Salmo macrostigma (Teleostei, Salmonidae): Nothing more than a brown trout ( S. trutta ) lineage? Christelle Tougard, Fabienne Justy, Bruno Guinand, Emmanuel Douzery, Patrick Berrebi
To cite this version:
Christelle Tougard, Fabienne Justy, Bruno Guinand, Emmanuel Douzery, Patrick Berrebi. Salmo macrostigma (Teleostei, Salmonidae): Nothing more than a brown trout ( S. trutta ) lineage?. Journal of Fish Biology, Wiley, 2018, 93 (2), pp.302 - 310. 10.1111/jfb.13751. hal-01921430
HAL Id: hal-01921430 https://hal.umontpellier.fr/hal-01921430 Submitted on 16 Nov 2018
HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. lineage of S. brown trutta lineage trout, sister which tobe wasfound lineage, isproposedAfrican forthis lineage a is macrostigma the shows that trout specimen,present onesyntype the museum including genome study from degraded samples, control and amplifycytochromemitogenomic protocol tothe Salmotrutta brown trout flanks, spots black the toassess itexampleon whether iswithin an oftaxonomic inflation the Salmomacrostigma macrostigmaWe specimens examined trout ofthe mtDNA, syntype, Sicily, taxonomicstatus North Africa, Conservation, KEYWORDS Salmo macrostigma Salmo
Accepted evolutionary lineagedistinct of Article C. Tougard, ISEM, CNRS, Université de Montpellier, IRD,EPHE, deMontpellier, France ISEM,CNRS,Université Montpellier C. Tougard, C. TOUGARD, F. JUSTY, B. GUINAND, E. J. P. DOUZERY AND P. BERREBI BERREBI C. TOUGARD,P.DOUZERY F. JUSTY,B. GUINAND,E.ANDP. J.
pagination andproofreading process, which version undergone full peer review but has not This article hasbeen accepted for publication inthe Journal ofFishBiologyand ISEM, CNRS, Université de Montpellier, IRD,EPHE,Montpellier, France deMontpellier ISEM, CNRS,Université
and the Versionof Record. Please cite this This article isprotectedby copyright. Allrights reserved. (Teleostei, Salmonidae): nothing moreabrown ( than trout complex. Using new specimens,complex. Using publicly available data and Email: [email protected]
. S. trutta not a valid species. Our results suggest the occurrence suggestthe Ourof a validspecies. not results Funding information Funding information Correspondence in lineage? North Africa and Sicily. The NorthnameNorth andSicily. the Africa of been through the copyediting, typesetting,
may lead to differencesbetweenlead to this may article as doi: 10.1111/jfb.1 b regions of regions mitochondrial the
, which refers , whichrefers to big to the Atlantic the 3751 S. trutta a
) 2004 morphological support, before requireunits variation to that related species status ofdefinition operational Deichmann al et distribution traits of phenotypic invalid al over „ new rather than concept discoveries data these 2007; Padial tomography, technologies, advanced such as numberdecades, namingclassifying and species. All biologicalconservation unit based andthecentral is on taxonomy in taxonomy isthe 1 | This articleisprotected bycopyright.Allrightsreserved.
Accepted taxonomic Article . , 2004 INTRODUCTION . - ). , splitting
2000; Phillimore &Owens
, relevant relevant
with Since adventof the Linnaeanbinomial taxonomy o ; Zachos
perational have to led inflation et al et
et al et n geographical informationgeographical systems in which umerous
patterns taxonomic . s , 2017 .
et al et , of described specieof described
2010; Zachos ‟ conservation
( reinterpretations ofreinterpretations specieslimits . Isaac ,
). numerous knownsubspecies
subspecies boundaries based boundaries subspecies in ondiscontinuities geographic the ( species 2013). Fraser Fraser
units ( units However, e decisions ,
Mallet, Mallet, & Mace , e.g. Species elevated inthiswayhaveSpecies elevated oftenbeenfound tobe &
molecular phylogenetics, DNA computed barcoding, poorly mainly ,
et alet
Bernatchez, 2001;Bernatchez, and 2006; evolutionar
( are madeare ffective e.g. s
. management , have
aligning based on based 2013). Newman &Rissler
cryptic species)cryptic
increased , 2004 conservation andmanagementconservation on rely
(Mace, 2004;Sites &Marshall (Mace, 2004). il The increased availability and selectiveof use
and with y significant units
morphological characters. be ; units units
various are Zachos Agapow described
appropriately assessedappropriately andconsidered in part based onlyon elevated . also also , taxonomists have describing, been , taxonomists
This process This process
, internet et al
2011
due to due to need et al et
molecular ( lineages . to species rank( the ,
, ; . 2013)
, congruent ESU; 1994).Moritz,
Pri 2004; tools the the useofwidespread
e change is known
et al et
and (Bickford Sites Sites During . , i s molecular
t 2012;
in species in species has &
as
Marshall,
resulted resulted
the Burbrink the et al To gain Isaac
p proper proper
and ast ast . Such ,
et 3 in
(Mutanen validity the of thiswithin complex 2013 2001; Fumagalli to appropriate naturalstrategies protect trout diversity (Bernatchez understandingthe of ofpossibletaxonomiccase inflation Salmo trutta S a provides and above Yahyaoui 2014 described during the Freyhof Depending onthe geographicalrestricted range century addition to ( variation complex pattern This articleisprotected bycopyright.Allrightsreserved. Accepted Article almo molecular data , Ninua ) , , which
obtusirostris such as In , ha
2007; IUCN
the brownthe trout et et al. 2015 Bernatchez ve detailed list S. trutta
et al et species species complex (Sanz, 2017).
led to led the are only a only oftheare snapshot research available literature, in thisarea is
tax S , 2015). described from s almo et al et
. a of phenotypically geographicformsdistinct life andconsiderable , 2018 source ,
have and even thoughthesearetheonly (Heckel 1851) has p the species‟ the
. ,
akairos , 2002;
et et al ast decade(
2016) to nearly2016) to 50(
and references] description description ). Furthermore, to S included , the number, the of already already almo Salmo trutta . , 1992 s
Snoj Delling
(
salar Berrebi Morocco
begun toshow ; evolutionary history type Turan ; Elliott, 1994; et et al. of several of several
Snoj
that hasconfounding L. & Doadrio 2005 . Apart from. Apart specimens (
L. et al et 1758, stud , 2010;
. al et Salmo et al. et
As illustrated by the numerous references bythenumerousAs illustrated references cited 1758 our knowledge, no molecular phylogeneticour knowledge, nomolecular study Froese & Pauly, 2018Froese &Pauly, . Hence, t , .
Salmo , 2013 , 2002
2009; Delling , natural
Crête
species species ranges that some species Kottelat & FreyhofKottelat & ies e.g. ; Clavero objective objective to link S. salar
] L. 1758 his -
, this diversity is , this of Lafrenière
and
holotype, isotype, holotype, isotype, syntype and
diversity isnotably characterizedby complex represents biological biological
taxonom impedes
S and few other valid speciesand fewothervalid
almo et al , species,
2010;
from around 25 (Kottelat & from & 25(Kottelat around
). A et al.et .
, viridis are
variation 2017 ic ramifications, ic et alet the developmentthe of , the Turan mong
2007 often
, 2012; Gratton not valid subsumedwithin
. Linnean ; , 1992; Antunes
Doadrio Ninua ; Sanz, ; Sanz,
these et al et having
an during the last thelast during
interesting .
[ , a , 2011 et al et Sanz binom ) to ) to check , Perea 2017
very dozen were - very
history hampers .
