Page 1 of 28 Diabetes
Title: Epigenetic mechanisms linking diabetes and synaptic impairments
Running title: Diabetes and synaptic dysfunction
Author: Jun Wang1,3, Bing Gong1, Wei Zhao1, Cheuk Tang2, Merina Varghese1, Tuyen Nguyen2, Weina Bi1, Amanda Bilski1, Shimul Begum1, Prashant Vempati1, Lindsay Knable1, Lap Ho1, Giulio M. Pasinetti1,3
Author affiliation: 1Department of Neurology, 2Department of Radiology, Mount Sinai School of Medicine, New York, New York 10029; 3Geriatric Research, Education and Clinical Center, James J. Peters Veterans Affairs Medical Center, Bronx, New York 10468.
Corresponding author: Giulio Maria Pasinetti, M.D., Ph.D. Department of Neurology The Mount Sinai School of Medicine 1 Gustave L. Levy Place, Box 1137 New York, NY 10029 Phone: (212) 241 7938 Fax: (212) 876 9042 Email: [email protected]
Word count: 3713
Number of figures: 5
Number of table: 1
1
Diabetes Publish Ahead of Print, published online October 23, 2013 Diabetes Page 2 of 28
ABSTRACT
Diabetes is one of the major risk factors for dementia. However, the molecular mechanism underlying the risk of diabetes for dementia is largely unknown. Recent studies revealed that epigenetic modifications may play a role in the pathogenesis of diabetes. We hypothesized that diabetes may cause epigenetic changes in the brain that may adversely affect synaptic function. We found significant elevation in the expression of histone deacetylases (HDACs) class IIa in the brains of diabetic subjects compared to control subjects, and these changes coincide with altered expression of synaptic proteins.
In a mouse model of diet induced type II diabetes mellitus (T2DM), we found that, similar to humans,
T2DM mice also showed increased expression of HDAC IIa in the brain and these alterations were associated with increased susceptibility to oligomeric Aβ induced synaptic impairments in the hippocampal formation and eventually led to synaptic dysfunction. Pharmacological inhibition of HDAC
IIa was able to restore synaptic plasticity. Our study demonstrated that diabetes may induce epigenetic modifications affecting neuropathological mechanisms in the brain leading to increased susceptibility to insults associated with neurodegenerative or vascular impairments. Our study provides, for the first time, an epigenetic explanation for the increased risk of diabetic patients to develop dementia.
2
Page 3 of 28 Diabetes
INTRODUCTION
The prevalence of dementia increases with age. It is estimated that over 36 million people worldwide
are currently living with this devastating disease and the prevalence is expected to increase to 66
million by 2030 and 115 million by 2050 (1). Dementia can be caused by a number of progressive
diseases such as Alzheimer’s disease (AD) and vascular dementia (VaD). Mounting evidence suggests
that cognitive impairments associated with dementia may be traced back to neuropathological
conditions initiated several decades before clinical onset. Therefore, clinical development of novel
interventions for dementia is now based on mechanisms associated with primary and/or secondary
prevention.
Diabetes increases the risk of both AD dementia and VaD (2 9). Based on the National
Diabetes Health Fact Sheet, approximately 8.3% of Americans have diabetes and, like dementia, the
prevalence of diabetes increases with age; currently 26.9% of people 65 years or older have diabetes
(10). Despite national and international campaign efforts to counter T2DM, its prevalence is still rising.
T2DM and hyperglycemia are associated with cognitive dysfunction and an increased risk for dementia,
including AD type dementia. Three longitudinal studies conducted by Yaffe (11) , Komulainen (12) and
Dik (13) independently showed that T2DM is related to a higher risk of cognitive decline. A meta
analysis performed by Profenno and colleagues (14) reviewed thirteen longitudinal epidemiological
studies that examined the association between diabetes and dementia, and found that diabetes
significantly and independently increases one’s risk for dementia.
Emerging evidence has demonstrated that diabetes associated chromatin modifications
pertinent to epigenetic mechanisms may play an important role in the pathogenesis of diabetes (15;16).
For example, epigenetic alterations of histone deacetylases (HDACs) cause decreases in H3 and H4
acetylation at the proximal promoter of pancreatic and duodenal homeobox factor 1 (Pdx-1) in
pancreatic β cells, leading to defects in glucose homeostasis and insulin resistance and eventually
leading to T2DM (17). Similarly, histone modifications of glut4 mediated by DNA methyltransferase 3
Diabetes Page 4 of 28
(Dnmt) and HDACs result in reduced transcription of glucose transporter 4 in skeleton muscle in
intrauterine growth restricted offsprings (18).
Epigenetic mechanisms have also been widely studied in the brain. Histone methylation and
histone acetylation in the hippocampal formation play an important role in modulating synaptic strength
following neuronal activation (19 26). Mice that lack both Dnmt1 and Dnmt3a exhibited abnormalities in
long term potentiation (LTP) and long term depression (LTD) following stimulations in CA1 synapses,
and these dysfunctions were associated with impaired learning and memory (19). HDAC2 has emerged
as a major histone modification enzyme in modulating synaptic plasticity and long term memory. Over
expression of HDAC2 is associated with structural dysfunction including reduced number of dendritic
spine and synapses as well as functional deficits such as impaired synaptic plasticity and memory
function (27). Moreover, pharmacological inhibition of HDACs by HDACi such as trichostatin A (TSA)
resulted in increased LTP responses, further confirming the role of histone acetylation in brain function
(23).
In the present study, we tested whether diabetic condition might alter the epigenetic mechanisms in the brain, which may lead to structural or functional changes that ultimately influence the ability of the brain to cope with conditions associated with neurological disorders, such as AD.
