A., Mill, P., Smith, K. M., Akhavan, M., Barnabe-

Heider, F., Biernaskie, J., Junek, A., Kobayashi, N. R., Toma, J. G., Kaplan, D. R.,

Labosky, P. A., Rafuse, V., Hui, C. C., and Miller, F. D. (2004) A dermal niche for multipotent adult skin-derived precursor cells. Nat Cell Biol 6, 1082-1093

12. Biernaskie, J. A., McKenzie, I. A., Toma, J. G., and Miller, F. D. (2006) Isolation of skin-derived precursors (SKPs) and differentiation and enrichment of their Schwann cell progeny. Nat Protoc 1, 2803-2812

13. Toma, J. G., McKenzie, I. A., Bagli, D., and Miller, F. D. (2005) Isolation and characterization of multipotent skin-derived precursors from human skin. Stem Cells 23,

727-737

14. Le, L. Q., Shipman, T., Burns, D. K., and Parada, L. F. (2009) Cell of origin and microenvironment contribution for NF1-associated dermal neurofibromas. Cell Stem Cell

4, 453-463

15. Yang, F. C., Ingram, D. A., Chen, S., Zhu, Y., Yuan, J., Li, X., Yang, X.,

Knowles, S., Horn, W., Li, Y., Zhang, S., Yang, Y., Vakili, S. T., Yu, M., Burns, D.,

Robertson, K., Hutchins, G., Parada, L. F., and Clapp, D. W. (2008) Nf1-dependent

198

tumors require a microenvironment containing Nf1+/-- and c-kit-dependent bone marrow.

Cell 135, 437-448

16. Chen, Z., Liu, C., Patel, A. J., Liao, C. P., Wang, Y., and Le, L. Q. (2014) Cells of origin in the embryonic nerve roots for NF1-associated plexiform neurofibroma. Cancer

Cell 26, 695-706

17. Korf, B. R. (1999) Plexiform neurofibromas. Am J Med Genet 89, 31-37

18. Tonsgard, J. H., Kwak, S. M., Short, M. P., and Dachman, A. H. (1998) CT imaging in adults with neurofibromatosis-1: frequent asymptomatic plexiform lesions.

Neurology 50, 1755-1760

19. Wennerberg, K., Rossman, K. L., and Der, C. J. (2005) The Ras superfamily at a glance. J Cell Sci 118, 843-846

20. Bourne, H. R., Sanders, D. A., and McCormick, F. (1991) The GTPase superfamily: conserved structure and molecular mechanism. Nature 349, 117-127

21. Vetter, I. R., and Wittinghofer, A. (2001) The guanine nucleotide-binding switch in three dimensions. Science 294, 1299-1304

22. Malumbres, M., and Barbacid, M. (2003) RAS oncogenes: the first 30 years. Nat

Rev Cancer 3, 459-465

23. Campbell, P. M., and Der, C. J. (2004) Oncogenic Ras and its role in tumor cell invasion and metastasis. Semin Cancer Biol 14, 105-114

24. Pylayeva-Gupta, Y., Grabocka, E., and Bar-Sagi, D. (2011) RAS oncogenes: weaving a tumorigenic web. Nat Rev Cancer 11, 761-774

25. Hashimoto, D., Arima, K., Yokoyama, N., Chikamoto, A., Taki, K., Inoue, R.,

Kaida, T., Higashi, T., Nitta, H., Ohmuraya, M., Hirota, M., Beppu, T., and Baba, H.

199

(2016) Heterogeneity of KRAS Mutations in Pancreatic Ductal Adenocarcinoma.

Pancreas 45, 1111-1114

26. Miglio, U., Oldani, A., Mezzapelle, R., Veggiani, C., Paganotti, A., Garavoglia,

M., and Boldorini, R. (2014) KRAS mutational analysis in ductal adenocarcinoma of the pancreas and its clinical significance. Pathol Res Pract 210, 307-311

27. Ulku, A. S., and Der, C. J. (2003) Ras signaling, deregulation of gene expression and oncogenesis. Cancer Treat Res 115, 189-208

28. Simanshu, D. K., Nissley, D. V., and McCormick, F. (2017) RAS Proteins and

Their Regulators in Human Disease. Cell 170, 17-33

29. Boettcher, M., and Hoheisel, J. D. (2010) Pooled RNAi Screens - Technical and

Biological Aspects. Curr Genomics 11, 162-167

30. Sims, D., Mendes-Pereira, A. M., Frankum, J., Burgess, D., Cerone, M. A.,

Lombardelli, C., Mitsopoulos, C., Hakas, J., Murugaesu, N., Isacke, C. M., Fenwick, K.,

Assiotis, I., Kozarewa, I., Zvelebil, M., Ashworth, A., and Lord, C. J. (2011) High- throughput RNA interference screening using pooled shRNA libraries and next generation sequencing. Genome Biol 12

31. Yang, X., Boehm, J. S., Yang, X., Salehi-Ashtiani, K., Hao, T., Shen, Y.,

Lubonja, R., Thomas, S. R., Alkan, O., Bhimdi, T., Green, T. M., Johannessen, C. M.,

Silver, S. J., Nguyen, C., Murray, R. R., Hieronymus, H., Balcha, D., Fan, C., Lin, C.,

Ghamsari, L., Vidal, M., Hahn, W. C., Hill, D. E., and Root, D. E. (2011) A public genome-scale lentiviral expression library of human ORFs. Nat Methods 8, 659-661

32. Bassik, M. C., Lebbink, R. J., Churchman, L. S., Ingolia, N. T., Patena, W.,

LeProust, E. M., Schuldiner, M., Weissman, J. S., and McManus, M. T. (2009) Rapid

200

creation and quantitative monitoring of high coverage shRNA libraries. Nat Methods 6,

