US 2011 O142815A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2011/0142815 A1 YU (43) Pub. Date: Jun. 16, 2011
(54) COMPOUNDS, COMPOSITION, METHODS, Publication Classification TARGETS FOR CANCERTHERAPY (51) Int. Cl. A6II 3/4I (2006.01) (76) Inventor: Ming YU, Los Angeles, CA (US) A638/43 (2006.01) A 6LX 3L/7052 (2006.01) CI2N 5/09 (2010.01) (21) Appl. No.: 12/667,687 A6IP35/00 (2006.01) (52) U.S. Cl...... 424/94.1: 514/381: 514/44 A: 435/375 (22) Filed: Jan. 4, 2010 (57) ABSTRACT This invention describes methods and pharmaceutical com Related U.S. Application Data positions for combinational cancer treatments that are capable of inducing JNK phosphorylation and induce pro (63) Continuation of application No. PCT/US08/69106, grammed cell death. It also identified genes as target for filed on Jul. 2, 2008. anti-cancer drug development and enhancement of the che motherapeutic drug effect for the treatment of cancer. This invention points to a novel method and principle for a new (60) Provisional application No. 60/929,535, filed on Jul. 2, avenue of developing more efficient and low or non cytotoxic 2007. Cancer treatment. Chemical Structure of 2,4-Dinitrophenol (DNP) and WST-3 NO, DNP HO
NO
WST-3 Patent Application Publication Jun. 16, 2011 Sheet 1 of 19 US 2011/O142815 A1
Fig 1 A Chemical Structure of 2,4-Dinitrophenol (DNP) and WST-3 NO, DNP HO
Patent Application Publication Jun. 16, 2011 Sheet 2 of 19 US 2011/O142815 A1
Fig 2 NF-kB Down Stream Gene Expression Levels A 050 a 3 Untreated Cir opcDNA3-Ctrl a KKa-KAT : a KKa-KA-2 8. KKo-KA x KKa-b-KA
KKEffect on CK2 mRNA Expression 3. O
O O ------| Un Treated Ctrl pcDNA3-Ctrl KKai-KA KKa-KA-2 KKo-KA KKa-b-KA Fig 3 Combinational Effect of IKK-KA Transfection and WST-1 Treatment
A 1.2 KK-KA Effects on Ce Survival r WS-i-O 1.0 - 8 WST-t-yes
O 6
KK2-KA IKK-KAKK2 KA
Untransfected pCDNA3 KK-KA KK2-KA KK-KA-KK2-KA Patent Application Publication Jun. 16, 2011 Sheet 3 of 19 US 2011/O142815 A1
Fig. 4 WST-1 promotes HT1080 Human Sarcoma cell death by triple combination Treatment
KK1-KA Ctrl/HT1080/24hr
was GSOP3-P9 / GSO KK1-KA-P9 -X-GSOP9 - K - GSOP3 - - - - - GSO KK-KA w-e GS 20/200 No DNA - GS 20/2OOP3-P9 GS 20/2OO KK-KA. -3s 2O2OOP9 - K - GS 20/2OOP3 --GS 20/200 KK1-KA 10 20 IKK inhibitor Ill Concentration (uM) GS-WST-1, P9-Puc19, P3-pCDNA3 Fig 5 LiC + Apigenin Synergized SCC-6 Cell Death, WST-1 Further Enhanced This Effect A UM-SCC-6/Apigenin+LiCl UM-SCC-6/Apigenin--LiCl+WST-1 1.4 -o-LiCIO -- LiCl1mM -(-e LiC 0 ... - LiC 1mM 1.4 - - -A- - -93mM. -x - 9 OnM s - A - LiCl3m M mix a LiC 10mM m . LiCl30mM mism.LiC 100mM 1.2-28 - LiCl30mM mea LiC 100m 2 a -- i
O. 8
O. 1 10 0.1 O Apigenin Concentration (uM) Apigenin Concentration (M) Patent Application Publication Jun. 16, 2011 Sheet 4 of 19 US 2011/O142815 A1
Fig 5 WST-1 induces ROS Generation Aa Si HT1080 Cell Treatedlabeled with CM-H2-DCFDAWSTGT1 for 4 hours, then C CO
t; 8 s Untreated 1-330M |-3 OuM Untreated Control &
WST-1 r ed -330M Patent Application Publication Jun. 16, 2011 Sheet 5 Of 19 US 2011/O142815 A1
Fig 6 puC19 DNA transfection synergize chemotherapeutic drug effect --r No SCC6/5-FU SCC6/Cis-Platinum Transfecti Transfectio B8 O |--pCDNA3 + - - - pCDNA3 1. 6 puc19 + puC19 woo. KK1-KA + - - - - - KK1-KA - 1.4 puc19 puc19 3. 2 - - - - KK2-KA + -Xe KK2-KA + <(d 1. puc19 puc19 g --IKK1-KA + to a KK1-KA + KK2-KA - Yew puC 19 pUC19 cus --OCDNA3 -O - pCDNA3 sce O.8 f a puC19 --puc19 5 0.6 . O6 O ar. A c. KK1-KA - Kx - KK1-KA 0.4 - - - - KK2-KA A or KK2-KA O2 - 0.2 - max) as KK1-KA + KK2KA --K - KK-KA . O ...i.d.s.l..l.).jur...i.l. iiii -i-...-kill...!! O | it l-C-DMSO O.O1 O. 1 O.O1 1 OO O vario. DMSO 5-FU Concentration (LM) MMWWMMMM Cis-Platinum Concentration (ug/ml) HT 108 Of Taxe on Co. Untransfec -- Untransfected ted D HTO8Of Cis-Platinum O.9 -
---- P3-P9 -- P3-P9 0.8 - - A - KK-KA ---- KK1-KA-p9 p9 - x - KK2-KA -a - KK2-KA-p9 2.5 - p9 C co - -, - KK1-KA aro KK1-KA ed c 2 KK2-KA es IKK2-KA-p9 V C S 04 --P9 15 - w x O3 - -ga. P3 O.2 - a - KK1-KA-p3 O.5 - is x - KK-KA p3 O. O -- KK2-KA-p3 on + as KK2-KA O 20 40 60 80 OO p3 O 2 3 Taxel Concentration (nM) - - KK1-KA KKKA. Cis-Platinum Concentration (- IKK2-KA-p3 Patent Application Publication Jun. 16, 2011 Sheet 6 of 19 US 2011/O142815 A1
Fig7. Reactive Oxygen Species Generation from Combination Treatment A UM-SCC6Cel/CCK8-KK inhibitor II B UM-SCC6 Cell/WST-1r-IKK inhibitor || - - - 0- - - CCK8 O 3 O ...... , ... wca. CCK8 130 " ' " WST-1r 0 13 O - B - WST-fr 13 O - - - WST. 1r 3 ...... CCK833 O - A - CCK810 3 O or/ WST-1r 1030 -ko. WST-r O 35 on 8 - WST. 1r - A - CCK80 35 - - - - - CCK81 35 --A - CCK8335 - - - - CCK810 35 -A- WST-1r 3 |35 -O-WST-1r 10 |35 -t, - WST-1r O - A - CCK8 O 310 - 3 - CCK81 310 -- WST-1r 13 10 on-a- WST-1r 33 10 -- WST-1r 1C -- CCK833 10 -- CCK810 13 10 10000
8 O OO
O 60 120 180 240 O "time Of Ten (min)" 240 Time of Treatment (min) C SCC6/CCK8/Ap/ROS D SCC6/GS/Ap/ROS - O - CCK80 Ap O CCK81 Ap 0 o wst-1ro Apo ---- wsT-1r 1 Apo - - - CCK83 Ap O CCK810 Ap 0-- - WST-1r 3 Apo - ... WST-1r 10 Apo -a- CCK80 Ap 10 -a - CCK81 Ap 10 – A – WST-1r O Ap 10 -a, - WST-1r 1 Ap 10 --- CCK83 Ap 10 * - CCK810 Ap 1 (- - WST-13 Ap 10 -a- WST-1r 10 Ap 10 -O - CCK80 Ap 30 -- CCK8 1 Ap 30 --O-WST-1r O Ap 30 -a- WST-1r 1 Ap 30 -- CCK83 Ap 30 - CCK810 Ap 3( WST-1r 3 Ap 30 -- WST-1r 10 Ap 3 - CCK80 Ap 100 -o- CCK8 1 Ap 1 Oc -- WST-1r O Ap 100 -e-WST-1r 1 Ap 10 e CCK83 Ap 100 -- CCK810 Ap 1. uu UU -o-WST-1r 3 Ap 100 -- WST-1r 10 Ap 10( 10000 MN 8000
2000 %
O 60 120 18O 240 O 60 120 18O 240 Time of Treatment (min) Time of Treatment (min) Ap=Apigenin (3=lKK inhibitor || Patent Application Publication Jun. 16, 2011 Sheet 7 of 19 US 2011/O142815 A1
Fig 8. Combination Treatment with Apigenin and WST-1r Induces Cancer Cell Death 40. a Untreated Ctrl WS-r
A Apigenin WST-1 r+Apigenin 120
100 i 8 O
USCC6 MD-MB-A23 A431 O80 Ca27 B6-5 294 Ce Lines
B 120 - MDA-MB-23 ---Cell - Apigenin MMO C 12O A431 Cell ... -- Apigenin 10 -0- Apigenin () 39 100 -O-ApigenA Age. in 39100 S 100 - ...a Ani?teninESER38 100 80 - 8 80 S& as 60 & 60 2 g s 40 40 o O c3 20 - 8o 20 O O O 2 4. 6 8 1 O O 2 4 6 8 1 O WST-1r Concenrtration (%) WST-1r Concenrtration (%)
D 120 MDAMB-231 Ce E 120 A431 Cell
1 O O
8 O
60
40
20 .
O 2O 40 SO 8O Apigenin Concentration (M) 40 Apigenin Concentration (uM) Patent Application Publication Jun. 16, 2011 Sheet 8 of 19 US 2011/O142815 A1
Fig 9. Comparison of Cancer cells and non cancer cells' response to WST-1r and Apigenin Apigenin ()
60 Apigenin 30 Apigenin 100 140 120 100 80 60 40 20 O WST-1 r () 1() () () O ()
HEKa UM-SCC6 Ca27 Cell Line and Treatment Patent Application Publication Jun. 16, 2011 Sheet 9 of 19 US 2011/O142815 A1
Fig 10 Time course and Dose Response of WST-1r and Dose Response of Apigenin (Ap) involved in the Combination Treatment of WST-1r with Apigenin A 16O Ca27 Ap (uM) O Ap (uM) 3 Ap (uM) 10 14.0 - E. Ap (uM) 30 g Ap (uM) 100 120 - OO - 80 - 6O – 40 a.
Treatment
B 2 O O HT1080 Eg Ap (uM) 0 O Ap (uM) 3 EAp (uM) 10 Ed Ap (uM) 30 Ap (uM) 100
5O
Treatment SCC6 o 20 a Ap (UM) 30 Ap (UM) 100 C C was 8 > S g te dis O O
Treatment Patent Application Publication Jun. 16, 2011 Sheet 10 of 19 US 2011/O142815 A1
Fig 11. Effect Of KK inhibitOr -WST-1r COmbination Treatment A 120 -- SK-Mel-5 Cells WST-1r 0% B120 T294 BMS345541 (uM) 0 EWSEE 3: BMS345541 (uM) 3 100 ------OO + BMs:4554 (um to 5 80 380 . 5 (5 60 & 60 5 a SSO 40 S 40 g 2O 2O
O O | O 3 10 O 1 BMS345541 Concentration (M) WST-1r Concentration (%) C | O Ctrl BMS-345541 WST-1r BMS-345541+WST-1r 5 120 S 100 CD 80 s' 60 > E 40 e S. 20
HEKa T294 SK-Me-5 Fig 12. Treatment Order of BMS345541 and WST-1r
T294 Cell BMS34554ENSE: (uM) g10
Ctrl WB W--B-B W. B Treatment Order Patent Application Publication Jun. 16, 2011 Sheet 11 of 19 US 2011/O142815 A1
Fig 13 WST-1r and Apigenin combination treatment induced JNK Phosphrylation
phosphoJNK/totalJNK
O.8
O6
O 4.
O.2 O Apig -T- enin WST or so too a solo O 1 O 30 OO -0.2 - - 1r to O 3 10 Treatments
Fig 14 Effect of CCK8 and XT Tas substitute of WST-1r in combination
20
OO .
8 O 6 O Y s 4.6OO
A
- he O i.i.d.------, -irst O 2O 40 60 80 OO Apigenin Concentration (mv) Apigenin Concentration (M) Patent Application Publication Jun. 16, 2011 Sheet 12 of 19 US 2011/O142815 A1
Fig 15. Combination Treatment of Apigenin with WST derivatives, mPMS or Combination of WST and mPMS A 2 O Ap 10 O Ap 30 Ap 100
100
8 O 4.6 OO
2 O
B 120 UM-SCC6 O Ap O EAp 10 Ap 30 Ap 100
O O
8 O
6 O
4 O
2 O
Ap=Apigenin Patent Application Publication Jun. 16, 2011 Sheet 13 of 19 US 2011/O142815 A1
120 —0 - Ap O A m HT1080 ------Ap 10 s 100 le, - - A - - Ap30 80 N 8&ss ss O- - - Ap 100 Figk 16. Dose- O 60 \ ,s , Response of s 40 Y Apigenin and e v \ V. mPMS is 20 a n --- Y COmbination D 0 t &exas ^. Treatment o O 0.02 0.04 0.06 0.08 0.1 0.12 mPMSConcentration (mv) -0-ApO B 120 MM UM-SCC6 Cell" ------Ap 10 - - A - - Ap30 is 100 - - - - - Ap 100 3 80 O 60 a 40. o . D 20 d O 0 O.15 -2O mPMS Concentration (uM) 120 ------HEKa - - - - - SK5 5 100C - A - Ca27 8 80 & . - - x - - SCC6 No. --O--HT1080 s 60 Ša 0 Fig 17 Differential E y '0 Cellular Responses isis 40 NNäss to mPNS Treatment 3 20 SO
O 1-----, -}. O O.O2 0.04 O.O6 mPMS Concentration (mM) Patent Application Publication Jun. 16, 2011 Sheet 14 of 19 US 2011/O142815 A1
Fig 18 WST-3 and Apigenin Combination Induced Synergistic Cancer Cell Death Ctrl O Apigenin A 120 WST-3 Apigenin-i-WST-3
100 s 3 80 o Š 60 e S 40 d CD W 2O
O UM-SCC6 HT1080
C100 SK-Miel-5 Cells g0 x -wr E v. 5 80 F \, . E y as 70 - v O w s a 60 w O * - ps - O 50 V V 8 * w E 40 w O w is 30 - S 30 w -- Apigenin O -- Apigenin 0 || 1 E w ------Apigenin 10 520 ------Apigenin 10 || 3 20 N ---- Apgenin 30 O - - A - - Apgenin 30 10 Yas-----a O t 0 F------O.05 O.1 O O.05 O.1 WST-3 Concentration (mM) WST-3 Concentration (mM) Patent Application Publication Jun. 16, 2011 Sheet 15 of 19 US 2011/O142815 A1
Fig 19. Effect of Combination WST-3-mPMSwith Apigenin On Cell Death WST-3 and Apigening Combination Treatment 120 ApO OAp 10 Ap30
100 8 O 6 O
4 O 2 O
s WST3 O 0.05 Cell HEKa Line
OO
60
40
UM-SCC6 Ap=Apigenin Patent Application Publication Jun. 16, 2011 Sheet 16 of 19 US 2011/O142815 A1
Fig 20. siRNA substitution of puC19 for Enhancing WST-1r-IKK inhibitor Combination Treatment Effect 3 a BMS345541 (uM) 0 Ed BMS34554 (uM) 5 BMS345541 (uM) 15
as 2.5 3 2 s 1.5
> 3 0.5 O WST- O 1r SRNA Cir pUC19 AllStar siRNA-3 MAG8 TMEM82 Treatment
Fig 21 Effect of Type IIFN Substitute puC19 Transfection in Combination Treatments Effect of Type IFN in Combination witn IKK inhibitor anf WST-1r 120 (HT1080 Cells) WST-1 Ctrl BMS345541 WST- BMS34554 100 - 9 80 C5s 60 - as & 40
20
O Ctrl DNA IFN-a Treatment (unit/ml) Patent Application Publication Jun. 16, 2011 Sheet 17 of 19 US 2011/O142815 A1
Fig 22. Enhancement of Taxel Efficacy Effects by Combination of Puc19 DNA sequence derived siRNA with Taxel A T1080/siRNA#1, TPCR6 siRNA?Taxel B HT1080/siRNAi 3, siRNA MAG3 and
te an in Ctrl 60 a new as Ctrl 160 e. area AllStar aX ana AllStar wampuC 19 140 admpuC 19 140 as Casa RNA 2. a wOm Sl --
3 as a siRNAX 1,5 S a MAG3 100 me a TPCR6 3 100 A TMEM182 SS is 80 S 80 E ia 60 60 D. s g 40 3 40 20 2O
O O O 20 40 60 80 100 OO -20 - 1. 20 . Taxel Concentration (nM) Taxel Concentration (nM) G80 HT1080/siRNAH2, siRNS against C6-108, 16O 0. SH3PXD2B Or TTBK/Taxe 6. ------Ctrl -- AllStar 140 BS, . -A-puC19 --X -- siRNA #2
s s AN , siRNA2+3 - H -- siRNA) 15 s 0. ------C6-108 -K-SH3PXD2B NM's --O--TTBK1 : w O w SS \\ a > 80 - \, s N. W. .. s i 60 w N CKS Ns - - - N D s N is ...... s 40 Sls N sN' O 's-sl- Y -N. 2O - - - - S - Sk --Ns O - H Has -20 O 10 20 30 40 50 60 70 80 90 100 Taxel Concentration (nM) Patent Application Publication Jun. 16, 2011 Sheet 18 of 19 US 2011/O142815 A1
Fig 23
12000 y-axy SCC6/CCK8-GS-AP 1OOOO, CCK8
3. 6000 4000 2000
10 30 1 OO
SCC6/CCK8-GS-3 12000 ex. 1 OOOO 8OOO 3. 6000 4OOO 2OOO Patent Application Publication Jun. 16, 2011 Sheet 19 of 19 US 2011/O142815 A1
Fig 24. Comparison of ROS Generation by WST-1r and CCK8 in Combination Treatment UM-SCC6/Apigenin +WST-1r or CCK8
CO O 6OOO ..
Treatment
B SCC6/KKinhibitor Witn CCK8. Or WST-1 r 12000 -
CCK8 OOOO WST-1r 8OOO O O 6000 - 4000 2000 O o g o yor c 3 st 3 O 5 10 Treatment
Ap=Apigenin US 2011/O 142815 A1 Jun. 16, 2011
COMPOUNDS, COMPOSITION, METHODS, could facilitate cancer cell death and sensitize cancer cells to TARGETS FOR CANCERTHERAPY chemotherapy drugs and radiation therapy (Kim H.J. Hawke N, and Baldwin AS, NE-KB and IKK as therapeutic targets in RELATED APPLICATION cancer, Cell Death and Differentiation, (2006) 13:738–47: 0001. This application is a continuation in part claims the Karin M, Nuclear factor-KB in cancer development and pro benefit of PCT application (PCT/US2008/069106) filed on gression, (2006) Natur 441:431-6; Chikashi Nakanishi and Jul. 2, 2008 claiming priority date of Jul. 2, 2007 and claims Masakazu Toi, Nuclear Factor-KB Inhibitors As Sensitizers the benefit of U.S. Provisional Application No. 61/156,507, To Anticancer Drugs, NATURE REVIEWS CANCER (2005) filed Mar. 1, 2009, which are herein incorporated by reference 5:297-309). in their entirety. 0009. There are two similar, but different IKB Kinases (IKK1 and IKK2) that are up stream regulator of NF-KB GOVERNMENT INTERESTS activity. In addition, alternative NF-kB activation pathways, Such as protein kinase CK2 (CK2), also exist. In most cancer 0002 The research carried out in the present application cells, NF-kB is constitutively activated. In addition to the was supported in part by NIH. The government may have IKK classic pathway, these alternative NF-kB activation certain rights in the invention of the present application. pathways may also contribute to the aberrant NF-kB activity in cancer cells (Ming Yu, Jason Yeh, and Carter Van Waes SEQUENCE LISTING Protein Kinase CK2 Mediates Inhibitor-Kappa B Kinase and 0003 Attached .txt file entitled: PCT/US2008/069106 Aberrant Nuclear Factor-KBActivation by Serum Factor(s) in SequenceListing Head and Neck Squamous Carcinoma Cells Cancer The sequence Listing contains the following sequences: Research, 2006 Jul. 1; 66(13): 6722-6731. and other for Nucleotide sequence of puC19 and pcDNA3; NFKB activation). Dozens of IKK inhibitors have been pro Nucleotide sequences: Transcripts of TRPC6 (NM duced and are in trials for treating anti-inflammatory diseases. 004621), SH3PXD2B (NM 001017995), MAGI3 (NM However, for treating cancer with these IKK inhibitors, these 152900), TMEM182 (NM 144632), C60rf108 (NM efforts have yielded results far from spectacular (Chikashi 19918.4): Nakanishi and Masakazu Toi, Nuclear Factor-KB Inhibitors Peptide sequences: TRPC6 (NP 004612), SH3PXD2B As Sensitizers To Anticancer Drugs, NATURE REVIEWS (NP 001017995), MAGI-3 (NP 690864), TMEM182 CANCER (2005) 5:297-309). (NP 653233), C60rf108 (NP 954653); (0010 More recent studies pointed to the balance between Double strand RNA sequences: siRNA1, siRNA 2, and NF-kB activity and C-Jun-N-Terminal-kinase (JNK) activity, SiRNA3. which regulates cell death or proliferation (reviews). In this theory, NF-kB and JNK cross talk through reactive oxygen DESCRIPTION OF THE INVENTION species (ROS). Both JNK and NF-kB activity leads to Cell 0004. 1. Technical Field of the Invention proliferation. However, ROS induces prolonged JNK activa 0005. This invention relates to the fields of oncology and tion that will induce programmed cell death. Conversely, chemotherapy. Specifically, the invention provides novel activated NF-kB suppresses ROS and, hence, suppress ROS compounds, methods, pharmaceutical composition and tar induced prolonged JNK activation. Therefore, inhibiting NF gets for more efficient and less or non cytotoxic treatments of KB while activating JNK would switche the balance to pro CaCC. grammed cell death. However, up to date, no Such treatment 0006 2. Background Art of the Invention method has been reported. Most importantly, although this 0007 Up to date, chemotherapy and radiation therapy are specific theory has been proposed, none has prior Succeeded still the mainstream for cancer treatment. These treatments in demonstrating this effect. were based on targeting proliferating cells rather than cancer 0011 ROS are potentially harmful by-products of normal cells only, which is also the cause fundamental basis of lethal cellular metabolism that directly affect cellular functions. side effects from these treatments. Targeted therapy, a new ROS are also acts messenger and indispensable for signal generation of cancer treatment, is aimed to target cancer transduction pathways that regulate cell growth and reduc specific changes of molecules and signaling pathways to tion-oxidation (redox) status. However, overproduction of induce cancer cell death, but limit such effects on normal these highly reactive oxygen metabolites can initiate lethal cells. Enormous efforts have been made in finding the targets chain reactions, which involve oxidation and damage to struc and the ways of targeting the targets inside the cells as a tures that are crucial for cellular integrity and Survival. In fact, treatment. However, up to date, the Success rate of this new many antitumor agents, such as vinblastine, cisplatin, mito generation is limited. One major challenge comes from the mycin C, doxorubicin, camptothecin, inostamycin, neocarzi complexity of cellular regulation mechanisms and overlap nostatin and many others exhibit antitumor activity via ROS ping pathways inside the cells. dependent activation of apoptotic cell death, Suggesting 0008 Aberrant Nuclear factor-kappa B (NF-kB) activa potential use of ROS as a fundamental antitumor principle. tion has been associated with a variety of tumors and cancer The “oxidation therapy a unique anticancer Strategy by cells for oncogenesis, regulation of cell proliferation, inhibi inducing the generation of ROS directly to solid tumors as tion of apoptosis, promoting angiogenesis, tumor invasion cytotoxic oxystress for cancer treatment has been developed. and metastasis as well as cancer cell resistance to chemo However no successful and practical results were obtained therapy and radiation therapy treatments (Kim H.J. Hawke N. probably because of the lack of tumor selective ROS delivery and Baldwin AS, NF-kB and IKK as therapeutic targets in and hence resulting in Subsequent induction of severe side cancer, Cell Death ad Differentiation, (2006) 13:738–47: effects (Fang, J., Nakamura, H., and Iyer, A. K. Tumor-tar Karin M, Nuclear factor-KB in cancer development and pro geted induction of oxystress for cancer therapy. J Drug Tar gression, (2006) Natur 441:431-6). Inhibition NF-kB activity get, 15:475-486, 2007). US 2011/O 142815 A1 Jun. 16, 2011
0012. One of the unique features of cancer cells is their Future Oncol. 1: 841-849, 2005), inhibit HIF, PKC, CDK, dependency on aerobic glycolysis, the “Warburg effect” that VEGF NF-kB, CK2, AKT, MAPK, AR and ER pathways, most cancer cells predominantly produce energy by glycoly activate wild type p53, modulate the deregulated cell cycle sis followed by lactic acid fermentation in the cytosol, rather checkpoint and induce apoptosis (Induction of caspase-de than oxidation of pyruvate in mitochondria by most normal pendent, p53-mediated apoptosis by apigenin in human neu cells (Warburg O., Science 123:309, 1956). Along with this roblastoma Torkinet al. 4 (1): 1–. 2007, Apigenin Inhibits Aerobic glycolysis is that cancer cells consume oxygen Expression of Vascular Endothelial Growth Factor and through trans-plasma membrane electron transport (tPMET) Angiogenesis in Human Lung Cancer Cells. Implication of at cell surface that oxidizes the NADH that generated from 2007, Apigenin inhibits VEGF and HIF-1 expression via the glycolysis processes in cytosol and to generate ATP PI3K/AKT/p70S6K1 and HDM2/p53 pathways Fang et al. (Heart, P M, Curr Mol Med, 2006, 6:895). The tBMET is 19 (3): 342 The FASEB. 2007; Balasubramanian, S. and mediated by NADH Oxidases (NOX) located on cell plasma Eckert, R. L. Keratinocyte proliferation, differentiation, and membrane. This process oxidizes intracellular NADH and apoptosis—differential mechanisms of regulation by cur recycles it to maintain the intracellular NADH/NAD+ ratio to cumin, EGCG and apigenin. Toxicol Appl Pharmacol, 224: support glycolytic ATP. As ATP production contributes sub 214-219, 2007; Birt, D. F., Walker, B., Tibbels, M. G., and stantially to fulfilling the energy requirements of rapidly Bresnick, E. Anti-mutagenesis and anti-promotion by apige dividing cells, such as cancer cells, and that tRMET is the nin, robinetin and indole-3-carbinol. Carcinogenesis, 7: 959 major source for cancer cell energy production that is differ 963, 1986; Patel, D., Shukla, S., and Gupta, S. Apigenin and ent from normal cells, which perform energy metabolism and cancer chemoprevention: progress, potential and promise (re consume oxygen in mitochondrial. Therefore, targeting view). IntJ Oncol, 30: 233-245, 2007: Sato, F., Matsukawa, tPMET could be a strategy for cancer specific treatment. This Y., Matsumoto, K, Nishino, H., and Sakai, T Apigenin concept was initially proposed by Herst PM, and Berridge M induces morphological differentiation and G2-Marrest in rat V based on the facts that the compounds that affect tRMET neuronal cells. Biochem Biophy's Res Commun 1994 Oct. 28; also affect cancer cell survival (Herst PM, Berridge M. V. 204: 578-584, 1994). In addition, apigenin has also been Curr Mol Med 6:895, 2006). It was further hypothesed that reported to generate ROS, which disrupt mitochondrial mem blocking the electron transport through interfering with mem branes. Current research trials indicate that it may reduce brane ubiquitou recycling, destabilizing the redox status of DNA oxidative damage: inhibit the growth of human leuke the cell membrane that may stimulate acid sphingo-myeli mia cells and induced these cells to differentiate; inhibit can nase activity, result in the conversion of sphigomyelin to cer cell signal transduction and induce apoptosis; act as an ceramide that will lead to formation of ceramide-enriched anti-inflammatory; and as an anti-spasmodic or spasmolytic. membrane islands, which lead to apoptosis (Dumitru, C. A. et More than 100 patent applications related to apigenin have al, 2006. Oncogene 25:5612-25). Based on this hypothesis, been filed. Among those, apigenin was claimed to be used as Berridge etal proposed to make drugs specifically located to a drug for treating inflammatory and autoimmune diseases. In the plasma membrane without entering the cell as a novel addition, apigenin was also claimed for the use as a cancer anticancer drug development strategy. However, up to the chemoprevention drug and as adjunct use for enhancing the date offiling this application, no Such development had been effects of chemotherapy drugs for cancer treatment at 10 LM reported. concentration (US Patent Application 20060189680). How 0013 Hypoxia inducing factor (HIF) and pyruvate kinase ever, as a chemo sensitizer, the efficacy effect of apigenin is 2(PK-M2) are known to be responsible to the switch to aero limited. To be a cytotoxic drug for treating cancer, apigenin bic glycolysis by cancer cells, but targeting PK-M2 resulted has to be combined with other treatments. Other isoforms of intolerable side effects. High HIF expression levels and apigenin, other flavonoids, isoflavonoids including, naturaly activities have been associated with all cancer cells that make existed, modified or synthetic including phenoXodiol a syn cancer cells resistant to low oxygen levels. Furthermore, can thetic isoflevene, have also been found with similar function cer cells are actively undergoing catabolism, which result of apigenin. All of those need to be combined with chemo high demands for reducing sources that oxidize the NADH therapy drugs for cancer treatment. generated from the glycolysis process, which further makes cancer cells can Survival in close to Zero oxygen levels. Single SUMMARY OF THE INVENTION inhibition of HIF seems not sufficient to kill cancer cells. 0015. A more efficient and cancer specific anticancer More effective inhibition of cancer cell specific respiration is treatment can be achieved by combining inhibition of cancer still lacking and has been sought hardly. cell Surface respiration with inhibiting its hypoxia response. 0014 Apigenin is a naturally occurring plant flavone (4'. 0016. The present invention provides pharmaceutical 5,7-trihydroxyflavone) abundantly present in common fruits composition and combinational composition and methods for and vegetables including apple, parsley, onions, oranges, tea, the treatments of cancer and genes as drug targets to enable chamomile, wheat sprouts and some seasonings. Apigenin is the treatment of cancer in a mammal to synergize cancer a multifunction signal conduction agent and has been shown specific cell death with less or no cytotoxic side effects to possess remarkable anti-inflammatory, antioxidant and including: anti-carcinogenic properties and is currently under active 0017. A pharmaceutical composition and a method for study. Studies on the biological effects of apigenin at cellular treating cancer by targeting the tRMET of cancer cells to and molecular levels have found that apigenin interferes with block the tarns plasma membrane electron transfer and/or a wide range of critical molecules and signaling and regula uncoupling the oxidative phosphorylation across the cell tory processes in the cells, including depleting the HER2 plasma membrane without affecting the same function at the protein and suppressing the Her2/Her3-phosphatidyli mitochondria membrane incombination inhibition of cellular nositide 3-kinase/AKT pathway (Way, T. D. and Lin, J. K. responses to hypoxia to reach a synergistic therapeutic effect Role of HER2/HER3 co-receptor in breast carcinogenesis. of inducing cancer specific cell death for cancer treatment; US 2011/O 142815 A1 Jun. 16, 2011
