A Promiscuous Lipid-Binding Protein Diversifies the Subcellular Sites Of

APromiscuousLipid-BindingProtein Diversiﬁes the Subcellular Sites of Toll-like Receptor Signal Transduction

Kevin S. Bonham,1 Megan H. Orzalli,2 Kachiko Hayashi,3 Amaya I. Wolf,4 Christoph Glanemann,1,7 Wolfgang Weninger,5,6 Akiko Iwasaki,3 David M. Knipe,2 and Jonathan C. Kagan1,* 1Division of Gastroenterology, Boston Children’s Hospital and Harvard Medical School, 300 Longwood Avenue, Boston, MA 02115, USA 2Department of Microbiology and Immunobiology, Harvard Medical School, 77 Avenue Louis Pasteur, Boston, MA 02115, USA 3Department of Immunobiology, Yale University School of Medicine, 300 Cedar Street, New Haven, CT 06520, USA 4The Wistar Institute, 3601 Spruce Street, Philadelphia, PA 19104, USA 5Immune Imaging Program, The Centenary Institute, Locked Bag 6, Newtown, NSW 2042, Australia 6Discipline of Dermatology, University of Sydney, NSW 2006, Australia 7Present address: Sandoz, Biochemiestr. 10, Kundl 6250, Austria *Correspondence: [email protected] http://dx.doi.org/10.1016/j.cell.2014.01.019

SUMMARY more (1988). In addition to these examples, a more complex type of protein movement exists, where proteins can be found in The Toll-like receptors (TLRs) of the innate immune multiple locations under resting conditions or can be recruited system are unusual in that individual family members to multiple locations in response to a stimulus. In this latter are located on different organelles, yet most activate instance, it is not obvious how a single localization signal would a common signaling pathway important for host de- allow a protein to be targeted to (and function from) multiple fense. It remains unclear how this common signaling organelles. An example of this can be found from the studies pathway can be activated from multiple subcellular of the Toll-like receptors (TLRs) of the innate immune system. TLRs are transmembrane receptors that are expressed by a locations. Here, we report that, in response to natural variety of mammalian cell types but are best studied in profes- activators of innate immunity, the sorting adaptor sional phagocytes such as macrophages and dendritic cells TIRAP regulates TLR signaling from the plasma mem- (DCs) (Akira et al., 2006). TLRs detect a wide range of microbial brane and endosomes. TLR signaling from both loca- products and may be divided into different groups based on their tions triggers the TIRAP-dependent assembly of the subcellular site of ligand recognition (Barton and Kagan, 2009). myddosome, a protein complex that controls proin- TLRs 1, 2, and 4–6 reside at the plasma membrane, where flammatory cytokine expression. The actions of they detect molecules displayed on the surface of various path- TIRAP depend on the promiscuity of its phosphoino- ogens. TLRs 3, 7–9, and 11–13 are localized to various endoso- sitide-binding domain. Different lipid targets of this mal compartments, where most detect microbial nucleic acids. domain direct TIRAP to different organelles, allowing Despite residing in distinct subcellular compartments, most it to survey multiple compartments for the presence TLRs activate a common signal transduction pathway to induce innate and adaptive immunity. TLR signaling usually initiates with of activated TLRs. These data establish how promis- the activation of an adaptor protein called MyD88, which is cuity, rather than specificity, can be a beneficial recruited to the conserved TIR domain present in the cytosolic means of diversifying the subcellular sites of innate tail of all receptors of this family (Gay et al., 2011; O’Neill and immune signal transduction. Bowie, 2007). MyD88 forms a protein complex with kinases of the IRAK family called the myddosome (Lin et al., 2010; Motsh- INTRODUCTION wene et al., 2009). This complex is thought to induce a cascade of signaling events that activates the NF-kB-dependent expres- At some point in their existence, all proteins must move within sion of cytokines, chemokines, and other immunomodulatory mammalian cells. Some movement is biosynthetic, in that the factors (Gay et al., 2011; Motshwene et al., 2009; Medzhitov protein must be transported from its site of synthesis on the ribo- and Horng, 2009). Because TLRs reside on distinct organelles, some to its site of action. Another type of movement is signal the myddosome must have the capacity to be assembled in dependent, meaning that the protein will move from one location multiple subcellular locations. How myddosome assembly can to another in response to some cellular stimulus. Classic cell bio- be promoted from multiple locations is unknown. Answering logical studies identified the cis-acting sequences that direct this question will fill a fundamental gap in our understanding of these types of protein movement within cells, for example, how immune signaling pathways are integrated into the cellular Blobel and Dobberstein (1975a, 1975b) and Baeuerle and Balti- infrastructure within which they operate.

Cell 156, 705–716, February 13, 2014 ª2014 Elsevier Inc. 705 A simple explanation for how MyD88 can be recruited to RESULTS diverse organelles would be through interactions with the TIR domains of activated TLRs. However, two-hybrid analyses per- TIRAP Is Required for Endosomal TLR Signaling in formed in yeast and mammalian cells indicated that MyD88 Response to Viral Infection has limited ability to interact with TLRs directly (Brown et al., To determine whether TIRAP would function as a sorting adaptor 2006; Ulrichts et al., 2007). For this reason, an intermediate pro- for endosomal TLRs, we readdressed the genetic requirement tein is likely required to link activated TLRs to the recruitment of for this protein in the signaling pathway activated by TLR9. MyD88. Consistent with this model, the cell-surface TLRs utilize TLR9 is an excellent model for these studies for two reasons. ‘‘sorting adaptors’’ to accomplish this task. Sorting adaptors are First, it is the best-characterized endosome-localized TLR the only regulators of TLR signaling that are located at the sub- (Barbalat et al., 2011), and its ligand (unmethylated CpG- cellular site of signal transduction, prior to any microbial containing DNA) is easy to produce (Hemmi et al., 2000). encounter (Kagan, 2012a). Their placement at the eventual site Second, whereas several viruses activate TLRs at the cell of signaling allows sorting adaptors to function as sensors of surface and endosomes (Barbalat et al., 2009; Georgel et al., activated TLRs and recruit downstream signaling adaptors 2007; Kurt-Jones et al., 2004), substrains of herpes simplex virus (e.g., MyD88) to induce inflammatory cytokine expression. (HSV) exist that only activate TLR9 (Sato et al., 2006). Thus, TLR9 Most plasma membrane-localized TLRs use the sorting adaptor provides a useful model for the study of both synthetic (CpG TIRAP (also known as Mal) to recruit MyD88 to the cell surface DNA) and natural (HSV) activators of endosomal TLRs. (Fitzgerald et al., 2001; Horng et al., 2002; Kagan and Medzhitov, Wild-type (WT) and TIRAP knockout (KO) primary bone- 2006; Yamamoto et al., 2002). The ability of TIRAP to function as marrow-derived macrophages (BMDMs) were stimulated with a sorting adaptor is dependent on its amino-terminal localization CpG DNA or three substrains of HSV-1 (Sato et al., 2006). The domain, which interacts with plasma membrane-localized phos- cell populations were then assessed for the expression of the phatidylinositol-4,5 bisphosphate (PI(4,5)P2) and other lipids cytokines interleukin-1b (IL-1b) and IL-6. As expected (Horng (Kagan and Medzhitov, 2006). The use of sorting adaptors et al., 2002; Yamamoto et al., 2002), TIRAP KO BMDMs had extends beyond the MyD88-dependent pathways because anal- no defect in responding to CpG DNA, whereas their response ogous systems exist in other immune signaling pathways in to bacterial lipopolysaccharide (LPS), a ligand for the cell- mammals and Drosophila melanogaster (Kagan, 2012a; Kagan surface TLR4, was impaired (Figure 1A). Interestingly, whereas et al., 2008; Marek and Kagan, 2012). all three substrains of HSV induced the expression of IL-1b Despite the apparent importance of sorting/signaling adaptor and IL-6 in WT BMDMs, TIRAP KO BMDMs were defective for pairs for controlling TLR signaling from the cell surface, a these responses (Figure 1B). Among the HSV substrains tested, sorting adaptor for the exclusively endosomal TLRs has not Kos A and Kos CE only engage TLR9, whereas Kos K engages been described. As such, it is unclear how MyD88-dependent both cell-surface TLR2 and endosomal TLR9 (Sato et al., innate immune responses are activated by endosomal TLRs. 2006). Our finding that TIRAP is required for cytokine expression TIRAP was initially excluded as a sorting adaptor for endoso- in response to HSV substrains that only engage TLR9 suggests mal TLRs because TIRAP-deficient cells retain the ability to that this adaptor plays a role in signaling from endosomal respond to synthetic TLR7 and TLR9 ligands (Horng et al., receptors. Interestingly, as was observed for ligands that acti- 2002; Yamamoto et al., 2002). However, these studies also vate cell-surface-localized TLRs (Horng et al., 2002), the require- demonstrated that the requirement of TIRAP for signaling ment for TIRAP in TLR9 signaling can be bypassed by increasing from cell-surface-localized TLRs can be bypassed when high the dose of a subset of HSV substrains (Figure S1A available concentrations of ligand are used. Primary macrophages and online, multiplicity of infection [moi] = 10). The requirement of DCs are highly endocytic. This property, combined with the TIRAP for antiviral responses was unique to the TLR pathway common use of phosphorothioate-linked (nuclease-resistant) because WT and TIRAP KO BMDMs expressed the interferon nucleic acids to activate endosomal TLRs, led us to hypothe- (IFN)-inducible gene viperin comparably when infected with size that these ligands could accumulate to high concentra- mammalian reovirus (Figure S1B), a known activator of the cyto- tions within endosomes, masking a requirement for TIRAP. In solic RIG-I-like receptors (Dixit et al., 2010). Collectively, these light of this hypothesis, we decided to reassess the role of data suggest an important role of TIRAP in the response to TIRAP in endosomal TLR signaling. natural (viral) activators of endosomal TLR9. Herein, we report that TIRAP is required for signaling down- To corroborate these findings, we sought an alternative cell stream of endosomal TLRs in response to natural ligands, such type to study the role of TIRAP. Plasmacytoid DCs (pDCs) are as viral nucleic acids. We show that TIRAP is present in an intriguing option because they exclusively utilize endosomal myddosomes induced by both cell-surface and endosomal TLRs to detect infections (Gilliet et al., 2008). As such, all of the TLRs and is required for myddosome formation. Furthermore, plasma membrane-localized TLRs that are established to we show that the ability of TIRAP to bind to multiple lipid require TIRAP are nonfunctional in these cells (Sato et al., species is critical for its ability to function from multiple sub- 2006). Moreover, in pDCs, endosomal TLRs exhibit an cellular compartments. These findings provide a molecular intriguing behavior in that they can induce cytokine and IFN explanation for the ability of MyD88 to be recruited to more production from different populations of endosomes, with than one organelle and highlight how a promiscuous lipid- IFN production occurring from endosomes rich in 30 phosphoi- binding domain can be used to diversify the subcellular sites nositides (PIs) (Sasai et al., 2010). We reasoned that if TIRAP of innate immune signal transduction. was not required for endosomal TLR signaling, as previously

