Streptozotocin Diabetes Induced by Multiple Low Doses of The

The Chemokine Binding Protein M3 Prevents Diabetes Induced by Multiple Low Doses of Streptozotocin

This information is current as Andrea P. Martin, Jennifer M. Alexander-Brett, Claudia of September 25, 2021. Canasto-Chibuque, Alexandre Garin, Jonathan S. Bromberg, Daved H. Fremont and Sergio A. Lira J Immunol 2007; 178:4623-4631; ; doi: 10.4049/jimmunol.178.7.4623

http://www.jimmunol.org/content/178/7/4623 Downloaded from

References This article cites 48 articles, 19 of which you can access for free at: http://www.jimmunol.org/content/178/7/4623.full#ref-list-1 http://www.jimmunol.org/

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication by guest on September 25, 2021

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2007 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

The Chemokine Binding Protein M3 Prevents Diabetes Induced by Multiple Low Doses of Streptozotocin1

Andrea P. Martin,* Jennifer M. Alexander-Brett,† Claudia Canasto-Chibuque,* Alexandre Garin,* Jonathan S. Bromberg,*‡ Daved H. Fremont,† and Sergio A. Lira2*

Multiple injections of low-dose streptozotocin (MLDS) induce lymphocytic insulitis and diabetes in rodents. To test whether the influx of inflammatory cells was associated with changes in the expression of chemokines, we measured the expression of all known chemokine ligands by real-time quantitative PCR in isolated islets. With the exception of CCL20 and CCL19, chemokines were not significantly expressed in islets from wild-type mice before MLDS treatment. Ten days after treatment, the expression of several chemokines, including CXCL9, CCL1, CXCL10, and CCL21, was dramatically up-regulated. The expression of CCL1, CXCL9, and CCL21 protein was confirmed by immunohistochemistry and was mostly associated with the infiltrating cells. The mouse herpesvirus 68-encoded chemokine decoy receptor M3 can broadly engage these chemokines with high affinity. To test Downloaded from whether a blockade of chemokine function would alter the onset or magnitude of insulitis and diabetes, we used transgenic mice expressing M3 in ␤ cells (rat insulin promoter (RIP)-M3 mice). RIP-M3 mice were normoglycemic and responded normally to glucose challenge but were remarkably resistant to diabetes induced by MLDS. Islets from MLDS-treated RIP-M3 mice had fewer inflammatory cells and expressed lower levels of chemokines than those from MLDS-treated controls. The role of M3 in chemokine blockade during insulitis was further supported by in vitro experiments demonstrating that multiple chemokines up-regulated during islet inflammation are high-affinity M3 ligands that can be simultaneously sequestered. These results implicate chemokines http://www.jimmunol.org/ as key mediators of insulitis and suggest that their blockade may represent a novel strategy to prevent insulitis and islet destruction. The Journal of Immunology, 2007, 178: 4623–4631.