0018. A compound and its required chemical structure for fection and (2) at least one IKK inhibitor and (3) an additional targeting th’MET for cancer treatment; third agent, WST-1 r or at least one of the valid substitutes of 0019. A use of WST-3 and any of the valid substitutes that WST-1r, in a pharmaceutically acceptable carrier medium. are capable of blocking the tRMET by uncoupling the oxida Wherein said combination enhances the induction of cancer tive phposphorylation on cell plasma membrane for the said cell death while otherwise any of these agents separately are combination treatment; demonstrated not to be toxic. 0020. A pharmaceutical composition and a method for 0026. The valid substitutes for Puc19 DNA transfection treating cancer by combining WST-3 or its valid substitutes are selected from the group consisting of (1) type I IFN. (2) with apiginin or its valid Substitutes as an cancer specific and Synthetic small interfering RNAs (siRNA) the nucleotide less toxic anticancer treatment; sequence SEQ ID NO 10-12 of which mapped to both the 0021 Ause of a reagent WST-1r comprising water soluble DNA sequence of the puC19 DNA vector and human tran tetrozolium salts and intermediate electron acceptors as a Scripts and genome DNA sequences, (3) the biological com drug to interfere tRMET for the said combination treatment; pounds selected from the group consisting of biological and 0022. A pharmaceutical composition of WST-1r and any non-biological organic or non-organic compounds. The said of the valid substitutes of WST-1r for the said combination method of screening compounds, wherein said biological treatment that are capable of conducting trans-plasma mem chemicals are further selected from the group of polypep brane electron transport and induces ROS. The WST-1r and tides, proteins, peptides, antibodies, antibody fragments, any of the valid substitutes of WST-1 is a mixture of tetrazo nucleic acids, and polynucleotide the products of which inter lium salt and an electron coupling reagent (IEA), or at least act and interfere said selected targets of the polynucleotide one of the tetrozolium salt or at least one of the IEA in sequences of TRPC6 (SEQID NO: 2), MAGI-3(SEQID NO: optimized concentration. The compounds may be adminis 4), TMEM182 (SEQ ID NO. 5), SH3PXD2B(SEQID NO: tered in a pharmaceutically acceptable carrier medium. 3), or c60rf108 (SEQ ID NO: 14), and the polypeptide 0023. A pharmaceutical composition and a method for sequences of TRPC6 (SEQID NO: 6), MAGI-3(SEQID NO: treating cancer by combining WST-1r or its valid substitutes 8), TMEM182 (SEQ ID NO: 9), SH3PXD2B(SEQ ID NO: with apiginin or its valid Substitutes as an cancer specific and 7), or c60rf108 (SEQ ID NO: 15). Synthetic siRNA that less toxic anticancer treatment; against these target genes (SEQ ID NO: 2 to 5 and SEQ ID 0024 Selected genes, molecules, and polynucleotide NO: 14) were selected for demonstrating the potential use of sequences and polypeptide sequences are provided as target these genes as a target for the combination treatment for for designing drugs for the treatment of a cancer in a patient cancer, in need. These targets are the human transcripts, and their 0027. A method of inducing programmed cell death of corresponding protein/peptide molecules and/or the genomic cancer cells in a malignant cell population, and treating a DNA sequences that are selected from the blast analysis of the patient with cancer comprising the use of a combination DNA sequence of puC19 DNA vector against human therapy. The combination therapy of the present invention genome and treanscripts, the DNA sequences of which comprises administering an effective dose of WST-1r or any mapped to the human transcripts and/or genomic sequences valid Substitutes, that is capable of conducting trans-plasma in short pieces. The transcripts and their corresponding cod membrane electron transfer and induces ROS in a cell and ing molecules are targets for enhancing the efficacy of the apigenin, a multi-function inhibitor that inhibits HIF, CK2, treatments of cancer. Other sequences that, thus, mapped to NF-KB activity and other molecules and/or signaling path human genomic sequences may be used as targets as well as ways, or at least one of the IKK inhibitor. The said combina being used for targeting these corresponding genes. The tion treatment enhances apigenin anti-neoplasm effect and potential drugs that can be designed to targeting these targets synergizes the induced cancer cell death; include, but not limited to, siRNA, small molecule inhibitors, 0028. A method is provided for treating a cancer in a peptides inhibitors, anti-sense RNA, anti-sense Oligo, anti patient in need thereof by administering to the patient, con bodies, antibody fragments, proteins, dominant negative currently or sequentially, a therapeutically effective amount DNA vectors and Interferon (IFN). In a particular embodi of at least one GSK3? inhibitor and protein kinase CK2 ment of this invention, these targets are, but not limited to, (CK2) inhibitor and addition of a third agent, WST-1 r. In a polynucleotide sequences of TRPC6 (SEQ ID NO: 2), particular embodiment of the invention, the preferred at least MAGI-3(SEQ ID NO: 4), TMEM182 (SEQ ID NO. 5), one GSK3f inhibitor is LiCl and the preferred protein kinase SH3PXD2B(SEQID NO:3), or c60rf108 (SEQID NO: 14), CK2 (CK2) inhibitor is Apigenin. The compounds may be and the polypeptide sequences of TRPC6 (SEQ ID NO: 6), administered in a pharmaceutically acceptable carrier MAGI-3(SEQ ID NO: 8), TMEM182 (SEQ ID NO: 9), medium. Wherein said combination enhances the induction SH3PXD2B(SEQID NO:7), or c60rf108 (SEQID NO:15). of cancer cell death otherwise any of these agents separately The sequence to target human genomic sequence and or tran are demonstrated not to be toxic; scripts are, but not limited to, puc19 DNA vector (SEQ ID 0029. A method is provided for treating cancer in a patient NO: 1), pc DNA3 vector (SEQID NO: 13), siRNA2 (SEQID in need comprising administering, concurrently or sequen NO: 10-12). Synthetic siRNA that against these target genes tially, a therapeutically effective amount of a combination of (SEQ ID NO: 2-5 and SEQ ID NO: 14) were selected for a selective Puc19 DNA trasnfection or at least one of any of demonstrating the potential use of these genes as a target for the valid substitutes of puc19 transfection as listed above in the combination treatment for cancer, combination with at least one of a selected approved chemo 0025. A method for treating a cancer in a patient in need therapeutic agents. Wherein said Puc19 DNA trasnfection or thereof comprising administering to the patient, concurrently administering at least one of the valid substitutes of puc19 or sequentially, a therapeutically effective amount of (1) at transfection being capable of Substantially enhancing anti least one of the transfection of puc19 DNA vector or admin neoplastic effects of said proved chemotherapeutic agents, istering at least one of the substitutes of puc19 DNA trans Substantially reducing toxic side effects of said chemothera US 2011/O 142815 A1 Jun. 16, 2011
peutic agents, or a combination thereof, wherein said Puc19 0046 FIG. 14 Chart of Effects of CCK8 and XTTas sub DNA trasnfection or at least one of the valid substitutes has a stitute of WST-1r in combination treatment with apigenin for Substantial effect on activity of said chemotherapeutic agents; inducing cancer cell death 0030. A method is provided for synergistically inhibiting 0047 FIG. 15 Chart of Combination Treatment of Apige NF-kBNF-KAPPAB activity in cancer cells and in a patient in nin with WST derivatives, mPMS or Combination of WST need thereof by administering to the cells or patient, concur and mPMS rently or sequentially, a therapeutically effective amount of at 0048 FIG. 16 Chart of Dose-Response of Apigenin and least one Dominant negative kinase dead IKK1 DNA vector mPMS Combination Treatment (IKK1-KA) and at least one Dominant negative kinase dead 0049 FIG. 17 Chart of Differential cellular responses to IKK2 DNA vector (IKK2-KA). The at least one Dominant mPMS treatment negative kinase dead IKK1-KA or IKK2-KA may be substi 0050 FIG. 18 Chart of Effect of Combination WST-3 with tuted by IKK inhibitors selected from the group consisting of Apigenin On Cell Death (IKK inhibitor list). The compounds may be administered in 0051 FIG. 19 Chart of Effect of WST-3, and WST-3+ a pharmaceutically acceptable carrier medium. This combi mPMS in Combination with Apigenin On Inducing Cancer national inhibition effect may be further enhanced by adding Cell Death a third agent, WST-1r or the valid substitutes of WST-1r, for 0052 FIG. 20 Chart of siRNA substitution of pUC19 for further induction of cancer cell death; enhancing WST-1r-IKK inhibitor combination Treatment 0031. A method of inducing cancer cell death, and treating Effect a patient comprising the use of a combination therapy. The 0053 FIG. 21. Chart for Effect of Type I INF Substitute combination therapy of the present invention comprises pUC19 for combination Cancer treatment administering an effective dose of at least a compound that 0054 FIG. 22. Chart of enhancement of Taxel Efficacy inhibits NF-kB activity and at least one compound that inhib Effects by Combination of Puc19 DNA sequence derived its STAT3 in a preferred embodiment, the compound that siRNA with Taxel inhibits NF-kB activity is apigenin or an IKK inhibitor or a 0055 FIG. 23. Image of Induction od ROS Generation by CK2 inhibitor and the compound that inhibits STAT is stattic. WST-1 rand the combination treatment. The compounds may be administered in a pharmaceutically 0056 FIG. 24 Chart of Dose Response of ROS generation acceptable carrier. after combination treatment of WST-1 r. CCK8 with apigenin 0032. A use of the combination therapy to treat cancers and IKK inhibitor III comprising administering IKK inhibitor or apigenin and a STAT3 inhibitor, stattic. In one preferred embodiment, the DETAILED DESCRIPTION OF THE INVENTION cancers are selected from the group consisting of a Subtype of head and neck squamous carcinoma. I. General Description
BRIEF DESCRIPTION OF THE FIGURES 0057 The efficacy of anticancer therapy can be enhanced by combination of proper selected compounds, biological 0033 FIG.1. Chemical Structure of DNP and WST-3 molecules and drugs that block the tRMET and cell surface 0034 FIG. 2. Chart of endogenous NF-kB down stream respiration in combination with inhibiting cellular hypoxia gene expression levels. responses to induce Synergistic and cancer cell specific cell 0035 FIG. 3. Chart of cell survival from IKK-KA trans death. Several combinational pharmaceutical compositions fection in combination with or without WST-1 treatment. and methods for anticancer treatment are described. The 0036 FIG. 4 Chart of WST-1 promotes HT1080 Human development of these pharmaceutical compositions were Sarcoma cell death by triple combination Treatment based on the following discoveries: 0037 FIG. 5 Chart of combination of LiCl and Apigenin 0058. The discovery the use of WST-3, WST-1r and their and WST-1r treatment. valid Substitutes as drugs for combination therapies by com bining with apigenin, IKK inhibitors or Puc19 DNA or any of 0038 FIG. 6 Chart of puC19 DNA transfection synergize its valid Substitutes that induced synergetic and cancer spe chemotherapeutic drug effect cific cell death, 0039 FIG. 7 Chart of Time Course of ROS generation 0059. The discovery the structure and function features of after combination treatment of WST-1 r. CCK8 with apigenin WST-3 representing a class chemicals of a cell surface oxi and IKK inhibitor III dative-phosphorylation uncpupler and the corresponding 0040 FIG. 8 Chart of combination treatment with apige principle to design a chemical compound for targeting nin and WST-1r synergizes induced cancer cell death. tPMET and blocking cell surface oxidative-phosphorylaition, 004.1 FIG.9. Chart for Differential Responses to WST-1r tPMET and cell respiration for the said combination antican and Apigenin Combination Treatment from Human Non Cer treatment. Cancer Cells and Human Head and Neck Cancer Cells. 0060 (3) The use of puc19 DNA sequences and the cor 0042 FIG. 10 Chart of Time course and Dose Response of responding siRNAS as anti cancer drugs as well as the dis WST-1 rand Dose-Response of apigenin involved in the com covery of the corresponding genes as target for developing bination treatment of WST-1r with apigenin. anticancer therapy. 0043 FIG. 11 Chart showing Effect of Combination treat 0061 (4) The discovery of the method and combinational ment with IKK Inhibitor and WST-1r on melanoma cell lines composition of WST-3 and apigenin or their valid substitutes 0044 FIG. 12 Chart of effects of treatment order of WST as anticancer treatment. 1 r and BMS345541 on induced cell death 0062 (5) The discovery of the method and combinational 0045 FIG. 13 Chart showing WST-1r and Apigenin com composition of WST-1 rand apigenin ortheir valid substitutes bination treatment induced JNK Phosphrylation as anticancer treatment. US 2011/O 142815 A1 Jun. 16, 2011
0063. The first and the second discoveries led to the iden the biological compound for the valid substitutes of Puc19 tification of classes of chemicals and corresponding pharma DNA include different members of Interferon and all the ceutical compositions of using these chemical compounds as siRNAs mentioned above. drugs for the combination treatment for cancer. The third 0074. In another embodiment, a medical use of combina finding further led to the discovery of several genes as targets tion treatment for cancer comprising apigenin, the flavonoids for developing anticancer drugs. These are rarely studied or at least one IKK inhibitor and WST-1r is described. genes and Some of them are still in hypothetical gene status. 0075 Yet in another embodiment, a medical use of com Together, these findings led to establishing several combina bination treatment for cancer comprising at least one Protein kinase II (CK2) inhibitor, apigenin, at least one GSK3f tional treatment methods for cancer therapy. inhibitor, Lithium chloride, and WST-1r for enhancing treat 0064. In one embodiment, the pharmaceutical composi ment effect is described. tion of WST-3 was described as a cell surface oxidative phosphorylation uncouple for the use as drugs for combina II. Definitions tional treatment of cancer. (0076. The term “pUC19 DNA” is a DNA cloning vector 0065. In one embodiment, the pharmaceutical composi (SEQ ID #1) that amplifies in prokaryotic cells. DNA tion of WST-1r was described an agent that interferestPMET sequence of this vector was originally submitted to NCBI for the use as drugs for combinational treatment of cancer. gene bank by J. Messing, Waksman Institute, N.J. on 3-MAR 0.066 Yet in another embodiment, the classes of chemical 1986 and revised by F. Pfeiffer on 16-DEC-1986. In the compounds of WST-3 and their special chemical structures present description, puC19 has been used as a drug for anti for designing drugs to direct target the tRMET and as an cancer therapy by transfected into human cancer cells. uncoupler to block the cell Surface energy metabolism and 0077. The data suggests that the DNA sequence that com cell surface respiration are descried for the use of the combi poses this DNA vector has biological effects in cultured nation treatment for cancer. human cancer cells that lead to synergistic cell death when 0067. Yet in another embodiment, the classes of chemical combined with other treatments to these cells as described in compounds and the combination of these compounds that can this description. Blast analysis of the DNA sequence of form the formula of WST-1r and the valid substitutes of pUC19 against human genome and transcripts for short WST-1 rare descried for the use of the combination treatment matches showed multiple short sequences aligned to varies for cancer. locations of flanking sequences of human genome and tran 0068. In one of the embodiments, Puc19 DNA vector was scripts (Blast result is attached to this application). In the found to have biological effect on mammalian and human present description, puC19 represents the combination of cancer cells and was used as a drug for combination treatment short DNA sequences, usually 15-100 bases that mapped to with WST-1r reagents and with or without IKK inhibitors. human transcripts and/or flanking regions of genes of human 0069. In another embodiment, Puc19 DNA vector was genome DNA sequences. Accordingly, the corresponding used as a drug in combination with chemotherapeutic drug for gene products are the targets of the puC19. The polynucle enhancing the therapeutic effect of these chemotherapeutic otide sequences and amino acid sequences that include but drugs for the treatment of cancer. not limited to siRNA, miRNA, shRNA, peptide that are directly derived from the puC19 DNA sequence as well as 0070 According to the above embodiments, small inter derived from the corresponding genes and Small molecules fering RNAs (SEQ-ID No:10-12), the sequence of which and antibodies that can interact and/or inhibit the function and were derived from the nucleotide sequence of Puc19 DNA activity of these corresponding molecules as direct gene prod vector, were described for the use of combination treatments ucts of their DNA sequences, the DNA sequences of their for cancer. corresponding gene contain these short matched DNA 0071. Yet also according to the above embodiments, sequences from the DNA sequence of puC19. The matched human genes (TRPC6 (SEQ ID NO: 2), MAGI-3(SEQ ID DNA sequences don't have to be exact matches. The matched NO: 4), TMEM182 (SEQ ID NO. 5), SH3PXD2B(SEQ ID DNA sequences can vary slightly, 10%, 20%, and even up to NO:3), or c60rf108 (SEQ ID NO: 14), and the polypeptide 30-40%. sequences of TRPC6 (SEQID NO: 6), MAGI-3(SEQID NO: (0078. The term “pcDNA3m DNA” is a mammalian 8), TMEM182 (SEQ ID NO: 9), SH3PXD2B(SEQ ID NO: expression vector version 3.1 with modifications SEQ ID 7), or c60rf108 (SEQID NO: 15)) that were selected based on #13. DNA sequence of this vector was originally derived Puc19 DNA sequence analysis and the biological function of from the puC19 with further modifications and obtained the corresponding siRNAS to be used as target for drug devel from Invitrogen, which has discontinued the production and opment for the treatment of cancer are described. selling of this vector. pcDNA3 has been transfected into 0072. Yet another embodiment, wherein said the valid human cancer cells by chemical or liposome based DNA substitutes of Puc19 DNA that were selected from biological transfection reagents. Similar to puC19, the DNA sequence and non-biological compounds and their effects in combina that composes this DNA vector have biological effects in tion with WST-1 r or the valid Substitutes of WST-1r and with cultured human cancer cells that lead to synergistic cell death or without IKK inhibitor is described. Wherein said the bio when combined with other treatments to these cells as logical compound for the valid substitutes of Puc19 DNA described. In the present description, pcDNA3 represents the include different members of Interferon and all the siRNAs short DNA sequences, usually 15-100 bases that mapped to mentioned above. human transcripts and/or human genome DNA sequences, 0.073 Yet another embodiment, wherein said the valid and their corresponding gene products that include but not substitutes of Puc19 DNA that were selected from biological limited to siRNA, miRNA, shRNA, peptide that are directly and non-biological compounds and their effects in combina derived from the DNA sequence of this vector and small tion with chemotherapeutic drugs is described. Wherein said molecules that can interact and/or inhibit the function and US 2011/O 142815 A1 Jun. 16, 2011 activity of these corresponding molecules as direct gene prod the siRNA sequence can vary slightly, 10%, 20% and even ucts of their gene sequences, the DNA sequences of their 30-40% from the exact sequence of the transcript. corresponding gene contain these short matched DNA I0083. The term “MAGI3” Nucleotide SEQ ID #4, Pep sequences from the DNA sequence of pcDNA3. The matched tide SEQID #8 represents human transcript of Homo sapiens DNA sequences don't have to be exact matches. The matched membrane associated guanylate kinase, WW and PDZ DNA sequences can vary up to 30-40% changes. domain containing 3 (MAGI3, GeneID: 260425), transcript 0079. The term “siRNA1 SEQ ID #10 is a siRNA variant 2, mRNA (NM 152900.1). Synonyms: MAGI-3, designed based on and derived from the DNA sequence of MGC163281. MAGI-3 is localized with ZO-1 and cingulin at tightjunctions in epithelial cells, whereas MAGI-3 was found pUC19 SEQ ID # 1. This siRNA sequence matches to the in E-cadherin-based cell-cell contacts and in focal adhesion human transcript of Homo sapiens transient receptor poten sites in primary cultured astrocytes (Adamsky K, Arnold K, tial cation channel, subfamily C, member 6(TRPC6, GeneID: Sabanay H. Peles E., Junctional protein MAGIKK interacts 7225), mRNA (gil 19923256|NM 004621.3) synonyms: with receptor tyrosine phosphatase beta (RPTP beta) and TRP6, FSGS2, FLJ11098. In the present description, siRNA1 tyrosine-phosphorylated proteins. (J Cell Sci. 2003,116(Pt was used as a drug for targeting TRPC6 for the treatment of 7): 1279-89). MAGI-3 interacts directly with LPA(2) and cancer. As in general the siRNA sequence can vary slightly, regulates the ability of LPA(2) to activate Erk and RhoA 10%. 20% and even 30-40% of the exact sequence of the MAGIKK regulates LPA-induced activation of Erk and transcript. RhoA (Zhang H. Wang D, Sun H, Hall R A, Yun C C, Cell 0080. The term “siRNA3 SEQ ID #12). is a siRNA Signal. 2007 February: 19(2):261-8. Epub 2006 Aug.9). The designed based on and derived from the puC19DNA function of MAGI3 has been previous linked to cancer, but no sequence SEQID # 1. This siRNA sequence matches to the report regarding the use of MAGI3 as a target for a combina human transcript of Homo sapiens membrane associated gua tional cancer treatment with WST-1r, IKK inhibitors or che nylate kinase, WW and PDZ domain containing 3 (MAGI3, motherapy drugs to reach the Synergistic inhibition of cancer GeneID: 260425), transcript variant 2, mRNA (NM cell growth and to promote cancer cell death. In the present 152900.1) synonyms: MAGI-3, MGC163281 and the Homo description, MAGI3 is a target for developing anticancer sapiens transmembrane protein 182 (TMEM182, GeneID: treatment. MAGI-3 can be targeted by any means that alter its 130827), mRNA (NM 144632.2). In the present descrip expression levels and activities at functioning levels includ tion, siRNA3 was used as drug for targeting MAGI3 and/or ing but not limited to poly nucleotides, such as siRNA, TMEM182 for the treatment of cancer. As in general the shRNA, anti-sense RNA, anti-sense DNA oligo, and domi siRNA sequence can vary slightly, 10%, 20% and even nant negative DNA vectors, peptide and amino acid 30-40% of the exact sequence of the transcript. sequences. Such as peptide, and antibodies, and Small mol 0081. The term “siRNA2 (SEQ ID #11 is a siRNA ecule inhibitors. The siRNA3 sequence described above is the designed based on and derived from the DNA sequence of preferred sequence, but this does not limit from other siRNA pUC19 SEQID#1). The 2/3 of this siRNA sequence matches sequences and other means as described in this paragraph. As to the human transcript of Homo sapiens SH3 and PX in general the siRNA sequence can vary slightly, 10%, 20% domains 2B (SH3PXD2B), mRNA. (SH3PXD2B, GeneID: and even 30-40% from the exact sequence of the transcript. 285590), mRNA (NM 001017995) synonyms: HOFI; I0084. The term “TMEM182 Nucleotide SEQ ID #5, FLJ20831; KIAA 1295. In addition, this sequence also Peptide SEQ ID #9 represents Homo sapiens trans-mem mapped to more than 45 sites within flankin sequences of brane protein 182 (TMEM182, GeneID: 130827), mRNA human genome. In the present description, siRNA2 was used (NM 144632.2). In the present description, SH3PXD2B is a for targeting SH3PXD2B and all the other potential DNA target for developing anticancer treatment. TMEM182 can be sequences in the human genome for the treatment of cancer. targeted by any means that alter its expression levels and As in general the siRNA sequence can vary 30-40% of the activities at functioning levels including but not limited to exact sequence of the transcript. poly nucleotides, such as siRNA, shRNA, anti-sense RNA, 0082. The term “TRPC6'Nucleotide SEQID #2, Peptide anti-sense DNA oligo, and dominant negative DNA vectors, SEQ ID #6 represents human transcript of Homo sapiens peptide and amino acid sequences, such as peptide, and anti transient receptor potential cation channel, Subfamily C. bodies, and small molecule inhibitors. The siRNA3 sequence member 6(TRPC6, GeneID: 7225), mRNA (NM 004621.3) described above is the preferred sequence, but this does not synonyms: TRPC6, FSGS2, FLJ11098. In the present limit from other siRNA sequences and other means as description, TRPC6 is a target for developing anticancer described in this paragraph. As in general the siRNA treatment. TRPC6 can be targeted by any means that alter its sequence can vary 10%, 20% and even30-40% from the exact expression levels and activities at functioning levels includ sequence of the transcript. TMEM182 has not been previ ing but not limited to poly nucleotides, such as siRNA, ously studied and not been linked to cancer. shRNA, anti-sense RNA, anti-sense DNA oligo, and domi I0085. The term “SH3PXD2B” Nucleotide SEQ ID #3, nant negative DNA vectors, peptide and amino acid Peptide SEQ ID #7 represents SH3 and PX domains 2B sequences, such as peptide, and antibodies, and Small mol adaptor protein HOFI (GeneID: 285590) that contains SH3 ecule inhibitors. The TRPC6 has been previous reported as a and PX domains. SH3 domains, Src homology 3 domains, potential target for cancer treatment, but no report regarding bind to prolinerich ligands with moderate affinity and selec the use of TRPC6 as a target for a combinational cancer tivity, preferentially to PxxP motifs; they play a role in the treatment with IKK inhibitors, WST1r or chemotherapy regulation of enzymes by intramolecular interactions, chang drugs to reach the synergistic effect of promoting cancer cell ing the subcellular localization of PX; PhoX homologous death. The siRNA1 sequence described above is the preferred domain, present in p47phoX and p40phoX. Eukaryotic sequence, but this does not limit from other siRNA sequences domain of unknown function presents in phoX proteins, PLD and other means as described in this paragraph. As in general isoforms, and a PI3K isoform. SHPXD2B has not been pre US 2011/O 142815 A1 Jun. 16, 2011
viously studied and not been linked to cancer. In the present (0096. The term “valid substitutes of WST-1r” represents description, SH3PXD2B is a target for developing anticancer any compounds that can substitute the function of WST-1r, treatment. SH3PXD2B can be targeted by any means that WST-1 c, or the electron coupling reagent mPMS or any of the alter its expression levels and activities at functioning levels remaining components either act alone or in any type of including but not limited to poly nucleotides, such as siRNA, combination among these Substitutes or any type of combi shRNA, anti-sense RNA, anti-sense DNA oligo, and domi nation with any of the component of the water soluble tetra nant negative DNA vectors, peptide and amino acid Zolium salt and IEA that comprising WST-1r to function as sequences, such as peptide, and antibodies, and Small mol the WST-1r as described in this specification to reproduce the ecule inhibitors. The siRNA2 sequence described above is the synergistic induction of cancer cell death. The term “valid preferred sequence, but this does not limit from other siRNA substitutes of WST-1r includes, but not limited to all the up sequences and other means as described in this paragraph. As to date available tetrazolium salt based WSTs that include, but in general the siRNA sequence can vary 10%, 20% and even not limited to, WST-1, WST-3, WST-4, WST-5, WST-9, 30-40% from the exact sequence of the transcript. WST-10 AND WST-11, MTS and XTT, and an IEA, includ I0086. The term “C6orf108' Nucleotide SEQ ID #14, ing mPMS and coenzyme Q1 and the combination of these Peptide SEQ ID #15 represents human C6orf108 chromo tetrazolium salts with IEA comprising WST-1+mPMS, WST some 6 open reading frame 108 Homo sapiens GeneID: 3+mPMS, WST-4+mPMS, WST-5+mPMS, WST-9--mPMS, 10591. Official Symbol C6orf108. This gene was identified WST-10+mPMS, WST-11+mPMS, XTT+mPMS, MTS+ on the basis of its stimulation by c-Myc protein. The exact mPMS, WST-3+Q1, WST-4+Q1, WST-5+Q1, WST-9--Q1, function of this gene is not known but studies in rat Suggest a WST-10+Q1, WST-11+Q1, XTT+Q1 MTS+Q1. role in cellular proliferation and c-Myc-mediated transforma (0097. The term “IKK inhibitor” refers to an agent capable tion. In the present description, C6orf108 is a target for devel of inhibiting the activity of Inhibitor kappaB kinase (IKK) oping anticancer treatment. C6orf108 can be targeted by any and thereby inhibiting the kinase activity of IKK and its means that alter its expression levels and activities at func function of activating NF-kB. Therefore, inhibits NF-kB tioning levels including but not limited to poly nucleotides, activity. An IKKinhibitor may be a competitive, noncompeti such as siRNA, shRNA, anti-sense RNA, anti-sense DNA tive, or irreversible IKK inhibitor. A competitive IKKinhibi oligo, and dominant negative DNA vectors, peptide and tor” is a compound or a peptide that reversibly inhibits IKK amino acid sequences, such as peptide, and antibodies, and enzyme activity at the catalytic site: “a noncompetitive IKK small molecule inhibitors. Inhibitor is a compound that reversibly inhibits IKK enzyme 0087. The term “Interferon” (IFN) is a group of cytokines activity at a non-catalytic site; and “an irreversible IKK produced by leucocytes and fibroblasts. The IFN that are inhibitor' is a compound that irreversibly destroys IKK described herein includes all type I and type II IFNs and all enzyme activity by forming a covalent bond with the enzyme. the subtypes of IFN including, but not limited to IFNC. A. The term “IKK inhibitors' include, without limitation, i) IFNG, B, IFNC, C, IFNC, D, IFNC, F, IFNC, G, IFNC, H, IFNC. compounds previously established to exhibit IKK inhibitory I, IFNC.J., IFNC K, IFNo. 4b, IFNC, WA, IFNB, IFNY and IL-6. properties including, but not limited to: SPC839 (Signal Phar I0088. The term “WST-1 c” representing a water soluble maceutical Inc.), Anilino-Pyrimidine Derivative(Signal Phar tetrazolium salt WST-1 4-3-(4-Iodophenyl)-2-(4-nitrophe maceutical Inc.), PS1145(Millennium Pharmaceutical Inc.), nyl)-2H-5-tetrazolio-1,3-benzenedilsulfonate was first BMS-345541*(Bristol-Myers Squibb Pharmaceutical described by ishiyama et al in 1996 (Ishiyam M. et al Biol Research Institute, IKK inhibitor III), SC-514*(Smithkilne Pharm Bull 1996, 19:1515-20). Beecham Corp.), Amino-imidazolecarboxamide derivative I0089. The term “WST-1r” represents a reagent mixture (Smithkilne Beecham Corp.), Ureudo-thiophenecarboxam comprising WST-1c and mPMS at optimized concentration ide derivatives(AstraZeneca), Diarylpybidine derivative and the ratio between WST-1c and mPMS for the combina (Bayer), Pyridooxazinone derivative(Bayer), tion treatment. The optimized concentration and molar ration Indolecarboxamide derivative(Aventis Pharma), Benzoimi of the two components may not be the same as that of the dazole carboxamide derivative(Aventis Pharma), Pyrazolo4. commercial “cell proliferation kit 3-cquinoline derivative(Pharmacia Corporation), Imida 0090. The term “IEA' is the symbol of “Intermediate Zolylduinoline-carbxaldehyde semicarbazide derivative Electron Acceptor. (Tulark Inc.), Pyridyl Cyanoguanidine derivate(Leo 0091. The term “mPMS (1-methoxy-5-methyl-phena Pharma), IkB Kinase Inhibitor Peptide(CalBiochem), IKK-2 Zinium methyl sulfate) is a chemical compound acts as an Inhibitor IV 5-(p-Fluorophenyl)-2-ureidothiophene-3-car “electron coupling agent/IEA when combined with tetrazo boxamide(CalBiochem), IKK Inhibitor II, Wedelolactone lium salts. (CalBiochem), IKK Inhibitor VII (CalBiochem), IKK-2 0092. The term “Q1” (coenzyme Q1, 2,3-Dimethoxy-5- Inhibitor V N-(3.5-Bis-trifluoromethylphenyl)-5-chloro-2- methyl-6-(3-methyl-2-butenyl)-1,4-benzoquinone) is a hydroxybenzamide IMD-0354(CalBiochem), IKK-2 Inhibi chemical compound act as an IEA. tor VI (5-Phenyl-2-ureido)thiophene-3-carboxamide(Cal 0093. The term “WST’ represents the collection of a class Biochem), IKK-2 Inhibitor VIII ACHP 2-Amino-6-(2- of compounds of water soluble tetrazolium salts including, (cyclopropylmethoxy)-6-hydroxyphenyl)-4-(4-piperidinyl)- but not limited to WST-3, WST-4, WST-5, WST-8, WST-9, 3-pyridinecarbonitrile(CalBiochem). ii) In a certain WST-10, WST-11, XTT, and MSN. These compounds are embodiment, the group of IKK inhibitors may additionally also impermeable to cell plasma membrane. include compounds discovered to have IKK inhibitory activ 0094. The term “XTT represents a water soluble tetrazo ity, in accordance with the present specification, and previ lium salt in the similar class of WST-1 as well as a reagent that ously identified to have anti-tumor activity, including, but not composed of XTT and mPMS or coenzyme Q1. limited to PS1145(Millennium Pharmaceutical Inc.), BMS 0095. The term “CCK8” represents a cell counting kite, 345541*(Bristol-Myers Squibb Pharmaceutical Research which is composed of WST-8 and mPMS. Institute). US 2011/O 142815 A1 Jun. 16, 2011