706 Cell 156, 705–716, February 13, 2014 ª2014 Elsevier Inc. IL-1β Figure 1. TIRAP Is Required for Endosomal IL-1β WT A 2.5 B 0.06 WT TIRAP KO TLR Signaling in Response to Natural TIRAP KO 2.0 Ligands 0.04 1.5 (A and B) Primary WT or TIRAP KO BMDMs were 1.0 treated with 100 ng/ml LPS or 1 M CpG DNA (A) 0.02 m 0.5

Expression/GAPDH or infected with HSV (B) for 3 hr. Total mRNA was

0.0 Expression/GAPDH N.S. LPS CpG 0.00 extracted and analyzed for expression of IL-1b and Mock KosA KosK KosCE IL-6. Note that TIRAP KO BMDMs are defective in IL-6 IL-6 responding to natural ligands. N.S., cells that were 0.020 0.0008 not stimulated. 0.015 0.0006 (C) Microarray gene expression proﬁles from sorted 0.010 0.0004 cDCs and pDCs were analyzed for transcripts 0.005 associated with TLR signaling pathways. Values on

Expression/GAPDH 0.0002

0.000 Expression/GAPDH the x axis represent the fold difference in gene N.S. LPS CpG 0.0000 expression between mDCs and pDCs. Gray area Mock KosA KosK KosCE depicts equal gene expression in cDCs and pDCs. Note that TIRAP is expressed in pDCs comparably IFN-α C D to cDCs, despite the absence of cell-surface TLRs. WT 600 p< 0.05 p< 0.05 (D) pDCs from WT or TIRAP KO mice were pDC mDC TIRAP KO infected with HSV-2 (186 syn+) at an moi of 1 or 400 Tlr1 inﬂuenza (A/PR/8) at an moi of 10. Supernatants Tlr3 Tlr13

units/mL were collected after 24 hr and analyzed by ELISA. Tlr6 200 Irak4 Error bars represent SD. See also Figure S1. Tlr4 Tlr2 0 Irak3 HSV Flu Traf1 Traf5 Myd88 Tirap IL-12p40 Tlr8 Ticam1 pDCs, suggesting that TIRAP regulates Traf6 40 p<0.0001 Tlr5 Irak2 signaling from endosomes that were Traf3 30 Tlr9 previously defined as being rich for 30 Irak1 20 Tlr7 ng/mL PIs (Sasai et al., 2010). Another sorting Traf4 Tlr12 10 adaptor may exist to control TLR 200100 15 10 51 1 5 10 15 100 200 fold change 0 signaling to induce IL-12p40. Overall, HSV Flu these data establish that, in response to natural activators of innate immunity, TIRAP is required for signaling by endo- reported by Horng et al. (2002) and Yamamoto et al. (2002), somal TLRs in multiple cell types. Furthermore, the use of HSV then pDCs would have no need to express the gene encoding strains that only activate TLR9, and the use of pDCs that only this adaptor. To address this possibility, a comparison of gene permit signaling by endosomal TLRs, eliminates the possibility expression was performed between highly purified pDCs and of contaminating bacterial products (e.g., LPS) explaining conventional DCs (cDCs). This analysis revealed that pDCs ex- these observations. press much lower levels of the cell-surface TLRs 1, 2, 4, and 6 than cDCs (Figure 1C). This observation may (in part) explain Immortalized Macrophages Are a Model for the inability of pDCs to respond to ligands for plasma mem- Investigating Endosomal TLR Signaling brane-localized TLRs (Sato et al., 2006). pDCs expressed To define the means by which TIRAP regulates TLR signaling higher levels of some endosomal TLRs (TLR7 and TLR12) from multiple organelles, we sought a cell type that would be than their cDC counterparts. Interestingly, both cell types ex- easy to propagate and amenable to genetic manipulation. pressed comparable levels of TLR9, TIRAP, and MyD88 (Fig- Immortalized BMDMs (iBMDMs) have emerged as a useful ure 1C), suggesting that TIRAP may indeed have a function tool in this regard because they retain the signaling properties downstream of endosomal TLRs in pDCs. To address this pos- of their primary cell counterparts (Dixit et al., 2010; Halle et al., sibility, pDCs were infected with either HSV or influenza virus, 2008), and TIRAP KO iBMDMs have been used to dissect the natural activators of endosomal TLR9 and TLR7, respectively functions of this adaptor (Nagpal et al., 2009). Similar to our (Diebold et al., 2004; Lund et al., 2004). Infected cells were observations made in primary BMDMs, TIRAP was required then assessed for their ability to induce the expression of for iBMDMs to respond to several substrains of HSV, including IFNa or the cytokine IL-12p40. Because the expression of two that engage only TLR9 (Kos A and Kos CE) (Figure 2A) these cytokines is initiated from different populations of endo- (Sato et al., 2006). We found that iBMDMs are less phagocytic somes (Sasai et al., 2010), this experiment allows us to deter- than primary BMDMs (Figure 2B). This was expected because mine if a population of endosomes exists that selectively endocytosis and phagocytosis rates are higher in nonmitotic requires TIRAP function. In comparison to WT pDCs, TIRAP macrophages (e.g., primary BMDMs) than in dividing macro- KO pDCs were impaired in the ability to produce IFNa in phages (Berlin et al., 1978). We hypothesized that this lower response to HSV or influenza virus (Figure 1D). In contrast, phagocytic activity would prevent CpG DNA from building to the production of IL-12p40 was not impaired in TIRAP KO high concentrations within endosomes, perhaps revealing a