4
Page 5 of 28 Diabetes
RESEARCH DESIGN AND METHODS
Brain specimen Human postmortem brain specimens from T2DM and age matched non diabetic
(control) cases were obtained from the Icahn School of Medicine at Mount Sinai, Department of
Psychiatry Brain Bank. The brains were donated by deceased residents of the Jewish Home and
Hospital (JHH, Manhattan, NY and Bronx, NY). Diabetic or non diabetic cases were identified using
criteria previously described (28). Specifically, patients were diagnosed with diabetes either by a
geriatrician or an internist based on the American Diabetes Association criteria symptoms of diabetes
plus casual plasma glucose concentration > 200 mg/dl; fasting plasma glucose > 126 mg/dl; 2 hour
plasma glucose > 200 mg/dl during an oral glucose tolerance test. We only included the subjects with
type 2 diabetes. Detailed demographic information is presented in Table 1. Clinical Dementia Rating
(CDR) scale was used to assess cognitive and functional impairments associated with dementia. The
cohort used in this study was devoid of any significantly cerebrovascular disease (CVD)
Assessment of gene expression Total RNA from brain tissues (hippocampus) was isolated using
RNeasy Mini Kit (Qiagen, Valencia, CA) and reverse transcribed using SuperScript III first strand
synthesis supermix for qRT PCR (invitrogen, Carlsbad, CA) according to manufacturer’s instruction.
Epigenetic chromatin modification enzymes PCR array for human or mouse (Qiagen, Valencia, CA)
were used to evaluate the levels of gene expression. Expression of synaptic plasticity gene PSD95 and
synaptophysin in the brains of T2DM mice were measured in 4 replicates by quantitative RT PCR using
Maxima SYBR Green master mix (Fermentas) in ABI Prism 7900HT with primers amplifying the target
genes: PSD95 (forward: CGGGAGAAAATGGAGAAGGAC, reverse: GCATTGGCTGAGACATCAAG);
Synaptophysin (forward: AGTGCCCTCAACATCGAAG, reverse: GCCACGGTGACAAAGAATTC).
Mouse hypoxanthine phosphoribosyltransferase (HPRT, forward: CCCCAAAATGGTTAAGGTTGC,
reverse: AACAAAGTCTGGCCTGTATCC) expression level was used as an internal control. Data were 5
Diabetes Page 6 of 28
normalized using the 2 Ct method (29). Levels of target gene mRNAs were expressed relative to those in control groups and plotted in GraphPad Prism.
Assessment of protein expression by Western blotting analysis Brain samples (the same
hippocampal tissue as used in the gene expression studies) were extracted with radio
immunoprecipitation assay (RIPA) buffer and boiled in Laemmli sample buffer for 5 min. Proteins were
separated by gel electrophoresis using 10% sodium dodecyl sulfate–polyacrylamide gels and
electrotransferred onto nitrocellulose membranes, blocking with 5% nonfat dried milk (Sigma Aldrich, St.
Louis, MO) in Tris buffered saline. Membranes were probed with primary antibodies anti PSD95
(Millipore, Billerica, MA, 1:2500) or anti synaptophysin (Sigma Aldrich, 1:5000) at 4 oC overnight, followed by HRP conjugated secondary antibodies. Specific protein signals were detected using the enhanced chemiluminescence system (ECL plus; PerkinElmer LAS, Inc., Boston, MA, USA) and signals was quantified by densitometric scanning (GS 800; Bio Rad, Hercules, CA) and analyzed using
Quantity One software (Bio Rad). Beta actin (Sigma Aldrich, 1:3000) was served as the loading control.
Mouse model and treatment Female C57BL6/J mice were purchased from the Jackson Laboratory
(Bar Harbor, ME) and housed in the centralized animal care facility of the Center for Comparative
Medicine and Surgery (CCMS) at Icahn School of Medicine at Mount Sinai. The C57BL/6J mouse
develops hyperinsulinemia and hyperglycemia when fed a high fat diet (30). Mice were randomly
grouped into two groups and received the following treatment starting at approximately 3 months of
age: Control mice were treated with regular diet (CTRL group, 10 kcal% fat, Research Diets D12450B),
T2DM mice were treated with a high fat diet (T2DM group, 60 kcal% fat, Research Diets, D12492). All
animals were maintained on a 12:12 h light/dark cycle with lights on at 07:00 h in a temperature
controlled (20 ± 2 °C) vivarium and all procedures were approved by the MSSM IACUC.
Intra peritoneal glucose tolerance test (IGTT) and fasting insulin measurements IGTT was
6
Page 7 of 28 Diabetes
performed as previously reported (31;32). Specifically, mice were given a single dose of intraperitoneal
glucose (2 g/kg BW) postprandially, and blood was collected from the tail vein periodically over a 3 h
period. Blood glucose content was assessed using the Contour blood glucose System (Bayer, IN).
Insulin was measured using the mouse serum adipokine multiplex MAP kit from Millipore (Billerica,
MA).
Electrophysiological Recordings Mice were sacrificed by decapitation and the brains were quickly
removed. Hippocampal slices (350 m) were placed into oxygenated artificial cerebrospinal fluid
(ACSF) at 29 oC for a minimum of 90 min to acclimatize. Slices were then transferred to a recording
chamber and perfused continuously with oxygenated ACSF in the presence or absence of 60nM of
oligomeric Aβ (oAβ) at 32 °C. For extracellular recordings: CA1 field excitatory postsynaptic potentials
(fEPSPs) were recorded by placing stimulating and recording electrodes in CA1 stratum radiatum.
Basal synaptic transmission was assayed by plotting the stimulus voltages against slopes of fEPSP.
