Ecological Appraisal A2 4Th Arm Coastbound Slip Road, Wincheap, Canterbury

Ecological Appraisal for

A2 4th Arm Coastbound Slip Road, Wincheap, Canterbury

October 2017

Status: Issue

Quality management

Project: A2 4th Arm Coastbound Slip Road, Wincheap, Canterbury

Project No: B09037

Report title: Ecological Appraisal

Report author: Name: Paul Evans Title: Ecologist

Approved by: Name: Dr Jo Parmenter Title: Director

Status: Issue

Date of last revision: 27 October 2017

Client Details

Client: Pentland Properties Ltd

Contact Details

The Landscape Partnership Ltd is a practice of Chartered Landscape Architects, Chartered Ecologists and Chartered Environmentalists, registered with the Landscape Institute and a member of the Institute of Environmental Management & Assessment & the Arboricultural Association.

Registered Office: Greenwood House 15a St Cuthberts Street Bedford MK40 3JG. Registered in England No 2709001

Quality standards

This report is certified BS 42020 compliant and has been prepared in accordance with The Chartered Institute of Ecology and Environmental Management’s (CIEEM) Technical Guidance Series ‘Ecological Report Writing’ and Code of Professional Conduct.

Contents Non-technical summary 1 Introduction 1 1.1 Commission 1 1.2 Legislation and policy background 1 1.3 Reporting standards 1 1.4 Site location and context 1 1.5 Acknowledgements 1 1.6 Description of the project 2 1.7 Objectives of this appraisal 2 1.8 Previous ecological studies 3 1.9 Duration of appraisal validity 3 2 Methodology 4 2.1 Desk study methodology 4 2.2 Phase 1 habitat survey methodology 4 2.3 Great crested newt Habitat Suitability Index (HSI) survey methodology 5 2.4 Great crested newts: environmental DNA (eDNA) survey 6 2.5 Reptile survey 7 2.6 Badger survey 8 2.7 Preliminary bat roost assessment methodology: Trees 8 2.8 Assessment methodology 10 2.9 Mitigation hierarchy 11 3 Results 12 3.1 Desk study results 12 3.2 Phase 1 habitat survey results 16 3.3 Great crested newt Habitat Suitability Index (HSI) survey results 18 3.4 Great crested newts: environmental DNA (eDNA) analysis 19 3.5 Reptile survey results 20 3.6 Badger survey 21 3.7 Preliminary bat roost assessment results: Trees 21 4 Evaluation of conservation status and impact assessment 22 4.1 Assessment rationale 22 4.2 Evaluation of conservation status and assessment of designated sites 22 4.3 Evaluation of conservation status and assessment of habitats and green infrastructure 24 4.4 Evaluation of conservation status and assessment of species 25 4.5 Cumulative impacts 27 5 Mitigation and avoidance measures 28 5.1 Avoidance measures 28 5.2 Proposed mitigation for known impacts 28 5.3 Compensation for ecological impacts 29 5.4 Species licensing 29 6 Enhancement options 30 6.1 Ecological enhancement 30 6.2 Pollution control measures 30 6.3 Habitat enhancement options 30 6.4 Small-scale species enhancement options 30 7 Recommendations 31 7.1 Recommendations for further survey 31 7.2 Other recommendations 31 7.3 Recommended conditions 31

8 Conclusions 32 8.1 Overall assessment of value and impact 32 8.2 Further survey requirements 32 9 References 33

Figures 1. Location Plan 2. Phase 1 Habitat Survey 3. Preliminary Ground Level Bat Roosts Assessment: Trees 4. Reptile Survey Results

Appendices 1. Summary of relevant legislation 2. Impact and assessment methodology 3. Red Line Boundary and Development Proposals 4. Landscape Proposals 5. Technical Advice Note for Field and Laboratory Sampling of Great Crested Newt (Triturus cristatus) environmental (eDNA) 6. Designated sites (information provided by Kent and Medway Biological Records Centre) 7. Great Crested Newts: Pond 1 Environmental DNA (eDNA) Laboratory Results 8. Detailed Reptile Survey Results 9. Bat Conservation Trust (BCT) Guidance on Lighting

Non-technical summary The Landscape Partnership was commissioned by Pentland Properties Ltd to undertake an Ecological Appraisal comprising a desk study, Phase 1 Habitat Survey, Habitat Suitability Index (HSI) survey of ponds, together with an assessment of impacts and subsequently, a number of protected species surveys including Great Crested Newts, Reptiles, an assessment of the potential of site features to support bats, and an assessment of the impacts of the proposed works to form the A2 4th Arm Coastbound Slip Road, Wincheap, Canterbury. The objectives of the ecological appraisal were to identify the habitats and species present or potentially present and evaluate their importance, assess the impact of the development proposal and describe any measures necessary to avoid impacts, reduce impacts or compensate for impacts so that there is no net harm to ecological features. The survey involved classifying and recording habitat types and features of ecological interest, undertaking detailed survey for the following protected species great crested newts, reptiles and identified the potential for protected species to be present by assessing habitat suitability for those species. The survey was undertaken by appropriately qualified and experienced personnel. The site comprises patches of dense, continuous scrub across the tall ruderal vegetation located within the attenuation basin, species poor semi-improved grassland with broad-leaved woodland planting along the A2 road verge and areas of landscape planting of shrubs and trees within the Park and Ride car park. Collectively the habitats within the proposed development site are assessed as being of overall value of Lower at the Parish scale. The proposed development is the construction of new coastbound slip road off the A2 at Wincheap, with associated reconfiguration of both Ten Perch Road and the Ten Perch Road / A28 junction, modified footpath / cycle route, works to existing surface water drainage, lighting and landscaping. It is understood that Ten Perch Road currently is not fitted with oil interceptors in its drainage system; oil interceptors will be fitted as part of the development to limit the potential for pollution to reach the River Stour. The development would utilise some of the existing Park and Ride car park to accommodate the new slip road and associated works. The impact of the proposed development upon site of European and National importance is considered to be Neutral. The impact of the proposed development upon veteran trees, rare, scarce or priority plants & invertebrates, amphibians including great crested newts, wintering birds, mammals including dormice, water vole, otter, badger and bats is considered to be Neutral. Reptiles were recorded on site at low numbers and the value of the site for reptile is therefore considered to be Lower at the Parish Scale. In the absence of mitigation, the impact of the development is assessed as Minor-Adverse. Mitigation has been proposed to reduce the impact of the development to Neutral. In the absence of mitigation, the proposed development would give rise to the desilting and removal of tall ruderal vegetation from the attenuation basin which forms part of the Great Stour Local Wildlife Site, a temporal minor impact on the habitat, affecting under 1% of the overall area of the local wildlife site. In addition the development would result in the loss of scrub and broadleaved woodland plantation, which in combination would give rise to a Minor Adverse impact upon habitat and species namely breeding birds which these habitats support. Mitigation has been proposed, including improvement to the attenuation basin for wildlife following the works and compensation planting of native mixed broadleaved trees and shrubs within the landscaping scheme for the development. This mitigation would reduce the impacts of the development proposals upon the habitats and species present, to give rise to an overall Neutral impact. No further surveys are recommended. A number of ecological enhancements have been proposed, which would improve the quality of the site for native flora and fauna, including improved management of the attenuation basin following the works and strengthening native planting around the Park and Ride complex. Delivery of these enhancements would lead to an overall Neutral-Minor Beneficial impact.

Ecological Appraisal A2 4th Arm Coastbound Slip Road, Wincheap, Canterbury

1 Introduction 1.1 Commission 1.1.1 The Landscape Partnership was commissioned by Pentland Properties Ltd to carry out a Ecological Appraisal, comprising a desk study, Phase 1 Habitat Survey, Habitat Suitability Index (HSI) survey of ponds, together with an assessment of impacts and subsequently, a number of protected species surveys including Great Crested Newts, Reptiles, an assessment of the potential of site features to support bats, and an assessment of the impacts. 1.2 Legislation and policy background 1.2.1 There is a range of protection given to sites and species. Sites may be designated for local, national, European or global importance for nature conservation. Species may be protected by European-scale legislation or varying levels of national regulation. 1.2.2 The Local Planning Authority has a policy to protect features of nature conservation value within its Local Plan. Other regulators have policies relating to the consents issued by them. 1.2.3 Further information is given in Appendix 1. 1.3 Reporting standards 1.3.1 This report was written in compliance with British Standard 42020:2013 ‘Biodiversity — Code of practice for planning and development’ and the Chartered Institute of Ecology and Environmental Management’s (CIEEM) Code of Professional Conduct. 1.3.2 This report was prepared in accordance with the CIEEM ‘Guidelines for Ecological Report Writing’ as updated December 2015. 1.3.3 The report was prepared by Paul Evans. The report was reviewed by Nick Sibbett, Associate and Dr Jo Parmenter, Director of The Landscape Partnership. 1.3.4 Assessment was undertaken against current legislation and planning policy, and in accordance with standard guidance. Further information is given in Section 2 and Appendix 2. 1.4 Site location and context 1.4.1 The site is located on the edge of the urban area of Canterbury, close to the A2/A28 junction. Access is from Ten Perch Road to the south and A2 to the west. The site comprises a poorly maintained attenuation basin associated with the A2, species poor semi-improved grassland with planted broad-leaved scrub along the A2 road verge, areas of landscape planting of shrubs and trees within the Park and Ride car park, and an area of allotment gardens. 1.4.2 Boundaries of the site are the A2 dual carriageway to the west, the River Great Stour to the north, A28, Wincheap Park & Ride and Retail Park to the south and east, with species poor grassland to the northwest and with Whitehall Meadows Local Nature Reserve beyond. 1.4.3 The Ordnance Survey Grid Reference for the approximate centre of the proposed development site is TR 1351 5693. The location of the site is shown in Figure 01. A plan showing the site is provided at Figure 02. 1.5 Acknowledgements Permissions to gain access to land 1.5.1 Permission to gain access for survey is gratefully acknowledged, Lynne Moore of Canterbury City Council for organising access to the allotments and Veljko Komad of Aone+ for access to the A2 verge and attenuation basin.

Surveyor Competencies Survey(s) Surveyor(s) Experience Licences (years)

Phase 1 Habitat Paul Evans 15+ Great crested newt Class Licence CL08 (Level 1) Survey MCIEEM

Great Crested Newt eDNA Survey Bats: Preliminary Katia Bresso 15+ Great Crested Newt Class Licence CL09 (Level 2) Roost Assessment MCIEEM CEnv Hazel dormice Class Licence CL10b (Level 2) – Trees Bat Class Licence CL18 (Level 2) Bat Roost Visitor Licence CL15 (Level 1) Reptile Survey Registered Consultant of the Bat Low Impact Class Licence WML-CL21

Other contributors 1.5.2 We acknowledge the input of: • Kent and Medway Biological Records Centre (KMBRC) for provision of data 1.6 Description of the project 1.6.1 It is proposed to construct a new off slip road on the coastbound carriageway of the A2 at Wincheap A28 junction, with associated reconfiguration of both Ten Perch Road and the Ten Perch Road / A28 junction, modified footpath / cycle route, works to existing surface water drainage, lighting and landscaping. The project would utilise some of the existing Park and Ride car park to accommodate the new slip road and associated works. This project is in the planning stages drawing up drawings, technical details and construction timetable for submission to the Local Planning Authority. The project is a requirement of Condition 10 of the Outline Planning Permission for the mixed-use development at land off Cockering Road, Thanington (CA/15/01479/OUT). 1.6.2 At present, drivers are unable to leave the A2 at Wincheap coming from the London (west) direction, although drivers can leave the A2 here coming from the east, and there is access to join the A2 travelling in both directions. The new slip road will ease congestion at the alternative exit for traffic from London, and also reduce congestion in the city centre as traffic from the A2 to the Wincheap area of Canterbury will no longer need to travel through the city centre. This new off-slip has been an aspiration of the City Council for many years and is now incorporated in Policy T11 of the Canterbury Local Plan (July 2017. 1.6.3 The development proposals are shown in appendix 3. 1.7 Objectives of this appraisal 1.7.1 The aim of this appraisal is to inform a planning application for the proposed development, as described above. Detailed objectives are to: • identify the habitats and species present or potentially present and evaluate their importance; • identify any ecological constraints to development; • assess the impact of the development proposal; • identify any opportunities available for integrating ecological features within the development; • describe any measures necessary to avoid impacts, reduce impacts or compensate for impacts so that there is no net harm to ecological features; • propose ecological enhancements

1.8 Previous ecological studies 1.8.1 There are no known previous ecological studies of the site. 1.9 Duration of appraisal validity 1.9.1 The assessment, conclusions and recommendations in this appraisal are based on the studies undertaken, as set out in this report, and the stated limitations. This appraisal is based on the project as described and any changes to the project would need the appraisal to be reviewed. Unless otherwise stated, the assessment, conclusions and recommendations given assume that the site habitats will continue to be used for their current purpose without significant changes until development takes place. However, changes in use or management may occur between the time of the survey and proposals being implemented. Ecological features may change naturally at any time; for example, species may be lost from existing sites or colonise new areas. Our knowledge of the ecology of the site enables us to provide an estimate of the duration of the validity of the surveys carried out and hence the applicability of this appraisal, so that any future need for review and update of this appraisal, or the surveys described within it, and the date by which such updates would become necessary, can be identified. 1.9.2 The table below sets out the duration of validity of each element of each information source. If the proposed development is delayed beyond the stated timescale, update surveys or further investigations would be required. Duration of validity of information source Information Date Duration of validity Notes source undertaken from date undertaken Desk study 7th August 2017 1 – 2 years Further data may become available. Phase 1 habitat 10th May 2017 2 years The habitats on site may change survey especially if management changes. Great Crested 10th May 2017 2 years Pond condition and suitably for great Newt Habitat crested newts may change especially Suitability Index if management of nearby habitats survey changes. Great Crested 10th May 2017 2 years Pond condition and suitably for great Newt eDNA crested newts may change especially if management of nearby habitats changes. Preliminary bat 25th July 2017 2 years Storm damage, tree felling or other roost inspection: factors can change bat roost Trees potential of trees. Reptile Survey 1st - 29th 2 years Storm damage, maintenance, neglect September 2017 or other factors can change bat roost potential of buildings.

2 Methodology 2.1 Desk study methodology 2.1.1 Kent and Medway Biological Records Centre was requested to provide records of protected, rare and/or priority species and details of statutory and non-statutory designated sites on 7th August 2017, within a 1km radius of the centre of the site at TR 1351 5693. 2.1.2 The Magic website (www.magic.gov.uk) was used to identify European sites within a 10km radius and national sites within a 5km radius. The Magic website was accessed on 7th August 2017. 2.1.3 Water bodies within 500m of the site were identified from the relevant 1:25,000 Ordnance Survey map sheet, to establish the need for protected species scoping surveys, such as great crested newt Habitat Suitability Index surveys. Consideration was also given to the green infrastructure of the local area. 2.1.4 The potential for protected, rare and/or priority species to be present on site has been considered in this assessment, taking into account the nature of the site and the habitat requirements of the species in question. Absence of records does not constitute absence of a species. Habitats on the site may be suitable for supporting other protected species that have not previously been recorded within the search area. Conversely, presence of a protected species in the search area does not imply its presence on-site. Records of alien species, non-localised records (e.g. tetrad records) and records dated before 1995 have not been described in detail, but are taken into account when considering likely species presence or absence. Limitations to desk study methodology 2.1.5 There were no significant limitations to the desktop study. 2.1.6 In accordance with BS42020 and advice from most Local Biological Record Centres, species lists are not appended to this report but are available to the Local Planning Authority on request. 2.1.7 The data supplied by the Records Centre was considered in the assessment of potential impacts below. 2.1.8 The Kent and Medway Biological Records Centre data search includes those Badger records they hold however further records can be obtained by carrying out a separate search request for records held by the West and East Kent Badger Groups, from whom records were not obtained for this report. 2.2 Phase 1 habitat survey methodology 2.2.1 The standard Phase 1 (baseline) habitat survey methodology1 was followed. Phase 1 habitat survey is a standardised system for surveying, classifying and mapping wildlife habitats, including urban areas. All habitats present and areas or features of ecological interest within such habitats were recorded and mapped. The survey methodology facilitates a rapid assessment of habitats and it is not necessary to identify every species on site. 2.2.2 The survey visit was also used to identify potential for protected, rare and/or priority species, for example bats, mammals, amphibians and reptiles, to occur on, or in the vicinity of, the proposed development site. Although the survey methodology is not intended for species survey, any protected, rare and/or priority species which were seen during the survey were noted. 2.2.3 The survey was undertaken on 10th May 2017 and the weather conditions were sunny, dry, warm (19oC) with no wind. Limitations to Phase 1 habitat survey 2.2.4 There were no significant limitations to the Phase 1 habitat survey.

1 JNCC (2010) Handbook for Phase 1 Habitat Survey - a Technique for Environmental Audit. Reprinted by JNCC, Peterborough.

2.2.5 Some areas adjacent to the River Great Stour were difficult to access due to tall nettles and scrub, but every effort was made to access as much of the area as possible so this is not considered to be a significant limitation to the survey. 2.3 Great crested newt Habitat Suitability Index (HSI) survey methodology Rationale 2.3.1 Great crested newts are protected by national and European legislation, and are ‘European Protected Species’. 2.3.2 Great crested newts are widespread but scattered at low density in mainland Britain. They breed in ponds and outside the breeding season they use land habitats such as farmland, woods, grasslands, quarries, industrial and 'brown-field' sites. They do not usually occur in flowing water. They hibernate on land, in shelter away from frosts and flooding, in places such as in log piles, under rubble or in hollow tree stumps. If a pond close to a site supports great crested newts, then there is potential for this species to occur on the site itself. 2.3.3 The Habitat Suitability Index (HSI) survey is used to estimate the likelihood of great crested newts being present in a pond and identifies which ponds in a survey area are likely to require great crested newt surveys. A summary of the methodology is given below. 2.3.4 HSI is a geometric mean of ten suitability indices, all of which are factors thought to affect Great Crested Newts. In general, ponds with high HSI scores are more likely to support Great Crested Newts than those with low scores. There is a positive correlation between HSI scores and the numbers of Great Crested Newts observed in ponds. So, in general, high HSI scores are likely to be associated with greater numbers of Great Crested Newts. The system is not sufficiently precise to allow the conclusion that any particular pond with a high score will support newts, or that any pond with a low score will not do so. It can, however, be useful in prioritising ponds for further survey effort. Methodology 2.3.5 The standard Habitat Suitably Index (HSI) methodology2 was followed. One water body was identified on the Ordnance Survey 1:25,000 map within the site and a further two within an approximate 500m radius of the site. Two water bodies were chosen for HSI survey. A pond on the northern side of River Great Stour was not surveyed as it is assumed the river, rail and road networks surrounding the pond provide sufficient barriers to Great Crested Newts accessing the land in and around the site boundary. 2.3.6 The following measurements were made or estimated on site: • pond area, to nearest 50m2; • estimate of the number of years in every ten when the pond would dry up in summer; • water quality, estimated by observation of invertebrates present; • percentage of pond edge (up to 1m from the shore) which is shaded, e.g. by trees; • presence/absence of and impact from waterfowl; • presence/absence and density of fish populations; • quality of surrounding terrestrial habitat; • percentage of the pond covered by aquatic macrophytes (plant species). 2.3.7 Two maps based estimates were made following the field survey • The area of the UK within which the pond was situated • The number of ponds within a 1km radius, as seen on a 1:25,000 Ordnance Survey map. Any ponds seen on the site visit but not present on the map would be included; ponds shown on the map but seen to be absent whilst on the site visit would not be counted.

2 ARG UK (2010) ARG UK Advice note no. 5. Great crested newt habitat suitability index, Amphibian and Reptile Groups of the United Kingdom.

2.3.8 Pond suitability for great crested newts was defined using a categorical scale, as follows. <0.5 poor: very unlikely to contain great crested newts. 0.5 – 0.59 below average: unlikely to contain great crested newts. 0.6 – 0.69 average: might contain great crested newts. 0.7 – 0.79 good: might contain great crested newts. > 0.8 excellent: most likely to contain great crested newts.

2.3.9 The survey was undertaken on 10th May 2017 and the weather conditions were sunny, dry, warm (19oC) with no wind. Limitations to HSI survey 2.3.10 There were no significant limitations to the survey. 2.3.11 Whilst the HSI assessment is particularly useful in terms of quantifying and subsequently comparing pond conditions within the local area, the assessment is not without limitations, which should be taken into consideration. The HSI score is designed to provide a general overview which quantifies favourable conditions that are commonly associated with the species. The assessment alone should not therefore be used to determine, at least with any confidence, whether or not further surveys should be undertaken. 2.3.12 In practice, there are many different variables which dictate the likelihood of presence or absence. For example, the methodology takes into account neither known records of the species in the vicinity nor habitat connectivity. The surveyor's own personal experience should therefore always be used in combination with the HSI scores to determine which ponds should be included within the next stage of survey. 2.4 Great crested newts: environmental DNA (eDNA) survey Rationale 2.4.1 Environmental DNA survey is a recently developed technique to determine the presence of Great Crested Newt in a waterbody, and may be employed to determine which ponds in a survey area require a full survey. A summary of the methodology is outlined below. Background 2.4.2 The environmental DNA (eDNA) test for the Great Crested Newt (GCN) was developed by Biggs et al (2014). Environmental DNA is genetic material released by an organism into the environment, such as urine, faecal matter, gametes, shed skin and carcasses. The survey technique comprises analysing water samples for traces of eDNA left by GCN in ponds. Use and limitations of eDNA 2.4.3 eDNA analysis for Great Crested Newt is a measure of newt presence within a pond or water body. Ponds with zero GCN eDNA present have not recently been used by newts. Due to the deterioration of eDNA (ranging from 7-21 days dependent on conditions), water sampling within, or close to, the breeding season is still required. eDNA survey cannot therefore rule the possibility of historical use of a pond by GCN, for example, in the previous year. There is a weak correlation between the quantity of eDNA present within water samples and the abundance of Great Crested Newt in a pond, indicating further research is required before the technique can be used to estimate population size. 2.4.4 eDNA analysis can be useful in: • Offering a high degree of certainty of GCN absence from a pond in the year of survey • Assessing the need for ‘full’ great crested newt surveys in ponds that scored ‘Average’ or above in HSI assessment • Determining the presence / absence of GCN in ponds within a group for large-scale projects • Allowing GCN absence to be established late in the survey season, when it is no longer possible to carry out ‘full’ survey due to time constraints.