, 2018
et al. ( , 2012 ). 2017 ial
[ the the active
, In e.g. et al. et
& ,
). ) ,
,
of t beexclusivelyshould usedfor Algerian distribution exists confusion still (Schöffmann in phenotype might beobserved ( (Kattoulas Greece & Arillo al. et been ( Turkey ( (Morocco: subspecies ( macrostigma H Natural weresyntypes, brought toParis of Algeria Collo in spots black on Salmo 1858)(Duméril 1968;Geldiay, 1988; Geldiay &Balik, This articleisprotected bycopyright.Allrightsreserved. he AcceptedGuyomard Berg Article S. macrostigma
use ofmacrostigma populations for , reported in
,
1991; Patarnello
genus. 1949; Derzhavin Considered Considered , Togan
2006; Querci istory (MNHN) Vivier ,
of the macrostigmaof the trout remains controversial S. t.macrostigma 1989; Roche & Mattei 1989; Roche&
has subsequently been has subsequently et al. et T the the
he et al. et represents interesting case study one tote Italy , ,
term flank , 2007; Kottelat
1948; Azeroual itself itself . 1972; Karakousis &Triantaphyllidis to be According toDuméril (1858),twoidentical specimens,considered here , regarding how
1995; Bardakci (including andSicily; Sardinia
et al. et al. , macrostigma by wasused Duméril (1858) s
within or outside oroutside within the
1929; Segherloo distributed named
and , ,
1994; Massidda ) level to) level characterize 2013), the otherthe forFrench Society. the Zoological ,
Salar macrostigma Salar France S almo
& et al. ,
in to distinguish 1997; Berrebi Gauthier& used at used at Albania (RakajAlbania &
Freyhof, 2007) et al. et s
, Kottelat &Freyhof,2007), cettii beyond outhern and Eurasia 1954; (Tortonese, NorthAfrica ,
populations
one for the collections of the National one forthecollections oftheNational Museum of 2000; Abba et alet ,
both 2006;
Raffinesque 1810,inhabiting Sicily , S. trutta
. 1995; ,
Algeria andevaluationAlgeria of the 2012) the species( the S. macrostigma Kara , other other
(
found in found in Nonnis and Boulenger et al. et Zouakh
. Macrostig complex
Flloko, 1995;Cullaj
et al.et ,
Duchi ( 1990) trout s , t fortaxonomicwithin inflation the
and 2010;
Marzano , ,
Salmo macrostigma
the Oued the 2010) , 2009;
native to
2007). required required , and some authors
2018 1901; Mola ma phenotypes
Lbadaoui to describe to describe
from Salmo macrostigma Corsica, and Turan
) rightlyreported that et al. A macrostigmaA -
el S. cettii S. North Africa genetic genetic comparison the - Abaïch 40km west
Th et al et ,
et alet et al. et Middle EastMiddle , 2003; Ciuffardi France, France,
taxonomic e assert assert that a 1928; Gandolfi
term trout with big . Indeed, . , 2011 .
, 2005), , 2011 have ) and
also also )
), .
it status Thus,
2.1 | Sampling 2 | geographic distribution macrostigma of ( Paris as approach 2010 phylogenetic Lafrenière ( complex uniparental inheritance propertiesbarcoding DNAWandeler 2000; copy nuclear (Höss, genomes museum and populations. macrostigmaof Algerian the This articleisprotected bycopyright.Allrightsreserved.
Accepted ArticleBernatchez
this this S. macrostigma M ; Snoj ; Snoj ATERIALS AND MNHN syntype In this study,In this Mitochondrial
partly partly (mtDNA) (mtDNA) used obtain to datafromsequence the
et al et al
et al et
fresh relationships and )
.
with other . because . , 2012) The , 2011 . , 1992; whether thisnamewhether ,
samples including the are available are aim traditional traditional mtDNA analysesmarker across DNA markers ; Sanz, 2017 ,
and of lineage this mtDNA somuch are data METHODS of the present study wasof present study the Snoj Salmo
is availab
b partly partly vertebrates ecause syntypes et al et
remains remains mtDNA at syntype because awell .
) , 2002;
much higher . nucleic overtimeacids degrade
le ( le refers to a to refers are
.
with European, and Asian , Bernatchez, Cortey 2001;
including fishes valued for an important catalog lineages orspecies lineages already fromavailable previous
Verspoor et al. distinct
d , copy numbers u - amag 2003) supported supported to ed
phy
characterize et al. et at at
marker ed DNA of museum samples labelled ed DNAsampleslabelled ofmuseum
logenetic reconstructions logenetic
p National naturalmuseum, history and
h ( were Allio , 2002; ylogenetic ylogenetic because mtDNA ;
the in
combined
et al. et per per cell : studies
other other
taxonomic status Sušnik phylogenetic relationships et al. - , 2017) and mtDNA has lineage based hypothesis of hypothesis based , North African trout compared with
2004 of the
mitochondrial mitochondrial et et al with a with a
salmonid .
; D
; Vera . the the limits , 2006; espite espite S. trutta mitogenomic using reliable
of
studies et al. its Crête S.
both
single of
, the
- -
the recommendations ofthe manufacturer, the exceptdecreasing elutionvolume the 100 to DNeasy the experiments, with kit( Blood andTissue wascontrols ADN performedthe dégradé in from ofdegradedlibraries small genomic quantities withbla DNA extraction DNA.First, by developed Tilak Sciences facilities ofthe technical Crête TTTAACCTCCGATCTCCGGATTACA CATAATTCCTGCCCGGACTCTAACC TTTATATGTTTGATTGAGA respectively: sets, ( region procedures( following standard T 2.2 | were analysed( macrostigma trout (MNHN_IC_0000_1909_C, MNHN_IC_1977_272_A andNMW_67984) syntype phylogenetic of macrostigma position the asmallmuscle piece of trout, from the populationsTurkish of DNAFin or s This articleisprotected bycopyright.Allrightsreserved. Accepted Article otal otal DNA - genomic Lafrenière For the museumFor the DNA retrieval samples,
CR specim
Montpellier extraction andsequencing extraction )
and amples were obtained foramples obtained were DNA en (MNHN_IC_A_7585) and en (MNHN_IC_A_7585) Supporting Information S Table
cytochrome et al Str et alet f
- . (ISEM) rom rom DL1F
(2012). sequencing Direct bothdirections wascarried out in S. .
genotyping genotyping and sequencing platform (2015) tobuildandsequence shotgun(2015) Illumina trutta 67
(5' b . specimens specimens
( -
- Sambrook cytb ( GCACCGACTACACTATCATT 3') designed for study; designed 3') this SalmoCBF (5' Supporting Information S Table )
gene
67 was extracted was extracted - - ,
3') correspondin Europeanspecimens to belonging 3') and 3') and were Fritsch, &Maniatis, p three latform 1).
amplified was optimized Salmo
other museum attributed tothe samples QIAGEN of ISEM dedicatedof tod ISEM from - CBR by g to the g tothe 96% ethanol 96% PCR followingprimer with the
of Institut the ; www.qiagen.com (5'
using 1989). The entire 1) - - 3') and StrDL1R3') (5' and cytb . To assess the . Toassess the
a protocol recently
primers mentionedprimers in (www.illumina.com) - - preserved e for Evolutionary e forEvolutionary ,
amag Moroccan MNHN ) following ) following control
ed DNA ed at fin
the - tissue tissue µ
and l nk . divergence of evolutionarydepiction affinities the ofthenewmitogenomes the and newmitogenomesthe context species the related of closely in wa sequences wasavailable donetoavoid specimen of a phylogenetic misidentification; analysis barcoding identification of specimens the based phylogenetic a tree closest through onthe toensuretaxonomicprovided identification andeasier mitogenomesamples for used sequencing Botero prematur mitogenome was To evaluate ofmitogenomes2.3 |control Quality nucleotides. with referencesimilarity the genome; a3% referencethe genome; maximum a5% of per mismatches read; minimum a of 95%overlap al a outagainst referencecarried genome of Mappinglane. ofshortreads(≤ Biotech mix includingequimolar for a library museumover each samplehanded toGATC was for(2015) blunt The Illumina libr This articleisprotected bycopyright.Allrightsreserved. Accepted Article . ,
2012). Reads were mapped 2012). Readswere -
Castro ( e stop codons in protein e stopcodonsin protein codinggenes. www.eurofinsgenomics.eu compared with
the
et al. et
- potential of pseudogenepresence nuclear end repair, adapter ligation, adapterfill ary preparationary procedurethus followed therecommendationsTilak of carefully
(2016) also were performed: detailed information origin ofthe onthe
close inspected inspected detectabnormalby eyeto boundaries,frameshifts and
as follows 100 of annotation bp) and
relatives. ) for the sequencing stepfor thesequencing onasingle Illumina HiSeq2000
: aminimum 24 of S
and . indel
trutta the of museum voucher
Three otherquality Three recommendedcontrols maximum exceedingof not agapsize 1
(JQ390057) Geneious using 7(Kearse cross - in s
the complete
in theassemblies, e and PCR indexing An steps. - referencing contiguous contiguous s conducted to get a clear togetaclear s conducted each ir mito ; a CR a nucleotides matched
degree of degree
sample genome ach anno nd
cytb was was s
were - tated tated
et al et 0 et
by .
both separate and concatenated CR andconcatenated and both separate ( 1892 Steindachner were datasets the includ forsequences markers both were cytb including basedonadataset were also of117 total CR wereused forreconstructions. sequences phylogenetic 2001; Dades Adriatic belSequences sequences control region. As specimens ( (Tamura weresequences extractedmitogenomes from andaligned MEGA these byhandusing 6.06 (2) M distances analyses2.4 | andgenetic Phylogenetic This articleisprotected bycopyright.Allrightsreserved.