Cell 156, 705–716, February 13, 2014 ª2014 Elsevier Inc. 707 Figure 2. iBMDM Responses to CpG DNA A IL-1β IL-6 0.25 0.0006 Mimic Primary Cell Responses to Natural 0.20 Ligands 0.0004 0.15 (A) WT, TIRAP KO, or TIRAP-expressing TIRAP KO 0.0002 0.00015 iBMDMs were infected with indicated HSV strains 0.020 0.015 0.00010 (moi = 1) for 3 hr and analyzed by qPCR. Expression/GAPDH 0.010 Expression/GAPDH (B) Primary or iBMDMs were incubated with fluo- 0.00005 0.005 rescent beads at 37C for the indicated times, and 0.000 0.00000 Mock KosA KosK KosCE Mock KosA KosK KosCE phagocytosis was analyzed by flow cytometry. Mean fluorescence intensity was plotted relative to WT TIRAP KO TIRAP Rescue cells incubated with beads on ice for 45 min. IL-6 (C) WT or TIRAP KO primary and iBMDMs were B C stimulated with 1mM CpG DNA. After 24 hr, Primary WT 4000 2.0 supernatants were collected and analyzed for IL-6 3000 Immortal TIRAP KO 1.5 by ELISA. N.D., no signal was detected. 2000 (D) WT, TIRAP KO, or TIRAP-expressing TIRAP KO 1000 1.0 300 iBMDMs were treated with LPS or CpG DNA for Relative MFI ng/mL 200 0.5 3 hr and analyzed by qPCR. 100 Error bars represent SD. See also Figure S1. N.D. 0 0.0 5min 15min 45min Primary Immortal

D IL-1β IL-6 4 0.15 act at a later stage of infection or in a 0.12 3 different cell type to interfere with TLR 1.5 0.050 signaling. Overall, the observation that 1.0 0.025 the signaling defects of TIRAP KO cells 0.5 Expression/GAPDH Expression/GAPDH can be rescued by the expression of a 0.0 0.000 N.S. LPS CpG N.S. LPS CpG TIRAP cDNA provides formal genetic proof of its role in signal transduction WT TIRAP KO TIRAP Rescue activated by endosomal TLRs. iBMDMs therefore provide a genetically tractable model to study the role of TIRAP in requirement for TIRAP in responses to synthetic TLR9 ligands. signaling from endosomal TLRs through the use of natural Indeed, whereas WT iBMDMs responded to CpG DNA compa- and synthetic ligands. rably to primary WT BMDMs, TIRAP KO iBMDMs were completely unresponsive (Figure 2C). However, high doses of TIRAP Promotes the Assembly of Myddosomes at the CpG DNA partially overcame the requirement for TIRAP in Plasma Membrane and Endosomes these cells (Figure S1C). To determine whether TIRAP defi- Based on the experiments described above, it was possible ciency was responsible for the unresponsiveness of these cells that TIRAP acts to assemble myddosomes after activation of to TLR9 ligands, this adaptor was stably reintroduced into TLRs found at the plasma membrane and endosomes. The TIRAP KO iBMDMs via retroviral transduction. The retroviral crystal structure of the myddosome indicates that the adaptor vector used also encodes an internal ribosomal entry site MyD88 is a core component of this signaling complex (Lin upstream of EGFP, which allowed for the use of fluores- et al., 2010). However, the natural kinetics of myddosome cence-activated cell sorting (FACS) to isolate a population of assembly induced by TLR ligands remains undefined. To cells with uniform levels of expression (data not shown). assess myddosome assembly, iBMDMs were stimulated with Rescuing TIRAP expression in TIRAP KO iBMDMs restored LPS or CpG DNA, and endogenous MyD88 immunoprecipitates responsiveness to plasma membrane and endosomal-local- were subjected to western analysis for the presence of the other ized TLR ligands (Figure 2D). Furthermore, rescuing TIRAP known components of the myddosome, the kinases IRAK2 and expression enabled an enhanced response to all substrains IRAK4 (Lin et al., 2010; Motshwene et al., 2009). Within minutes of HSV examined (Figures 2A and S1D). Among the substrains of stimulating cells with either LPS or CpG DNA, both kinases examined is HSV-7134 (Figure S1D), which lacks the expres- were recruited to MyD88 (Figures 3A and 3B). Immunoprecipita- sion of ICP0 (van Lint et al., 2010). ICP0 is an immune evasion tions with IRAK2 antisera yielded comparable results, with protein that may interfere with TLR signaling by causing the MyD88 and IRAK4 being recruited to IRAK2 within minutes of degradation of TIRAP and/or MyD88 (van Lint et al., 2010). stimulation (Figure S2A). Consistent with prior work on the acti- To determine whether ICP0 is acting to prevent TLR signaling vation of MAP kinases and NF-kB(Horng et al., 2002; Schnare in our assays, side-by-side experiments were performed with et al., 2000), LPS induced maximal assembly of the myddo- HSV-7134 and an isogenic substrain whose expression of some more rapidly than CpG DNA (Figures 3A and 3B). ICP0 was restored (7134R). We observed no difference in the Because the myddosome is not detected in resting cells, its ability of these strains to induce TIRAP-dependent cytokine assembly can be used to monitor the earliest cytosolic events expression (Figure S1D). These data suggest that ICP0 may that occur during TLR signaling.

708 Cell 156, 705–716, February 13, 2014 ª2014 Elsevier Inc. A LPS (min) N.S. 10 30 60 B CpG (min) N.S. 30 60 120 Figure 3. TIRAP Is a Critical Constituent of the Myddosome anti-IRAK2 (A and B) WT iBMDMs were stimulated with LPS (A) anti-IRAK4 or CpG DNA (B) for the indicated times. MyD88 was IP: MyD88 IP: MyD88 anti-IRAK4 immunoprecipitated (IP) from lysates and analyzed anti-MyD88 anti-MyD88 by western blot. anti-MyD88 (C and D) TIRAP-transgenic iBMDMs were stimu- anti-MyD88 Inputs lated with LPS (C) or CpG DNA (D), and biotin- anti-Actin Inputs TIRAP was precipitated from cleared lysates with anti-Actin avidin-coated agarose before western analysis. (E) WT, TIRAP KO, or TIRAP-expressing TIRAP KO C D iBMDMs were treated with LPS for 1 hr or CpG DNA LPS (min) N.S. 10 30 60 CpG (min) N.S. 30 60 120 for 2 hr and analyzed as in (A). N.S., cells that were anti-IRAK4 anti-IRAK4 not stimulated. See also Figure S2. anti-MyD88 anti-MyD88 PD: Avidin PD: Avidin anti-HA anti-HA anti-MyD88 Inputs the question of how a plasma membrane- anti-MyD88 anti-HA Inputs localized adaptor can function from endo- anti-HA somes. The localization of TIRAP is strictly dependent on an amino-terminal lipid- binding domain that interacts with acidic N.S. LPS N.S. CpG PIs and phosphatidylserine (PS) (Kagan E and Medzhitov, 2006). To conﬁrm these TIRAP KO WT KO WT TIRAP WT KO WT KO TIRAP TIRAP observations, the ability of TIRAP to bind lipids was assessed by PIP-strip analysis, anti-IRAK4 which permits the identiﬁcation of several IP: MyD88 possible protein-lipid interactions in a anti-MyD88 single experiment. Glutathione S-trans-