2.4.5 It is therefore a useful tool for the current study. Methodology Collection of data 2.4.6 In order to ensure water samples have the maximum possibility of containing Great Crested Newt eDNA, and that no cross-contamination occurs, a strict protocol was followed. For full details of the methodology, see Appendix 5. 2.4.7 Samples were collected by Paul Evans MCIEEM, a licensed great crested newt surveyor, on 10th May 2017. Analysis of data 2.4.8 Water samples were sent to SureScreen Scientifics on 11th May 2017 for analysis. Analysis consists of amplifying mitochondrial DNA present within the samples and performing comparative analysis with the genetic material of great crested newts. If analysed eDNA is genetically similar to GCN, it means that the species has been recently active in the sampled pond. Limitations to the survey 2.4.9 There were no significant limitations to the eDNA survey. 2.5 Reptile survey Rationale 2.5.1 The commoner species of reptile (slow worm, common lizard, grass snake and adder) are protected from intentional killing or injury, and it is also illegal to sell these species. The rare species, found primarily in heathland and dunes in the south of England, are smooth snake and sand lizard. These are European Protected Species and it is illegal to kill, injure, disturb, or take any of these species, or to damage or destroy a breeding site or resting place. Habitats used by reptiles include heathland, brownfield land, long grassland, scrub, including gorse and bramble scrub, the base of hedgerows and open (sunny) woodland. Most undisturbed (e.g. not regularly mown or closely grazed) areas of suitable size have the potential to support reptiles. 2.5.2 Possible hibernation sites, or hibernacula, (potentially occupied from late September to early April) include embankments, piles of cut logs or timber, fly-tipped material (including dumped tin sheets, rubble, tyres, turves and mounds of soil), beneath tree roots, in mammal burrows and any other cavities or crevices above the winter water table. Methodology 2.5.3 A presence-absence survey was undertaken in respect of reptiles in accordance with guidance set out in the Herpetofauna Workers Manual (Gent & Gibson, 2003) and Froglife advice sheet 10 (1999), in areas potentially suitable for reptiles. A total of 54 artificial refugia, each measuring approximately 100cm by 50cm, were placed around the site in areas thought to have most potential to support reptiles, on 10th May 2017 and 18th July 2017. Locations for refugia were primarily located on grassland areas along scrubby margins or nettle areas near the river considered as suitable reptile habitat. Where possible, refugia were placed in inconspicuous locations to reduce the risk of interference. Refugia were made of heavy-duty bituminous roofing felt weighing 4kg/m2 for greater thermal mass and little prospect of being blown away compared to cheaper alternatives. They were left in situ for a period of several month before survey visits were commenced. 2.5.4 Refugia were placed at a density of on average approximately one per 15m linear habitat which is higher than the recommended density of ten per hectare for more accurate results. The higher density was chosen to give a greater sample size and a greater likelihood of attracting reptiles compared to standard recommended density. 2.5.5 Seven survey visits were carried out in the early morning or late afternoon, during suitable weather conditions; avoiding heavy rain, strong wind and temperatures below 10ºC or above 17ºC. The visits started on 1st September 2017 and ended on 29th September 2017. On all visits,

the temperature of the refugia was checked by hand to ensure that they were warm to the touch, and thus likely to be attractive to basking reptiles. Opportunistic survey of potential basking areas, such as bare soil on banks, was undertaken concurrently with checks on the refugia. This survey method can also be effective in ascertaining presence or absence of terrestrial amphibians, including Great Crested Newt. Limitations to reptile survey 2.5.6 The first survey visit to the attenuation basin was not possible due to access restrictions, this is however not thought to pose a significant limitation to the Reptile survey, as all other visits were completed in optimum conditions. Dense nettles were in part of the area surveyed; these were strimmed to provide surveyor access to install refugia and for surveying purposes. It is considered that this activity is unlikely to affect reptile distribution and any impact might be to draw reptiles to the strimmed path and refugia where basking may be more possible than in dense nettles. 2.6 Badger survey Rationale 2.6.1 Badgers are protected from killing, injury, capture and ill-treatment, disturbance within a sett and their setts are also protected 2.6.2 Badgers inhabit a wide variety of habitats in the UK. Typical habitats include woodland, long grassland, scrub and hedgerows for sett excavation and foraging, with pasture and arable land also used for foraging. Methodology 2.6.3 The proposed development site, and where accessible, land in the immediate vicinity was systematically searched during the Phase 1 Habitat Survey for setts and other signs of Badger activity such as paths, footprints, hairs, latrines and feeding signs, following guidelines set out in Harris, Cresswell and Jeffries (1989). In addition, an assessment was made of the likely value of the habitats within the survey area as foraging habitats for Badgers. 2.6.4 Any badger sett(s) identified during the survey would be recorded as the number of disused, partially-used and well-used holes. This information would be subsequently used to assign the sett to one of four standard categories (main, annexe, subsidiary and outlying) as used in the National Badger Surveys. Limitations to badger survey 2.6.5 Some of the areas by the River Great Stour were particularly overgrown potentially obscuring the view of any badger setts present underneath, however no paths or other signs were seen going into or around these inaccessible areas so the limitation is low. 2.7 Preliminary bat roost assessment methodology: Trees Rationale 2.7.1 Bats are European Protected Species. Many roosts are within trees, and the protection given to roosts means that their presence or absence in trees on the proposed development site needs to be understood. Methodology 2.7.2 The standard Preliminary Ground Level Roost Assessment (PRA) methodology for trees3 was followed. This aims to determine the actual or potential presence of bats, by inspecting for potential roost features from the ground, and determines any need for further survey and/or mitigation. 2.7.3 Trees within the proposed development area and close to the boundaries were inspected for the presence of features which may be suitable for use by roosting bats, with particular attention

3 Collins, J. (ed.) (2016) Bat surveys for professional ecologists: good practice guidelines, Third Edition, Bat Conservation Trust.

given to older and mature trees. A thorough inspection was undertaken, looking for features and signs indicative of bat roosts: • woodpecker holes; • rot holes; • hazard beams; • other vertical or horizontal cracks and splits, such as frost cracks in stems or branches; • partially detached bark plates; • knot holes arising from naturally shed branches, or branches previously pruned back to the branch collar; • artificial holes (such as cavities that have developed from flush cuts) or cavities created by branches tearing out from parent stems; • cankers, caused by localised bark death, in which cavities have developed; • other hollows or cavities including butt-rots at the base of the tree; • potential cavities in the fork between double trunks (“compression forks”), where the wood has grown around sections of bark (“included bark”); • gaps between overlapping stems or branches; • partially detached ivy with stem diameters in excess of 50mm; • bat, bird or dormouse boxes. 2.7.4 Signs of a bat roost, in addition to the visible presence of bats, include: • bat droppings in or around a potential roost feature (PRF); • odour coming from a PRF; • audible bat squeaks at dusk or during the day in warm weather; • staining below the PRF. 2.7.5 Some signs, such as staining, odour or squeaking, may originate from other species, and staining may arise from wet rot which would preclude bat use. Bats or bat droppings are the only conclusive evidence of bat use, but many bat roosts have no external signs. 2.7.6 Close-focusing binoculars were used to inspect trees from the ground to the canopy, from all sides, and from close to the trunk and further away. A high-power torch was used to inspect cavities and shaded areas of the branch structure. Where there were potential roost features within 1.5m of ground level, these were inspected using an endoscope to identify the bats themselves, droppings, or other signs. 2.7.7 The survey of trees included an assessment of their potential to support bat roosts using the following categories. Assessment of trees’ potential to support bat roosts Category Description

Negligible Trees with no potential to support bats Low A tree of sufficient size and age to contain potential roost features, but with none seen from the ground, or where the features seen have only very limited potential to support bats. Moderate A tree with one or more potential roost features, that could be used by bats due to their size, shelter, protection, condition and surrounding habitat, but are unlikely to support a roost of high conservation status. High A tree with one or more potential roost sites, that are obviously suitable for use by larger numbers of bats on a more regular basis, and potentially for longer periods of time, due to their size, shelter, protection, condition and surrounding habitat. Confirmed roost Trees with evidence of bats present. Unknown Unable to survey fully, for example because part of the tree is inaccessible.

2.7.8 The assessment was undertaken on 24th July 2017 and the weather conditions were dry, warm with some cloud cover.

Limitations to preliminary bat roost assessment: trees The survey was undertaken when the trees were in full leaf, there is a low probability some bat roosting features may have been missed because of this. 2.8 Assessment methodology 2.8.1 The assessment was undertaken in accordance with the Chartered Institute of Ecology and Environmental Management’s Professional Guidance Series4. 2.8.2 More details of the assessment methodology are provided in Appendix 2, but, in summary, the impact assessment process involves: • identifying and characterising impacts; • incorporating measures to avoid and mitigate (reduce) these impacts; • assessing the significance of any residual effects after mitigation; • identifying appropriate compensation measures to offset significant residual effects; and • identifying opportunities for ecological enhancement. 2.8.3 The hierarchical process of avoiding, mitigating and compensating for ecological impacts is explained further below. 2.8.4 In Ecological Impact Assessment (EcIA) it is only essential to assess and report significant residual effects (i.e. those that remain after mitigation measures have been taken into account). However, it is considered good practice for the EcIA to make clear both the potential significant effects without mitigation and the residual significant effects following mitigation, particularly where the mitigation proposed is experimental, unproven or controversial. Alternatively, it should demonstrate the importance of securing the measures proposed through planning conditions or obligations. 2.8.5 Assessment of the potential impacts of the proposed development takes into account both on- site impacts and those that may occur to adjacent and more distant ecological features. Impacts can be positive or negative. Negative impacts can include: • direct loss of wildlife habitats; • fragmentation and isolation of habitats through loss of connectivity; • disturbance to species from noise, light or other visual stimuli; • changes to key habitat features; and • changes to the local hydrology, water quality, nutrient status and/or air quality. 2.8.6 Negative and positive impacts on ecological features are characterised based on predicted changes as a result of the proposed activities. In order to characterise the impacts on each feature, the following parameters are considered: • the magnitude of the impact; • the spatial extent over which the impact would occur; • the temporal duration of the impact and whether it relates to the construction or operational phase of the development; • the timing and frequency of the impact; and • whether the impact is reversible and over what time frame. 2.8.7 Both short-term (i.e. impacts occurring during the site clearance and construction phases) and long-term impacts are considered. Conservation status 2.8.8 The extent to which the proposed development may have an effect upon ecological features should be determined in the light of its expected influence on the integrity of the site or ecosystem. The integrity of protected sites is considered specifically in the light of the site’s conservation objectives. Beyond the boundaries of designated sites with specific nature conservation designations and clear conservation objectives, the concept of ‘conservation status’ is used. Conservation status should be evaluated for a study area at a defined level of ecological

4 CIEEM (2016) Guidelines for Ecological Impact Assessment in the UK and Ireland: Terrestrial, Freshwater and Coastal, Second Edition.

value. The extent of the area used in the assessment relates to the geographical level at which the feature is considered important. For habitats, conservation status is determined by the sum of the influences acting on the habitats and their typical species that may affect their long-term distribution, structure and functions, as well as the long-term survival of its typical species within a given geographical area. For species, conservation status is determined by the sum of influences acting on the species concerned and inter-relationships that may affect the long-term distribution and abundance of its populations within a given geographical area. Confidence in predictions 2.8.9 It is important to consider the likelihood that a change or activity will occur as predicted and also the degree of confidence in the assessment of the impact on ecological structure and function. • Certain probability estimated at above 95% • Probable probability estimated above 50% but below 95% • Possible probability estimated above 5% but below 50% • Unlikely probability estimated as less than 5% Cumulative impacts 2.8.10 Consideration is also given to the potential for the development proposal to give rise to significant negative impact in combination with other proposed developments in the local area. Overall assessment 2.8.11 An overall assessment of value and impact is provided. This is based upon the highest level or value of any of the features or species present, or likely to be present on the site. Similarly, the overall assessment of impact is the impact of greatest significance. 2.9 Mitigation hierarchy 2.9.1 The following principles underpin EcIA and have been followed, where applicable, in this assessment. • Avoidance Seek options that avoid harm to ecological features (for example, by locating the proposed development on an alternative site or safeguarding on-site features within the site layout design). • Mitigation Adverse effects should be avoided or minimised through mitigation measures, either through the design of the project or subsequent measures that can be guaranteed – for example, through a condition or planning obligation. • Compensation Where there are significant residual adverse ecological effects despite the mitigation proposed, these should be offset by appropriate compensatory measures. • Enhancement Seek to provide net benefits for biodiversity over and above requirements for avoidance, mitigation or compensation.

3 Results 3.1 Desk study results Sites of European importance 3.1.1 The following sites of European importance (Ramsar, Special Protection Area, Special Area of Conservation) were identified within the search area. Sites of European importance Distance from Site development Direction Key habitat/features of interest site (approx.) Blean Complex is broadleaved woodland covering over 500ha, where hornbeam Carpinus betulus coppice occurs Blean Complex Special interspersed with pedunculate oak Quercus Area of Conservation 2.7km NW robur stands and introduced sweet (SAC) chestnut Castanea sativa. The stands have traditionally been managed as coppice, and are one of the British strongholds for the heath fritillary butterfly Mellicta athalea. Wye and Crundale Downs consists mostly of species-rich chalk grassland. It has an important assemblage of rare, scarce and uncommon orchids, including early spider- Wye & Crundale Downs orchid Ophrys sphegodes, late spider- Special Area of 7.3km SW orchid O. fuciflora, burnt orchid Neotinea Conservation (SAC) ustulata and lady orchid Orchis purpurea. The site contains the largest UK colony of O. fuciflora, representing about 50% of the national population. Stodmarsh covers around 565ha, containing a wide range of habitats including open water, extensive reedbeds, scrub and alder carr which together support a rich flora and fauna. The vegetation is a good example of a southern Stodmarsh Special Area eutrophic flood plain and a number of rare of Conservation (SAC), 5km NE plants are found here. The invertebrate Special Protection Area fauna is varied and several scarce moths (SPA) and Ramsar have been recorded in recent years. The site is also of ornithological interest with its diverse breeding bird community. Two rare British birds Cetti’s warbler and bearded tit, regularly breed in nationally significant numbers. The Swale includes the largest remaining areas of freshwater grazing marsh in Kent and is representative of the estuarine habitats found on the north Kent coast. The habitats comprise chiefly mudflats, saltmarsh, and freshwater grazing marsh, The Swale Special the latter being intersected by extensive Protection Area (SPA) 8.3km N dykes and fleets. The area is particularly and Ramsar notable for the internationally important numbers of wintering and passage wildfowl and waders, and there are also important breeding populations of a number of bird species. Associated with the various constituent habitats of the site are outstanding assemblages of plants and

invertebrates. The mudflats of the Swale are extremely rich in invertebrates, over 350 species having been recorded. Some of these, such as the polychaete worm Clymenella torquata are known from nowhere else in Britain, while other more widespread species are present at high densities and provide food for the huge numbers of birds, especially waders, which use the Swale.

Sites of national importance 3.1.2 The following sites of national importance (Site of Special Scientific Interest, National Nature Reserve) were identified within the search area. Sites of national importance Distance from Site development Direction Key habitat/features of interest site (approx.) Ash-maple coppice is the predominant woodland type on the slopes of this dry chalk valley. This grades into beech high Larkey Valley Wood forest on the thin calcareous soils of the Site of Special Scientific 1.2km SW upper slopes with hornbeam coppice on Interest (SSSI) the deeper soils in the valley bottom. The varied ground flora includes a number of uncommon plants. The wood also supports many breeding birds and Dormice. The woodland in the valley is a good example of a base-rich springline alder wood. Unimproved acidic grassland is Chequer’s Wood and present on the dry sandy plateau in the Old Park Site of Special western part of the site. In addition, a 3.5km E Scientific Interest variety of other habitats are present (SSSI) including pedunculate oak-birch woodland, dense scrub and a pond. Some uncommon plants occur and the area also supports a diverse breeding bird community. A mosaic of ancient semi-natural woodland and conifer plantation is set within the ancient Blean Forest complex and includes West Blean and several rare woodland types. The woodland Thorden Woods Site of 3.8Km NE has been noted for birds with over 50 Special Scientific species of breeding bird recorded, and Interest (SSSI) supports a diverse invertebrate fauna including five nationally rare and 13 nationally scarce species.

Church Woods, Blean Is a component of Blean Complex Special Site of Special Scientific 2.6km NW Area of Conservation described above in Interest (SSSI) section 3.1.1

Is a component of Blean Complex Special Blean Woods National 2.6km NW Area of Conservation described above in Nature Reserve (NNR) section 3.1.1

Sites of local importance 3.1.3 The following sites of local importance (Local Wildlife Site, County Wildlife Site, Ancient Woodland, Local Nature Reserve) were identified within the search area. Sites of local importance Distance from Site development Direction Key habitat/ features of interest site (approx.) Great Stour Ashford to Fordwich includes river corridor with associated habitats including - wet grassland, wet woodland, swamp, areas of unimproved neutral grassland. Plants including shining pondweed Potamogeton lucens, river water Parcel No’s 1 dropwort Oenanthe fluviatilis and common (allotments), 2 meadow rue Thalictrum flavum. Otters AS27 Great Stour (wet woodland) Lutra lutra have also been recorded Ashford to Fordwich & 4 (attenuation NW alongside water voles Arvicola amphibius, Local Wildlife Site basin) are within white-clawed crayfish Austropotamobius (LWS) the boundary of pallipes, Atlantic salmon Salmo salar. A the LWS Wide range of birds are present including water rail Rallus aquaticus, reed bunting Emberiza schoeniclus, Cetti’s warbler Cettia cetti, gadwall Anas strepera and other wildfowl including lapwing Vanellus vanellus, and occasional sightings of bittern Botaurus stellaris CA3 - Cooper's Pit, 900m E A geological site. Cooper's Pit was once Canterbury Local described as the finest inland exposure of Geological Site (LGS) Upper Chalk in the Canterbury district. Today it is in a degraded condition but still retains two good chalk faces. Although obscured, the southern face contains the Tertiary-Cretaceous unconformity, about four meters of basal Tertiary loamy sands and the underlying "Bull Head Bed" marking the unconformity. The western face exposes Upper Chalk containing Micraster coranguinum with a distinctive flint deposit known as Whitaker's Three Inch Flint Band. Bus Company Island 1.8km NE Former orchard planted with wildflowers LNR and trees Larkey Valley Wood 1.2km SW Ancient Woodland with spectacular displays LNR (also SSSI and of wildflowers from March to May, ancient woodland) including many species of orchid. Regular monitoring of the wood has shown that this is one of the best in the country for dormice5. Whitehall Meadows 200m E Damp-loving grassland plant species, and LNR bats, snails, common reptiles, dragonflies, damselflies and butterflies are just some of the wildlife that has been seen in the meadows6. Tyler Hill Meadow LNR 4.1km N One of the few remaining unimproved neutral grasslands in Kent. In summer the grassland supports colourful wild flowers such as St John’s wort and

5 http://www.lnr.naturalengland.org.uk/special/lnr/lnr_details.asp?themeid=1008990 6 http://www.lnr.naturalengland.org.uk/special/lnr/lnr_details.asp?themeid=1009240

black knapweed. Although the grassland is important the surrounding scrub and woodland also provides undisturbed habitat for birds. Eleven species of butterfly have been recorded on the site as have reptiles such as slow-worms and common lizards which shows that even small sites support a wealth of wildlife7. No Mans Orchard LNR 2.4km W One of only a handful of traditional orchards remaining in the Stour Valley. It retains the large trees so valuable to birds, insects and lichen. Blossom, windfall fruit and wild flowers among the grassland also attract wildlife8.

3.1.4 See appendix 6 for map showing location of designated sites. Protected, rare and/or priority species 3.1.5 A number of species records were returned for the search area. Records for protected, rare and/or priority species from within the search area are summarised below. In accordance with BS42020 and advice from most Local Biological Record Centres, species lists are not appended but are available to the Local Planning Authority on request. Veteran trees 3.1.6 No veteran tree records were returned. Plants 3.1.7 A number of invertebrate records were returned from the search area; however no protected, rare and/or priority plant species records were returned for the proposed development site or within close proximity of the boundary. Invertebrates 3.1.8 A number of invertebrate records were returned from the search area; however no protected, rare and/or priority invertebrate species records were returned for the proposed development site or within close proximity of the boundary. Amphibians including great crested newts 3.1.9 A number of records of common frog Rana temporaria were returned for the area surrounding the proposed development with some records from within the site itself. 3.1.10 A record of palmate newt Lissotriton helveticus was returned located directly adjacent to the proposed development site at Thanington Allotments in 2014 Reptiles 3.1.11 There were a few records of slow worm Anguis fragilis, common lizard Zootoca vivipara and grass snake Natrix natrix returned, located directly adjacent to the proposed development site at Thanington Allotments most recently in 2014. Birds 3.1.12 There were many bird records for the area. The majority where recorded from Thanington Lakes site some 850m to the west. There were no bird records for the site itself. Dormouse 3.1.13 Dormouse Muscardinus avellanarius records were returned with the closest being 450m away from the proposed development site boundary southwest on the opposite side of the A2 and A28.