For long term potentiation (LTP) experiments, a 15 min baseline was recorded every min at an intensity
that evokes a response ~35% of the maximum evoked response. LTP was induced using θ burst
stimulation (4 pulses at 100 Hz, with the bursts repeated at 5 Hz and each tetanus including three 10
burst trains separated by 15 s) and fEPSPs were monitored for 60 min to assess the magnitude of
potentiation.
Functional Magnetic Resonance Imaging (fMRI) Imaging The Bruker Biospec 70/30 system, a 7T
micro MRI scanner, was used. Prior to scanning, mice were anesthetized with 2% Isofluorane in NO2
(75%) and O2 (23%). They were then positioned onto the scanner bed. Anesthesia was maintained at
1.5% isofluorane throughout the scan time. Data acquisition was done using a 4 channel mouse brain
dedicated phased array coil as follows: after a localizer we manually shimmed the brain region for
optimal signal and signal distortion. The resting state fMRI was acquired using an EPI BOLD sequence
7
Diabetes Page 8 of 28
with the following protocol: Segmented EPI (4x), TR=1500ms, TE=18.9ms, Matrix=96x96,
FOV=12.8mm, slice thickness=1.1mm, 11 slices. Total acquisition time was around 5 mins per scan; 3
scans were acquired for each mouse. Analysis Preprocessing of the functional images began by
excluding scans where there was movement. Manual brain extraction was then performed on the
mean functional image. A study specific template was created based on all the mean functional images
using FSL. Independent component analysis (ICA) was used to identify unique networks of resting state
activity using MELODIC (33) as implemented in FSL. We visually identified the DMN from the networks
produced by FSL. The default mode network (DMN) was defined as containing orbital cortex, cingulate
cortex and hippocampal regions according to the literature (34).Group ICA was performed and the DMN
and sensory motor were visually identified for dual regression analysis. General linear modeling and
permutation based inference testing (RANDOMISE) were used to test for group differences and
symptom severity correlates of the DMN (35;36).
Primary neuron culture and MC1568 treatment Embryonic day 16 cortico hippocampal neuronal
cultures were prepared from C57BL6/J mice as previously described (32). Neurons were seeded on
poly D lysine–coated 6 well plates and cultured in Neurobasal medium supplemented with 2% B27, 0.5
mM L glutamine and 1% penicillin streptomycin (Gibco BRL) in the tissue culture incubator at 37 oC
with 5% CO2. Following 5 days in vitro culturing, the neurons were treated either with 200nM MC1568
(Selleckchem) or vehicle for 16 18 hours. Cells were washed once with cold PBS before RNA isolation.
Overall statistics In these studies, all values are expressed as mean and standard error of the mean
(SEM). Differences between means were analyzed using either two way repeated measures ANOVAs
or two tailed student t test. In all analyses, the null hypothesis was rejected at the 0.05 level. All
statistical analyses were performed using the Prism Stat program (GraphPad Software, Inc.).
8
Page 9 of 28 Diabetes
RESULTS
Differential regulation of histone deacetylase IIa is associated with impaired synaptic integrity in
the brains of diabetic subjects To test whether there are epigenetic changes in the brains of diabetic
patients, we measured the expressions of epigenetic chromatin modification enzymes in the brains of
diabetic patients and normal controls using a PCR based array. We found that there are significant
changes in the expression of select chromatin modification enzymes, particularly HDAC class IIa (Fig.
1A), while there are no changes with regard to the expression of HDAC class I (Fig. 1B). Specifically,
over 50% upregulation of HDAC4, 7 and 9 were observed in the brains of diabetic subjects, as well as
an almost two fold increase in HDAC5 expression compared to the non diabetic controls.
We next tested whether diabetes induced epigenetic modifications in the brain might be associated with
the modulation of neuronal activity at the level of synapse. We examined the levels of proteins involved
in synaptic plasticity in the pre and postsynaptic compartments as indices for synaptic integrity in the
control and T2DM subjects. Western blot was used to examine the levels of synaptophysin, an
important presynaptic protein responsible for synaptic vesicle biogenesis and recycling, and
postsynaptic density protein 95 (PSD 95), the most abundant scaffolding protein involved in recruiting
and anchoring glutamate receptor subunits in PSD. We found that the levels of synaptophysin and
PSD 95 were both significantly lower in postmortem brain specimens from the T2DM subjects
compared to the control subjects (Fig. 1C and inset). Moreover, correlation studies showed that the
expression of HDAC5 was significantly reverse correlated with PSD95 (p<0.05) and synaptophysin
(p<0.01, Fig, 1D). The expression of HDAC7 was significantly reverse correlated with synaptophysin
(p<0.05) but had no correlation with PSD95. We also found that the expression of HDAC9 showed non
significant reverse correlations with the expression of PSD95 (p=0.085) and synaptophysin (p=0.084).
We did not find any correlation between HDAC4 and the expression of synaptic proteins.
9
Diabetes Page 10 of 28
Elevated HDAC IIa in the brain of a mouse model of diabetes Based on the specific HDAC changes observed in the post mortem brains from diabetic subjects, we tested whether diabetic conditions can causally induce HDAC IIa alteration in the brain. We used the C57BL/6J mouse as a model of human
T2DM, because it develops hyperinsulinemia and hyperglycemia when fed a diabetogenic diet but remains physically normal when fed low fat chow (30). We treated mice with a regular low fat diet or the diabetogenic diet starting at 2 months of age. Following 6 months of chronic diet treatment, the T2DM mice developed severe diabetes including increased baseline fasting glucose, and impaired insulin sensitivity and glucose tolerance as compared to the CTRL mice (Fig. 2A, B and C). Examination of chromatin modification enzyme expressions in the brains following 6 months diabetogenic diet treatment revealed that, similar to the human data, two of the class IIa HDACs are upregulated in the brains of T2DM mice. Most notably, HDAC5 was significantly upregulated, 4 fold, and HDAC9 by 2 fold
(Fig. 2D). We did not find any changes in the expression of Class I HDACs including HDAC 1, 2, 3 and
8 in the brain. HDAC 10, which belongs to HDAC IIb, was significantly reduced in the T2DM mouse brains, while there was no change in the expression of HDAC 6 and HDAC 11.