Supporting Supporting Information S Table Accepted Article itogenomes GenBank ofthefourmuseum andofseveral samples were alignedusingthe Geneious withdefaultaligner parameters. cytb
sequences intotal
ed Cortey ( Phylogenetic analysesperformed were Phylogenetic Phylogenetic reconstructions were reconstructions conducted onPhylogenetic the MacCrimmon 1968; 1989; &Marshall, Elliott, Bernatchez
; phylogeny from Crête
et al. et 89 Marbled or ,
7 Supporting Information S Supporting Table new 1
et al et
completed withGenBanksequences of o , GenBank sequences wereGenBank sequences added theseto inourdataset. identify lineages
ng 2013) with
and GenBank sequences ( and GenBanksequences ed . . , mtDNA
Finally, 2004
to S. ) . were Thetwodatasets concatenated in a eight ( trutta ,
2009; Vera
newly produced lineages of lineages the the tree bywas rooted designating main ) -
Lafrenière marmoratus 1). available for recognized lineages recognized
et al et S. 70 cytb trutta new et al .
Supporting Information S Table , 2010; and GenBank sequences obtainedand GenBanksequences for
1).
Cuvier 1829 Cuvier datasets through technicalthe of facilities the
on a dataset including on adataset the same individual. . and 49
were previouslyidentified from (2012), t Snoj
S. obtusirostris GenBank sequencesof
of et alet hese separatedandconcatenated ; Mediterranean; Tigris Duero; S. trutta mitogenom . , 2011; S. single salar : Atlantic; Danubian;
et alet This concatenated dataset S. trutta Özen, 2013).
4 Control regionControl and 6 , Phylogenetic Phylogenetic
. ic
as , 1992; dataset new
S dataset as well as ondataset as aswell an almo 1).
(4) sequences ofthesequences outgroup cytb According to
Suárez when
CR and ohridanus additional
Thus, a (
i.e.
and S. salar analyses
119 al. et ; cytb
,
complete and CR mitogenomesLT617633 forthe ( numbers LT617521 N 3 | separateon the sampled 100generation every from probabilities(PP)50%majority obtained consensusoftre posterior the were rule for carriedwere simultaneously out 5 under robustness percentage(BP)was estimated bybootstrap 1000pseudo values after codon position of partitioned concatenated in mitogenomic dataset ( time (GTR)generalized reversible marker Huelsenbeck (Guindon reconstructed platform Montpellier This articleisprotected bycopyright.Allrightsreserved.
Accepted ArticleI ) and ) and a gamma ew sequences were deposited were ew sequences inthe RESULTS
ML
Intra dataset as well as a dataset
et et al optimization : - HKY ( ,
and interlineage genetic distances genetic and interlineage wereestimated uncorrected bythe BI using 2003). Best
.
, and concatenated datasetsand concatenated withMEGA.
2010) and inference (BI)usingMrBayes3.1.2(Ronquist Bayesian & analysis inwhich analysis distribution ( distribution c cytb H ytb
– a maximum asegawa LT617587 for bioinformatics biodiversity
; sequences were 1019and longwith108and 1140 nucleotides 128 . of runs MonteFive independent five chain Markov GTR + both s the concatenated datasets the - fitting ML and BI.
et al. et s G
I after aburn ) -
+ likelihood approach (ML) (ML) approach likelihood models ofsequence evolution for wereidentified each Supporting Information S Supporting Table was selected
G for the the CR , model
cytb 1985)
000 European European Nucleotide , LT617588 A
(Yang, 1994) region and and region 000 generations 000 generations + I + + I G
- mixed model in stage of 25 second and third positions andthirdpositions ofsecond the for theconcatenated datasetinMLandthe at using for CR;
– ISEM. Phylogenetic trees were LT617629 for LT617630 CRand cytb
with a proportion ofsites invariable
MrModeltest 2.3 (Nylander
was recommended was
000 codon positions K80 (Kimura, 1980)forthe K80 (Kimura, first under
in program the Archiv
generations
BI 1). e underaccession the
optimization A lignments ofthe .
PhyML 3.0 were separately were separately - Carlo chains for a cytb - . Bayesian . Bayesian replicates . Nodal p - ,
distance 2004). – es A 3.2 |distances Genetic remain theselineages between PP<1.00; (0.99 < concatenatedthe dataset, all A lineages ( with together clustered weak support(PP≤0.80;BP Inthe ≤50%). < the 0.99; 57% BP whereas <95%), D Figures but 100%) species latter BP Thetwo =100%). other the (1.00) was InformationSupporting Figures Phylogenetic 3. 907phylogenetically683 positionswith informative sites( phylogenetically sites, informative respectively. This articleisprotected bycopyright.Allrightsreserved.
AcceptedSupporting Article driatic anubian 1 |
supported with highPPsupported (1.00) TREE TOPOLOGIES TREE and BP valuesin (100%) the mitogenome tree ( In the CRIn the
S1 , ha M analyses
an , were d arbled
S2).
Information S Figure d moderate to 71% highsupportwhereas values (PP=1.00; included in included in gene , and 55 S. % T generated mtDNA tree urkish ( form Supporting Information S Figure S. trutta mitochondrial ed lineages lineages lineages S1 ed similar tree topologiesinBI andML( unresolved. 1) – values in in values the concatenated a clade with clade a , the were S3 with PP and BP values). ThemonophylyS3 withPPandBPvalues). of in the CRin the and A tlantic we we A always highly supported (PP = always supported (PP < highly 1.00; 98% BP < tlantic re re lineages re re spread inthe out Inthe tree. treeobtained f , moderately highly supported(0.93< to PP < D S. ohridanus A , uero M lignment of the mitogenomes the lignment of cytb we editerranean , Sicilian andMoroccan specimens Supporting FigureSupporting Information S re re and concatenated trees, relationships gene moderately highly to supported Supporting Information S Table 2) and trees ( trees tree tree ( , the , the , Dades, S. obtusirostris Figure Supporting Information M cytb editerranean Figure gene D 1) anubian and tree 1 and comprised with high PP (PP = 1.00; , and S. M trutta arbled 3 D ). In ). In rom we uero 2). 16 re re , from Albania 2011) BP =76%; 55 form with aclade fromoriginating Northern Africa ( clearlyIt appearsfrom dataset the concatenated that three the m 3.3 |themacrostigma of museumspecimens Position salar ohridanus obtusirostris distancegenetic lineage group including to for0.6 ±0.2% 1.7±0.3% 0.5 0.0% to for± 0.1% dataset. theconcatenated Theinte 0.5% forthe groupincluding to0.6±0.1%for± 0.0% InformationSupporting Table between Gene This articleisprotected bycopyright.Allrightsreserved. Accepted Article %) tic distances fromtic separate the (5.9 ± (5.9 ± 8.00.6% and for ±0.7% . ( Figure The lastmuseum amacrostigmasample to attributed (NMW trout ); 0.5); to1. ±0.1% S. (2.4 ±0 trutta Figure Figure (2.1 ± 0.4%for(2.1 ± and3.9±0.4% ; 1) Supporting Information s . Atlantic This between lineages, new .4% and5.6±0.5%for 1) and clade and GenBank , NorthAfrican, Sicilian and 6 cytb not at alltothe not at S. trutta S. obtusirostris ± 0. is cytb Atlantic ; 0.0 ± ; 0.0± 0.4 0.0% to for± 0.1% CR( s closely to related the 3 S3 % for ; to for0.7 ± 0.2% 1.3±0.2% CR( , Algeria and Morocco; and closestspecies its related S4). In S4). In and concatenated datasetswereestimatedand concatenated and within specimens (PP =0. from andSicily Morocco cytb , NorthAfrican,Sicilian and concatenated dataset. Fromconcatenated dataset. dataset, concatenated the Table S Table Dades , and CR, respectively). cytb S. trutta S. ohridanus cytb 1) and CR, respectively) lineage clustered withthe clustered and CR, respectively), 2.6and CR,with ±0.3% respectively), , intragroup