ype 1 diabetes is an autoimmune disease characterized by cells (5) and/or by spontaneously releasing NO (6). Subsequently, a local inflammatory reaction in and around islets that is as a result of a novel ␤ cell Ag expression, mononuclear cells will T followed by selective destruction of insulin-secreting ␤ infiltrate the islets and start a multifactorial process (7) that will cells (1). The factors leading to the destruction of the islets are still lead to islet destruction and diabetes. not known, but it is well accepted that immune-based mechanisms The trafficking of macrophages and T cells has been shown to be by guest on September 25, 2021 involving macrophages and T cells are responsible for the death of regulated by chemokines, small m.w. chemoattractant proteins that ␤ the cells (2, 3). interact with G protein-coupled receptors present at the cell surface Experimentally induced insulin-dependent diabetes mellitus in of these leukocytes to regulate their migration, differentiation, and 3 rodents with multiple low doses of streptozotocin (MLDS) is a function (8–10). The migration of macrophages and T cells is con- widely used model that has clinical and histoimmunological fea- trolled by multiple chemokines, including CCL2, CCL21, CCL19 tures similar to those of human disease, with T cells and macro- (9, 11, 12), CXCL10, and CXCL9 (13). The migration of mono- phages playing a major pathogenic role (4). When administered in cytes and macrophages is mediated by CCL2 and its receptor, animals at multiple low doses, the ␤ cell toxin streptozotocin is thought to induce initial cell damage by alkylating the DNA in islet CCR2 (14). Both homeostatic and inflammatory T cell trafficking are under the control of chemokines. The homeostatic migration of T cells is regulated by CCL21 and CCL19. Both CCL19 and CCL21 interact with a common receptor, CCR7, which is ex- *Immunobiology Center, Mount Sinai School of Medicine, New York, NY 10029; pressed by naive and memory T cells (15). The influx of effector † Department of Pathology and Immunology, Washington University School of Med- T cells into inflamed areas is regulated by multiple chemokines, icine, St. Louis, MO 63110; and ‡Gene and Cell Medicine, Mount Sinai School of Medicine, New York, NY 10029 including the IFN-␥-inducible chemokines CXCL10 and CXCL9 Received for publication August 16, 2006. Accepted for publication January 18, 2007. and their receptor CXCR3 (13). The costs of publication of this article were defrayed in part by the payment of page Chemokines are not highly expressed by the normal islets, but charges. This article must therefore be hereby marked advertisement in accordance chemokine expression has been detected in islets cultured in vitro. with 18 U.S.C. Section 1734 solely to indicate this fact. Primary cultures of murine and human pancreatic islets express 1 This work was supported by National Institutes of Health Grants DK067381 (to S.A.L.) and AI051426 (to D.H.F.). and secrete CCL2 (16). CCL2 expression in the pancreas parallels 2 Address correspondence and reprint requests to Dr. Sergio A. Lira, Immunobiology disease progression in NOD mice (17, 18). A recent study has Center, Mount Sinai School of Medicine, 1425 Madison Avenue, Box 1630, New suggested an important role for CCL2 in the clinical outcome of York, NY 10029. E-mail address: [email protected] islet transplantation in patients with type I diabetes (16). Low 3 Abbreviations used in this paper: MLDS, multiple low-doses of streptozotocin; h, CCL2 secretion by islets before transplantation was the most rel- human; MHV-68, mouse herpesvirus 68; m, mouse; Q-PCR, quantitative real time PCR; RIP, rat insulin promoter; RU, resonance unit; SPR, surface plasmon resonance; evant factor for predicting long-lasting insulin independence. STZ, streptozotocin; tg, transgenic; VEGF, vascular endothelial growth factor; wt, CCL21 is not normally expressed by pancreatic islets, but its wild type. expression has been observed in the pancreas of NOD mice (19, Copyright © 2007 by The American Association of Immunologists, Inc. 0022-1767/07/$2.00 20). The expression of CCL21 by the islets has been proposed www.jimmunol.org 4624 M3 PREVENTS MLDS-INDUCED DIABETES to be an important factor contributing to autoimmunity (21). were anti-CD45 (catalog no. 550539), CD3 (catalog no. 553058), CD11c Moreover, ␤ cells secrete CXCL9 and CXCL10 during virus- (catalog no. 553799), CD11b (catalog no. 553308), and CD31 (catalog no. induced diabetes (13, 22). 550274) from BD Biosciences, rat anti-insulin (catalog no. MAB1417), anti-CCL1 (catalog no. MAB845), anti-CCL21 (catalog no. AF455) from Interference with the chemokine system has been shown to at- R&D Systems, anti-CXCL9 (provided by J. Farber and H. Zhang, National tenuate or prolong the development of experimental models of Institute of Allergy and Infectious Diseases), and guinea pig polyclonal diabetes. For instance, animals lacking the chemokine receptor anti-insulin (catalog no. A0564) from DakoCytomation. The secondary CXCR3 show a delayed onset of type 1 diabetes subsequent to a Abs used were Alexa Fluor 488 goat anti-rat IgG (catalog no. A-11006), Alexa Fluor 594 goat anti-rat IgG (catalog no. A-11007), and Alexa Fluor viral infection (13). In addition, Ab neutralization of a macro- 594 goat anti-rabbit IgG (catalog no. A-11037) from Molecular Probes phage-derived chemokine (CCL22) causes a significant reduction and FITC anti-Guinea Pig IgG (catalog no. 127065160) from Jackson ϩ of CCR4 T cells within the pancreatic infiltrates and inhibits the ImmunoResearch Laboratories. development of insulitis and diabetes in NOD mice (23). Finally, To study the cellular changes promoted by STZ treatment we performed the treatment of NOD mice with a neutralizing anti-CCR5 Ab semiquantitative analysis on insulin/CD45-stained sections, assessing 20–80 islets per animal. Three grades of infiltration were based on the ␤ ϩ inhibits cell destruction and diabetes (24). In none of these mod- number of CD45 cells in or around the islet: 1 (10–20 cells), 2 (20–50 els, however, is there a complete abrogation of disease, which cells), and 3 (Ͼ50 cells). At least 20 sections were evaluated per mouse and suggests that other factors (including additional chemokines) may per day in a blinded fashion. Data are presented as mean insulitis score Ϯ be relevant for pathogenesis. SD for the indicated experimental groups. Testing a possible role for multiple chemokines in the patho- Intraperitoneal glucose tolerance test genesis of diabetes has been hampered by the lack of pharmaco- After a 16-h fast, glucose (1.5 g/kg body weight in saline (0.9% NaCl)) was Downloaded from logical agents with broad specificity and by the fact that many administered i.p. The blood glucose was monitored at 0, 30, 60, 120, and chemokine receptor genes are clustered in the genome, which pre- 240 min using an Ascensia Elite XL one-touch blood glucometer (Bayer). cludes the generation of compound mutants by conventional Isolation of pancreatic islets of Langerhans breeding techniques. A novel tool for testing chemokine function is M3, a chemokine-binding protein encoded by the mouse her- Islets of Langerhans were isolated as previously described (29). Briefly, the pesvirus 68 (MHV-68). M3 blocks chemokine receptor-binding common bile duct was clamped distal to the pancreatic duct junction at its hepatic insertion. The proximal common bile duct was then cannulated interfaces and displaces and removes chemokines from inflamma- using a 27-gauge needle, and the pancreas was infused by retrograde in- http://www.jimmunol.org/ tory sites (25). Recent studies from our laboratory show that the jection of 2 ml of ice-cold collagenase solution (1.0 mg/ml; Sigma-Aldrich) expression of M3 by ␤ cells blocks lymphocyte recruitment in- in HBSS (Invitrogen Life Technologies). Pancreatic tissue was recovered duced by transgenic (tg) expression of CCL21 (26), CCL2, and and subjected to a 12-min digestion at 37°C. Subsequently, ice cold HBSS CXCL13 (27). was added and the suspension was vortexed at full speed for 10 s. Islets were hand picked under a dissection microscope. Islets were used imme- In this study we show that chemokines are expressed in the islets diately after isolation to obtain RNA or protein. of mice treated with MLDS before the development of diabetes. Furthermore, we show that the expression of the promiscuous che- Western analysis mokine decoy receptor M3 in the islets reduces the leukocyte in- To analyze Glut-2 expression, islets from control and tg mice were soni- filtration and islet destruction induced by MLDS. These results cated in freshly prepared lysis buffer (5% SDS, 80 mmol/L Tris-HCl (pH by guest on September 25, 2021 indicate that chemokines are important determinants of diabetes 6.8), 5 mmol/L EDTA, and 0.5 mmol/L PMSF). The supernatants contain- ing the cell lysate were separated by centrifugation and the protein con- and suggest that multichemokine blockade may be a novel ap- centrations were determined using the MicroBCA assay (Pierce). Forty proach to prevent insulitis and diabetes. micrograms of protein from each sample was added to loading buffer and analyzed using 10% SDS-polyacrylamide gels. Proteins were transferred Materials and Methods from the gels to Immobilon-P membranes (Millipore) using standard tech- Transgenic mice niques. Blots were incubated with Abs against Glut-2 (Santa Cruz Bio- technology) and actin (Sigma-Aldrich) and then with a peroxidase-conju- Rat insulin promoter (RIP)-M3 tg mice were described previously (26). gated donkey anti-goat IgG (Santa Cruz Biotechnology) and a peroxidase- B6D2F1 mice were obtained from Charles River Laboratories. All mice conjugated rabbit anti-mouse IgG (Abcam), respectively. were housed under specific pathogen-free conditions in individually ven- To analyze M3 expression, 200 islets from control and tg animals were tilated cages at the Mount Sinai School of Medicine Animal Facility (New incubated for 24 h in glucose-free medium and supernatants were collected. York, NY). All experiments were performed following institutional Twenty micrograms of protein from each sample was processed as de- guidelines. scribed above. Blots were incubated with primary Abs against M3 (26) and a peroxidase-conjugated goat anti-rabbit IgG (Abcam). Chemilumines- Streptozotocin treatment in vivo cence was detected using the Western Lightning Western Blot Chemilu- To induce diabetes, mice (6–10 wk of age) were injected i.p. with strep- minescence Reagent Plus (enhanced luminol) (PerkinElmer). tozotocin (STZ) (40 mg/kg freshly dissolved in cold 0.1 M citrate buffer Islet glucose-stimulated insulin release (pH 4.5); Calbiochem, EMD Biosciences) for 5 consecutive days as previously described (28). Blood glucose was monitored weekly over the fol- The insulin secretion assay was performed as described by Eizirik et al. lowing 35 or 70 days using an Ascensia Elite XL one-touch blood glu- with some modifications (30). Briefly, 20 islets from each group were set cometer (Bayer). Animals were considered diabetic when their blood in quintuplicate in a 24-well plate and incubated in CMRL 1066 medium glucose levels were Ͼ250 mg/dl in two consecutive daily measurements. In (Cellgro, Mediatech) supplemented with 1.7 mM glucose or with 16.7 mM some experiments mice were treated with a single i.p. of STZ (300 mg/kg glucose for 60 min at 37°C in an atmosphere of 95% O2 and 5% CO2. For body weight) and blood glucose was observed daily for 1 wk. Mice in the insulin content, fresh islets were collected, washed with 1 ml of PBS, and control group received a corresponding volume of sodium citrate buffer sonicated in acid ethanol to extract insulin. All of supernatants and extrac- alone. tions were kept at Ϫ20°C. Insulin released into supernatants and insulin content was measured by ELISA (ALPCO Diagnostic). Histology Quantitative real-time PCR (Q-PCR) Tissues for light microscopic examination were fixed by immersion in 10% phosphate-buffered formalin and then processed for paraffin sections. Rou- Total RNA was extracted from pooled islets using the RNeasy maxi kit tinely, 5-␮m sections were cut and stained with H&E. For immunohisto- (Qiagen) according to the manufacturer’s instructions. Reverse transcrip- chemical staining fresh-frozen sections were first fixed with ice-cold ace- tion was performed for 3 ␮g of RNA. Q-PCR was conducted in duplicate tone for 20 min and dried and stored at Ϫ20°C. Slides were incubated for from 25 ng of cDNA and with each primer at 0.4 ␮Mina30-␮l final 1 h at room temperature with purified primary Abs followed by incubation reaction volumes of 1ϫ SYBR Green PCR Master Mix (Applied Biosys- with the appropriate labeled secondary Abs for 30 min. Primary Abs used tems). PCR cycling conditions were 50°C for 2 min, 95°C for 15 min, and The Journal of Immunology 4625