443-445

33. Brummelkamp, T. R., Fabius, A. W., Mullenders, J., Madiredjo, M., Velds, A.,

Kerkhoven, R. M., Bernards, R., and Beijersbergen, R. L. (2006) An shRNA barcode screen provides insight into cancer cell vulnerability to MDM2 inhibitors. Nat Chem Biol

2, 202-206

34. Silva, J. M., Marran, K., Parker, J. S., Silva, J., Golding, M., Schlabach, M. R.,

Elledge, S. J., Hannon, G. J., and Chang, K. (2008) Profiling essential genes in human mammary cells by multiplex RNAi screening. Science 319, 617-620

35. Luo, B., Cheung, H. W., Subramanian, A., Sharifnia, T., Okamoto, M., Yang, X.,

Hinkle, G., Boehm, J. S., Beroukhim, R., Weir, B. A., Mermel, C., Barbie, D. A., Awad,

T., Zhou, X., Nguyen, T., Piqani, B., Li, C., Golub, T. R., Meyerson, M., Hacohen, N.,

Hahn, W. C., Lander, E. S., Sabatini, D. M., and Root, D. E. (2008) Highly parallel identification of essential genes in cancer cells. Proc Natl Acad Sci U S A 105, 20380-

20385

36. Wilson, L. J., Linley, A., Hammond, D. E., Hood, F. E., Coulson, J. M.,

MacEwan, D. J., Ross, S. J., Slupsky, J. R., Smith, P. D., Eyers, P. A., and Prior, I. A.

(2018) New Perspectives, Opportunities, and Challenges in Exploring the Human Protein

Kinome. Cancer Res 78, 15-29

37. Manning, G., Whyte, D. B., Martinez, R., Hunter, T., and Sudarsanam, S. (2002)

The protein kinase complement of the human genome. Science 298, 1912-1934

38. Taylor, S. S., and Kornev, A. P. (2011) Protein kinases: evolution of dynamic regulatory proteins. Trends Biochem Sci 36, 65-77

201

39. Johnson, L. N., Noble, M. E., and Owen, D. J. (1996) Active and inactive protein kinases: structural basis for regulation. Cell 85, 149-158

40. Pletscher-Frankild, S., Palleja, A., Tsafou, K., Binder, J. X., and Jensen, L. J.

(2015) DISEASES: text mining and data integration of disease-gene associations.

Methods 74, 83-89

41. Etienne-Manneville, S., and Hall, A. (2002) Rho GTPases in cell biology. Nature

420, 629-635

42. Hall, A. (2012) Rho family GTPases. Biochem Soc Trans 40, 1378-1382

43. Jaffe, A. B., and Hall, A. (2005) Rho GTPases: biochemistry and biology. Annu

Rev Cell Dev Biol 21, 247-269

44. Zandvakili, I., Lin, Y., Morris, J. C., and Zheng, Y. (2017) Rho GTPases: Anti- or pro-neoplastic targets? Oncogene 36, 3213-3222

45. Li, H., Chang, L. J., Neubauer, D. R., Muir, D. F., and Wallace, M. R. (2016)

Immortalization of human normal and NF1 neurofibroma Schwann cells. Lab Invest 96,

1105-1115

46. Subramanian, A., Tamayo, P., Mootha, V. K., Mukherjee, S., Ebert, B. L.,

Gillette, M. A., Paulovich, A., Pomeroy, S. L., Golub, T. R., Lander, E. S., and Mesirov,

J. P. (2005) Gene set enrichment analysis: a knowledge-based approach for interpreting genome-wide expression profiles. Proc Natl Acad Sci U S A 102, 15545-15550

47. Ingram, D. A., Hiatt, K., King, A. J., Fisher, L., Shivakumar, R., Derstine, C.,

Wenning, M. J., Diaz, B., Travers, J. B., Hood, A., Marshall, M., Williams, D. A., and

Clapp, D. W. (2001) Hyperactivation of p21(ras) and the hematopoietic-specific Rho

202

GTPase, Rac2, cooperate to alter the proliferation of neurofibromin-deficient mast cells in vivo and in vitro. J Exp Med 194, 57-69

48. Dai, Z., Sheridan, J. M., Gearing, L. J., Moore, D. L., Su, S., Wormald, S.,

Wilcox, S., O'Connor, L., Dickins, R. A., Blewitt, M. E., and Ritchie, M. E. (2014) edgeR: a versatile tool for the analysis of shRNA-seq and CRISPR-Cas9 genetic screens.

F1000Res 3, 95

49. Yang, J., Chang, E., Cherry, A. M., Bangs, C. D., Oei, Y., Bodnar, A., Bronstein,

A., Chiu, C. P., and Herron, G. S. (1999) Human endothelial cell life extension by telomerase expression. J Biol Chem 274, 26141-26148

50. Dickson, M. A., Hahn, W. C., Ino, Y., Ronfard, V., Wu, J. Y., Weinberg, R. A.,

Louis, D. N., Li, F. P., and Rheinwald, J. G. (2000) Human keratinocytes that express hTERT and also bypass a p16(INK4a)-enforced mechanism that limits life span become immortal yet retain normal growth and differentiation characteristics. Mol Cell Biol 20,

1436-1447

51. Bodnar, A. G., Ouellette, M., Frolkis, M., Holt, S. E., Chiu, C. P., Morin, G. B.,

Harley, C. B., Shay, J. W., Lichtsteiner, S., and Wright, W. E. (1998) Extension of life- span by introduction of telomerase into normal human cells. Science 279, 349-352

52. Ramirez, R. D., Sheridan, S., Girard, L., Sato, M., Kim, Y., Pollack, J., Peyton,

M., Zou, Y., Kurie, J. M., Dimaio, J. M., Milchgrub, S., Smith, A. L., Souza, R. F.,

Gilbey, L., Zhang, X., Gandia, K., Vaughan, M. B., Wright, W. E., Gazdar, A. F., Shay,

J. W., and Minna, J. D. (2004) Immortalization of human bronchial epithelial cells in the absence of viral oncoproteins. Cancer Res 64, 9027-9034