distances , intragroup distances A Duero tlantic , endemic and Supporting Information S Table rgroup distances specimens the with lineage of S. salar ac but we to r Duero ostigmasamples MNHN S. obtusirostris re Morocco but 6.2 ± 0.5%but 6.2± forthe distances (Table and : S. trutta 1.7 with ±0.2% we specimens 67984 5.7 ± 0.5% with 5.7 ±0.5% we s re re re re 1 (Snoj (Snoj as follows: 0.0 r and ose as follows: ( , originating , originating Danubian PP = 1.00; 99 to specimens ); 0.1± et al ; BP = 5.4 ± S. . , 1) S. S. th existence of described museum supported with specimens fromand populationsSicilian Moroccan samples). A found to MNHN syntype or France in studyconsidered this didnotcluster together (sub)species diagnos characters that stronglyvarywithin the validspecies as a phyloge sample The termmacrostigma 4 | Figures from Bosnia andHerzegovina This articleisprotected bycopyright.Allrightsreserved. Accepted Article driatic ese DISCUSSION specimens phenotypes with alternative s from North Africa, Turkey, East Turkey, North Africa, Middle s from T e netic study S1 for h cluster within recognized withinrecognized cluster specimen , an e (Oued clade where macrostigma thought is , macrostigma S2). Albanian Albanian in a monophyletic a monophyletic covering covering this very valid valid in the in the concatenated tree - or el may s - with focused on this focused onthis Abaïch, Algeria; Duméril, 1858) taxon matche samples; contribute is other macrostigmaother specimen syntype fromsyntype MNHN widely used widely to . Results showedResults that d S. macrostigma with the location and A wide tlantic to taxonomic and becausemorphological meristic inflation Croatia S. trutta phenotype geographic isunlikely geographic area , S. trutta ( phenotypically phenotypically A Figure also also driatic in alltrees lineages ( restricted to are included in the to has previously been from . the existence of a and two other macrostigma other and two trout complex are 1). No specimen from Balkan the be distributed , and M The geographical origin ofthese where arbled . s e.g. Southern Europe However, r ( considered in in study.this They considered Figures describe peri that North Africa D S. macrostigma anubian and being we , 1 M was found tocl was found and Supporting and Supporting Information S. trutta re re as esults single single editerranean performed grouped a in erroneously the four for Iraniansamples - Mediterranean , . However, did not supportdid not but showed rather that S. complex. ( was originally was originally t. macrostigma trout ) . macrostigma I s for Corsican for Corsican uster with the ts , Turkey, Iran used to w s recognition recognition clustered clustered ell no Individuals Individuals - three trout were ; the the all all Such methodsSuch delimit taxonboundaries macrostigma a myth a than but,a investigated further a wide is Lake Ifni located in andAlgeria Morocco (Delling thatreported so the samples, from have been tree ( Morocca withthethree grouped macrostigma trout are S other occurred result the (2011), evolutionary of legacy definition donotsupportthe of 3.5% forCR) speciesother considered ( 2015 distancesintergroup genetic geographically restric of this This articleisprotected bycopyright.Allrightsreserved. Accepted Article 1 in ). Such distances ). Suchdistances Figure Figure ( Geiger of several waves of waves of colonisationAfricaPleistocene. several during the It inNorth e.g. well North African n samples Lake (I1,MNCN85764 from Ifni that strong similarity - supported supported 1). This suggeststhat 1). This et al et and other and other described S. trutta well can western western enough ., - distinguish between with structure associated intraspecific variation - supported reality 2014) called of ted withunresolved groups relationships ( geographic areageographic mtDNA replaced haplotypes compared with the Siculo Morocco Morocco cytochrome I oxidase , are challengingare but and t thisstage S. obtusirostris Atlantic Atlantic mtDNA S. macrostigma ( - 0.2 to0.6%for relatively uniformrelatively North African & ( Doadrio, 2005;Zouakh,Doadrio, Doadrio 2009; Lake Ifni Salmo at one least waveof Salmo slope haplotypes . , Nuclear Nuclear the the the intergroup genetic distances between intergroupthe genetic does not appear does not sp of , North African diversification in Northern Africa in Northern diversification is S. ohridanus i ) eci s Morocco to Sicily. clade are distributedclade are infour more restricted restricted drainagesto Mediterranean of cytb have all es as valid es asvalid species haplotypes data arenecessaryaddress to of therelevance valid during process. this However throughout Sicilian Sicilian (T250009, T25010 and 0.2 to 0.5%and 0.2to forCR greatly improvedgreatly inthe fewyears past Salmo undetected macrostigmaundetected . and Thus, a Additionally, some mtDNA replacement would to be and S. macrostigma among MNCN85765) concatenated inthe species S. salar the covered by range very multi Figure Figure . Mediterranean Mediterranean Phylogenomicmethods par . A - , always for >2% replacement s ccording to Snoj ccording to imonious 1) andwith low appears et al a in Doadrio uthors uthors , , samples that and T25011 and possibly . - probably , 2015), while or . S. trutta trout This be hasto to be may have scenario - less those have had to ; et al. cytb et al more Figure and the the and ) and ) and . to over over , > , . of S. economic issues alternatives distributionspatial ofdiversity; thegenetic Theseauthorsrecommenddiagnosability. of use the species To introgression withdomestic ( activities populations of Snoj relationships betweennativeMoroccan andSicilian populations(Schöffmann results S. trutta samplesother 2017) techniques may specimens largescale because integrative taxonom al. reconciliation reassessment Zarza introgression This articleisprotected bycopyright.Allrightsreserved. Accepted Article , 2016; manage biodiversity native et al et et alet and nuclear dataand nuclear based on - C However, if splitting based onsplitting based from genetrees inferred , onversely with the . Morard , 2011; Fruciano e.g. . certainly certainly , 2016 [ e.g. from ( resultingfromspeciation that of units evolutionary of probably increased water use,environmental degradation duetodeforestation) the the facilitate theretrievalfacilitate of partial partial and complete CR ( morphological and morphological taxonom molecular operational conservationoperational ; Baumsteiger Dodson well et al so , S. macrostigma it isclearfromit remains crucial (Mutanen - called - . known , 2016). T ( belong toa belong e.g. et al et et al. et N S. trutta Grandjean orth African orth . A better , et al.et , 2014). tlantic 1998; Machordom he in challenging taxa Figure Figure previously undescribedpreviously is not Salmo , Zachos from hatcheries from (Snoj hatcheries , 2017 lineage et al et ic more complete that a valid studies arecurrentlyC studies lacking. 