Table I. Sequences of primers used to study mRNA chemokine expression by Q-PCR (5Ј to 3Ј)

Chemokine Forward Primers Reverse Primers

CCL1 CCCAGCTGTGGTATTCAGGC GTGATTTTGAACCCACGTTTTG CCL2 GCTGGAGCATCCACGTGTT ATCTTGCTGGTGAATGAGTAGCA CCL3 CCAAGTCTTCTCAGCGCCAT GAATCTTCCGGCTGTAGGAGAAG CCL4 TCTGCGTGTCTGCCCTCTC TGCTGAGAACCCTGGAGCA CCL5 GCAAGTGCTCCAATCTTGCA CTTCTCTGGGTTGGCACACA CCL6 CTTGGGTCCCAGGCTGG AGTGTCTTGAAAGCCTTGATGAATT CCL7 GGGAAGCTGTTATCTTCAAGACAAA CTCCTCGACCCACTTCTGATG CCL8 GCTACGAGAGAATCAACAATATCCAGT CAGAGAGACATACCCTGCTTGGT CCL9.10 GGTTCCAGGTCTGTGCCAA GTGGTTGTGAGTTTTTCTCCAATCT CCL11 CCAGGCTCCATCCCAACTT TGGTGATTCTTTTGTAGCTCTTCAGT CCL12 AATCACAAGCAGCCAGTGTCC TCAGCACAGATCTCCTTATCCAGT CCL13 GCTGGAGAGCTACAAGAGGATCAC TGCCCAACCTGGTCTTGAAG CCL17 GGATGCCATCGTGTTTCTGA GCCTTCTTCACATGTTTGTCTTTG CCL19 ATGCGGAAGACTGCTGCC AGCGGAAGGCTTTCACGAT CCL20 CCAAGTCTTCTCAGCGCCAT GAATCTTCCGGCTGTAGGAGAAG CCL21 CCCCGGCTGCAGGAA TGTTCAGTTCTCTTGCAGCCC CCL22 TGCCAGGACTACATCCGTCA GGCAGGATTTTGAGGTCCAG CCL24 TGGTAGCCTGCGCGTGTT AAGGACGTGCAGCAAGATGA CCL25 TGAAAGGAAGAAGTCAAACCATATGA AGGGTGGCACTCCTCACG Downloaded from CCL27 CAGGCTGCTGAGGAGGATTG CACGACAGCCTGGAGGTGA CCL28 CATACTTCCCATGGCCTCC GAGAGGCTTCGTGCCTGTG CXCL1 AATGAGCTGCGCTGTCAGTG TGAGGGCAACACCTTCAAGC CXCL2 CCTGCCAAGGGTTGACTTCA TTCTGTCTGGGCGCAGTG CXCL4 GCCTGGAGGTGATCAAGGC GGCAAATTTTCCTCCCATTCT CXCL5 CATCCCCAGCGGTTCCA CGTGAACAGCAACAGAAATGC

CXCL7 CGTGCCTGGACCCAAATG GCTGGTCAGTAACCTTCCAAGATT http://www.jimmunol.org/ CXCL9 TGCACGATGCTCCTGCA AGGTCTTTGAGGGATTTGTAGTGG CXCL10 GACGGTCCGCTGCAACTG GCTTCCCTATGGCCCTCATT CXCL11 CGGGATGAAAGCCGTCAA AACTTTGTCGCAGCCGTTACTC CXCL12 GCTCCTCGACAGATGCCTTG GACCCTGGCACTGAACTGGA CXCL13 CATAGATCGGATTCAAGTTACGCC TCTTGGTCCAGATCACAACTTCA CXCL14 AGCACTGCCTGCACCCTAAG TCTCGTTCCAGGCATTATACCA CXCL15 GCTCCTGCTGGCTGTCCTTA CACAGACATCGTAGCTCTTGAGTGT CXCL16 AGCACACCAGCTTGGGTACC CATGGCTGCAGTGAGGAAGA XCL1 GGTGAAAGCAGCGATCAAG TGGGAACAGTTTCAGCCATGT CX3CL1 CAGCAGTGACCGGATCATCTC TGCTCTGAGGCTTAGCCGTAA by guest on September 25, 2021