203

53. Wu, J., Meng, F., Kong, L. Y., Peng, Z., Ying, Y., Bornmann, W. G., Darnay, B.

G., Lamothe, B., Sun, H., Talpaz, M., and Donato, N. J. (2008) Association between imatinib-resistant BCR-ABL mutation-negative leukemia and persistent activation of

LYN kinase. J Natl Cancer Inst 100, 926-939

54. Robertson, K. A., Nalepa, G., Yang, F. C., Bowers, D. C., Ho, C. Y., Hutchins, G.

D., Croop, J. M., Vik, T. A., Denne, S. C., Parada, L. F., Hingtgen, C. M., Walsh, L. E.,

Yu, M., Pradhan, K. R., Edwards-Brown, M. K., Cohen, M. D., Fletcher, J. W., Travers,

J. B., Staser, K. W., Lee, M. W., Sherman, M. R., Davis, C. J., Miller, L. C., Ingram, D.

A., and Clapp, D. W. (2012) Imatinib mesylate for plexiform neurofibromas in patients with neurofibromatosis type 1: a phase 2 trial. Lancet Oncol 13, 1218-1224

55. Guo, L., Moon, C., Niehaus, K., Zheng, Y., and Ratner, N. (2012) Rac1 controls

Schwann cell myelination through cAMP and NF2/merlin. J Neurosci 32, 17251-17261

56. Bitgood, M. J., and McMahon, A. P. (1995) Hedgehog and Bmp genes are coexpressed at many diverse sites of cell-cell interaction in the mouse embryo. Dev Biol

172, 126-138

57. Marei, H., and Malliri, A. (2017) Rac1 in human diseases: The therapeutic potential of targeting Rac1 signaling regulatory mechanisms. Small GTPases 8, 139-163

58. Jacquier, A., Buhler, E., Schafer, M. K., Bohl, D., Blanchard, S., Beclin, C., and

Haase, G. (2006) Alsin/Rac1 signaling controls survival and growth of spinal motoneurons. Ann Neurol 60, 105-117

59. Loucks, F. A., Le, S. S., Zimmermann, A. K., Ryan, K. R., Barth, H., Aktories,

K., and Linseman, D. A. (2006) Rho family GTPase inhibition reveals opposing effects of mitogen-activated protein kinase kinase/extracellular signal-regulated kinase and Janus

204

kinase/signal transducer and activator of transcription signaling cascades on neuronal survival. J Neurochem 97, 957-967

60. Kanekura, K., Hashimoto, Y., Kita, Y., Sasabe, J., Aiso, S., Nishimoto, I., and

Matsuoka, M. (2005) A Rac1/phosphatidylinositol 3-kinase/Akt3 anti-apoptotic pathway, triggered by AlsinLF, the product of the ALS2 gene, antagonizes Cu/Zn-superoxide dismutase (SOD1) mutant-induced motoneuronal cell death. J Biol Chem 280, 4532-4543

61. Tourette, C., Li, B., Bell, R., O'Hare, S., Kaltenbach, L. S., Mooney, S. D., and

Hughes, R. E. (2014) A large scale Huntingtin protein interaction network implicates Rho

GTPase signaling pathways in Huntington disease. J Biol Chem 289, 6709-6726

62. Harraz, M. M., Marden, J. J., Zhou, W., Zhang, Y., Williams, A., Sharov, V. S.,

Nelson, K., Luo, M., Paulson, H., Schoneich, C., and Engelhardt, J. F. (2008) SOD1 mutations disrupt redox-sensitive Rac regulation of NADPH oxidase in a familial ALS model. J Clin Invest 118, 659-670

63. Benitah, S. A., Valeron, P. F., van Aelst, L., Marshall, C. J., and Lacal, J. C.

(2004) Rho GTPases in human cancer: an unresolved link to upstream and downstream transcriptional regulation. Biochim Biophys Acta 1705, 121-132

64. Merajver, S. D., and Usmani, S. Z. (2005) Multifaceted role of Rho proteins in angiogenesis. J Mammary Gland Biol Neoplasia 10, 291-298

65. Lin, Y., and Zheng, Y. (2015) Approaches of targeting Rho GTPases in cancer drug discovery. Expert Opin Drug Discov 10, 991-1010

66. Jin, G., Sah, R. L., Li, Y. S., Lotz, M., Shyy, J. Y., and Chien, S. (2000)

Biomechanical regulation of matrix metalloproteinase-9 in cultured chondrocytes. J

Orthop Res 18, 899-908

205

67. Kheradmand, F., Werner, E., Tremble, P., Symons, M., and Werb, Z. (1998) Role of Rac1 and oxygen radicals in collagenase-1 expression induced by cell shape change.

Science 280, 898-902

68. Jacks, T., Shih, T. S., Schmitt, E. M., Bronson, R. T., Bernards, A., and

Weinberg, R. A. (1994) Tumour predisposition in mice heterozygous for a targeted mutation in Nf1. Nat Genet 7, 353-361

69. Chang, T., Krisman, K., Theobald, E. H., Xu, J., Akutagawa, J., Lauchle, J. O.,

Kogan, S., Braun, B. S., and Shannon, K. (2013) Sustained MEK inhibition abrogates myeloproliferative disease in Nf1 mutant mice. J Clin Invest 123, 335-339

70. Staser, K., Park, S. J., Rhodes, S. D., Zeng, Y., He, Y. Z., Shew, M. A.,

Gehlhausen, J. R., Cerabona, D., Menon, K., Chen, S., Sun, Z., Yuan, J., Ingram, D. A.,

Nalepa, G., Yang, F. C., and Clapp, D. W. (2013) Normal hematopoiesis and neurofibromin-deficient myeloproliferative disease require Erk. J Clin Invest 123, 329-

334

71. Side, L., Taylor, B., Cayouette, M., Conner, E., Thompson, P., Luce, M., and

Shannon, K. (1997) Homozygous inactivation of the NF1 gene in bone marrow cells from children with neurofibromatosis type 1 and malignant myeloid disorders. N Engl J

Med 336, 1713-1720

72. Lindsley, A., Snider, P., Zhou, H., Rogers, R., Wang, J., Olaopa, M., Kruzynska-

Frejtag, A., Koushik, S. V., Lilly, B., Burch, J. B., Firulli, A. B., and Conway, S. J.