Diabetes induced HDAC IIa upregulation is associated with increased synaptic susceptibility to oligomeric Aβ insults We next tested whether the epigenetic changes in the brain of T2DM mice coincide with synaptic impairments. Electrophysiological studies were performed on the hippocampal slices isolated from the T2DM mice. We found that hippocampal slices derived from the T2DM mice following 6 months of diabetogenic diet treatment had normal electrophysiological responses following tetanus stimulation (data not shown). However, these hippocampal slices had a much lower threshold to oligomeric Aβ1 42 (oAβ) induced LTP deficits. Normally, healthy hippocampal slices show compromised LTP when exposed to 200 nM oAβ (data not shown). However, hippocampal slices derived from T2DM mice showed limited potentiation following tetanic stimulation in the presence of 60 nM of oAβ, while slices from strain , age and gender matched mice on the control diet showed robust
LTP under the same conditions (Fig. 3A). Consistent with previous observations, oAβ had no effect on 10
Page 11 of 28 Diabetes
basal synaptic transmission (37) (Fig. 3B). Synaptic deficits were exacerbated with prolonged diabetic
conditions. While hippocampal slices isolated from T2DM mice, following 6 months of diabetogenic diet
treatment, showed normal LTP response in the absence of oAβ, slices isolated from mice following 10
months of treatment showed compromised LTP responses (Fig 3C). In the diabetic mice, the LTP
responses were 153.48±±±5.05% 60 minutes after the theta burst stimulus while in the CTRL mice, the
responses were 233.97±±±14.82% (p<0.01), further stressing that diabetic conditions might adversely
influence brain synaptic function and may eventually lead to cognitive impairments.
LTP deficits coincide with abnormal brain connectivity in T2DM mice To test whether diabetic
condition induced epigenetic alterations/synaptic impairments in the brain might be associated with
brain biology changes, we used MRI imaging to objectively measure the biological effects of diabetic
condition on the brain. We used fMRI with blood oxygenation level dependent (BOLD) contrast to
examine the brain connectivity in T2DM and control mice, following 10 months treatment. We found
significant difference between the CTRL and T2DM mice in the Default Mode Network (DMN).
Compared to CTRL mice, T2DM mice had significantly stronger signal intensities in the DMN (Fig. 4A)
as well as in the sensory/motor cortex regions (Fig. 4B). The green color represents the group resting
state network and the dark blue color (red arrows) represents significant difference between CTRL and
T2DM.
Inhibition of HDAC class IIa restores LTP response in brain slices isolated from T2DM mice and
increases the expression of synaptic structure proteins in primary neurons To confirm whether
HDAC IIa might be responsible for the synaptic impairment we observed in the electrophysiology study
on the T2DM mice treated with diabetogenic diet for 10 months (Fig. 3C), we treated hippocampal
slices isolated from these mice with an HDAC IIa specific inhibitor, MC1568 (38;39), and recorded the
LTP responses. We found that ex. vivo treatment with MC1568 significantly improved LTP responses
compared to the vehicle treated slices. In the vehicle treated diabetic brain slices, 60 minutes after the
11
Diabetes Page 12 of 28
theta burst stimulus, the LTP responses were 151.85±±±8.64% while in the MC1568 treated diabetic
slices, the responses were 202.51±±±12.08% (p<0.01, Fig.5A). There was no difference in basal synaptic
transmission (Fig. 5B). Similarly, we also found that ex. vivo MC1568 treatment promoted the LTP in
brain slices from T2DM mice following 6 months diabetogenic diet treatment when challenged with
60nM of oAβ (from 156.58±4.48% to 198.02±10.28%, p<0.01). In control studies, we found that 200nM
MC1568 treatment did not affect LTP responses in hippocampal slices from mice treated with regular diet.
We also tested whether pharmacological inhibition of HDAC IIa could influence some of the indices of neuronal activity. In primary neurons derived from C57BL6/J mice, treatment with MC1568 significantly increased the transcription level of the synaptic structure proteins PSD 95, synaptophysin and brain derived neurotrophic factor (BDNF) (Fig. 5C), which are important molecules for learning and memory, thus confirming the role of HDAC IIa in the regulation of synaptic activity.
12
Page 13 of 28 Diabetes
DISCUSSION
Diabetes mellitus has become an epidemic and the prevalence in the U.S. is projected to reach 39
million in 2050. As one of the major causes of functional disability, this disease poses tremendous
burden on the health system including medical expenses, costs for caregivers and reduced productivity.
Diabetes is one of the major causes of morbidity and mortality and is associated with long term
complications that affect the peripheral as well as the central nervous system.