0098. The term “CK2 inhibitor” represents all protein (a dimmer composed of HIF-1C. and HIF-1B), HIF-2 (a dim kinase casein kinase2 inhibitors. The preferred CK2 inhibi mer composed of HIF-2C. and HIF-2B), HIF-3 (a dimmer tors is, but not limited to Apigenin. composed of HIF-3C. and HIF-3B). 0099. The term “Apigenin’ CAS Registry Number: 520 0102) The term “HIF inhibitors” are the biological and 36-5, Chemical Abstracts Service Name: 4H-1-benzopyran non-biological compounds that inhibit HIFs and/or cellular 4-one.5,7-dihydroxy-2-(4-hydroxy-phenyl)-(9CI). It is also responses to hypoxia, including, but not limited to: 2,2-dim named as Apigenine; Chamomile; Apigenol; Spigenin; and ethybenzopyran compounds, chetomin, 2-methoxyestradiol Versulin and is a member of Flavones, a subclass of fla (2ME2), PX-478, 17-N-allylamino-17-demethoxygeldana vonoids. Apigenin is a multi function signal transductor mycin (17-AAG), EZN-2968, camptothecins, NSC 644221. modulator that reduces DNA oxidative damage: inhibit the 3-(5'-hydroxymethyl-2-furyl)-1-benzylindazole (YC-1), growth of human leukemia cells and induced these cells to rapamycin, and decoy oligonucleotides against HIF-1 differentiate; inhibit cancer cell signal transduction and RX-0047. induce apoptosis; act as an anti-inflammatory; and as an anti (0103) The term “tNOX represents a tumor specific cell spasmodic or spasmolytic. Apigenin inhibits activity of NF surface NADH oxidase. It is also called ECTO2. KB, IKK-1 and IKK-2, protein kinase 2 (CK2), mape kinase 0104. The term “tNOX inhibitors' represents the com (MPK), hypoxia inducing factor 1 (HIF), vescular epithelium pounds that are capable of inhibiting the tNOX activity. The growth factor (VEGF) and some other molecules and regula tNOX inhibits, herein, includes, but not limited, catechins: tory pathways Such as cell cycle and angiogenesis, induce p53 catechin, epicatechin (EG), epicatechin gallate (EGC), and activity, maintaining genomic stability by holding cell cycle epigallocatechin gallate (EGCG); and a isoflavenes analogue for mismatch repair or arrest cell cycle and induce apoptosis derivative, the phenoxodiol. etc. Apigenin is know to have the effects of anti-UV radiation 0105. The term “Oxidative Phosphorylation” is a process caused oxidation, and chemoprevention for cancer. The api that coupling the oxidation of the protons with the synthesis genin, herein, is also described as a representative of the of ATP, which transfer and store the energy derived from Subclasses of flavonoids, the flavones including, but not lim glucose metabolism to the ATP as cellular energy source. ited to: tricin, luteolin, tangeritin, 6-hydroxyflavone, Baica 0106 The term “Uncoupler means to uncouple the cel lein, Scutellarein, Wogonin, Diosmin, Flavoxate, Chrysin, lular oxidative phosphrylation process that blocks the ATP the glycosided forms of these flavones, and other subclasses synthesis, the energy metabolism in the cell. The known of the flavonoids with similar biological activities include, but unucouplers including, but not limited to: dinitrophenol not limited to Isoflavones, Flavonols, Flavanones, 3-Hy (DNP), Carbonyl cyanide m-chlorophenyl hydrazone droxyflavanones, Flavan-3-ols, Anthocyanidins, 3-deoxyan (CCCP), Carbonyl cyanide-p-trifluoromethoxyphenylhydra thocyanidin, Anthocyanins, Acetylated and glycosides, and Zone (FCCP), Hindered pheniil (SF6847), Salicylanilide Tannins, as well as isoflavonoids and neoflavonoids. S-13, PCP, TTFB, and alpha-(phenylhydrazono)phenylac 0100. The term “Flavonoids also called bioflavonoids etonitrile derivatives. also collectively know as Vitamin P and citrin, are a class of 0107 The term “LiCl’ is an inorganic salt, lithedium plant secondary metabolites. Herein flavonoids represent all Chloride, and is used as an inhibitor of GSK3f. LiCl, herein, of the three ketone-containing compounds (flavonoid and represents the class of inhibitors that inhibit GSK3f. flavonols) according to IUPAC nomenclature classifications: 0108. The term “IKK” represents Inhibitory kappaB i) the flavonoids derived from 2-phenylchromen-4-one Kinase, which phosphorylate IKB that leads to NF-KAPPAB (2-phenyl-1,4-benzopyrone) structure; ii) isoflavonoids, activation. Two IKK isoforms have been identified. They are derived from 3-phenylchromen-4-one (3-phenyl-1,4-ben IKK1 (IKKO) and IKK2 (IKKB). The term “NF-kappaB' Zopyrone) structure; and iii) neoflavonoids, derived from Nuclear factor kappaB is a family of rel proteins that act as 4-phenylcoumarine (4-phenyl-1,2-benzopyrone) structure; transcription factors regulating gene expression. Normally as well as the non-ketone polyhydroxy polyphenol com NF-KAPPAB proteins forms a dimmer which also complex pounds including: flavanoids, flavan-3-ols and catechins. with an inhibitory kappa B (IKB) molecule stay in inactive Sample compounds include, but not limited to Isoflavone: form in the cytoplasm. Upon signal activation, the IKB is Biochanin A, Daidzein, Daidzin, Formononetin, Genistein, phosphorylated by IKK and dissociate from the NF-kappaB Coumestrol, Puerarin; flavan-3-ols: catechins (catechin, epi dimmer, which release the NF-KAPPAB to entering the catechin (EG), epicatechin, gallate (EGC), and epigallocat nuclear for activating transcription of a special set of genes echin gallate (EGCG)); flavonol: myricetin, quercetin, and that are regulated by NF-KAPPAB. The dissociated IKB will Kaempferol; Isoflavenes: phenoXodiol; Anthocyanins: Anti be degraded by protesomes. Activation of NF-kappaB favors rrhinin, Chrysanthenin, Malvin, Myrtillin, Oenin Primulin, cell proliferation and survival. NF-kappaB activity has been Protocyanin, Tulipanin; 3-deoxyanthocyanidin: Apigenini found to associate with and contribute to carcinogenesis pro din, Columnidin, Diosmetinidin, Luteolinidin, Tricetinidin; cess, tumor progression and resistance of cancer cells to Anthocyanidins: Aurantinidin, Cyanidin, Delphinidin, Euro chemo and radiation therapies. pinidin, Luteolinidin, Malvidin, Pelargonidin, Peonidin, 0109. The term “C-Jun N-terminal kinases” (JNKs), origi Petunidin, Rosinidin; 3-Hydroxyflavanones: Dihydro nally identified as kinases that bind and phosphosphorylate kaempferol, Dihydroquercetin: Flavanones: Eriodictyol. c-Jun on Ser63 and Ser73 within its transcriptional activation Hesperetin, Homoeriodictyol. Naringenin: Flavonols: Fise domain, are mitogen-activated protein kinases which are tin, Isorhamnetin, Kaempferol, Myricetin, Pachypodol, responsive to stress stimuli. Such as cytokines, ultraviolet Quercetin, Rhamnazin, Morin; and their glycoside forms. irradiation, heat shock, and osmotic shock, and are involved 0101. The term “HIF'hypoxia inducible factor represents in T cell differentiation and apoptosis. a family of transcription factors that response to decrease of 0110. The term “Reactive Oxygen Species” (ROS) available oxygen or hypoxia in the cellular environment. includes oxygen ions, free radicals and peroxides both inor Three family members have been identified. They are HIF-1 ganic and organic. They are generally very Small molecules US 2011/O 142815 A1 Jun. 16, 2011 and are highly reactive due to the presence of unpaired 0.122 The term a “therapeutically effective amount of a valence shell electrons. ROSs form as a natural byproduct of compound or a pharmaceutical composition refers to an the normal metabolism of oxygen and have important roles in amount Sufficient to modulate cancer cell proliferation in cell signaling. The effects of ROS on cell metabolism have culture, tumor growth or metastasis in an animal, especially a been well documented in a variety of species. These include human, including without limitation decreasing tumor not only roles in programmed cell death and apoptosis, but growth or size or preventing formation of tumor growth in an also positive effects such as the induction of host defence animal. This term may also mean the effective amount(s) genes and mobilisation of ion transport systems. This is needed to cause cancer cell death or selective cancer cell implicating them more frequently with roles in redox signal death while not causing side effects in normal cells. ing or oxidative signaling. I0123. The term “Pharmaceutically acceptable' indicates 0111. The term “Cancer Cells' represents the cells in cul approval by a regulatory agency of the Federal or a state ture that were derived from human cancer or tumors, which government or listed in the U.S. Pharmacopeia or other gen have malignant features, such as lost of contact inhibition. erally recognized pharmacopoeia for use in animals, and 0112. The term “Cancer describes a diseased state in more particularly in humans. which a carcinogenic agent or agents causes the transforma 0.124. The term a “carrier refers to, for example, a diluent, tion of a normal cell into an abnormal cell, the invasion of adjuvant, excipient, auxiliary agent or vehicle with which an adjacent tissues by these abnormal cells, and lymphatic or active agent of the present specification is administered. Such blood-borne spread of malignant cells to regional lymph pharmaceutical carriers can be sterile liquids. Such as water nodes and to distant sites, i.e., metastasis. and oils, including those of petroleum, animal, vegetable or 0113. The term “Effective dose” As used herein, the term synthetic origin, such as peanut oil, Soybean oil, mineral oil, “effective dose” means that amount of a drug or pharmaceu sesame oil and the like. Water or aqueous saline solutions and tical agent that will elicit the biological or medical response of aqueous dextrose and glycerol Solutions are preferably a cell, tissue, system, animal or human that is being sought, employed as carriers, particularly for injectable Solutions. for instance, by a researcher or clinician. Suitable pharmaceutical carriers are described in “Reming 0114. The term “therapeutically effective amount’ means ton's Pharmaceutical Sciences” by E. W. Martin. It also any amount which, as compared to a corresponding Subject include the transfection reagents as used for deliver of DNA who has not received such amount, results in improved treat and/or RNA into cells either in vitro or in vivo. ment, healing, prevention, or amelioration of a disease, dis 0.125. The term “Concurrently’ means (1) simultaneously order, or side effect, or a decrease in the rate of advancement in time, or (2) at different times during the course of a com of a disease or disorder. The term also includes within its mon treatment schedule. Scope amounts effective to enhance normal physiological 0.126 The term “Sequentially” refers to the administration function. of one active agent used in the method followed by adminis 0115 The term “Treatment of cancer describes the drug tration of another active agent. After administration of one or reagents administrated to the cells or to a mammal, the active agent, the next active agent can be administered Sub duration of the treatment, the method used to administrate stantially immediately after the first, or the next active agent these drugs, or reagents and the order and intervals of between can be administered after an effective time period after the these treatments. first active agent; the effective time period is the amount of 0116. The term “Synergistic effect/Synergize” refers to a time given for realization of maximum benefit from the combination of two or more treatments, which is more effec administration of the first active agent. tive to produce advantageous results than the additive effects of these agents. III Targets and Targeting the Therapeutic Targets for 0117 The term “Chemotherapy Drugs (Agent) refers to the Treatment of Cancer any drugs that have cytrotoxic effect on cancer cells and are I0127. This description provides nucleotide sequences for currently used as a drug for treating cancer. The drugs that genes that implicate and/or can be utilized as therapeutic were tested in this specification are listed as the following. targets for the treatment of cancer, and polypeptides encoded Chemotherapy Drugs that we are mentioned in this specifi by Such sequences and antibodies and compounds reactive cation were not limit to this list. with Such polypeptides in methods of treating a cancer, and 0118. The term “5-fluorouracil'.5-fluoro-2,4-(1H,3H) for agents effective in reducing the activity of cancer-linked pyrimidinedione(5-FU), is commercially available as fluo genes and thereby treating a cancerous condition which were rouracil. not previously established for anti-tumor effect(s). 0119 The term "Cis-Platinum cis-diamminedichloro I0128. The disclosed nucleotide sequences are related to platinum, is commercially available as PLATINOLR) as an and derived from a DNA cloning vector, puC19 (SEQID #1), injectable solution. which was discovered to synergize IKK inhibition, inhibit 0120. The term “Paclitaxel’ is a potent anti-neoplastic cancer cell growth proliferation and promote cancer cell drug; binds to the N-terminal region of B-tubulin and pro death when transfection of this vector to cancer cells was motes the formation of highly stable microtubules that resist combined with or without IKK inhibitor treatment and fol depolymerization, thus preventing normal cell division and lowed by WST-1 r or any of its valid substitutes treatment or in arresting the cell cycle at the G2/M phase. combination with chemotherapeutic drugs. This function of 0121. The term “Doxorubicin', (8S, 10S)-10-(3-amino-2, pUC19 has not been previously reported. Other potential 3,6-trideoxy-alpha.-L-lyxo-hexopyranosyl)oxy-8-gly DNA sequence may also include a pcDNA3 version 3.1, coloy1,7,8,9,10-tetrahydro-6,8,11-trihydroxy-1-methoxy-5, (SEQ ID 13) and the attached blast result entitled: “NCBI 12 naphthacenedione hydrochloride, is commercially Blast pcDNA3 Nucleotide sequence (5448 letters). available as an injectable form as RUBEX(R) or ADRIAMY I0129. Accordingly, the discovery that the anti-cancer CIN RDF(R). effect of pUC19 vector (SEQID #1) was primarily resides in US 2011/O 142815 A1 Jun. 16, 2011
its DNA sequences that are mapped to transcripts and/or short includes a Substitute group, or (iii) one in which the mature sequences (from 15bp up to 100 bp) that flanking the genes in polypeptide is fused with another compound. Such as a com human genome. The human transcripts that puC19 DNA pound to increase the half-life of the polypeptide (for sequences mapped to are, but not limited to, (1) Homo sapiens example, polyethylene glycol), or (iv) one in which the addi transient receptor potential cation channel, Subfamily C. tional amino acids are fused to the mature polypeptide. Such member 6 (TRPC6, GeneID: 7225, mRNA: NM 004621.3, as a leader or secretor sequence or a sequence which is SEQID #2, #6), (2) Homo sapiens SH3 and PX domains 2B employed for purification of the mature polypeptide (such as (SH3PXD2B, GeneID: 285590, mRNA:NM 001017995, a histidine hexapeptide) or a proprotein sequence. Such frag SeO ID #3, #7), (3) Homo sapiens membrane associated ments, derivatives and analogs are deemed to be within the guanylate kinase, WW and PDZ domain containing 3 (MAG scope of those skilled in the art from the teachings herein. IKK, GeneID: 260425, transcript variant 2, mRNA:NM I0135 Substituting these siRNAs (SEQ ID 10, 11, 12) as 152900, SeO ID #4, #8), (4) the Homo sapiens trans-mem disclosed herein above may also be useful in practicing the brane protein 182 (TMEM182, GeneID: 130827, mRNA: processes of the present specification. Examples may include, NM 144632, SeO ID #5, #9) and (5) Homo sapiens chro but not limited to, (i) a siRNA that mapped to another part of mosome 6 open reading frame 108 C6orf108, GeneID: 10591 the sequence of the coding sequence of the gene, (ii) varia SeOID # 14, #15). The human genome sequences that puC19 tions of the siRNA sequences that still capable to target the DNA sequences mapped to are listed in the attached file same gene and reduce it expression level, (iii) any type of “NCBI Blast-pUC19-Human-Transcripts and genome(2686 modifications of the siRNA either at the nucleotides or the letters)”, “NCBI Blast siRNA2 Nucleotide sequence (24 let whole siRNA, (iv) put the siRNA sequence into any type of ters)” and “NCBI Blast pcDNA3 Nucleotide sequence (5448 carriers, such as a vector or a chemical for the delivery of the letters). Sequence. 0130. The polynucleotide disclosed herein incorporate 0.136 The nucleotide sequence of the complete mRNA various polynucleotide transcripts (SEQID NO: 2, 3, 4, 5 and and open reading frame of the transcripts and amino acid 14) and, thus, derived amino acid sequence (SEQID NO: 6, 7, sequences, as discussed above, can be found in the NCBI 8, 9 and 15) from said transcripts are available as targets for GenBank database with the Gene ID or accession numbers treatment of cancer, especially anti-cancer agents, including, listed above. with no limitation, peptide and proteins, such as antibodies 0.137 The pharmaceutical compositions and the medical specific against said polypeptides, peptide inhibitors, Small use as described are based, at least in part, on the discovery of molecule inhibitor, polynucleotides, such as siRNAs, inhibitory effect of puC19 vector in cancer cell growth and shRNA, anti-sense RNA, anti-sense oligo and dominant proliferation and inducing cancer cell death when combined negative DNA vectors. In a particular embodiment the with IKK inhibitor WST-1r treatment as well as in combina wherein said double strand siRNAs are, but not limited to, tion with chemotherapeutic drugs to treat cancer cells. This siRNA1 (SEQ ID #10), siRNA2 (SEQ ID #11), siRNA3 inhibitory effect of puC19 DNA transfection may be substi (SEQ ID #12). tuted by siRNA, compounds or small molecule inhibitor, 0131 The polynucleotides and polypeptides, as gene peptide inhibitor, antibody, shRNA, anti-sense RNA, anti products, used in the processes may comprise a recombinant sense oligo, and antibody and dominant negative DNA vec polynucleotide or polypeptide, a natural polynucleotide or tors targeting the gene to alter its expression level, the corre polypeptide, or a synthetic polynucleotide or polypeptide, or sponding transcripts and/or protein as described above in this a chemically modified polynucleotide or polypeptide. section and at least in partial by IFN. 0132) The nucleotides and polypeptides of the puC19 0.138 Cancers that may be treated using the present dis vector, that are mapped to the human genome, flanking genes covery include, but are not limited to: cancers of the prostate, in the human genome used in the processes of the present colorectum, pancreas, cervix, stomach, endometrium, brain, description may comprise a recombinant polynucleotide or liver, bladder, ovary, testis, head, neck, skin (including mela polypeptide, a natural polynucleotide or polypeptide, or a noma and basal carcinoma), mesothelial lining, esophagus, synthetic polynucleotide or polypeptide. breast, lung (including Small-cell lung carcinoma and non 0.133 Fragments of such polynucleotide and polypeptides Small-cell carcinoma), adrenal gland, thyroid, kidney, glio as are disclosed herein may also be useful in practicing the blastoma, mesothelioma, renal cell carcinoma, gastric carci processes of the present specification. For example, a frag noma, choriocarcinoma, cutaneous basocellular carcinoma, ment, derivative or analog of the polynucleotide (SEQID# 2. and testicular seminoma, sarcoma of muscle, connective tis 3, 4, 5 and 14) may be substituted by (i) any part of these Sue or bone and leukemia. sequences and/or with mismatches for up to 40% of the total sequences been used for, (ii) fused into a DNA vector or any IV. Pharmaceutical Compositions and Methods for type of carriers, (iii) nucleotide sequences with modified Cancer Therapy nucleotides. I0139 1. Inhibition oftBMET and Cell Surface Respiration 0134) Fragments of such polynucleotides and polypep in Combination with Inhibition of HIF as a Strategy for Syn tides as are disclosed herein may also be useful in practicing ergizing Cancer Cell Death as a Cancer Treatment the processes of the present specification. For example, a 0140. A living cell relies on energy. Unlike normal cells fragment, derivative or analog of the polypeptide (SEQ ID that consume oxygen and generate ATP in mitochondrial, NO: 6, 7, 8, 9 and 15) may be (i) one in which one or more of cancer cells consume oxygen on cell surface throughtPMET. the amino acid residues are substituted with a conserved or This cellular geographic difference between cancer cells and non-conserved amino acid residue (more preferably a con normal cells makes the PMETaunique site for cancer specific served amino acid residue) and Such substituted amino acid targeting. In addition, cancer cells are resistant to hypoxia due residue may or may not be one encoded by the genetic code, to increased levels and activities of hypoxia inducible factor or (ii) one in which one or more of the amino acid residues (HIF). Therefore, blocking the PMET while inhibiting the US 2011/O 142815 A1 Jun. 16, 2011
HIF will induce synergistic and cancer specific cell death for derivatives; and 2) intermediate electron acceptor that direct treating cancer in a cancer patient. interact with thMET, including with no limitation: mPMS 0141 One embodiment of the present invention provides and coenzyme Q1; 3) tMET substrates, such as NADH: 4) pharmaceutical compositions comprising (1) a compound the cyanic group (C=N). Such as ferricyanide, and respira that is impermeable to cell plasma membrane and is capable tion inhibitors. of interfering, and/or blocking tMPET and/or cell surface 0147 The chemical structure of the said second chemical respiration, such as WST-1 r. WST-3 or their valid substitute, group or combination of groups that keeps the compound in combination with (2) the second compound that is capable impermeable to cell plasma membrane can be designed and/ of Suppressing cellular Survival signaling, such as NF-KB or produced by a skilled person in the field. Examples include, activities, and/or cellular responses to hypoxia, such as api but not limited to the chemical groups that were used for genin or its valid substitute, HIF inhibitors, IKK inhibitors, modifying the tetrazolium to form the WSTs, such as the flavonoids and puC19 and its valid substitutes. Such a phar chemical structures of the WST-1, WST-3, WST-4, WST-5, maceutical composition may be administered, in a therapeu WST-8, WST-9, WST-10, WXST-11, XTT, MSN that keep tically effective amount, in optimized concentrations in phar the compound impermeable to the cell plasma membrane. maceutical acceptable medium, to a patient in need for the 0.148. Accordingly, the said the first compound is selected treatment of cancer. from the available groups comprising 1) cell plasma mem 0142. The first compound that, is composed of two func brane impermeable uncoupler WST-3, 2) tMET and/or tional chemical groups: A) an functional group that is capable tNOX inhibitors, including, but not limited to capsaicin, cap of binding to and/or interfering and/or blocking the electron Sicin pepper Vanilloid, green tea catechin, epigallocatechin transport process of the tRMET systems, blocking the cou 3-gallate; 3) the reagents that interfere tRMET activities pling of oxidative phosphorylation, and/or inhibiting the including WST-1r and its valid substitutes including but not tNOX, therefore, to block cell surface respiration and oxygen limited to WST-3+mPM, WST-4+mPMS, WST-5+mPMS, consumption; and B) another chemical group or a combina WST-9-mPMS, WST-10+mPMS, WST-11+mPMS, XTT+ tion of chemical groups that make(s) the entire compound mPMS, MSN+mPMS, WST-3+Coenzyme Q1, WST-4+Co impermeable to cell plasma membrane and capable of block enzyme Q1, WST-5+Coenzyme Q1, WST-9--Coenzyme Q1, ing the said compound penetrating the cell plasma membrane WST-10+Coenzyme Q1, WST-11+Coenzyme Q1, XTT+Co and entering the cell. By integrating these functional groups enzyme Q1, and MSN+Coenzyme Q1; 4) the compounds that into single molecule, the said compound is capable of inter include at least one of the functional groups as described fering, inhibiting and/or blocking the tRMET, or the oxidative above in the paragraph 00109 and are impermeable to cell phosphorylation process or the coupling of the oxidative plasma membrane that can be designed and produced by a phosphorylation and cell Surface respiration specifically on skilled person in the field. cell Surface, but not affecting the mitochondrial respiration in 014.9 The said second compound is the one that inhibits normal cells. cell hepoxia responses, which when combined with the first 0143 WST-3 represents such a class of the first com compound, results in Synergistic cell death, such as apigenin. pound. It contains a dinitrophenol functional group and a The said second compound is selected from the groups com chemical group that is impermeable to cell plasma mem prising 1)HIF inhibitors, 2) the flavonoids and its subclasses brane. such as flavorones, 3inhibitors that inhibit NF-kB activities, 014.4 FIG. 1 diagrams the chemical structure of WST-3 such including, but no limited to IKK inhibitors, 4) plasmid (Japanese patent JP2592436.B., 1995), which is composed DNA pUC19 SEQID No:1 and its valid substitutes includ with a 2,4-Dinitrophenol (DNP), chemical structure as the ing, but not limited to at least one of the siRNAs derived from said functional chemical group and a 1,3-benzenedilsul SEQID No: 10, 11, 12, means to targeting the genes (SEQ fonate and a 4-Iodophenyl to enhance its hydrophilic fea ID No. 2, 3, 4, 5, 14 and their corresponding gene products ture SEQID No. 6,7,8,9, 15 to alter their expression levels and 0145 The DNP is an oxidative phosphorylation uncoupler functional activities including, but not limited to nucleotide by dissolving in the inner membrane of mitochondria and sequences including dominant negative DNA that block the forms a protonophore, which caused the protons across the function of the corresponding gene products, siRNA, anti mitochondrial membrane, leading to a rapid consumption of Snese RNA, antisense oligo, peptides, peptide inhibitors, anti energy without generating ATP. By integrating the said DNP bodies, small molecule inhibitors. with the said second group, the cell plasma impermeable 0150. The said apigenin is a flavone, a subclass of fla group, it keeps the DNP from entering the cell, but can only vonoids, and is a multi-function signal transduction modula act on the cell plasma membrane. As cancer cells respiration tor and/or inhibitor to cells. Its function includes, but not mainly rely on cell surface, the WST-3 will only blocks the limited to induction of p53 activation, suspend cell cycle cell surface respiration of cancer cells, but, will not affect the progression for maintaining genomic stability, inhibiting oxidative phosphorylation in mitochondrial from normal expression and/or activities of hypoxia induced factor-1 cells, hence, the treatment will be cancer specific. (HIF-1), casein kinase II, NF-kB, IKK and induction of gen 0146 The DNP as the said first functional chemical group eration of reactive oxygen species (ROS) and more. represents an uncoupler of oxidative phosphorylatoin and 0151. The second compound and the valid substitutes of may also implicate other ways of blocking tPMET and cell apigenin is selected from the groups comprising (1) At least surface respiration. Accordingly, the said DNP can be substi one flavones, include, but not limited to nature existed fla tuted by 1) the compounds of oxidative-phsphorylation Vones, such as: tricin, Luteolin, Tangeritin, Chrysin, 6-hy decoupling agents comprising: carbonyl cyanide m-chloro droxyflavone, Baicalein, Scutellarein, Wogonin and synthetic phenyl hydrazone (CCCP) and Carbonyl cyanide p-rifluo flavones, such as: Diosmin, Flavoxate, additional Subgroups romethoxyl-phenyl-hydrozone (FCCP), SF 6847, salicyla of flavones:flavonols, flavannones, flacanonols, catechins, nilide S-13, and alpha-(phenylhydrazono)phenylacetonitrile isoflavones; or US 2011/O 142815 A1 Jun. 16, 2011