7 http://www.lnr.naturalengland.org.uk/special/lnr/lnr_details.asp?themeid=1009593 8 http://www.lnr.naturalengland.org.uk/special/lnr/lnr_details.asp?themeid=1009591

Terrestrial Mammals including badgers 3.1.14 Badger Meles meles has been recorded from the local area, but not from within the proposed development site boundary. 3.1.15 Records of weasel Mustela nivalis were returned with the closest record being 750m away. 3.1.16 Records of hedgehog Erinaceus europaeus were returned locally. Aquatic Mammals including water voles and otters 3.1.17 Records water vole Arvicola terrestris were returned with the closest record being 1.2km away. 3.1.18 Records of non-native American Mink Neovison vison have been returned located at Whitehall Meadows LNR 300m to the northwest. Bats 3.1.19 There was a small number of records of bats in the 1km study area, with the nearest record being a flying Daubenton’s Myotis daubentonii on the western/opposite side of the A2 from the site boundary on the Great River Stour a short distance from the proposed development site. Four roost records were returned within the 1km search area of unknown type and located in the residential areas of Canterbury with the nearest being located 480m to the southeast of the proposed development site. 3.2 Phase 1 habitat survey results 3.2.1 Thirteen Phase 1 habitat categories were identified during the Phase 1 habitat survey and are shown on Figure 02. Management, setting and green infrastructure 3.2.2 Within the site boundary the habitat comprises of patches of dense, continuous scrub across the tall ruderal vegetation located within the attenuation basin, species poor semi-improved grassland with broad-leaved woodland planting along the A2 road verge, areas of landscape planting of shrubs and trees within the Park and Ride car park and an area of allotment gardens. 3.2.3 To the west the site is bounded by the A2 dual carriageway. To the south is the A28 Ashford Road and beyond this residential and retail units. To the east is Ten Perch Road and the Wincheap Retail Park & Industrial Estate. To the north adjoining the site boundary is the chalk river of the River Great Stour, a small area of wet woodland and tall ruderal habitat adjacent to the allotment gardens and an area of species poor semi improved grassland. 3.2.4 The attenuation basin (parcel 4) currently appears to be unmanaged and was dry at the time of the survey. The established terrestrial scrub indicated that it has been dry and heavily silted up for a number of years. The A2 verge (parcel 5) is managed under a Highway England ground maintenance regime to ensure the highway verge is mown regularly and trees are managed for Health and Safety requirements. The Park and Ride car park landscaping (parcel 3) appears to be well maintained with regular standard ground maintenance works carried out. The allotments (parcel 1) are overall being regularly worked with only a few abandoned plots with bramble developing along with ruderal vegetation. The adjoining wet woodland habitat (parcel 2) is not currently receiving any active management unlike the species-poor semi-improved grassland (parcel 6) which had been mown shortly before the survey visit. 3.2.5 The Great Stour Way cycle routes runs along the north bank of the River Great Stour. The habitats/land along the River Great Stour is managed through a Countryside Partnership project as part of a key piece of Green Infrastructure and Biodiversity Opportunity Area with the river itself and other sites along it being designated Local Wildlife Site. This provides good wildlife links and connectivity to habitats in the wider countryside to the north, into the city of Canterbury to the East and under the A2 bridge to the west. 3.2.6 Figure 02 shows the habitats present. Each habitat is described below.

A1.1.1 Broadleaved semi-natural woodland 3.2.7 Part of parcel 2 is an area of seasonally damp ground dominated by Common Nettle Urtica dioica with clearing to centre surrounded by White Willow Salix alba, older specimens on river edge with Wild Cherry Prunus avium to east forming an area of wet woodland adjacent to the site boundary. Hemlock Water Dropwort Oenanthe crocata, Water Mint Mentha aquatica and Himalayan Balsam Impatiens glandulifera are found along the river bank here. A1.1.2 Broadleaved plantation woodland 3.2.8 There were two areas of broadleaved plantation woodland. One covered much of the eastern two-thirds of the boundary of the A2 (parcel 5) which comprises mixed native planting of Common Hawthorn Crataegus monogyna, Ash Fraxinus excelsior, Field Maple Acer campestre and Dogwood Cornus sanguinea, with Bramble Rubus fruticosus agg., Common Nettle Urtica dioica, Hemlock Conium maculatum and Ivy Hedera helix. There was lots of litter due to the proximity to the layby on the A2 and some brash piles from previous tree management works. 3.2.9 The other area was along the bank to the southern boundary of parcel 6 which was dominated by planted Field Maple Acer campestre and Hazel Corylus avellana with bare ground underneath due to the density of the planting allowing little light to the ground. A2.1 Dense/Continuous Scrub 3.2.10 Within the attenuation basin adjacent to the A2 parcel 4 were patches of dense continuous scrub of Common Hawthorn Crataegus monogyna, Ash Fraxinus excelsior, Field Maple Acer campestre and Dogwood Cornus sanguinea, with Bramble Rubus fruticosus agg. 3.2.11 Along the west and southern boundaries of the allotment gardens (parcel 1) were areas of dense continuous scrub dominated by Bramble Rubus fruticosus agg. with occasional Common Hawthorn Crataegus monogyna and Ash Fraxinus excelsior. A3.1 Scattered broadleaved trees 3.2.12 A number of scattered trees are present within parcel 6 of Poplars Populus sp. and White Willow Salix alba. 3.2.13 Along the dry ditch between parcel 2 and 6 is a line of mature tree dominated by Poplars Populus sp. with the occasional White Willow Salix alba some were Ivy Hedera helix clad. 3.2.14 Adjacent to the entrance gate to the allotment garden is a large recently pollarded dead Ash Fraxinus excelsior. B6 Poor semi-improved grassland 3.2.15 The majority of parcel 6 comprises species poor semi-improved neutral grassland with frequent Common Nettle Urtica dioica and Docks Rumex sp. recently mown at time of survey. Close to the eastern boundary was a series of shallow scrapes that were dry at the time of the survey. 3.2.16 The western third of the A2 verge comprised areas of poor semi-improved grassland dominated by False Oat Grass Arrhenatherum elatius, with areas of local dominant Hemlock Conium maculatum, occasional Musk Mallow Malva moschata and Charlock Sinapis arvensis. C3.1 Tall ruderal vegetation 3.2.17 Within the attenuation basin area areas of tall ruderal vegetation scattered between the scrub and along the dry ditch dominated by Common Nettle Urtica dioica with locally abundant Greater Willowherb Epilobium hirsutum, frequent Wild Angelica Angelica sylvestris and occasional Bramble Rubus fruticosus agg. 3.2.18 There are further areas of tall ruderal vegetation in parcel 2 and on the western edge of parcel 6 but here the vegetation is dominated by Common Nettle Urtica dioica with few other species found in notable abundance. It is possible that the local conditions are high in nutrients, which would encourage this species.

G1 Standing water 3.2.19 A small pond dominated by Reedmace Typha latifolia, with abundant Duckweed Lemna sp., is located within parcel 6 outside the site boundary surrounded by poor semi-improved grassland. The pond appears to have been recently dug, circa 2-3 years old. 3.2.20 A very small under 1m x 1m waterbody is contained in the northwest corner of the allotments (parcel 1), enveloped by Bramble Rubus fruticosus agg. J1 Allotment Gardens 3.2.21 The allotments parcel 1 are mainly worked some have small fruit trees within them, at the entrance are two large sheds, a brash pile behind it and an area of grass to the front. Behind the sheds to the east is a vacant plant with ruderal vegetation and Bramble Rubus fruticosus agg. There are some vacant plots along the western edge which have ruderal vegetation, with dense continuous scrub to the boundary. J1.2 Amenity Grassland 3.2.22 There are small areas of amenity grassland between Ten Perch Road and the Wincheap Retail Park this is dominated by a mix of Perennial Rye Grass Lolium perenne. Close to the A28 there is a small area of grassland with some more interesting species, Goatsbeard Tragopogon pratensis, Grass Vetchling Lathyrus nissolia, Red Fescue Festuca rubra, Common Cat’s-ear Hypochaeris radicata, Buckhorn Plantain Plantago coronopus, Meadow Vetchling Lathyrus pratensis and Bee Orchid Ophrys apifera. J1.4 Introduced Scrub 3.2.23 Landscape planting around Park & Ride and retail units parcel 3 is of mixed shrubs and trees which is well managed with bare ground sprayed between planting. Planting consists of Dogwood Cornus sanguinea, Ivy Hedera helix, Ash Fraxinus excelsior and Guelder Rose Viburnum opulus. With the area bounding the A2 consisting of Field Maple Acer campestre, Common Hawthorn Crataegus monogyna, Sycamore Acer pseudoplatanus and Goat Willow Salix caprea. J3.6 Building 3.2.24 There are several buildings within the site boundary. The largest is a modern brick building, part of the Park and Ride scheme, housing toilets and bus waiting area. There are two wooden sheds within the allotments and adjacent to the A28 are two structures housing telecoms equipment. J4 Hardstanding 3.2.25 Extensive areas of tarmac and concrete are present within much of the site. The Park and Ride car park/facility, Ten Perch Road and the footways make up approximately 75% of the site area. A small layby on the A2 is contained within the site boundary in parcel 5. A tarmac cycleway continues from Ten Perch Road through parcel 6 crossing the River Great Stour to join the Great Stour Way cycle route. 3.3 Great crested newt Habitat Suitability Index (HSI) survey results 3.3.1 The results of the HSI assessment for each of the ponds surveyed are tabulated below. 3.3.2 Pond locations are detailed in Figure 02.

Habitat Suitability Index (HSI) survey results HSI variables

HSI Pond No. Total SI1 - Location Location SI1 - area Pond SI2 - drying Pond SI3 - quality Water SI4 - Shade SI5 - Fowl SI6 - Fish SI7 - Ponds SI8 - SI9 - Terrestrial habitat SI10 - Macrophytes 1 1 0.1 0.5 0.67 1 1 1 0.31 0.5 0.7 0.68 2 1 0.01 0.1 0.01 0.8 1 0.67 0.31 0.5 0.3 0.47

3.3.3 A summary of the HSI scores, with the distances from the development site and comments is tabulated below. Summary of Habitat Suitability Index (HSI) survey results Distance from HSI HSI Pond development Direction Comments Score category No. (approx.) Pond immediately northeast of the 1 0.68 Average 50m E proposed development site boundary Very small (1m x 1m) pond 2 0.47 Poor 10m - enveloped by bramble in the corner of the allotments

3.3.4 One pond was categorised as ‘Average’ and is therefore considered suitable for great crested newts. One pond was categorised as 'Poor' and is therefore considered unsuitable for great crested newts. 3.4 Great crested newts: environmental DNA (eDNA) analysis 3.4.1 Pond 1 within a 500m radius of the Site was identified as requiring further survey after the HSI assessments. 3.4.2 The results of the eDNA analysis are set out in the table beneath and laboratory reports are reproduced in Appendix 7. The HSI score and a brief description of each pond are also provided.

Results of eDNA analysis

eDNA GCN Further Pond HSI analysis considered survey Comments No. category outcome present? required?

Pond immediately northeast 1 Average Negative No No of the proposed development site boundary

3.4.3 The sampled pond returned a negative result for the presence of great crested newt eDNA. It is therefore considered that great crested newts are not present in this pond and no further survey is necessary.

3.5 Reptile survey results 3.5.1 The results of the survey are given below in the table below and the location of records is shown on Figure 03. Detailed records are included in Appendix 8.

Survey Date Temp Weather Common Slow Grass o Adder and time (BST) ( C) Conditions Lizard worm snake

A2 lay-by and verge Cloud Cover: 20% 1st September 2017 16 0 0 0 0 Wind: light Cloud Cover: 90% 6th September 2017 16 0 1 0 0 Wind: moderate Cloud Cover: 90% 8th September 2017 16 0 1 0 0 Wind: light Cloud Cover: 20% 13th September 2017 17 0 2 0 0 Wind: moderate Cloud Cover: 90% 20th September 2017 15 0 4 0 0 Wind: light Cloud Cover:100% 27th September 2017 19 0 2 0 0 Wind: very light Cloud Cover: 50% 29th September 2017 18 0 1 0 0 Wind: very light Peak Count 0 4 0 0 Attenuation Basin Cloud Cover: 20% 1st September 2017 16 0 0 0 0 Wind: light Cloud Cover: 90% 6th September 2017 16 0 4 0 0 Wind: moderate Cloud Cover: 90% 8th September 2017 16 0 2 0 0 Wind: light Cloud Cover: 20% 13th September 2017 17 0 1 0 0 Wind: moderate Cloud Cover: 90% 20th September 2017 15 0 2 0 0 Wind: light Cloud Cover:100% 27th September 2017 19 0 2 0 0 Wind: very light Cloud Cover: 50% 29th September 2017 18 0 2 0 0 Wind: very light Peak Count 0 4 0 0 Allotments Cloud Cover: 20% 1st September 2017 16 0 3 0 0 Wind: light Cloud Cover: 90% 6th September 2017 16 0 2 0 0 Wind: moderate Cloud Cover: 90% 8th September 2017 16 0 1 0 0 Wind: light Cloud Cover: 20% 13th September 2017 17 0 0 0 0 Wind: moderate

Survey Date Temp Weather Common Slow Grass o Adder and time (BST) ( C) Conditions Lizard worm snake

Cloud Cover: 90% 20th September 2017 15 0 2 0 0 Wind: light Cloud Cover:100% 27th September 2017 19 0 1 0 0 Wind: very light Cloud Cover: 50% 29th September 2017 18 0 2 0 0 Wind: very light Peak Count 0 3 0 0 Wet Woodland Cloud Cover: 20% 1st September 2017 16 0 0 0 0 Wind: light Cloud Cover: 90% 6th September 2017 16 0 0 0 0 Wind: moderate Cloud Cover: 90% 8th September 2017 16 0 0 0 0 Wind: light Cloud Cover: 20% 13th September 2017 17 0 0 0 0 Wind: moderate Cloud Cover: 90% 20th September 2017 15 0 0 0 0 Wind: light Cloud Cover:100% 27th September 2017 19 0 0 1 0 Wind: very light Cloud Cover: 50% 29th September 2017 18 0 0 0 0 Wind: very light Peak Count 0 0 1 0

3.5.2 Slow worms were recorded from habitats within the development including within the attenuation basin (parcel 4) and the A2 verge (parcel 5). No further reptile species were recorded during the survey visits. 3.5.3 Slow worms were recorded from habitats at the allotments (parcel 1) located directly adjacent to the development site boundary. No further reptile species were recorded during the survey visits. 3.5.4 One grass snake was recorded under refugia 9 on the 6th survey visit on 27th September 2017 from the wet woodland habitat (parcel 2) located adjacent to the development site boundary. No further reptile species were recorded during the survey visits. 3.5.5 The survey technique employed for reptiles can also record foraging amphibians. No amphibians were found under refuges. 3.6 Badger survey 3.6.1 Initial survey carried out in May 2017 did not note conclusive signs of badger within the proposed development site boundary or the immediate surrounding. Some of the areas by the River Great Stour were particularly overgrown potentially obscuring the view of any badger setts present underneath, however no paths or other signs were seen going into or around these inaccessible areas so the likely presence is thought to be very low. 3.7 Preliminary bat roost assessment results: Trees 3.7.1 Four trees and one group of trees were assessed. Two trees from the group were categorised as ‘High Suitability’ trees. One tree was categorised as ‘Low Suitability’ tree. The remaining trees were categorised as ‘Negligible’ trees.

3.7.2 The results of the survey are shown in the table below and the location of the trees is shown in Figure 04. Preliminary bat roost assessment results Tree Potential Roost Feature (PRF)

No. Species Type Height Facing Suitability Comments above direction ground

T1 Poplar 1 x Broken branch 6 – 7m S High Within row of 1 x Vertical cavity 6 – 7m S poplar and willow trees on the eastern boundary of parcel 1 – wet woodland T2 Willow 2 x Split branches 2 – 4m W High Within row of poplar and willow trees on the eastern boundary of parcel 1 – wet woodland T3 Willow Dense Ivy 0 – 5m All Low On eastern boundary of allotments T4 Ash Heart rot in main trunk, 0 – 5m All Negligible Old pollard by previous branch with allotment gates vertical cavity recently removed

4 Evaluation of conservation status and impact assessment 4.1 Assessment rationale 4.1.1 The assessment is based on the ecological data presented within this report. Future changes in the wildlife present on site after a period of time has elapsed are beyond the scope of this report, unless specifically stated. 4.2 Evaluation of conservation status and assessment of designated sites 4.2.1 The ecological value of the site is considered below and evaluated using the methodology set out in Appendix 2 and in accordance with species legislation and planning policy, as outlined in Appendix 1. Sites of European importance 4.2.2 There are four sites of European importance within the search area. These sites are assessed as being of Very High importance for wildlife at the European scale. 4.2.3 The development is highly unlikely to increase the recreational impact of visitors to these sites as it will not facilitate visiting these sites in anyway and therefore not increase visitor numbers. The impact is therefore assessed as Neutral. 4.2.4 The development is likely to slightly increase the water runoff from the A2 and surrounding land as natural permeable ground becomes an impermeable road surface for example tarmac road surface. It is understood that current runoff from this area of the A2 is dealt with by the attenuation basin before being slowly discharged into the Great River Stour which this basin is connected too. This provides a potential impact pathway to Stodmarsh SAC & SPA which lies along the River Great Stour 5km downstream. The development is unlikely to increase runoff significantly and the proposed management works to restore the attenuation basin will ensure water quality impact will be insignificant and is therefore assessed as Neutral. A separate drainage report accompanying the planning application has further detail. 4.2.5 Typically, contributions to ambient NOx concentrations from roads reduce to background concentrations within 100 to 200m from the kerbside. However, in areas with low and relatively

consistent concentrations of background pollution the influence of the road may be detected at around 250m (English Nature, 2004)9. The development is over 250m from the nearest European site Blean Complex SAC and that the development would potential draw traffic off the A2050 by providing an alternative route, it is impact of air quality on European site would be insignificant and is therefore assessed as Neutral. 4.2.6 It is anticipated that no negative impacts to these sites are likely to result from the proposed development due to the distance of them from the proposed development and the nature of the development. The impact of the proposed development upon sites of European importance is therefore assessed as Neutral. Sites of national importance 4.2.7 There are five sites of national importance within the search area. These sites are assessed as being of High importance for wildlife at the National scale. 4.2.8 Sites of Special Scientific Interest (SSSI) Impact Risk Zones are used to assess the necessity to consult Natural England on planning applications at varying distances from SSSIs. In accordance with the SSSI Impact Risk Zones User Guidance10 consultation with Natural England would be required for the proposed development site for: • all planning applications outside or extending beyond existing settlements and urban areas, affecting greenspace, farmland, semi-natural habitats or features such as trees, hedges, streams, and rural buildings or structures, except householder applications; • Any industrial/agricultural development that could cause AIR POLLUTION (incl: industrial processes, pig & poultry units, slurry lagoons > 200m² & manure stores > 250t). • Any discharge of water or liquid waste of more than 20m³/day to ground (ie to seep away) or to surface water, such as a beck or stream (NB This does not include discharges to mains sewer which are unlikely to pose a risk at this location).

4.2.9 The proposed development does not fall within these categories and therefore does not require consultation with Natural England. 4.2.10 As described in 4.2.5 the development will likely locally increase air quality impacts, the main impact pathway would be the potential for nutrient nitrogen deposition from vehicle exhausts. Typically, contributions to ambient NOx concentrations from roads reduce to background concentrations within 100 to 200m from the kerbside. However, in areas with low and relatively consistent concentrations of background pollution the influence of the road may be detected at around 250m (English Nature, 2004)11. The development is over 250m from the nearest National site which is Larkey Valley Wood SSSI, its impact on air quality on European site would be insignificant and is therefore assessed as Neutral. 4.2.11 The impact of the proposed development overall upon sites of national importance is considered to be Neutral, given the distance of the proposed development from the designated sites. Sites of local importance 4.2.12 One Local Wildlife Site (LWS), one Local Geological Site (LGS) and one Local Nature Reserve (LNR) are present within the search area. These sites are assessed as being of Medium importance for wildlife at the County scale. 4.2.13 The distance from the Local Geological Site (LGS) and nature of the proposed development indicates that the impact upon this site is considered to be Neutral. 4.2.14 The distance of the proposed development from the Local Nature Reserve indicates that there is unlikely to be any increase in disturbance as a result of the development. In addition given the

9 English Nature (2004). The ecological effects of diffuse air pollution from road transport. English Nature; Peterborough. 10 Natural England, from www.magic.gov.uk, March 2016, 11 English Nature (2004). The ecological effects of diffuse air pollution from road transport. English Nature; Peterborough.

proposed management of water discharge into the River Great Stour there are unlikely to be any impacts on the hydrology of Whitehall Meadows. The impact of the proposed development on Whitehall Meadows LNR is considered to be Neutral. 4.2.15 Parcel 4, the attenuation basin, is identified as being part of AS27 Great Stour Ashford to Fordwich Local Wildlife Site (LWS). The development proposals are to bring this attenuation basin back into management which is likely to involve the removal of the dense scrub, tall ruderal vegetation and desilt the basin thereby restoring it to function properly. This will be a temporal minor impact on the habitat, affecting under 1% of the overall area of the local wildlife site, with the basin likely to revegetate over the next 2-3 years post construction. The management of the attenuation basin has the potential to provide a minor positive impact by functions correctly to ensure pollution in road runoff is addressed before water is discharged from the basin into the River Great Stour. The standing water habitat in the basin following management has the potential to provide improved habitat for local wildlife. After reviewing the Local Wildlife Sites in Kent Criteria for Selection and Delineation12, it is unclear how the concrete attenuation basin qualifies for selection as a LWS as it does not appear to contain habitats or species which meet the criteria for selection, apart from as complementing and buffer habitat given its position next to the larger ecological unit of Great Stour LWS. 4.2.16 The current use of the majority of the site as a Park and Ride car park and the close proximity of the A2 already has a high level of associated disturbance from traffic noise and pollution. The development is likely to cause a minor increase in this disturbance during the construction and operational phases of the proposed development. 4.2.17 Lighting columns within the park and ride site and along the highways currently have a high level of associated illumination of the surrounding habitats with light spill onto the A2 verge and broadleaved tree and shrub planting along this boundary which would affect wildlife potentially using these corridors for example bats. The development is unlikely to cause an increase in this disturbance during the construction and operational phases of the proposed development. 4.2.18 Given the small percentage of the area of the overall Local Wildlife Site affected by the development, doubt over which elements of the selection criteria this part of LWS meets and what receptors there would be for disturbance, little change in the disturbance & pollution the LWS already receives and the potential for the management of the attenuation basin to provide a positive impact, the overall impact of the proposed development on the AS27 Great Stour Ashford to Fordwich Local Wildlife Site is considered to be Neutral. 4.3 Evaluation of conservation status and assessment of habitats and green infrastructure Habitats 4.3.1 The majority of habitats within the site boundary are considered to of Lower to Negligible value for wildlife between Parish and Site only scale. The attenuation basin because of it inclusion within the Local Wildlife Site boundary might normally be considered to be of Medium value at the County scale, however the character of the habitat and for the reasons discussed in Section 4.2 indicates an assessment as Lower value for wildlife at Parish scale. 4.3.2 Given the proposed development would result in the loss of habitat along the A2 verge and the temporal disturbance to the attenuation basin through management the impacts of the development upon the site habitats are considered to be Minor Adverse in the absence of mitigation. Providing that mitigation as set out in section 5 is implemented the mitigated impact of the development on habitats is provisionally assessed as Neutral. Green infrastructure 4.3.3 The attenuation basin is identified as part of the Great Stour LWS which is part of a key piece of Green Infrastructure along the river valley and is also identified as part of the Biodiversity