Diabetes has been linked to cognitive impairment and an increased risk factor for dementia,
including AD type dementia. Hyperglycemia induced metabolic and vascular disturbances are well
acknowledged, however, the exact mechanisms underlying cognitive dysfunction in diabetes are
unclear. We found that select chromatin modification enzymes, specifically HDAC class IIa, were
upregulated in the brains of diabetic patients and this increase was associated with reduced expression
of synaptic proteins that are important for synaptic structural integrity and function. Using an animal
model of T2DM, we found similar HDAC IIa changes in the brains and these alterations coincided with
increased susceptibility of synaptic function to amyloid toxicity. In addition, prolonged diabetic condition
exacerbated the observed synaptic dysfunction. Since MRI has been widely used to assess
hemodynamic responses related to neural activity in the brain; we used resting state functional MRI to
investigate the regionally connected functional networks, e.g., motor/sensory cortex, hippocampus,
amygdala, striatum, visual, etc. in the T2DM mouse brains. We found that T2DM mice exhibited
increased signal intensity both in the hippocampal formation and the sensory motor in the cortex,
suggesting that T2DM brain might not be functioning efficiently and requires much more energy to
accomplish a task compared to the normal efficient brain (40;41). It is also possible that a T2DM brain
may not be signaling coherently and the increase in signaling is a result of haphazard signaling. Our
findings are consistent with the human imaging and epidemiology studies demonstrating that
progressive cerebral atrophy is associated with prolonged diabetic condition (42 46) and diabetic
13
Diabetes Page 14 of 28
individuals have an increased risk of developing cognitive dysfunction, including mild cognitive impairment and dementia (6 8;47) .
HDACs are a family of enzymes that remove the acetyl moiety of lysine residues from the N terminus of histone proteins, leading to chromatin compaction and thus transcription repression. Both class I and class II HDACs are abundantly expressed in the brains and have been shown to regulate neuronal activity that are essential for synaptic function, as well as for learning and memory. Our study for the first time demonstrates that diabetic condition can causally induce changes in HDAC levels in the brain, which in turn, trigger a detrimental molecular cascade that leads to compromised neuronal structure integrity and synaptic plasticity. Our study also demonstrates that diabetic brains are more susceptible to oAβ induced synaptic toxicity. oAβ is increasingly accepted as one of the major culprits for AD dementia. Cognitive deterioration in AD is directly linked to the brain accumulation of extracellular soluble oligomeric Aβ species, rather than amyloid plaque deposition (49;50). Previous epidemiological studies showed that the age of onset, duration and severity of diabetes can influence the incidence of mild cognitive impairment (MCI) (48). This is consistent with our findings that six month diabetogenic diet treatment resulted in increased susceptibility to oAβ, while prolonging the diabetic condition for an additional 4 months resulted in reduced synaptic response in the absence of exogenous insults. Thus our results may provide mechanistic explanations of the epidemiological observation that diabetic subjects have an increased risk of developing AD dementia. Notably, HDACs are capable of regulating many cellular and molecular pathways involved in synaptic function and learning and memory. It is possible that modulation of other molecular mechanisms, such as BDNF, cAMP response element binding (CREB) signaling and protein kinase mediated hyperphosphorylation of microtubule binding protein tau, can all contribute to the phenomenon observed in our study. These mechanisms need to be further investigated.
Diabetes is a multifaceted metabolic disorder that affects both the peripheral as well as the central nervous system. Based on our findings, it is plausible that the epigenetic alterations in diabetic brains may not only make the brain more susceptible to oAβ, but also to other insults such as 14
Page 15 of 28 Diabetes
aberrantly aggregated neurofibrillary tangles made of hyperphosphorylated tau, the other pathological
hallmark of AD. It is also possible that these changes make the brains more vulnerable to infarction and
small vessel disease, which may lead to vascular dementia and other insults such as inflammation and
advanced glycation end products that are prevalent in diabetes. Future research on the relationship of
diabetes induced alteration of epigenetic mechanisms and the susceptibility to these potential diabetes
associated pathologic changes will further elucidate the molecular mechanisms underlying the
increased risk of diabetic patients to develop dementia.
15
Diabetes Page 16 of 28
Acknowledgement:
This study was supported by discretionary funding to GMP. No conflict of interest exists for all authors
of this manuscript.
We would like to thank Dr. Vahram Haroutunian, Ph.D of Department of Psychiatry and Neurology from
Mount Sinai School of Medicine, for providing us with the samples from the brain bank.
Author contributions: J.W, L.H and G.M.P designed the studies; J.W, B.G, W.Z, M.V, T.N, W.B, A.B,
S.B, P.V and L.K performed experiments. J.W and G.M.P wrote the manuscript.
G.M.P. is the guarantor of this work and, as such, had full access to all the data in the study and takes
responsibility for the integrity of the data and the accuracy of the data analysis.
The authors acknowledge the editorial assistance of Ms. Samara Levine of the Department of
Neurology at the Icahn School of Medicine for help with preparing the manuscript.