0152 (2) at least one from other subgroups of Flavonoid CalBiochem). ii) In a certain embodiment, the group of IKK (Bioflavonoids) and their isoforms including naturally inhibitors may additionally include compounds discovered to existed, artificial modified ketone isoforms and synthetic have IKK inhibitory activity, in accordance, and previously compounds including, but not limited to flavonoids, derived identified as anti-tumor agents, including, but not limited to from 2-phenylchromen-4-one (2-phenyl-1,4-benzopyrone) PS1145(Millennium Pharmaceutical Inc.), BMS-345541* structure (examples: quercetin, rutin); isoflavonoids, derived (IKK inhibitor III, Bristol-Myers Squibb Pharmaceutical from 3-phenylchromen-4-one (3-phenyl-1,4-benzopyrone) Research Institute); or structure; neoflavonoids, derived from 4-phenylcoumarine (O155 (5) at leastone nucleotide sequences SEQID NO:1, (4-phenyl-1,2-benzopyrone) structure, and flavanoids as a 10, 11, 12, 13, and means for targeting the genes of poly non-ketonepolyhydroxy polyphenol compounds, including: nucleotide sequences SEQID No. 2, 3, 4, 5, 14 and peptide flavanoids, flavan-3-ols and catechins. Sample compounds sequences SEQID No. 6,7,8,9, 15 to inhibit the expression include, but not limited to Isoflavone:Biochanin A, Daidzein, levels and functional activities of the corresponding genes by Daidzin, Formononetin, Genistein, Coumestrol, Puerarin; siRNA, antisense RNA, antisense oligo, dominant negative flavan-3-ols: catechins (catechin, epicatechin (EG), epicat DNA, peptide, peptide inhibitors, antibodies, small molecule echin, gallate (EGC), and epigallocatechin gallate (EGCG)); inhibitors. flavonol: myricetin, quercetin, and Kaempferol; Isoflavenes: phenoXodiol; Anthocyanins: Antirrhinin, Chrysanthenin, 2. Pharmaceutical Composition and Method of WST-3 and Malvin, Myrtillin, Oenin Primulin, Protocyanin, Tulipanin; Apigenin Combination Treatment for Cancer Therapy 3-deoxyanthocyanidin: Apigeninidin, Columnidin, DioSme 0156. One of the best mode embodiment of the present tinidin, Luteolinidin, Tricetinidin; Anthocyanidins: Auran invention provides pharmaceutical compositions comprising tinidin, Cyanidin, Delphinidin, Europinidin, Luteolinidin, (1) at least one Water-soluble tetrazolium salts 3 (WST-3,2- Malvidin, Pelargonidin, Peonidin, Petunidin, Rosinidin; (4-Iodophenyl)-3-(2,4-dinitrophenyl)-5-(2,4-disulfophe 3-Hydroxyflavanones: Dihydrokaempferol, Dihydroquerce nyl)-2H-tetrazolium, sodium salt, FIG. 1A) or its valid sub tin: Flavanones: Eriodictyol, Hesperetin, Homoeriodictyol. stitutes in combination with (2) at least one apigenin or its Naringenin: Flavonols: Fisetin, Isorhamnetin, Kaempferol, valid Substitutes. Such a pharmaceutical composition may be Myricetin, Pachypodol, Quercetin, Rhamnazin, Morin; and administered, in a therapeutically effective amount, in opti their glycoside forms; or mized concentration in pharmaceutical acceptable medium, 0153 (3) At least one HIF inhibitors and/or inhibition of to a patient in need for the treatment of cancer. cellular responses to hypoxia including, but not limited to: O157 WST-3 is a water soluble tetrazoliums (WST) that 2,2-dimethybenzopyran compounds, chetomin, 2-methox were developed by Dojindo Inc., whose WSTs have sulfate yestradiol (2ME2), PX-478, 17-N-allylamino-17-demethox groups added directly or indirectly to the phenyl ring to ygeldanamycin (17-AAG), EZN-2968, camptothecins, NSC improve water-solubility that also makes the compound 644221, 3-(5'-hydroxymethyl-2-furyl)-1-benzylindazole impermeable to cell plasma membrane. Different from all (YC-1), rapamycin, and decoy oligonucleotides against other WSTs, WST-3 contains a 2,4-dinitrophenol (DNP) HIF-1 RX-0047; or group directly linked to the tetrazolium ring (FIG. 1). 0154 (4) IKK inhibitors are as listed above and following 0158 DNP, a cellular metabolic poison, represents a class embodiments include compounds which exhibits IKK inhibi of six manufactured chemical compounds that can dissolve in tory activity in pharmaceutically acceptable medium. The at the mitochondria membrane, acts as a proton ionophore, an least one IKK inhibitor may be selected from compounds of agent that can shuttle protons (hydrogen ions) across biologi the group consisting of without limitation, i) compounds cal membranes, where it uncouples oxidative phosphoryla previously established to exhibit IKK inhibitory properties tion by carrying protons across the mitochondrial membrane, including, but not limited to: SPC839 (Signal Pharmaceutical leading to a rapid consumption of energy without generating Inc.), Anilino-Pyrimidine Derivative(Signal Pharmaceutical ATP. DNP defeats the proton gradient across mitochondria Inc.), PS1145(Millennium Pharmaceutical Inc.), BMS and chloroplast membranes, collapsing the proton motive 345541*(IKK inhibitor III, Bristol-Myers Squibb Pharma force that the cell uses to produce most of its ATP chemical ceutical Research Institute), SC-514*(Smithkilne Beecham energy. Instead of producing ATP, the energy of the proton Corp.), Amino-imidazolecarboxamide derivative(Smithkilne gradient is lost as heat. Cells counteract the lowered yields of Beecham Corp.), Ureudo-thiophenecarboxamide derivatives ATP by oxidizing more stored reserves such as carbohydrates (AstraZeneca), Diarylpybidine derivative(Bayer), Pyridoox and fat. DNP has been used as weight loss treatment for azinone derivative(Bayer), Indolecarboxamide derivative burning extra fats. However, it is toxic to the cells by exough (Aventis Pharma), Benzoimidazole carboxamide derivative sting cell energy sources. (Aventis Pharma), Pyrazolo 4.3-cquinoline derivative 0159 General structure feature of uncouplers are weak (Pharmacia Corporation), Imidazolylduinoline acids comprising the chemical groups: Weakly Acidic Phe carbxaldehyde semicarbazide derivative(Tulark Inc.), nols, benzimidazoles, N-phenylanthranilates, salicylanilides, Pyridyl Cyanoguanidine derivate(Leo Pharma), IKB Kinase phenylhydrazones, Salicylic acids, acyldi-thiocarbazates, Inhibitor Peptide(CalBiochem), IKK-2 Inhibitor IV 5-(p- cumarines, and aromatic amines. Fluorophenyl)-2-ureidothiophene-3-carboxamide(CalBio 0160 The chemical structures of representative weakly chem), IKK Inhibitor II (Wedelolactone(CalBiochem), IKK acidic uncouplers that are capable of substituting the DNP are Inhibitor VII (CalBiochem), IKK-2 Inhibitor V (N-(3.5-Bis selected from the groups comprising: 5-chloro-3-tert-butyl trifluoromethylphenyl)-5-chloro-2-hydroxybenzamide 2'-chloro-4'-nitrosalicylanilide (S-13), sodium 2,3,4,5,6-pen IMD-0354, CalBiochem), IKK-2 Inhibitor VI (5-Phenyl-2- tachlorophenolate (PCP), 4,5,6,7-tetrachloro-2-(trifluorom ureido)thiophene-3-carboxamide, CalBiochem), IKK-2 ethyl)-1H-benzimidazole (TTFB), Flufenamic acid (2-3- Inhibitor VIII (ACHP 2-Amino-6-(2-(cyclopropylmethoxy)- (trifluoromethyl)anilinobenzoic acid), 3,5-di-tert-butyl-4- 6-hydroxyphenyl)-4-(4-piperidinyl)-3-pyridinecarbonitrile, hydroxy-benzylidenemalononitrile (SF6847), carbonyl US 2011/O 142815 A1 Jun. 16, 2011
cyanide m-chloro phenyl hydrazone (CCCP) and Carbonyl including, but not limited to: SPC839 (Signal Pharmaceutical cyanide p-trifluoromethoxy-phenyl-hydrazone (FCCP), Inc.), Anilino-Pyrimidine Derivative(Signal Pharmaceutical and alpha-(phenylhydrazono)phenylacetonitrile derivatives. Inc.), PS1145(Millennium Pharmaceutical Inc.), BMS 0161 The incorporating DNP into the water soluble tetro 345541*(IKK inhibitor III, Bristol-Myers Squibb Pharma Zolium salts that keeps the WST-3 impermeable to cell plasma ceutical Research Institute), SC-514*(Smithkilne Beecham membrane, hence, makes WST3 capable of mimicking the Corp.), Amino-imidazolecarboxamide derivative(Smithkilne DNP effect to act on cell plasma membrane for uncoupling Beecham Corp.), Ureudo-thiophenecarboxamide derivatives oxidative phosphorylation that interrupts thMET, but does (AstraZeneca), Diarylpybidine derivative(Bayer), Pyridoox not affect mitochondria in normal cells (FIG. 1). azinone derivative(Bayer), Indolecarboxamide derivative 0162 Thus, WST-3 represents classes of compounds that (Aventis Pharma), Benzoimidazole carboxamide derivative comprises of (1) an active group that is capable of blocking (Aventis Pharma), Pyrazolo 4.3-cquinoline derivative tPMET and/or oxidative phosphorylation and/or the coupling (Pharmacia Corporation), Imidazolylduinoline process between these two processes and (2) the chemical carbxaldehyde semicarbazide derivative(Tulark Inc.), structure that keeps the compound impermeable to cell Pyridyl Cyanoguanidine derivate(Leo Pharma), IKB Kinase plasma membrane. In this way Such a compound shall be able Inhibitor Peptide(CalBiochem), IKK-2 Inhibitor IV 5-(p- to specifically block the tRMET electron transfer and/or oxi Fluorophenyl)-2-ureidothiophene-3-carboxamide(CalBio dative phosphorylation of ADP on cell surface, hence, spe chem), IKK Inhibitor II (Wedelolactone(CalBiochem), IKK cifically inhibit tRMET and ATP production in cancer cells. Inhibitor VII (CalBiochem), IKK-2 Inhibitor V (N-(3.5-Bis (0163 The valid substitutes of WST-3 include, but not lim trifluoromethylphenyl)-5-chloro-2-hydroxybenzamide ited to the compounds that contains the combination of the IMD-0354, CalBiochem), IKK-2 Inhibitor VI (5-Phenyl-2- two said features including (1) the active group as described ureido)thiophene-3-carboxamide, CalBiochem), IKK-2 above that can block the tRMET and/or oxidative phospho Inhibitor VIII (ACHP 2-Amino-6-(2-(cyclopropylmethoxy)- rylation and/or the coupling of the tRMET and the oxidative 6-hydroxyphenyl)-4-(4-piperidinyl)-3-pyridinecarbonitrile, phosphoryalation process (2) the chemical structure that CalBiochem). ii) In a certain embodiment, the group of IKK makes the resulting compound impermeable to cell plasma inhibitors may additionally include compounds discovered to membrane as described above for the first compound as have IKK inhibitory activity, in accordance, and previously described in paragraph 0038. identified as anti-tumor agents, including, but not limited to 0164. The said Apigenin is a flavonoid and is a multi PS1145(Millennium Pharmaceutical Inc.), BMS-345541* function inhibitor to cells. Its function includes, but not lim (IKK inhibitor III, Bristol-Myers Squibb Pharmaceutical ited to induction of p53 activation, Suspend cell cycle pro Research Institute). gression to maintain genomic stability, inhibiting expression 0.167 (5) at least one nucleotide sequences SEQID NO:1, and/or activities of hypoxia induced factor-1 (HIF-1), casein 10, 11, 12, 13, and means for targeting the genes of poly kinase II, NF-kB, induction of generation of ROS and more. nucleotide sequences SEQID No. 2, 3, 4, 5, 14 and peptide 0.165. The valid substitutes of apigeninare are selected sequences SEQID No. 6,7,8,9, 15 to inhibit the expression from the groups comprising: at least one flavones, include, levels and functional activities of the corresponding genes by but not limited to nature existed flavones, such as: Tricin, siRNA, antisense RNA, antisense oligo, dominant negative Luteolin, Tangeritin, Chrysin, 6-hydroxyflavone, Baicalein, DNA, peptide, peptide inhibitors, antibodies, small molecule Scutellarein, Wogonin and synthetic flavones, such as: inhibitors. Diosmin, Flavoxate, additional subgroups of flavones: fla One embodiment provides methods and a treatment protocol Vonols, flavannones, flacanonols, catechins, isoflavones; at for inducing cancer cell death and tumor Suppression to treat least one from other subgroups of Flavonoid or Bioflavonoids cancer in a patient. In accordance with this method, it has and their isoforms including naturally existed, artificial modi been discovered that the combination of WST-3 and/or its fied isoforms and synthetic compounds including, but not valid Substitutes with an apigenin and/or its valid Substitutes limited to flavonoids, derived from 2-phenylchromen-4-one for synergistic induction of cancer cell death and Suppression (2-phenyl-1,4-benzopyrone) structure (examples: quercetin, of tumor growth. rutin); isoflavonoids, derived from 3-phenylchromen-4-one 0168 Accordingly, cancer cells are treated with effective (3-phenyl-1,4-benzopyrone) structure; neoflavonoids, dose(s) of WST-3 and/or at least one of its valid substitutes in derived from 4-phenylcoumarine (4-phenyl-1,2-benzopy combination with apigenin and/or at least one of its valid rone) structure, and flavanoids as a non-ketonepolyhydroxy Substitutes in pharmaceutical acceptable medium for effec polyphenol compounds as described in paragraph 00115 and tive time period. 00114; at least one HIF inhibitors and/or inhibition of cellu (0169. The valid substitutes of WST-3 include, but not lim lar responses to hypoxia including, but not limited to: 2.2- ited to the compounds that contains the combination of the dimethybenzopyran compounds, chetomin, 2-methoxyestra two said features including (1) the active group as described diol (2ME2), PX-478, 17-N-allylamino-17 above that can block the tRMET and/or oxidative phospho demethoxygeldanamycin (17-AAG), EZN-2968, rylation and/or the coupling of the tRMET and the oxidative camptothecins, NSC 644221, 3-(5'-hydroxymethyl-2-furyl)- phosphoryalation process (2) the chemical structure that 1-benzylindazole (YC-1), rapamycin, and decoy oligonucle makes the resulting compound impermeable to cell plasma otides against HIF-1 RX-0047. membrane as described above for the first compound as listed 0166 IKK inhibitors are as listed above and following in the paragraph I0038. embodiments include compounds which exhibits IKK inhibi (0170 The suitable active groups that can block the tRMET tory activity in pharmaceutically acceptable medium. The at and oxidative phosphorylation include, but not limited to the least one IKK inhibitor may be selected from compounds of DNP group and the cyano group. the group consisting of without limitation, i) compounds 0171 Suitable as least one valid substitute for apigenin, as previously established to exhibit IKK inhibitory properties listed above, include, but not limited to (1) any other fla US 2011/O 142815 A1 Jun. 16, 2011 vonoids and their isoforms including naturally existed, arti 0185. Alternatively, administering of apigenin or at least ficial modified isoforms and synthetic compounds, any isof one of its valid substitutes and the WST-3 or its valid substi levens as described in paragraph 00114 and 00115; (3) tutes can be concurrently to the cancer cells continuesly. inhibitors to HIF-1 and/or any inhibitors to cellular responses 0186 The actual treatment doses of WST-3 and apigenin to hypoxias described in paragraph 00116; (4) inhibitors to and the treatment time of these compounds can be adjusted by NOXes especially tNOX as described in paragraph 0035: a physician or a skilled person. (5) inhibitors that can mimic one or more of the predeter 0187. The preferred embodiment for the treatment is to mined apigenin effects. administer the apigenin or at least one of its valid Substitutes 0172. It is yet another embodiment to treat cancer cells and the WST-3 or its valid substitutes to the cancer cells for 4 with WST-3 with at least one apigenin or any of its valid hours, then remove the treatments and administering the api substitutes for both WST-3 and apigenin simultaneously and genin or at least one of its valid substitutes for another 24 sequentially in any order for each of the above and following hours. This is because we have the most date for. embodiments, forming a more preferred embodiment. 0188 Cancers that may be treated using the combinatorial 0173 It is yet another embodiment to treat cancer cells protocol with WST-3 or its valid substitutes in combination with WST-3 with at least one IKK inhibitor or all other valid with apigenin or its valid Substitutes are carcinomas and substitutes for both WST-1r and IKK inhibitor simulta sarcomas include, but are not limited to those carcinomas and neously and sequentially in any order for each of the above sarcomas that may be treated using the present protocol and following embodiments, forming a more preferred include, but are not limited to: cancers of the sqoumas cell embodiment. carcinoma, breast, prostate, colorectum, pancreas, cervix, stomach, endometrium, brain, liver, bladder, ovary, testis, (0174. The in vitro effective dose of WST-3 may be 50 uM head, neck, skin (including melanoma and basal carcinoma), or lower, but can be higher as well. mesothelial lining, esophagus, breast, muscle, connective tis 0.175. The effective dose of apigenin under in vitro cell Sue, lung (including Small-cell lung carcinoma and non culture may be at 1-100 uM. Small-cell carcinoma), adrenal gland, thyroid, kidney, or (0176 The WST-3 or at least one of its valid substitutes and bone; glioblastoma, mesothelioma, renal cell carcinoma, gas apigenin or at least one of its valid Substitutes may be admin tric carcinoma, sarcoma, choriocarcinoma, cutaneous baso istered to cancer cells or to cancer patients concurrently, cellular carcinoma, and testicular seminoma, Soft tissue sar separately and/or sequentially in any order. coma, as well as lymphomas and leukemia. (0177. Each of the treatment agents may be administrated (0189 Accordingly, one of the embodiments of this inven via oral, intra peritonea injection, intra muscular injection, tion provides a method for treating cancer in a patient by intravenous injection, intravenous infusion, intraartery infu combination of (1) means of blocking tPMET and/or uncou Sion, intra artery injection, as well as via dermal penetration. pling the oxidative-phosphorylation on the cell plasma mem 0.178 The treatment time of WST-3 or at least one of its brane with (2) means of inhibiting cellular responses to valid substitutes may be between pulsed for 30 minutes to 8 hypoxia, HIF, NOX. NF-KB activity or mimic one or more of hours of initial treatment or continuesly. predetermined apigenin effects on cancer cells. 0179 The treatment time of apigenin or at least one of its (0190. The means to block tMET and/or uncouple oxida valid substitutes may be last for 15 minto 24 hours consecu tive phosphorylation on the cell plasma membrane include, tively or longer. but not limited to: the cell plasma membrane impermeable tMPET oxidative phosphorylation uncoupler or its valid sub 0180. In other words, the WST-3 or at least one of its valid stitutes are the compounds that can inhibit the trans plasma substitutes may be treated first with effective dose for 30 membrane electron transfer process, or the oxidative phos minutes to 4 hours in the absence of apigenin, then, remove phorylation process or the coupling of electron transport and the WST-3 and administer the apigenin or at least one of its the oxidative phosphorylation and impermeable to cell valid substitutes to the cancer cells for another 4 to 24 hours; plasma membrane. O 0191 The means of inhibiting cellular responses to 0181 Alternatively, administering the apigenin or at least hypoxia, HIF, NOX. NF-kB activity, or mimic one or more of one of its valid substitutes to the cancer cells for another 4 to predetermined apigenin effects on cancer cells including, but 24 hours, and then, remove the administer the apigenin or at not limited to treatment with apigenin, or its valid Substitutes. least one of its valid substitutes and administering the WST-3 0.192 The order of the treatment to cancer cells or cancer or its valid substitutes to cancer cells for 30 minutes to 4 patients of the means of blocking tPMET and/or oxidative hours; or phosphorylation on the cell plasma membrane with the means 0182 Alternatively, administering the apigenin or at least of inhibiting cellular responses to hypoxia, HIF, NOX. NF one of its valid substitutes and the WST-3 or its valid substi KB activity, or mimic one or more of predetermined apigenin tutes to the cancer cells for 30 minutes to 4 hours, then remove effects on cancer cells can be concurrently or sequentially in the treatments and administering the apigenin or at least one any order at effective doses and effective time period for the of its valid substitutes for another 4-24 hours, or treatment. 0183 Alternatively, administering the apigenin or at least 0193 The present invention also provides additional one of its valid Substitutes for 24 hours, then, administering methods for inducing cancer cell death and Suppressing the WST-3 or at least one of its valid substitutes to the treat tumor growth in cancer patients. In accordance with the ment of cancer cells for 30 minutes to 4 hours, present invention, it has been discovered that the combination 0184 Alternatively, administering of apigenin or at least of a flavonoid, apigenin, or its valid Substitutes, with the one of its valid substitutes and the WST-3 or its valid substi WST-3 or the valid substitutes at effective concentration for tutes can be concurrently to the cancer cells for 30 minutes to synergistic induction of cancer cell death. Accordingly, the 4 hours. present invention provides a pharmaceutical composition and US 2011/O 142815 A1 Jun. 16, 2011
protocol for the treatment of cancer in a patient in need with 0202 Cancers that may be treated using the combinatorial effective dose comprising of at least one flavonoid, specifi protocol with WST-3 or its valid substitutes in combination cally, apigenin, or its valid substitutes, with WST-3 or at least with apigenin include, but are not limited to Cancers that may one of the valid substitutes of the WST-3 in a pharmaceutical be treated using the present protocol include, but are not acceptable medium. limited to: colorectum, pancreas, cervix, stomach, 0194 Suitable flavonoids include, but not limited to, api endometrium, brain, liver, bladder, ovary, testis, head, neck, genin and valid Substitutes of apigenin as described above in skin (including melanoma and basal carcinoma), mesothelial paragraph 00114-00118 in pharmaceutically acceptable lining, white esophagus, breast, muscle, connective tissue, medium. lung (including Small-cell lung carcinoma and non-Small-cell 0.195 The valid substitutes of apigenin include the com carcinoma), adrenal gland, thyroid, kidney, or bone; glioblas pounds that exhibit inhibitory activity as at least one of the toma, mesothelioma, renal cell carcinoma, gastric carcinoma, effects of that Apigenin does in pharmaceutically acceptable sarcoma, choriocarcinoma, cutaneous basocellular carci medium. noma, and testicular seminoma, leukemia, lymphoma and sarcomas, lymphomas and leukemia. 0196. The suitable at least one of the valid substitutes for the WST-3, as noted herein above in paragraph 00111. include, but are not limited to the individual components that 3. Pharmaceutical Composition and Treatment Method of are comprises the active group as represented by DNP and the Combination of WST-1r and Apigenin for the Treatment of valid substitutes for tetrazolium salts that make the compound Cancer impermeable to cell plasma membrane at optimized concen 0203 One embodiment of the invention provides pharma trations in pharmaceutically acceptable medium. ceutical compositions comprising 1) WST-1 r or its valid sub 0197) The effective concentration of apigenin that were stitutes, which have not previously been established as having used may vary depending on cell type. The preferred dose is an anticancer effect. The WST-1r has been used as a cell at the range of 1-100 uM in vitro. proliferation detection agent, the Cell Proliferation WST-1. 0198 For all the above and following embodiments, the When WST-1r combined with 2) apigenin, a flavonoid, or its effective concentration of WST-3 and the valid substitutes valid substitutes, oran IKK inhibitor, or trasnfection of Puc19 may vary depending on the individual composition and the or its valid Substitutes Synergize the induction of cancer cell effective concentration of each of the composition may or death. Such a pharmaceutical composition may be adminis may not be the same concentration as that in the WST-3 and tered, in a therapeutically effective amount, in optimized may vary from each of the compositions and their valid Sub concentration in phosphate buffered saline or any of the valid stitutes and between in vitro and in vivo usage. The preferred pharmaceutical acceptable medium, to a patient in need for in vitro concentration range for in vitro treatment of WST-3 is the treatment of cancer. 50 uM or lower in a pharmaceutical acceptable medium. 0204 The afficacy of the said anticancer treatment imme 0199. In a specific embodiment of the present invention, diate above was synergized by combination use of WST-1r the administration of the WST-3 or at least one valid substi and its valid substitutes which have not previously been estab tutes of WST-3, the apigenin or at least one of the valid lished. The Cell Proliferation WST-1r is composed of a tet Substitutes of apigenin can be in any type of order. Specifi razolium salt, WST-1c (WST-1, Ishiyam M. etal Biol Pharm cally, the WST-3 or at least one valid substitutes of WST-3, Bull 1996, 19:1515-20; Berridge M. V. et al Biotechnology and the apigenin or at least one of the valid Substitutes of Annual Review, Vol. II: 127-152, 2005), and an IEA, mPMS, apigenin may be administered to the cells or patient concur (Berridge M. V. et al Biotechnology Annual Review, Vol. rently or sequentially. In other words, the apigenin or at least II: 127-152, 2005) diluted in phosphor buffered saline. WST one of the valid substitutes of apigenin or the WST-3 or the at 1 r has also been used for measuring tPMET activity. Treat least one substitute of WST-3 may be administered first, or the ment with WST-1 renhanced cell respiration. When the WST WST-3 or at least one valid substitutes of WST-3, and the 1r treatment was withdraw following the treatment and in apigenin or at least one of the valid Substitutes of apigenin combination of inhibiting HIF by apigenin or any of its valid may be administered at the same time. The preferred order of Substitutes resulted in Synergized cancer cell death. In the the treatment in this invention is to administer the WST-3 or present invention, WST-1r is used as a drug for a combination the valid substitutes of WST-3 and the apigenin or the valid treatment for cancer therapy. Substitutes of apigenin simultaneously and then, after 0205. In accordance, the active gradient of WST-1r for the removal of the WST-3, add apigenin again and keep in contact treatment of cancer can be either the WST-1c or the mPMS or with cells for another 24 hours. the combination of the two components in optimized concen 0200. In a particular embodiment, the treatment of WST-3 tration and optimized ratio. The WST-1r that as described is in contact with cells for 15 minutes to 8 hours. The pre herein above and there after represents a group of chemical ferred time is between 30 minto 4 hours. The more preferred compound or mixture of combinations of a water soluble time is between 2-4 hours. A removal of the WST-3 or its valid tetrazolium salt and an IEA that are capable of interacting substitute's from treatment is required for all the above and with and/or interfering to tMET, and/or capable of inducing following embodiments to induce programmed cell death of reactive oxygen species (ROS) generation. the treated cells by this method thereof. 0206. The valid substitutes of WST-1c include, but not 0201 Moreover, the present invention provides a method limited to other WST, including, but not limited to WST-3, for the treatment of cancer by administering to a patient, in WST-4, WST-5, WST-9, WST-10, WST-11, MSN and XTT at need thereof, a therapeutically effective dose of at least one of optimized concentration in a pharmaceutical acceptable the WST-3 or its valid substitutes and apigenin or at least one medium. of its valid substitutes mentioned above in pharmaceutical 0207. The valid substitutes of mPMS include, other IEAs, acceptable medium. examples may be as, but not limited to coenzyme Q1 (Ber US 2011/O 142815 A1 Jun. 16, 2011