(2007) Identification and characterization of a novel Schwann and outflow tract endocardial cushion lineage-restricted periostin enhancer. Dev Biol 307, 340-355

206

73. Jessen, W. J., Miller, S. J., Jousma, E., Wu, J., Rizvi, T. A., Brundage, M. E.,

Eaves, D., Widemann, B., Kim, M. O., Dombi, E., Sabo, J., Hardiman Dudley, A., Niwa-

Kawakita, M., Page, G. P., Giovannini, M., Aronow, B. J., Cripe, T. P., and Ratner, N.

(2013) MEK inhibition exhibits efficacy in human and mouse neurofibromatosis tumors.

J Clin Invest 123, 340-347

74. Rhodes, S. D., He, Y., Smith, A., Jiang, L., Lu, Q., Mund, J., Li, X., Bessler, W.,

Qian, S., Dyer, W., Sandusky, G. E., Horvai, A. E., Armstrong, A. E., and Clapp, D. W.

(2019) Cdkn2a (Arf) loss drives NF1-associated atypical neurofibroma and malignant transformation. Hum Mol Genet 28, 2752-2762

75. Sugihara, K., Nakatsuji, N., Nakamura, K., Nakao, K., Hashimoto, R., Otani, H.,

Sakagami, H., Kondo, H., Nozawa, S., Aiba, A., and Katsuki, M. (1998) Rac1 is required for the formation of three germ layers during gastrulation. Oncogene 17, 3427-3433

76. Glogauer, M., Marchal, C. C., Zhu, F., Worku, A., Clausen, B. E., Foerster, I.,

Marks, P., Downey, G. P., Dinauer, M., and Kwiatkowski, D. J. (2003) Rac1 deletion in mouse neutrophils has selective effects on neutrophil functions. J Immunol 170, 5652-

5657

77. Cox, A. D., Fesik, S. W., Kimmelman, A. C., Luo, J., and Der, C. J. (2014)

Drugging the undruggable RAS: Mission possible? Nat Rev Drug Discov 13, 828-851

78. Downward, J. (2003) Targeting RAS signalling pathways in cancer therapy. Nat

Rev Cancer 3, 11-22

79. Dombi, E., Baldwin, A., Marcus, L. J., Fisher, M. J., Weiss, B., Kim, A.,

Whitcomb, P., Martin, S., Aschbacher-Smith, L. E., Rizvi, T. A., Wu, J., Ershler, R.,

Wolters, P., Therrien, J., Glod, J., Belasco, J. B., Schorry, E., Brofferio, A., Starosta, A.

207

J., Gillespie, A., Doyle, A. L., Ratner, N., and Widemann, B. C. (2016) Activity of

Selumetinib in Neurofibromatosis Type 1-Related Plexiform Neurofibromas. N Engl J

Med 375, 2550-2560

80. Alvarez, D. E., and Agaisse, H. (2014) A role for the small GTPase Rac1 in vaccinia actin-based motility. Small GTPases 5, e29038

81. Watson, I. R., Li, L., Cabeceiras, P. K., Mahdavi, M., Gutschner, T., Genovese,

G., Wang, G., Fang, Z., Tepper, J. M., Stemke-Hale, K., Tsai, K. Y., Davies, M. A.,

Mills, G. B., and Chin, L. (2014) The RAC1 P29S hotspot mutation in melanoma confers resistance to pharmacological inhibition of RAF. Cancer Res 74, 4845-4852

82. Haga, R. B., and Ridley, A. J. (2016) Rho GTPases: Regulation and roles in cancer cell biology. Small GTPases 7, 207-221

83. Hein, A. L., Post, C. M., Sheinin, Y. M., Lakshmanan, I., Natarajan, A., Enke, C.

A., Batra, S. K., Ouellette, M. M., and Yan, Y. (2016) RAC1 GTPase promotes the survival of breast cancer cells in response to hyper-fractionated radiation treatment.

Oncogene 35, 6319-6329

84. Ferguson, M. J., Rhodes, S. D., Jiang, L., Li, X., Yuan, J., Yang, X., Zhang, S.,

Vakili, S. T., Territo, P., Hutchins, G., Yang, F. C., Ingram, D. A., Clapp, D. W., and

Chen, S. (2016) Preclinical Evidence for the Use of Sunitinib Malate in the Treatment of

Plexiform Neurofibromas. Pediatr Blood Cancer 63, 206-213

85. Watson, A. L., Anderson, L. K., Greeley, A. D., Keng, V. W., Rahrmann, E. P.,

Halfond, A. L., Powell, N. M., Collins, M. H., Rizvi, T., Moertel, C. L., Ratner, N., and

Largaespada, D. A. (2014) Co-targeting the MAPK and PI3K/AKT/mTOR pathways in

208

two genetically engineered mouse models of schwann cell tumors reduces tumor grade and multiplicity. Oncotarget 5, 1502-1514

86. Mayes, D. A., Rizvi, T. A., Cancelas, J. A., Kolasinski, N. T., Ciraolo, G. M.,

Stemmer-Rachamimov, A. O., and Ratner, N. (2011) Perinatal or adult Nf1 inactivation using tamoxifen-inducible PlpCre each cause neurofibroma formation. Cancer Res 71,

4675-4685

87. Wu, J., Williams, J. P., Rizvi, T. A., Kordich, J. J., Witte, D., Meijer, D.,

Stemmer-Rachamimov, A. O., Cancelas, J. A., and Ratner, N. (2008) Plexiform and dermal neurofibromas and pigmentation are caused by Nf1 loss in desert hedgehog- expressing cells. Cancer Cell 13, 105-116