16
Page 17 of 28 Diabetes
Reference List
1. Alzheimer's Disease International. World Alzheimer Report 2009. London : Alzheimer's Disease International. 2009.
2. Arvanitakis,Z, Wilson,RS, Bienias,JL, Evans,DA, Bennett,DA: Diabetes mellitus and risk of Alzheimer disease and decline in cognitive function. Arch Neurol 61:661 666, 2004
3. Luchsinger,JA, Tang,MX, Shea,S, Mayeux,R: Hyperinsulinemia and risk of Alzheimer disease. Neurology 63:1187 1192, 2004
4. Hassing,LB, Grant,MD, Hofer,SM, Pedersen,NL, Nilsson,SE, Berg,S, McClearn,G, Johansson,B: Type 2 diabetes mellitus contributes to cognitive decline in old age: a longitudinal population based study. J Int Neuropsychol Soc 10:599 607, 2004
5. Leibson,CL, Rocca,WA, Hanson,VA, Cha,R, Kokmen,E, O'Brien,PC, Palumbo,PJ: Risk of dementia among persons with diabetes mellitus: a population based cohort study. Am J Epidemiol 145:301 308, 1997
6. Xu,WL, Qiu,CX, Wahlin,A, Winblad,B, Fratiglioni,L: Diabetes mellitus and risk of dementia in the Kungsholmen project: a 6 year follow up study. Neurology 63:1181 1186, 2004
7. Ott,A, Stolk,RP, van,HF, Pols,HA, Hofman,A, Breteler,MM: Diabetes mellitus and the risk of dementia: The Rotterdam Study. Neurology 53:1937 1942, 1999
8. MacKnight,C, Rockwood,K, Awalt,E, McDowell,I: Diabetes mellitus and the risk of dementia, Alzheimer's disease and vascular cognitive impairment in the Canadian Study of Health and Aging. Dement Geriatr Cogn Disord 14:77 83, 2002
9. Peila,R, Rodriguez,BL, Launer,LJ: Type 2 diabetes, APOE gene, and the risk for dementia and related pathologies: The Honolulu Asia Aging Study. Diabetes 51:1256 1262, 2002
10. Steinman,MA, Lee,SJ, John,BW, Miao,Y, Fung,KZ, Moore,KL, Schwartz,JB: Patterns of multimorbidity in elderly veterans. J Am Geriatr Soc 60:1872 1880, 2012
11. Yaffe,K, Haan,M, Blackwell,T, Cherkasova,E, Whitmer,RA, West,N: Metabolic syndrome and cognitive decline in elderly Latinos: findings from the Sacramento Area Latino Study of Aging study. J Am Geriatr Soc 55:758 762, 2007
12. Komulainen,P, Lakka,TA, Kivipelto,M, Hassinen,M, Helkala,EL, Haapala,I, Nissinen,A, Rauramaa,R: Metabolic syndrome and cognitive function: a population based follow up study in elderly women. Dement Geriatr Cogn Disord 23:29 34, 2007
13. Dik,MG, Jonker,C, Comijs,HC, Deeg,DJ, Kok,A, Yaffe,K, Penninx,BW: Contribution of metabolic syndrome components to cognition in older individuals. Diabetes Care 30:2655 2660, 2007
14. Profenno,LA, Porsteinsson,AP, Faraone,SV: Meta analysis of Alzheimer's disease risk with obesity, diabetes, and related disorders. Biol Psychiatry 67:505 512, 2010
17
Diabetes Page 18 of 28
15. Gray,SG, De,MP: Role of histone and transcription factor acetylation in diabetes pathogenesis. Diabetes Metab Res Rev 21:416 433, 2005
16. Pinney,SE, Simmons,RA: Epigenetic mechanisms in the development of type 2 diabetes. Trends Endocrinol Metab 21:223 229, 2010
17. Park,JH, Stoffers,DA, Nicholls,RD, Simmons,RA: Development of type 2 diabetes following intrauterine growth retardation in rats is associated with progressive epigenetic silencing of Pdx1. J Clin Invest 118:2316 2324, 2008
18. Raychaudhuri,N, Raychaudhuri,S, Thamotharan,M, Devaskar,SU: Histone code modifications repress glucose transporter 4 expression in the intrauterine growth restricted offspring. J Biol Chem 283:13611 13626, 2008
19. Feng,J, Zhou,Y, Campbell,SL, Le,T, Li,E, Sweatt,JD, Silva,AJ, Fan,G: Dnmt1 and Dnmt3a maintain DNA methylation and regulate synaptic function in adult forebrain neurons. Nat Neurosci 13:423 430, 2010
20. Levenson,JM, Roth,TL, Lubin,FD, Miller,CA, Huang,IC, Desai,P, Malone,LM, Sweatt,JD: Evidence that DNA (cytosine 5) methyltransferase regulates synaptic plasticity in the hippocampus. J Biol Chem 281:15763 15773, 2006
21. Nelson,ED, Kavalali,ET, Monteggia,LM: Activity dependent suppression of miniature neurotransmission through the regulation of DNA methylation. J Neurosci 28:395 406, 2008
22. Zhao,X, Ueba,T, Christie,BR, Barkho,B, McConnell,MJ, Nakashima,K, Lein,ES, Eadie,BD, Willhoite,AR, Muotri,AR, Summers,RG, Chun,J, Lee,KF, Gage,FH: Mice lacking methyl CpG binding protein 1 have deficits in adult neurogenesis and hippocampal function. Proc Natl Acad Sci U S A 100:6777 6782, 2003
23. Vecsey,CG, Hawk,JD, Lattal,KM, Stein,JM, Fabian,SA, Attner,MA, Cabrera,SM, McDonough,CB, Brindle,PK, Abel,T, Wood,MA: Histone deacetylase inhibitors enhance memory and synaptic plasticity via CREB:CBP dependent transcriptional activation. J Neurosci 27:6128 6140, 2007
24. Fischer,A, Sananbenesi,F, Wang,X, Dobbin,M, Tsai,LH: Recovery of learning and memory is associated with chromatin remodelling. Nature 447:178 182, 2007