12 Kent Wildlife Trust (August 2015) Local Wildlife Sites in Kent Criteria for Selection and Delineation Version 1.5, Kent Wildlife Trust

Opportunity Area. Management of the attenuation basin has the potential to benefit the green infrastructure by addressing road runoff pollution, water discharge management and improving the standing water habitat for wildlife as outlined in mitigation in section 5. The impact of the proposed development on green infrastructure is therefore assessed as Neutral to Minor Beneficial. 4.4 Evaluation of conservation status and assessment of species Veteran trees 4.4.1 There are no veteran trees present on the site and the value of the proposed development site for these is therefore Negligible. The impact of the proposed development upon this group is Neutral. Plants 4.4.2 Given the nature of the habitats recorded at the site and the plant records returned for the local area, it is not considered that the site has potential to support protected, rare and/or priority plants. Bee Orchid Ophrys apifera identified locally from the amenity grassland is not a significant record, being neither protected, rare or priority species. The value of the proposed development site for this group is Negligible and the impact of the proposed development is Neutral. Invertebrates 4.4.3 Given the nature of the habitats recorded on the site and the invertebrate records returned for the local area, it is not considered that the site has potential to support protected, rare and/or priority invertebrates. The value of the proposed development site for this group is Negligible and the impact of the proposed development is Neutral. Amphibians including great crested newts 4.4.4 Amphibians require suitable aquatic and terrestrial habitats for foraging, breeding, dispersing and hibernating. Most of the proposed development site is hardstanding and landscape planting which is considered poor terrestrial habitat for amphibians. The scrub, woodland habitats provide some suitable terrestrial habitat for amphibians, such as great crested newts, during their terrestrial phase. There is some suitable aquatic habitat for amphibians in the two ponds identified from the survey in adjoining land although the attenuation basin is unlikely to provide suitable aquatic habitat in its dry, heavily silted and scrubby state. The site is isolated by various barriers to amphibian movement with the A2 along the western boundary, hardstanding, further roads, retail and residential units to the south and much of the east and River Great Stour to the north, with only small connecting habitat through parcel 6 to the east. There are no records of great crested newts in the area and eDNA testing of the pond in parcel 6 was negative for Great Crested Newts. 4.4.5 Records of Common Frog and Palmate Newt were identified from habitats adjoining the site boundary in parcel 1. 4.4.6 The value of the proposed development site for this group is Negligible and the impact of the proposed development is Neutral. Reptiles 4.4.7 Reptiles require a mosaic of habitats. The dense scrub vegetation provides suitable refuge and the adjacent areas of grassland provides some foraging and basking opportunities, whilst the larger areas of tall ruderal vegetation provide foraging habitat. Slow worms were recorded in low numbers from the A2 verge and the attenuation basin. There is one record grass snake in the wet woodland and low population of slow worms in the allotments adjacent to the development site. The value of the site is therefore considered to be Lower at the Parish Scale. 4.4.8 There is good connectivity from the site to the east to suitable off-site habitat for widespread reptiles via the river margins, wet woodland, allotments and grassland habitats beyond. 4.4.9 The development would result in temporary loss of habitat and there is a danger of reptiles straying into working areas during the construction phase, where they may be subject to impacts such as killing and injury. The impact of the development is assessed as Minor-Adverse. Mitigation has been proposed to reduce the impact of the development to Neutral.

Birds Breeding birds 4.4.10 The site will most likely be used by common breeding bird species, both for nesting and foraging, with the woodland and scrub habitats being of greatest value in this respect. It is considered that the value of the site to breeding birds is of Lower, i.e. at the Parish/Neighbourhood scale. 4.4.11 There would be a loss of nesting habitat due to loss of the broad leaved woodland planting along the A2 verge and dense continuous scrub within the attenuation basin should management work be carried out here to bring it back into working condition. The unmitigated impact is considered to be Minor Adverse. Providing that mitigation as set out in section 5 is implemented the mitigated impact of the development on breeding birds is provisionally assessed as Neutral. Wintering birds 4.4.12 There are no habitats present on site which might support significant populations of wintering birds, although the site does offer some limited foraging potential for small numbers of common species. The site is considered to be of Negligible value for this group. Dormice 4.4.13 There were no dormouse records returned for the site with the closest being on the opposite side of the A2. Habitats on site and surrounding offer only a limited resource for this species and the vegetation along the A2 is sub-optimal habitat for Dormice. The trees and shrub vegetation within the development is isolated, bound by the river to the north, roads and car parking to the west, south and most of the east, with no visible connections to any suitable Dormice habitat. Based on this no further surveys for this species were carried out. 4.4.14 The site is therefore considered to be of Negligible value for this species and the impact of the proposed development is Neutral. Aquatic mammals including water voles and otters 4.4.15 The proposed development site does not comprise habitats of the river corridor apart from the attenuation basin which is considered unsuitable for otters and water voles. No records of these species were returned from the search area and no signs of presence were found during the site survey. The site is assessed as being of Negligible value and the impact of development is assessed as Neutral. Terrestrial mammals including badgers 4.4.16 There are some habitats within the site boundary and habitats adjoining the site boundary that provide suitable habitats for badgers. Some badger records were returned from the local area but not within the site boundary. The site survey however did not reveal any signs of badgers within or adjacent to the site boundary. The site is therefore considered to be of Negligible value for this species and the impact of the proposed development is Neutral. Bats Roosting potential 4.4.17 Of the trees surveyed for bat roost potential, two were assessed as having high roosting potential, one as low roosting potential and one of negligible roosting potential, these are deemed to be of Lower importance for roosting bats at the Parish level. 4.4.18 None of these three trees are believed to be affected by the development. The impact of development upon these trees is considered to be Neutral. Foraging/commuting potential 4.4.19 Based on the evidence gained during the Phase 1 survey, the site is likely to be used for commuting and foraging purposes by relatively common and widespread bat species. The habitat along the A2 verge may provide a flight corridor and the attenuation basin sheltered foraging opportunities. Research has shown that bat abundance is reduced close to the M6 motorway, and it is possible that the A2 has a similar effect.

4.4.20 It is considered that the value of the Site to foraging and commuting bats is Lower at the Parish/Neighbourhood scale. The mitigated impact is Neutral. 4.5 Cumulative impacts 4.5.1 There are a series of consented sites to the southwest of development site, including a large parcel of land on the opposite side of the A2 on land off Cockering Road, Thanington, which are proposed for residential and employment development. Cumulative impact(s) for the proposed A2 development in-combination with these other sites has been considered for the various designated sites identified in section 3.1. Changes to water quality and levels are unlikely with no in-combination effects anticipated. Disturbance due to increased visitors is unlikely with no in- combination effects anticipated. Changes in air quality are likely at a very local level but this is unlikely to result in in-combination effects upon ecological features. It is therefore considered that there are no known cumulative impacts.

5 Mitigation and avoidance measures 5.1 Avoidance measures 5.1.1 The following impact avoidance measures have been identified and will be delivered. • During construction works Heras type fencing or similar appropriate fencing, will be erected around the site boundary to prevent incursion into the habitats adjacent to the north and eastern boundaries. 5.2 Proposed mitigation for known impacts 5.2.1 The following mitigation is required to reduce the impacts of the scheme to within acceptable limits and have been recommended based on the protected species surveys that have been carried out. Habitats • To mitigate for the loss of vegetation along the A2 semi-natural planting will be incorporated within the new landscape planting alongside the new slip road which is suitable for a range of species including Dormice. The planting will be a range of broadleaved, native species reflective of the species found in the local area, see Appendix 4 for planting species list and location. Stock for planting will be from seed sourced and grown in the UK. The proposed planting will be structurally diverse, with tree, shrub layers, and areas of dense scrub as well as more open areas. • Provide opportunities for a wider range of native wetland vegetation to colonise the attenuation basin by leaving some substrate in place for rooting on the shallow concrete slopes. • Make the profiles with the attenuation basin following the works wildlife friendly with the substrate left in the basin, as identified above, being graded to form shallow sloping sides along a proportion (40%) of the bank edges. • It is recommended that the new and replacement lighting installed as part of the development will follow the Bat Conservation Trust Interim Guidance on Artificial Lighting and Wildlife June 2014 as detailed in Appendix 9 to minimise the impact of artificial lighting on wildlife present in habitats surrounding the development. Rare plants • No mitigation required. Invertebrates • No mitigation required. Great Crested Newt • No mitigation required. Other Amphibians • Carry out works within the attenuation basin within winter months (October – February) to avoid impacts on breeding amphibians. Reptiles • In order to avoid killing or injuring reptiles, the site will need to be fenced, the reptiles present trapped and them moved away from those areas affected by development and construction, as follows: - Fence the perimeter of the site boundary as identified by an Ecologist, using Herptosure Semi Permanent Reptile Fencing (or similar) - Utilising the survey mats which are already in place and add further refugia to increase density carry out a minimum of 30 days trapping visits during warm, dry, sunny conditions, with a minimum air temperature of 12oC in spring or autumn - Carry on trapping until 5 clear days are reached when no reptiles are caught

- Caught reptiles are to be relocated in suitable habitats which adjoin the site boundary in agreement with the landowner. - Maintain the reptile fence and vegetation until construction is complete

Breeding birds • The reduction in nesting opportunities as a consequence of vegetation removal will be offset by the replacement of native planting within the landscaping scheme. See Appendix 4 for full details of landscaping scheme. • Vegetation removal required for the construction phase will take place outside of the bird breeding season of March to August inclusive, to prevent disturbance to birds, or if removed in that period, only after a survey by a suitably qualified ecologist has shown that no active nests are present. Dormouse • No mitigation required. Water Vole • Heras or similar security fencing should be deployed to ensure that the river corridor remains undisturbed for the duration of the construction of the development. Otter • Heras or similar security fencing should be deployed to ensure that the river corridor remains undisturbed for the duration of the construction of the development. Badger As a precautionary approach for potential of badgers and other mammals e.g. hedgehogs foraging in the area: • Trenches should be filled in prior to the end of the working day, or a plank left leaning up from the base of the trench to the surface, so that animals falling in can get out of the excavation. • Pipework should be closed off at the end of each working day to avoid badgers and other animals becoming trapped. • Security fencing should be raised from the ground to provide gaps 100mm high and 300mm wide, at approximately 100m intervals around the boundary of the site, to allow the continued movement of mammals, including badger, across the site for foraging and commuting. Bats • Should current development plans change resulting in any trees, highlighted in figure 04 as providing high roosting potential, becoming due for removal or surgery works then further surveys for bats will need to be carried out. Climb and inspect surveys and emergence/return to roost surveys would be carried out during the bat active season (May to August). If any trees that provided low – negligible bat roost potential are due for removal or surgery works then these would be soft felled (dismantled) under the supervision of a licenced bat ecologist. 5.3 Compensation for ecological impacts 5.3.1 To compensate for the loss of the strip of broadleaved woodland plantation along the A2 verge (parcel 5) the landscape planting as part of the proposed development will comprise a similar native species mix of trees and shrubs covering a similar size area. See Appendix 4. 5.4 Species licensing 5.4.1 No species licences are necessary based on the information provided in this report and the current information provided by the client on the nature of the development and the site boundary.

6 Enhancement options 6.1 Ecological enhancement 6.1.1 Ecological enhancement aims to improve the quality of the site and the immediate vicinity for native flora and fauna. Such enhancements can also provide aesthetic appeal and can add value to the proposed development, and deliver a gain in biodiversity in accordance with the NPPF. 6.1.2 Possible enhancement opportunities specific to the development proposals for this site are provided below. It is not anticipated that all of these options would be utilised. The options are listed in order of priority, with habitat enhancements having most benefit to wildlife. Small-scale enhancements targeted at individual species, whilst valuable, are generally of less overall benefit than habitat enhancement measures. 6.2 Pollution control measures 6.2.1 It is understood that Ten Perch Road currently is not fitted with oil interceptors in its drainage system; oil interceptors will be fitted as part of the development to limit the potential for pollution to reach the River Stour. This will be an improvement to the existing situation. 6.3 Habitat enhancement options 6.3.1 Potential habitat enhancements include the following. • The boundary vegetation and landscaping within the Park and Ride car park/roadside could be strengthened by further native planting, including berry-bearing species to provide for bird foraging, and native species to attract insects. A structurally diverse range of plants should be used, including shrubs large enough to support nesting birds. 6.3.2 These enhancements would benefit common invertebrates, breeding and wintering birds, wetland plant, amphibians and bat foraging. 6.4 Small-scale species enhancement options 6.4.1 The potential small-scale enhancements to benefit individual species/species groups has been considered. It is not felt that the size of development allows for any meaningful small-scale enhancement to be incorporated or that if any were included whether this would be suitable given the surrounding environment and nature of the development.

7 Recommendations 7.1 Recommendations for further survey 7.1.1 No further ecological survey work is recommended. 7.2 Other recommendations Ecological mitigation method statement 7.2.1 It is recommended that an ecological mitigation method statement, setting out timings of delivery of mitigation and enhancement measures, is prepared prior to commencement of site clearance and construction. Landscape and ecological management plan 7.2.2 It is recommended that an Ecological Management Plan (EMP) setting out the proposed aftercare and long term management of retained attenuation basin and the compensation broadleaved woodland planting incorporated in the landscaping scheme is prepared. 7.3 Recommended conditions 7.3.1 It is recommended that the following conditions, based on model conditions in Appendix D of BS42020:2013, are applied to the planning permission. 7.3.2 No removal of hedgerows, trees or shrubs shall take place between 1st March and 31st August inclusive, unless a competent ecologist has undertaken a careful, detailed check of vegetation for active birds’ nests immediately before the vegetation is cleared and provided written confirmation that no birds will be harmed and/or that there are appropriate measures in place to protect nesting bird interest 7.3.3 No development, demolition or earth moving shall take place, nor material or machinery be brought onto the site until protective fencing and warning signs have been erected on site in accordance with the approved CEMP. All protective fencing and warning signs will be maintained during the construction period in accordance with the approved details.

8 Conclusions 8.1 Overall assessment of value and impact 8.1.1 The overall value of the site to wildlife is considered to be Lower at the Parish scale. 8.1.2 A summary of assessments of value and the impact of the proposed development without mitigation, and the residual significant effects following mitigation, is provided in the table below. Summary of assessment of value and impact Level of Unmitigated Confidence Mitigated Feature Scale value impact level impact

Sites of European Very High European Neutral Certain Neutral importance Sites of national importance High National Neutral Certain Neutral Sites of local importance Medium County Minor Adverse Probable Neutral Neutral to Habitats and Green Lower - Parish to Minor Adverse Probable Minor Infrastructure Negligible Site only Beneficial Veteran trees Negligible - Neutral Certain Neutral Plants Negligible - Neutral Probable Neutral Invertebrates Negligible - Neutral Probable Neutral Amphibians including great Lower Parish Neutral Certain Neutral crested newts Reptiles Lower Parish Minor Adverse Certain Neutral Breeding birds Lower Parish Minor Adverse Probable Neutral Wintering birds Negligible - Neutral Probable Neutral Dormice Negligible - Neutral Probable Neutral Aquatic mammals including Lower Parish Neutral Probable Neutral water voles and otters Terrestrial mammals Negligible - Neutral Probable Neutral including badgers Bats: roosting Lower Parish Neutral Certain Neutral Bats: foraging/commuting Lower Parish Neutral Probable Neutral

8.1.3 The overall impact of the proposals is considered to be Minor Adverse in the absence of mitigation. The mitigated impact is considered to be Neutral. 8.1.4 The adoption of all or most of the enhancement measures detailed in Section 6 above would give rise to a Neutral-Minor Beneficial impact. 8.2 Further survey requirements 8.2.1 No further ecological survey work is recommended.

9 References

ARG UK (2010) ARG UK Advice note no. 5: Great crested newt habitat suitability index, Amphibian and Reptile Groups of the United Kingdom. Biggs, J., Ewald, N., Valentini, A., Gaboriaud, C., Griffiths, R.A., Forster, J., Wilkinson, J., Arnett, A., Williams, P., and Dunn, F. (2014) Analytical and methodological development for improved surveillance of the Great Crested Newt. Appendix 5. Technical advice note for field and laboratory sampling of great crested newt (Triturus cristatus) environmental DNA, Freshwater Habitats Trust, Oxford. CIEEM (2016) Guidelines for Ecological Impact Assessment in the UK and Ireland: Terrestrial, Freshwater and Coastal, Second Edition. Collins J. (ed.) (2016) Bat surveys for professional ecologists: good practice guidelines, Third Edition, Bat Conservation Trust, London. DEFRA Magic Map Application. Available from: http://magic.defra.gov.uk/MagicMap.aspx Froglife (1999) Froglife advice sheet 10: reptile survey. Froglife, London. Gent T & Gibson S (2003) Herpetofauna Workers Manual. JNCC, Peterborough. JNCC (2010) Handbook for Phase 1 Habitat Survey - a Technique for Environmental Audit. Reprinted by JNCC, Peterborough. Oldham, R.S., Keeble, J., Swan, M.J.S., & Jeffcote, M. (2000) Evaluating the suitability of habitat for the Great Crested Newt (Triturus cristatus), Herpetological Journal 10(4), 143-155.

Figures

Key

Site Boundary

B09037 - Thanington Park Canterbury

A2 4th Arm Coastbound Slip Road, Wincheap: Location Plan

Figure 01 Scale: 1:25,000 @ A3

August 2017

© The Landscape Partnership Ltd Reproduced fr om the Ordnance Survey map with the permission of the controller of Her Majesty's Stationery Office. Licence number: AL 100002205. © CROWN COPYRIGHT. Target Notes Key 1 Large recently pollarded dead Ash (Fraxinus excelsior) by gate, bat roost potential further survey required Site Boundary 2 Tall bramble (Rubus fruiticosus agg.) patch extending north along chain link fence and timber stacked to Survey Boundary west A1.1.1 Woodland Broad-leaved 3 Unworked plots with ruderal species Semi-natural 4 Vacant plot with summer house to west, large brash A1.1.2 Woodland Broad-leaved Plantation pile in centre of plot 5 Allotment holder notes presence of Slow worms A2.1 Scrub Dense/Continuous (Anguis fragilis) on site 6 Small ditch off main river with Hemlock Water A3.1 Scattered Broadleaved Trees Dropwort (Oenanthe crocata), Water Mint (Mentha aquatic) and Himalayan Balsam (Impatiens 20 SI glandulifera) B6 Poor Semi-improved grassland 7 Seasonally damp ground dominated by Common Nettle P6 (Urtica dioica) with clearing to centre surrounded by C3.1 Tall Ruderal White Willow (Salix alba), older specimens on river SI edge with Wild Cherry (Prunus avium) to east 19 G1 Standing Water 8 Line of mature Poplars (Populus sp.), low bat roost Pond 1 potential further survey required 21 A J1.1 Allotments 22 9 Landscape planting around Park & Ride and retail units of mixed shrubs and trees, well managed with bare A J1.2 Amenity Grassland ground sprayed between planting 6 10 Landscape planting of Dogwood (Cornus sanguinea), P2 J1.4 Introduced Shrub Ivy (Hedera helix), Ash (Fraxinus excelsior) and 8 12 Guelder Rose (Viburnum opulus) 7 J2.6 Dry Ditch 11 Field Maple (Acer campestre), Common Hawthorn SI (Crataegus monogyna), Sycamore (Acer P4 14 J3.6 Building pseudoplatanus) and Goat Willow (Salix caprea) 5 bounding area to A2 15 13 J4 Car Park / Road / Pavement / 12 Pond 2 Cycleway Dominated by Common Nettle (Urtica dioica) with 9 locally abundant Greater Willowherb (Epilobium A 1 hirsutum), frequent Wild Angelica (Angelica sylvestris) P1 Target Notes and occasional Bramble (Rubus fruiticosus agg.) 3 4 P1 13 Dense scrub similar in composition to target note 16 10 Parcel Numbers but self-set 1 2 14 Concrete lined ditch, dry at time of survey, silted up 17 and dominated by Common Nettle (Urtica dioica) and Greater Willowherb (Epilobium hirsutum) 15 Steep bank approximately 1.5-2m high with more P3 grassy area on top with patches of Wild Marjoram 16 (Origanum vulgare), Ox-eye Daisy (Leucanthemum vulgare), Red Fescue (Festuca rubra), Meadow Vetchling (Lathyrus pratensis), Common Sorrel P5 (Rumex acetosa)

16 Mixed native shrub planting of Common Hawthorn, Ash 11 (Fraxinus excelsior), Field Maple (Acer campestre) and Dogwood (Cornus sanguinea), with Bramble (Rubus 18 fruiticosus agg.), Common Nettle (Urtica dioica), Hemlock (Conium maculatum) and Ivy (Hedera helix) 17 Lots of litter B09037 - Thanington Park, Canterbury A 18 Brash piles 19 Species poor Neutral Grassland with frequent Common A2 4th Arm Coastbound Slip Road, Wincheap: Nettle (Urtica dioica) and Docks (Rumex sp.) recently SI 23 Phase 1 Habitat Survey mown at time of survey Figure 02 20 Dry scrapes 21 Pond dominated by Reedmace (Typha latifolia), eDNA Scale: 1:2000 @ A3 test for Great Crested Newts (Triturus cristatus) carried out – Result: Negative August 2017 22 Bank dominated by planted Field Maple (Acer campestre) and Hazel (Corylus avellana) 23 Small area of grassland with Goatsbeard (Tragopogon pratensis), Grass Vetchling (Lathyrus nissolia), Red Fescue (Festuca rubra), Common Cat’s-ear (Hypochaeris radicata), Buckhorn Plantain (Plantago coronopus), Meadow Vetchling (Lathyrus pratensis) and Bee Orchid (Ophrys apifera)