88. Zhu, Y., Ghosh, P., Charnay, P., Burns, D. K., and Parada, L. F. (2002)

Neurofibromas in NF1: Schwann cell origin and role of tumor environment. Science 296,

920-922

89. Brannan, C. I., Perkins, A. S., Vogel, K. S., Ratner, N., Nordlund, M. L., Reid, S.

W., Buchberg, A. M., Jenkins, N. A., Parada, L. F., and Copeland, N. G. (1994) Targeted disruption of the neurofibromatosis type-1 gene leads to developmental abnormalities in heart and various neural crest-derived tissues. Genes Dev 8, 1019-1029

90. Liao, C. P., Booker, R. C., Brosseau, J. P., Chen, Z., Mo, J., Tchegnon, E., Wang,

Y., Clapp, D. W., and Le, L. Q. (2018) Contributions of inflammation and tumor microenvironment to neurofibroma tumorigenesis. J Clin Invest 128, 2848-2861

91. Brosseau, J. P., Liao, C. P., Wang, Y., Ramani, V., Vandergriff, T., Lee, M.,

Patel, A., Ariizumi, K., and Le, L. Q. (2018) NF1 heterozygosity fosters de novo tumorigenesis but impairs malignant transformation. Nat Commun 9, 5014

209

92. Friedrich, R. E., Keiner, D., and Hagel, C. (2007) Expression of insulin-like growth-factor-1 receptor (IGF-1R) in peripheral nerve sheath tumors in neurofibromatosis type 1. Anticancer Res 27, 2085-2090

93. Bosco, E. E., Mulloy, J. C., and Zheng, Y. (2009) Rac1 GTPase: a "Rac" of all trades. Cell Mol Life Sci 66, 370-374

94. Yue, X., Zhang, C., Zhao, Y., Liu, J., Lin, A. W., Tan, V. M., Drake, J. M., Liu,

L., Boateng, M. N., Li, J., Feng, Z., and Hu, W. (2017) Gain-of-function mutant p53 activates small GTPase Rac1 through SUMOylation to promote tumor progression.

Genes Dev 31, 1641-1654

210

CURRICULUM VITAE

Julie Ann Mund

Education

2019: Ph.D., Indiana University, Indianapolis, IN

2008: M.S., Cellular and Integrative Physiology, Indiana University, Indianapolis, IN

2005: B.A., Classical and Near Eastern Studies, Creighton University, Omaha, NE

Academic and Professional Awards

2016-Present: Pre-Doctoral Fellow, Institutional National Research Service Award

(5T32DK007519-15)

2018 5 th Place for Best Poster at IUSCC Cancer Research Day

2007 Fellow, American Vascular Association Lifeline Student Research Award

2006 Candidate, Dr. Jeffery Isner Young Investigator Award for Excellence in Gene

Therapy

2005 Arete Award for Excellence in Classical Civilizations

Professional Experience

2012-14 Scientific Director, Angio BioCore, Indiana University Simon Cancer Center

• Liaised with clinicians and researchers to design hypothesis-driven experiments tailored

to meeting the goals of each individual clinical or preclinical study across adult and

pediatric disease

• Drafted budgets, maintained financial records, and set pricing based on cost for all

experiments performed by the ABC.

• Incorporated my 14,000+ hours of in vitro expertise to maintain cutting edge protocols,

design/troubleshoot new experiments, and liaise with investigators across the world to

further research elucidating how circulating hematopoietic stem/progenitor cell

populations change with response to disease.

• Recruited new employees by drafting new job positions, establishing the job-related

criteria then evaluating prospective new employees through interviewing and

recommendation of qualified candidates.

• Wrote grants, publications and created figures for investigators for internal and external

funding, manuscripts, and patent applications, including documents for the ABC to

become one of 5 nationally recognized NIH Core Centers of Excellence in Molecular

Hematology (2010-2015).

• Promoted from Lab Manager Position (2010-2012)

2005-2014 Research Associate (started as Research Technician), Indiana University School of

Medicine, Department of Pediatrics, Division of Neonatal-Perinatal Medicine, Indianapolis, IN

• Hired as a research technician. Following completion of MS, promoted up 3 levels

before being promoted to Faculty at IUSM (one of few Faculty without a terminal

degree).

• Designed, planned and executed multiple projects investigating the role of pro-

angiogenic and anti-angiogenic circulating hematopoietic stem and progenitor cells

(CHSPCs) in tumor progression and angiogenesis from adult and pediatric patients with

various solid and hematological cancers, diabetes (Type 1, Type 2, Gestational) and

cardiovascular disease.

• Designed, planned and executed experiments to identify the origins and in vivo capacity

of endothelial colony forming cells (ECFCs) to repair damaged blood vessels.

Implemented projects involving the use of novel anti-angiogenic compounds and small

molecule inhibitors to slow or inhibit the growth different tumor cells lines and

endothelial cell lines.

• Development of over 20 novel multi-parametric flow cytometry protocols to identify

cellular biomarkers of active angiogenesis/tumorigenesis, and across cardiovascular

diseases.

• Trained 26 scientists in the proper techniques for our laboratory.

• Started up and managed a new laboratory on the IUSM campus including

implementation of clinical and pre-clinical studies, assisted with IRB, IACUC, and

FDA IND protocol preparation and submission for the first FDA approved clinical trial

using autologous bone marrow for the treatment of critical limb ischemia.