25. Levenson,JM, O'Riordan,KJ, Brown,KD, Trinh,MA, Molfese,DL, Sweatt,JD: Regulation of histone acetylation during memory formation in the hippocampus. J Biol Chem 279:40545 40559, 2004
26. Peleg,S, Sananbenesi,F, Zovoilis,A, Burkhardt,S, Bahari Javan,S, gis Balboa,RC, Cota,P, Wittnam,JL, Gogol Doering,A, Opitz,L, Salinas Riester,G, Dettenhofer,M, Kang,H, Farinelli,L, Chen,W, Fischer,A: Altered histone acetylation is associated with age dependent memory impairment in mice. Science 328:753 756, 2010
27. Guan,JS, Haggarty,SJ, Giacometti,E, Dannenberg,JH, Joseph,N, Gao,J, Nieland,TJ, Zhou,Y, Wang,X, Mazitschek,R, Bradner,JE, DePinho,RA, Jaenisch,R, Tsai,LH: HDAC2 negatively regulates memory formation and synaptic plasticity. Nature 459:55 60, 2009
18
Page 19 of 28 Diabetes
28. Beeri,MS, Silverman,JM, Davis,KL, Marin,D, Grossman,HZ, Schmeidler,J, Purohit,DP, Perl,DP, Davidson,M, Mohs,RC, Haroutunian,V: Type 2 diabetes is negatively associated with Alzheimer's disease neuropathology. J Gerontol A Biol Sci Med Sci 60:471 475, 2005
29. Livak,KJ, Schmittgen,TD: Analysis of relative gene expression data using real time quantitative PCR and the 2( Delta Delta C(T)) Method. Methods 25:402 408, 2001
30. Surwit,RS, Feinglos,MN, Rodin,J, Sutherland,A, Petro,AE, Opara,EC, Kuhn,CM, Rebuffe Scrive,M: Differential effects of fat and sucrose on the development of obesity and diabetes in C57BL/6J and A/J mice. Metabolism 44:645 651, 1995
31. Wang,J, Ho,L, Qin,W, Rocher,AB, Seror,I, Humala,N, Maniar,K, Dolios,G, Wang,R, Hof,PR, Pasinetti,GM: Caloric restriction attenuates beta amyloid neuropathology in a mouse model of Alzheimer's disease. FASEB J 19:659 661, 2005
32. Wang,J, Ho,L, Chen,L, Zhao,Z, Zhao,W, Qian,X, Humala,N, Seror,I, Bartholomew,S, Rosendorff,C, Pasinetti,GM: Valsartan lowers brain beta amyloid protein levels and improves spatial learning in a mouse model of Alzheimer disease. J Clin Invest 117:3393 3402, 2007
33. Beckmann,CF, Smith,SM: Probabilistic independent component analysis for functional magnetic resonance imaging. IEEE Trans Med Imaging 23:137 152, 2004
34. Lu,H, Zou,Q, Gu,H, Raichle,ME, Stein,EA, Yang,Y: Rat brains also have a default mode network. Proc Natl Acad Sci U S A 109:3979 3984, 2012
35. Beckmann,CF, DeLuca,M, Devlin,JT, Smith,SM: Investigations into resting state connectivity using independent component analysis. Philos Trans R Soc Lond B Biol Sci 360:1001 1013, 2005
36. Zuo,XN, Kelly,C, Adelstein,JS, Klein,DF, Castellanos,FX, Milham,MP: Reliable intrinsic connectivity networks: test retest evaluation using ICA and dual regression approach. Neuroimage 49:2163 2177, 2010
37. Wang,HW, Pasternak,JF, Kuo,H, Ristic,H, Lambert,MP, Chromy,B, Viola,KL, Klein,WL, Stine,WB, Krafft,GA, Trommer,BL: Soluble oligomers of beta amyloid (1 42) inhibit long term potentiation but not long term depression in rat dentate gyrus. Brain Res 924:133 140, 2002
38. Mai,A, Rotili,D, Tarantino,D, Ornaghi,P, Tosi,F, Vicidomini,C, Sbardella,G, Nebbioso,A, Miceli,M, Altucci,L, Filetici,P: Small molecule inhibitors of histone acetyltransferase activity: identification and biological properties. J Med Chem 49:6897 6907, 2006
39. Itoh,Y, Suzuki,T, Miyata,N: Isoform selective histone deacetylase inhibitors. Curr Pharm Des 14:529 544, 2008
40. Haier,RJ, Siegel,BV, Jr., MacLachlan,A, Soderling,E, Lottenberg,S, Buchsbaum,MS: Regional glucose metabolic changes after learning a complex visuospatial/motor task: a positron emission tomographic study. Brain Res 570:134 143, 1992
41. C.Y.Tang, E.L.Eaves, J.C.Ng, D.M.Carpenter, X.Mai, D.H.Schroeder, C.A.Condon, R.Colom, R.J.Haier: Brain networks for working memory and factors of intelligence assessed in males and females with fMRI and DTI. Intelligence 38:293 303, 2011
19
Diabetes Page 20 of 28
42. den,HT, Vermeer,SE, van Dijk,EJ, Prins,ND, Koudstaal,PJ, Hofman,A, Breteler,MM: Type 2 diabetes and atrophy of medial temporal lobe structures on brain MRI. Diabetologia 46:1604 1610, 2003
43. Tiehuis,AM, van der,GY, Visseren,FL, Vincken,KL, Biessels,GJ, Appelman,AP, Kappelle,LJ, Mali,WP: Diabetes increases atrophy and vascular lesions on brain MRI in patients with symptomatic arterial disease. Stroke 39:1600 1603, 2008
44. Khan,G, Khan,N, Aziz,A: Detection of cerebral atrophy in type II diabetes mellitus by magnetic resonance imaging of brain. J Ayub Med Coll Abbottabad 22:67 70, 2010
45. van Elderen,SG, de,RA, de Craen,AJ, Westendorp,RG, Blauw,GJ, Jukema,JW, Bollen,EL, Middelkoop,HA, van Buchem,MA, van der,GJ: Progression of brain atrophy and cognitive decline in diabetes mellitus: a 3 year follow up. Neurology 75:997 1002, 2010
46. van,HB, Oosterman,J, Muslimovic,D, van Loon,BJ, Scheltens,P, Weinstein,HC: Cognitive impairment and MRI correlates in the elderly patients with type 2 diabetes mellitus. Age Ageing 36:164 170, 2007