anti-MyD88 ferase (GST)-TIRAP interacted with all Inputs phosphorylated PIs and PS (Figure 4A). anti-Actin As a control for specificity of these interactions, we used a mutant that is defective for lipid binding in vitro and localization in vivo (TIRAP 4X) (Kagan and Medzhitov, To determine whether TIRAP is a component of LPS or CpG 2006). This mutant TIRAP allele did not bind to any lipids in this DNA-induced myddosomes, we utilized the transgenic TIRAP analysis (Figure 4A). Among the lipids TIRAP interacts with, KO cells described above. The TIRAP allele expressed in these PI(4,5)P2 is considered solely important for its function in con- cells contains a biotinylation sequence and an HA epitope tag trolling signaling by plasma membrane-localized TLRs (Aksoy to facilitate biochemical analysis. LPS and CpG DNA-induced et al., 2012; Kagan and Medzhitov, 2006). In this regard, TIRAP myddosomes containing IRAK4 and MyD88 could be detected is similar to many other lipid-binding proteins in that its ability by direct isolation of biotinylated TIRAP through the use avidin- to bind PIs promiscuously is not considered functionally signifi- coated beads (Figures 3C and 3D). Moreover, TIRAP could be cant (Kavran et al., 1998). recruited to MyD88 immunoprecipitates in LPS-treated cells Because some of the lipids that TIRAP interacts with are (Figure S2B). These data indicate that TIRAP is a stable compo- enriched on endosomes (e.g., PI(3)P and PI(3,5)P2) (De Matteis nent of the myddosomes induced by either TLR4 or TLR9. and Godi, 2004), we considered the possibility that a pool of To determine whether TIRAP was required for myddosome TIRAP would be located on endosomes. This possibility was formation, TIRAP KO iBMDMs were examined. Myddosome for- addressed by examining the localization of the lipid-binding mation in response to both LPS and CpG DNA was impaired in domain of TIRAP in primary BMDMs. We transfected these cells TIRAP KO cells but rescued in TIRAP KO cells expressing the with plasmids encoding the GFP-tagged lipid-binding domain of TIRAP transgene (Figure 3E). These data establish that TIRAP TIRAP (TIRAP-loc) along with a plasmid encoding a cherry- controls the assembly of (and is a component of) myddosomes tagged pleckstrin homology (PH) domain from PLCd1 (PLC), formed in multiple subcellular compartments. which binds to PI(4,5)P2 uniquely (Botelho et al., 2000). We reasoned that, if TIRAP binds only to PI(4,5)P2 within cells, Promiscuous Lipid Binding Diversifies the Subcellular then the subcellular distribution of these two proteins should Sites of TIRAP Residence be identical. However, if TIRAP binds to more lipids than TIRAP is a peripheral membrane protein that is enriched at the PI(4,5)P2, then the distributions of these proteins should be over- cell surface (Kagan and Medzhitov, 2006). Our discovery that lapping but distinct. Confocal microscopy revealed that both TIRAP regulates TLR signaling from endosomes therefore raises proteins colocalized extensively at the plasma membrane, which

Cell 156, 705–716, February 13, 2014 ª2014 Elsevier Inc. 709 Figure 4. Promiscuous Lipid Binding Diversiﬁes the Localization of TIRAP (A) GST-tagged TIRAP or TIRAP 4X proteins were incubated with PIP strips containing various lipids (shown in left panel) and assessed for protein binding by far western analysis. (B) TIRAP KO primary BMDMs expressing TIRAP loc-GFP and PLC-cherry were analyzed by confocal microscopy. All images are representative of at least three independent experiments where more than 200 cells were examined per condition and >95% of the cells displayed similar staining. Selective localization of TIRAP to intracellular vesicles compared to the PLCd1 PH domain demonstrates that TIRAP binds to multiple lipids. (C) TIRAP KO primary BMDMs expressing TIRAP loc-GFP were analyzed by confocal microscopy. One image was captured every 20 s for 20 min. (C) Shows representative frames from one such capture (see Movie S1 for full-length movie). See also Movie S1.

710 Cell 156, 705–716, February 13, 2014 ª2014 Elsevier Inc. is an abundant site of PI(4,5)P2 (Botelho et al., 2000). Interest- tion of the function of PX-TIRAP yielded the opposite results. ingly, TIRAP’s lipid-binding domain also labeled intracellular TIRAP KO cells expressing PX-TIRAP (localized to endosomes vesicles that were devoid of the PLCd1 PH domain (Figure 4B, via PI(3)P) responded robustly to CpG DNA but did not respond inset), suggesting that TIRAP binds additional lipid targets inside to LPS (Figure 5B). Similar results were obtained with the PS- cells, as it does in vitro. binding SLP2a-TIRAP allele (Figure 5B). To determine whether the intracellular TIRAP-positive com- The localization of TIRAP was also critical for myddosome partments were endosomes, live time-lapse microscopy was formation. Consistent with Figure 3E, TIRAP KO cells reconsti- performed in primary BMDMs expressing the GFP-tagged tuted with WT TIRAP formed myddosomes in response to both lipid-binding domain of TIRAP. Primary BMDMs were highly LPS and CpG DNA (Figure 5C). By contrast, PLC-TIRAP was active and exhibited extensive ruffling of the plasma membrane able to rescue myddosome formation solely in response to (Movie S1). Numerous TIRAP-positive vesicles were formed at LPS, whereas PX-TIRAP and SLP2a-TIRAP were able to rescue these sites of membrane ruffling, and these vesicles accumu- myddosome formation in response to CpG DNA, but not LPS lated Alexa-647-labeled dextrans that were added to the culture (Figure 5C). Overall, these data establish that distinct targets of media shortly after imaging began (Figure 4C; Movie S1). These the promiscuous TIRAP lipid-binding domain are functional data indicate that the lipid-binding domain of TIRAP is capable of and allow this adaptor to promote TLR signaling from more localizing to the plasma membrane and bona fide endosomes. than one site in the cell. Promiscuous lipid binding by TIRAP may therefore be important for its ability to function as a sorting adaptor for TLRs located at DISCUSSION the cell surface and endosomes. It has become clear in recent years that TLRs can induce signal Distinct Lipid Targets of the TIRAP Localization Domain transduction from diverse locations in the cell, with the cell sur- Permit TLR Signaling from the Plasma Membrane and face and endosomal membranes being the best-defined sites Endosomes (Kagan, 2012b). However, the question remained as to how To determine the function of the individual lipids with which this diversification of receptor locale can be accommodated TIRAP interacts, the lipid-binding domain of TIRAP was replaced with the common need to activate MyD88-dependent signaling. with domains of singular specificity (Figure 5A, top). We replaced Our finding that TIRAP can function as a sorting adaptor for the endogenous lipid-binding domain of TIRAP with the PLCd1 MyD88 at the cell surface and endosomes provides a molecular PH domain described above, which binds exclusively to PI(4,5) explanation to this question and fills an important gap in our P2 (hereafter referred to as PLC-TIRAP). By a similar strategy, knowledge of how diverse subcellular compartments can sup- a PI(3)P-specific TIRAP allele was generated called PX-TIRAP. port TLR signaling. This adaptor has the localization domain of p40-phox, which Several lines of evidence indicate that TIRAP can function from binds exclusively to PI(3)P on endosomes (Kagan and Medzhi- endosomes. First, TIRAP KO primary and immortal BMDMs are tov, 2006; Sato et al., 2001). PX-TIRAP was of particular interest defective for TLR signaling in response to HSV infection. This because of our finding that TIRAP preferentially regulates IFNa finding is in contrast to results obtained with nondegradable expression induced by TLR7 and TLR9 (Figure 1D), which occurs nucleic acids containing phosphorothioate linkages, which from endosomes containing 30 PIs in pDCs (Sasai et al., 2010). bypass the need for TIRAP in primary BMDMs. These data high- Finally, SLP2a-TIRAP was generated, which binds PS, a general light the utility of natural activators of innate immunity to dissect component of the cell surface and endosomal membranes (Kur- TLR signal transduction pathways. Second, TIRAP is expressed oda and Fukuda, 2004). These constructs were fused to GFP, in cells that do not express plasma membrane-localized TLRs stably transduced into TIRAP KO iBMDMs, and subjected to (pDCs), and TIRAP KO pDCs are defective for IFN responses FACS to isolate clones of comparable expression levels. The induced by TLR7 or TLR9. Because plasma membrane-localized resulting cell populations were examined by confocal micro- TLRs are not functional in pDCs, these data eliminate any possibil- scopy, which verified their expected localization (Figure 5A, ity that contaminating TLR2 or TLR4 ligands can explain our find- bottom). PLC-TIRAP was detected primarily at the cell surface, ings. Third, TIRAP is a component of myddosomes induced by PX-TIRAP was enriched on intracellular vesicles previously iden- TLR4 and TLR9 and is required for their formation. Collectively, tified as endosomes (Kagan and Medzhitov, 2006), and SLP2a- using multiple activators, assays, and cell types, these data estab- TIRAP was detected at the cell surface and endosomes. lish that TIRAP has a widespread role in controlling TLR signal This set of stable macrophage lines was stimulated with LPS transduction in response to bacteria and viruses (Figure 5D). or CpG DNA to determine which lipids were important for TLR We do note, however, that not all MyD88-dependent re- signal transduction. As expected, TIRAP KO cells expressing sponses are mediated by TIRAP. In addition to the MyD88- WT TIRAP regained the ability to permit TLR4 signaling from dependent signaling pathways activated by the IL-1 receptor the cell surface and TLR9 signaling from endosomes (Figure 5B). (IL-1R) family (Horng et al., 2002; Yamamoto et al., 2002), we The cell-surface-exclusive PLC-TIRAP restored responsiveness found that TLR7/TLR9-induced IL-12p40 expression in pDCs to the TLR4 ligand LPS, but interestingly, this allele did not was TIRAP independent. This finding is in contrast to TLR7/ restore TLR9 signaling in response to CpG DNA (Figure 5B). TLR9-induced IFNa expression in the same cells. Thus, like These data indicate that whereas PI(4,5)P2 binding by TIRAP is TLR4 (Kagan, 2012a), at least some endosomal TLRs may sufficient for signaling from the plasma membrane, it is not engage distinct sorting adaptors to induce compartment- sufficient for signaling from endosomes. Remarkably, examina- specific cellular responses. The sorting adaptor(s) that mediates