ridge M. V. et al Biotechnology Annual Review, Vol. II: 127 0216. It is yet another embodiment to treat with (1) the 152, 2005) at optimized concentration in a pharmaceutical DNA transfection, or IFN, or siRNA transfection or all other acceptable medium. valid substitutes and, then, (2) one of the IKK, or CK2 or 0208. The WST-1r includes compositions of at least one GSK3.f3 inhibitors and, simultaneously or sequentially in any WST, WST-1c, and at lease one IEA, mPMS in optimized order treat with any valid substitution for WST-1r for each of concentration and ratio in a pharmaceutical acceptable the above and following embodiments, forming a more pre medium. ferred embodiment 0209. The valid substitute of WST-1r includes, but not 0217. It is yet another embodiment to treat with (1) the limited to (1) the combination of at least one WST with at DNA transfection, or IFN, or siRNA transfection or all other least one IEA. Examples as, but not limited to: WST-1+ valid substitutes and, then, (2) one of the IKK, or CK2 or mPMS, WST-3+mPMS, WST-4+mPMS WST-5+mPMS, GSK3.f3 inhibitors and, simultaneously or sequentially in any WST-9-mPMS, WST-10+mPMS, WST-11+mPMS, MSN+ order treat with any valid substitution for WST-1c for each of mPMS XTT+mMS, WST-1+coenzyme Q1, WST-3+coen the above and following embodiments, forming a more pre Zyme Q1, WST-4+coenzyme Q1 WST-5+coenzyme Q1, ferred embodiment WST-9--coenzyme Q1, WST-10+coenzyme Q1, WST-11+ 0218. It is yet another embodiment to treat with (1) the coenzyme Q1, MSN+coenzyme Q1 XTT+coenzyme Q1; (2) DNA transfection, or IFN, or siRNA transfection or all other at least one of the WST, such as, with no limitation, WST-3: valid substitutes and, then, (2) one of the IKK, or CK2 or (3) at least one IEA, such as, with no limitation, mPMS and GSK3.f3 inhibitors and, simultaneously or sequentially in any coenzyme Q1 at optimized concentration in a pharmaceuti order treat with any valid substitution for electron coupling cally acceptable medium. reagent of the WST-1r, such as mPMS, for each of the above 0210. The Apigeninherein represents the second molecule and following embodiments, forming a more preferred of this combination composition. The valid substitutes of embodiment. apigenin are selected from the groups comprising: 1) at least 0219. It is yet another embodiment to treat with (1) the one flavone as listed above in paragraph 00114, 2) at least DNA transfection, or IFN, or siRNA transfection or all other one flavonoids or isoflavonoids as listed above in paragraph valid substitutes and, then, (2) one of the IKK, or CK2 or 00115; 3) at least one HIF inhibitors as described above in GSK3.f3 inhibitors and, simultaneously or sequentially in any paragraph O0116.3) at least one IKK inhibitors as described order treat with any valid substitution for the remaining sub above in paragraph 00117. 4) at least one nucleotide component of the WST-1r for each of the above and following sequences SEQ ID NO:1, 10, 11, 12, 13, and means for embodiments, forming a more preferred embodiment. targeting the genes of polynucleotide sequences SEQID No: 0220. It is yet another embodiment to treat with (1) the 2, 3, 4, 5, 14 and peptide sequences SEQID No. 6, 7, 8, 9. DNA transfection, or IFN, or siRNA transfection or all other 15 as listed above in paragraph 00118. valid substitutes and, then, (2) one of the IKK, or CK2 or 0211. It is yet another embodiment to treat cancer cells GSK3.f3 inhibitors and, treat with WST-1 r simultaneously or with WST-1r and apigenin, a flavonoids or all other valid sequentially in any order treat with any valid Substitution as substitutes for both WST-1 rand apigenin simultaneously and any type of combination of the valid substitutes and the sub sequentially in any order for each of the above and following component of the WST-1r for each of the above and following embodiments, forming a more preferred embodiment. embodiments, forming a more preferred embodiment. 0212. It is yet another embodiment to treat cancer cells with WST-1 r with at least one IKK inhibitor or all other valid 0221 Moreover, the present descriptions provide pharma substitutes for both WST-1r and IKK inhibitor simulta ceutical compositions and methods for the treatment of can neously and sequentially in any order for each of the above cer by administering to a patient, in need thereof, a therapeu and following embodiments, forming a more preferred tically effective amount of at least one of the WST-1r embodiment. component or its valid Substitutes mentioned immediately above. 0213. It is yet another embodiment to treat cancer cells with (1) the DNA transfection, or IFN, or siRNA transfection 0222. The optimized concentration may or may not be the or all other valid substitutes and, then, (2) one of the IKK, or same concentration as that of the Cell Proliferation WST-1 CK2 or GSK3 B inhibitors and, treat with WST-1r simulta reagent and may vary from each of the compositions and their neously or sequentially in any order for each of the above and valid substitutes and between in vitro and in vivo usage. The following embodiments, forming a more preferred embodi preferred optimized in vitro WST-1r, WST-3+mPMS, WST ment. 4+mPMS and WST-3 are the most preferred embodiment 0214. It is yet another embodiment to treat with (1) the because they were the component for which we have the most DNA transfection, or IFN, or siRNA transfection or all other valid data. valid substitutes and, then, (2) one of the IKK, or CK2 or 0223) Moreover, the present description provides a GSK3? inhibitors and, treat with electron coupling reagent of method for the treatment of cancer by administering to a the WST-1 r simultaneously or sequentially in any order for patient, in need thereof, a therapeutically effective amount of each of the above and following embodiments, forming a at least one of the WST-1r component or its valid substitutes more preferred embodiment mentioned immediately above. 0215. It is yet another embodiment to treat with (1) the 0224. In a particular embodiment, the preferred treatment DNA transfection, or IFN, or siRNA transfection or all other of WST-1r is in contact with cells for at lease 15 minutes or valid substitutes and, then, (2) one of the IKK, or CK2 or longer. The more preferred treatment time for WST-1r is GSK3? inhibitors and, simultaneously or sequentially in any between 30 min to 4 hours. The even more preferred treat order treat with all the remaining subcomponent of the WST ment time for WST-1r is between 2-4 hours. 1 r for each of the above and following embodiments, forming 0225. Each of the treatment agents may be administrated a more preferred embodiment via oral, intra peritonea injection, intra muscular injection, US 2011/O 142815 A1 Jun. 16, 2011
intravenous injection, intravenous infusion, intraartery infu mRNA (NM 152900.1) synonyms: MAGI-3, MGC163281 Sion, intra artery injection, as well as via dermal penetration. (SEQ ID #4, #8), and (4) the Homo sapiens transmembrane 0226 Cancers that may be treated using the present pro protein 182 (TMEM182, GeneID: 130827), mRNA (NM tocol include, but are not limited to: carcinoma derived from 144632.2) (SEQ ID #5, #9). prostate, colorectum, pancreas, cervix, stomach, 0230. The gene products include, but not limited to, the endometrium, brain, liver, bladder, ovary, testis, head, neck, transcripts from these genes and proteins above. skin (including melanoma and basal carcinoma), mesothelial 0231. The siRNA sequences and the targets of the siRNA lining, white esophagus, breast, muscle, connective tissue, sequences may also include the human genomic sequences lung (including Small-cell lung carcinoma and non-Small-cell that flanking the genes as listed in the attached file entitled: carcinoma), adrenal gland, thyroid, kidney, or bone; glioblas “NCBI Blast-pUC19-Human-Transcripts and genome(2686 toma, mesothelioma, renal cell carcinoma, gastric carcinoma, letters)”, “NCBI Blast siRNA2 Nucleotide sequence (24 let sarcoma, choriocarcinoma, cutaneous basocellular carci ters) and “NCBI Blast pcDNA3 Nucleotide sequence (5448 noma, and testicular seminoma, leukemia, lymphoma and letters). NCBI Blast-pUC19-Human-Transcripts and SaCOaS. genome. 4. Combinatorial Therapies with Inhibitors and WST-1r for 0232. The at least one IFN may be selected from the sub the Treatment of Cancer family of type I IFN including, but not limited to: IFNC. A. 0227. The present description provides additional meth IFNG, B, IFNC, C, IFNC, D, IFNC, F, IFNC, G, IFNC, H, IFNC. ods for inducing cancer cell death for the treatment of cancer I, IFNO. J., IFNC. K. IFNo. 4b, IFNO WA, and IFNC. for a patient in need. In accordance, it has been discovered 0233. The effective concentration of IFN that were used that the combination of puC19 DNA transfection and/or its for treating cancer cells was 10 unit/ml or lower for each IFN valid substitutes with an IKK inhibitor plus WST-1r or its used. valid Substitutes for synergistic inducing cancer cell death. 0234 Suitable IKK inhibitors include any compound Accordingly, the present description provides a pharmaceu which exhibits IKK inhibitory activity. tical composition and protocol for the treatment of cancer in 0235. The at least one IKK inhibitor may be selected from a patient comprising at lease pUC19 DNA transfection or its compounds of the group consisting of, without limitation, i) valid substitutes in combination with at least one IKK inhibi compounds previously established to exhibit IKK inhibitory tor and WST-1 r or at least one of the valid substitutes of the properties including, but not limited to: SPC839 (Signal Phar WST-1 r. Also provided is a method for treating cancer in a maceutical Inc.), Anilino-Pyrimidine Derivative(Signal Phar patient by IFN in combination with administering an effective maceutical Inc.), PS1145(Millennium Pharmaceutical Inc.), amount of at least one IKK inhibitor and WST-1 r or at least BMS-345541*(IKK inhibitor III, Bristol-Myers Squibb one of the valid substitutes of the WST-1 r. Also provided is a Pharmaceutical Research Institute), SC-514*(Smithkilne method for treating cancer in a patient by transfection of the Beecham Corp.), Amino-imidazolecarboxamide derivative cells with siRNA in combination with administering an effec (Smithkilne Beecham Corp.), Ureudo-thiophenecarboxam tive amount of at least one IKK inhibitor and WST-1 r or at ide derivatives(AstraZeneca), Diarylpybidine derivative least one of the valid substitutes of the WST-1 r. (Bayer), Pyridooxazinone derivative(Bayer), 0228. The DNA transfection may be substituted by (i) Indolecarboxamide derivative(Aventis Pharma), Benzoimi administering a suitable dose of at least one IFN, or (ii) dazole carboxamide derivative(Aventis Pharma), Pyrazolo4. transfection of at least one specific siRNA targeting at least 3-cquinoline derivative(Pharmacia Corporation), Imida one of the target transcripts as described previously in this Zolylduinoline-carbxaldehyde semicarbazide derivative description, or (iii) chemical compounds or Small molecule (Tulark Inc.), Pyridyl Cyanoguanidine derivate(Leo inhibitors that targets at least one of the target genes and/or its Pharma), IKB Kinase Inhibitor Peptide(CalBiochem), IKK-2 gene products as described previously in this description, or Inhibitor IV 5-(p-Fluorophenyl)-2-ureidothiophene-3-car (iv) antibodies targeting at least one of the target genes prod boxamide(CalBiochem), IKK Inhibitor II (Wedelolactone ucts as described previously in this description, (v) anti-sense (CalBiochem), IKK Inhibitor VII (CalBiochem), IKK-2 RNAS targeting at least one of the target transcripts as Inhibitor V (N-(3.5-Bis-trifluoromethylphenyl)-5-chloro-2- described previously in this description, (vi) shRNAs target hydroxybenzamide IMD-0354, CalBiochem), IKK-2 Inhibi ing at least one of the target transcripts as described previ tor VI (5-Phenyl-2-ureido)thiophene-3-carboxamide, Cal ously in this description, (vii) anti-sense oligos targeting at Biochem), IKK-2 Inhibitor VIII (ACHP 2-Amino-6-(2- least one of the target transcripts as described previously in (cyclopropylmethoxy)-6-hydroxyphenyl)-4-(4-piperidinyl)- this description, (viii) A dominant negative DNA vector tar 3-pyridinecarbonitrile, CalBiochem). ii) In a certain geting at least one of the target genes as described previously embodiment, the group of IKK inhibitors may additionally in this description, (ix) peptides targeting at least one of the include compounds discovered to have IKK inhibitory activ target genes products as described previously in this descrip ity, in accordance, and previously identified as anti-tumor tion. agents, including, but not limited to PS1145 (Millennium 0229. The target genes are, but not limited to, (1) Homo Pharmaceutical Inc.), BMS-345541*(IKKinhibitor III, Bris sapiens transient receptor potential cation channel, Subfamily tol-Myers Squibb Pharmaceutical Research Institute). C, member 6(TRPC6, GeneID: 7225.), mRNA (NM 0236 Suitable WST-1r and the at least one of the valid 004621.3) synonyms: TRP6, FSGS2, FLJ11098 (SEQID #2, substitutes of the WST-1r, as noted herein above, include, but #6), (2) Homo sapiens SH3 and PX domains 2B are not limited to to (1) the combination of at least one WST (SH3PXD2B), mRNA (. (SH3PXD2B, GeneID: 285590), with at least one IEA. Examples as, but not limited to:WST mRNA (NM 001017995) synonyms: HOFI; FLJ20831; 1+mPMS, WST-3+mPMS, WST-4+mPMS WST-5+mPMS, KIAA1295 (SEQ ID #3, #7), (3) Homo sapiens membrane WST-9-mPMS, WST-10+mPMS, WST-11+mPMS, MSN+ associated guanylate kinase, WW and PDZ domain contain mPMS XTT+mMS, WST-1+coenzyme Q1, WST-3+coen ing 3 (MAGIKK, GeneID: 260425), transcript variant 2, Zyme Q1, WST-4+coenzyme Q1 WST-5+coenzyme Q1, US 2011/O 142815 A1 Jun. 16, 2011
WST-9--coenzyme Q1, WST-10+coenzyme Q1, WST-11+ forms including naturally existed, artificial modified iso coenzyme Q1, MSN+coenzyme Q1 XTT+coenzyme Q1; (2) forms and synthetic compounds including, but not limited to at least one of the WST, such as, with no limitation, WST-3: flavonoids, derived from 2-phenylchromen-4-one (2-phenyl (3) at least one IEA, such as, with no limitation, mPMS and 1,4-benzopyrone) structure (examples: quercetin, rutin); coenzyme Q1 at optimized concentration in a pharmaceuti isoflavonoids, derived from 3-phenylchromen-4-one (3-phe cally acceptable medium. nyl-1,4-benzopyrone) structure; neoflavonoids, derived from 0237. In a specific embodiment, the preferred order of 4-phenylcoumarine (4-phenyl-1,2-benzopyrone) structure, treatment is to administer the puC19 DNA transfection or its and flavanoids as a non-ketonepolyhydroxy polyphenol com valid substitutes, at least one IKK inhibitor and WST-1r or at pounds as described above in paragraph 00114 and 00115; least one of the valid substitutes of WST-1r concurrently or (3) At least one HIF inhibitors and/or inhibition of cellular and/or sequentially in any type of order. However, the pUC19 responses to hypoxia including, but not limited to: 2,2-dim DNA transfection or IFN treatment, or siRNA transfection or ethybenzopyran compounds, chetomin, 2-methoxyestradiol its other valid substitutes, at least one IKK inhibitor and the WST-1r ortheat least one valid substitutes of WST-1r may be (2ME2), PX-478,17-N-allylamino-17-demethoxygeldana administered to the cells or patient concurrently or sequen mycin (17-AAG), EZN-2968, camptothecins, NSC 644221. tially. In other words, the puC19 DNA transfection may be 3-(5'-hydroxymethyl-2-furyl)-1-benzylindazole (YC-1), treated first, the at least one IKK inhibitor may be adminis rapamycin, and decoy oligonucleotides against HIF-1 tered first, the WST-1 r or the at least one substitute of WST-1r RX-0047; as as described above in paragraph 00116 in may be administered first, or the puC19 DNA transfection, effective doses and in pharmaceutically acceptable medium. the at least one IKK inhibitor and the at least one substitute of 0244 Suitable IKK inhibitors are as listed above and fol WST-1 r may be administered at the same time. Additionally, lowing embodiments include any compound which exhibits when the puC19 DNA transfection is replaced by siRNA IKK inhibitory activity in pharmaceutically acceptable transfection, IFN administration, or Small molecule targeting medium. The at least one IKK inhibitor may be selected from the target genes as described in this description above, in compounds of the group consisting of, without limitation, i) combination with at least one IKK inhibitor and WST-1 r or at compounds previously established to exhibit IKK inhibitory least one valid substitute of WST-1r is used, the compounds properties including, but not limited to: SPC839 (Signal Phar may be administered in any order. maceutical Inc.), Anilino-Pyrimidine Derivative(Signal Phar 0238 Cancers that may be treated using the present com binatorial protocol are carcinomas and sarcomas, lym maceutical Inc.), PS1145(Millennium Pharmaceutical Inc.), phomars and leukemia include, but are not limited to those BMS-345541*(IKK inhibitor III, Bristol-Myers Squibb cancers described herein above in paragraph Pharmaceutical Research Institute), SC-514*(Smithkilne 0239. However, the suitable cancer cells and tumors that Beecham Corp.), Amino-imidazolecarboxamide derivative may be more susceptible to this treatment are those with (Smithkilne Beecham Corp.), Ureudo-thiophenecarboxam aberrant NF-kB activities. ide derivatives(AstraZeneca), Diarylpybidine derivative 0240. The present description also provides additional (Bayer), Pyridooxazinone derivative(Bayer), methods for inducing cancer cell death and Suppressing Indolecarboxamide derivative(Aventis Pharma), Benzoimi tumor in cancer patients. In accordance, it has been discov dazole carboxamide derivative(Aventis Pharma), Pyrazolo4. ered that the combination of a flavonoid, apigenin, or its valid 3-cquinoline derivative(Pharmacia Corporation), Imida substitutes, or an IKK inhibitor at effective concentration Zolylduinoline-carbxaldehyde semicarbazide derivative with the WST-1 r or the valid substitutes at effective concen (Tulark Inc.), Pyridyl Cyanoguanidine derivate(Leo tration for synergistic induction of cancer cell death. Accord Pharma), IKB Kinase Inhibitor Peptide(CalBiochem), IKK-2 ingly, the present description provides a pharmaceutical com Inhibitor IV 5-(p-Fluorophenyl)-2-ureidothiophene-3-car position and protocol for the treatment of cancer in a patient boxamide(CalBiochem), IKK Inhibitor II (Wedelolactone in need with effective dose comprising of at least one fla (CalBiochem), IKK Inhibitor VII (CalBiochem), IKK-2 vonoid, preferably, apigenin, or its valid Substitutes, or an Inhibitor V (N-(3.5-Bis-trifluoromethylphenyl)-5-chloro-2- IKK inhibitor with WST-1r or at least one of the valid substi hydroxybenzamide IMD-0354, CalBiochem), IKK-2 Inhibi tutes of the WST-1r in a pharmaceutical acceptable medium. tor VI (5-Phenyl-2-ureido)thiophene-3-carboxamide, Cal 0241. A removal of the treatment is required for all the Biochem), IKK-2 Inhibitor VIII (ACHP 2-Amino-6-(2- above and following embodiments to induce programmed (cyclopropylmethoxy)-6-hydroxyphenyl)-4-(4-piperidinyl)- cell death of the treated cells by this method. 3-pyridinecarbonitrile, CalBiochem). ii) In a certain 0242 Suitable flavonoids include, but not limited to, api embodiment, the group of IKK inhibitors may additionally genin, the flavonoids, and valid Substitutes of apigenin as include compounds discovered to have IKK inhibitory activ described above in paragraph 00114 and 00115 in pharma ity, in accordance, and previously identified as anti-tumor ceutically acceptable medium. agents, including, but not limited to PS1145 (Millennium 0243 The valid substitutes of apigenin are selected from Pharmaceutical Inc.), BMS-345541*(IKKinhibitor III, Bris the groups comprising The second compound and the valid tol-Myers Squibb Pharmaceutical Research Institute). Substitutes of apigenin is selected from the groups comprising 0245 Suitable WST-1r and the at least one of the valid (1) At least one flavones, include, but not limited to nature substitutes of the WST-1r, as noted herein above, include, but existed flavones, such as: Luteolin, Tangeritin, Chrysin, 6-hy are not limited to WST-1r and each of the individual compo droxyflavone, Baicalein, Scutellarein, Wogonin and synthetic nents, the WST-1 canfmPMS, that are comprises the WST-1r, flavones, such as: Diosmin, Flavoxate, additional Subgroups the valid Substitutes for WST and that for IEA of the WST-1r of flavones:flavonols, flavannones, flacanonols, catechins, and all possible combination among these valid Substitutes of isoflavones in paragraph 00114; or(2) at least one from WST-1 and mPMS or the combination of these valid substi other subgroups of Flavonoid or Bioflavonoids and their iso tutes and the individual component of the WST-1r, the WST US 2011/O 142815 A1 Jun. 16, 2011
and IEA as described above in paragraph 00171, at opti cinoma, cutaneous basocellular carcinoma, lymphoma, leu mized concentrations in pharmaceutically acceptable kemia and testicular seminoma, Soft tissue Sacoma. medium. 0246 The effective concentration of apigenin that were 5. Other Compositions and Methods for Enhance and Syner used may vary depending on cell type. For all the above and gize the Treatment of Cancer following embodiments, the effective concentration of WST 0252. The present description provides additional meth 1r and the valid Substitutes may vary depending on the indi ods for synergistic inhibition of NF-kB activity in cancer vidual composition and the effective concentration of each of cells. In accordance, it has also been discovered that the the composition may or may not be the same concentration as pUC19 DNA transfection may also synergize the inhibition that in the Cell Proliferation WST-1 reagent and may vary of NF-KB activity in cancer cells when both IKK1-KA and from each of the compositions and their valid substitutes and IKK2-KA kinase dead dominant negative vector were used between in vitro and in Vivo usage. simultaneously. This inhibitory effect can be further 0247. In a specific embodiment, the administration of the enhanced by the combination of additional treatment of WST WST-1 r or at least one valid substitutes of WST-1r, the api 1 r or at least one of the valid substitutes for WST-1r. genin, the flavonoid or at least one of the valid substitutes of 0253) Accordingly, pUC19 DNA trasnfection may be sub apigenin or the at least one IKKinhibitor can be in any type of stituted by treating the cells or a mammal with (i) adminis order. Specifically, the WST-1 r or at least one valid substitutes tering a suitable dose of at least one IFN, or (ii) transfection of of WST-1r, and the apigenin or at least one of the valid at least one specific siRNA or shRNA targeting at least one of substitutes of apigenin or the at least one IKK inhibitor may the target transcripts as described previously in this specifi be administered to the cells or patient concurrently or sequen cation, or (iii) Small molecule inhibitors that targets at least tially. In other words, the apigenin or at least one of the valid one of the target genes products as described previously in substitutes of apigenin or the at least one IKK inhibitor may this specification, or (iv) antibodies and peptide inhibitors be administered first, the WST-1 r or the at least one substitute targeting at least one of the target genes products as described of WST-1 r may be administered first, or the WST-1 r or at least previously in this specification, (v) anti-sense RNA targeting one valid substitutes of WST-1r, and the apigenin or at least at least one of the target transcripts as described previously in one of the valid substitutes of apigenin or the at least one IKK this specification, (vi) anti-sense oligo targeting at least one of inhibitor may be administered at the same time. The preferred the target gene's transcripts as described previously in this order of the treatment is to administer the WST-1 r or the valid specification in combination with the treatment of at least one substitutes of WST-1 rand the apigenin or the valid substitutes IKK inhibitors that can inhibit both IKK1 and IKK2 kinase of apigenin or at least one IKK inhibitor simultaneously and activities. then, after removal of the WST-1r, add apigenin or IKK 0254 The at least one IFN may be selected from the sub inhibitor again and keep in contact with cells for another 24 family of IFN including, but not limited to: IFNC. A. IFNC. B. hours. IFNC, C, IFNC, D, IFNC, F, IFNC, G, IFNC, H, IFNC. I, IFNC.J., 0248. In a particular embodiment, the in vitro treatment of IFNC K, IFNo. 4b, IFNC, WA, IFNB, IFNY or IL-6. WST-1r is in contact with cells for at least 15 minutes or 0255. The transcripts, and proteins as the targets of the longer The preferred time is between 30 minto 4 hours. The siRNA, shRNA, small molecule inhibitor, peptide inhibitor, more preferred time is between 2-4 hours. A removal of the antibody, anti-sense RNA, anti-sense oligo, and antibody are, WST-1 r or its valid substitute's from treatment is required for but not limited to, (1) Homo sapiens transient receptor poten all the above and following embodiments to induce pro tial cation channel, subfamily C, member 6(TRPC6, SEQID grammed cell death of the treated cells by this method 2, 6), (2) Homo sapiens SH3 and PX domains 2B thereof. (SH3PXD2B, SeO ID #3, #7), (3) Homo sapiens membrane 0249 Moreover, the present description provides a associated guanylate kinase, WW and PDZ domain contain method for the treatment of cancer by administering to a ing 3 (MAGIKK, SeO ID #4, #8), (4) the Homo sapiens patient, in need thereof, a therapeutically effective dose of at transmembrane protein 182 (TMEM182, SeOID #5, #9) and least one of the WST-1 r or its valid substitutes and apigenin or (5) the C6orf108 (Seq ID #14, #15). at least one of its valid substitutes as described above in 0256 Suitable WST-1r and the at least one of the valid pharmaceutical acceptable medium. substitutes of the WST-1r, as noted herein above, include, but 0250 Also, the present description provides a method for are not limited to WST-1r and each of the individual tetrazo the treatment of cancer by administering to a patient, in need lium components that are comprises the WST-1r, the valid thereof, a therapeutically effective dose of at least one of the substitutes of each component of the WST-1r and any type of WST-1 r or its valid substitutes and at least one IKK inhibitor combination among these valid Substitutes or the combina mentioned above in pharmaceutical acceptable medium. tion among these valid Substitutes and the individual compo 0251 Cancers that may be treated using the combinatorial nent of the WST-1 and mPMS. protocol with WST-1r or its valid substitutes in combination (0257. The at least one IKK inhibitor may be selected from with apigenin include, but are not limited to those carcinomas compounds of the group consisting of i) compounds previ and sarcomas that may be treated using the present protocol ously established to exhibit IKK inhibitory properties includ include, but are not limited to: cancers of the prostate, col ing, but not limited to: SPC839 (Signal Pharmaceutical Inc.), orectum, pancreas, cervix, stomach, endometrium, brain, Anilino-Pyrimidine Derivative(Signal Pharmaceutical Inc.), liver, bladder, ovary, testis, head, neck, skin (including mela PS1145(Millennium Pharmaceutical Inc.), BMS-345541* noma and basal carcinoma), mesothelial lining, esophagus, (Bristol-Myers Squibb Pharmaceutical Research Institute), breast, muscle, connective tissue, lung (including Small-cell SC-514*(Smithkilne Beecham Corp.), Amino-imidazolecar lung carcinoma and non-Small-cell carcinoma), adrenal boxamide derivative(Smithkilne Beecham Corp.), Ureudo gland, thyroid, kidney, or bone; glioblastoma, mesothelioma, thiophenecarboxamide derivatives(AstraZeneca), Diarylpy renal cell carcinoma, gastric carcinoma, sarcoma, choriocar bidine derivative(Bayer), Pyridooxazinone derivative US 2011/O 142815 A1 Jun. 16, 2011 20