1 that unit genus lineage ) Moritz . , 2017) and et et al have s et et al as ( North Africanmacrostigma specimen OCU sometimes for allow is certainly one interestingto case species its its Wagner . , currentlyare threatenedbyhuman mt . already underlinedalready thephylogenetic close (2013) particularly(2013) discourage et al. et 1994; , 2015 frommuseum specimens concepts such concepts such sister clade DNA ), (Papakostas ies reflecting interaction with socioreflecting mitochondrial , based on our mtDNA onourbased data 2000) ; Schultz Almodóvar et al et in integrative et et al North African and and . , 2013; ] . phenetic phenetic analyses aimed at . , , which This confirms previous 2011; Fruciano as et al et al et al.et ESU a deeptaxonomic Mutanen ( . . van der van der , 2016), , 2015 highlight studies studies onsideration of mtDNA s , 2006 ( considering the . et al et ). Valk et alet or New ( ) et alet Dejaco d , or . lineage , 2007; even both , consider and native native . et al. et , 2015; . s , 2014). and - by type type et et , in Abba, E., Belghyti, D., Abba, E.,Belghyti, Benabid, M.&ElIbaoui, taille H.(2010). Relation REFERENCES reviewers forhelpful comments France) Biodiversité,Montpellier, dela et technical fortheir help ISEM platforms LabExMéditerranéen withthe de CeMEB(Centre shared l‟Environnement GENESALM samples projectforproviding trout DNA. or L. alsogratefulare to troutproviding museumsamples, the macrostigma especially Pa Thanks to ACKNOWLEDGEMENTS Bernatchez, 2001) evolutionaryand integrated probably subspecies diversity intraspecific This articleisprotected bycopyright.Allrightsreserved. Accepted Article ris, France)ris, and García l'Oued Sidi Rachid (Moyen Atlas) l'Oued (Moyen SidiRachid Atlas) Maroc. coefficient de condition truitecommunede la ( - more local groups Marín, A. (Freudenstein Dettai Dettai (Collections ofIchthyology, Museumd‟Histoire Naturelle, National S. . H. A. Muracciole, Wellendorf ( Snoj, without et al. et framework M. within promoting , 2017) Arculeo, A. Crivelli, Arculeo, A.Crivelli, . V. Publication Naturhistorisches Museum Wien,Naturhistorisches Museum Vienna,Austria) for this lineage Peyronnet, Peyronnet, . The , such as , suchas with taxonomic arbitrary conceptof the and inflation N ISEM n°201X orth Afrique Science certainly certainly G. salmo trutta macrostigma salmo trutta 1858dumeril. A Pustovrh, Pustovrh, frican D. ESU Doucende, must s, lineage We also thank We also team the - to be moreto be (Fraser effective XXX A. syntype 6 be managed , 60 Sabatini, Sabatini, , aswell astwo . described inthisstudy - M. 70. specimen. Geiger, Geiger, H. - in a more in a adaptive poids et Watt D. The authors authors The anonymous and Jesensek, s of the of the to the the & and ) de ) de J. - Berg, L.S.(1949). Baumsteiger, J.,Moyle,P. A.,O‟Rourke, B.,Aguilar, S.M. M.& Miller, R.(2017). F., N.,Bardakci, Degerli, Ozdemir, O.&Basibuyuk,H.(2006). A., M.(2000).Azeroual, A.J.,Yahyaoui,&Dakki, Crivelli, R., Antunes, A.,Faria, Weiss, Alexandrino,P.(2001). S.& Almodóvar, A.,Nicola,G.G.,B.&García Elvira, R.,Donega, N.& Allio, S.,Galtier, Nabholz, B.(2017). Agapow, P. This articleisprotected bycopyright.Allrightsreserved. Accepted Article Instituta Akademii NaukSSSR Instituta e0189417. Genomics clarifies taxonomic difficult boundaries ina species complex. Fish Biology brownTurkish trout watersinland ofMorocco. 2 browntrout: the management amongvariability Iberian browntrout Evolution use and the mitochondrialof DNA as nuclearmutationmitochondrial to rate diversity across animals: forgenetic implications The J. Marshall, C. &Purvis, concept A.(2004).Theimpactonbiodiversitystudies. ofspecies , 337 Quarterly Review ofQuarterly Review Biology - 347. - M., Bininda 34 , 2762 and environmental features. 68 , Presnovodnye rybyIrana i sopredel‟nykhstran. insights 36 - - 2772. 55. Salmo trutta - E dmonds, K.A.,Gittleman,O. R. J.L.,Mace, P.,Crandall, G.M., on the recognition ofconservation recognition units.on the Cybium 8 , 783 79 L. 24 : mitochondrial DNAPCR , 161 – , a molecular marker. 858. evolutionary significant units 17 - - Freshwater Biology 179. 22. - Marín, J.L. (2006). Large variation Large variation in ratioof the Complex history evolutionary in Molecular BiologyMolecular and The ichthyofauna of the The ichthyofaunathe of 51 - RFLP variation. RFLP variation. Trudy Zoologicheskogo Phylogeography of the , 1175 Conservation Genetics : the influence of local oflocal : the influence Introgression Introgression - 1187. PLoS ONE Journal of 12 , Clavero, M., J., J.,Clavero, Calzada, Esquivias, Ver Ciuffardi, Arillo,A.(2006).Lafauna Liguria: L.& dolcedella ittica d‟acqua composizione concept. of polytyp the F.Burbrink, B. (2000). T.,Lawson, J. R.&Slowinski, Boulenger, G. A. (1901). Botero P., Petkovski,S.& I., A.J. Berrebi, Crivelli, Tougard, C.,Dubois,S.,Shao,Z.,Koutseri, Bernatchez, L. (2001). Bernatchez, L., Guyomard, R.&Bonhomme,(1992). F. This articleisprotected bycopyright.Allrightsreserved. Accepted ArticleBickford, D.,Lohman,D. J.,Sodhi,N.S.,Ng,R.,Winker, K.L., K.,Ingram, P. Meier, K. K. doi:10.1017/S0030605316001551 Salmo multipunctata M. (2017) ecategorieattuale regionali IUCN. Naturaland Magazineof History guidelines control to validate newmitogenomes. Ecology andEvolution (2007).& Das,I. of Journal Molecular Sciences (2013). variation. nestedfrom clade phylogeographic, brown trout regionmitochondrial control amonggeographically andmorphologically remote European - Castro, F.,Delsuc,F.&Douzery,E.J.P. (2016). Evolution Genetic diversity andc . Evolution ic NorthAmericanic ( rat snake Nowhere swim to ofthe Dadestrout climateandconservation relict change to: Salmo trutta 54 Cryptic species as Cryptic speciesas anda windowondiversity conservation. , 2107 The evolutionary historyof ( browntrout 55 in the IV , 22 351 - populations. On the Occurrence ofOn theOccurrence 2118. , 148 h - 379. igh Atlas Mountains, - of Balkans.onservation thePrespatroutin 14 155. , 8 . 23454 , Journal of Journal and 14 Molecular Ecology - 14. íssimo, A.,Hermoso,V.,Qninba, A.&Delibes, mismatch of DNA mitochondrial analyses Elaphe obsolete - 23470. Freshwater Biology Salmo macrostigma Mitochondrial Morocco. Morocco. Mitochondrial DNA phylogeography DNA sequence ofthe variation Thrice better Thrice better than quality once: ): acritique of thesubspecies 1 , 161 Oryx Salmo t DNA PartA - 173. 34 in Sardinia. in Sardinia. rutta , 1 - 5. L.) inferred L.) inferred 27 Trends in International , 449 Annals - 454. Derzhavin, Derzhavin, A. N. (1929). B. Delling, & Doadrio, I. (2005). B.(2010).Delling, M., T.,Gassner, Dejaco, Arthofer,W.,Schlick Deichmann,J. L.,Mulchay, D.G., Vanthomme,Wynn,H., Tobi, E., A.H.&Zimkus, B.M. A., Cullaj, Hasko, A.,Miho,Schanz,F.,Brandl,H.&Bachofen, (2005). R. Crête Cortey, M., Pla,Vera, M., C.&García Cortey, M., Pla, C.&García This articleisprotected bycopyright.Allrightsreserved. Accepted Article Ichthyological Laboratory Freshwaters description (Teleostei:of anewspecies Salmonidae). of FreshwatersExploration fromnew species Greece (Teleostei: LourosRiver, the Salmonidae). Systematic Biology limits bristletailsdespite injumping hy widespread Taxonomist‟s nightmare … forwestdata African Central amphibian conservation. ( waters natural Albanian humanimpact.and the 7 phy theBiological Society Journalof Linnean ofbrown expansions trout ( Atlantic trout. 2017) , - e46662. Lafrenière, A.,Weir, L.K.& Bernatchez, L. (2012). logenetic a from portrait: picture more complete taxonsampling increased Molecular Phylogenetics and Molecular Phylogenetics Evolution . Howmany UsingDNA andunderwhat names? species barcoding andGenBank 16 , Diversity ofwestern Diversity with southern Balkantrouts, and the of description a 49 - 65 64. , 947 A note on fishes of the River Karaj A noteonfishesoftheRiver Persia). Karaj (North - Marín, J. 2 - 974. evolutionist‟s evolutionist‟s 21 , 69 Systematics ofthetrouts endemic lakes, with toMoroccan , 331 – 79. - - - Salmo trutta L. (2004). 