Site Boundary

Survey Areas

1 Location and No. of Reptile Mats

Reptile Species present

Grass snake recorded

Slow worm recorded

NB: locations of refugia and species are indicative

SI P6 Phase 1 Key

Survey Areas

A1.1.1 Woodland Broad-leaved Wet Woodland Semi-natural 9 A1.1.2 Woodland Broad-leaved Plantation Attenuation Basin 1 2 8 3 P2 7 A2.1 Scrub Dense/Continuous SI 27 4 6 5 1 15 30 28 A3.1 Scattered Broadleaved Trees 2 31 26 3 16 29 SI P4 25 Allotments B6 Poor Semi-improved grassland 4 17 24 5 23 14 13 18 12 A C3.1 Tall Ruderal 21 11 P1 6 19 22 10 9 5 G1 Standing Water 20 4 8 7 2 3 7 6 A J1.1 Allotments 1 A J1.2 Amenity Grassland 8 P1 J1.4 Introduced Shrub A2 Verge 9 P3 J2.6 Dry Ditch

P5 10 J3.6 Building J4 Car Park / Road / Pavement / Cycleway 11 P1 Parcel Numbers

12 A B09037 - Thanington Park, Canterbury

13 A2 4th Arm Coastbound Slip Road, Wincheap: SI Reptile Survey Results 14 Figure 01 Scale: 1:2000 @ A3

October 2017

Site Boundary

Tree with low Bat Roost Potential

Tree with high Bat Roost Potential

Tree with negligible Bat Roost Potential A1.1.1 Woodland Broad-leaved Semi-natural A1.1.2 Woodland Broad-leaved Plantation

A2.1 Scrub Dense/Continuous

P6 A3.1 Scattered Broadleaved Trees SI SI B6 Poor Semi-improved grassland

C3.1 Tall Ruderal T2 G1 Standing Water T1 A J1.1 Allotments P2 A J1.2 Amenity Grassland SI J1.4 Introduced Shrub P4 T3 J2.6 Dry Ditch A J3.6 Building P1 J4 Car Park / Road / Pavement / T4 Cycleway P1 Parcel Numbers

B09037 - Thanington Park, Canterbury A A2 4th Arm Coastbound Slip Road, Wincheap: SI Preliminary Bat Roost Assessment - Trees Figure 04 Scale: 1:2000 @ A3

August 2017

Appendix 1

Legislative and policy context There is a number of pieces of legislation, regulations and policies specific to ecology which underpin this assessment. These may be applicable at a European, National or Local level. References to legislation are given as a summary for information and should not be construed as legal advice. Birds Directive The European Community Council Directive on the Conservation of Wild Birds (79/409/EEC), normally known as the Birds Directive, sets out general rules for the conservation of all naturally occurring wild birds, their nests, eggs and habitats. It was superseded by the ‘new’ Birds Directive (2009/147/EC) which generally updated the previous directive. These requirements are interpreted into English law by the Wildlife and Countryside Act 1981 (as amended) with regard to protection of birds, and the Conservation of Habitats and Species Regulations 2010 with regard to the registration and regulation of Special Protection Areas. Habitats Directive The European Community Council Directive on the Conservation of Natural Habitats of Wild Fauna and Flora (92/43/EEC), normally known as the Habitats Directive, aims to protect the European Union's biodiversity. It requires member states to provide strict protection for specified flora and fauna (i.e. European Protected Species) and the registration and regulation of Special Areas of Conservation. These requirements are interpreted into English law by the Conservation of Habitats and Species Regulations 2010 with regard to European Protected Species and the registration and regulation of Special Areas of Conservation. Conservation of Habitats and Species Regulations 2010 The Conservation of Habitats and Species Regulations 2010 interpret the Birds Directive and Habitats Directive into English and Welsh law. For clarity, the following paragraphs consider the case in England only, with Natural England given as the appropriate nature conservation body. In Wales, the Countryside Council for Wales is the appropriate nature conservation body. Special Protection Areas and Special Areas of Conservation are defined in the regulations as ‘European sites’. The Regulations regulate the management of land within European sites, requiring land managers to have the consent of Natural England before carrying out management. Byelaws may also be made to prevent damaging activities and if necessary land can be compulsorily purchased to achieve satisfactory management. The Regulations define competent authorities as public bodies or statutory undertakers. Competent authorities are required to make an appropriate assessment of any plan or project they intend to permit or carry out, if the plan or project is likely to have a significant effect upon a European site. The permission may only be given if the plan or project is ascertained to have no adverse effect upon the integrity of the European site. If the competent authority wishes to permit a plan or project despite a negative assessment, imperative reasons of over-riding public interest must be demonstrated, and there should be no alternative to the scheme. The permissions process would involve the Secretary of State and the option of consulting the European Commission. In practice, there will be very few cases where a plan or project is permitted despite a negative assessment. This means that a planning application has to be assessed by the Local Planning Authority, based on information provided by the applicant, and the assessment must either decide that it is likely to have no significant effect on a European site or ascertain that there is no adverse effect upon the integrity of the European site. Government policy is for Ramsar sites (wetlands of global importance) to be treated as if they were European sites within the planning process. Appropriate Assessment Appropriate Assessment is required in certain instances under the Conservation of Habitats and Species Regulations 2010. Regulation 61 says that: 61.—(1) A competent authority, before deciding to undertake, or give any consent, permission or other authorisation for, a plan or project which- (a) is likely to have a significant effect on a European site or a European offshore marine site

(either alone or in combination with other plans or projects), and (b) is not directly connected with or necessary to the management of the site, must make an appropriate assessment of the implications for that site in view of that site's conservation objectives. (2) A person applying for any such consent, permission or other authorisation shall provide such information as the competent authority may reasonably require for the purposes of the assessment or to enable them to determine whether an appropriate assessment is required. (3) The competent authority shall for the purposes of the assessment consult the appropriate nature conservation body and have regard to any representations made by that body within such reasonable time as the authority may specify. (4) They must also, if they consider it appropriate, take the opinion of the general public, and if they do so, they must take such steps for that purpose as they consider appropriate. (5) In the light of the conclusions of the assessment, and subject to regulation 62 (considerations of overriding public interest), the competent authority shall agree to the plan or project only after having ascertained that it will not adversely affect the integrity of the European site or the European offshore marine site (as the case may be). (6) In considering whether a plan or project will adversely affect the integrity of the site, the authority must have regard to the manner in which it is proposed to be carried out or to any conditions or restrictions subject to which they propose that the consent, permission or other authorisation should be given. The competent authority is typically the local planning authority. The appropriate assessment contains the information the council requires for the purposes of its assessment under the Habitat Regulations. The Habitat Regulations also are applicable to local authority land use plans and policies. If a policy or plan is likely to have a significant effect upon a European site, the permission may only be given if the policy or plan is ascertained to have no adverse effect upon the integrity of the European site. This approach gives rise to a hierarchy of plans each with related appropriate assessments. For example, the appropriate assessment of a Regional Spatial Strategy will affect policies within a Core Strategy, which will then need its own appropriate assessment, and so on. European Protected Species European Protected Species of animals are given protection from deliberate capture, injury, killing, disturbance or egg taking/capture. Their breeding sites or resting places are also protected from damage or destruction, which does not have to be deliberate. A number of species are listed as European Protected Species, with those most likely to be considered in planning applications being bats, dormouse, great crested newt and otter. Natural England may give a licence for actions that are otherwise illegal, subject to them being satisfied on the three tests of no alternative, over-riding public interest, and maintenance of the species in favourable condition. European Protected Species of plant are also listed and given protection. These species are generally very rare and unlikely to be present in proposed development sites. Wildlife and Countryside Act 1981 The Wildlife and Countryside Act 1981 has been amended many times, including by the Countryside and Rights of Way Act 2000. It contains provisions for the notification and regulation of Sites of Special Scientific Interest, and for protected species. The Regulations regulate the management of land within Sites of Special Scientific Interest, requiring land managers to have the consent of Natural England before carrying out management. All public bodies are defined as ‘S28G’ bodies, which have a duty to further the nature conservation of Sites of Special Scientific Interest in the undertaking of their functions. In practice, this prevents planning applications being permitted if they would harm Sites of Special Scientific Interest, as it would be a breach of that duty.

The Act makes it an offence intentionally to kill, injure, or take any wild bird, take, damage or destroy the nest of any wild bird, while that nest is in use or being built, or take or destroy an egg of any wild bird. Special penalties are available for offences related to birds listed on Schedule 1, for which there are additional offences of disturbing these birds at their nests, or their dependent young. The Act makes it an offence intentionally to kill, injure or take any wild animal listed on Schedule 5, and prohibits interference with places used for shelter or protection, or intentionally disturbing animals occupying such places. Some species have lesser protection under this Act, for example white-clawed crayfish, common frog and toads are only protected from sale, and reptile species, other than smooth snake and sand lizard, are protected from intentional killing or injury, but they are not protected from disturbance and their habitat is not protected. It is also an offence intentionally to pick, uproot or destroy any wild plant listed in Schedule 8. National Planning Policy Framework The National Planning Policy Framework dated March 2012 (NPPF) replaces previous Government Policy in relation to nature conservation and planning, which was set out in Planning Policy Statement 9. Paragraph 109 of the NPPF says that the planning system should contribute to and enhance the natural and local environment by minimising impacts on biodiversity and providing net gains in biodiversity where possible. Paragraph 113 describes policy for designated sites, where Local Planning Authorities should set criteria-based policies, against which proposals for any development on or affecting protected wildlife or geodiversity sites or landscape areas will be judged. Further policy is within paragraph 118, where Local Planning Authorities should aim to conserve and enhance biodiversity when determining planning applications by applying the following principles. • If significant harm resulting from a development cannot be avoided (through locating it on an alternative site with less harmful impacts), adequately mitigated, or, as a last resort, compensated for, then planning permission should be refused, • Opportunities to incorporate biodiversity in and around developments should be encouraged. • Planning permission should be refused for development resulting in the loss or deterioration of irreplaceable habitats, including ancient woodland and the loss of aged or veteran trees found outside ancient woodland, unless the need for, and benefits of, the development in that location clearly outweigh the loss. • Paragraph 115 adds protection to biodiversity within areas designated for their landscape value. It says that great weight should be given to conserving landscape and scenic beauty in National Parks, the Broads and Areas of Outstanding Natural Beauty, which have the highest status of protection in relation to landscape and scenic beauty. The conservation of wildlife and cultural heritage are important considerations in all these areas, and should be given great weight in National Parks and the Broads. Government circular ‘Biodiversity and Geological Conservation – Statutory Obligations and their Impact Within the Planning System’ referenced ODPM 06/2005 and Defra 01/2005 has not been replaced and remains valid. It sets out the legislation regarding designated and undesignated sites and protected species, and describes how the planning system should take account of that legislation. It does however pre-date the NERC Act 2006 (see below), which includes a level of protection for a further list of habitats and species regardless of whether they are on designated sites or elsewhere. Natural Environment and Rural Communities (NERC) Act 2006 This Act includes a list of habitats and species of principal importance in England. Local Authorities are required to consider the needs of these habitats and species when making decisions, such as on planning application. Local Planning Authority’s planning policy The Local Planning Authority will have policies relating to biodiversity conservation.

Species Legislation The following table provides an overview of legislation with regard to species.

Legislation The Natural Conservation of Environment & Protected Species Wildlife & Protection of Habitats and Rural Countryside Act, Badgers Act, Species Communities 1981 1992 Regulations, (NERC) Act, 2010 2006

Plants (certain ‘rare’ species) 9 913 9

Invertebrates (certain ‘rare’ 9 914 9 species)

White-clawed crayfish 9 9

Great crested newt, natterjack 9 9 9 toad, pool frog

Other amphibians 915 9

Sand lizard, smooth snake 9 916 9

Other reptiles 917 9

Breeding birds 9 9 9

Wintering birds (certain ‘rare’ 9 9 9 species)

Bats 9 9 9

Dormouse 9 9 9

Water vole 9 9

Otter 9 9 9

Badger 9

13 Nine species present in the UK, with very specialised habitat requirements, are European Protected Species. 14 Fisher’s estuarine moth, large blue butterfly and lesser whirlpool ram’s-horn snail are European Protected Species. 15 The four other native amphibian species (smooth and palmate newts, common frog and common toad) are only protected against trade under this act. 16 Smooth snake and sand lizard are European Protected Species. 17 The four other native reptile species (common lizard, slow worm, grass snake and adder) are protected against intentional killing, injury and trade under this act.

Appendix 2

Assessment Methodology: Valuing Ecological Features and Impact Assessment The three-stage assessment method for determining ecological value is based upon assessment matrices published in the Handbook of Biodiversity Methods18. It has been updated to comply with recent changes to planning policy and legislation. The three-stage process allows the value of ecological sites, habitats and populations, and the magnitude of the impact, to be cross-tabulated to identify impact significance. Valuing ecological sites, habitats and populations: scale and level of value

Scale Level of value Sites, habitats and populations

Statutory sites designated under international conventions or related national legislation, for example: European Very High • Wetlands of International Importance (Ramsar sites), • Special Areas of Conservation, • Special Protection Areas. Statutory sites designated under national legislation, for example:

• Sites of Special Scientific Interest (England, Wales, Scotland), • National Nature Reserves (UK).

Significant viable areas of habitats, or populations or assemblages of species of principal importance for the conservation of biodiversity in England and Wales (Section 41 species and habitats)19 of such size and quality as might qualify for SSSI designation. National High Populations or assemblages of red-isted, rare or legally protected species, as might qualify for SSSI designation, for example:

• species of conservation concern, • Red Data Book (RDB) species, • birds of conservation concern (Red List species), • nationally rare and nationally scarce species, • legally protected species.

Statutory sites of lower conservation value designated under national legislation, for example Local Nature Reserves (UK). Non-statutory sites designated under local legislation, for example: • County Wildlife Sites, • Local Wildlife Sites, County Medium • Roadside Nature Reserves (protected road verges). Viable areas of habitat or populations of species of principal importance for the conservation of biodiversity in England and Wales (Section 41 species and habitats)20 of such size and quality as might qualify for designation at the county level. Other non-designated sites which meet the criteria for designation at this level.

18 Hill, D., Fasham, M., Tucker, G., Shewry, M., Shaw, P. (eds.) (2005) Handbook of Biodiversity Methods: Survey, Evaluation and Monitoring, Cambridge University Press. 19 Listed under S41 of the Natural Environment and Rural Communities Act 2006 http://www.naturalengland.org.uk/ ourwork/conservation/biodiversity/protectandmanage/habsandspeciesimportance.aspx. 20 Listed under S41 of the Natural Environment and Rural Communities Act 2006 http://www.naturalengland.org.uk/ ourwork/conservation/biodiversity/protectandmanage/habsandspeciesimportance.aspx.

Sites meeting criteria for metropolitan designations. Undesignated sites or features not meeting criteria for county designation, but that are considered to enrich appreciably the habitat resource within the local district or borough, for example: • ancient woodland, District/ Lower • diverse, ecological valuable and cohesive hedgerow networks, Borough21 • significant clusters or groups of ponds, • veteran or ancient trees.

Viable areas of habitat or populations of species of principal importance for the conservation of biodiversity in England and Wales (Section 41 species and habitats)22 not qualifying for designation at the county level. Areas of habitat considered to enrich appreciably the ecological resource within the context of the local parish. Parish Lower Small areas of habitat or populations of species of principal importance for the conservation of biodiversity in England and Wales (Section 41 species and habitats)23.

Site only Negligible Ecological feature or resource not meeting any of the above criteria.

Note: there is much overlap in designations and lists of important species, and many sites, habitats and species appear on several. Where a site, habitat or species has multiple designations or levels of protection, normally the highest level would be the level at which impacts are assessed.

21 Including metropolitan boroughs. 22 Listed under S41 of the Natural Environment and Rural Communities Act 2006 http://www.naturalengland.org.uk/ ourwork/conservation/biodiversity/protectandmanage/habsandspeciesimportance.aspx. 23 Listed under S41 of the Natural Environment and Rural Communities Act 2006 http://www.naturalengland.org.uk/ ourwork/conservation/biodiversity/protectandmanage/habsandspeciesimportance.aspx.

Definitions of impact magnitude

Magnitude(negative Definition/trigger or positive)

Loss or severe degradation affecting over 75% of a site feature, habitat or population. Severe Adverse change to, or reduced condition of, over 90% of a site feature, habitat or population, for example through disturbance or trampling.

Loss or severe degradation affecting over 25% of a site feature, habitat or population. Adverse change to, or reduced condition of, over 50% of a site feature, habitat or population, Major for example through disturbance or trampling. For benefits, an impact equivalent in nature conservation terms to a gain of over 50% in a site feature, habitat or population.

Loss or severe degradation affecting over 5% of a site feature, habitat or population. Adverse change to, or reduced condition of, over 10% of a site feature, habitat or population, Moderate for example through disturbance or trampling. For benefits, an impact equivalent in nature conservation terms to a gain of 10-50% in a site feature, habitat or population

Loss or severe degradation affecting up to 5% of a site feature, habitat or population. Adverse change to, or reduced condition of, 1-10% of a site feature, habitat or population, for Minor example through disturbance or trampling. For benefits, an impact equivalent in nature conservation terms to a gain of up to 10% in a site feature, habitat or population.

No loss of or severe degradation to a site feature, habitat or population. Adverse change to, or reduced condition of, less than 1% of a site feature, habitat or Insignificant population. No benefit to a site feature, habitat or population.

Impact significance

Magnitude of impact Severe Value of site, Negative Major Moderate Minor Minor Medium Major habitat or Insignificant Negative Negative Negative Positive Positive Positive population European Severe Severe Major Major Major Major Major Neutral* (Very High) Adverse Adverse Adverse Adverse Beneficial Beneficial Beneficial National Severe Major Major Moderate Moderate Major Major Neutral* (High) Adverse Adverse Adverse Adverse Beneficial Beneficial Beneficial County/Metropolitan Major Major Moderate Moderate Minor Moderate Major Neutral (Medium) Adverse Adverse Adverse Adverse Beneficial Beneficial Beneficial District/Borough Major Moderate Moderate Minor Minor Moderate Moderate Neutral (Lower) Adverse Adverse Adverse Adverse Beneficial Beneficial Beneficial Parish Moderate Moderate Minor Minor Minor Minor Moderate Neutral (Lower) Adverse Adverse Adverse Adverse Beneficial Beneficial Beneficial Minor Minor Moderate Minimal/negligible Neutral Neutral Neutral Neutral Neutral Beneficial Beneficial Beneficial

Where the impact significance falls below Minor Adverse, the term ‘Neutral’ is used. *In some circumstances, some ‘insignificant’ impacts might fail legislative or policy tests and the impact would be greater than Neutral.

Appendix 3

0 GENERAL NOTES: 10 1. THIS DRAWING SHALL BE READ IN CONJUNCTION WITH ALL OTHER RELEVANT CB14.29

14.19 14.10 DOCUMENTATION.

Edge of Vegetation

PA 14.15

2. DO NOT SCALE FROM THIS DRAWING. 20

CE14.28

CB14.35 3. ALL DIMENSIONS ARE IN METRES UNLESS SPECIFIED OTHERWISE. 30 4. DRAWING BASED ON WSP DRAWING 5269-SK02, A2 TOPOGRAPHICAL SURVEY BY MEC AND ORDNANCE SURVEY INFORMATION.

CB14.04 A2 TRUNK ROADPA 13.88

IC 13.85 5. ROUNDABOUT ALIGNMENT TO RETAIL PARK & RIDE SHOWN INDICATIVE AT THIS STAGE 40 Edge of Vegetation

13.83

13.77

50 LEGEND: CE14.06

CB14.15

60 RETAIL PARK PROPOSED CARRIAGEWAY - ASPHALT CONCRETE CONSTRUCTION

Edge of Vegetation

13.52

70 TIE IN TO EXISTING CARRIAGEWAY Edge of Vegetation

13.59

13.49

80 PROPOSED FOOTWAY AND TRAFFIC ISLAND - ASPHALT CONCRETE CONSTRUCTION

CE13.78

CB13.87 90

PROPOSED VERGE 100 Edge of Vegetation

13.35

13.25

FE 13.04 PROPOSED EARTHWORKS EMBANKMENT (1:3)

FE 13.51 FE 12.57

Gate 110 FE 13.42 Edge of Vegetation

CE13.56 EXISTING GROUND TO BE RE-PROFILED CB13.64

IC 13.25 120

PROPOSED CARRIAGEWAY HIGH FRICTION SURFACING

EXIT 130

Edge of Vegetation PETROL STATION EXIT PROPOSED OVER RUN AREA

13.09

13.00 140 PROPOSED TACTILE PAVING AT CONTROLLED CROSSING

CE13.32

CB13.36 Edge of Vegetation

150 PROPOSED TACTILE PAVING AT UNCONTROLLED CROSSING 160 PROPOSED VEHICLE RESTRAINT SYSTEM (CRASH BARRIER)

Edge of Vegetation PROPOSED PEDESTRIAN GUARD RAILINGS 12.90170

12.82

CE13.17 EXIT PROPOSED LIGHTING COLUMN (INDICATIVE LOCATION)

13.14 13.22 180 MORRISONS PROPOSED RED UNIDIRECTIONAL RETROREFLECTING ROAD STUD CB13.19 13.11

13.18 SUPERMARKET PROPOSED AMBER/RED UNIDIRECTIONAL RETROREFLECTING ROAD

190 STUD

IC 12.89 PROPOSED GREEN UNIDIRECTIONAL RETROREFLECTING ROAD 200 STUD

Edge of Vegetation

12.77

12.69 210

EXIT 12.93 DIA 670 DIA 512 13.00

CB13.00 220 (30mph) (bend) 230

Edge of Vegetation

240 WINCHEAP PARK & RIDE

12.59 12.52 ILLUSTRATIVE LAYOUT

450 CB12.88 250

12.76

12.84

TEN PERCH ROAD 260 440

Edge of Vegetation 12.49 270

12.43 430 D RETAIL ACCESSES REVISED 17.08.17 AM TW

CB12.78

12.66 DIA 512 DIA 670 12.74 280 C ROUNDABOUT AND P&R LAYOUTS ADJUSTED 01.08.17 AP AM (bend) (30mph)

420 B LAYOUT UPDATED TO SUIT COMMENTS FROM RSA1 26.04.17 WSW AM 290

12.71 CB12.75 12.63 A ROAD MARKINGS LAYOUT REVISED 12.04.17 WSW AM CB12.70

12.44 Edge of Vegetation 12.50

300 410 Revision DrawnMark ChkdDate Appd

SCALING NOTE: Do not scale from this drawing. If in doubt, ask. 12.34 12.26 UTILITIES NOTE: The position of any existing public or private sewers, utility services, plant or apparatus shown on this CB12.33

310 drawing is believed to be correct, but no warranty to this is expressed or implied. Other such plant or apparatus may also be present but not shown. The Contractor is therefore advised to undertake their own investigation where the presence 400 of any existing sewers, services, plant or apparatus may affect their operations.