(Bayer), Indolecarboxamide derivative(Aventis Pharma), SCC-6 cells. Cancers that may be treated using the present Benzoimidazole carboxamide derivative(Aventis Pharma), combinational protocol include, but are not limited to, those Pyrazolo 4.3-cquinoline derivative(Pharmacia Corpora cancers described herein. tion), Imidazolylduinoline-carbXaldehyde semicarbazide 0263. The present description provides additional medical derivative(Tulark Inc.), Pyridyl Cyanoguanidine derivate use for enhancing or synergizing the efficacy effects of che (Leo Pharma), IkB Kinase Inhibitor Peptide(CalBiochem), motherapy drugs for the treatment of cancer. In accordance, it IKK-2 Inhibitor IV 5-(p-Fluorophenyl)-2-ureidothiophene has also been discovered that the Puc19 DNA transfection 3-carboxamide(CalBiochem), IKK Inhibitor II, Wedelolac also synergizes Suppression of tumor growth and promotes tone(CalBiochem), IKK Inhibitor VII K Inhibitor VII(Cal cancer cell death. Accordingly, the present description pro Biochem), IKK-2 Inhibitor V N-(3.5-Bis vides a pharmaceutical composition for the treatment of can trifluoromethylphenyl)-5-chloro-2-hydroxybenzamide cer in a patient comprising puc19 DNA transfection or at least IMD-0354(CalBiochem), IKK-2 Inhibitor VI (5-Phenyl-2- one of its valid Substitutes and at least one chemotherapeutic ureido)thiophene-3-carboxamide(CalBiochem), IKK-2 agent. This induction of cancer cell death effect may be fur Inhibitor VIII ACHP 2-Amino-6-(2-(cyclopropylmethoxy)- ther enhanced by additional combination with WST-1 r or at 6-hydroxyphenyl)-4-(4-piperidinyl)-3-pyridinecarbonitrile least one of the valid substitutes of WST-1r in a pharmaceu (CalBiochem). In a certain embodiment, the group of IKK tically acceptable carrier. Also provided is a method for treat inhibitors may additionally include compounds discovered to ing cancer cells or cancer in a patient by administering an have IKK inhibitory activity, in accordance, and previously effective dose of at least one DNA transfection or at least one identified as anti-tumor agents, including, but not limited to of the valid substitutes for DNA transfection in combination PS1145 (Millennium Pharmaceutical Inc.), BMS-345541* with at least one chemotherapeutic agent. In a preferred (Bristol-Myers Squibb Pharmaceutical Research Institute). embodiment, the preferred DNA for transfection is pUC19 The preferred IKK inhibitors are the IKK inhibitors that can DNA cloning vector as described previous in this application inhibit both IKK1 and IKK2 kinase activities. (Sequence #1). 0264. Theat least one valid substitute for the puC19 DNA 0258. The present description provides additional medical transfection may include, but not limited to, (i) administering use for inducing cancer cell death and tumor Suppression. In a suitable dose of at least one IFN, or (ii) transfection of at accordance, it has been discovered that the combination of a least one specific siRNA targeting at least one of the target GSK3? inhibitor with a CK2 inhibitor in combination with transcripts as described previously in this specification, or WST-1 r or at least one of the valid Substitutes for WST-1 ract (iii) at least one chemical compounds or small molecule synergistically to suppress tumor growth. Accordingly, the inhibitors that targets at least one of the target genes and/or its present description provides a pharmaceutical composition gene products as described previously in this specification, or for the treatment of cancer in a subset of cancer cells and/or in (iv) at lease one antibody targeting at least one of the target a patient comprising at least one GSK33 inhibitor, at least one genes products as described previously in this specification, CK2 inhibitor and WST-1 r or the at least one of the valid or (V) anti-sense RNA targeting at least one of the target substitutes for WST-1 in a pharmaceutically acceptable car transcripts as described previously in this specification, (vi) rier. Also provided is a method for treating cancer in a patient shRNA targeting at least one of the target transcripts as by administering an effective amount of at least one GSK3f described previously in this specification, (vii) anti-sense inhibitor in combination with at least one CK2 inhibitor. oligo targeting at least one of the target transcripts as Suitable GSK3? inhibitors include any compound which described previously in this specification, (viii) A dominant exhibits GSK3? inhibitory activity, for example, LiCl, Suit negative DNA vector targeting at least one of the target genes able CK2 inhibitors, include, but are not limited to: Apigenin as described previously in this specification, (ix) peptides 0259. Theat least one CK2 inhibitor may be selected from targeting at least one of the target genes products as described compounds of the group comprising, but not limited to: TBB, previously in this specification. TBBZ, emodin, CK2 inhibitor III (sigma). 0265 Suitable IFN may be selected from any IFN subfam 0260 Suitable WST-1r and the at least one of the valid ily members, which include, but not limited to, IFNC.A, IFNC. substitutes of the WST-1r, as noted herein above, include, but B, IFNC, C, IFNC, D, IFNC, F, IFNC, G, IFNC, H, IFNC. I, IFNC. are not limited to WST-1r and each of the individual compo J, IFNC. K. IFNo. 4b, WA, IFNB, IFNY and Interlukine-6 nents that comprises the WST-1r, the valid substitutes of each (IL-6). In a preferred embodiment, the preferred IFN are component of the WST-1r and any type of combination subfamily members of IFNB, IFNB. The effective concentra among these valid Substitutes or the combination among tion of IFN is 10 unit/ml or lower for each IFN. these valid substitutes and the individual component of the 0266 The target genes to be targeted by the at least one WST-1 r. chemical compounds or Small molecule inhibitors, at least 0261. In a specific embodiment, the at least one GSK3? one specific siRNA, shRNA, anti-sense RNA, anti-sense inhibitor and at least one CK2 inhibitor may be administered oligo, dominant negative DNA vector, at least one peptide, at to the cancer cells or patient concurrently or sequentially. In lease one antibody, at least one inhibitor are, but not limited other words, the at least one GSK3 B inhibitor may be admin to, (1) TRPC6, (SEQ ID #2, #6), (2) SH3PXD2B, (SEQ ID istered first, the at least one CK2 inhibitor may be adminis #3, #7), (3) MAGIKK, (SEQ ID #4, #8), (4) TMEM182, tered first, or the at least one GSK3? inhibitor and the at least (SEQ ID #5, #9), and (5) C6orf108 (Seq ID #14, #15). one CK2 inhibitor may be administered at the same time. 0267. The gene products include, but not limited to, the Additionally, when more than one GSK3 B inhibitor and/or nucleotide sequence of the transcripts from the gene and CK2 inhibitor are used, the compounds may be administered amino acid sequence of the protein that derived from these in any order. genes. 0262 Cancer cells that may be treated using the present 0268. The siRNA and or shRNA sequences and the targets combinatorial protocol include, but are not limited to UM of the siRNA sequences may also include the nucleotide US 2011/O 142815 A1 Jun. 16, 2011 sequence that mapped to the human genomic sequences that an important role in cancer cells Survival and proliferation. flanking the genes as listed in the attached file “NCBI Blast However, Stat Inhibitors or IKKinhibitors alone showed little pUC19-Human-Transcripts and genome(2686 letters) and inhibiting effect on cancer cell survival. Evidence showed “NCBI Blast siRNA2 Nucleotide sequence (24 letters). that these two transcription factors interact with each other 0269. Accordingly, Suitable siRNAs include siRNA1 and to functionally cooperate with each other. In addition, (SEQID #10), siRNA2(SEQID #11), and siRNA 3(SEQID NF-kB and STAT binding sites linked together to form pro #12) as described previous in this specification and all the moter modules. Combination of Stattic, a Stat inhibitor with potential siRNAs that may be derived from puC19 DNA either IKK inhibitor or apigenin results in Synergetic induc sequence that mapped to human genome and/or transcripts in tion of cell death. This combination provides a method of short pieces (10-100 by and more). These nucleotide treating cancer. sequences and their corresponding genes are listed in the 0276. The present invention provides additional methods attached file “NCBI Blast-puC19-Human-Transcripts and for inducing cancer cell death and tumor Suppression. In genome(2686 letters)” and “NCBI Blast siRNA2 Nucleotide accordance with the present invention, it has been discovered sequence (24 letters). As in general, these siRNA sequences that the combination of a IKK inhibitor or a CK2 inhibitor in can be vary up to 40% from the exact sequences of the gene. combination with Stat inhibitor, stattic, or at least one of the Additionally, the function of these siRNAs can be substituted valid Substitutes for stattic act synergistically to induce cancer by any of the siRNA and/or shRNA that mapped to other part cell death and to Suppress tumor growth. Accordingly, the sequences of the corresponding target gene, Small molecule present invention provides a pharmaceutical composition for inhibitors, peptide inhibitors, antibodies, anti-sense RNAs, the treatment of cancer in a Subset of cancer cells and/or in a anti-sense oligos and dominant negative DNA vectors that patient comprising at least one IKK inhibitor or at least one can effectively target the gene products as targets, which are CK2 inhibitor and stattic or the at least one of the valid the target of the siRNAs as described above in this paragraph Substitutes for stattic in a pharmaceutically acceptable carrier. and are include, but not limited to, (1) TRPC6, (SEQ ID #2, Also provided is a method for treating cancer in a patient by #6), (2) SH3PXD2B, (SEQ ID #3, #7), (3) MAGIKK, (SEQ administering an effective amount of at least one IKK inhibi ID #4, #8), (4) TMEM182, (SEQID #5, #9), and (5) C6orf108 tor or at least one CK2 inhibitor in combination with stattic or (Seq ID #14, #15). valid substitutes. Suitable IKK inhibitors are as listed above. 0270. The WST-1r or at least one of the valid substitutes of Suitable CK2 inhibitors, include, but are not limited to: Api WST-1r, as noted herein above, include, but are not limited to genin. Suitable Stat inhibitors are the inhibitors that inhibit WST-1r and each of the individual components that are com stat phosphorylation, activation and nuclear translocation, prises the WST-1r, the valid substitutes of each component of include, but not limited to stattic. The administration of the the WST-1r and any type of combination among these valid IKK inhibitors or the CK2 inhibitors and the stattic may be Substitutes or the combination among these valid Substitutes administered in any order. The preferred order is to adminis and the individual component of the WST-1 r. trate the inhibitors concurrently. 0271 Suitable chemotherapeutic agents include, but are not limited to: paclitaxel (Taxol.R.), cisplatin, docetaxol, car ADVANTAGES boplatin, Vincristine, vinblastine, methotrexate, cyclophos 0277 From the description above, a number of advantages phamide, CPT-11, 5-fluorouracil (5-FU), gemcitabine, estra of the embodiments of this cancer treatment protocol and mustine, carmustine, adriamycin (doxorubicin), etoposide, composition become evident: arsenic trioxide, irinotecan, and epothilone derivatives. The 0278. This combination treatment targeting the tRMET preferred chemotherapeutic agents are paclitaxel (Taxol.R.), and the HIF or cell responses to hypoxia is a synergistic cisplatin, 5-fluorouracil (5-FU), and combination strategy that block cancer cell respiration 0272. In a specific embodiment, the preferred order is to through the tFMET at cell surface while inhibit cancer cell transfect the puC19 DNA or at least one of its valid substi capability of tolerating hypoxia. This combination did not tutes first and, then, administering the chemotherapy drugs inhibit cancer cell growth, but induced synergistic cancer after the transfection of puC19DNA. However, the puC19 specific cell death. This combination composition and DNA transfection or at least one of its valid substitutes and method represent a new concept and principle for a new administering the chemotherapy drugs may be administered avenue of cancer treatment strategy for a synergistic cancer to the cancer cells or patient concurrently or sequentially. In specific treatment and anti-cancer drug development. other words, the pUC19 DNA transfection may be adminis (0279. The chemical structure of WST-3 represents a tered first; the chemotherapy drugs may be administered first. model of a class of compounds that is capable of interfering 0273 Cancers that may be treated using the present com the tRMET and restricts its activity on cell surface without binatorial protocol include, but are not limited to those carci affecting the mitochondrial in the normal cells. As cancer nomas and sarcomas set forth herein above. cells rely on cell surface ixygen consumption, the WST-3 0274 Combined Treatment of Apigenin and Stattic Syn represents the model of compounds that selectively affect ergistic Inhibition of Cal27 Cell Survival And Induced Cell cancer cells only. Death. 0280. The use of WST-1r also represents a novel strategy 0275. In addition to NF-kB, Signal transducer and activa that incorporate cellular response to the treatemtn into the tor of transcription (Stat) is another family of transcription treatment protocol by inducing cancer cell thMET followed factors. They mediate extra cellular signals stimulated by by withdraw to induce cancer cells death. cytokines and growth factors, translocation to the cell nucleus 0281. This combination treatment is different from con where they act as transcription activators. These proteins ventional chemotherapy that inhibits cancer cell growth, mediate the expression of a variety of genes in response to cell instead, it directly induce cancer cell death, which made it a stimuli, and thus play a key role in many cellular processes more efficient cancer treatment by selectively killing cancer Such as cell growth and apoptosis. Stat, such as STAT3, play cells. US 2011/O 142815 A1 Jun. 16, 2011 22
0282. In summary this present invention provides a new Drug Bioavailability, Drug Product Design and Performance, concept of combinational treatment strategy for anticancer Smolen and Ball (eds.), Wiley: New York (1984); Ranger and drug development. This combination treatment will selec Peppas, J. Macromol. Sci. Rev. Macromol. Chem. (1983) tively block the cell surface respiration of cancer cell while 23:61; see also Levy et al., Science (1985) 228:190; Duringet inhibiting their capability to response to hypoxia therefor, to al., Ann. Neurol. (1989) 25:351; Howard et al., J. Neurosurg. inhibit cancer cell respiration and hence the energy metabo (1989) 71:105). In yet another embodiment, a controlled lism from two direction to obtain synergistic inducible cancer release system can be placed in proximity of the target tissues cell death. In addition, these treatments utilize non cytotoxic of the animal, thus requiring only a fraction of the systemic compounds result in Synergistic cancer specific cell death, dose (see, e.g., Goodson, in Medical Applications of Con which provides a new avenue for anti-cancer drug develop trolled Release, supra, (1984) vol. 2, pp. 115-138). In particu ment and for cancer treatment. lar, a controlled release device can be introduced into an 0283 Although the description above contains much animal in proximity of the site of inappropriate immune acti specificity, these should not be construed as limiting the scope vation or a tumor. Other controlled release systems are dis of the embodiments but as merely providing illustrations of cussed in the review by Langer (Science (1990) 249:1527 some of the presently preferred embodiments. For example, 1533). the WST-3 and the apigenin each represents classes of chemi 0287. The conclusion that this is programmed cell death is cal compounds with similar function. Also the combination of formed by the observation that normal cells had no cytotoxic WST-3 and apigenin represents a new strategy and a new reaction and further, that a over 90% kill rate is more than avenue of cancer drug development by targeting tPMET in Substantial evidence of a significant find. Therein, because combination with inhibition of cellular responses to hypoxia this specification touches a programmed cancer cell death and some other related process. pathway that was prior untouched, or in the alternative, that 0284 Thus the scope of the embodiments should be deter this invention may activates a known pathway or a novel mined by the appended claims and their legal equivalents, unknown pathway in a manner not able to be duplicated by rather than by the examples given. other inventions, the very sequence of events defined in this specification activates programmed cell death in the cancer V. Administration of Pharmaceutical Compositions cells and as Such, presents a valid model for further study. In and Compounds other words, through processes known to those of skill, the 0285. The pharmaceutical compositions can be adminis very core molecular event leading to the over 90% kill rate, tered by any suitable route, for example, by injection, by intra can be explored because we have the working model to induce Vaneus infusion, by intra artery infusion, by oral, pulmonary, Such events. Therein, the invention is also claimed as an nasal, transdermal or other methods of administration. In important model for further research, study and pathway illu general, pharmaceutical compositions of the present specifi mination/elucidation. cation comprise, among other things, pharmaceutically 0288 Although above and below I have shown specific acceptable diluents, preservatives, Solubilizers, emulsifiers, experimentation and data, one of skill in the art of cancer adjuvants and/or carriers. Such compositions can include preclinical and clinical protocol structure, execution and diluents of various buffer content (e.g., Tris-HCl, acetate, analysis will recognize upon reading this document, through phosphate), pH and ionic strength; and additives such as variation of the dosages of the named components, the order detergents and solubilizing agents (e.g., Tween 80, Polysor in which they are applied and the time frames between appli bate 80), anti-oxidants (e.g., ascorbic acid, sodium met cations, valid Substitutions of the named components there abisulfite), preservatives (e.g., Thimersol, benzyl alcohol) are a myriad of variable applications which may result in the and bulking Substances (e.g., lactose, mannitol). The compo same or similar outcome. To the extent that these variables sitions can be incorporated into particulate preparations of can be applied to any cancer in any mammal, the inventor polymeric compounds such as polylactic acid, polyglycolic notes than nothing contained within this document or any acid, etc., or into liposomes. Such compositions may influ Subsequent documentation provided by the inventor is ence the physical state, stability, rate of in vivo release, and intended to be limiting. The inventor also notes that this rate of in vivo clearance of components of a pharmaceutical specification is intended to work alone, and reduce cytotoxic compositions. See, e.g., Remington's Pharmaceutical Sci effects of traditional cancer therapy, such as chemotherapy ences, 18th Ed. (1990, Mack Publishing Co., Easton, Pa. and radiation, however, nothing herein is intended to limit the 18042) pages 1435-1712 which are herein incorporated by use of this specification to the extent that chemotherapeutic reference. The pharmaceutical compositions can be prepared, and radiation combination therapies can be utilized in com for example, in liquid form, or can be in dried powder form bination with this specification. Further, that the use of che (e.g., lyophilized). Particular methods of administering phar motherapy and radiation therapy combinations, in conjunc maceutical compositions are described hereinabove. tion with this specification, may reduce the cytotoxicity of the 0286. In yet another embodiment, the pharmaceutical chemotherapy or radiation therapy because the dosages of the compositions can be delivered in a controlled release system, chemotherapy and radiation therapy can be reduced when Such as using an intravenous infusion, an implantable osmotic used in combination with this specification. And finally, that pump, a transdermal patch, liposomes, or other modes of the named specification may further sensitize cancer cells administration. In a particular embodiment, a pump may be selectively over normal cells Such that Subsequent application used (see Langer, supra; Sefton, CRC Crit. Ref Biomed. Eng. of chemotherapy and radiation, as well as combination (1987) 14:201: Buchwald et al., Surgery (1980) 88:507: Sau chemo/radiation therapies, will work more efficiently again, dek et al., N. Engl. J. Med. (1989) 321:574). In another allowing for the reduction of chemotherapy and radiation and embodiment, polymeric materials may be employed (see combination chemo/radiation dosages. Medical Applications of Controlled Release, Langer and 0289. The foregoing description of the present specifica Wise (eds.), CRC Press: Boca Raton, Fla. (1974); Controlled tion provides illustration and description, but is not intended US 2011/O 142815 A1 Jun. 16, 2011
to be exhaustive or to limit the specifications to the precise constitutive NF-KAPPAB activity in these cancer cells, sug one disclosed. Modifications and variations consistent with gesting potential interchangeable function between these two the above teachings may be acquired from practice of the IKKS. specification. Thus, it is noted that the scope of the invention is defined by the claims and their equivalents. Example 2 0290 The present specification will now be illustrated in more detail in the following examples. It is to be understood Simultaneous Inhibition of IKK1 and IKK2 Also that these examples serve only to describe the specific Lead to Cancer Cell Death embodiments of the present specification, but do not in any 0294. In addition to the inhibition of NF-KAPPAB activ way intend to limit the scope of the claims. It is of further note ity, cell death associated with cotransfection of K44A-IKK1 to one of skill that unique sequence data has been provided in and K44A-IKKB into UM-SCC-6 cells (FIG. 3). 48 hours this application. To the extent that each of these new sequence after tranfection, K44A-IKK1 and K44A-IKK2 co-trans data represent novel targets for the development of cancer fected cells showed 85% reduction in cell number (FIG. 3 therapeutics, nothing contained herein is intended to be lim WST-1 no) and dramatic cell death (FIG. 3B). The data rep iting. Said targets are noted as potential targets for further resents the average of 7 sets of duplicates. This result indi development under this application using the above methods cates that inhibition of NF-KAPPAB activity does lead to and other methods known to those of skill. Although not cancer cell death and that this can be reached only by inhib mentioned in this specification elsewhere, use of radiation as iting both IKK1 and IKK2 simultaneously. In addition, add a distinct step, or other small molecule drugs, DNA, RNA, ing tetrazolium dye WST-1r further enhanced cancer cell siRNA and all other methods for cancer therapy known to death caused by double inhibition of IKKs (FIG. 3 WST-1- those of skill are noted as possible adjuvant to these protocols. yes). Following inhibition of both IKK1 and IKK2 treating cells with WST-1r further enhance cell death (FIG. 3 WST VI. Examples 1-yes). In FIG. 3A about 80% reduction of cell number in K44A-IKK1 and K44A-IKK2 cotransfected cells and over Example 1 95% reduction when these cells were treated with WST-1 in addition to cotransfection of K44A-IKK1 and K44A-IKKB. Synergistic inhibition of NF-KAPPAB activity Data represents an average of 7 sets of duplicates. FIG. 3B 0291. Overview: Normally, NF-kappaB activity is mea shows cell death from double transfected cells, partial cell sured by reporter assay, electronic gel mobility shift assay and death from K44A-IKK1 or K44A-IKK2 single transfected more recently, DNA binding ELISA. However, all of these cells and further enhanced cell death by adding WST-1r treat methods employ exogenous DNA oligo or constructs carry ment to K44A-IKK1 and K44A-IKK2 double trasfected ing consensus NF-kappaB response element sequences for cells. measuring specific NF-KAPPAB DNA binding and tran scriptional activity. Additionally, the NF-KAPPAB consen Example 3 sus response element is different from the real promoter WST-1 promote HT1080 human sarcoma cell death sequences that also need complex interaction with multiple by combination with DNA Transfection and IKK molecules and may introduce artificial effects. Inhibitor Treatment 0292 Method: UM-SCC-6 cells were transfected with effectene (Qiagen) i) 20% dominant negative IKK1-KA 0295 Methods: HT1080 cells were cultured in 96 well (K44A) and 80% pluC19, ii) 20% dominant negative IKK2 plates and transfected with one of the puC19, pcDNA3, KA (K44A) and 80% puC19, iii) 20% dominant negative IKK1-KA, IKK1-KA+PUC19, or pcDNA3+pUC19 DNA IKK1-KA (K44A), 20% dominant negative IKK2-KA vectors for 24 hours followed with treatment of IKKInhibitor (K44A) and 60% puC19, iv) 20% pcDNA3 and 80% puC19 IIII at 3-30 LM for another 24 hours and, then, treated with as negative control, for 72 hours. At the end of transfection, 10% WST-1 for 4 hours and cultured overnight before detec cells were lysed with lysis solution from GeneSpectra kit tion. The same treatments of cells were measured at 24, 48 (Panomics). The IKBO. p100, CSNK2B mRNA levels were and 96 hours after WST-1 treatment. Cell viability was mea measured with the GeneSpectra kit. The expression levels of sured by Cell Count Kit 8 (CCK8). each transcript from different transfections were normalized 0296 Data showed (1) significant IKK inhibitor III dose by their 18sRNA level as measured at the same time. dependent induction of cell death from the cells that were 0293 Previously, we observed partial inhibition of NF transfected with any of the DNA vectors at 24, 48 and 96 hour KAPPAB reporter activity by ~50% caused by cotransfection after WST-1 treatment comparing to non transfected control of kinase dead K44A-IKK1 or K44A-IKK2 into UM-SCC-6 cells, but no significant difference between puC19 vector cells and other head and neck squamars carcinoma cells. By only from IKK1-KA vector (FIG. 4); (2) further induced cell measuring expression levels of endogenous NF-KAPPAB death and decreased cell survival detected from the cells that downstream gene, IKB B. p100 and CK2B, as an indicator of were treated with WST-1 at 24, 48 and 96 hours after WST-1 NF-KAPPAB activity, we observed little inhibitory effect on treatment comparing to those with no WST-1 treated cells; (3) NF-KAPPAB activity from K44A-IKK1 transfected cells at 96 hours after the treatment of WST-1 all the non trans (~20%) and no inhibitory effect from K44A-IKK2 trans fected cells grow back to the same amount as the untreated fected cells. In contrast, when inhibiting both IKK1 and IKK2 control, while partial recovery of the cells from no WST-1 molecules by cotransfecting dominant negative K44A-IKK1 treated, but transfected cells; and (4) at 96 hours after all the and K44A-IKK2 simultaneously, we observed ~90% inhibi treatment, only the cells transfected and also treated with tionatall three target gene expression levels that we measured WST-1 remained died with no recovery, which indicated the (FIGS. 2A and B). These data showed synergistic inhibitory combination of either IKK inhibitor and/or DNA transfection effect of combination of K44A-IKK1 and K44A-IKK2 on with the WST-1 treatment further synergize these cancer cells US 2011/O 142815 A1 Jun. 16, 2011 24 to 100% death. The difference in the absorption at 24 hour brane electron transport (Berridge, MV et al. Biotechnol after WST-1 treatment were caused, in partial, by decreased Annu Rev, 2005; 11:127052). Alternatively, WST-1 can be response from the WST-1 treated cells to the CCK8 detection. reduced by cell surface NAD(P)H-Oxidase (Berridge, MV, et This effect reduced in 48 hours after the removal of WST-1 al, Antioxid Redox Signal, 2000, 2:231-42, Scalett, DJ, et al. treatment and diminished at 96 hours after the removal of Biofactors, 2004, 20:199-206) In the present invention WST-1 treatment. Morphology examination of the cells WST-1 has been found to synergize the inhibitory effect on found that at 24 hours after the WST-1 treatment majority of cell growth and promote cancer cell death when it is used in the 30 uM IIKK inhibitor III treated cells died after the treat combination with at least one of the DNA transfection, or ment. However, the survival cells that were not treated with IFN, or siRNA transfection and one of the IKK, or combina WST-1 grow back up again. Conversely, the deaths of all the tion of CK2 and GSK3? inhibitors. Theoretically, it has been cells that were transfected with DNA vectors and with the proposed that the balance between JNK activation and NF same IKK inhibitor III treatment and treated with WST-1 KAPPAB activity determines cell faith to death or a live. were 100%. These data demonstrate the effect of WST-1 Prolonged JNK activation induces programmed cell death. enhances the IKK inhibitor III induce cancer cell death effect Generation of ROS induces JNK activation while NF-KAP and promote cell death of these cells and that puC19 vector PAB activity leads to suppress ROS level (Luo, J. L., et al., J. also contribute to the combined effect of inducing cell death. Clin. Invest, (2005) 115:2625-32, Shen, H M, et al. Free Radical Biology & Medicine 2006, 40:928-939). The present Example 4 invention has found that WST-1 induces ROS production in these cancer cells and promotes cell death. IFN Substitute Puc19 Transfection to Enhance IKK 0301 Methods: HT1080 cells were cultured in cover Inhibitor III and WST-1 Effect slices and transfected with puC19 and treated with IKK inhibitor III in sequential. Following these treatment, the 0297. Overview: Our previous data suggest that DNA cells, thus, treated, were either labeled with CM-H2-DCFDA, transfection plays a role in the triple combination treatment a fluorescence dye that can labeling ROS in cells, and, then, for synergistic cancer cell death. Moreover, Interferon (IFN) treated with WST-1 for 30 minutes (FIG.23A) or treated with responses have been reported to be involved in transfection WST-1 for 2 hours and then labeled with CM-H2-DCFDA effects. We examined whether IFN can be a substitute for the (FIG. 23-B). The results were recorded by a digital camera DNA transfection effect for in vivo treatment. with Spotlight software. Manuel exposure levels were used to 0298 Methods: HT1080 cells were cultured in 96 well maintain the same exposure level for comparison. plates and treated with IFN, IKK inhibitor III and WST-1 0302. In both experiments, significant WST-1 induced sequentially. Each set of the cells were treated with one of the ROS generation has been documented (FIGS. 23 A and B). In IFN members at the concentration ranging from 2-1000 units/ FIG. 23-A, we also observed IKK inhibitor III dose depen ml for 24 hours followed by IKK inhibitor III treatment at dent labeled ROS from the cells that were transfected with concentration of 3-30 uM for another 24 hours and, then, with pUC19, and treated with IKK, but with no exposure to WST WST-1 for 4 hours and cultured overnight before detection. 