40 cycles of 95°C for 15 s and 60°C for 1 min. Relative expression levels not suffer from mass transport limitations. The solution-surface competi- Ct ubiquitin Ϫ Ct gene were calculated as 2 (where Ct is cycle threshold; for tion assay is conducted by measuring equilibrium (Req) chemokine binding details see ABI PRISM 7700 User Bulletin no. 2; Applied Biosystems) to surface-bound M3BBXB as the amount of M3 solution competitor is using ubiquitin RNA as endogenous control. The melt curve was per- increased. The experiment yields a competition titration curve that is math- formed and primer dimers were absent. The sequences of primers used to ematically fit to obtain the solution-based wild-type (wt) M3-chemokine study chemokine mRNA expression are described in Table I. The results binding affinity. were graphed as fold increase in chemokine expression between days 0 and To perform this assay, the M3BBXB mutant was immobilized on a CM5 10 and the experiments were repeated at least three times. sensor chip to a level of 800 RU. CXCL10 (15 nM) and CCL21 (8 nM) were each pre-equilibrated with M3 over a range of concentrations from Surface plasmon resonance (SPR)-based competition assay 1:0 to ϳ1:2 molar ratio. Mixtures were injected over the flow cells at 60 ␮l/min, and the surface was regenerated with 1 M calcium chloride. Com- SPR experiments were conducted using a Biacore 2000 biosensor at 25°C petition titration curves were analyzed using equations previously derived under conditions of 20 mM HEPES (pH 7.4), 150 mM sodium chloride, for solution-surface SPR competition using the program Scientist (Micro- 0.005% Triton X-100. The M3 and human (h)CCL2 used in this analysis math Science Software) to yield KI, the solution affinity for M3 binding to were produced as described elsewhere (J. M. Alexander-Brett and D. H. each chemokine. Fremont, submitted for publication). Murine (m)CXCL10, mCCL21, and For the second-site binding assay, M3 (1 mg/ml) was pre-equilibrated hXCL1 were purchased from BioSource, and vascular endothelial growth with biotinylated CCL2 at a 10:1 ratio, and the mixture was injected over factor (VEGF) was from PeproTech. For the two-site binding assay, M3 a neutravidin coated sensor chip to immobilize ϳ500 RU of material. M3 was pre-equilibrated with biotinylated CCL2 at a 10:1 ratio, and the mix- is captured via a stable 2:1 interaction with CCL2 and only the free second ture was injected over a NeutrAvidin-coated sensor chip to immobilize ϳ site is available for binding to other chemokines. The chemokines CXCL10 500 resonance units (RU) of material. M3 is captured via stable inter- and CCL21 were injected over the sensor chip at 50 nM to assess their action with CCL2 and only the free second site is available for binding. The ability to bind the second M3 site, with XCL1 and VEGF (each at 50 nM) chemokines CXCL10 and CCL21 were injected over the sensor chip at 50 serving as the positive and negative controls, respectively. nM to assess their ability to bind the second M3 site, with XCL1 and VEGF (each at 50 nM) serving as positive and negative controls, respectively. Statistical analysis M3-chemokine binding affinities were measured using an SPR-based competition assay, which is described in full detail elsewhere (J. M. Data are expressed as means Ϯ SD. An unpaired t test, one-way ANOVA, Alexander-Brett and D. H. Fremont, 2006, submitted for publication). and repeated measures ANOVA were used to determine statistical signif- Briefly, the competition assay facilitates the measurement of M3-chemo- icance. Differences were considered significant when p Ͻ 0.05. kine binding affinities that are otherwise unobtainable by direct surface binding methods due to severe mass transport artifacts. The solution-sur- Results face competition assay uses a mutant form of M3 in which the s2b-s3 loop Streptozotocin treatment induces chemokine production is mutated from 80EELGQ84 to 80SRRGR84, referred to as M3BBXB (where B represents a basic amino acid such as arginine and X is any other amino MLDS initially induce ␤ cell damage (5), and mononuclear cells acid), which exhibits decreased chemokine binding on-rates and thus does that infiltrate the islets start a multifactorial process that leads to 4626 M3 PREVENTS MLDS-INDUCED DIABETES

FIGURE 1. MLDS treatment induces the expression of chemokines and the recruitment of inﬂammatory cells to the islets of Langerhans. A, Fold increase in chemokine mRNA levels in islets of Langerhans after MLDS. Values were determined by Q-PCR before treatment and at day 10. Shown are chemokines for which there was at least a 3-fold difference in expression levels. B and C, Insulin/CD45 (green/red) staining at day 0 (B) and day 10 (C). D–F, CCL1 (red) together with CD45 (green; D), CD11b (green; E) and CD11c (green; F) staining. G, Immunostaining for CCL21 (red). H, CCL21 (red) and CD31 (green) staining. I and J,

CXCL9 (red) together with CD11b (green; I) and Downloaded from CD11c (green; J) staining. Note that chemokine expression is mostly associated with the inﬂammatory cells. White arrowheads point to the coexpression of chemokines and the cell marker analyzed in each case. In B–J immunostaining was performed in pancreata 10 days after of MLDS treatment. Scale bars, 25 ␮m. http://www.jimmunol.org/

destruction of the insulin-producing ␤ cells (31). To characterize and I–J, respectively) but not for T cells or endothelial cells (data by guest on September 25, 2021 the chemokines produced in the MLDS model, we performed not shown). CCL21 was found in areas where there was an accu- Q-PCR on total RNA isolated from islets. We examined the mulation of inflammatory cells (Fig. 1G) mainly expressed by en- expression of all known murine chemokine ligands in islets of dothelial (CD31ϩ) cells (Fig. 1H). These results validate the re- Langerhans taken from control mice before (day 0, n ϭ 40) and sults obtained by Q-PCR analysis and indicate that MLDS after MLDS treatment on days 3 (n ϭ 6), 5 (n ϭ 6), and 10 (n treatment induced the expression of chemokines primarily in cells ϭ 30). With the exception of CCL20 and CCL19, chemokines infiltrating the islets of Langerhans. were expressed at very low levels before treatment (data not ␤ shown). No significant differences in chemokine expression Expression of M3 does not affect the ability of cells to were detected 3–5 days after the initiation of treatment (data not produce or secrete insulin shown). However, there were striking differences in the expres- Next, we tested the hypothesis that an islet-specific chemokine sion levels of some chemokines, most notably CXCL9, blockade affected the development of diabetes induced by MLDS. CXCL10, and CCL1 (which were expressed at 31- to 178-fold To this end we used mice expressing the chemokine-binding pro- higher levels than at day 0) (Fig. 1A). tein M3 in the islets (RIP-M3 mice) (26). We have previously We then used immunohistochemical analysis to determine shown that mice expressing M3 in the islets develop normally and whether MLDS led to changes in chemokine protein expression. are normoglycemic. Furthermore, we found that the constitutive Several sections of pancreata from control mice (n ϭ 8) before and expression of M3 in the pancreas of the RIP-M3 mice did not affect 10 days after initiation of MLDS were analyzed using Abs against the development of lymphoid or nonlymphoid tissues. To rule out some of the chemokine ligands that were found to be highly up- that expression of M3 affected ␤ cell function we performed both regulated in the Q-PCR analysis (CXCL9, CCL1, and CCL21). To in vitro and in vivo experiments. determine the cellular source of chemokines, we used Abs against First we confirmed that islets from tg animals secreted M3 in insulin, the pan-leukocyte marker CD45, the myeloid marker vitro. Isolated islets from tg RIP-M3 mice secreted immunoreac- CD11b, dendritic cells (CD11c), T cells (CD3), and endothelial tive 44-kDa M3 protein after 24 h of culture (Fig. 2A). No immu- cells (CD31). Few CD45ϩ cells were found within islets of Lang- noreactivity was found in the medium from control islets. Densi- erhans before treatment (Fig. 1B). However, by day 10 we ob- tometric scanning of the bands showed that islets from served many CD45ϩ inflammatory cells within the islets (Fig. 1C). homozygous (tg/tg) mice released approximately double the At this point, we detected strong staining for the chemokines stud- amount of M3 as heterozygous (tg/wt) islets (data not shown, n ϭ ied (Fig. 1, D–J). As shown in Fig. 1, CCL1 and CXCL9 were 4 experiments). localized to the infiltrating cells (within CD45ϩ cells; Fig. 1D and To determine whether the expression of M3 by ␤ cells affected data not shown). Further analysis showed that CCL1 and CXCL9 glucose homeostasis, we analyzed the insulin content and the se- were expressed mainly by CD11bϩ and CD11cϩ cells (Fig. 1, E–F cretion of insulin after a glucose challenge in islets from controls The Journal of Immunology 4627