CB12.60

12.51 CB12.58 12.59 320 12.57 Drawing Issue Status 12.50 A2 TRUNK ROAD

12.31 APPROVAL 12.37 DIA 515

330 390

Edge of Vegetation THANINGTON FOURTH ARM SLIP ROAD 340

CB12.25

12.24 380

12.18 350

CB12.51 12.43 CB12.51 GENERAL ARRANGEMENT PLAN

12.51 370 12.48 360 EXISTING WING WALL TO A28 OVER BRIDGE 12.41

12.20

12.26

CB12.45 Client

Edge of Vegetation

Soffit 17.81 PENTLAND Soffit 18.07 Soffit

Z2 CB12.29 Soffit 17.95 Edge of Vegetation 17.372 12.28 DIA 515

12.23 HR Soffit 18.31 Soffit

A28 THANINGTON ROAD RS Soffit 18.25 HOMES Ltd

Soffit 18.37 HR

12.46

12.45

SCALE BAR: Date of 1st Issue Designed Drawn 1:500 METRIC 31.03.2017 PG AP Offices throughout Z1 12.25 19.070 12.30 the UK and Europe CB12.38 A1 Scale Checked Approved 50m010m 1:500 AM www.peterbrett.com Reproduced from/based upon Ordnance Survey material with the permission of Ordnance Survey ® Drawing Number Revision © Peter Brett Associates LLP on behalf of The Controller of Her Majesty's Stationery Office. Crown Copyright. © ASHFORD Unauthorised reproduction infringes Crown Copyright and may lead to prosecution or civil proceedings. Soffit 18.36 CB12.51 12.51 12.45 39183/2001/001 Tel: 01233 651 740 Licence No. Year of Publication Owner/Purchaser of Mapping PETER BRETT ASSOCIATES LLP01000316732017 18.37 Soffit D

Soffit 18.37 HR

Soffit 18.38 user name: anthony moore File Location: j:\39183 - th - thanington fourth arm slip\3-autocad\drawings\2001\39183_2001_001.dwg GENERAL NOTES:

1. THIS DRAWING SHALL BE READ IN CONJUNCTION WITH ALL OTHER RELEVANT DOCUMENTATION.

2. DO NOT SCALE FROM THIS DRAWING.

3. ALL DIMENSIONS ARE IN METRES UNLESS SPECIFIED OTHERWISE.

4. DRAWING BASED ON WSP DRAWING 5269-SK02, A2 TOPOGRAPHICAL SURVEY BY MEC AND ORDNANCE SURVEY INFORMATION.

CB14.88

14.83

14.75 LEGEND:

CB14.48

14.43 14.37 DEVELOPMENT AREA

Edge of Vegetation (AREA 3.385HA)

CE14.58

CB14.68

CB14.29

14.19

14.10 Edge of Vegetation

PA 14.15

CE14.28 RETAIL PARK CB14.35

CB14.04

PA 13.88

IC 13.85 A2 TRUNK ROADEdge of Vegetation

13.83

13.77

CE14.06

CB14.15

Edge of Vegetation

13.52

Edge of Vegetation

13.59

13.49 PETROL

CE13.78 CB13.87 STATION

Edge of Vegetation

13.35 FE 13.04 13.25

FE 12.57

FE 13.51

Gate

Edge of Vegetation

FE 13.42

IC 13.25 CE13.56

CB13.64

Edge of Vegetation

13.09 13.00 MORRISONS

Edge of Vegetation

CE13.32 SUPERMARKET CB13.36

Edge of Vegetation

12.90

12.82

CE13.17

13.14

13.22

CB13.19 13.11

13.18

IC 12.89

Edge of Vegetation

12.77

12.69

TEN PERCH ROAD

12.93

13.00 CB13.00 WINCHEAP PARK & RIDE

Edge of Vegetation

12.59

12.52

D PLANNING BOUNDARY REVISED 21.08.17 AM RJE CB12.88 12.76

12.84 C PLANNING BOUNDARY AMENDED 18.08.17 AM TW

Edge of Vegetation

12.49 12.43 B ISSUED FOR INFORMATION 20.07.17 AM TW

CB12.78 12.66 12.74 A BOUNDARY ADJUSTED 19.06.17 AM TW

CB12.75 Revision DrawnMark ChkdDate Appd 12.71 Edge of Vegetation

12.63

CB12.70

12.44 12.50 SCALING NOTE: Do not scale from this drawing. If in doubt, ask. 12.34

12.26 CB12.33 UTILITIES NOTE: The position of any existing public or private sewers, utility services, plant or apparatus shown on this drawing is believed to be correct, but no warranty to this is expressed or implied. Other such plant or apparatus may also be present but not shown. The Contractor is therefore advised to undertake their own investigation where the presence

CB12.60 12.51

CB12.58 12.59 12.57 of any existing sewers, services, plant or apparatus may affect their operations. 12.50 A2 TRUNK ROAD

RS 12.31 Edge of Vegetation Drawing Issue Status 12.37

CB12.25

12.24 12.18 INFORMATION

12.43 CB12.51

CB12.51 12.51

12.48 12.41 THANINGTON FOURTH ARM SLIP ROAD

Edge of Vegetation

12.20

HR 12.26

Edge of Vegetation CB12.45

HR CB12.29

12.28

12.23 HR RS Soffit 18.07 Soffit 18.31 Soffit 18.37 Soffit 17.95

Soffit 18.25 HR

Soffit 17.81

12.46 A28 THANINGTON ROAD 12.45 DEVELOPMENT BOUNDARY PLAN

Z1 19.070

12.25

12.30

CB12.38

CB12.51 12.51

12.45

HR Soffit 18.36 Client Soffit 18.37 Soffit 18.37 Z2 Soffit 18.38

17.372 Soffit 18.38

CB12.78 12.70 Soffit 18.29

CB12.74 12.78 HR PENTLAND 12.75

12.68 CB12.71 HOMES Ltd

12.48 CB12.64 12.55 Edge of Vegetation

HR IC 12.95

12.93

12.85

Date of 1st Issue Designed Drawn

13.10

13.17

HR CB13.22 15.06.2017 PG AM

Edge of VegetationEdge Vegetation IC 13.20 BoB 13.50 13.21 Offices throughout 13.14 CB13.23 the UK and Europe Edge of Vegetation A2 Scale Checked Approved

SCALE BAR: 12.89 12.97 Edge of Vegetation

CB13.05 1:1000 www.peterbrett.com

1:1000 13.49 BoB 13.38 METRIC Reproduced from/based upon Ordnance Survey material with the permission of Ordnance Survey ® 13.42 Drawing Number Revision © Peter Brett Associates LLP on behalf of The Controller of Her Majesty's Stationery Office. Crown Copyright. © ASHFORD

Unauthorised reproduction infringes Crown Copyright and may lead to prosecution or civil proceedings. BoB 13.40 50m 0 13.66 100m50m 39183/2001/SK17 D Tel: 01233 651 740 Licence No. Year of Publication Owner/Purchaser of Mapping PETER BRETT ASSOCIATES LLP01000316732017 13.74

MH CB13.74 user name: anthony moore File Location: j:\39183 - th - thanington fourth arm slip\3-autocad\drawings\2001\sketches\39183-2001-sk017.dwg

Appendix 4

Highways S278 - 4th Arm Planting PlanInsert 1 1:500@ A1 1:500@ A1 SPECFICATION NOTES

1. The contractor shall be responsible for checking the location of existing services and is responsible for ensuring that services are not damaged.

2. All groundworks and planting operations shall be in accordance with the following British Standards: BS 3936: Part 1 (1992) Nursery Stock - Specification for Trees and Refer to Insert Shrubs Part 4 (2007) Nursery Stock - Specification for Forest trees, poplars and willows 1 for red line BS 4428 (1989) Code of Practice for General Landscape Operations (excluding Hard Surfaces) boundary BS 3882 (2015) Specification for topsoil 3. All plants shall be supplied in accordance with the National Plant Specification, by nurseries accredited by the Horticultural Trade Association. Native plants to be sourced locally in accordance with Forestry Commission's Provenance Area 40. All container grown plants to be grown and supplied in peat-free compost.

4. All areas of proposed planting and seeding to be cleared of: building debris, stones, brick and concrete over 50mm in diameter; contamination; and soils unsuitable for landscape purposes. These should be removed from site.

5. Topsoil depths to be:- 150mm for grass areas; 450mm for shrub areas and 300mm fo native shrub and tree mix. Topsoil for tree pits to be 900 x 900 x 600mm deep. Topsoil to be multi-purpose grade to BS 3882:2015 and free of all contaminants.

6. BR transplants or cell grown plants within mixes to be notch planted in a 'T notch' ensuring roots of plants are distributed evenly within notch and not compacted. Ensure plants are planted at their natural level and firmly healed in. If the root system is too big for the notch the plant must be pit planted.

7. All shrubs and trees within Shrub and Tree Mix to to have individual Tubex Shrub Shelters 60x130-160cm as supplied by green-tech, supported by a timber stake 25x25x750mm long. Protection to be installed immediately after planting.

8. Individual Feathered trees within mixes to be pit planted in pits 300x300x300mm and have 8L of peat-free tree and shrub planting compost, incorporating within base of pit and backfill material. Feathered trees to be supported by 1No. 50mm dia x 1200mm long stakes set vertical with 600mm above ground level, tied with 1 No Rainbow Mini tree tie with spacer as supplied by Green-tech or similar approved. All feathered trees to have individual spiral rabbit guards installed immediately after planting.

9. Individual containerised shrubs to be pit planted in pits 300x300x300mm and have 8L of peat-free tree and shrub planting compost, incorporating within base of pit and backfill material. Shrub beds to be mulched with 75mm depth of ornamental grade bark mulch.

10. Individual 14-16cm trees to be planted in pits 900x900x600mm deep and have 40L of peat-free tree and shrub planting compost, incorporating within base of pit and backfill material. Trees to be supported by 2No 75mm dia x PLANTING SCHEDULE 1500mm double stake, cross-bar and tie 1m above ground. Trees supported against cross bar with a rubber flat back block with rubber tie belting nailed to rear of cross bar. All trees to have individual spiral rabbit guards installed immediately after planting.

11. Mixed Hedgerows to be notch planted in a 1.0m wide cultivated strip 300mm deep. Ensuring plants are planted at their natural level and firmly healed in. If the root system is too big for the notch the plant must be pit planted. All hedgerow plants to have individual spiral rabbit guards supported by a timber cane installed immediately after planting. Hedgerow to be mulched with 75mm depth of ornamental grade bark mulch.

12. Single species Hedgerows to be notch planted in a 1.0m wide cultivated strip 300mm deep. Ensuring plants are planted at their natural level and firmly healed in. If the root system is too big for the notch the plant must be pit planted. Hedgerow to be mulched with 75mm depth of ornamental grade bark mulch. Plants to have individual spiral rabbit guards supported KEY by a timber cane installed immediately after planting. 13. Grass Seed mix for verges and beneath Native Tree and shrub mix Masterline PM 85 DOT (DOT Official Mix) as supplied by DLF Seeds and Science www.dlf.co.uk sown at 20g/m2

14. All plant stations within Mixes are to be maintained weed free for a diameter of 900mm. All hedgerows and shrub beds to be maintained weed free.

15. Maintenance shall be carried out regularly to all proposed grass areas. Mowing operations shall be carried out to maintain a height of 100mm max.

16. Any dead or diseased plants shall be replaced during the immediate following planting season.

Number DateByRevision

Project Bedford 01234 261315 Thanington Park, Canterbury Woodbridge 01394 380509 London 020 7252 0002 Norwich 01603 230777

Drawing Job No. B09037 Highways S278 - 4th Arm Planting Dwg. No. 130 Planting Proposals Scale 1:200@ A1 Drawn DT Status Checked JB DRAFT Date 02.10.2017

Do not scale off drawing. All dimensions & Levels are to North be checked on site. Any discrepancies must be reported to the landscape architect immediately. Copyright THE LANDSCAPE PARTNERSHIP LTD

Appendix 5

Analytical and methodological development for improved surveillance of the Great Crested Newt

WC1067

Appendix 5. Technical advice note for field and laboratory sampling of great crested newt (Triturus cristatus) environmental DNA This report should be cited as: Biggs J, Ewald N, Valentini A, Gaboriaud C, Griffiths RA, Foster J, Wilkinson J, Arnett A, Williams P and Dunn F 2014. Analytical and methodological development for improved surveillance of the Great Crested Newt. Appendix 5. Technical advice note for field and laboratory sampling of great crested newt (Triturus cristatus) environmental DNA. Freshwater Habitats Trust, Oxford.

Version Control

Document date: 30 September 2014 Version Number: 1.1

2 Document date: 30 September 2014 Version Number: 1.1 Contents

1. Scope of document ...... 4 2. Quality assurance and quality control ...... 4 2.1 Laboratory standard ...... 4 2.2 Sample acceptance ...... 5 2.3 Stability of field sampling kits ...... 5 2.4 Outcome required ...... 5 2.5 Identification of risks of false positives and false negatives ...... 5 2.6 Laboratory specifications ...... 7 3. Field protocol ...... 10 3.1 Sampling equipment ...... 10 3.2 Field water sample collection protocol ...... 11 4. Laboratory protocol ...... 12 4.1 Introduction ...... 12 4.2 Analytical methods ...... 12 5. Data recording and reporting ...... 14 5.1 Sampling information ...... 14 5.2 Laboratory data ...... 14 6. References ...... 15 Appendix 1. Frequently asked questions about eDNA sampling from volunteer and non-specialist surveyors ...... 16 Appendix 2 Details of primers and probes ...... 17

3 Document date: 30 September 2014 Version Number: 1.1 1. Scope of document

Environmental DNA (eDNA) is nuclear or mitochondrial DNA that is released from an organism into the environment. Sources of eDNA include secreted faeces, mucous, and gametes; shed skin and hair; and carcasses. In aquatic environments, eDNA is diluted and distributed in the water where it persists for 7–21 days, according to the detection limits of qPCR approaches and associated fragment sizes, and depending on environmental conditions (Biggs et al. 2014). Recent research has shown that the DNA from a range of aquatic organisms can be detected in water samples at very low concentrations using qPCR (quantitative Polymerase Chain Reaction) methods.

This document provides technical advice for laboratories and field staff collecting and analysing samples for qPCR analysis of great crested newt (Triturus cristatus) environmental DNA. The document:

• Sets out the standards required

• Sets out field and laboratory approaches for screening the presence/absence of the great crested newts

• Is designed to deliver a consistent approach, and hence comparable data, between laboratories for use in decision making.

Deviations from this protocol will need to demonstrate equivalence.

This document is based mainly on research undertaken during Defra project WC1067 “Analytical and methodological development for improved surveillance of the great crested newt” (Biggs et al. 2014). We advise that this report is used as a reference document for those carrying out great crested newt surveys using the methods described here.

2. Quality assurance and quality control

The methods described in this technical advice note are designed to reduce as far as possible the risk of field or laboratory generated false positive and false negative results. Quality control measures must be extended to sample collection, preservation and handling, as well as laboratory protocols, since assurances of sample quality will prove critically important to the avoidance of false negatives.

The field of aquatic eDNA is developing rapidly and it is likely that, as methods evolve, appropriate updates will need to be made to the processes detailed in this technical advice note.

2.1 Laboratory standard

Laboratories undertaking eDNA analysis should be able to demonstrate adequate quality assurance standards. Typically these will comprise a documented quality management system which would usually follow, or be equivalent to, the outline of ISO/IEC 17025 standard.

Ultimately it may be necessary to develop a proficiency testing scheme for eDNA analysis to enable the identification of laboratories certified as achieving the appropriate level of proficiency with the eDNA methods. At present a proficiency testing scheme for eDNA is not available because an appropriate proficiency testing methodology has not been established. Further research and development work will be needed to establish such a scheme.

In the meantime, agencies and organisations may wish to include samples from ponds known to support great crested newt and samples from sites known to be free from great crested newts to validate sampling programmes.

4 Document date: 30 September 2014 Version Number: 1.1 2.2 Sample acceptance

The laboratory analysing eDNA water samples should have a standard and documented sample acceptance procedure in place. This should include:

• Date and time of sample receipt • Sample condition (i.e. has the sample container been damaged in any way) • A visual verification of the sample volume (to detect any leakages) • A note to confirm appropriate handling in transit (e.g. courier packaging intact).

The receiving laboratory should transfer the sample number to the sample acceptance record at this point.

2.3 Stability of field sampling kits

The stability of field sampling kits should be assessed through the use of an appropriate artificial DNA marker to check for unexpected decay of DNA between sampling and sample analysis. Details of the marker used, expected rates of decay and actual decay rates should be published alongside eDNA results for the target species. The marker can be chosen by the laboratory or the marker used in WC1067 can be purchased from Spygen.

2.4 Outcome required Biggs et al. (2014) achieved a Limit of Quantification of 3 * 10-3 ng/L: at present there is no evidence that great crested newt eDNA can be quantified with precision and accuracy below this level. Failure to achieve detection at this limit will lead to increased risk of false negative results for sites where great crested newt occur at low density. There should be no detection of closely related species. In the case of the great crested newt in the UK, the risk is mainly of detecting the Italian crested newt (Triturus carnifex) which is present at a few of locations. The primers and probe were also tested on tissue samples of marbled newt (Triturus marmoratus). None of these samples were amplified, confirming the suitability of the primer pair and probe for the great crested newt. The primers and probe also did not bind with the DNA of other UK native newts (smooth and palmate newt) which are in the genus Lissotriton.

2.5 Identification of risks of false positives and false negatives

There are risks of both false positives and false negatives in eDNA analysis (Darling and Mahon, 2011). Errors can occur in both field and laboratory stages of the work. Given the test’s sensitivity it appears that the main risk from contamination will be from false positives.

The main risks, and their mitigation for great crested newt eDNA work, are:

(i) Molecular assay design: mitigated in research and development phase of primer and probe design. Salt free primers should be used. The quality of the primer and of the PCR mix is assured by the standards.

(ii) Laboratory quality control: mitigated by laboratory design and process control.

(iii) Sampling design: mitigated by site selection procedures in field monitoring programmes.

(iv) Uncertainty in the relationship between presence of target DNA and presence of viable target organisms: mitigated partially by research so far undertaken, and by future research increasing knowledge of great crested newt eDNA.

Table 1 summarises information on situations which may have an increased risk of generating false negatives and false positives, and potential ways to mitigate these risks. For the field sampling protocol, the risk of contamination may be greater for specialist contractors undertaking large numbers of great crested newt surveys compared to volunteers making infrequent visits to a small number of sites.

5 Document date: 30 September 2014 Version Number: 1.1 Table 1. Risk, and mitigation, of false positives and false negatives

Risk factor Mitigation

Field-based false positives

Cross contamination between Ensure that there is no contact between contaminated material sites (due to equipment, clothing and the water being preserved in the sampling process. etc.). Inflows, bringing eDNA from sites This risk cannot be eliminated at present and its extent is not with newts into unoccupied understood. Where ponds have inflows, survey teams will have ponds. Note that there is so far to make judgements about the likely impact of any inflow. little evidence that this is a However, the majority of great crested newt ponds lack significant problem but it is a substantial inflows. The presence/absence of inflows, and theoretical possibility. whether they are wet or dry at the time of survey should be recorded in field notes. Aquatic animals (e.g. herons, This risk cannot be eliminated and the extent to which it occurs is water voles) transferring newt currently unknown. Further research will be required to assess DNA between sites (e.g. in whether this is a significant risk, although at present it seems faeces, in water trapped in fur) likely to be small.

Field-based false negatives

Low numbers of newts This risk is minimised by following good field protocol. Note that at present the minimum number of newts that can be detected in different waterbodies is not known. However, ponds with torch counts of zero animals in the breeding season, where newts were known to be present, have provided positive eDNA results in the breeding season. Very wide, shallow drawdown To access deeper water areas it is possible that the water zones may increase the likelihood sampler could be added to a long pole. It is important not to of collecting water samples in enter the water as sediments will be disturbed which may areas where there has been no contain historical great crested newt DNA. Further research data newt activity even though the on sediment DNA is likely to be available within 6-12 months to pond is currently occupied. refine understanding of this issue. In all water depths it is necessary to gently stir the water throughout its depth, without disturbing sediments, as eDNA is believed to sink. It is advisable to avoid sampling very shallow water (less than 5-10 cm deep) as it may be difficult to avoid stirring up sediment in these areas. There is evidence that DNA is Avoid sampling in these areas: sample from water in areas less likely to be detected in water where vegetation is suitable for egg-laying and open water areas taken from densely packed mats suitable for displaying. of vegetation; either because of a lack of newt activity or because of the difficulty of sample collection in these areas. There is evidence that eDNA is Every effort should be made to access 20 sites around the pond less likely to be detected if the for sampling. Sites where 80-90% of pond margins were whole pond perimeter is not accessed achieved 99.3% detection rates. Attaching the sampled. sampling ladle to an extension pole may be an option for reaching a wider range of areas. Effective cleaning of the extension pole between sites is essential. The pole must be kept separate from any equipment that is in contact with newts.

6 Document date: 30 September 2014 Version Number: 1.1 Table 1 (cont). Risk, and mitigation, of false positives and false negatives

Risk factor Mitigation

Laboratory false positives

Contamination of eDNA sampling Mitigation is largely ensured by good laboratory design, set-up kits. and processes, particularly separation of the sample preparation room from all other stages of the process. Contamination during DNA Mitigation is largely ensured by physical separation of the amplification. different stages of the PCR process, use of dedicated equipment and lab coats for each stage and a uni-directional work flow from clean to DNA contaminated rooms. The risk of contamination in the Mitigation is largely ensured by good laboratory design, set-up laboratory is likely to be greatest and processes. It is to be expected that handing of smaller when larger numbers of samples batches of samples (i.e. <20 samples), in single trials, will be (>20) and multiple batches of easier than larger throughput operations. samples are handled.

Laboratory false negatives

Very low eDNA concentrations. Samples with DNA amounts below the Limit of Detection will generate false negatives. It is not currently possible to mitigate this risk.