1. This may suggest that IKK Inhibitor III may also induce Cell viability was measured by CCK8 kit at 24 and 48 hours ROS generation. after WST-1 treatment. Total of 15 IFNs were tested. They arewer IFNCA, IFNOB, IFNCC, IFNCD, IFNCF, IFNOG, Example 6 IFNGH, IFNCI IFNC.J., IFNOK, IFNC4b, and IFNCWA, LiCl-i-Apigenin Induced Synergized Cancer Cell IFNB, IFNY and IL-6. Death, WST-1 Enhance Further these Cell Death 0299 Representative data (FIG. 21) showed IFN dose (0303 Overview: LiCl is known to inhibit GSK3 Bactivity dependent and IKK Inhibitor III dependent decrease of cell and Apigenin is a multi signal transducer that inhibits mul growth and enhancement of cell death comparing to that tiple signaling processes, including protein kinase 2 (CK2). without IFN treatment. Comparing to puC19 DNA transfec The activity of both GSK3 B and CK2 are known to enhance tion, which synergized the inhibition of cell growth and pro constitutive NF-kB activity. This test was intended to exam motes cell death, IFN reached 80-90% inhibitory effects ine whether combination of LiCl and Apigenin can Substitute caused by pUC19 DNA transfection when combined with 30 DNA transfection for the synergistic inhibitory effect and uM BMS345541 and WST-1 at 48 hours after WST-1 treat induction of cancer cell death. ment. 0304 Methods: UM-SCC-6 cells were cultured in 96 well plates and treated with LiCl (1, 3, 10, 30, 100 mM) and Example 5 Apigenin (1, 3, 10, 30, and 100 uM) in different combination WST-1 induces ROS Generation of theirdoses for 24 hours followed by WST-1 treatment. Cell viability was measured with CCK8 kit. 0300. Overview: WST-1 was first described by ishiyama et 0305 Data showed that combination of LiCl and Apigenin al in 1996 (Ishiyam M. etal Biol Pharm Bull 1996, 19:1515 dose dependent decrease of cell growth and increased cell 20). It is a cell proliferation detection reagent manufactured death comparing to untreated control cells. 10uMAP and 100 by Roche. WST-1 is composed of tetrazolium salt WST-1 mM LiCl showed synergistic increase of cell death (FIG.5A). {4-3-(4-Iodophenyl)-2-(4-nitrophenyl)-2H-5-tetrazolio-1, The subsequent treatment of WST-1 further enhanced this 3-benzenedilsulfonate and an electron coupling reagent inhibitory effect (FIG. 5B). diluted in phosphate buffered saline. WST-1 can be cleaved by mitochondrial Succinate-tetrazolium-reductase system. Example 7 This cleavage has been used as the basis of the measurement pUC19 DNA Transfection Synergize Chemothera of live cell. However, WST-1 has been found impermeable to peutic Drug Effect in UM-SCC6 Cells cell membrane and their reduction occurs at the cell surface or (0306 UM-SCC-6 cells were transfected with puC19 at the level of the plasma membrane via trans-plasma mem DNA, pcDNA3, puC19+pcDNA3, IKK1-KA+pUC19, US 2011/O 142815 A1 Jun. 16, 2011
IKK2-KA+pUC19, and IKK1-KA+IKK2-KA+pUC19, or 100 uMapigenin or combination of 3% WST-1r with 100 IKK1-KA+pcDNA3, IKK2-KA+pcDNA3, or IKK1-KA+ uM apigenin in parallel with untreated control cells. Date IKK2-KA+pcDNA3, for 48 hours and, treated with variable showed that the combination of WST-1 randapigenin induced doses of 5-FU (FIG. 6A) or Cis-Platinum (FIG. 6B) for 96 or 75% to 95% cell death of all seven tested cancer cell lines 72 hours respectively. Cell viabilities were measured in 72 comparing to untreated controls (FIG. 8A). and 96 hours respectively after drug treatment. Data showed 0314 B-E: Data showed both WST-1r and apigenin dose that puC19 transfected cells showed the strongest inhibitory dependent cell death and synergized cell death effect when effects on cell growth. combining 3% WST-1r with 100 uMapigenin or 10% WST Example 8 1 r with 30 uMapigenin. B & C: WST-1r Dose-Response of MA-MB-231 cells (B) and A431 cells (C). The IC50 of WST 0307 pUC19 DNA Transfection Synergize Chemothera 1 r in the presence of 100 uM apigenin were 1% for both peutic Drug Effect in HT1080 Cells MDA-MB231 cells and A431 cells, while treatment of 0308 HT1080 Cells were transfected with puC19 DNA, pcDNA3, puC19+pcDNA3, IKK1-KA+pUC19, IKK2-KA+ apigein alone showed little effect on cell survival. D & E: pUC19, and IKK1-KA+IKK2-KA+pUC19, IKK1-KA+ apigenin Dose-Response of MDA-MB-231 cells and A431 pcDNA3, IKK2-KA+pcDNA3, or IKK1-KA+IKK2-KA+ cells. The apigenin IC50 in the presence of 10% WST-1r were pcDNA3, for 48 hours before the treatment of chemotherapy 10 uM for both cell lines (FIG. 8 B-E). drugs at various doses. Cell viability was measured in 72 and 96 hours after drug treatment. Example 10 0309 Drug treatment: Cis-Platinum 30 ng/ml-3 ug/ml (FIG. 6D), Paclitaxel 1 nM-10 uM (FIG. 6C), 5-FU 50 0315 Comparison of cell responses to modified WST-1r nM-500 uM (data not shown), Doxorubicin 30 nM-3.3 uM and Apigenin combination treatment between cancer cells (data not shown). and non-cancer cells. UM-SCC6, Cal27 human head and 0310 Variable enhancement and synergistic effects were neck cancer cell lines and primary cultured human bronchia shown by the transfection of these DNA vectors. pUC19 keratinocytes (HEKa) as labeled were treated with 10% DNA alone transfection showed the strongest synergistic effi modified WST-1r (mPMS 20 uM, WST-1 c 1 mM) with cacy effect to this chemotherapy drugs comparing to other (WST-1r 10) or without (WST-1r 0) 10% modified WST-1r in DNA vectors tested. IC50 of the drugs were lowered approxi combination with 0 (Apigenin 0), 30 (Apigenin 30) or 100 mately 10 fold when combining puC19 DNA transfected (Apigenin 100) uM Apigenin for 4 hours, then, changed to cells to that of untransfected cells of drug treatment (IC50 of Cis-Platinum from HT 1080 cells and UM-SCC-6 cells apigenin in the corresponding concentrations for another 24 untransfecte control 3 lug/ml, puC19 transfected cells 0.3 hours. Data showed that each of the WST-1 rand the Apigenin ug/ml and 1 lug/ml respectively; IC50 of 5-FU from untrans single agent treatment had little effect on cell viabilities (FIG. fected UM-SCC6 cells was more than 1 mM, but 200 uM 9). Combination of WST-1r with 100LM Apigenin resulted in from puC19 transfected cells: IC50 of texal from puC19 synergistic cell death in both UM-SCC6 and Cal27 cancer transfected HT1080 cells was 20 nM, while untransfected did cell lines, but not in paired non-cancer primary cultured not show any response upto 100 nM.). Furthermore, at 96 HEKa cells (FIG.9). These data demonstrated the cancer cell hours after of the cis-Platinum or palitaxel treatment untrans specificity of this combination treatment. fected cells recovered and grown up while the cell death from DNA transfected cells, especially puC19 vector alone trans Example 11 fected cells were irreversible, meaning they were 100% died. These data Suggest that these chemotherapy drugs inhibit Time Course and Dose Response of WST-1r and cancer cell growth, but may not kill these cells. The combi Dose-Response of Apigenin Involved in the Combi nation of transfection of puC19 DNA promote cell to death. nation Treatment of WST-1r with Apigenin Example 9 0316 Methods: Cal27 (A), HT1080 (B) and UM-SCC6 (C) cells were treated with variable concentration (1%, 3% Combination Treatment of Apigenin with WST-1r and 10%) of WST-1r as indicated for 0.5, 1, 2, and 4 hours in Synergizes Induced Cancer Cell Death combination with varible doses of apigenin (3, 10.30 and 100 0311 Method: UM-SCC6, MDA-MB-231, Cal27, uM) as indicated and, then, treated with the same concentra HT1080, T294, B6-5 and A431 cells were treated with 3% or tion of apigenin for another 24 hours. Cell viabilities were 10% of WST-1r or 10,30, or 100 uMapigenin or combination measured by CCK8. Kit and normalized as % of that of of variable concentrations of WST-1r with apigenin in paral untreated control calls. lel with untreated control cells and DMSO control for 4 hours, 0317 Results: Data showed WST-1 r time and dose depen then, the treatments were removed and the cells, thus, treated dent and apigenin dose dependent cell death from all three were changed to normal growth medium and maintained in tested cell lines (FIG. 10A-C). Synergetic induction of cell culture for another 24 hours. DMSO was used as vehicle death (over 80%) occurred at 10% WST-1r treatment for 0.5 control. Cell viabilities were measured by CCK8. Kit and hour in combination with 100LM apigeinin treated Cal27 and normalized to % of untreated control calls. UM-SCC6 cells (FIG. 10A, C) and at 3% WST-1r treatment 0312 Result: DMSO treated cells of every tested cell line for 1 hour in combination with 100 uM apigeinin treated showed same levels of cell viability as untreated control cells HT1080 cells (FIG. 10B). By increasing WST-1r treatment (data not shown). time, 80-90% cell death can be reached at 30 Mapigenin in 0313 A: UM-SCC6, MDA-MB-231, Cal27, HT1080, combination with 4 hour 10% WST-1r treatment from T294, B6-5 and A431 cells were treated with 3% of WST-1r HT1080 and UM-SCC6 cells (FIGS. 10B&C) and at 30 uM US 2011/O 142815 A1 Jun. 16, 2011 26 apigenin in combination with 1 hour 10% WST-1r treatment to total cell number measured by crystal violet staining The from Cal 27 cells (FIG. 10C). (Ap=apigenin; uMuM) phosphorylated JNK from each measurement were normal ized to the ratio of phosphorylated JNK over total JNK values. Example 12 0323 Result: Data showed WST-1r and apigenin dose Effect of Combination Treatment with IKK Inhibitor dependent induction of phosphorylation of JNK in and WST-1r on Melanoma Cell Lines UM-SCC6 cells (FIG. 13). Combination of WST-1r and api genin further increased JNK phosphorylation. The most sig 0318 Method: SK-Mel-5 and T294 human melanoma nificant increase of JNK phosphorylation from UM-SCC6 cells were treated with WST-1r at 1% and 3% final concen cells occurred at the treatment of 100 uMapigenin in combi tration respectively as indicated for 4 hours, then, removed nation with 3% or 10% WST-1 r. This result supports the WST-1 r by changing to normal growth medium and added hypotheses that the combination of WST-1r with apigenin IKK inhibitor III for another 24 hours. After 24 hours treat treatment induced JNK activation. ment with 3 uM and 10 uMIKK inhibitor III respectively as indicated, cells were changed to grow in normal growth medium for 48 hours before measuring cell viability by Example 15 CCK8. Kit. 0319 Result: Both SK-mel-5 cells (FIG. 11A), and T294 Dose Response of ROS Generation after Combina cells (FIG. 11B) showed WST-1r and IKK inhibitor tion Treatment of WST-1r and Apigenin and IKK BMS345541 dose dependent increase of cell deaths. Combi Inhibitor III nation of 3% WST-1r and 10 uMBMS345541 further syner 0324 Method: UM-SCC6 cells were labeled with 10 uM gized the induction of cell (FIGS. 11 A&B). Whereas, the CM-H2-DCFDA for 15 minutes and then treated with WST non-cancer primary cultured human keratinocytes were resis 1 r or CCK8 at the indicated amounts in combination with tant to this combination treatment (FIG. 11C). variable doses of apigenin (A) or IKK Inhibitor III (B) for 4 hours. Fluorescence at Ex485/Em535 were measured for Example 13 detecting ROS generation that labeled by the CM-H2 Effects of Treatment Order of WST-1r and IKK DCFDA. Inhibitor III (BMS345541) on Inducing Human 0325 Result: Data showed WST-1rdose dependent induc Melanoma Cell Death tion of ROS generation (FIGS. 24A and B). On the other 0320 Method: T294 cells were treated with 3% of WST-1r hand, CCK8 induced low and very limited level of ROS in combination with 3 or 10 uMBMS345541 respectively in generation with no relation to the CCK8 treatment dose at 4 different order as indicated. Cell viabilities were measured by hours after the treatment. Apigenin alone showed no effect on CCK8. Kit and normalized as % of that of untreated control ROS generation. However, combination of apigenin with 1% calls. Control: Cells were either untreated or treated with and 3% WST-1r did show apigenin dose dependent, limited, BMS345541 only at the indicated doses for 24 hours and, but, steady increase on ROS generation from thus treated cells then, changed to normal growth medium for another 24 hours when comparing to that of the corresponding doses of WST before measuring cell viability. B->W: Cells treated with 1 r only treated cells. (FIG. 24-A) Conversely, combination of BMS345541 only at the indicated doses for 24 hours and, 10% of WST-1r with apigenin resulted in decrease of ROS then, added WST-1r at 3% final concentration for 4 hours, levels(FIG. 24-B). In addition, when combined with CCK8. then removing the treatment and changed to normal growth apigenin also increase the ROS generation (FIG. 24-A). This medium for another 24 hours before measuring cell viability. effect is apigenin dose dependent. W+B: Cells treated with 3% WST-1r and BMS345541 at the 0326 Similarly, IKK inhibitor III alone and combination indicated doses for 4 hours and, then, removing the treatment of WST-1r with IKK inhibitor III (FIG.24-B) showed similar and changed to normal growth medium for another 24 hours effect as apigenin did, where 5 uMIKK Inhibitor increased before measuring cell viability. W+B->B: Cells treated with ROS levels while 10 uMIKK Inhibitor III decreased it (FIG. 3% WST-1r and BMS345541 at the indicated doses for 4 24-B). However, IKK Inhibitor III had no combined effect hours and, then, removing the treatment and added with CCK8 on ROS levels. BMS345541 at the indicated doses in normal growth medium for another 24 hours before measuring cell viability. W->B: Example 16 Cells treated with 3% WST-1rfor 4 hours and, then, removing the treatment and added IKK BMS345541 at the indicated Time Course of ROS Generation after Combination doses in normal growth medium for another 24 hours before Treatment of WST-1e and Apigenin and IKK Inhibi measuring cell viability. tor III 0321 Result: Data showed that W->Band W+B->B treat ment orders synergized induction of cell death (FIG. 12). 0327 Method: UM-SCC6 cells were labeled with 10 uM CM-H2-DCFDA for 15 minutes and then treated with WST Example 14 1 r (B & D) or CCK8 (A & C) at the indicated amounts in combination with variable doses of apigenin (C&D) or IKK WST-1r and Apigenin Combination Treatment inhibitor III (A & B) for the time period from 15 minute up to Induced JNK Phosphrylation 4 hours. At each time points as indicated, fluorescence at 0322 Method: UM-SCC6 cells were treated with WST-1r Ex485/Em335 were measured for detecting ROS generation and apigenin at the indicated doses for 4 hours, and then that labeled by the CM-H2-DCFDA. phosphorylated JNK and total JNK were measured in parallel 0328. Result: Data showed that WST-1 rinduced ROS gen with FACE Kit (Qiogen). The resulting data were normalized eration continued increase and lasted at least for more than 4 US 2011/O 142815 A1 Jun. 16, 2011 27 hours (FIG.7-B& D), whereas, CCK8 only induced low level and mPMS+WST-1 from UM-SCC6 cells was 30 uM verses and transience increase of ROS(FIG. 7-A & C). 80 uM from untreated control cells. Example 20 Example 17 Differential Cellular Responses to mPNS Treatment CCK8-XTTWST-1 Comparison 0336 Non cancer human keratinocyte (HEKa), SK-Mel-5 human malonoma cell line (SK5), human head and neck 0329 Comparison cell death inducing capability of CCK8 cancer cell Cal27 line (Cal27) and UM-SCC6 line (SCC6) and XTT to WST-1r in combination with apigenin treatment cells and human soft tissue sarcoma cell line HT1080 0330 Method: HT1080 and UM-SCC6 cells were treated (HT1080) were treated with 30, 40 or 50 mM mPMS for 4 with 10% of WST-1r, CCK8 or XTT in combination with hours and then cultured in normal growth medium for another variable doses of apigenin for 4 hours and, then changed to 24 hours. Cell viabilities were measured with CCK8 kit. Data normal growth medium for another 24 hours. Cell viability showed mPMS dose dependent cell death and differential was measured with CCK8 kit. sensitivities to mPMS treatment from each of the cell lines 0331 Result: Data showed that CCK8 had no effect on cell (FIG. 17). Among those, the non cancer primary cultured death when comparing to control cells, while XTT showed HEKa cells showed the least sensitivity to mPMS treatment intermediate induction of cell death effect comparing to with IC5050 uM, while the 1050 from Cal27, UM-SCC6 and WST-1r on both UM-SCC6 (FIG. 14B) and HT1080 cells HT1080 cells were 20, and 30 mM respectively. (FIG. 14A). Apigenin 1050 of WST-1r and, XTT treated UM-SCC6 cells were 5 and 25 M while apigenin only and Example 21 CCK8+apigenin treatments did not reached 1050. Similar Effect of Combination Treatment of WST-3 with result from HT 1080 cells as well. Apigenin on Induction of Cancer Cell Death 0337 Method: UM-SCC6, HT1080, Cal27, SK-Mel-5, Example 18 and HEKa cells were treated with 50 or 100 mMWST-3 or 10 or 30 mM apigenin alone, or combination of WST-3 and Effects of Other Tetrazolium Salts as Substitutives of apigenin at different concentrations for 4 hours with WST-1 r for Combination Treatment untreated cells as control, then, changed to normal growth medium and remained culture in this medium for another 24 0332 Method: HT1080 and UM-SCC6 cells were treated hours. After the 24 hours culture, cell viabilities were mea with 1 mM WST-1, 0.4 m MWST-3, 0.5 mMWST-4, 0.5 mM sured with CCK8. Kit. Data were normalized to % of WST-5 or 0.12 mM mPMS alone or each of the WST-3, untreated control cells. WST-4, and WST-5 at the same concentration in combination 0338 Result: A: Summary of differential cell responses to with 0.12 mM mPMS (0.4 mMWST-3+0.12 mM mPMS, 0.5 WST-3, apigenin and combination treatments. Comparing to mM WST-4+0.12 mM mPMS, 0.5 mM WST-5+0.12 mM untreated cells (Ctrl) treatment of 50 mM WST-3 (WST-3) or mPMS) plus 10, 30 or 100LLM apigenin for 4 hours and, then 30 mMapigenin (Apigenin) alone showed no or limited effect changed to normal growth medium for another 24 hours. Cell of cell death to all tested cell line. Combination of WST-3 and viability was measured with CCK8 Kit. apigenin (Apigenin-i-WST-3) resulted in Synergistic cell death 0333 Result: Data showed that WST-3 alone, WST-3+ of SK-Mel-5, Cal27, UM-SCC6 and HT1080 all four tested mPMS and WST-4+mPMS in combination with apigenin human cancer cell lines, but limited cell death from non showed similar synergistic effect on inducing cell death that cancer human keratinocytes (FIG. 18A). equivalent to that WST-1r does from both HT1080 cells (FIG. 0339 B & C: Comparison of Dose-Response of WST-3 17A) and UM-SCC6 cells (FIG. 17B). WST-1, WST-4, and and apigenin between non cancer HEKa and human mela WST-5 alone showed no such effect (FIG. 17 A.B). WST-3+ noma cell line SK-Mel-5 cells. Data showed both WST-3 and mPMS are more potent than WST-1r on cell death induction. apigenin induced and dose dependent but limited cell death from both HEKa cells (FIG. 18B) and SK-Mel-5 (FIG. 18C) Example 19 cells. HEKa cells showed limited cell death in response to apigenin or WST-3 alone treatment. WST-3 IC50 of combi mPMS Dose-Response nation of 30 uM apigenin and WST-3 was 40 uM. Further increase WST-3 concentration showed no more cell death 0334 Method: A & B: HT1080 (FIG. 16A) and UM from HEKa cells (FIG. 18B). However, the SK-Mel-5 cells SCC6 (FIG. 16B) cells were treated with variable concentra showed synergistic cell death response to combination treat tions of mPMS as indicated in combination with 1 mMWST ment of 50 MWST-3 and 30 Mapigenin. The WST-3 IC50 1c and 10, 30 or 100 uM apigenin for 4 hours and, then, from this combination treatment of the SK-Mel-5 cells was 20 changed to normal growth medium for another 24 hours. Cell uM, one fold less than that from HEKa cells (FIG. 18C). The viabilities were measured by CCK8. Kit. 1 mM WST-1 only, HEKa cells were much more resistant to this combination 0.12 mM mPMS only and 10% WST-1r were used as parallel treatment. Similar results were also observed from other can control. AP 0: Untreated Control, AP 10: 10 mM Apigenin, cer cells. AP30: 30 mM Apigenin, AP 100: 100 mM Apigenin. Example 22 0335 Result: Data showed mPMS and apigenin dose dependent cell death of both HT1080 and UM-scc6 cells Effect of Substitution of WST-1r with WST-3+ (FIGS. 16A &B), mPMS1050 of combination treatment of mPMS for Combination Treatment with Apigenin on apigenin 100 uMandmPMS+WST-1 from HT1080 cells was Induction of Cell Death 5 mM verses 60 mM from untreated control cells. 0340 Method: UM-SCC6, HT1080, Cal127, SK-Mel-5, mPMS1050 of combination treatment of apigenin 100 uM and HEKa cells were treated with 0.1 mM WST-3 plus 30 uM US 2011/O 142815 A1 Jun. 16, 2011 28 mPMS, or WST-3 only, or untreated control in combination siRHA#3 (IC50: 25 nM FIG. 22B), and siRNA targeting with 10 or 30 uM apigenin for 4 hours and, then, changed to SH3PXD2B (IC50: 25 nM FIG. 22C), C60rf108 (IC50: 20 normal growth medium and remained culture in this medium nM FIG. 22C). These data demonstrated that the DAN for another 24 hours. After the 24 hours culture, cell viabili sequences of Puc19 DNA vector code for some short func ties were measured with CCK8. Kit. Data were normalized to tional sequences that can target and interrupt the expression % of untreated control cells. levels of the corresponding genes and the cellular functions. 0341 Result: Data showed that over 90% induced cell At least the genes (TRPC6, SH3PXD2B, C60rf108, MAGI3, death observed from thus treated Cal27, UM-SCC6, and SK and TMEM182) that have been tested can be used as a target Mel-5 cells that were treated in combination of 0.1 mM for anti-cancer drug design for enhancing the efficacy effect WST-3, and 30 M apigenin (FIG. 19C). Adding 30 uM of chemotherapy drugs. The siRNAS targeting these corre mPMS to these treatments further synergize the cell death sponding genes that were identified may also be used as a tool from Cal27 and UM-SCC6 cells (FIG. 19C). On the other to reach this goal. In addition, these combined treatments hand, under this treatment condition, HEKa, primary cultured induce cancer cell death rather than simple inhibition of cell human keratinocytes, were relative resistant to this treatment. growth. 72 hours after treatment, the treated cells did not grow This difference in sensitivity to this combination treatment back. This feature adds to lasting effect of the treatment. may provide a window for differentiating targeting cancer cells and to control toxicity to normal cells. Example 24 Substitution of Puc19 with siRNA Against Example 23 TMEM182 and MAGI3 for Puc19-Ikk Inhibitor Enhancement of Taxel Efficacy Effects by Combina WST-1r Triple Combination Treatment tion of Puc19 DNA Sequence Derived siRNA with 0344 Method: HT1080 cells were transfected with Taxel siRNAi3, or the siRNA targeting MAGI3, and TMEM182 0342 Method: HT1080 cells transfected with siRNAs that that were derived from Puc19 DNA sequence and the siRNAs were derived from Puc19 DNA sequence and the siRNAs that that targeting the corresponding genes that are the targets of targeting the corresponding genes that are the targets of the the Puc19 derived siRNAs for 24 hours, then, treated with Puc19 derived siRNAs for 24 hours, then, treated with Taxel IKK inhibitor III for 24 hours followed by adding WST-1r for at 3, 10, 30, and 100 nM for 48 hours. After the 48 hours of another 4 hour. After the 4 hours WST-1r treatment, cells in Taxel treatment, cells in culture were changed to normal culture were changed to normal growth medium for 24 hours. growth medium for 24 to 72 hours. Cell viability was moni Cell viability were monitored by CCK8 Kit every 24 hours. tored by CCK8 Kit every 24 hours. Data are normalized to % Data were normalized to % of untreated control cells. AllStar ofuntreated control cells. The siRNAs that used for this study siRNA was used as negative siRNA trasnfection control. includes siRNAH1, siRNAH2, siRHA#3, siRNA targeting Puc19 DNA vector transfection was used as positive control. TRPC6, SH3PXD2B, C6Orf108, TTBK1, MAGI3, and (0345 Data label: Untreated control: 0 Ctrl, WST-1r only: TMEM182 as well as combination of siRNAH2+H3, and 10 Ctrl, puC19 transfected cells: 0 p9, puC19 transfected siRNAi1+#2+#3+#4+#5 (siRNAX.1-5). and WST-1r treated: 10 p9, AllStar negative contrl siRNA 0343 Result: Data showed represent the measurements of transfected: O AllStar, AllStar transfected and WST-1r 72 hours after the treatment. The cell survival data showed treated: 10 AllStar, siRNAH3 transfected: O siRNAH3, Taxel dose dependent cell death and enhanced cell death by siRNAH3 transfeted and WST-1r treated: 10 siRNAH3, siR Puc19 trasnfection and majority of the siRNA trasfections NAMAGI3 transfected: O MAGI3, siRNAMAGI3 transfcted (FIG. 22). The IC50 of taxel (Contrl IC50: 60 nM) was and WST-1r treated: 10 MAGI3, siRNATMEM182 trans reduced more than 3 fold by Puc19 DNA trasnfection (IC50: fected: O TMEM182, siRNATMEM182 transfcted and WST 20 nM) and by the trasnfeciton of siRNAs targeting TRPC6 1r treated: 10 TMEM182, (IC50: 25 nM FIG. 22A), SH3PXD2B (IC50: 20 nM FIG. 0346 Result: Data showed IKK inhibitor BMS345541 22C), C60rf108 (IC50: 20 nM FIG.22C), TTBK1 (IC50:35 dose dependent cell death and that siRNA targeting MAGI3 nM FIG. 22C), MAGI3 (IC50: 20 nM FIG. 22A), and and TMEM182 synergize the cell death (FIG. 20). At 15uM TMEM182 (IC50: 20 nM FIG.22B), as well as by the trans BMS345541 incombinatolin with 10% WST-1r and either fection of combination of siRNAi2+i3 (IC50: 25 nM FIG. pUC19 or the siRNA trasnfection resulted in synergistic 22A), B, and siRNAi 1+#2+#3+#4+#5 (IC50: 20 nM FIG. induction of cell death. Again, these data showed that target 22A-C). Over 2.5 fold IC50 decrease of taxel concentration ing TMEM182 and MAGI3 may enhance effect on cancer were observed from siRNAi2 (IC50: 25 nM FIG. 22C), treatment.
SEQUENCE LISTING
<16 Os NUMBER OF SEO ID NOS : 13
<21 Os SEQ ID NO 1 &211s LENGTH: 26.86 &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: Cloning vector pUC19c
US 2011/O 142815 A1 Jun. 16, 2011 34
- Continued gaaaaatcaa aaccocaaac aaacactgtg gttgtttggit to cattatag cacaattittg 4 O93 tgcc atttct gggagcattt acagatgaat CCC cacactt agc cattgaa totalaagggg 4153 aaaaataagg tdagaatttg taaatactta t ctdttattt toaatatgtt citatic cttct 4213 acccaaatat ataaaacagg aatttgcatt catgtgcatt taccalagagg ttgttgttgt 4273 tact tact ga t catgtgaag toggtgtc.tta aacaactaaa agcigatgaag gttcatatgt 4.333 ttactcaaag accattggca ttcagaggat gctggacatt aactggaact gctact tcca 4393 attcaataat giggagattitc aaatgcaaat ctitta acttic at cittaaaga tigaaatggitt 4453 gcagaaaatc tdtttagctic caactittggc titaatttaaa toaaagaac a tittatgtaac 4513 Cagat cagaa aatacagctgaaaatttgga atticgagctic ggit accc.ggg g 4564