344. Marín, J. 97 delight: anintegrative species approach resolves - Steiner, B. F.Steiner, C. &Steiner, M.(2016). , - 904 33 L. (2009). Historical Historical biogeography ofMediterranean Environment Environment Internati ) populationsthe during Pleistocene. , - 831 917. bridization andp - Ichthyological of Exploration 844. PLoS One Framing the Northern Northern and Southern 12 arthenogenesis. arthenogenesis. , Ichthyological Salmonidae family e0187283. onal News of Baku 31 The of quality , . 133 PLoS - 146. ONE Fruciano, C.,Fruciano, A. V.(2014). Pappalardo, C.&Ferrito, M.,Tigano, R.& (2018).WideFroese, FishBase: Pauly,D.(Eds) WorldWeb el Freudenstein, andthe B.T.(2017).Biodiversity J.V.,Broe,M.B.,Folk,R.A. &Sinn, D.J. Fraser, & Bernatchez, L.(2001) J.M.Elliott, (1994). J.M.Elliott, (1989). Duméril, A.(1858). numberDuchi, A.(2018).Flank spot significance for andits systematics, taxonomy and Dodson, J. I., S.&Yahyaoui,Doadrio, Perea, A.(2015). This articleisprotected bycopyright.Allrightsreserved. Accepted Article morphospace occupation. relationships of effects of geneticintrogressionbrown trout andthe Sicilian on atwww.fishbase.orgAvailable species concept for concept defining conservationunits. Press. resource. de Magazin Zoologie population.genetically pure conservation ofthenear and Aquatic Sciences for plans of salmon conservation Atlantic ( J. L.,Power,Newbury, R.,Nielsen, M.E.&Roy,S.(1998). Salmonidae)(Actinopterygii, from Morocco. J., Gibson, R. J., Cunjak, R. A., Friedland, K. D., de Leaniz, C.de Leaniz, K.D., G.,Gross,J., Gibson,R.Cunjak,A.,Friedland, M.R., Freshwater – Note ( unetruited‟Algérie sur lineages Quantitative EcologyQuantitative andthe BrownTrout Wild browntrout Biology 10 55 - , , threatened threatened Mediterranean trout 396 312 Biological Jou are not not are enough. Journal of Fish B Journal ofFish - - 399. 21 323. , 1 . - Adaptive evolutionaryconservation: towardsaunifiedAdaptive 5. Salmo trutta Mole rnal of rnal the Linnean Society Salmo salar Systematic Biology Two new species of Atlantic trout Two trout new speciesofAtlantic c Graellsia iology ular Ecology Salar macrostigma Salar an important national and international 92 ). , 254 71 Salmo cettii Canadian Fisheri Journal of , e031. 10 - . Oxford: Oxford University . Oxford: Oxford University Elements development inthe 260. 66 , 2741 Phylogeographical ectronic publication.ectronic , 644 , A.Dum.). : evidence from: evidence a 112 - 2752. - 656. , 387 - 398. Revue et Revue et es Grandjean, F.,Grandjean, Tan,M.H.,Gan,M.,Lee,Y.P.,Kawai, R. H. T.,Distefano, J.,Blaha,M., R.& Geldiay, R.(1968). Geldiay, Geiger A.Gauthier, &Berrebi, Lacoloni P. (2007). Gandolfi, G.,Zerunian, P.,S., Torricelli, Fumagalli, D.,L., Snoj,A.,Jesensek, F.,Jug,T.,Duron,O.,Brossier,Crivelli, Balloux, A. This articleisprotected bycopyright.Allrightsreserved. Accepted Article 718 Hemispgenome Northern from skimming C. Austin, Roles, A.J.& M.(2017). Serisi Kitaplar TürkBiyolojiMilli Tebliğler,15 Kongresi, fishes. of freshwater its heterogeneitySpatial in theMediterranean Šanda, R.,Schneider, M., M.,Walter, Šlechtová, V.,Stoumbouti, Freyhof, S.& J.(2014) Z., Özuluğ,H., M.,Perdices, A.,Perea,S.,Persat, Porcelotti, S.,Puzzi,C., Kalogianni, E., Kärst, H.,Kottelat,M.,Kovačić, M., Laporte,Lorenzoni,Marčić, M., P., Bo la etlaCorse pour Pêche du Protection Aquatique. Milieu de Guide degestion macrostigmala truite italiane marble trout( J. &Berrebi, P.(2002). - M. F., F., Herder, Monaghan,M.T.,Almada, V 728. h len, J.,Casal len, . Roma: delloPoligrafico e Zecca Stato. Istituto Balık, S. Balık, Salmo 97 A study ontrout( , 519 - marmoratus Lopez, Delmastro, M., Denys,G.P. G.B., J.,Dettai,A.,Doadrio, I., ( 1988) . Molecular Ecology Resources Extreme differentiation among remnant genetic the populations of . Türkiye tatlısu balıklarıTürkiye tatlısu ) in ) in Slovenia. Salmo trutta Rapid recovery ofnuclearRapid recovery andmitochondrialgenes by & Marconato, A.(1991).Marconato, sation par de l‟île différentessouchesdetruite. In here freshwater crayfish. freshwater here (Muracciole, S.,ed), pp.4 (Muracciole, biodiversity hotspotbiodiversity - 21 August, İzmir, Turkey, Molecular EcologyMolecular L.) populations in in L.) populations the Kazdagi stream.VI. ., Barbieri, R.,Bariche,., Barbieri, Berrebi, M., . Ege Üniversitesi 14 , 1210 - affects barcoding accuracyaffects barcoding I pesciacque delle interne 1 221. 11 Zoologica Scripta Zoologica - , 2711 10. Fédération Corte: pp. Fen Fakültesi 65 Robalo, J., - 2716. - 77. 46 , Kearse, M., R.,Wilson,Kearse, A.,StonesMoir, Kattoulas, M. (1972). Y.Karakousis, C. &Triantaphyllidis, (1990). M. Kara, C.,Alp,A.&Simsekli, (2010). IUCN. (2016). N.J. Isaac, B., Mallet, J.G. &Mace, M.(2004). Höss, M. H.Hasegawa, M.,Kishino, &Yano,T.(1985). génétiqueGuyomard, R.(1989).Diversité delatruite commune. Guindon, S.,Dufayard, O.(2010). J.F.,Lefort,V.,Anisimova, W.Gascuel, M.,Hordijk, & P., Gratton, Allegrucci, G., Gandolfi, A This articleisprotected bycopyright.Allrightsreserved. Accepted Article Cooper, A., Markowitz, T.,Cooper, A.,Markowitz, S., Duran,C.,Thierer, P. Ashton,B.,Meintjes, &Drummond, Physics of University &Mathematics, Faculty of Thess trout ( Greek brown 111 basin www.iucnredlist.org macroecology andconservation. clockmolecular DNA. ofmitochondrial de Pêche et laPisciculture performance ofPhyML3.0. methodsNew algorithms estimate andto maximum lake.karstic occurring naturally sympatrichybridization intwo trout - 122. of Turkey. CeyhanRiver, ( 2000). The IUCN Red List of Threatened Species. Species. The IUCN ofThreatened RedList Journal ofFishJournal Biology Neanderthal populationgenetics.Neanderthal The fish fauna of the Mornos RiversThe fish (Greece). faunaoftheMornos Salmo trutta . Downloaded 314, Systematic Biolog Turkish Journal ofTurkish Journal andAquatic Sciences Fisheries 118 L.) populations. Trends Ecology in andEvolution on 16 March on 16March 2017. - . 135. 82 & Sbordoni, V.(2013) & Sbordoni, - Distribution of Havas, S.,Cheung, S.,Buxton, M.,Sturrock, S., , 637 Journal of Molecular Evolution ofMolecular Journal Genetic structure anddifferentiation among - Dating the human the Dating 657. Taxonomic inflati y Nature 57 Heredity , 307 - likelihood phylogenies: assessinglikelihood phylogenies: the fish fauna andmiddle onthe upper aloniki Version 2016 - 404 Salmo 321. 64 , . 452 , Genetic differentiation and Bulletin Bulletin de Français la 297 12 – spp. forms from asmall ape splitting bya ape splitting on: its influence on - , 454. Scientific Annals, - 317 19 304. - , 3 - 464 . 328. Available at 22 - 469. , 160 – 174. 10 , Morard, R., Morard, Weiner,Escarguel, G., A., Douady, A.K. Darling, C.J.,Wade, M.,André, C.M., P.Massidda, (1995). A., J.,Almodóvar,A.&Bautista,J.M.(2000). Machordom, Suárez, G.M.Mace, The oftaxonomy (2004). role conservation. inspecies MacCrimmon, H.R.T. &Marshall, L.(1968). K.,Nouiri, H.&Jaziri Lbadaoui, Kottelat, M.&Freyhof,J.(2007). methodKimura, Asimple M.(1980). for estimatingevolutionaryratesofbasesubstitutions This articleisprotected bycopyright.Allrightsreserved. Accepted Article 65 diversity taxonomyexemplified cryptic Foraminifera. byplanktonic of M.