2.6 Laboratory specifications

2.6.1 How the laboratory should be set up

The set-up of an eDNA laboratory should broadly follow the outline below. Note that this is not a detailed specification for building a laboratory: rather it provides guidance on the standard which is needed.

Successful eDNA work has so far been undertaken both in laboratories designed to standards established over the last 20 years for ancient DNA (aDNA) work (Knapp et al., 2012), and in more conventional DNA labs. There is as yet no evidence available to evaluate whether these different set-ups produce different results.

The main principles of the laboratory set-up should be (PHE, 2013):

● Physical separation of pre and post-PCR work: to prevent amplified DNA from contaminating samples there should be physical separation of pre and post PCR stages of the work. This should include separation of the area where sampling kits are prepared.

● Unidirectional workflow: The arrangement of activities in the rooms should be unidirectional to reduce potential for contamination. This can be achieved by physically having one room leading to another or by set working practices.

Two potential layouts of facilities based on existing constructed systems are exemplified below (Figure 1). The simpler design has some recognised limitations which are noted in the figure. Good results are known to have been produced in higher specification laboratories. The main features of the designs are:

7 Document date: 30 September 2014 Version Number: 1.1 ● Reagent preparation clean room: a clean DNA free room is needed for the preparation of field sampling kits. Samples containing DNA should never be brought into this room and no DNA extractions or PCRs are performed in this room1.

● Nucleic acid extraction room: the only area where DNA extractions are performed, and an area where PCR products and stocks of cloned material have not been handled.

● Amplification room: this is the area where PCR machines are housed. The schematic designs shown in Figure 1 fulfil these criteria.

2.6.2 Appropriate precautions to avoid laboratory contamination

As PCR products are ubiquitous in post-PCR laboratories it is important to make sure that no consumables or equipment for the DNA facility have been sourced from laboratories which undertake post-PCR amplification analysis.

Full body suits have been adopted by some eDNA laboratories for work in the sample kit preparation room and the eDNA sample preparation room, including full body suit, face masks, face shields and hairnets. In other rooms disposable laboratory coats are sufficient. Dedicated clean room shoes are useful to reduce carry-over contamination. Wearing two pairs of gloves will prevent exposure of skin when changing gloves. However, not all laboratory managers consider ‘suiting-up’ necessary, preferring separation of staff as the contamination control method (i.e. staff do not move between pre- and post-PCR laboratories). Those working with full body suits regard this approach as good practice for rare DNA work which generally reduces the amount of DNA present in the rooms to very low levels. Face masks reduce the breathing out of DNA which has been inhaled outside the clean rooms.

To reduce the risk of DNA contamination regular bleaching of the laboratory should be undertaken weekly. qPCR work should be undertaken inside a cabinet with UV light and in a room which is also lit by UV light outside the cabinet; to control aerosol DNA. Although UV lights are widely recommended for decontamination they need to be high power and close enough to the surface for decontamination to be effective and only then for low level contamination - cleaning and liquid decontamination is more effective (for detailed discussion see Champlot et al., 2010). They are also used in some laboratories to keep levels of environmental DNA low, including UV irradiating the facility when it is not in use.

Dedicated laminar flow hoods and fume hoods for DNA extraction and manipulation can reduce the risk of contamination still further. However, note that laminar flow hoods and fume hoods can under some circumstances make contamination worse by circulating contaminating aerosols around the laboratory. Most PCR hoods either do not have air flow, or are used switched off, providing a dedicated work station that is contained and can be easily decontaminated.

Further useful features are a positive pressure system and HEPA-filtered air conditioning. Some teams regard positive and negative pressure as desirable features to control contamination effectively. However, others suggest that procedural aspects are more important. At present it is not possible to tell which of these positions is correct. The more stringent standards of ancient DNA workers normally include positive / negative pressure and several successful laboratories working with eDNA have used this set-up. However, other groups have produced published results (e.g. Pilliod et al., 2013) without such systems. A highly specified laboratory (e.g. a forensic laboratory) may also have dedicated staff for each area because people are a major source of contamination. Vestibules with shoe/coat changing are effective techniques to prevent transfer of DNA in a highly specified laboratory, but can be adopted less expensively in less well specified laboratories by having dedicated shoes and coats for each laboratory.

1 It is possible that a Class II cabinet in a non-DNA free room could be used for this step. If this approach is used it would be advisable for laboratories to demonstrate that this process did not lead to contamination of sample test kits. Cabinets are at risk of contamination from DNA aerosols which can be present in DNA laboratories even with UV lighting.

8 Document date: 30 September 2014 Version Number: 1.1 Figure 1. Examples of laboratory specifications proposed or in use for eDNA work.

Laboratory layout based on Example of a more highly specified standard recommendations for laboratory based on standards PCR work typical for ancient DNA studies.

This approach was not used in the Defra WC1067 This approach was used in the Defra WC1067 project project, and could increase the risk of false positive results.

Reagent preparation room i.e. for water Sampling kit preparation room for sampling kit preparation. preparing the water sampling kits. This is a "DNA free zone": samples containing Rooms may be equipped with UV lights DNA are never brought into the room and to disrupt stray DNA (see note on no DNA extractions or PCRs are decontamination in Section 2.6.2) performed there.

This room is subject to positive pressure (to prevent entry of DNA) and is equipped with UV lights (see note 2.6.2). It is not yet clear that both steps (a) and (b) below can be undertaken in the same room, even with work area division. This set-up could lead to contamination of samples. Sample preparation room, the only

location at the facility where eDNA Sample preparation room i.e. DNA samples (rare or degraded DNA) are extraction and PCR set-up. extracted.

This area could be divided into two In highly specified facilities this room is subject to positive pressure. distinct areas (e.g. by flow hoods) for:

(a) sample preparation and negative controls (but note that flow hood would need to A "classical" DNA room, where contain a large centrifuge which may be extraction from tissues and swabs are impractical) performed. The room has a dedicated

(b) for positive control preparation (i.e. PCR chamber where the standards are tissue and swab extraction). added to the qPCR plate.

There is evidence that flow hoods may release Separation of the room where eDNA samples are DNA aerosols into the room, even with UV prepared from the room where qPCR standards treatment. We do not at present recommend are prepared reduces the risk of one this approach and laboratories using this design contaminating the other. should test that aerosol contamination is not occurring.

Amplification room where the qPCRs are performed.

Amplification room i.e. qPCRs are In highly specified facilities this room is subject to performed in this room. negative pressure (i.e. air enters but cannot leave). Alternatively it could also be in a separate building to prevent escape of amplified DNA to 9 Document date: 30 September 2014 Version Number: 1.1 earlier preparation stages.

10 Document date: 30 September 2014 Version Number: 1.1 3. Field protocol

Field sampling should be undertaken by a suitably trained and experienced great crested newt surveyor (trained volunteer or professional). At present it is believed that eDNA water sampling does not disturb newts enough to justify the procedure being licensed by the national regulatory authority.

A single visit to the target pond should be made between mid-April and June, during the newt breeding season. eDNA samples can be collected at any time of day and in any reasonable weather conditions, including light rain. It may be best to avoid heavy rain as this makes sampling more difficult and might increase the risk of cross contamination (e.g. splashing of mud which could contain great crested newt DNA from wet ground). There is evidence that unpreserved amphibian eDNA decays slightly more quickly in full sun than shaded conditions, becoming undetectable after 8 and 11 days respectively (Pilliod et al., 2014), but as long as samples are preserved the impact on detection should be slight.

3.1 Sampling equipment

The field sampling equipment used by Biggs et al. (2014) has five components (Figure 2): • A sterile 30 mL ladle • A sterile self-supporting Whirl-Pak plastic bag with 1 L capacity • A sterile 10 mL pipette to resample the pond water • Six sterile 50 mL centrifuge tubes containing preservative (Absolute Ethanol (200 Proof), Molecular Biology Grade, Fisher BioReagents (Product Code: 10644795), sodium acetate and other markers) • Two pairs of sterile gloves.

Figure 2 Sampling equipment used for eDNA water samples by Biggs et al. (2014)

Sterile plastic ladle Two pairs of sterile gloves

Self-supporting plastic bag to hold water Six individually sample during labelled sample tubes collection for preserving eDNA

Sterile plastic pipette

11 Document date: 30 September 2014 Version Number: 1.1 Kits can be stored at room temperature before use in an appropriate solvent store, consistent with Home Office regulations, and should be used within about two weeks of receipt. The time between kit receipt and use should be noted (see Section 5.1). Use one kit per pond up to an area of 1 ha. Beyond this, use an additional kit per hectare. However, note that as yet there is no practical experience of the effectiveness of kits used on ponds greater than 1 ha in area. Note that sampling techniques are still developing rapidly in this field and alternative preservatives to ethanol are currently being sought.

3.2 Field water sample collection protocol

The field sampling protocol should follow the steps outlined below. Gloves should be worn at all times during the sampling process, replacing the gloves between sample collection from the pond and pipetting into the sterile sub-sample tubes. Samples should be collected without entering the water, i.e. the surveyor stands only on the pond bank or muddy pond edges. This prevents disturbance of the substrate and may limit cross-contamination.

Stages of field sampling protocol

Step 1 Identify where 20 samples will be taken from the pond. The location of sub-samples should be spaced as evenly as possible around the pond margin, and if possible targeted to areas where there is vegetation which may be being used as egg laying substrate and open water areas which newts may be using for displaying.

Step 2 Open the sterile Whirl-Pak bag by tearing off the clear plastic strip c 1cm from the top (along the perforated line), then pulling the tabs. The bag will stand-up by itself.

Step 3 Collect 20 samples of 30 mL of pond water from around the pond (see 1 above) using the ladle (fill the ladle), and empty each sample into the Whirl-Pak bag. At the end the Whirl-Pak bag should be just under half full (600 mL).

NOTE: Before each ladle sample is taken, the pond water column should be mixed by gently using the ladle to stir the water from the surface to close to the pond bottom without disturbing the sediment on the bed of the pond. It is advisable not to sample very shallow water (less than 5-10 cm deep).

Step 4 Once 20 samples have been taken, close the bag securely using the top tabs and shake the Whirl-Pak bag for 10 seconds. This mixes any DNA across the whole water sample.

Step 5 Put on a new pair of gloves to keep the next stage as uncontaminated as possible.

Step 6 Using the clear plastic pipette provided take c15 mL of water from the Whirl-Pak bag and pipette into a sterile tube containing 35 mL of ethanol to preserve the eDNA sample (i.e. fill tube to the 50 mL mark). Close the tube ensuring the cap is tight.

Step 7 Shake the tube vigorously for 10 seconds to mix the sample and preservative. This is essential to prevent DNA degradation. Repeat for each of the 6 conical tubes in the kit. Before taking each sample, stir the water in the bag to homogenize the sample - this is because the DNA will constantly sink to the bottom.

Step 8 Empty the remaining water from the Whirl-Pack bag back into the pond.

Step 9 The box of preserved sub-samples is then returned at ambient temperature immediately for analysis. If batches of samples are collected and stored prior to analysis they should be refrigerated at 2-4° C. Kits can be stored for up to one month in a refrigerator before analysis. It is not necessary to freeze samples. Freezing may damage storage bottles, which can lead to leaking during transit, and also unnecessarily increases costs by requiring refrigerated transport. The length of time eDNA samples are stored in a refrigerator prior to analysis should be recorded and passed on to the analysing laboratory. Use an appropriate labelling system to ensure that the kits are supplied with a unique reference number.

12 Document date: 30 September 2014 Version Number: 1.1 4. Laboratory protocol

4.1 Introduction

This section describes the laboratory protocol for analysis of eDNA samples. It is assumed that laboratory staff are familiar with the techniques for using the proprietary products specified.

It is important that the analysing laboratory has no prior knowledge of whether sites being tested do or do not have newts. Samples should be identified only by a unique reference number which contains no site identifying information.

4.2 Analytical methods

Primers and probes

Great crested newt (Triturus cristatus) DNA should be amplified using the primers and probes listed in Appendix 2. They amplify a fragment of the mitochrondrial cytochrome oxidase I gene (cytb). It may be desirable for laboratories undertaking analyses to demonstrate that these primers and probes have been tested in vitro against real great crested newt tissue (which can be collected by external swabbing), and in situ from real ponds with great crested newts (unless they have already undertaken eDNA work with great crested newts). There are a number of amphibian biologists around the UK who have licenses to swab newts and they can be contracted to do this work. An alternative approach to standardisation is to purchase synthetic DNA.

Water

Water used in eDNA analysis should be ultrapure water for molecular biology grade, which can either be purchased or made in the laboratory, using proprietary equipment.

1. DNA extraction

DNA should be extracted using the DNA Blood and Tissue kit (Qiagen®) following the manufacturer’s instructions.

Step 1 For each sample from a site, the six subsamples per site should be centrifuged at 14000 x g1, for 30 minutes, at 6 °C and the supernatant discarded.

Step 2 360 µL of ATL Buffer from the DNeasy Blood & Tissue Extraction Kit (Qiagen®) is added to the first tube, the tube is vortexed for several minutes (time depends on degree of film accumulation on tubes) and the supernatant poured into the second tube. This operation is repeated for all the six tubes, resulting in the 6th tube containing the ATL buffer that has been vortexed sequentially in each of the six sample tubes. Vortexing is needed to remove films of DNA which become attached to the tubes at high centrifuge speeds. Flicking the tube or pipetting have not been found sufficiently vigorous to remove these films. Other kits may be suitable for this step but would need to be evaluated, perhaps as part of a proficiency testing process.

Step 3 The supernatant in the sixth tube, containing the DNA concentrated from all 6 sub- samples, is transferred to a 2 mL tube and the DNA extraction performed following the manufacturer’s instructions. The DNA extraction should be performed in the room or laboratory area dedicated for degraded DNA samples.

Step 4 An extraction control should be performed at the same time to monitor possible

1The centrifugation speed suggested originally by Ficetola et al. (2008) was 5500 x g. Internal tests made by Spygen indicated that better results were found with the highest centrifugation speed, which led to the adoption of 14,000 x g for the Great Crested Newt DNA extraction. 13 Document date: 30 September 2014 Version Number: 1.1 laboratory contamination. The extraction control is undertaken using an 11th tube containing buffers alone and no sample (i.e. no alcohol mix and no pond water). Note that the quality of the alcohol (i.e. absence of DNA contamination) is assessed with the negative controls in the field. These can be either out of range sites where great created newts are definitely absent or sites within the newt’s range where there is high certainty that newts are absent. If no negative field sites are available in a study, a different approach may be needed. In the analytical process the extraction control sample is, from Step 4 onwards, processed as a normal sample.

Additional control samples may be added to the process depending on where it is believed contamination may be originating.

2. qPCR

Step 5 DNA inhibition should be tested by adding a known amount of an artificial gene tothe sample and running qPCR in duplicate. If a different than expected Ct2 value is observed in a least one replicate, the sample should be considered inhibited. In this instance dilute the sample twice before amplification with great crested newt primer and probes.

Step 6 qPCR analysis. Each sample should be run in 12 replicates. A dilution series of T. -1 -1 -4 -1 -1 -2 -3 -4 cristatus DNA, ranging from 10 ng µL to 10 ng µL (increments 10 , 10 , 10 , 10 ) and measured using a Nanodrop ND-1000 or equivalent, should be used as a qPCR standard. The qPCR standards are made using DNA extracted from great crested newt tissue samples, and the quantification made on extracted DNA before the dilution. Samples should be run on a BIO-RAD® CFX96 Touch real time PCR detection system or equivalent.

Note that the standards are the positive controls for qPCR in this approach (i.e. assuring that the method successfully detects DNA when present). Negative controls are provided by one extraction blank, which is run with 12 replicates, as a normal sample, and with four qPCR negative controls which also run during the qPCR step, using ultrapure water for molecular biology grade.

Step 7 The quantitative PCR is performed in a final volume of 25 µL made up from: • 3 µL of template DNA • 12.5 µL of TaqMan® Environmental Master Mix 2.0 (Life Technologies ®)

• 6.5 µL of ddH2O • 2 µL of primer (1 µL each of primer 10 µM TCCBL and TCCBR) • 1 µL of probe (2.5 µM TCCB Probe)

Step 8 The PCR is performed under thermal cycling at 56.3 °C for 5 minutes and 95 °C for 10 minutes, followed by 55 cycles of 95 °C for 30 seconds and 52°C for one minute.

2(Ct = Ct threshold value, the number of PCR cycles after which amplification becomes exponential) 14 Document date: 30 September 2014 Version Number: 1.1 5. Data recording and reporting

Accurate detailed records of the sites surveyed should be kept by the commissioning ecologists for reporting, reference and auditing purposes.

5.1 Sampling information

Sampling kits should be identified by a unique identifying code when provided to field ecologists. All site information should be associated with this unique number. Laboratory staff do not need further site reference information.

The commissioning ecologists should maintain records which include:

• Site name • Nearest settlement (provides double check against grid reference errors) • County (provides double check against grid reference errors) • Time between receipt of sampling kit and date of sampling • Date of sampling • Personnel collecting sample • Ordnance Survey grid reference, ideally to 1 m (i.e. a 12 figure grid reference) • Site maps showing locations of sites • Percentage of pond perimeter that is accessible for survey • Data on inflows, and whether these were wet or dry at the time of survey • If available, data on presence and number of great crested newt recorded during eDNA collection to help with further assessment / refinement of this technique • Information on any difficulties experienced during sample collection.

5.2 Laboratory data

The laboratory should maintain records which include:

• Personnel involved identified

• Date of kit preparation • Duration of storage of samples once returned from the field • Dates of analysis • Details on type and any degradation of the marker DNA in sample kits

• A record of any modifications to standard operation procedures of laboratory equipment.

Standard laboratory data should be maintained by the laboratory.

Information on sample inhibition should be reported with the reporting of positive or negative DNA results.

At present there is no intention to archive eDNA samples although this may become necessary in the future.

15 Document date: 30 September 2014 Version Number: 1.1 6. References

Biggs J, Ewald N, Valentini A, Gaboriaud C, Griffiths RA, Foster J, Wilkinson J, Arnett A, Williams P and Dunn F. (2014). Analytical and methodological development for improved surveillance of the Great Crested Newt. Defra Project WC1067. Freshwater Habitats Trust: Oxford.

Champlot S, Berthelot C, Pruvost M, Bennett EA, Grange T, et al. (2010) An Efficient Multistrategy DNA Decontamination Procedure of PCR Reagents for Hypersensitive PCR Applications. PLoS ONE 5(9): e13042. doi:10.1371/journal.pone.0013042.

Darling JA and Mahon AR (2011). From molecules to management: Adopting DNA-based methods for monitoring biological invasions in aquatic environments. Environmental Research, 111, 978-988. Ficetola GF, Miaud C, Pompanon F and Taberlet P (2008). Species detection using environmental DNA from water samples. Biology Letters 4: 423.

Knapp M, Clarke AC, Horsburgh KA, Matisoo-Smith EA (2012). Setting the stage–building and working in an ancient DNA laboratory. Annals of Anatomy 194, 3-6.

PHE (2013). UK standards for microbiology investigations. Good laboratory practice when performing molecular amplification assays. Public Health England, London.

Pilliod DS, Goldberg CS, Arkle RS, Waits LP ( 2013). Estimating occupancy and abundance of stream amphibians using environmental DNA from filtered water samples. Canadian Journal Fisheries and Aquatic Sciences 70, 1123-1130.

Pilliod DS, Goldberg CS, Arkle RS, Waits LP (2014). Factors influencing detection of 736 eDNA from a stream-dwelling amphibian. Molecular Ecology Resources, 14, 109-116.

Thomsen P, Kielgast J, Iversen LL, Wiuf C, Rasmussen M, Gilbert MTP, Orlando L and Willerslev E (2012). Monitoring endangered freshwater biodiversity using environmental DNA. Molecular Ecology, 21: 2565-2573.

16 Document date: 30 September 2014 Version Number: 1.1 Appendix 1. Frequently asked questions about eDNA sampling from volunteer and non-specialist surveyors

What is eDNA? eDNA in the case of larger organisms, is DNA that is collected from the environment in which an organism lives, rather than directly from the plants or animals themselves. In aquatic environments, animals including amphibians and fish, shed cellular material into the water via their saliva, urine, faeces, skin cells etc. This DNA may persist for several weeks, and can be collected through a water sample, and analysed to determine if target species of interest have been present in the waterbody.

Why must surveyors remain out of the pond? There is a considerable risk of contaminating your pond sample by bringing in Great Crested Newt DNA in mud and water from other areas on your boots and equipment. This is a real risk: DNA can remain on surfaces even after they have been dried, and can persist in soil for many years. There are recorded examples of eDNA cross-contaminating pond water samples from surveyor’s boots.

Why are sampling points spread around the pond? Existing data shows that eDNA can be very patchy depending on where the animals have been. By sampling in many areas you considerably increase your chance of collecting their DNA successfully.

Why is the water column mixed before sampling? DNA ‘sinks’ and so will often be present in larger amounts close to the pond bottom. However, it is important not to collect sediment because it is currently thought that DNA may persist in the sediment for substantially longer than in the water column. If you collect sediment, there is a risk your sample might show a false positive indicating great crested newts were present recently, when in fact this was a long time in the past.

Why is such a large volume of water collected? In this methodology we collect a larger volume of water than previous methods have recommended (e.g. Thomsen et al. 2012). Our experience indicates that collecting a larger volume of water than was taken by Thomsen et al. (2012) is important to the success of the method.

Does it matter if I get things like duckweed, algae or zooplankton in my sample? No, small amounts don’t matter. However try not to collect bottom sediment in the sample, because the DNA can be absorbed by sediment and may give false positive results (see above).

What happens if I spill the preservative - or the sample tube itself If you spill some of the preservative from one of the tubes, just add proportionally less water from your pond sample. The samples from all six tubes are later combined for the laboratory analysis, so it’s not disastrous if some sample is lost.

Will samples degrade in the post? The preservative (alcohol) in the sample bottle will slow, but not eliminate, degradation of any DNA. Keeping the samples refrigerated also slows this process. The rate of decay during posting at ambient temperatures will be faster, but it will not be sufficient to degrade the sample completely.

What evidence is there to support the use of this technique? Defra project WC1067 has demonstrated the effectiveness of environmental DNA in the detection of Great Crested Newts. In detailed field studies eDNA detected Great Crested Newts 99.3% of the time in ponds where they were known to occur. When used by volunteers surveyors, eDNA detected Great Crested Newts at 91% of ponds where they were known to be present. No false positives were recorded from sites either outside or within the known range of the newt.