Conferences Attended

1. Mund JA , Park SJ, Smith A, Yuan J, Bessler WK, Clapp DW. Identification of

Rac1 by an shRNA Library Screen and Genetic Proof of Concept That Disruption

of Rac1 Prevents Plexiform Neurofibroma Formation in a Mouse Model of

Neurofibromatosis Type 1. Children’s Tumor Foundation Conference, Paris, FR

2018. ( Poster Presentation )

2. Mund JA , Park SJ, Smith A, Yuan J, Bessler WK, Clapp DW. Genetic

Disruption of Rac1 Reduces Tumor Size and Number in Two Mouse Models of

Neurofibromatosis Type 1. Simon Cancer Research Day, Indianapolis, IN 2018.

(Poster Presentation )

3. Mund JA , Ingram DA, Pollok KE, Case J. Human proangiogenic circulating

hematopoietic stem and progenitor cells promote tumor growth in an orthotopic

melanoma xenograft model. Angiogenesis Gordon Research Conference. Aug 4-

9th Salve Regina College, Newport RI, 2013 ( Poster Presentation )

4. Mund JA , Pollok KE, Case J. Human proangiogenic circulating hematopoietic

stem and progenitor cells promote tumor growth in an orthotopic melanoma

xenograft model. Angiogenesis Gordon Research Seminar. Aug 3-4th Salve

Regina College, Newport RI, 2013 (Oral Presentation )

5. Pradhan K, Claussen H, Vik T, Calley C, Mund JA , Case J. A Predictive

biomarker of vasculopathy in survivors of childhood malignancies. 12 th

International Conference on Long-Term complications of Treatment of Children

and Adolescents for Cancer. June 8-9 St. Jude Children’s Research Hosptial,

Williamsburg, VA, 2012 ( Poster Presentation )

6. Downing B, Li F, Bessler WK, Stansfield BK, Mund JA , Sarchet K, Distasi MC,

Smiley LC, Ingram DA. Monocyte/macrophages are the primary effectors of

Nf1 +/- aneurysm formation via increased activation of the NADPH oxidase

system. Gordon Research Seminar: NOX Family NADPH Oxidases. Waterville

Valley, NH, June 2-3, 2012 ( Oral Presentation ).

7. Downing B, Li F, Bessler WK, Stansfield BK, Mund JA , Sarchet K, Distasi MC,

Ingram DA. Myeloid cells induce Nf1 +/- aneurysms via activation of NADPH

oxidase. National Clinical and Translational Sciences Predoctoral Programs

Meeting. Rochester, MN, May 6-8 2012 ( Poster Presentation )

8. Stansfield BK, Bessler WK, Mund JA , Sarchet K, Downing B, Distasi M, Smiley

L, Li F, Ingram DA. Monocyte/macrophages are the primary effectors of Nf1+/-

vaso-occlusive disease. Children’s Tumor Foundation: NF Conference. Jackson

Hole, WY, June 11-14, 2011 ( Poster Presentation )

9. Mund JA and Case J. The role of human circulating hematopoietic stem and

progenitor cells (CHSPCs) in promoting tumor growth, angiogenesis, and

vascular repair. 4th International Meeting on Angiogenesis. March 2-4, VU

University Medical Center, Amsterdam, Netherlands, 2011. Angiogenesis

14(1):73 (0-6), 2011 ( Oral Presentation )

10. Pradhan K, Estes ML, Mund JA , Calley C, Vik T, Ingram DA, Case J.

Polychromatic Flow Cytometry to Identify Novel Biological Markers Associated

with Tumor Induced Angiogenesis in Pediatric Solid Tumors. 42 nd Congress of

the Society of Paediatric Oncology, Oct 21-24, Boston, MA, USA, 2010. ( Oral

Presentation )

11. Mund JA , Application of polychromatic flow cytometry to identify circulating

mature endothelial and endothelial progenitor cells with colony forming potential.

INFANT Foundation, Buenos Aires, Argentina October 15 th 2010. ( Invited

Lecturer )

12. Mund JA , Application of polychromatic flow cytometry to identify circulating

mature endothelial and endothelial progenitor cells with colony forming potential.

Vrije University Medical Center, Amsterdam, The Netherlands July 8 th 2010.

(Invited Lecturer )

13. Mund JA , Application of polychromatic flow cytometry and cell sorting

techniques to identify subsets of rare circulating cells with angiogenic potential.

Leiden University Medical Center, Leiden, The Netherlands July 5 th 2010.

(Invited Lecturer )

14. Mund JA , Cai S, Wang H, Sinn AL, Silver J, Estes ML, Ingram DA, Pollok KE,

Case J. Human Circulating Progenitor Cells of Hematopoietic Origin Promote

Tumor Growth in Melanoma Xenograft Models. 8 th Annual Midwest Blood Club

Symposium, May 6-7, Indianapolis, IN, USA, 2010. ( Oral Presentation )

15. Pollok KE, Cai S, Wang H, Sinn AL, Silver J, Estes ML, Mund JA , Ingram DA,

Case J. Human Circulating Progenitor Cells of Hematopoietic Origin Promote

Tumor Growth in Melanoma Xenograft Models. 101 st American Association of

Cancer Research, April 17-21, Washington DC, USA, 2010. ( Oral Presentation)

16. Pollok KE, Cai S, Wang H, Estes ML, Mund JA , Ingram DA, Case J. The role of

circulating progenitor cells in cancer and tumor progression. 38 th Annual Scientific

Meeting of the Society for Hematology and Stem Cells, September 9-12, Athens,

Greece, 2009.