FIGURE 2. Expression of M3 does not alter the function of ␤ cells. A, Western blot analysis of M3 protein in supernatants of cultured islets. B, Insu- lin content measured by ELISA in freshly isolated islets from control and RIP-M3 mice (n ϭ 15 per group, p ϭ 0.65; one-way ANOVA). C, Isolated islets were cultured with 1.7 or 16.7 mM glucose for 1 h. The insulin concentration in supernatants was determined by ELISA. The results represent three separate experiments under similar experimental conditions (p ϭ 0.75; one-way ANOVA). D, Intraperitoneal glucose tolerance test. Glucose was injected i.p. into fasting non-tg and tg mice (8 wk old) and blood glucose was measured every 30 min (p ϭ 0.97; one- way ANOVA). E, Blood glucose levels Downloaded from after the administration of a high dose of STZ in RIP-M3 tg/wt (n ϭ 5, E), RIP-M3 tg/tg (n ϭ 5, F) and their non-tg (wt) littermates (n ϭ 5, ᮀ)(p ϭ 0.78; one-way ANOVA). http://www.jimmunol.org/

and RIP-M3 tg mice. There was no signiﬁcant difference in the insulin content between islets from control and RIP-M3 mice (n ϭ 15 per group, Fig. 2B). As expected, higher levels of secreted insulin were detected in the supernatants of cultured islets from both control and RIP-M3 tg mice after they were

exposed to high concentrations of glucose, but there was no by guest on September 25, 2021 difference between the groups (Fig. 2C, n ϭ 3 experiments). Finally, the results of an i.p. glucose tolerance test on 8-wk-old control and RIP-M3 tg mice were identical, with plasma glucose reaching maximal levels 90 min after glucose administration (Fig. 2D). To evaluate whether ␤ cell integrity was altered by M3 expression we treated the mice with a high dose of STZ (300 mg/kg). Two days after treatment all control and RIP-M3 tg mice (n ϭ 5 per group) became diabetic (Fig. 2E). Taken together these results indicate that the insulin synthesis and secretion are not altered by the expression of M3.

Expression of M3 in ␤ cells blocks the development of diabetes induced by MLDS To test the effect of M3 on the development of diabetes we treated 6–10 wk-old male RIP-M3 mice and control littermates with either STZ (40 mg/kg) or vehicle for 5 consecutive days. As expected (32), Four weeks after the beginning of treatment 85% of the control mice treated with MLDS were diabetic. At this point only 35% of the RIP-M3 tg/wt mice and, remarkably, none of the homozygous RIP-M3 mice were diabetic (Fig. 3A). After 70 days all control mice were diabetic but only 60% of heterozygous mice and FIGURE 3. Expression of M3 in ␤ cells blocks the development of none of the homozygous RIP-M3 mice developed disease (n ϭ 5 diabetes induced by MLDS. A, Diabetes incidence in animals treated per group). with multiple low doses of STZ. Shown is the cumulative incidence of ϭ ᭺ ϭ F To exclude the possibility that RIP-M3 mice were resistant to diabetes in RIP-M3 tg/wt (n 25, ) and RIP-M3 tg/tg (n 13, ) mice and their non-tg (wt) littermates (n ϭ 24, ᮀ). Animals were con- the effects of STZ, we analyzed the expression of Glut-2 (the trans- sidered diabetic if blood glucose levels were higher than 250 mg/dl in porter for STZ (33)) in islets of RIP-M3 tg/wt, tg/tg, and control two consecutive measurements. B, Western blot analysis of islet ex- mice by Western blotting. The levels of Glut-2 protein in the islets tracts from controls and RIP-M3 mice (n ϭ 6) using Glut-2 Ab together of normal and tg mice were comparable (Fig. 3, C and D), sug- with actin Ab as an internal control. C, Densitometric scanning of West- gesting that the expression of M3 did not alter the mechanism of ern blots. The results are representative of two separate experiments STZ uptake into the cell. (p ϭ 0.44; one-way ANOVA). 4628 M3 PREVENTS MLDS-INDUCED DIABETES Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021

FIGURE 4. Expression of M3 in ␤ cells prevents recruitment of inflammatory cells. A, Semiquantitative analysis of islet infiltrates in the pancreas from control and RIP-M3 mice before (day 0) and after (days 7, 14, and 21) MLDS treatment. There is a significant difference in the number of infiltrated islets between RIP-M3 and control mice (p Ͻ 0.05; one-way ANOVA). B, Immunostaining for CD45 (red) and insulin (green) in the pancreata of control (wt), heterozygous (tg/wt), and homozygous (tg/tg) mice before (day 0) and after (days 7, 14, and 21) MLDS treatment. Scale bars, 25 ␮m.

Expression of M3 in ␤ cells prevents the recruitment of After 10 days of treatment, several chemokines were up-regulated inflammatory cells in control mice. However, there was no increase in chemokine Recent studies from our laboratory show that islet-specific expres- mRNA expression in islets from tg mice (data not shown). These sion of M3 blocks leukocyte recruitment induced by islet-specific results are consistent with the view that the main source of che- expression of CCL21 (26), CCL2, and CXCL13 (27). mokines at this point were the infiltrating cells. To test the hypothesis that M3 expression blocked STZ-induced diabetes by preventing chemokine-induced recruitment of inflam- M3 binds multiple chemokines expressed during insulitis with matory cells, we treated mice (n ϭ 3 per group) with MLDS and high affinity then sacrificed at 7, 14, and 21 days after the first injection. The Inflammatory stimuli generally result in the up-regulation of infiltration of CD45ϩ cells into the islets of control mice was first groups of chemokines rather than a single species, as reflected by seen on day 7 (Fig. 4, A and B), and the number of inflammatory the elevated expression of numerous chemokines in the MLDS cells and the frequency of infiltrated islets increased thereafter. By model described here. Previous studies have indicated that M3 day 21 most control islets were infiltrated by mononuclear cells binds to both murine and human chemokines from all four struc- and had lost normal morphologic integrity. In contrast, a small tural classes, thus acting as a broad-spectrum chemokine scavenger number of infiltrating cells was found in RIP-M3 tg/wt mice only (34, 35). However, the M3 affinities for several chemokines that after 21 days of treatment and the morphological appearance of are relevant to the MLDS model have not been reported. To es- the islets was normal. Remarkably, none of the homozygous tablish whether M3 binds to up-regulated inflammatory and ho- RIP-M3 mice showed infiltrating cells at day 21 ( p ϭ 0.035, meostatic chemokines, we measured its affinity for mCCL21 and one-way ANOVA), and the insulin-positive cells appeared nor- mCXCL10. Binding studies were conducted using a SPR-based mal (Fig. 4B). competition assay (J. M. Alexander-Brett and D. H. Fremont, sub- To determine whether the M3 blockade of inflammatory cell mitted for publication), which yielded affinities of 12 Ϯ 1 and influx altered the mRNA chemokine expression, we performed Q- 320 Ϯ 30 pM for mCCL21 and mCXCL10, respectively (Fig. 5A). PCR on total RNA isolated from islets before and after MLDS. It was also of interest to assess whether a single M3 dimer could The Journal of Immunology 4629

