DOCSLIB.ORG

Tumor Gene Chromosome Coordinate Variant Hgvsc Hgvsp ADAM29 4

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Tumor Gene Chromosome Coordinate Variant Hgvsc Hgvsp ADAM29 4 Supplementary material J Clin Pathol Supplementary table 1 : Genetic alterations identified in the four tumors analyzed. Genetic alterations Tumor Gene Chromosome Coordinate Variant HGVSc HGVSp ADAM29 4 175899088 G>G/T NM_014269.4:c.2412G>T NP_055084.3:p.Arg804Ser ANKRD36 2 97833499 G>G/C NM_001164315.1:c.1628G>C NP_001157787.1:p.Gly543Ala CBX2 17 77757739 G>G/A NM_005189.2:c.497G>A NP_005180.1:p.Arg166Gln CDH1 16 68846080 C>C/T NM_004360.3:c.1051C>T NP_004351.1:p.Gln351Ter CDRT15 17 14139702 G>G/A NM_001007530.1:c.308C>T NP_001007531.1:p.Ala103Val CNIH3 1 224927032 A>A/T NM_152495.1:c.457A>T NP_689708.1:p.Met153Leu CTBP2 10 126686682 A>A/T NM_022802.2:c.2036T>A NP_073713.2:p.Ile679Asn CTBP2 10 126686692 C>C/T NM_022802.2:c.2026G>A NP_073713.2:p.Asp676Asn CX3CR1 3 39307802 C>C/T NM_001171174.1:c.295G>A NP_001164645.1:p.Asp99Asn FAM8A1 6 17601058 G>G/A NM_016255.2:c.418G>A NP_057339.1:p.Ala140Thr FOXC1 6 1611802 G>G/GGGC NM_001453.2:c.1139_1141dupGCG NP_001444.2:p.Gly380dup GBE1 3 81698058 C>C/T NM_000158.3:c.640G>A NP_000149.3:p.Ala214Thr HAUS4 14 23421618 A>A/C NM_017815.2:c.249T>G NP_060285.2:p.Ile83Met HES4 1 935076 T>T/A NM_001142467.1:c.278A>T NP_001135939.1:p.Lys93Ile HOMEZ 14 23745840 C>C/G NM_020834.2:c.597G>C NP_065885.2:p.Gln199His ICAM5 19 10404565 G>G/A NM_003259.3:c.1657G>A NP_003250.3:p.Glu553Lys IL32 16 3119297 C>C/CG NM_004221.4:c.514dupG NP_004212.4:p.Asp172GlyfsTer12 IQSEC2 X 53264161 G>G/A NM_001111125.2:c.3707C>T NP_001104595.1:p.Ser1236Phe IVL 1 152883493 T>T/A NM_005547.2:c.1220T>A NP_005538.2:p.Val407Glu KIR2DL1 19 55284986 C>C/G NM_014218.2:c.272C>G NP_055033.2:p.Thr91Arg KMT2C 7 151962265 C>C/T NM_170606.2:c.1042G>A NP_733751.2:p.Asp348Asn KRT8 12 53298648 G>G/A NM_001256282.1:c.202C>T NP_001243211.1:p.Arg68Ter KRT8 12 53298675 A>A/C NM_001256282.1:c.175T>G NP_001243211.1:p.Ser59Ala MAGED2 X 54836575 G>G/C NM_177433.1:c.466G>C NP_803182.1:p.Glu156Gln MST1L 1 17085006 C>C/T NM_001271733.1:c.1469G>A NP_001258662.1:p.Gly490Glu MST1L 1 17087541 GGTGCT>GGTGCT/G NM_001271733.1:c.119_123delAGCAC NP_001258662.1:p.Gln40ProfsTer18 MTCH2 11 47660294 C>C/T NM_014342.3:c.236G>A NP_055157.1:p.Cys79Tyr MUC12 7 100634922 G>G/A NM_001164462.1:c.1078G>A NP_001157934.1:p.Ala360Thr