<210s, SEQ ID NO 3 &211s LENGTH: 931 212. TYPE: PRT <213> ORGANISM: Homo sapiens
<4 OOs, SEQUENCE: 3 Met Ser Glin Ser Pro Ala Phe Gly Pro Arg Arg Gly Ser Ser Pro Arg 1. 5 1O 15 Gly Ala Ala Gly Ala Ala Ala Arg Arg Asn. Glu Ser Glin Asp Tyr Lieu. 2O 25 3O Lieu. Met Asp Ser Glu Lieu. Gly Glu Asp Gly Cys Pro Glin Ala Pro Lieu. 35 4 O 45 Pro Cys Tyr Gly Tyr Tyr Pro Cys Phe Arg Gly Ser Asp Asin Arg Lieu. SO 55 6 O Ala His Arg Arg Glin Thr Val Lieu. Arg Glu Lys Gly Arg Arg Lieu Ala 65 70 7s 8O Asn Arg Gly Pro Ala Tyr Met Phe Ser Asp Arg Ser Thr Ser Leu Ser 85 90 95 Ile Glu Glu Glu Arg Phe Lieu. Asp Ala Ala Glu Tyr Gly Asn. Ile Pro 1OO 105 11 O Val Val Arg Llys Met Lieu. Glu Glu. Cys His Ser Lieu. Asn Val Asn. Cys 115 12 O 125 Val Asp Tyr Met Gly Glin Asn Ala Lieu. Glin Lieu Ala Wall Ala Asn. Glu 13 O 135 14 O His Lieu. Glu Ile Thr Glu Lieu. Lieu. Lieu Lys Lys Glu Asn Lieu. Ser Arg 145 150 155 160 Val Gly Asp Ala Lieu. Lieu. Lieu Ala Ile Ser Lys Gly Tyr Val Arg Ile 1.65 17O 17s Val Glu Ala Ile Lieu. Ser His Pro Ala Phe Ala Glu Gly Lys Arg Lieu 18O 185 19 O Ala Thr Ser Pro Ser Glin Ser Glu Lieu. Glin Glin Asp Asp Phe Tyr Ala 195 2OO 2O5 Tyr Asp Glu Asp Gly Thr Arg Phe Ser His Asp Val Thr Pro Ile Ile 21 O 215 22O Lieu Ala Ala His Cys Glin Glu Tyr Glu Ile Val His Thr Lieu. Lieu. Arg 225 23 O 235 24 O Lys Gly Ala Arg Ile Glu Arg Pro His Asp Tyr Phe Cys Lys Cys Asn 245 250 255 Asp Cys Asn. Glin Lys Glin Llys His Asp Ser Phe Ser His Ser Arg Ser 26 O 265 27 O US 2011/O 142815 A1 Jun. 16, 2011 35
- Continued
Arg Ile Asn Ala Tyr Lys Gly Lieu Ala Ser Pro Ala Tyr Lieu. Ser Lieu 27s 28O 285 Ser Ser Glu Asp Pro Val Met Thr Ala Lieu. Glu Lieu. Ser Asn. Glu Lieu. 29 O 295 3 OO Ala Val Lieu Ala Asn. Ile Glu Lys Glu Phe Lys Asn Asp Tyr Lys Llys 3. OS 310 315 32O Lieu. Ser Met Glin Cys Lys Asp Phe Val Val Gly Lieu. Lieu. Asp Lieu. Cys 3.25 330 335 Arg Asn Thr Glu Glu Val Glu Ala Ile Lieu. Asn Gly Asp Val Glu Thr 34 O 345 35. O Lieu. Glin Ser Gly Asp His Gly Arg Pro Asn Lieu. Ser Arg Lieu Lys Lieu. 355 360 365 Ala Ile Llys Tyr Glu Val Llys Llys Phe Val Ala His Pro Asn. Cys Glin 37 O 375 38O Glin Glin Lieu. Lieu. Ser Ile Trp Tyr Glu Asn Lieu. Ser Gly Lieu. Arg Glin 385 390 395 4 OO Glin Thr Met Ala Val Llys Phe Lieu Val Val Lieu Ala Val Ala Ile Gly 4 OS 41O 415 Lieu Pro Phe Leu Ala Lieu. Ile Tyr Trp Phe Ala Pro Cys Ser Lys Met 42O 425 43 O Gly Lys Ile Met Arg Gly Pro Phe Met Llys Phe Val Ala His Ala Ala 435 44 O 445 Ser Phe Thir Ile Phe Lieu. Gly Lieu. Lieu Val Met Asn Ala Ala Asp Arg 450 45.5 460 Phe Glu Gly. Thir Lys Lieu. Lieu Pro Asn. Glu Thir Ser Thr Asp Asn Ala 465 470 47s 48O Lys Gln Leu Phe Arg Met Lys Thr Ser Cys Phe Ser Trp Met Glu Met 485 490 495 Lieu. Ile Ile Ser Trp Val Ile Gly Met Ile Trp Ala Glu. Cys Lys Glu SOO 505 51O Ile Trp Thr Glin Gly Pro Lys Glu Tyr Lieu Phe Glu Lieu. Trp Asn Met 515 52O 525 Lieu. Asp Phe Gly Met Lieu Ala Ile Phe Ala Ala Ser Phe Ile Ala Arg 53 O 535 54 O Phe Met Ala Phe Trp His Ala Ser Lys Ala Glin Ser Ile Ile Asp Ala 5.45 550 555 560 Asn Asp Thir Lieu Lys Asp Lieu. Thir Lys Val Thir Lieu. Gly Asp Asn Val 565 st O sts Llys Tyr Tyr Asn Lieu Ala Arg Ile Llys Trp Asp Pro Ser Asp Pro Glin 58O 585 59 O Ile Ile Ser Glu Gly Lieu. Tyr Ala Ile Ala Val Val Lieu. Ser Phe Ser 595 6OO 605 Arg Ile Ala Tyr Ile Lieu Pro Ala Asn. Glu Ser Phe Gly Pro Lieu. Glin 610 615 62O Ile Ser Leu Gly Arg Thr Val Lys Asp Ile Phe Llys Phe Met Val Ile 625 630 635 64 O Phe Ile Met Val Phe Val Ala Phe Met Ile Gly Met Phe Asn Lieu. Tyr 645 650 655 Ser Tyr Tyr Ile Gly Ala Lys Glin Asn Glu Ala Phe Thr Thr Val Glu 660 665 67 O US 2011/O 142815 A1 Jun. 16, 2011 36
- Continued Glu Ser Phe Llys Thr Lieu Phe Trp Ala Ile Phe Gly Lieu Ser Glu Val 675 68O 685 Llys Ser Val Val Ile Asn Tyr Asn His Llys Phe Ile Glu Asn. Ile Gly 69 O. 695 7 OO Tyr Val Lieu. Tyr Gly Val Tyr Asn Val Thr Met Val Ile Val Lieu. Leu 7 Os 71O 71s 72O Asn Met Lieu. Ile Ala Met Ile Asn. Ser Ser Phe Glin Glu Ile Glu Asp 72 73 O 73 Asp Ala Asp Val Glu Trp Llys Phe Ala Arg Ala Lys Lieu. Trp Phe Ser 740 74. 7 O Tyr Phe Glu Glu Gly Arg Thr Lieu Pro Val Pro Phe Asn Lieu Val Pro 7ss 760 765 Ser Pro Llys Ser Lieu. Phe Tyr Lieu. Lieu. Lieu Lys Lieu Lys Llys Trp Ile 770 775 78O Ser Glu Lieu. Phe Glin Gly His Llys Lys Gly Phe Glin Glu Asp Ala Glu 78s 79 O 79. 8OO Met Asn Lys Ile Asn. Glu Glu Lys Llys Lieu. Gly Ile Lieu. Gly Ser His 805 810 815 Glu Asp Lieu. Ser Llys Lieu. Ser Lieu. Asp Llys Lys Glin Val Gly His Asn 82O 825 83 O Lys Gln Pro Ser Ile Arg Ser Ser Glu Asp Phe His Lieu. Asn Ser Phe 835 84 O 845 Asn Asn Pro Pro Arg Glin Tyr Glin Lys Ile Met Lys Arg Lieu. Ile Llys 850 855 860 Arg Tyr Val Lieu. Glin Ala Glin Ile Asp Llys Glu Ser Asp Glu Val Asn 865 87O 87s 88O Glu Gly Glu Lieu Lys Glu Ile Lys Glin Asp Ile Ser Ser Lieu. Arg Tyr 885 890 895 Glu Lieu. Lieu. Glu Glu Lys Ser Glin Asn Thr Glu Asp Lieu Ala Glu Lieu. 9 OO 905 91 O Ile Arg Glu Lieu. Gly Glu Lys Lieu. Ser Met Glu Pro Asn Glin Glu Glu 915 92 O 925 Thir Asn Arg 93 O
<210s, SEQ ID NO 4 211 LENGTH: 7777 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221s NAME/KEY: CDS <222s. LOCATION: (172) ... (2907)
<4 OOs, SEQUENCE: 4 agtgcgc.gcc gag.cga-aggg C9g.cggcggit gcgg.cggcg gct C9tgctic gCCCC9gct 6 O gcgattgcgc ticagotcCag gttcc ctgcc cycggcggcg cgc.ccc.ca.gc gct Coctgca 12 O cc.ccgc.gc.ca ccc.gcacccg cgct cqgc cc gctg.cgggcg gaggagcggc C atg cc.g 177 Met Pro 1. ccg cgg cqc agc atc gtg gag gtg aag gtg cta gac gtg cag aag cqg 225 Pro Arg Arg Ser Ile Val Glu Val Llys Val Lieu. Asp Val Glin Lys Arg 5 1O 15 cgg gtg ccc aac aag cat tat gt C tac at C atc. c99 gtc acg tdg to C 273 Arg Val Pro Asn Lys His Tyr Val Tyr Ile Ile Arg Val Thir Trp Ser
US 2011/O 142815 A1 Jun. 16, 2011 42
- Continued ggatgtgagg ggaggggtga gaacaactag Ctgtagcatg tdtaggctat at actitt acc 7 707 atttgactitc titt cotttitt tttitttittaa ataaaaaaag togcttgact g gtttcaa.gct 7767 t cat catgaa 7777
<210s, SEQ ID NO 5 &211s LENGTH: 911 212. TYPE: PRT <213> ORGANISM: Homo sapiens
<4 OOs, SEQUENCE: 5 Met Pro Pro Arg Arg Ser Ile Val Glu Val Llys Val Lieu. Asp Val Glin 1. 5 1O 15 Lys Arg Arg Val Pro Asn Llys His Tyr Val Tyr Ile Ile Arg Val Thr 2O 25 3O Trp Ser Ser Gly Ser Thr Glu Ala Ile Tyr Arg Arg Tyr Ser Llys Phe 35 4 O 45 Phe Asp Leu Gln Met Gln Met Lieu. Asp Llys Phe Pro Met Glu Gly Gly SO 55 6 O Glin Lys Asp Pro Llys Glin Arg Ile Ile Pro Phe Lieu Pro Gly Lys Ile 65 70 7s 8O Lieu. Phe Arg Arg Ser His Ile Arg Asp Wall Ala Val Lys Arg Lieu. Ile 85 90 95 Pro Ile Asp Glu Tyr Cys Lys Ala Lieu. Ile Gln Lieu. Pro Pro Tyr Ile 1OO 105 11 O Ser Glin Cys Asp Glu Val Lieu. Glin Phe Phe Glu Thr Arg Pro Glu Asp 115 12 O 125 Lieu. Asn Pro Pro Llys Glu Glu. His Ile Gly Lys Llys Llys Ser Gly Gly 13 O 135 14 O Asp Glin Thir Ser Val Asp Pro Met Val Lieu. Glu Gln Tyr Val Val Val 145 150 155 160 Ala Asn Tyr Glin Lys Glin Glu Ser Ser Glu Ile Ser Lieu. Ser Val Gly 1.65 17O 17s Glin Val Val Asp Ile Ile Glu Lys Asn. Glu Ser Gly Trp Trp Phe Val 18O 185 19 O Ser Thr Ala Glu Glu Gln Gly Trp Val Pro Ala Thr Cys Lieu. Glu Gly 195 2OO 2O5 Glin Asp Gly Val Glin Asp Glu Phe Ser Lieu. Glin Pro Glu Glu Glu Glu 21 O 215 22O Lys Tyr Thr Val Ile Tyr Pro Tyr Thr Ala Arg Asp Glin Asp Glu Met 225 23 O 235 24 O Asn Lieu. Glu Arg Gly Ala Val Val Glu Val Ile Gln Lys Asn Lieu. Glu 245 250 255 Gly Trp Trp Llys Ile Arg Tyr Glin Gly Lys Glu Gly Trp Ala Pro Ala 26 O 265 27 O Ser Tyr Lieu Lys Lys Asn Ser Gly Glu Pro Leu Pro Pro Llys Pro Gly 27s 28O 285 Pro Gly Ser Pro Ser His Pro Gly Ala Lieu. Asp Lieu. Asp Gly Val Ser 29 O 295 3 OO Arg Glin Glin Asn Ala Val Gly Arg Glu Lys Glu Lieu Lleu Ser Ser Glin 3. OS 310 315 32O Arg Asp Gly Arg Phe Glu Gly Arg Pro Val Pro Asp Gly Asp Ala Lys 3.25 330 335 US 2011/O 142815 A1 Jun. 16, 2011 43
- Continued
Glin Arg Ser Pro Llys Met Arg Glin Arg Pro Pro Pro Arg Arg Asp Met 34 O 345 35. O Thir Ile Pro Arg Gly Lieu. Asn Lieu Pro Llys Pro Pro Ile Pro Pro Glin 355 360 365 Val Glu Glu Glu Tyr Tyr Thr Ile Ala Glu Phe Glin Thr Thr Ile Pro 37 O 375 38O Asp Gly Ile Ser Phe Glin Ala Gly Lieu Lys Val Glu Val Ile Glu Lys 385 390 395 4 OO Asn Lieu. Ser Gly Trp Trp Tyr Ile Glin Ile Glu Asp Llys Glu Gly Trip 4 OS 41O 415 Ala Pro Ala Thr Phe Ile Asp Llys Tyr Lys Llys Thir Ser Asn Ala Ser 42O 425 43 O Arg Pro Asn. Phe Lieu Ala Pro Lieu Pro His Glu Val Thr Glin Lieu. Arg 435 44 O 445 Lieu. Gly Glu Ala Ala Ala Lieu. Glu Asn. Asn Thr Gly Ser Glu Ala Thr 450 45.5 460 Gly Pro Ser Arg Pro Leu Pro Asp Ala Pro His Gly Val Met Asp Ser 465 470 47s 48O Gly Lieu Pro Trp Ser Lys Asp Trp Llys Gly Ser Lys Asp Wall Lieu. Arg 485 490 495 Lys Ala Ser Ser Asp Met Ser Ala Ser Ala Gly Tyr Glu Glu Ile Ser SOO 505 51O Asp Pro Asp Met Glu Glu Lys Pro Ser Lieu Pro Pro Arg Lys Glu Ser 515 52O 525 Ile Ile Llys Ser Glu Gly Glu Lieu. Lieu. Glu Arg Glu Arg Glu Arg Glin 53 O 535 54 O Arg Thr Glu Gln Lieu. Arg Gly Pro Thr Pro Llys Pro Pro Gly Val Ile 5.45 550 555 560 Lieu Pro Met Met Pro Ala Lys His Ile Pro Pro Ala Arg Asp Ser Arg 565 st O sts Arg Pro Glu Pro Llys Pro Asp Llys Ser Arg Lieu. Phe Glin Lieu Lys Asn 58O 585 59 O Asp Met Gly Lieu. Glu. Cys Gly His Llys Val Lieu Ala Lys Glu Val Lys 595 6OO 605 Llys Pro Asn Lieu. Arg Pro Ile Ser Lys Ser Lys Thr Asp Lieu Pro Glu 610 615 62O Glu Lys Pro Asp Ala Thr Pro Glin Asn Pro Phe Leu Lys Ser Arg Pro 625 630 635 64 O Glin Val Arg Pro Llys Pro Ala Pro Ser Pro Llys Thr Glu Pro Pro Glin 645 650 655 Gly Glu Asp Glin Val Asp Ile Cys Asn Lieu. Arg Ser Llys Lieu. Arg Pro 660 665 67 O Ala Lys Ser Glin Asp Llys Ser Lieu. Lieu. Asp Gly Glu Gly Pro Glin Ala 675 68O 685 Val Gly Gly Glin Asp Wall Ala Phe Ser Arg Ser Phe Lieu Pro Gly Glu 69 O. 695 7 OO Gly Pro Gly Arg Ala Glin Asp Arg Thr Gly Lys Glin Asp Gly Lieu. Ser 7 Os 71O 71s 72O Pro Lys Glu Ile Ser Cys Arg Ala Pro Pro Arg Pro Ala Lys Thir Thr 72 73 O 73
US 2011/O 142815 A1 Jun. 16, 2011 48
- Continued aag gag tac aac atgggg ctg. itt C at C citt Cdt Ctt gct gaa gat 31.59 Lys Glu Tyr Asn Met Gly Lieu. Phe Ile Lieu. Arg Lieu Ala Glu Asp O4 O O45 OSO ggit cot gcc atc aaa gat ggc aga att cat gtt ggit gaC cag att 3204 Gly Pro Ala Ile Lys Asp Gly Arg Ile His Val Gly Asp Glin Ile O55 O6 O O65 gtt gala atc aat ggg gaa cct aca caa gga atc aca cat act Ca 3249 Val Glu Ile Asn Gly Glu Pro Thr Glin Gly Ile Thr His Thr Arg Of O O7 O8O gca att gag citc att cag got ggit gga aat aaa gtt citt citt citt 3.294 Ala Ile Glu Lieu. Ile Glin Ala Gly Gly Asn Llys Val Lieu Lleu Lieu. O85 O9 O O95 ttg agg cca gga act ggc titg at a cct gaC cat ggt ttg gct cct 3339 Lieu. Arg Pro Gly Thr Gly Lieu. Ile Pro Asp His Gly Lieu Ala Pro 1 OO 105 11 O tcc ggit Ctg to tcc tac gitg aaa ccc gag caa cat taa ggctitt Cagg 3388 Ser Gly Lieu. Cys Ser Tyr Val Llys Pro Glu Gln His 115 12 O 125 gcttitt cittg gtc.ttt cott aaaaagacitt ggtaaatttg catgtc.ttgt aaat cactitt 3448 cittcttttgt titt cittittaa attaaaaatg atgct attaa atacat citat ttctat 3504
<210s, SEQ ID NO 7 &211s LENGTH: 1125 212. TYPE: PRT <213> ORGANISM: Homo sapiens <4 OO > SEQUENCE: 7 Met Ser Lys Thr Lieu Lys Llys Lys Arg His Trp Lieu. Ser Llys Val Glin 1. 5 1O 15 Glu Cys Ala Val Ser Trp Ala Gly Pro Pro Gly Asp Phe Gly Ala Glu 2O 25 3O Ile Arg Gly Gly Ala Glu Arg Gly Glu Phe Pro Tyr Lieu. Gly Arg Lieu. 35 4 O 45 Arg Glu Glu Pro Gly Gly Gly Thr Cys Cys Val Val Ser Gly Lys Ala SO 55 6 O Pro Ser Pro Gly Asp Val Lieu. Leu Glu Val Asn Gly Thr Pro Val Ser 65 70 7s 8O Gly Lieu. Thir Asn Arg Asp Thir Lieu Ala Val Ile Arg His Phe Arg Glu 85 90 95 Pro Ile Arg Lieu Lys Thr Val Llys Pro Gly Llys Val Ile Asn Lys Asp 1OO 105 11 O Lieu. Arg His Tyr Lieu. Ser Lieu. Glin Phe Glin Lys Gly Ser Ile Asp His 115 12 O 125 Llys Lieu. Glin Glin Val Ile Arg Asp Asn Lieu. Tyr Lieu. Arg Thir Ile Pro 13 O 135 14 O Cys Thir Thr Arg Ala Pro Arg Asp Gly Glu Val Pro Gly Val Asp Tyr 145 150 155 160 Asn Phe Ile Ser Val Glu Glin Phe Lys Ala Lieu. Glu Glu Ser Gly Ala 1.65 17O 17s Lieu. Leu Glu Ser Gly Thr Tyr Asp Gly Asin Phe Tyr Gly Thr Pro Llys 18O 185 19 O Pro Pro Ala Glu Pro Ser Pro Phe Glin Pro Asp Pro Val Asp Glin Val 195 2OO 2O5 Lieu. Phe Asp Asn. Glu Phe Asp Ala Glu Ser Glin Arg Lys Arg Thir Thr US 2011/O 142815 A1 Jun. 16, 2011 49
- Continued
21 O 215 22O Ser Val Ser Lys Met Glu Arg Met Asp Ser Ser Leu Pro Glu Glu Glu 225 23 O 235 24 O Glu Asp Glu Asp Llys Glu Ala Ile Asin Gly Ser Gly Asn Ala Glu Asn 245 250 255 Gly Glu Arg His Ser Glu Ser Ser Asp Trp Met Lys Thr Val Pro Ser 26 O 265 27 O Tyr Asn Gln Thr Asn Ser Ser Met Asp Phe Arg Asn Tyr Met Met Arg 27s 28O 285 Asp Glu Thir Lieu. Glu Pro Leu Pro Lys Asn Trp Glu Met Ala Tyr Thr 29 O 295 3 OO Asp Thr Gly Met Ile Tyr Phe Ile Asp His Asn Thr Lys Thr Thr Thr 3. OS 310 315 32O Trp Lieu. Asp Pro Arg Lieu. Cys Llys Lys Ala Lys Ala Pro Glu Asp Cys 3.25 330 335 Glu Asp Gly Glu Lieu Pro Tyr Gly Trp Glu Lys Ile Glu Asp Pro Glin 34 O 345 35. O Tyr Gly Thr Tyr Tyr Val Asp His Lieu. Asn Gln Lys Thr Glin Phe Glu 355 360 365 Asn Pro Val Glu Glu Ala Lys Arg Llys Lys Glin Lieu. Gly Glin Val Glu 37 O 375 38O Ile Gly Ser Ser Lys Pro Asp Met Glu Lys Ser His Phe Thr Arg Asp 385 390 395 4 OO Pro Ser Glin Lieu Lys Gly Val Lieu Val Arg Ala Ser Lieu Lys Llys Ser 4 OS 41O 415 Thr Met Gly Phe Gly Phe Thr Ile Ile Gly Gly Asp Arg Pro Asp Glu 42O 425 43 O Phe Lieu. Glin Val Lys Asn Val Lieu Lys Asp Gly Pro Ala Ala Glin Asp 435 44 O 445 Gly Lys Ile Ala Pro Gly Asp Val Ile Val Asp Ile Asn Gly Asn. Cys 450 45.5 460 Val Lieu. Gly His Thr His Ala Asp Val Val Gln Met Phe Gln Leu Val 465 470 47s 48O Pro Val Asn Glin Tyr Val Asn Lieu. Thir Lieu. Cys Arg Gly Tyr Pro Leu 485 490 495 Pro Asp Asp Ser Glu Asp Pro Val Val Asp Ile Val Ala Ala Thr Pro SOO 505 51O Val Ile Asin Gly Glin Ser Lieu. Thir Lys Gly Glu Thr Cys Met Asn Pro 515 52O 525 Glin Asp Phe Llys Pro Gly Ala Met Val Lieu. Glu Glin Asn Gly Lys Ser 53 O 535 54 O Gly His Thir Lieu. Thr Gly Asp Gly Lieu. Asn Gly Pro Ser Asp Ala Ser 5.45 550 555 560 Glu Glin Arg Val Ser Met Ala Ser Ser Gly Ser Ser Gln Pro Glu Lieu. 565 st O sts Val Thir Ile Pro Leu. Ile Lys Gly Pro Lys Gly Phe Gly Phe Ala Ile 58O 585 59 O Ala Asp Ser Pro Thr Gly Glin Llys Val Lys Met Ile Lieu. Asp Ser Glin 595 6OO 605 Trp. Cys Glin Gly Lieu. Glin Lys Gly Asp Ile Ile Lys Glu Ile Tyr His 610 615 62O US 2011/O 142815 A1 Jun. 16, 2011 50
- Continued
Glin Asn Val Glin Asn Lieu. Thir His Lieu. Glin Val Val Glu Val Lieu Lys 625 630 635 64 O Glin Phe Pro Val Gly Ala Asp Val Pro Lieu. Lieu. Ile Lieu. Arg Gly Gly 645 650 655 Pro Pro Ser Pro Thr Lys Thr Ala Lys Met Lys Thr Asp Llys Lys Glu 660 665 67 O Asn Ala Gly Ser Lieu. Glu Ala Ile Asin Glu Pro Ile Pro Gln Pro Met 675 68O 685 Pro Phe Pro Pro Ser Ile Ile Arg Ser Gly Ser Pro Llys Lieu. Asp Pro 69 O. 695 7 OO Ser Glu Val Tyr Lieu Lys Ser Lys Thr Lieu. Tyr Glu Asp Llys Pro Pro 7 Os 71O 71s 72O Asn. Thir Lys Asp Lieu. Asp Val Phe Lieu. Arg Lys Glin Glu Ser Gly Phe 72 73 O 73 Gly Phe Arg Val Lieu. Gly Gly Asp Gly Pro Asp Glin Ser Ile Tyr Ile 740 74. 7 O Gly Ala Ile Ile Pro Lieu. Gly Ala Ala Glu Lys Asp Gly Arg Lieu. Arg 7ss 760 765 Ala Ala Asp Glu Lieu Met Cys Val Asp Gly Ile Pro Wall Lys Gly Lys 770 775 78O Ser His Lys Glin Val Lieu. Asp Lieu Met Thir Thr Ala Ala Pro Asn Gly 78s 79 O 79. 8OO His Val Lieu. Lieu. Thr Val Arg Arg Lys Ile Phe Tyr Gly Glu Lys Glin 805 810 815 Pro Glu Asp Asp Ser Ser Glin Ala Phe Ile Ser Thr Glin Asn Gly Ser 82O 825 83 O Pro Arg Lieu. Asn Arg Ala Glu Val Pro Ala Arg Pro Ala Pro Glin Glu 835 84 O 845 Pro Tyr Asp Val Val Lieu. Glin Arg Lys Glu Asn. Glu Gly Phe Gly Phe 850 855 860 Val Ile Lieu. Thir Ser Lys Asn Llys Pro Pro Pro Gly Val Ile Pro His 865 87O 87s 88O Lys Ile Gly Arg Val Ile Glu Gly Ser Pro Ala Asp Arg Cys Gly Lys 885 890 895 Lieu Lys Val Gly Asp His Ile Ser Ala Val Asn Gly Glin Ser Ile Val 9 OO 905 91 O Glu Lieu. Ser His Asp Asn. Ile Val Glin Lieu. Ile Lys Asp Ala Gly Val 915 92 O 925 Thr Val Thr Lieu. Thr Val Ile Ala Glu Glu Glu. His His Gly Pro Pro 93 O 935 94 O Ser Gly Thr Asn. Ser Ala Arg Glin Ser Pro Ala Lieu Gln His Arg Pro 945 950 955 96.O Met Gly Glin Ser Glin Ala Asn His Ile Pro Gly Asp Arg Ser Ala Lieu. 965 97O 97. Glu Gly Glu Ile Gly Lys Asp Val Ser Thr Ser Tyr Arg His Ser Trp 98O 985 99 O Pro Asp His Llys His Lieu Ala Glin Pro Asp Thir Ala Val Ile Ser Val 995 1OOO 1005 Val Gly Ser Arg His Asn Glin Asn Lieu. Gly Cys Tyr Pro Val Glu 1010 1015 1 O2O US 2011/O 142815 A1 Jun. 16, 2011 51
- Continued Lieu. Glu Arg Gly Pro Arg Gly Phe Gly Phe Ser Lieu. Arg Gly Gly O25 O3 O O35 Lys Glu Tyr Asn Met Gly Lieu. Phe Ile Lieu. Arg Lieu Ala Glu Asp O4 O O45 OSO Gly Pro Ala Ile Lys Asp Gly Arg Ile His Val Gly Asp Glin Ile O55 O6 O O65 Val Glu Ile Asn Gly Glu Pro Thr Glin Gly Ile Thr His Thr Arg Of O O7 O8O Ala Ile Glu Lieu. Ile Glin Ala Gly Gly Asn Llys Val Lieu Lleu Lieu. O85 O9 O O95 Lieu. Arg Pro Gly Thr Gly Lieu. Ile Pro Asp His Gly Lieu Ala Pro 1 OO 105 11 O Ser Gly Lieu. Cys Ser Tyr Val Llys Pro Glu Gln His 115 12 O 125
<210s, SEQ ID NO 8 &211s LENGTH: 3285 &212s. TYPE: DNA <213> ORGANISM: Homo sapiens 22 Os. FEATURE: <221s NAME/KEY: CDS <222s. LOCATION: (147) . . (836)
<4 OOs, SEQUENCE: 8 taggacagoc ttctgaagaa gattctgcca actcaaaaat attattottt tttittttittt 6 O tttittittgct gttgtttctg agaaactagg tdt cittacca ttittaaaatt toatattitta 12 O tittaaaagga aaccagtgaa ttgaaa atgaga cita aat atc gct atc titc titt 173 Met Arg Lieu. Asn. Ile Ala Ile Phe Phe 1. 5 gga gct Ct c titt ggit gct ttgggg gtg tta ctic titt ttg gtg gct titt 221 Gly Ala Lieu. Phe Gly Ala Lieu. Gly Val Lieu. Lieu. Phe Lieu Val Ala Phe 10 15 2O 25 gga tog gat tat tdg Ctt Ctt gca act gala gtgggg aga tigt to a ggit 269 Gly Ser Asp Tyr Trp Lieu. Lieu Ala Thr Glu Val Gly Arg Cys Ser Gly 3 O 35 4 O gala aag aat at a gag aac gtc act titt cac cat gala ggg tt C titc tig 317 Glu Lys Asn Ile Glu Asn Val Thr Phe His His Glu Gly Phe Phe Trp 45 SO 55 agg tt tog titt aat ggg att gtg gala gag aat gac toc aat att tog 365 Arg Cys Trp Phe ASn Gly Ile Val Glu Glu Asn Asp Ser Asn. Ile Trp 60 65 70 aag titc togg tac acc aat cag cca cc.g. tcc aag aac togc aca cat gct 413 Llys Phe Trp Tyr Thr Asn Gln Pro Pro Ser Lys Asn Cys Thr His Ala 7s 8O 85 tac ctd tot cog tac ccc titc atgaga ggc gag cac aac tog acc to c 461 Tyr Lieu Ser Pro Tyr Pro Phe Met Arg Gly Glu. His Asn Ser Thr Ser 9 O 95 1 OO 105 tat gac tot goa gtt att tac cqt ggit ttctgg gca gtc ct g atg ct c 509 Tyr Asp Ser Ala Val Ile Tyr Arg Gly Phe Trp Ala Val Lieu Met Lieu. 11O 115 12 O
Ctgggg gta gtt gct gta gtc at C gca agc titt ttg atc at C tit gca sist Lieu. Gly Val Val Ala Val Val Ile Ala Ser Phe Lieu. Ile Ile Cys Ala 125 13 O 135 gcc ccc titc goc agc cat titt ct c tac aaa got gigg gga ggc tica tat 605 Ala Pro Phe Ala Ser His Phe Leu Tyr Lys Ala Gly Gly Gly Ser Tyr 14 O 145 150 US 2011/O 142815 A1 Jun. 16, 2011 52
- Continued att got gca ggc atc cta ttt to a ttg gtg gtg atg citg tat gtc atc 653 Ile Ala Ala Gly Ile Lieu. Phe Ser Lieu Val Val Met Lieu. Tyr Val Ile 155 16 O 1.65 tgg gt C cag gCa gtg gct gac atg gala agc tac ca aac atg aaa atg 7 O1 Trp Val Glin Ala Val Ala Asp Met Glu Ser Tyr Arg Asn Met Lys Met 17O 17s 18O 185 aag gac togc ct g g at titc acc cct tct gtt ctog tat ggc tigg to a titt 749 Lys Asp Cys Lieu. Asp Phe Thr Pro Ser Val Lieu. Tyr Gly Trp Ser Phe 190 195 2OO titc ctd gcc cca gct ggg at a titt ttt tot ttg cta gct gga tta cta 797 Phe Lieu Ala Pro Ala Gly Ile Phe Phe Ser Lieu. Lieu Ala Gly Lieu. Lieu. 2O5 21 O 215 titt ctd gtt gtt gga cqg cat att cag at a cat cac taa at caactgtt 846 Phe Leu Val Val Gly Arg His Ile Glin Ile His His 22 O 225 gtcacaagta ttittcttgag agattittaaa acaaggaata cittitttitt.cc attttgttt c 906 attgat coca gcataaagtt agtagatata actttittagt togctatt caa attaatcatt 966 ttactaaaat titt citt cagt aagaaggit co tagaatctot coaga cacca gcaa.gc.ctict O26 atcttgtcta agtgctgtca agg acctagt totttaggga atagg taaac aggtotc cct O86 tt cattgaac atgttagagt to atgcaggit cqcaaaggcc tdataatago ttaataccat 146 gacatgggga aaatct cqat agatttggct taaagttct cottggcattca cittctgctaa 2O6 ttaaaaaaaa t ccttgaaga ataattaaga atgggcaagg ttgtcagaga atttattittg 266 tittcttgc cc acacagataa tat coacata cacattcact ggctic ttgttg agcaaatgaa 326 tittaaaaata gacago agitt gttctaatta gtgggagcca totact cacc agittaaaatg 386 ggccacaa.ca aacaag actg agagcatgta cittat cittgc tittitt cacca acagtggittt 446 ggittacctag titt tatt cac ttaattgttgc atgcttacat aaactittaaa citacatttaa SO 6 aactagdaaa totgcatacc aaattatgta taacgtagat tdaatttitta tdaacttaaa 566 gtgagttaat tdtataatgt aatattgttt aaaatatgta aaaac caagc atttic cqctt 626 ggtc cataat t ct atttgat attittaaaat t ct catttaa aaattatatt gctat catt c 686 agcatgtgaaaatttattga taaaatgtga ttittaatatt ctittagatat aaactitt cag 746 cg tact tcca tatgaggatt ataatagocc tdott tatta aagaccataa aat attaact 806 titc.cccaaga tigittatgggit to cagttctt ctdat cattt gattic ctitta attactgtc.c 866 citcaatttct t catctttac aatagatata tta acattta cagat.cgact atttic ctitta 926 acct Cotaga agaaagttitt ttggggaaa gatgattctg. t attatt cag tag catagac 986 attittgcata t caaagatgt to atttggca ctaatgttga ttgaaat caa atc catctga 2O46 gatgcctago togt atttgc attctggaag cct coat cqc aggggagctic ggcagggitat 2106 gtgagctttgttggaggtgc ggtgttt cat tctgcagctg. ittgtgaggac agagaggcat 2166 ggcc cacagg caaaaaaagt caccacccag aagatgctct gggatagagg aactgct cot 2226 titt catcago tott coaatg ccgtgggaga gotgatcc.ca gtc.ttct ctd tacat cittgt 2286 gcttitt CC at taagacittgt t cc agtggga aggagctttg gaaaaattgc aaaggtotga 2346 atct tcaggg cattitt catg acagg acttg ccaataataa taataataat aataataata 24O6 ataataataa taataaagct c cagaggcct aactggitttc. tcaagt catt toagtgatat 2466 cattgaaacg tttttgttggit act tcc.ctitt gtc.ttt cact gttt catttt tatattgctt 2526 US 2011/O 142815 A1 Jun. 16, 2011 53
- Continued catttact tc tittgcttittg gctttgtt at tagaaaaaat aattatgagg totgttgtgc 2586 atgttgactg. tatattalag titatggcatg C cattaagtt titc.ca.gacga tigttggatgt 2646 atctgattag tt catgtcat ctd taaatac aattic tittitt togtag tactt toggaatggag 27O6 c ctittittctg gtgtactgta togc catttaa gttt cacata caa.gctgct t t cq.gcaaagg 2766 citcgaatatt tataaattitc agatggittat cot cactitta tag tacactt aagtggctac 2826 catatattitt ttatatgaca attggctgaa tagctgatgt gitatgacact tttacacaga 2886 tittgcactitt ggaact attt tatagttgta atgcatcaat caaatacatt toaag cacat 2.946 ttcttgat ca atttaccagc aaccotctga aggaatgaag gagagttgttg attgctatgt 3 OO6 caatgagtga aatatactta aaaatggcag agatatatag tacattattg tagcaac citt 3 O66 at atctgatt tdagatactg togttgccaaa tdtccatgtt atgtttattt citc tattggit 3126 tg tatttatt aatttittaga agc ctittaaa citgtgttaga atc.tttittga aaaatgttga 3186 ttittgcatca taaagttt ca atttatcaag gatat cittitt cagttacact tittagaaaga 3246 gtgaataaaa agggcagtga gttatgct ct tacttgg 3285
<210s, SEQ ID NO 9 &211s LENGTH: 229 212. TYPE: PRT <213> ORGANISM: Homo sapiens < 4 OO > SEQUENCE: 9 Met Arg Lieu. Asn. Ile Ala Ile Phe Phe Gly Ala Lieu. Phe Gly Ala Lieu. 1. 5 1O 15 Gly Val Lieu. Lieu. Phe Lieu Val Ala Phe Gly Ser Asp Tyr Trp Lieu. Lieu. 2O 25 3O Ala Thr Glu Val Gly Arg Cys Ser Gly Glu Lys Asn. Ile Glu Asn Val 35 4 O 45 Thr Phe His His Glu Gly Phe Phe Trp Arg Cys Trp Phe Asin Gly Ile SO 55 6 O Val Glu Glu Asn Asp Ser Asn Ile Trp Llys Phe Trp Tyr Thr Asn Glin 65 70 7s 8O Pro Pro Ser Lys Asn Cys Thr His Ala Tyr Lieu Ser Pro Tyr Pro Phe 85 90 95 Met Arg Gly Glu. His Asn Ser Thr Ser Tyr Asp Ser Ala Val Ile Tyr 1OO 105 11 O Arg Gly Phe Trp Ala Val Lieu Met Lieu. Lieu. Gly Val Val Ala Val Val 115 12 O 125 Ile Ala Ser Phe Lieu. Ile Ile Cys Ala Ala Pro Phe Ala Ser His Phe 13 O 135 14 O Lieu. Tyr Lys Ala Gly Gly Gly Ser Tyr Ile Ala Ala Gly Ile Lieu. Phe 145 150 155 160 Ser Lieu Val Val Met Lieu. Tyr Val Ile Trp Val Glin Ala Val Ala Asp 1.65 17O 17s Met Glu Ser Tyr Arg Asn Met Lys Met Lys Asp Cys Lieu. Asp Phe Thr 18O 185 19 O Pro Ser Val Lieu. Tyr Gly Trp Ser Phe Phe Leu Ala Pro Ala Gly Ile 195 2OO 2O5 Phe Phe Ser Lieu. Lieu Ala Gly Lieu. Lieu. Phe Lieu Val Val Gly Arg His 21 O 215 22O US 2011/O 142815 A1 Jun. 16, 2011 54
- Continued
Ile Glin Ile His His 225
<210s, SEQ ID NO 10 &211s LENGTH: 25 212. TYPE : RNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: siRNA oligo sequence
<4 OOs, SEQUENCE: 10 ugaaluu.cgag cucggulac cc gggga 25
<210s, SEQ ID NO 11 &211s LENGTH: 24 212. TYPE : RNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: siRNA oligo <4 OOs, SEQUENCE: 11
Caggaaagaa caugugagca aaag 24
<210s, SEQ ID NO 12 &211s LENGTH: 25 212. TYPE : RNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: siRNA oligo <4 OOs, SEQUENCE: 12 cuuuula aaluu aaaaaugaag uuuula 25
<210s, SEQ ID NO 13 &211s LENGTH: 5521. &212s. TYPE: DNA <213> ORGANISM: Artificial 22 Os. FEATURE: <223> OTHER INFORMATION: pCDNA3 cloning vector with mutation, deletion and insertions
<4 OOs, SEQUENCE: 13 gacggat.cgg gagat CtcCC gatcc cct at ggtcgactict Cagtacaatic totctgatg 6 O cc.gcat agtt aagc.cagt at Ctgct Coctg. Cttgttgttgtt ggaggtogct gagtagtgcg 12 O cgagcaaaat ttalagctaca acaaggcaag gcttgaccga caattgcatg aagaatctgc 18O ttagggittag gcgttittgcg Ctgct tcgcg atgtacgggc Cagatatacg cgttgacatt 24 O gattattgac tagttattaa tagtaatcaa ttacggggtc attagttcat agcc catata 3OO tggagttc.cg cgttacatala Cttacggtaa atggc.ccgcc tigct gaccg cccaacgacc 360 cc.cgcc catt gacgtcaata atgacg tatgttcc catagt aacgc.caata ggg acttitcc 42O attgacgt.ca atgggtggac tatttacggit aaactg.ccca Cttggcagta Cat Caagtgt 48O at catatgcc aagtacgc.cc cct attgacg tdaatgacgg taaatggc.cc gcc tiggcatt 54 O atgcc.cagta catgacctta togggactitt.c ct acttggca gta catctac gitat tagt ca 6OO tcgct attac catggtgatg cggittittggc agtacat caa tiggcgtgga tagcggitttg 660 acticacgggg attitccaagt citccaccc.ca ttgacgt caa togggagtttgttittggcacc 72 O aaaatcaacg ggactitt.cca aaatgtcgta acaactic cqc cc cattgacg caaatgggcg 78O
US 2011/O 142815 A1 Jun. 16, 2011 57
- Continued cgcaaaaaag ggaataaggg cqacacggaa atgttgaata ct catactict tcc tttitt.ca 54 OO at attattga agcatttatc agggittattgtct catgagc ggata catat ttgaatgitat 546 O ttagaaaaat aaacaaatag giggttcc.gcg cacattt coc cqaaaagtgc cacctgacgt. 552O c 5521
What is claimed: 11. The composition of claim 1, wherein the second agent 1. A composition comprising: comprises a flavonoid. (a) a first agent that blocks cell plasma membrane respira 12. The composition of claim 1, wherein the second agent tion, and comprises apigenin. (b) a second agent that blocks at least one of NF-kB, CK2, 13. The composition of claim 1, wherein the second agent IKK activities and cell hypoxia responses, and, option comprises an IKK inhibitor, a CK2 inhibitor, a HIF inhibitor, ally, or a NOX inhibitor. (c) a pharmaceutically acceptable carrier. 14. The composition of claim 13, wherein the IKK inhibi 2. The composition of claim 1, wherein the first agent tor is selected from the group consisting of BMS-345541, comprises a cell plasma membrane impermeable trans SC-514. IKK-2 Inhibitor IV 5-(p-Fluorophenyl)-2-ureido plasma membrane electron transport (tPMET) inhibitor, or a thiophene-3-carboxamide, IKK Inhibitor VII, IKK Inhibitor cell plasma membrane impermeable oxidative phosphoryla II, Wedelolactone, IKK-2 Inhibitor VN-(3.5-Bis-trifluorom tion inhibitor. ethylphenyl)-5-chloro-2-hydroxybenzamide IMD-0354, and 3. The composition of claim 1, wherein the first agent IKK-2 Inhibitor VI (5-Phenyl-2-ureido)thiophene-3-car comprises an uncoupler of electron transfer and oxidative boxamide. phosphorylation and a chemical group that is impermeable to cell plasma membrane. 15. The composition of claim 1, wherein the second agent 4. The composition of claim 3, wherein the first agent is comprises a puC19, pcDNA3 (SEQ ID NO: 1 and 13) or WST-3 (2-(4-Iodophenyl)-3-(2,4-dinitrophenyl)-5-(2,4-dis siRNA selected from the group consisting of SEQID NOS: ulfophenyl)-2H-tetrazolium). 10-12. 5. The composition of claim 3, wherein the uncoupler of 16. A composition comprising WST-3 and apigenin. electron transfer and oxidative phosphorylation is a ditrophe 17. A composition comprising at least one of WST-1+ nol (DNP) or a cyano group. mPMS, or WST-3+mPMS, or WST-4+mPMS and apigenin 6. The composition of claim 3, wherein the uncoupler of or at least one IKK inhibitors. electron transfer and oxidative phosphorylation is selected 18. A method of selectively inhibiting cell surface respira from the group consisting of CCCP, FCCP, SF6847, S-13, tion in cancer cells, the method comprising contacting a PCP, TTFB, and alpha-(phenylhydrazono)phenylacetonitrile population of cells with a composition of claim 1 in an derivatives. amount effective to block the tRMET and/or oxidative phos 7. The composition of claim 1, wherein the first agent phorylation and/or the coupling of the tRMET and the oxida comprises a water soluble tetrazolium (WST) and an inter tive phosphoryalation process. mediate electron acceptor IEA). 19. A method of selectively killing cancer cells, the method 8. The composition of claim 7, wherein the IEA comprises comprising contacting a population of cells with a composi coenzyme Q1 or mPMS. tion of claim 1 in an amount effective to block the tFMET 9. The composition of claim 7, wherein the WST further and/or oxidative phosphorylation and/or the coupling of the comprises WST-1, WST-3, WST-4, WST-5, XTT, WST-9, tPMET and the oxidative phosphoryalation process and cell WST-10, WST-11 or MSN. hypoxia responses. 10. The composition of claim 2, wherein the first agent comprises mPMS.