47. Luchsinger,JA, Reitz,C, Patel,B, Tang,MX, Manly,JJ, Mayeux,R: Relation of diabetes to mild cognitive impairment. Arch Neurol 64:570 575, 2007
48. Roberts,RO, Geda,YE, Knopman,DS, Christianson,TJ, Pankratz,VS, Boeve,BF, Vella,A, Rocca,WA, Petersen,RC: Association of duration and severity of diabetes mellitus with mild cognitive impairment. Arch Neurol 65:1066 1073, 2008
49. Cleary,JP, Walsh,DM, Hofmeister,JJ, Shankar,GM, Kuskowski,MA, Selkoe,DJ, Ashe,KH: Natural oligomers of the amyloid [beta] protein specifically disrupt cognitive function. Nat Neurosci 8:79 84, 2005
50. Klyubin,I, Walsh,DM, Lemere,CA, Cullen,WK, Shankar,GM, Betts,V, Spooner,ET, Jiang,LY, Anwyl,R, Selkoe,DJ, Rowan,MJ: Amyloid beta protein immunotherapy neutralizes A beta oligomers that disrupt synaptic plasticity in vivo. Nature Medicine 11:556 561, 2005
20
Page 21 of 28 Diabetes
Table 1
non-diabetes Diabetes
24 24 n
Age at death (years) 87 (8) 85 (8.1)
Sex (% female) 75 62.5
Race (% white; black; 91.7; 8.3; 0 66.7; 20.8; 12.5 Hispanic) CDR 1.9 (2.2) 1.9 (2.2)
CERAD 1.65 (0.86) 1.70 (0.91)
CVD* (%) 0 0
Medication for diabetes (%) 0 62.5
Table 1. Demographic information of control and diabetes cohorts for this study. A total of 48 cases, comprising 24 non diabetic control subjects and 24 diabetic subjects were obtained from the brain bank. Key: CDR, Clinical Dementia Rating; CERAD, consortium to Establish a Registry for Alzheimer’s Disease; CVD. Cerebrovasular Disease; F, female. Data are expressed as group mean (SD). *Cerebrovascular disease (CVD) as primary or secondary CERAD diagnosis.
21
Diabetes Page 22 of 28
Figure Legend
Fig. 1. Differential expression of class IIa HDACs in the brains of CTRL vs. T2DM subjects and measurements of protein levels of synaptic structure proteins in the same brains. (A B)
Messenger RNA expression of (A) Class IIa HDACs (HDAC4, HDAC5, HDAC7 and HDAC9) and (B)
Class I HDACs (HDAC1, HDAC2, HDAC3 and HDAC8) in the brains of CTRL and T2DM subjects. (C)
Protein levels of PSD 95 (left panel) and synaptophysin (right panel) in the membrane fraction of brain tissues from the CTRL and T2DM subjects assessed by western blot analysis. Inset: representative
Western blot. (D) Correlation of HDAC5 with PSD 95 (left, p=0.032) and synaptophysin (right, p=0.0074). For (A) and (C), *p<0.05, **p<0.01, n=21 24 per group.
Fig. 2. Increased expression of class IIa HDACs 5 and 9 in the brains of diabetogenic induced
T2DM C57BL/6J mice (A) Postprandial plasma glucose level (B) Fasting insulin level (C) Intra peritoneal glucose tolerance test (D) Expression of HDAC IIa in the brain of mice following 6 months diabetogenic diet treatment; **p<0.01, ***p<0.001, n=7 for (A C) and n=5 for (D).
Fig. 3. Increased susceptibility to oAβ induced synaptic impairments in hippocampal slices isolated from T2DM mice. (A B) The fEPSPs of (A) LTP and (B) Basal synaptic transmission were recorded from the CA1 region of hippocampal slices from CTRL (■) or T2DM (□) mice following 6 months dietary treatment and exposed to 60 nM of oAβ for 1 hour. (C) LTP and (D) basal synaptic transmission recorded from hippocampal slices from CTRL (■) or T2DM (□) mice following 10 months treatment. The arrow indicates the beginning of tetanus to induce LTP.
Fig.4. Voxel by voxel statistics of the default mode network (DMN) superimposed on anatomical resting state fMRI. Two networks were analyzed. (A): DNM (arrows indicate cingulate gyrus and part of the hippocampus) and (B): sensory motor network (arrows indicate the bilateral sensory motor 22
Page 23 of 28 Diabetes
cortices. Green color represents group resting state network. Blue color represents significantly
stronger signals in T2DM mice compared to the control mice; n=8 per group.
Fig. 5. Inhibition of HDAC class IIa restores LTP in the hippocampal slices from T2DM mice and
increases expression of synaptic proteins in primary neurons (A) Hippocampal slices from T2DM
mice were treated with 200nM of MC1568 for 2 hours and LTP (left panel) and basal synaptic
transmission (right panel) were recorded. (B) Primary neurons derived C57BL6/J mice were cultured for
5 days before treatment with vehicle or 5 M MC1568 for 16 hours. Transcription levels of PSD 95 (left
panel), synaptophysin (middle panel) and brain derived neurotrophic factor (right panel) were
normalized with hypoxanthine phosphoribosyltransferase (HPRT) *p<0.05; **p<0.01; n=4 per group.
23
Diabetes Page 24 of 28
180x135mm (300 x 300 DPI)
Page 25 of 28 Diabetes
180x135mm (300 x 300 DPI)
Diabetes Page 26 of 28
88x73mm (300 x 300 DPI)
Page 27 of 28 Diabetes
88x61mm (300 x 300 DPI)
Diabetes Page 28 of 28
180x135mm (300 x 300 DPI)