17. Mund JA, Booth DL, Shafique S, Nachreiner RD, Unthank JL, Dalsing MC,

Murphy MP. Endothelial Progenitor Cells are Mobilized in Critical Limb

Ischemia. Society of Vascular Surgery Atherosclerosis Meeting, March,

Washington, DC, USA, 2007. ( Poster Presentation )

18. Mund JA , Murphy MP, Shafique S, Lawson JH, Nelson C, Dalsing MC, March

KL. Stem cell mediated angiogenesis for peripheral vascular disease. 2 nd Annual

Cardiovascular Cell and Gene Therapy Conference, April, Boston, MA, USA,

2006. ( Poster Presentation)

19. Mund JA , Murphy MP, Shafique S, Lawson JH, Nelson C, Dalsing MC, March

KL. Stem cell mediated angiogenesis for peripheral vascular disease. 2 nd

International Stem Cell Research & Therapeutics Conference March, San

Francisco, CA, USA, 2006. ( Oral Presentation )

Publications

*Denotes co-first authorship

1. Mund JA , Park SJ, Smith A, Jiang L, Hawley E, Roberson, M, Yuan J, Bessler WK,

Sandusky GE, Chen S, Zhang C, Rhodes SD, Clapp DW. Genetic disruption of Rac1

prevents neurofibroma formation in mice with neurofibromatosis type 1 (In Preparation).

2. Rhodes SD, He Y, Smith A, Jiang L, Lu Q, Mund J , Li X, Bessler W, Qian S, Dyer W,

Sandusky GE, Hirvai AE, Armstrong AE, Clapp DW. Cdkn2A (arf) loss drives NF1-

associated atypical neurofibroma and malignant transformation. Hum Mol Genet . 2019 (In

Press)

3. Reese MJ, Knapp DW, Anderson KM, Mund JA , Case J, Jones DR, Packer RA. In vitro

effect of chlorambucil on human glioma cell lines (SF767 and U87-MG), and human

microvascular endothelial cell (HMVEC) and endothelial progenitor cells (ECFCs), in the

context of plasma chlorambucil concentrations in tumor-bearing dogs. PLoS One . 2018

Sept 7 th ; 13(9):e0203517

4. Salazar TE, Richardson MR, Beli E, Ripsch MS, George J, Kim Y, Duan Y, Moldovan L,

Yan Y, Bhatwadekar A, Jadhav V, Smith JA, McGorray S, Bertone AL, Traktuev DO,

March KL, Colon-Perez LM, Avin KG, Sims E, Mund JA , Case J, Deng X, Kim MS,

McDavitt B, Boulton ME, Thinschmidt J, Li Calzi S, Fitz SD, Fuchs RK, Warden SJ,

McKinley T, Shekhar A, Febo M, Johnson PL, Chang LJ, Gao Z, Kolonin MG, Lai S, Ma

J, Dong X, White FA, Xie H, Yoder MC, Grant MB. Electroacupuncture promotes central

nervous system-dependent release of mesenchymal stem cells. Stem Cells . 2017

May;35(5):1303-1315. doi: 10. 1002/stem.2613

5. Kim JE, Lin G, Zhou J, Mund JA , Case J, Campbell WW. Weight loss achieved using an

energy restriction diet with normal or higher dietary protein decreased the number of the

CD14++CD16+ pro-inflammatory monocytes and plasma lipids and lipoproteins in middle-

aged, overweight and obese adults. Nutr Res. 2017 Apr;40:75-81. doi:

101016/j.nutres.2017.02.007. Epub 2017 Mar 14.

6. Bessler WK, Hudson FZ, Zhang H, Harris V, Wang Y, Mund JA , Downing B, Ingram DA

Jr, Case J, Fulton DJ, Stansfield BK. Neurofibromin is a novel regulator of Ras-induced

reactive oxygen species production in mice and humans. Free Radic Biol Med 2016 Aug;

97:212-22 Epub 2016 Jun 3

7. Green LA, Njoku V, Mund JA , Case J, Yoder MC, Murphy MP, Clauss M. Endogenous

transmembrane TNF-Alpha protects against premature senescence in endothelial colony

forming cells. Circ Res . 2016 May 13;118(10):1512-24 Epub 2016 Apr 13

8. Bessler WK, Kim G, Hudson F, Mund JA , Mali R, Menon K, Kapur R, Clapp DW, Ingram

DA Jr, Stansfield BK. Nf1 +/- monocytes/macrophages induce neointima formation via

CCR2 activation. Hum Mol Genet . 2016 March 15;25(6):1129-39 Epub 2016 Jan 5

9. Distasi MR, Mund JA , Bohlen HG, Miller SJ, Ingram DA, Dalsing MC, Unthank JL.

Impaired compensation to femoral artery ligation in diet induced obese mice is primarily

mediated via suppression of collateral growth by Nox2 and p47phox. AM J Physiol Heart

Circ Physiol . 2015 309:H1207-1217 Epub 2015 Aug 21

10. Pradhan KR, Mund J , Case J, Gupta SK, Liu Z, Gathirua-Mwangi W, McDaniel A,

Renbarger J, Champion V. Differences in circulating endothelial progenitor cells among

childhood cancer survivors treated with and without radioation. J Hematol Throm 2015;

1(1):4 Epub 2015 Aug 5.

11. Pradhan KR*, Mund JA* , Claussen HL, Gosiengfiao YC, Radulescu VC, Ballard JJ, Liu

Z, Vikt TA, Case J. A pilot study of circulating endothelial and hematopoietic progenitor

cells in children with sarcomas. J Pediatric Hematol Oncol . 2015 Aug;37(6):443-8 Epub

2015 Jun 24

12. Hays T, Mund JA , Liu Z, Case J, Ingram DA, Gupta SK. Endothelial colony forming cells

and inflammatory monocytes in HIV. J Acquir Immune Defic Syndr. 2015 Apr

15;68(5):550-3

13. Assif SJ, Chang DV, Tiller CJ, Kisling JA, Case J, Mund JA , Slaven JE, Yu Z, Ahlfeld

SK, Poindexter B, Haneine LS, Ingram DA, Tepper RS. Lung parenchymal development in

premature infants without bronchopulmonary dysplasia. Pediatric Pulmonary . 2015

Dec;50(12):1313-9 Epub 2014 Dec 2

14. Basavarajappa H, Lee B, Fei X, Callaghan B, Mund JA , Case J, Rajashekhar G., Seo SY,

Corson TW. Synthesis and Mechanistic Studies of a Novel Homoisoflavanone Inhibitor of

Endothelial Cell Growth. PLoS One 2014 Apr 21;9(4):e95694.