Cell 156, 705–716, February 13, 2014 ª2014 Elsevier Inc. 711 AB

Figure 5. Promiscuous Lipid Binding by TIRAP Diversiﬁes the Sites of TLR Signaling (A) Confocal microscopic analysis of TIRAP KO iBMDMs stably transduced with GFP-tagged TIRAP alleles that contain different lipid-binding domains (depicted in the top panel). The micrographs demonstrate selective localization of TIRAP dependent on its lipid-binding domain. All images are representative of at least three independent experiments where over 200 cells were examined per condition and >95% of the cells displayed similar staining. (B) Cells from (A) were stimulated with LPS or CpG DNA and analyzed by qPCR. Note that selective binding of TIRAP to distinct lipids permits signaling from distinct compartments. (C) Cells from (A) were stimulated with LPS or CpG DNA for 1 hr, and myddosome formation was assessed. (D) Model depicting how the promiscuous lipid-binding domain of TIRAP promotes signal transduction from the plasma membrane and endosomes. TLRs found at the cell surface signal from a PI(4,5)P2-rich subdomain, and TIRAP is recruited to that location via interactions with PI(4,5)P2. TLRs found on endosomes signal from a domain rich in 30 PIs (depicted is PI(3)P). These lipids direct TIRAP to endosomes to promote TLR signaling. Error bars represent SD.

712 Cell 156, 705–716, February 13, 2014 ª2014 Elsevier Inc. MyD88 recruitment to these TIRAP-independent receptors in the antiviral RIG-I like receptor signaling pathway (Seth remains unknown. An alternative explanation for these observa- et al., 2005). Both MAVS and TIRAP can be considered sorting tions is that endosomes that induce IL-12p40 expression may adaptors, in that they define the subcellular sites of signal trans- contain higher concentrations of TLR ligands than IFN-inducing duction induced by their respective upstream receptors. Like endosomes, rending some signaling pathways more dependent TIRAP, MAVS is located on several organelles in the cell, all of on TIRAP than others. Although it is formally possible that some which are important for antiviral signal transduction (Dixit et al., TLRs simply recruit MyD88 to their cytosolic TIR domains 2010; Horner et al., 2011; Seth et al., 2005). Thus, a common directly (bypassing the need for a sorting adaptor), the increasing theme appears to be emerging whereby the sites of innate incidence of sorting adaptor dependence for MyD88 recruitment immune signal transduction can be diversified simply by altering makes this possibility unlikely. the subcellular sites of sorting adaptor residence. TIRAP is one of numerous PI-binding proteins that can bind to In summary, we have revealed a means by which a promiscu- multiple lipids (Kavran et al., 1998). This promiscuity of lipid bind- ous lipid-binding protein can be used in nature. We suggest that ing has been a point of inquiry because we and others have the sorting adaptor TIRAP evolved specifically to survey multiple suggested that PI(4,5)P2 is mainly responsible for controlling organelles for the presence of activated TLRs. In this context, the its localization and function (Aksoy et al., 2012; Kagan and Medz- promiscuity of lipid binding by TIRAP provides a molecular hitov, 2006). Our finding that a PI(4,5)P2-specific allele of TIRAP explanation for how the subcellular sites of TLR signal transduc- is sufficient to support TLR4 signaling is consistent with this idea. tion are so diverse. Our work also demonstrates a means by However, PI(4,5)P2-specific alleles of TIRAP cannot support which functional diversity can be achieved at the level of a single TLR9 signaling. These observations argue strongly that the role protein because TIRAP can now be considered to function in of TIRAP in TLR signaling from endosomes involves interactions bacterial detection at the plasma membrane and virus detection with lipids other than PI(4,5)P2. Our functional analysis of TIRAP in endosomes. These studies therefore highlight how pro- alleles that bind to single lipids revealed that PI(3)P and PS are miscuity, rather than specificity, can be beneficial in biological sufficient to support TLR9 signaling. From these data, it systems, and provide a mandate to examine the function of other becomes clear that multiple targets of the lipid-binding domain promiscuous lipid-binding proteins in the innate immune system, of TIRAP are functionally important. and beyond. The analysis of TIRAP alleles that bind single lipids was also informative in considering the precise subcellular sites of TLR EXPERIMENTAL PROCEDURES signaling. We found that PI(4,5)P2-specific and PS-specific alleles of TIRAP are localized to the plasma membrane, but Cell Culture, Stable Transductions, and Microscopy All experiments with mice were performed with oversight by the appropriate only PI(4,5)P2 specificity confers LPS responsiveness. Because institutional review board to conform with approved animal protocols. WT the PS-specific TIRAP allele is functional when the correct stim- (C57B/6) and TIRAP KO iBMDMs were a gift from D. Golenbock (University ulus is applied to the cells (CpG DNA), these data cannot be ex- of Massachusetts) and were cultured in complete DMEM (GIBCO) containing plained by this protein being misfolded or poorly expressed. 10% FBS and 5% L929 conditioned supernatant. Primary BMDMs from WT Rather, these findings may highlight the precise requirement (C57B/6) or TIRAP KO mice (Jax 017629) were prepared as described (Kagan for TIRAP to be present in a region of the cell surface that is and Medzhitov, 2006). Cells were stimulated with LPS (Invitrogen) at 100 ng/ml or phosphorothioate-linked CpG DNA (TCCATGACGTTCCTGACGTT; MWG devoid of PS (or at least enriched for PI(4,5)P2). This suggestion Operon) at 1 mM, unless otherwise indicated. is consistent with prior work demonstrating that localization of TIRAP alleles were introduced into TIRAP KO iBMDMs by retroviral trans- TIRAP to the plasma membrane is not sufficient for TLR4 duction and subjected to FACS to normalize GFP expression. When biotin- signaling (Kagan and Medzhitov, 2006); TIRAP must be localized based myddosome isolations were performed, TIRAP alleles were introduced to PI(4,5)P2-rich regions specifically. Likewise, our analysis of in iBMDMs stably expressing the biotin ligase BirA. Where indicated, cells TLR9 signaling highlights the importance of TIRAP localization were fixed with 2% paraformaldehyde and stained with anti-GFP (Clontech) to endosomes containing PS, the 3 PI PI(3)P, and probably according to manufacturer’s instructions. Antibody staining was detected 0 with the secondary antibody labeled with Alexa Fluor 488 and analyzed by PI(3,5)P2 (Sasai et al., 2010). These observations are of note confocal microscopy. when considering that the various membrane-bound organelles Primary BMDMs were transfected by nucleofection using mouse macro- in mammalian cells have been proposed to consist of a PI code phage transfection reagent (Lonza VPA-1009) according to manufacturer’s (Kutateladze, 2010). This PI code is ‘‘read’’ by various lipid-bind- instructions. Cells were imaged 4 hr later by confocal microscopy. Where indi- ing proteins to assemble different protein structures on different cated, dextran-Alexa Fluor 647 (Life Technologies) was used at 10 mg/ml. membranes, effectively allowing the PI code to determine (in Flt3 Ligand-Induced Bone-Marrow-Derived pDC Culture part) the activities of each organelle (Kutateladze, 2010). Our Bone marrow cells were isolated and cultured for 7 days in RPMI supple- analysis of this PI code, through the use of TIRAP alleles that mented with 10% FBS, 50 U/ml penicillin, 50 mg/ml streptomycin, 10 mM bind to single lipids, provides a functional means to identify the HEPES (Invitrogen), 2-mercaptoethanol (Sigma-Aldrich), and 100 ng/ml Flt3 precise subcellular sites of TLR signal transduction. We suggest ligand (GEMINI). On day 8, cells in the supernatant were harvested, counted, that a comprehensive map of the sites of innate immune signal and plated for subsequent experiments. transduction can be created by further study of the link between Viral Infections the PI code and sorting adaptor localization. KOS A, KOS CE, and KOS K (Sato et al., 2006) viruses were propagated and From a broader perspective, this function for TIRAP in control- titered on Vero cells as described (Knipe and Spang, 1982). The ICP0 null ling TLR signaling from multiple organelles is reminiscent of the (7134) and restored (7134R) virus was grown and titered on U2OS cells (Cai activities of the protein MAVS, the receptor-proximal adaptor and Schaffer, 1989). Virus was diluted in PBS containing 0.1% (w/v) glucose