FIGURE 5. High-affinity M3 binding of relevant chemokines. A, Solution binding affinity of murine CCL21 and CXCL10 to M3. Representative titration curves are shown with equilibrium chemokine binding BBXB (Req) to surface-bound M3 plotted as a function of coinjected M3 concentration with corresponding fits to the data. Thus, M3 chemokine binding affinities are determined by the competitive inhibition of chip binding. B, The schematically depicted second-site binding assay was used to assess the ability of M3 dimers to simultaneously bind distinct chemokines. M3 is loaded with CCL2 with a 2:1 stoichiometry and bound to the chip via interaction with biotinylated hCCL2. Chemokine binding to the second free M3 chemokine binding site is qualitatively assessed by sensorgram response, shown here for 50 nM injections of CXCL10, CCL21, hXCL1 (K ϭ 500 pM), and VEGF used as a negative control. D Downloaded from

simultaneously engage two distinct chemokines. This question was the production of chemokines by resident inflammatory cells, http://www.jimmunol.org/ addressed using a two-site SPR binding assay in which M3 was endocrine cells, and endothelial cells and promoted the infil- immobilized to the sensor chip via interaction with the high-affin- tration of the islets, first by macrophages and subsequently by ity chemokine hCCL2, and chemokine binding to the second site lymphocytes (31). The infiltrating cells themselves represent a was demonstrated by injecting several chemokines over the M3- major source of chemokines, as suggested by our immunohis- CCL2 coupled sensor chip (shown schematically in Fig. 5B). The tochemical analysis. We propose that this initial burst in the chemokines mCCL21, mCXCL10, and hXCL1 all bind the avail- expression of chemokines contributes to the further recruitment able M3 second site, indicating that M3 is capable of simulta- of inflammatory cells and the destruction of the islets. Further neously binding relevant chemokines of different structural classes studies focusing on the temporal analysis of chemokine mRNA at opposite ends of the dimer (Fig. 5B). The lack of binding for the and protein will be required to evaluate the role of chemokines by guest on September 25, 2021 negative control protein VEGF demonstrates the specificity of this in the onset of diabetes triggered by MLDS. interaction. Although the changes in chemokine expression suggest a link with pathogenesis, they do not prove it. The results shown here Discussion indicate that chemokines are critical for pathogenesis. The expres- Autoimmune diseases are thought to result from complex interac- sion of a chemokine scavenger in the islets dramatically reduced tions between genetic and environmental factors. Although the cellular infiltration and blocked the development of diabetes. This mechanisms by which autoimmune diseases evolve in individuals effect was more pronounced in the islets from homozygous are inevitably comprised of numerous variables, there is evidence RIP-M3 mice, which expressed higher levels of M3 than the islets that infection may represent a key element in the development of of heterozygous mice. We believe that the blockade in cellular certain autoimmune responses leading to tissue-specific destruc- recruitment was caused by M3 inactivation of one or more che- tion (36–39). Leukocytes are frequently involved in the response mokines expressed during the course of MLDS treatment. The to infection and in autoimmune responses, but information on crystal structure of M3 shows that M3 dimerizes and generates mechanisms leading to their recruitment and the emergence of the a binding site for the N-terminal region of chemokines that autoimmune attack is lacking. precludes the binding to their receptors (42). M3 also uses elec- In diabetes, an accumulation of cells around the islets precedes trostatic mimicry to directly inhibit chemokine-glycosamino- the onset of clinical disease. We hypothesized that chemokines are glycan interactions for a diverse array of chemokines (D. H. critical determinants of the influx of leukocytes into the islets and, Alexander and J. M. Fremont-Brett, 2006, submitted for pub- thus, constitute one of the major component in the pathogenesis of lication). Glycosaminoglycan association is important for che- diabetes. To start addressing the role of chemokines in diabetes, mokine function, being a prerequisite for chemokine uptake, we have examined in a comprehensive and quantitative fashion the transcytosis to the apical side of the endothelial cell, and ap- expression of chemokines in the MLDS model. Our results show propriate solid-phase presentation to the passing leukocytes that of all the murine chemokine ligands, only two (CCL20 and (43). In vivo, M3 reduces mononuclear cellular responses after CCL19) were expressed, albeit at low levels, in pancreatic islets MHV-68-induced meningitis in mice (44) and blocks leukocyte of B6D2F1 mice before MLDS treatment. MLDS treatment in- recruitment to the pancreas induced by CCL21 (26), CXCL13, duced the high expression of several chemokines, including and CCL2 (27), respectively. CXCL9, CXCL10, and CCL2, before the onset of diabetes. The We suggest that these scavenging properties of M3 are essential expression of these chemokines was likely triggered by IFN-␥ for the reduced inflammation observed in the RIP-M3 tg mice. and TNF-␣ (40), cytokines whose expression has been docu- Many of the chemokines up-regulated in the MLDS model are mented in islets before the onset of MLDS-induced diabetes known to bind M3 with high affinity (34, 35). In this study we (41). The early expression of these cytokines likely influenced show that M3 binds the murine chemokines CCL21 and CXCL10 4630 M3 PREVENTS MLDS-INDUCED DIABETES with picomolar affinity (12 and 320 pM, respectively) (Fig. 5). 2002. Beta cells are responsible for CXCR3-mediated T-cell infiltration in insu- Further, we show that M3 is able to engage either of these che- litis. Nat. Med. 8: 1414–1420. mokines while simultaneously binding CCL2 at opposite ends of 14. Rollins, B. J. 1997. Chemokines. Blood 90: 909–928. 15. Homey, B., A. Muller, and A. Zlotnik. 2002. Chemokines: agents for the immu- the dimer structure, suggesting that M3 can effectively inhibit notherapy of cancer? Nat. Rev. Immunol. 2: 175–184. mixed populations of chemokines as observed in the insulitis mod- 16. Piemonti, L., B. E. Leone, R. Nano, A. Saccani, P. Monti, P. Maffi, G. Bianchi, els. As such, M3 may disrupt the proper presentation and function A. Sica, G. Peri, R. Melzi, et al. 2002. Human pancreatic islets produce and of CCL2 (42), CXCL10, and CCL21, important players regulating secrete MCP-1/CCL2: relevance in human islet transplantation. Diabetes 51: 55–65. the migration of monocytes and T cells that are critical for the 17. Cameron, M. J., G. A. Arreaza, M. Grattan, C. Meagher, S. Sharif, development of diabetes (19, 23). Although our results suggest that M. D. Burdick, R. M. Strieter, D. N. Cook, and T. L. Delovitch. 2000. Differential the primary site of chemokine blockade induced by M3 is the expression of CC chemokines and the CCR5 receptor in the pancreas is associ- endocrine pancreas, we cannot rule out that the trace amounts of ated with progression to type I diabetes. J. Immunol. 165: 1102–1110. 18. Chen, M. C., P. Proost, C. Gysemans, C. Mathieu, D. L. Eizirik, 2001. Monocyte M3 present in pancreatic lymph nodes and the bloodstream (not chemoattractant protein-1 is expressed in pancreatic islets from prediabetic NOD shown) may contribute to the effects seen here. mice and interleukin-1 ␤-exposed human and rat islet cells. Diabetologia 44: In conclusion, we demonstrate that chemokine expression is 325–332. a hallmark of insulitis promoted by MLDS treatment. This al- 19. Bouma, G., J. M. Coppens, S. Mourits, T. Nikolic, S. Sozzani, H. A. Drexhage, and M. A. Versnel. 2005. Evidence for an enhanced adhesion of DC to fibronectin tered expression is not limited to one or a few chemokines; and a role of CCL19 and CCL21 in the accumulation of DC around the pre- several chemokines are expressed at the same time, a pattern diabetic islets in NOD mice. Eur. J. Immunol. 35: 2386–2396. already observed in other conditions (8, 45–48). We also show 20. Hjelmstrom, P., J. Fjell, T. Nakagawa, R. Sacca, C. A. Cuff, and N. H. Ruddle. 2000. Lymphoid tissue homing chemokines are expressed in chronic inflamma- Downloaded from that a chemokine blockade prevents mice from developing in- tion. Am. J. Pathol. 156: 1133–1138. sulitis and diabetes induced by MLDS. Taken together, these 21. Ploix, C., D. Lo, and M. J. Carson. 2001. A ligand for the chemokine receptor results constitute direct evidence that chemokines are critical CCR7 can influence the homeostatic proliferation of CD4 T cells and progression determinants of MLDS-induced diabetes. Future work will be of autoimmunity. J. Immunol. 167: 6724–6730. directed to investigate whether M3 can block diabetes occurring 22. Christen, U., D. B. McGavern, A. D. Luster, M. G. von Herrath, and M. B. Oldstone. 2003. Among CXCR3 chemokines, IFN-␥-inducible protein of in autoimmune settings and to test whether it can prevent the 10 kDa (CXC chemokine ligand (CXCL) 10) but not monokine induced by IFN-␥ rejection of transplanted islets. (CXCL9) imprints a pattern for the subsequent development of autoimmune dis- http://www.jimmunol.org/ ease. J. Immunol. 171: 6838–6845. 23. Kim, S. H., M. M. Cleary, H. S. Fox, D. Chantry, and N. Sarvetnick. 2002. CCR4-bearing T cells participate in autoimmune diabetes. J. Clin. Invest. 110: Acknowledgments 1675–1686. We thank Limin Shang for expert technical assistance. We also thank Jay 24. Carvalho-Pinto, C., M. I. Garcia, L. Gomez, A. Ballesteros, A. Zaballos, Unkeless for critical comments on the manuscript and A. Zlotnik and R. de J. M. Flores, M. Mellado, J. M. Rodriguez-Frade, D. Balomenos, and Wall Malefyt for primer sequences. A. C. Martinez. 2004. Leukocyte attraction through the CCR5 receptor controls progress from insulitis to diabetes in non-obese diabetic mice. Eur. J. Immunol. 34: 548–557. 25. Proudfoot, A. E., T. M. Handel, Z. Johnson, E. K. Lau, P. LiWang,