15. Li F, Downing BD, Stansfield BK, Smiley LC, Mund JA , DiStasi MR, Bessler WK,

Sarchet KN, Hinds DM, Kamendulis LM, Hingtgen CM, Case J, Clapp WD, Conway SJ,

Ingram DA. Neurofibromin deficient myeloid cells are critical mediators of aneurysm

formation in vivo. Circulation . 2014 Mar 18;129(11):1213-24. Epub 2013 Dec 26.

16. Stansfield BK, Bessler WK, Mali R, Mund JA , Downing BD, Kapur R, Ingram DA. Ras-

Mek-Erk Signaling Regulates Nf1 Heterozygous Neointima Formation. A J Path. Am J

Pathol . 2014 Jan; 184(1):79-85.

17. Blue EK, DiGiuseppe R, Derr-Yellin E, Acosta JC, Mund JA , Case J, Heneline LS.

Gestational diabetes induces alterations in the function of neonatal endothelial colony

forming cells. Pediatr Res . 2014 Feb;75(2):266-72. Epub 2013 Nov 14.

18. Mund JA , Sinn AL, Shannon H, Cai S, Wang H, Pradhad KR, Pollok KE, Case J. Human

proangiogenic circulating hematopoietic stem and progenitor cells promote tumor growth

in an orthotopic melanoma xenograft model. Submitted to Angiogenesis . 2013 Oct;

16(4):953-62.

19. Chang DV, Tiller CJ, Kisling J, Case J, Mund JA , Haneline LS, Ingram DA, Tepper RS.

Membrane and capillary components of lung diffusion and pro-angiogenic cells in infants.

Eur Respir J. 2014 Feb;43(2):497-504. Epub 2013 May 16

• Editorial by Merkus PJFM. Standing on shoulders. Eur Respir J . 2014 Feb;43(2):329-

330.

20. Stansfield BK, Bessler WK, Mali R, Mund JA , Downing B, Li F, Sarchet KN, Distasi MR,

Conway SJ, Kapur R, Ingram DA. Heterozygous inactivation of NF1 gene in myeloid cells

enhances neointima formation via a rosuvastatin-sensitive cellular pathway. Hum Mol

Genet. 2013 Mar 1;22(5):977-88. doi: 10.1093/hmg/dds502. Epub 2012 Nov 29

21. Mund JA and Case J. Children with solid tumors: Identification of hematopoietic and

endothelial progenitor cells as biomarkers. Invited book chapter for a series in the field of

pediatric cancers in Methods of Cancer Diagnosis, Therapy and Prognosis , Volume 11,

Stem Cell and Cancer Stem Cell . May 2013.

22. Bentley RT, Mund JA , Pollok KE, Childress MO, Case J. Peripheral blood biomarkers of

solid tumor angiogenesis in dogs: A polychromatic flow cytometry pilot study. The

Veterinary Journal , 196(2):236-240, 2013.

23. Mund JA , Ingram DA, and Yoder MC. Defining endothelial progenitor cells. Allen DS,

Strunk D, eds. Regenerative Therapy Using Blood Derived Stem Cells. Humana Press

2012:9-20

24. Mund JA , Estes ML, Yoder MC, Ingram DA, Case J. Flow cytometric identification and

functional characterization of immature and mature circulating endothelial cells. Featured

Clinical and Population Studies article of the month. Arteriosclerosis, Thrombosis and

Vascular Biology , 32(4):1045-1053, 2012.

• Editorial by Pober JS. Just the FACS or stalking the elusive circulating endothelial

progenitor cell. ATVB , 32(4):837-838, 2012.

25. Pradhan KR, Mund JA , Calley C, Vik TA, Ingram DA, Case J. Polychromatic flow

cytometry identifies novel subsets of circulating cells with angiogenic potential in pediatric

solid tumors. Cytometry Part B: Clinical Cytometry , 80B(5):335-338, 2011.

26. Mund JA , Case J. The ontogeny of endothelial progenitor cells through flow cytometry.

Invited Review for special Vascular Biology section in Current Opinion in Hematology ,

18(3):166-170, 2011.

27. Mund JA , Case J. The role of circulating endothelial progenitor cells in tumor angiogenesis.

Invited Review. Current Stem Cell Research and Therapy, 6(2):115-121, 2011.

28. Mund JA , Case J. Endothelial progenitor cells and mechanisms for revascularization.

Invited Review. International Review of Thrombosis, 6(1):56-62, 2011.

29. DiMeglio LA, Tosh A, Saha C, Estes M, Mund J , Mead LE, Lien I, Ingram DA, Haneline

LS. Endothelial abnormalities in adolescents with type 1 diabetes: A biomarker for vascular

sequelae? The Journal of Pediatrics , 157(4):540-546, 2010.

30. Estes ML*, Mund JA* , Mead LE, Prater DN, Cai S, Wang H, Pollok KE, Murphy MP, An

CST, Srour EF, Ingram DA, Case J. Application of polychromatic flow cytometry to

identify novel subsets of rare circulating cells with angiogenic potential. Cytometry A ,

77A(9):831-839, 2010.

31. Estes ML, Mund JA , Ingram DA, Case J. Identification of endothelial cells and progenitor

cell subsets in human peripheral blood. Invited Protocol. Current Protocols in Cytometry ,

52(9):9.33.1-9.33.11, 2010.

32. Mund JA , Ingram DA, Yoder MC, Case J. Endothelial progenitor cells and cardiovascular

cell based therapies. Invited Review. Cytotherapy , 11(2):103-113, 2009.

33. Blanton MW, Hadad I, Johnstone BH, Mund JA , Rogers PI, Eppley BL, March KL.

Adipose stromal cells and platelet-rich plasma therapies synergistically increase

revascularization during wound healing. Plast Reconstr Surg . 2009 Feb; 123 (2 Supple):