Cell 156, 705–716, February 13, 2014 ª2014 Elsevier Inc. 713 and 1% (v/v) heat-inactivated FBS. Cells were infected at the moi indicated for by overlap extension PCR. The biotin ligase BirA (Mechold et al., 2005) was

1 hr at 37C, washed twice with PBS, and overlaid with DMEM containing 1% subcloned into pMSCV2.2 by standard procedures. WT TIRAP-GFP, PLC- (v/v) heat-inactivated FBS. Infected cells were incubated at 37C for the TIRAP-GFP, and PX-TIRAP-GFP were described previously (Kagan and indicated length of time. A total of 2 3 106/well pDCs were stimulated with Medzhitov, 2006) and are present in the retroviral vector MSCV202 IRES- either 2 3 106 pfu (plaque-forming unit) of HSV-2 (186 syn+) or 2 3 107 pfu hCD2. pEGFP-N1-based TIRAP loc-GFP (amino acids 1–85 of TIRAP fused of Influenza A/PR/8 for 24 hr. Supernatant was then harvested, and ELISA in frame to GFP) was described previously (Kagan and Medzhitov, 2006). was performed to measure IFNa and IL-12p40. BMDMs were infected with SLP2a-TIRAP-GFP was cloned similarly to the TIRAP alleles described above. the type 3 Dearing strain of reovirus at moi 10, 100, or 1,000 for 3 hr and Briefly, the C2A domain of murine SLP2a was cloned from a murine spleen analyzed by quantitative PCR (qPCR) as described below. cDNA library and fused in frame to amino acid 86 of TIRAP-GFP. This SLP2a-TIRAP-GFP fusion cDNA was then subcloned into the retroviral vector Microarray Sample Generation, Data Acquisition, and Processing MSCV2.2 IRES-hCD2. mCherry-PH was purchased from Addgene (plasmid pDC and cDC samples for microarrays were generated as described by 36075). / Iparraguirre et al. (2008). In brief, DPE-GFP 3 RAG1À À transgenic mice (Mempel et al., 2006; Mrass et al., 2006), in which pDCs are identified by GFP expression (Iparraguirre et al., 2008), were injected with Flt 3 ligand- ACCESSION NUMBERS expressing B16F10 tumor cells for expansion of DC subsets. At 12–14 days later, spleens were harvested and stained for CD11b and CD11c. pDCs and The Gene Expression Omnibus (GEO) accession number for the microarray cDCs were sorted using a MoFlo cell sorter (DakoCytomation) based on data reported in this paper is GSE50436. high GFP expression and a CD11chiCD11bhi phenotype, respectively. Sam- ples were prepared in two independent experiments. Total RNA, isolated SUPPLEMENTAL INFORMATION with the RNeasy kit (QIAGEN), was processed, amplified, labeled, and hybrid- ized to mouse MOE430v2 GeneChip microarrays (Affymetrix) by the University Supplemental Information includes two figures and one movie and can be of Pennsylvania Microarray Core Facility using standard protocols. Data were found with this article online at http://dx.doi.org/10.1016/j.cell.2014.01.019. processed using Affymetrix GeneChip Operating System v.1.4 software, and probe intensity files (.cel files) were imported and analyzed in Partek Genomics