17 Document date: 30 September 2014 Version Number: 1.1 Appendix 2 Details of primers and probes

Primers are salt free and HPLC-purified.

Primer Sequence (5’-‘3) Fragment Gene

TCCBL CGTAAACTACGGCTGACTAGTACGAA 81 Cyt-b

TCCBR CCGATGTGTATGTAGATGCAAACA 81 Cyt-b

Probe

TCCB CATCCACGCTAACGGAGCCTCGC 81 Cyt-b

Degradation control

A length of artificial DNA is added to the samples to assess post-sampling degradation. This DNA does not have an analogue in the natural world so it can clearly be separated from all DNAs that can be sampled in the field. The structure of the molecule is commercially confidential to Spygen so is not reproduced in this guide. Laboratories may either design their own synthetic DNA or purchase material from Spygen.

18 Document date: 30 September 2014 Version Number: 1.1 Acknowledgements

We would like to thank all those who helped with Defra project WC1067 including the landowners who facilitated access to their sites, and particularly the many people and groups who volunteered time and resources to collect eDNA samples. This includes NARRS and PondNet volunteers, the team in Wales co-ordinated by Matt Ellis of Natural Resources Wales, who generated an excellent dataset for the detailed methodological component of the project, and Tom Langton who not only collected many eDNA samples, but provided access to a dataset from Suffolk extending over 20 years which has helped us to better interpret the relationship between eDNA and Great Crested Newt abundance. The project lead was Natasha Chick (Defra) and the Steering Group was Matt Ashton (Defra), Pete Brotherton (Natural England), Paul Edgar (Natural England), John McKinnel (Scottish Natural Heritage), Katharine Woods (Natural England) and Anna Robinson (JNCC). Our thanks also to Barbara Zweifel for delivering eDNA samples to France for analysis.

Specific thanks for technical advice on the preparation of this document are given to Neil Boonham (FERA), Simon Creer (Bangor University), Helen Rees (ADAS) and Kerry Walsh (Environment Agency), and to Mike Wilkinson and Katharine Woods (both of Natural England).

19 Document date: 30 September 2014 Version Number: 1.1

Appendix 6

This map is reproduced from Ordnance Survey material with the permission of Ordnance Survey on behalf of the Kent & Medway Biological Records Centre Controller of Her Majesty's Office © Crown Copyright. Unauthorised reproduction infringes Crown copyright Map showing the statutory and non-statutory designated sites, and may lead to prosecution or civil proceedings. Kent County Council. 100019238. (© 2017) ancient woodland, higher level stewardship and water features at FOR REFERENCE PURPOSES ONLY. Wincheap Park and Ride, Canterbury NO FURTHER COPIES MAY BE MADE. Paul Evans, The Landscape Partnership. Kent & Medway Biological Records Centre would like to 0 0.5 10.25 Kilometres acknowledge, where appropriate: Natural England for ENQ/17/352 07/08/2017 Ramsar, SAC, SPA, NNR, SSSI, Higher Level Stewardship and Ancient Woodland data; Kent County Council for AONB, Heritage Coast, LNR, Country Park and County Boundary 612000.000000 613000.000000 614000.000000 615000.000000 data; Kent Wildlife Trust for LWS, RNR and Reserve data; Kent RIGS group for RIGS data; and the National Trust, the RSPB and the Woodland Trust for Reserve data used in this map.

.000000 ± .000000 KEY 158000 158000 Study Area Local Wildlife Site

RIG Site Local Nature Reserve Higher Level Stewardship Scheme Whitehall Meadows LNR Water Feature

AS27 Great Stour, Ashford to Fordwich

Whitehall Meadows LNR .000000 .000000 157000 157000

CA3 - Cooper's Pit, Canterbury .000000 .000000 156000 156000

612000.000000 613000.000000 614000.000000 615000.000000

Appendix 7

Folio No: E0679 Report No: 1 Order No: - Client: THE LANDSCAPE PARTNERSHIP LTD. Contact: Paul Evans Contact Details: [email protected] Date: 16/05/2017

TECHNICAL REPORT

ANALYSIS OF ENVIRONMENTAL DNA IN POND WATER FOR THE DETECTION OF GREAT CRESTED NEWTS

Date sample received at Laboratory: 12/05/2017 Date Reported: 16/05/2017 Matters Affecting Results: None

RESULTS Lab Sample Site Name O/S Reference SIC DC IC Result Positive No. Replicates

32152 Wincheap TR1364 5708 Pass Pass Pass Negative 0 Park+Ride/A2 Off Slip

SUMMARY

When Great Crested Newts (GCN); Triturus cristatus inhabit a pond, they deposit traces of their DNA in the water as evidence of their presence. By sampling the water, we can analyse these small environmental DNA (eDNA) traces to confirm GCN habitation, or establish GCN absence.

The water samples detailed below were submitted for eDNA analysis to the protocol stated in DEFRA WC1067 (Latest Amendments). Details on the sample submission form were used as the unique sample identity.

Lab Sample No.- When a kit is made it is given a unique sample number. When the pond samples have been taken and the kit has been received back in to the laboratory, this sample number is tracked throughout the laboratory.

Site Name- Information on the pond.

O/S Reference – Location/co-ordinates of pond.

SIC- Sample Integrity Check. Refers to quality of packaging, absence of tube leakage, suitability of sample (not too much mud or weed etc.) and absence of any factors that could potentially lead to results errors. Inspection upon receipt of sample at the laboratory. To check if the Sample is of adequate integrity when received. Pass or Fail.

DC- Degradation Check. Analysis of the spiked DNA marker to see if there has been degradation of the kit since made in the laboratory to sampling to analysis. Pass or Fail.

IC- Inhibition Check- PCR inhibitors can cause false results. Inhibitors are analysed to check the quality of the result. Every effort is made to clean the sample pre-analysis however some inhibitors cannot be extracted. An unacceptable inhibition check will cause an indeterminate sample and must be sampled again.

Result- NEGATIVE means that GCN eDNA was not detected or is below the threshold detection level and the test result should be considered as no evidence of GCN presence. POSITIVE means that GCN eDNA was found at or above the threshold level and the presence of GCN at this location at the time of sampling or in the recent past is confirmed. Positive or Negative.

Positive Replicates- To generate the results all of the tubes from each pond are combined to produce one eDNA extract. Then twelve separate analyses are undertaken. If one or moreof these analyses are positive the pond is declared positive for the presence of GCN. It may be assumed that small fractions of positive analyses suggest low level presence but this cannot currently be used for population studies. In accordance with Natural England protocol, even a score of 1/12 is declared positive.

METHODOLOGY

The laboratory testing adheres to strict guidelines laid down in WC1067 Analytical and Methodological Development for Improved Surveillance of The Great Crested Newt, Version 1.1

The analysis is conducted in two phases. The sample first goes through an extraction process where all six tubes are pooled together to acquire as much eDNA as possible. The pooled sample is then tested via real time PCR (also called q-PCR). This process amplifies select part of DNA allowing it to be detected and measured in ‘real time’ as the analytical process develops. qPCR combines PCR amplification and detection into a single step. This eliminates the need to detect products using gel electrophoresis. With qPCR, fluorescent dyes specific to the target sequence are used to label PCR products during thermal cycling. The accumulation of fluorescent signals during the exponential phase of the reaction is measured for fast and objective data analysis. The point at which amplification begins (the Ct value) is an indicator of the quality of the sample. Truepositive controls, negatives and blanks as well as spiked synthetic DNA are included in every analysis and these have to be correct before any result is declared so they act as additional quality control measures.

The primers used in this process are specific to a part of mitochondrial DNA only found in GCN ensuring no DNA from other species present in the water is amplified. The unique sequence appropriate for GCN analysis is quoted in DEFRA WC 1067 and means there should be no detection of closely related species. We have tested our system exhaustively to ensure this is the case in our laboratory. We can offer eDNA analysis for most other species including other newts.

Analysis of eDNA requires scrupulous attention to detail to prevent risk of contamination. Kits are manufactured by SureScreen

Forensic Scientists and Consultant Engineers SureScreen Scientifics Division Ltd, Morley Retreat, Church Lane, Morley, Derbyshire, DE7 6DE UK Tel: +44 (0)1332 292003 Email: [email protected] Company Registration No. 08950940 | 2 Scientifics to strict quality procedures in a separate building and with separate staff, adopting best practice from WC1067 and WC1067 Appendix 5. Kits contain a ‘spiked’ DNA marker used as a quality control tracer (SureScreen patent pending) to ensure any DNA contained in the sampled water has not deteriorated ni transit. Stages of the DNA analysis are also conducted in different buildings at our premises for added

SureScreen Scientifics Ltd also participate in Natural England’s proficiency testing scheme and we also carry out inter-laboratory checks on accuracy of results as part of our quality procedures.

Reported by: Sam Humphrey Approved by: Derry Hickman

End Of Report

Appendix 8

Reptile survey, A2 slip road, Wincheap, Canterbury

A2 lay-by and verge Survey Date Time Average Air Cloud cover, %Wind Lizards Slow worms Grass snakes Adders Other notes, refuge number Temp. deg C: Adult Juvenile adults juveniles adults juveniles adults juveniles 1 01.09.2017 12:00 16 20 light after rain, no animals 2 06.09.2017 11:30 16 90 moderate 1 1 3 08.09.2017 15:30 16 90 light 1 1, after rain 4 13.09.2017 11:00 17 20 moderate 2 1,3 5 20.09.2017 13:30 15 90 light 3 1 1,2,3 6 27.09.2017 13:00 19 100 v.light 2 1,4 7 29.09.2017 14:00 18 50 v.light 1 2

Attenuation Basin Survey Date Time Average Air Cloud cover, %Wind Lizards Slow worms Grass snakes Adders Other notes Temp. deg C: Adult Juvenile adults juveniles adults juveniles adults juveniles 1 No Access No survey 2 06.09.2017 11:30 16 90 moderate 4 15,16,19 3 08.09.2017 15:30 16 90 light 1 1 15,16 4 13.09.2017 11:00 17 20 moderate 1 16 5 20.09.2017 13:30 15 90 light 1 1 16 6 27.09.2017 13:00 19 100 v.light 2 17 7 29.09.2017 14:00 18 50 v.light 2 16,17

Allotments Survey Date Time Average Air Cloud cover, %Wind Lizards Slow worms Grass snakes Adders Other notes Temp. deg C: Adult Juvenile adults juveniles adults juveniles adults juveniles 1 01.09.2017 12:00 16 20 light 3 after rain, 10,12 2 06.09.2017 11:30 16 90 moderate 2 9,10 3 08.09.2017 15:30 16 90 light 1 10 4 13.09.2017 11:00 17 20 moderate No animals 5 20.09.2017 13:30 15 90 light 2 6,10 6 27.09.2017 13:00 19 100 v.light 1 9 7 29.09.2017 14:00 18 50 v.light 2 10

Wet woodland Survey Date Time Average Air Cloud cover, %Wind Lizards Slow worms Grass snakes Adders Other notes Temp. deg C: Adult Juvenile adults juveniles adults juveniles adults juveniles 1 01.09.2017 12:00 16 20 light after rain, no animals 2 06.09.2017 11:30 16 90 moderate No animals 3 08.09.2017 15:30 16 90 light No animals 4 13.09.2017 11:00 17 20 moderate No animals 5 20.09.2017 13:30 15 90 light No animals 6 27.09.2017 13:00 19 100 v.light 1 9 7 29.09.2017 14:00 18 50 v.light No animals

Appendix 9

Artificial lighting and wildlife Interim Guidance: Recommendations to help minimise the impact artificial lighting

Wherever human habitation spreads, so does artificial lighting. This increase in lighting has been shown to have an adverse effect on our native wildlife, particularly on those species that have evolved to be active during the hours of darkness. Consequently, development needs to carefully consider what lighting is necessary and reduce any unnecessary lighting, both temporally and spatially. When the impacts on different species groups are reviewed, the solutions proposed have commonalities that form the basis of good practice. These are outlined in the following document.

Overview of impacts Invertebrates Artificial light significantly disrupts natural patterns of light and dark, disturbing invertebrate feeding, breeding and movement, which may reduce and fragment populations. Some invertebrates, such as moths, are attracted to artificial lights at night. It is estimated that as many as a third of flying insects that are attracted to external lights will die as a result of their encounter.1 Insects can become disoriented and exhausted making them more susceptible to predation. In addition, the polarisation of light by shiny surfaces attracts insects, particularly egg laying females away from water. Reflected light has the potential to attract pollinators and impact on their populations, predators and pollination rates. Many invertebrates natural rhythms depend upon day-night and seasonal and lunar changes which can be adversely affected by artificial lighting levels.

It is not always easy to disentangle the effects of lighting on moths from other impacts of urbanisation. However, it is known that UV and green and blue light, which have short wavelengths and high frequencies, are seen by most insects and are highly attractive to them. Where a light source has a UV component, male moths in particular will be drawn to it. Most light-induced changes in physiology and behaviour are likely to be d 2

etrimental. They discern it to be ‘light’, so they do not fly to feed or mate. Birds There are several aspects of changes to bird behaviour to take into account. The phenomenon of robins and other birds singing by the light of a street light or other external lighting installations is well known, and

and couldresearch disrupt has the shown long-term that singing circadian did rhythm not have that a dictates significant the onseteffect of on the the br eeding bird’s bodyseason mass3. Many regulation. species However,of bird migrate it was at felt night that and the there continual are well-documented lack of sleep was cases likely of to the be massdetrimental mortality to theof noct birds’urnal survival migrating birds as they strike tall lit buildings. Other UK bird species that are particularly sensitive to artificial lighting are long-eared owls, black-tailed godwit and stone curlew.4

1 Bruce-White C and Shardlow M (2011) A Review of the Impact of Artificial Light on Invertebrates - See more at: http://www.buglife.org.uk/advice-and-publications/publications/campaigns-and-reports/review-impact-artificial- light#sthash.s7GPA1vL.dpuf 2 As above 3 Pollard A. (2009) Visual constraints on bird behaviour. University of Cardiff 4 Rodriguez A., Garcia A.M., Cervera F. and Palacios V. (2006) Landscape and anti-predation determinants of nest site selection, nest distribution and productivity in Mediterranean population of Long-eared Owls, Asio otus. Ibis, 148(1), pp. 133-145

Mammals A number of our British mammals are nocturnal and have adapted their lifestyle so that they are active in the dark in order to avoid predators. Artificial illumination of the areas in which these mammals are active and foraging is likely to be disturbing to their normal activities and their foraging areas could be lost in this way. It is thought that the most pronounced effect is likely to be on small mammals due to their need to avoid predators. However, this in itself has a knock-on effect on those predators.

The detrimental effect of artificial lighting is most clearly seen in bats. Our resident bat species have all suffered dramatic reductions in their numbers in the past century. Light falling on a bat roost exit point, regardless of species, will at least delay bats from emerging, which shortens the amount of time available to them for foraging. As the main peak of nocturnal insect abundance occurs at and soon after dusk, a delay in emergence means this vital time for feeding is missed. At worst, the bats may feel compelled to abandon the roost. Bats are faithful to their roosts over many years and disturbance of this sort can have a significant effect on the future of the colony. It is likely to be deemed a breach of the national and European legislation that protects British bats and their roosts.

In addition to causing disturbance to bats at the roost, artificial lighting can also affect the feeding behaviour of bats and their use of commuting routes. There are two aspects to this: one is the attraction that short wave length light (UV and blue light) has to a range of insects; the other is the presence of lit conditions.

As mentioned, many night-flying species of insect are attracted to lamps that emit short wavelength

advantage of the concentration of insects around white street lights as a source of prey, this behaviour is not truecomponent. for all bat Studies species. have The shownslower flying, that, althoughbroad-winged noctules, species, sero suchtines, as pipistrellelong-eared andbats, Leisler’sbarbastelle, bats, greater take and lesser horseshoe bats and the Myotis species (which includ external lights. e Brandt’s, whiskered, Daubenton’s, Natterer’sLighting can and be Bechstein’s particularly bats) harmful generally if it avoid illuminates important foraging habitats such as river corridors, woodland edges and hedgerows used by bats. Studies have shown that continuous lighting along roads creates barriers which some bat species cannot cross5. It is also known that insects are attracted to lit areas from further afield. This could result in adjacent habitats supporting reduced numbers of insects, causing a further impact on the ability of light-avoiding bats to feed.

These are just a few examples of the effects of artificial lighting on British wildlife, with migratory fish, amphibians, some flowering plants, a number of bird species, glow worms and a range of other invertebrates all exhibiting changes in their behaviour as a result of this unnatural lighting.

Recommendations Survey and Planning The potential impacts of obtrusive light on wildlife should be a routine consideration in the Environmental Impact Assessment (EIA) process6. Risks should be eliminated or minimised wherever possible. Some locations are particularly sensitive to obtrusive light and lighting schemes in these areas should be carefully planned.

In August 2013, Planning Minister Nick Boles launched the new National Online Planning Guidance Resource aimed at providing clearer protection for our natural and historic environment. The guidance looks at when lighting pollution concerns should be considered and is covered within one of the on line planning practice

5 Stone E. L., Jones G and Harriss (2009) Street lighting disturbs commuting bats. Current Biology, 19, pp 1-5 6 See also: Institution of Lighting Professionals Professional Lighting Guide (PLG 04) Guidance on undertaking lighting environmental impact assessments) – guides7. The guide provides an overview for planners with links to documents that aim to give planners an overview of the subject through the following discussion points:

1. When is obtrusive light / light pollution relevant to planning? 2. What factors should be considered when assessing whether a development proposal might have implications for obtrusive lighting / light pollution? 3. What factors are relevant when considering where light shines? 4. What factors are relevant when considering how much the light shines? 5. What factors are relevant when considering possible ecological impact? This can help planners reach the right design through the setting of appropriate conditions relating to performance and mitigation measures at the planning stage.

The Institution of Lighting Professionals (ILP) recommends that Local Planning Authorities specify internationally recognised environmental zones for exterior lighting control within their Development Plans8. In instances lacking classification, it may be necessary to request a Baseline Lighting Assessment/Survey conducted by a Lighting Professional in order to inform the classification of areas, particularly for large-scale schemes and major infrastructure projects.

When assessing or commissioning projects that include the installation of lighting schemes, particularly those subject the EIA process, the following should be considered and relayed to applicants:

 Ecological consultants should confirm the presence of any sensitive fauna and flora, advising the lighting designers of bat routes and roosts and other areas of importance in order to ensure that reports correspond with each other.  Ecological consultants should consider the need for quantitative lighting measurements. In some instances it may be necessary for further lighting measurements to be taken. For example, outside an important bat roost. These should follow best practice guidance from the ILP and would ideally be conducted by a Lighting Professional.  Where appropriate, professional lighting designers should be consulted to design and model appropriate installations that achieve the task but mitigate the impacts. This should be done at the earliest opportunity. Early decisions can play a key role in mitigating the impact from lighting.  Reports submitted should outline the impacts of lighting in relation to ecology, making clear reference to the ecological findings, highlighting any sensitive areas and detail proposed mitigation. Consideration should also be given to internal lighting where appropriate.  Post –installation checks and sign off upon commissioning should be carried out by the lighting designer to ensure that the lighting installation has been installed in accordance with the design, that predictions were accurate and mitigation methods have been successful.

Principles and design considerations Do not  provide excessive lighting. Use only the minimum amount of light needed for the task.  directly illuminate bat roosts or important areas for nesting birds

Avoid  installing lighting in ecologically sensitive areas such as: near ponds, lakes, rivers, areas of high conservation value; sites supporting particularly light-sensitive species of conservation significance (e.g. glow worms, rare moths, slow-flying bats) and habitat used by protected species.  using reflective surfaces under lights.

7http://planningguidance.planningportal.gov.uk/blog/guidance/light-pollution/when-is-light-pollution-relevant-to- planning/ 8 Institution of Lighting Professionals (2011) Guidance Notes for the Reduction of Obtrusive Light GN01:2011. Do  consider employing a competent lighting designer who will apply the principals of providing the right light, in the right place, at the right time and controlled by the right system.  minimise the spread of light to at, or near horizontal and ensure that only the task area is lit. Flat cut-off lanterns or accessories should be used to shield or direct light to where it is required.  consider the height of lighting columns. It should be noted that a lower mounting height is not always better. A lower mounting height can create more light spill or require more columns. Column height should be carefully considered to balance task and mitigation measures.  consider no lighting solutions where possible such as white lining, good signage and LED cats eyes. These options can also be effective. For example, light only high-risk stretches of roads, such as crossings and junctions, allowing headlights to provide any necessary illumination at other times.  use temporary close-boarded fencing until vegetation matures, to shield sensitive areas from lighting.  limit the times that lights are on to provide some dark periods. The task being lit often varies, for example roads are less used after 23.00hrs and car parks are empty. A lighting designer can vary the lighting levels as the use of the area changes reducing lighting levels or perhaps even switching installations off after certain times. This use of adaptive lighting can tailor the installation to suit human health and safety as well as wildlife needs.

Technological specifications Research from the Netherlands has shown that spectral composition does impact biodiversity.  Use narrow spectrum light sources to lower the range of species affected by lighting.  Use light sources that emit minimal ultra-violet light  Lights should peak higher than 550 nm  Avoid white and blue wavelengths of the light spectrum to reduce insect attraction and where white light sources are required in order to manage the blue short wave length content they should be of a warm / neutral colour temperature <4,200 kelvin.

Further guidance on the spectral composition of artificial lighting will be made available following the publication of research from the Netherlands.

Further reading:  A review of the impact of artificial light on invertebrates. Buglife. 2011  Royal Commission on Environmental Pollution. 2009. Artificial light in the environment. London, HMSO  The Ecological Consequences of Artificial Night Lighting" edited by Longcore and Rich  Shedding Light: A survey of local authority approaches to lighting in England. CPRE 2014

For more information on lighting and wildlife see:  Bat Conservation Trust (BCT) www.bats.org.uk  Campaign for Dark Skies (CfDS) www.britastro.org/dark-skies —  Bats and Lighting Research project www.batsandlighting.co.uk/index.html. —  Institution of Lighting Professionals (ILP) www.theilp.org.uk —  Lichtopnatuur - Impact of artificial light on flora and fauna in The Netherlands - http://www.lichtopnatuur.org/ —