Disclosures I. Clark-Lewis, F. Borlat, T. N. Wells, and M. H. Kosco-Vilbois. 2003. Glycos- by guest on September 25, 2021 The authors have no financial conflict of interest. aminoglycan binding and oligomerization are essential for the in vivo activity of certain chemokines. Proc. Natl. Acad. Sci. USA 100: 1885–1890. 26. Jensen, K. K., S. C. Chen, R. W. Hipkin, M. T. Wiekowski, M. A. Schwarz, C. C. Chou, J. P. Simas, A. Alcami, and S. A. Lira. 2003. Disruption of CCL21- References induced chemotaxis in vitro and in vivo by M3, a chemokine-binding protein 1. Foulis, A. K. 1987. C. L. Oakley lecture (1987): the pathogenesis of ␤ cell encoded by murine ␥herpesvirus 68. J. Virol. 77: 624–630. destruction in type I (insulin-dependent) diabetes mellitus. J. Pathol. 152: 27. Martin, A. P., C. Canasto-Chibuque, L. Shang, B. J. Rollins, and S. A. Lira. 2006. 141–148. The chemokine decoy receptor M3 blocks CC chemokine ligand 2 and CXC 2. Adorini, L., S. Gregori, and L. C. Harrison. 2002. Understanding autoimmune chemokine ligand 13 function in vivo. J. Immunol. 177: 7296–7302. diabetes: insights from mouse models. Trends Mol. Med. 8: 31–38. 28. Flodstrom, M., B. Tyrberg, D. L. Eizirik, and S. Sandler. 1999. Reduced sensi- 3. Yoon, J. W., H. S. Jun, and P. Santamaria. 1998. Cellular and molecular mech- tivity of inducible nitric oxide synthase-deficient mice to multiple low-dose strep- anisms for the initiation and progression of ␤ cell destruction resulting from the tozotocin-induced diabetes. Diabetes 48: 706–713. collaboration between macrophages and T cells. Autoimmunity 27: 109–122. 29. Gotoh, M., T. Maki, T. Kiyoizumi, S. Satomi, and A. P. Monaco. 1985. An 4. Elliott, J. I., H. Dewchand, and D. M. Altmann. 1997. Streptozotocin-induced improved method for isolation of mouse pancreatic islets. Transplantation 40: diabetes in mice lacking ␣␤ T cells. Clin. Exp. Immunol. 109: 116–120. 437–438. 5. Like, A. A., and A. A. Rossini. 1976. Streptozotocin-induced pancreatic insulitis: 30. Eizirik, D. L., G. S. Korbutt, and C. Hellerstrom. 1992. Prolonged exposure of new model of diabetes mellitus. Science 193: 415–417. human pancreatic islets to high glucose concentrations in vitro impairs the ␤-cell 6. Kwon, N. S., S. H. Lee, C. S. Choi, T. Kho, and H. S. Lee. 1994. Nitric oxide function. J. Clin. Invest. 90: 1263–1268. FASEB J. generation from streptozotocin. 8: 529–533. 31. Kolb-Bachofen, V., and H. Kolb. 1989. A role for macrophages in the patho- 7. Kolb-Bachofen, V., S. Epstein, U. Kiesel, and H. Kolb. 1988. Low-dose strep- genesis of type 1 diabetes. Autoimmunity 3: 145–154. tozotocin-induced diabetes in mice: electron microscopy reveals single-cell in- 32. Mabley, J. G., G. Hasko, L. Liaudet, F. Soriano, G. J. Southan, A. L. Salzman, sulitis before diabetes onset. Diabetes 37: 21–27. and C. Szabo. 2002. NF␬B1 (p50)-deficient mice are not susceptible to multiple 8. Luster, A. D. 2002. The role of chemokines in linking innate and adaptive im- low-dose streptozotocin-induced diabetes. J. Endocrinol. 173: 457–464. munity. Curr. Opin. Immunol. 14: 129–135. 33. Schnedl, W. J., S. Ferber, J. H. Johnson, and C. B. Newgard. 1994. STZ transport 9. Zlotnik, A., and O. Yoshie. 2000. Chemokines: a new classification system and and cytotoxicity: specific enhancement in GLUT2-expressing cells. Diabetes 43: their role in immunity. Immunity 12: 121–127. 1326–1333. 10. Rossi, D., and A. Zlotnik. 2000. The biology of chemokines and their receptors. Annu. Rev. Immunol. 18: 217–242. 34. van Berkel, V., J. Barrett, H. L. Tiffany, D. H. Fremont, P. M. Murphy, G. McFadden, S. H. Speck, and H. I. Virgin. 2000. Identification of a ␥ herpes- 11. Martin, A. P., E. C. Coronel, G. Sano, S. C. Chen, G. Vassileva, virus selective chemokine binding protein that inhibits chemokine action. J. Vi- C. Canasto-Chibuque, J. D. Sedgwick, P. S. Frenette, M. Lipp, G. C. Furtado, and rol. 74: 6741–6747. S. A. Lira. 2004. A novel model for lymphocytic infiltration of the thyroid gland generated by transgenic expression of the CC chemokine CCL21. J. Immunol. 35. Parry, C. M., J. P. Simas, V. P. Smith, C. A. Stewart, A. C. Minson, S. Efstathiou, 173: 4791–4798. and A. Alcami. 2000. A broad spectrum secreted chemokine binding protein 12. Grewal, I. S., B. J. Rutledge, J. A. Fiorillo, L. Gu, R. P. Gladue, R. A. Flavell, encoded by a herpesvirus. J. Exp. Med. 191: 573–578. and B. J. Rollins. 1997. Transgenic monocyte chemoattractant protein-1 36. Yoon, J. W., S. H. Ihm, and K. W. Kim. 1989. Viruses as a triggering factor of (MCP-1) in pancreatic islets produces monocyte-rich insulitis without diabe- type 1 diabetes and genetic markers related to the susceptibility to the virus- tes: abrogation by a second transgene expressing systemic MCP-1. J. Immu- associated diabetes. Diabetes Res. Clin. Pract. 7(Suppl. 1): S47–S58. nol. 159: 401–408. 37. Honeyman, M. C., B. S. Coulson, N. L. Stone, S. A. Gellert, P. N. Goldwater, 13. Frigerio, S., T. Junt, B. Lu, C. Gerard, U. Zumsteg, G. A. Hollander, and L. Piali. C. E. Steele, J. J. Couper, B. D. Tait, P. G. Colman, and L. C. Harrison. 2000. The Journal of Immunology 4631