Suite (v.6.6, Partek). Data were log2 transformed and normalized with GC ACKNOWLEDGMENTS Robust Multi-array Averaging (GCRMA). Significance Analysis of Microarrays ([SAM] samr v.2.0; Stanford University) (Tusher et al., 2001) was applied to We thank the members of the Kagan Lab for helpful discussions and Dr. John identify differentially expressed genes in mature DCs (mDCs) and pDCs. The W. Tobias (University of Pennsylvania Bioinformatics Core) for his contribution most significant probe set for each gene of interest was used to calculate to the microarray data analysis. K.S.B. holds a fellowship from the National fold changes (in Partek) between gene expression levels in mDCs versus Science Foundation. NIH grants AI093589, AI072955, and P30DK34854 and pDCs that were graphed using Prism software (v.5.0c; GraphPad Software). an unrestricted gift from Mead Johnson & Company support the work performed in the lab of J.C.K. J.C.K. is also supported by the Bill and Melinda Phagocytosis Assay Gates Foundation (OPP1066203). A.I. is supported by NIH grant AI064705, A total of 5 3 105 cells were kept on ice in 500 ml of complete media (described and D.M.K. is supported by NIH grant AI063106. W.W. is supported by a above) and incubated with Fluoresbrite Carboxy YG 2.0 mm beads fellowship from the Cancer Institute New South Wales and NHMRC grant (PolySciences) at ten beads/cell. Cells were added to a 37C water bath for APP1010680. J.C.K. holds an Investigators in the Pathogenesis of Infectious indicated times. Phagocytosis was stopped with ice-cold PBS. Cells were Disease Award from the Burroughs Wellcome Fund. washed 33 with ice-cold PBS and analyzed by FACS. Received: September 2, 2013 Myddosome Isolation Assay Revised: December 4, 2013 Cells were plated on 10 cm tissue culture-treated dishes and grown to conflu- Accepted: January 9, 2014 ency (107 cells/plate overnight). Cells were stimulated with ligand as indicated, Published: February 13, 2014 then lysed in 700 ml of buffer containing 1% NP-40, 50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 10% glycerol, and protease/phosphatase inhibitors (Roche). REFERENCES A total of 100 ml of cleared lysate was retained for analysis (input), and the remaining 600 ml was incubated overnight at 4 C with 1 mg anti-MyD88 (R&D Akira, S., Uematsu, S., and Takeuchi, O. (2006). Pathogen recognition and LifeSciences) or anti-iRAK2 (ProSci). The following day, 50 ml of protein G innate immunity. Cell 124, 783–801. Sepharose (GE Healthcare) was added for 1 hr. Alternatively, cleared lysates were incubated with NeutrAvidin agarose beads (Thermo Scientific) for 2 hr. Aksoy, E., Taboubi, S., Torres, D., Delbauve, S., Hachani, A., Whitehead, M.A., Beads were washed 33 with lysis buffer, then proteins were extracted by Pearce, W.P., Berenjeno, I.M., Nock, G., Filloux, A., et al. (2012). The p110d adding 50 ml 2x Laemmli buffer, electrophoresed, and immunoblotted with isoform of the kinase PI(3)K controls the subcellular compartmentalization the indicated antibodies using standard conditions. The following antibodies of TLR4 signaling and protects from endotoxic shock. Nat. Immunol. 13, were used: anti-MyD88 (R&D LifeSciences), anti-iRAK2 (ProSci), anti-HA 1045–1054. (3F10; Roche), anti-GFP (JL-8; Clontech), and anti-actin (ac-15; Sigma- Baeuerle, P.A., and Baltimore, D. (1988). Activation of DNA-binding activity in Aldrich). Anti-iRAK4 was kindly provided by Shizuo Akira. an apparently cytoplasmic precursor of the NF-kappa B transcription factor. Cell 53, 211–217. Real-Time qPCR Barbalat, R., Lau, L., Locksley, R.M., and Barton, G.M. (2009). Toll-like recep- Total RNA was extracted from 2 3 106 cells using RNA-Bee (Tel-Test) accord- tor 2 on inflammatory monocytes induces type I interferon in response to viral ing to manufacturer’s instructions and analyzed with TaqMan one-step qPCR but not bacterial ligands. Nat. Immunol. 10, 1200–1207. reagents. Expression was plotted relative to GAPDH, shown as mean and SD of three technical replicates. All qPCR graphs in this study are representative of Barbalat, R., Ewald, S.E., Mouchess, M.L., and Barton, G.M. (2011). Nucleic at least three independent experiments. acid recognition by the innate immune system. Annu. Rev. Immunol. 29, 185–214. Plasmids Barton, G.M., and Kagan, J.C. (2009). A cell biological view of Toll-like receptor TIRAP-TAP IRES GFP was produced as follows. Human TIRAP was appended function: regulation through compartmentalization. Nat. Rev. Immunol. 9, with triple HA and a BirA target site (de Boer et al., 2003; Mechold et al., 2005) 535–542.

714 Cell 156, 705–716, February 13, 2014 ª2014 Elsevier Inc. Berlin, R.D., Oliver, J.M., and Walter, R.J. (1978). Surface functions during (2008). Two distinct activation states of plasmacytoid dendritic cells induced Mitosis I: phagocytosis, pinocytosis and mobility of surface-bound Con A. by influenza virus and CpG 1826 oligonucleotide. J. Leukoc. Biol. 83, 610–620. Cell 15, 327–341. Kagan, J.C. (2012a). Defining the subcellular sites of innate immune signal Blobel, G., and Dobberstein, B. (1975a). Transfer of proteins across mem- transduction. Trends Immunol. 33, 442–448. branes. I. Presence of proteolytically processed and unprocessed nascent Kagan, J.C. (2012b). Signaling organelles of the innate immune system. Cell immunoglobulin light chains on membrane-bound ribosomes of murine 151, 1168–1178. myeloma. J. Cell Biol. 67, 835–851. Kagan, J.C., and Medzhitov, R. (2006). Phosphoinositide-mediated adaptor Blobel, G., and Dobberstein, B. (1975b). Transfer of proteins across mem- recruitment controls Toll-like receptor signaling. Cell 125, 943–955. branes. II. Reconstitution of functional rough microsomes from heterologous Kagan, J.C., Su, T., Horng, T., Chow, A., Akira, S., and Medzhitov, R. (2008). components. J. Cell Biol. 67, 852–862. TRAM couples endocytosis of Toll-like receptor 4 to the induction of Botelho, R.J., Teruel, M., Dierckman, R., Anderson, R., Wells, A., York, J.D., interferon-beta. Nat. Immunol. 9, 361–368. Meyer, T., and Grinstein, S. (2000). Localized biphasic changes in phosphati- Kavran, J.M., Klein, D.E., Lee, A., Falasca, M., Isakoff, S.J., Skolnik, E.Y., and dylinositol-4,5-bisphosphate at sites of phagocytosis. J. Cell Biol. 151, 1353– Lemmon, M.A. (1998). Specificity and promiscuity in phosphoinositide binding 1368. by pleckstrin homology domains. J. Biol. Chem. 273, 30497–30508. Brown, V., Brown, R.A., Ozinsky, A., Hesselberth, J.R., and Fields, S. (2006). Knipe, D.M., and Spang, A.E. (1982). Definition of a series of stages in the Binding specificity of Toll-like receptor cytoplasmic domains. Eur. J. Immunol. association of two herpesviral proteins with the cell nucleus. J. Virol. 43, 36, 742–753. 314–324. Cai, W.Z., and Schaffer, P.A. (1989). Herpes simplex virus type 1 ICP0 plays a Kuroda, T.S., and Fukuda, M. (2004). Rab27A-binding protein Slp2-a is critical role in the de novo synthesis of infectious virus following transfection of required for peripheral melanosome distribution and elongated cell shape in viral DNA. J. Virol. 63, 4579–4589. melanocytes. Nat. Cell Biol. 6, 1195–1203. de Boer, E., Rodriguez, P., Bonte, E., Krijgsveld, J., Katsantoni, E., Heck, A., Kurt-Jones, E.A., Chan, M., Zhou, S., Wang, J., Reed, G., Bronson, R., Arnold, Grosveld, F., and Strouboulis, J. (2003). Efficient biotinylation and single- M.M., Knipe, D.M., and Finberg, R.W. (2004). Herpes simplex virus 1 interac- step purification of tagged transcription factors in mammalian cells and tion with Toll-like receptor 2 contributes to lethal encephalitis. Proc. Natl. transgenic mice. Proc. Natl. Acad. Sci. USA 100, 7480–7485. Acad. Sci. USA 101, 1315–1320. De Matteis, M.A., and Godi, A. (2004). PI-loting membrane traffic. Nat. Cell Kutateladze, T.G. (2010). Translation of the phosphoinositide code by PI effec- Biol. 6, 487–492. tors. Nat. Chem. Biol. 6, 507–513. Diebold, S.S., Kaisho, T., Hemmi, H., Akira, S., and Reis e Sousa, C. (2004). Lin, S.C., Lo, Y.C., and Wu, H. (2010). Helical assembly in the MyD88-IRAK4- Innate antiviral responses by means of TLR7-mediated recognition of single- IRAK2 complex in TLR/IL-1R signalling. Nature 465, 885–890. stranded RNA. Science 303, 1529–1531. Lund, J.M., Alexopoulou, L., Sato, A., Karow, M., Adams, N.C., Gale, N.W., Dixit, E., Boulant, S., Zhang, Y., Lee, A.S., Odendall, C., Shum, B., Hacohen, Iwasaki, A., and Flavell, R.A. (2004). Recognition of single-stranded RNA N., Chen, Z.J., Whelan, S.P., Fransen, M., et al. (2010). Peroxisomes are viruses by Toll-like receptor 7. Proc. Natl. Acad. Sci. USA 101, 5598–5603. signaling platforms for antiviral innate immunity. Cell 141, 668–681. Marek, L.R., and Kagan, J.C. (2012). Phosphoinositide binding by the Toll Fitzgerald, K.A., Palsson-McDermott, E.M., Bowie, A.G., Jefferies, C.A., adaptor dMyD88 controls antibacterial responses in Drosophila. Immunity Mansell, A.S., Brady, G., Brint, E., Dunne, A., Gray, P., Harte, M.T., et al. 36, 612–622. (2001). Mal (MyD88-adapter-like) is required for Toll-like receptor-4 signal Mechold, U., Gilbert, C., and Ogryzko, V. (2005). Codon optimization of the transduction. Nature 413, 78–83. BirA enzyme gene leads to higher expression and an improved efficiency of Gay, N.J., Gangloff, M., and O’Neill, L.A. (2011). What the Myddosome biotinylation of target proteins in mammalian cells. J. Biotechnol. 116, structure tells us about the initiation of innate immunity. Trends Immunol. 32, 245–249. 104–109. Medzhitov, R., and Horng, T. (2009). Transcriptional control of the inflamma- Georgel, P., Jiang, Z., Kunz, S., Janssen, E., Mols, J., Hoebe, K., Bahram, S., tory response. Nat. Rev. Immunol. 9, 692–703. Oldstone, M.B., and Beutler, B. (2007). Vesicular stomatitis virus glycoprotein Mempel, T.R., Pittet, M.J., Khazaie, K., Weninger, W., Weissleder, R., von G activates a specific antiviral Toll-like receptor 4-dependent pathway. Boehmer, H., and von Andrian, U.H. (2006). Regulatory T cells reversibly sup- Virology 362, 304–313. press cytotoxic T cell function independent of effector differentiation. Immunity Gilliet, M., Cao, W., and Liu, Y.J. (2008). Plasmacytoid dendritic cells: sensing 25, 129–141. nucleic acids in viral infection and autoimmune diseases. Nat. Rev. Immunol. 8, Motshwene, P.G., Moncrieffe, M.C., Grossmann, J.G., Kao, C., Ayaluru, M., 594–606. Sandercock, A.M., Robinson, C.V., Latz, E., and Gay, N.J. (2009). An oligo- Halle, A., Hornung, V., Petzold, G.C., Stewart, C.R., Monks, B.G., Reinheckel, meric signaling platform formed by the Toll-like receptor signal transducers T., Fitzgerald, K.A., Latz, E., Moore, K.J., and Golenbock, D.T. (2008). The MyD88 and IRAK-4. J. Biol. Chem. 284, 25404–25411. NALP3 inflammasome is involved in the innate immune response to Mrass, P., Takano, H., Ng, L.G., Daxini, S., Lasaro, M.O., Iparraguirre, A., amyloid-beta. Nat. Immunol. 9, 857–865. Cavanagh, L.L., von Andrian, U.H., Ertl, H.C., Haydon, P.G., and Weninger, Hemmi, H., Takeuchi, O., Kawai, T., Kaisho, T., Sato, S., Sanjo, H., Matsumoto, W. (2006). Random migration precedes stable target cell interactions of M., Hoshino, K., Wagner, H., Takeda, K., and Akira, S. (2000). A Toll-like tumor-infiltrating T cells. J. Exp. Med. 203, 2749–2761. receptor recognizes bacterial DNA. Nature 408, 740–745. Nagpal, K., Plantinga, T.S., Wong, J., Monks, B.G., Gay, N.J., Netea, M.G., Horner, S.M., Liu, H.M., Park, H.S., Briley, J., and Gale, M., Jr. (2011). Fitzgerald, K.A., and Golenbock, D.T. (2009). A TIR domain variant of MyD88 Mitochondrial-associated endoplasmic reticulum membranes (MAM) form adapter-like (Mal)/TIRAP results in loss of MyD88 binding and reduced innate immune synapses and are targeted by hepatitis C virus. Proc. Natl. TLR2/TLR4 signaling. J. Biol. Chem. 284, 25742–25748. Acad. Sci. USA 108, 14590–14595. O’Neill, L.A., and Bowie, A.G. (2007). The family of five: TIR-domain-containing Horng, T., Barton, G.M., Flavell, R.A., and Medzhitov, R. (2002). The adaptor adaptors in Toll-like receptor signalling. Nat. Rev. Immunol. 7, 353–364. molecule TIRAP provides signalling specificity for Toll-like receptors. Nature Sasai, M., Linehan, M.M., and Iwasaki, A. (2010). Bifurcation of Toll-like 420, 329–333. receptor 9 signaling by adaptor protein 3. Science 329, 1530–1534. Iparraguirre, A., Tobias, J.W., Hensley, S.E., Masek, K.S., Cavanagh, L.L., Sato, T.K., Overduin, M., and Emr, S.D. (2001). Location, location, location: Rendl, M., Hunter, C.A., Ertl, H.C., von Andrian, U.H., and Weninger, W. membrane targeting directed by PX domains. Science 294, 1881–1885.