(2016).Nome Kucera, K. F.,Y.,Seears, deH. A., Ujiié, Garidel Quillevéré, Dolce Italiani 1325 andvariation phylogeography of browntroutpopulations. Iberian Royal the B Transactions of Society trutta Journal dugenre truites Germany:Berlin, Kottelat andFreyhof. Publications 111 ofnucleotidesequences. comparativestudies through organization andanalysisof data. sequence A. (2012). , 925 - 120. - . 1338. . Journal of the Journal the of - ( 940. 12 Ambientale , Geneious Basic:anintegratedandextendableGeneious d 13 - 23. Salmo Salmo , Fisheries Research BoardofCanada B : variation allozymiquetaxonomique. etstatut . , ed. ( nclature fornclature nameless: the aproposalfor integrative molecular an trutta ), pp. , H. (2011). ) fishes Hanbook ofEuropeanfreshwater macrostigma 40 , - 359 43 . , 711 Tries Les populations marocaines autochtones des Bioinformatics World - te: AcquaAssociazione Italiana Ittiologidi 719. in Sardegna. In in Sardegna. In distribution ofdistribution brown trout Journ - Thoron, T., de Vargas, C.& Thoron, T.,deVargas, esktop softwareplatformthe for 25 28 al of Molecular Evolution , , Workshop Salmonidi sui 2527 1647 Philosophical Molecular Ecology Mitochondrial haplotype - - 2548. Lebanese Science Lebanese 1649. Systematic BiologySystematic . Cornol and , Salmo 9 16 , , Özen, N.(2013). J. Nylander, A. (2004). Nonnis Marzano,F., Ninua, L.,Tarkhnishvili, D.&Gvazava,E.(2018) Newman, E.&Rissler,L.J.(2011). C. C.(1994).Moritz, fauna P.(1928).floraMola, edella Facies della delleaque interne. S.W., M.,Kekkonen,L. P.D.N.Mutanen, Prosser, One M., &Kaila, (2015). Herbert, This articleisprotected bycopyright.Allrightsreserved. Accepted Article df doi: AdnanMenderesUniversity,Thesis. Aydın,Turkey. www. Biology Cent Biology Environmental of Fishes ofmassive a result restocking ofApenninepopulations Central (Northern and Italy). for variabilityevidence introgressionin ofgenetic andloss evolutiontrout andtaxonomy. and trout salmon Ponto from the subspecies. impactfrog: the ofgeography Ecology andEvolution Hydrobiologiegesamten undHydrographie Molecular Ecology Resources sp ecies ineight:DNA fromecies barcodes specimensquagmire. type ataxonomic resolve adudspace.adu.edu.tr:8080/jspui/bitstream/11607/1417/3/NAZAN%20%C3%96ZEN.p github.com/nylander/MrModeltest2 Molecular Ecology re, Uppsalare, University. Available at Türkiye‟deki alabaliklarin Türkiye‟deki alabaliklarin ( Defining Significant “Evolutionarily Units” forconservation. Corradi, N.,Papa,Corradi, J. R.,Tagliavini, & Gandolfi, G.(2003). 9 MrModeltest v2.ProgramMrModeltest distributedbytheauthor.Evolutionary , 373 - and climate distribution lineages onthe of vs. genetic 375. 15 Ecology andEvolution 20 - , 967 Caspian drainages, inference with 68 , 5295 , Phylogeographic analysesPhylogeographic ofthesouthernleopard 349 - 984. - - 5312. 356. Salmo trutta 20 , . 117 Phylogeography andtaxonomic statusof - 173. Available at doi: 10.1002/ece3.3884 L.) D. moleküler filogenisi. Phil. Salmo Internationale Revue der ( s onEuropean brown trutta ) macrostigma Trends in Molecular Molecular . as Sambrook, F.&Huelsenbeck,P.(2003).Ronquist, J. J.(1997). espèces animalesRoche, B.&Mattei, Les int A.(1995).Rakaj, N.&Flloko, F. G.,Pecchioli,E.,Leonzio,C.,Frati, Querci, V.,Puillandre,Prie, N.&Bouchet, P. (2012) Phillimore, P.F.(2006). A.B. I. &Owens, Patarnello, T., Bargelloni, L.,Caldara,F.&Colombo, L.(1994). S.,Papakostas, Michaloudi,E.,Proios,K.,Brehm, A., J.M.,Miralles, Padial, DelaRiva,I.&Vences,M.(2010). This articleisprotected bycopyright.Allrightsreserved. Accepted Article New York: ColdSpring LaboratoryPress.Harbor mixedmodels. Corse. Conservation Hydrobiologia and hybridization in Knowledge of conserv Molecular Phylogenetics andEvolution rRNA inthe variation sequence from evidence cryptic species arotifer complex. taxonomy evolutionary units despite mitonuclear recognizes widespread discordance: S.A. V.L.,D.&Declerck, Integrative (2016). Stamou,Pritchard, Fontaneto, G., taxonomy. Unio mancus Bulletin FrançaisBulletin PêchelaPisciculture dela etde ation biology? J., Fritsch, E. T.(1989).J., Fritsch, F.&Maniatis, Frontiers inZoologyFrontiers and Management of Aquatic Ecosystemsand Management ofAquatic 72 702 Bioinformatics , 195 Lamarck, Unionidae) and 1819(Bivalvia: its accepted subspecies. , 191 Salmo - 199. Proceedings of B RoyalSociety the - 200. ( trutta Conservation status of freshwater fishConservation status of offreshwater Albania. 19 Salmo trutta 7 , , ) 1572 16. macrostigma MrBayes3: Bayesianphylogenetic inference under - 3 1574. Are subspecies usefulAre subspecies inevolutionary and , . 69 Bad taxonomy can kill: molecularBad taxonomycankill: reevaluation & (Salmonidae, complex. species Teleostei) - 74. Nardi, F.(2013).Nardi, M., Verhage, L.,Rota,J.,Peña,C.,M., Verhage, Molecular cloning: a Molecularlaboratory cloning: manual Syst morphotypes from roduites les dans eauxdouces de ematic Biology 405 , 08. , 344 273 The integrative future ofThe integrativefuture - Cytochrome 345 , 1049 Molecular characterizationMolecular , 233 c 65 - entral Italy. entral 1053. , 508 - 239. b - 524. and 16S and Biological Biological . Snoj, A., Melkič, E., Snoj, A.,Melkič, Snoj, A Snoj, A.,Glamuzina, A.,Zablocki, J., Razpet, Bogut,I.,Lercetau B., W. J. Sites, & Marshall, J. C.(2004).Operational I.H., A.,Bernatchez,L., Segherloo, Farahmand, H.,Abdoli, Primmer, A., C.R.,Swatdipong, N. Schultz, E., Lane,C.LeB.,Rousseau, L.,Gey,Bigney,A.R.,F. Gall, D.,deReviers, J.,Sušnik, Schöffmann, S. Phylogeography historySanz, N.(2017). In ofbrowntrout: areview. This articleisprotected bycopyright.Allrightsreserved. Accepted Article Linnean Society revised classificationsupports of Molecular Phylogenetics andEvolution structurePhylogeographic patterns anddemographic of browntrout in dentex Sušnik, S. ofEcology,Review Evolution approach.morphogenetic populations in fiveriversCaspianSeaandtwo from lake southern basins, Iran:a inland the B. (2012). & Khalili, Karami, M. Phycology epi Atlantic Phaeophyceae) in western and Oceanwithfourthe species the novel & Scneider, W. analysisofthegenus C. Abarcode (2015). onmitochondrialfrom and based Sicily, nuclear DNA analyses. Wiley. Ecology andManagement typification of . , Marić, S.,Sušnik S , Marić, Bajec, and community. the Balkantrout (2010). mol uncertainties Resolvingusing taxonomic 50 , 481 77 L. variegat Sušnik - , 399 500. & - 411. , S.,Muhamedagič, DNA S.&Dovč,P.(2002). phylogeny Journal of Journal Fish Biology Snoj, A.(2007). (Lobón a and (J. V. (J. Lamouroux) E.C. Oliveira. . , Berrebi, P., S. , Berrebi, Janjani, & Schöffmann, J.(2011). Salmothymus obtusirostris Phylogenetic status of brown trout Phylogenetic statusofbrowntrout - Systematics Cervi 61 á, J.&Sanz, N.,eds),pp.17 Hydrobiologia , Phylogenetic Phylogenetic of origin 203 35 criteria for delimiting species. fordelimitingcriteria species. - 211. , 199 81 , 1479 - 227. 651 - Lobophora , 199 . 1500. Biological Journal of theBiological Journalof ecular systematics: Hydrobiologia - European of Journal 212. - Salmo trutta Köhler, E.,Pojkić,N.& Brown Salmo trutta - 63. Hoboken, NJ: 63. Hoboken,NJ: north (Dictyotales, Trout - west Annual L 1758 575 – Biology, Biology, Africa. Salmo , 51 - 55. Turan, D., Kottelat, M. Turan, D.,Kottelat, S.(2009). & Engin, M. Turan, D.,Kottelat, Y & Bektas, Turan, D.,Doğan,E.,Kaya, C.&Kanyılmaz, (2014). M. E.Tortonese, (1954). Togan, I.,Fidan,A. Z.,Yain, E.,Erguven,A.&Emre, Y.(1995). M. Tilak, G., Tamura, K.,Stecher, S J.,Bautista,Suárez, J.M.,Almodóvar, A.