Association between rotavirus infection and pancreatic islet autoimmunity in 43. Middleton, J., S. Neil, J. Wintle, I. Clark-Lewis, H. Moore, C. Lam, M. Auer, children at risk of developing type 1 diabetes. Diabetes 49: 1319–1324. E. Hub, and A. Rot. 1997. Transcytosis and surface presentation of IL-8 by 38. von Herrath, M. G., R. S. Fujinami, and J. L. Whitton. 2003. Microorganisms and venular endothelial cells. Cell 91: 385–395. autoimmunity: making the barren ﬁeld fertile? Nat. Rev. Microbiol. 1: 151–157. 44. van Berkel, V., B. Levine, S. B. Kapadia, J. E. Goldman, S. H. Speck, and 39. Marks, D. J., N. A. Mitchison, A. W. Segal, and J. Sieper. 2006. Can unresolved H. W. T. Virgin. 2002. Critical role for a high-afﬁnity chemokine-binding protein infection precipitate autoimmune disease? Curr. Top. Microbiol. Immunol. 305: in ␥-herpesvirus-induced lethal meningitis. J. Clin. Invest. 109: 905–914. 105–125. 40. Mahalingam, S., and G. Karupiah. 1999. Chemokines and chemokine receptors in 45. Arimilli, S., W. Ferlin, N. Solvason, S. Deshpande, M. Howard, and S. Mocci. infectious diseases. Immunol. Cell Biol. 77: 469–475. 2000. Chemokines in autoimmune diseases. Immunol. Rev. 177: 43–51. 41. Herold, K. C., V. Vezys, Q. Sun, D. Viktora, E. Seung, S. Reiner, and 46. Gerard, C., and B. J. Rollins. 2001. Chemokines and disease. Nat. Immunol. 2: D. R. Brown. 1996. Regulation of cytokine production during development of 108–115. autoimmune diabetes induced with multiple low doses of streptozotocin. J. Im- 47. Gerszten, R. E., F. Mach, A. Sauty, A. Rosenzweig, and A. D. Luster. 2000. munol. 156: 3521–3527. 42. Alexander, J. M., C. A. Nelson, V. van Berkel, E. K. Lau, J. M. Studts, T. J. Brett, Chemokines, leukocytes, and atherosclerosis. J. Lab. Clin. Med. 136: 87–92. S. H. Speck, T. M. Handel, H. W. Virgin, and D. H. Fremont. 2002. Structural 48. Bone-Larson, C. L., K. J. Simpson, L. M. Colletti, N. W. Lukacs, S. C. Chen, basis of chemokine sequestration by a herpesvirus decoy receptor. Cell 111: S. Lira, S. L. Kunkel, and C. M. Hogaboam. 2000. The role of chemokines in the 343–356. immunopathology of the liver. Immunol. Rev. 177: 8–20. Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021