Cell 156, 705–716, February 13, 2014 ª2014 Elsevier Inc. 715 Sato, A., Linehan, M.M., and Iwasaki, A. (2006). Dual recognition of herpes Ulrichts, P., Peelman, F., Beyaert, R., and Tavernier, J. (2007). MAPPIT simplex viruses by TLR2 and TLR9 in dendritic cells. Proc. Natl. Acad. Sci. analysis of TLR adaptor complexes. FEBS Lett. 581, 629–636. USA 103, 17343–17348. van Lint, A.L., Murawski, M.R., Goodbody, R.E., Severa, M., Fitzgerald, Schnare, M., Holt, A.C., Takeda, K., Akira, S., and Medzhitov, R. (2000). K.A., Finberg, R.W., Knipe, D.M., and Kurt-Jones, E.A. (2010). Herpes Recognition of CpG DNA is mediated by signaling pathways dependent on simplex virus immediate-early ICP0 protein inhibits Toll-like receptor the adaptor protein MyD88. Curr. Biol. 10, 1139–1142. 2-dependent inflammatory responses and NF-kappaB signaling. J. Virol. Seth, R.B., Sun, L., Ea, C.K., and Chen, Z.J. (2005). Identification and charac- 84, 10802–10811. terization of MAVS, a mitochondrial antiviral signaling protein that activates NF-kappaB and IRF 3. Cell 122, 669–682. Yamamoto, M., Sato, S., Hemmi, H., Sanjo, H., Uematsu, S., Kaisho, T., Tusher, V.G., Tibshirani, R., and Chu, G. (2001). Significance analysis of Hoshino, K., Takeuchi, O., Kobayashi, M., Fujita, T., et al. (2002). Essential microarrays applied to the ionizing radiation response. Proc. Natl. Acad. Sci. role for TIRAP in activation of the signalling cascade shared by TLR2 and USA 98, 5116–5121. TLR4. Nature 420, 324–329.

716 Cell 156, 705–716, February 13, 2014 ª2014 Elsevier Inc. Supplemental Information

Figure S1. Further Analysis of TLR Signaling in Primary and iBMDMs, Related to Figure 1 (A) WT or TIRAP KO primary BMDM were infected with two strains of HSV at multiple MOIs. Higher MOI with substrain 7134 overcomes the signaling defect in TIRAP KO BMDM. (B) WT and TIRAP KO primary BMDM were infected with reovirus at multiple MOIs. Responses to reovirus were unimpaired in TIRAP KO BMDM. (C) WT and TIRAP KO iBMDM were stimulated with increasing doses of CpG DNA (1-100 mM). TIRAP KO cells are defective for cytokine expression except at high ligand concentration, analogous to the concentration-dependence of cell-surface TLRs. (D) iBMDM were infected with an IPC0 null (7134) or revertant (7134R) strain of HSV and transcriptional responses were assessed by qPCR. Error bars represent SD.

Cell 156, 705–716, February 13, 2014 ª2014 Elsevier Inc. S1 Figure S2. Biochemical Analysis of TLR-Induced Myddosomes, Related to Figure 3 (A) iBMDM were treated with LPS for the indicated times and IRAK2 was immunoprecipitated from lysates and analyzed by western blot. (B) HA-TIRAP-expressing iBMDM were treated as indicated and MyD88 was precipitated from cleared lysates. Immunoprecipitates were then analyzed by western blot for the indicated proteins.

S2 Cell 156, 705–716, February 13, 2014 ª2014 Elsevier Inc.