&Machordom,(2001). A. This articleisprotected bycopyright.Allrightsreserved. Accepted Article ušnik, S., Knizhin, I., S.,Knizhin, I., ušnik, Snoj, A.&Weiss,S.(2006). Ichthyological Exploration ofFreshwaters Ana migratory, in sympatric streams of northern River, Salmonidae).Tigris Turkey(Teleostei: Salmonidae).(Teleostei, from Stream,trout Alakır draining to Mediterraneanthe insouthern Anatolia, Turkey DergisiHidrobiolji Enstitüsü brownpopulations.Turkish trout Resources assemble mitogenomes complete from non (2015). comparison sympatric to ofendemic,characterization aLakeOhrid ofthebiogeographical role Peninsula. Iberian regionmitochondrial brown control Palaearctic in trout ( 2729. evolutionary analysis genetics - k., F.,Debiais Justy, A cost 7 , 37 - effective protocol designedstraightforward for shotgunIlluminalibraries to - 40. The of trouts AsiaticTurkey. Peterson, D.,Peterson, Filipski,A.&Kumar, S.(2013). Zookeys Salmo trutta - Thibaud, M.,Botero Seri B2 . (2011). Journal ofFish Biology version 6.0. 462 , . , 1 135 Journal ofJournal Biology Fish - Two new species of trouts, resident and Two ofresident new species trouts, 26. Salmo tigridis - Salmo - 20 151. model species. , Molecular Biology andEvolution Molecular Biology Heredity Zootaxa 333 tolia (Salmoniformes: Salmonidae). Istanbul Istanbul - ( Genetic and morphological Genetic andmorphological Castro, F., Delsuc, F. & Douzery Castro, F.&Douzery F.,Delsuc, E.J.P. Acantholingua - 364. Salmo kottelati 2993 87 , froma newspeciesoftrout the Salmo trutta Üniversitesi Üniversitesi Fen Fakültesi 47 , Conservation Genetics 198 , , 23 164 - G 68 - 206. 33. enetic structure of structure twoenetic ) - , Evolution of the 169. ohridanus 2 - MEGA6: ) populations: the 23. , of anewspecies with a with a molecular molecular 30 , 2725 - Zachos, F.E.,Apollonio, M., Barmann, E.V., Festa Yang, Z.(1994). P.,Smith,P.A.,R.Wandeler, S.,Morin, Pettifor, A. Wittwer,Wagner, I., C.E., L., S.,Selz,O.M.,Nwaiko, Keller, S.,Greuter, A. Sivasundar, & P.(1948)Vivier, E.,Verspoor, M.,Sanz, Cortey, Vera, M., N.&García Valk,van der K. T.,Durazo, F.L.,Dalén,Whole L.&Guschanski, (2017) mitochondrial M. Turan, D.,Kottelat, S.(2012). & Engin, This articleisprotected bycopyright.Allrightsreserved. Accepted Article Haring, E.,Kruckenhauser, L.,Lovari,Haring, S.,McDevitt, A.D.,Pertoldi, G.E., C.,Rossner, Evolution 12 DNA overtime degradation radiation. boundaries ofspecies and resolution relationships adaptative intheLake cichlid Victoria Seehausen, O. (2013). de Français la Pisciculture Baypopulations the Canada. within eastern ofFundy, genematrilineal differentiation flowandregional salmon among( Atlantic Systematics and EvolutionaryResearch ofbrown ( lineage trout Ecology Resources genome from specimens. samplesfaecal capture andmuseumpreserved Ichthyological Exploration ofFreshwaters Anatolia,southern Turkey,with descriptionofthreenewspecies(Teleostei: , 1087 - 1093. Molecular EcologyMolecular 39 O‟Sullivan, M.,Arnold,A. P.G.(2002).Restricted D.&Amiro, L.,Knox, , . Notesureauxdouces sur les duMarocet leur mise envaleur. 105 Estimating pattern the substitution. ofnucleotide - 111. 17 , e1 Genome Salmo trutta 11 150 - – e121. 22 a case study in historic in study a case teeth samples. - , 5 wide RAD sequence data provide data unprecedented RAD sequence wide , 787 - 17. ) within the Duero) within the riverbasin - - 798. Marín, J.L.(2010). 48 The the of trouts Mediterranean drainagesof , 23 181 , 219 - 187. - Bianchet, M., Gohlich, U.,Habel, J.C., & - 236. Funk, S.M. Heredity Maintenance ofanendemic Journal ofMolecular 89 ( . Journal . Journal of Zoological 2003). , 465 Molecular Ecology Molecular - 472. Molecular Molecular Pattern of Pattern nuclear Salmo salar Salmonidae). Bulletin L.) online Information the Supporting of mayfoundin paper version this be Supporting Zouakh, D.E.(2009). B. E.,Faircloth, W.Zarza, C., Tsai, L. E.,BrysonR.W.,J.& Jr, Klicka, McCormack,J.E. This articleisprotected bycopyright.Allrightsreserved. Accepted Article Bo ichtyologiques d‟Algérie. D.Phil. Molecular Ecology Hidden of(2016). histories geneflo Mammalian Biology taxonomic artefacts Sanchez umediene, Alger, Algeria, umediene, Algeria, Alger, - Villagra, M.R.,Villagra, Scandura, Suchentrunk, F.(2013).M. & I nformation Hydrosystèmes etvalorisation continentaux des ressources 25 - 78 A critical comment trendsinmammalian onrecent classification. , 5144 , 1 - 6. - 5157. doi: hdl.handle.net/123456789/703 Thesis, Univ.des Thesis, Technologie Sciences dela et Houari w in highland birds revealed genomicw inhighland birds with markers. Species i nflation nflation and onindicated right. the the (≥ probabilities as used mitogenome the M mitochondrial FIGURE This articleisprotected bycopyright.Allrightsreserved. Accepted Article useum samples are are samples useum aiu likelihood maximum 1 Bayesian phylogenetic tree reconstructed from reconstructed tree phylogenetic Bayesian co 0.80) and bootstrap percentages (≥ percentages bootstrap and 0.80) to and ntrol in bold. * bold. in a or reference for read mapping. Numbers at nodes are for posterior posterior for are nodes at Numbers mapping. read for reference cytochrome aein inference Bayesian , M , acrostigma b region MNHN syntype MNHN s 50%). . anal ape labels Sample yses – , . Lineage or species names are are names species or Lineage . Nodes a concatenated ; ** weakly supported in supported weakly , the accession number of number accession the are given alignment n al S1. Table in of the the of either This articleisprotected bycopyright.Allrightsreserved. Accepted Article Duero Danubian Dades Atlantic Adriatic aredistances intergroup diagonal) above the (with distances 1 TABLE This articleisprotected bycopyright.Allrightsreserved. Accepted Article G enetic distances between lineages and the the and lineages between distances enetic S.E. (0.001) 0.009 0.011 0.004 0.011 0.012 in brackets) in the diagonal are intragroup distances intragroup are diagonal the in brackets) in 1 (0.000) 0.001 0.009 0.013 0.009 0.002 2 (0.001) 0.002 0.011 0.011 0.002 0.002 3 (0.001) 0.005 0.016 0.002 0.002 0.002 4 most close 0.001 0.003 0.002 0.002 0.002 5 ly related (in bold) (in 0.002 0.002 0.002 0.001 0.002 6 species of species , while the genetic distances below the diagonal (with their (with diagonal the below distances genetic the while , 0.002 0.002 0.002 0.002 0.002 7 Salmo trutta Salmo 0.002 0.002 0.001 0.002 0.002 8 based on based 0.002 0.002 0.002 0.002 0.002 9 the concatenated dataset concatenated the 0.003 0.004 0.003 0.003 0.003 10 0.002 0.003 0.003 0.003 0.003 11 . Genetic 0.005 0.005 0.005 0.005 0.005 12 S.E. S. S. salar S. ohridanus S. obtusirostris Turkish Mediterranean Marbled North African This articleisprotected bycopyright.Allrightsreserved. Accepted Article 0.018 0.009 0.009 0.008 0.011 0.058 0.028 0.059 0.029 0.016 0.011 0.011 0.011 0.005 0.055 0.022 0.018 0.010 0.007 0.008 0.009 0.059 0.026 0.021 0.012 0.012 0.012 0.013 (0.000) 0.010 0.059 0.031 0.016 0.013 0.013 0.013 (0.001) 0.003 0.057 0.024 0.016 0.011 0.011 0.010 (0.000) 0.001 0.002 0.058 0.027 0.016 0.010 0.008 (0.000) 0.001 0.058 0.029 0.019 0.011 0.002 0.002 (0.001) 0.003 0.056 0.026 0.018 0.002 0.002 0.002 (0.001) 0.001 0.068 0.027 0.004 0.004 0.004 0.003 (0.001) 0.002 0.061 0.003 0.003 0.003 0.003 0.002 (0.002) 0.008 0.005 0.005 0.005 0.005 0.005 0.005