NFKBIZ 3 101568542 G>G/A NM_031419.3:c.70G>A NP_113607.1:p.Gly24Ser Primary breast Bergeron A, et al. J Clin Pathol 2020;0:1–5. doi: 10.1136/jclinpath-2019-205783 Supplementary material J Clin Pathol Primary breast OR2T35 1 248801778 A>T/T NM_001001827.1:c.782T>A NP_001001827.1:p.Leu261Gln tumor PDZD8 10 119134498 T>T/G NM_173791.3:c.241A>C NP_776152.1:p.Thr81Pro PFKM 12 48527121 A>A/G NM_001166686.1:c.664A>G NP_001160158.1:p.Thr222Ala PFKM 12 48534616 G>G/A NM_001166686.1:c.1516G>A NP_001160158.1:p.Val506Ile PHRF1 11 610711 G>G/A NM_020901.2:c.4624G>A NP_065952.2:p.Glu1542Lys PIK3R6 17 8726721 G>G/C NM_001010855.2:c.1609C>G NP_001010855.1:p.Gln537Glu PRB1 12 11506856 G>G/A NM_005039.3:c.181C>T NP_005030.2:p.Pro61Ser PRSS3,UBE2R2-AS1 9 33798529 C>C/G NM_007343.3:c.671C>G NP_031369.2:p.Thr224Ser PRUNE2 9 79324135 A>A/ATGACTGTTGCAGM_015225.2:c.3043_3054dupCTGCAACAGTCANP_056040.2:p.Leu1015_Ser1018dup RHOA 3 49405978 C>C/T NM_001664.2:c.160G>A NP_001655.1:p.Glu54Lys ROBO2 3 75986750 C>C/T NM_001128929.2:c.106C>T NP_001122401.1:p.Gln36Ter SIPA1L2 1 232650316 C>C/T NM_020808.3:c.770G>A NP_065859.3:p.Arg257His SLC23A2 20 4893567 G>G/T NM_203327.1:c.166C>A NP_976072.1:p.Leu56Ile SPHKAP 2 228882558 C>C/G NM_001142644.1:c.3012G>C NP_001136116.1:p.Lys1004Asn SRR 17 2218895 A>A/G NM_021947.1:c.41A>G NP_068766.1:p.Lys14Arg SSBP4 19 18542496 A>A/C NM_032627.4:c.475A>C NP_116016.1:p.Thr159Pro TBC1D29 17 28890301 G>G/A NM_015594.2:c.311G>A NP_056409.1:p.Ser104Asn TIGD6 5 149375086 C>C/T NM_030953.3:c.826G>A NP_112215.1:p.Glu276Lys TPRX1 19 48305819 C>C/G NM_198479.2:c.449G>C NP_940881.2:p.Arg150Pro TRIM6,TRIM6-TRIM34 11 5632482 C>C/G NM_001003818.2:c.1461C>G NP_001003818.1:p.Phe487Leu TYW1B 7 72081809 T>T/C NM_001145440.1:c.1634A>G NP_001138912.1:p.Gln545Arg USP5 12 6972416 G>G/C NM_001098536.1:c.1829G>C NP_001092006.1:p.Gly610Ala ZAN 7 100350330 C>C/A NM_003386.1:c.2602C>A NP_003377.1:p.Pro868Thr ZKSCAN1 7 99627887 G>G/T NM_003439.1:c.688G>T NP_003430.1:p.Glu230Ter ZNF260 19 37004920 C>C/G NM_001012756.2:c.1221G>C NP_001012774.1:p.Gln407His ZNF3 7 99669169 G>G/T NM_001278284.1:c.938C>A NP_001265213.1:p.Ala313Asp ZNF493 19 21607406 C>C/A NM_001076678.2:c.1945C>A NP_001070146.1:p.Gln649Lys ZNF595 4 86022 C>A/A NM_182524.2:c.627C>A NP_872330.1:p.Tyr209Ter ZNF717 3 75786035 G>G/GA NM_001128223.1:c.2738dupT NP_001121695.1:p.Ter915LeufsTer? ZNF92 7 64864361 G>G/T NM_152626.2:c.1334G>T NP_689839.1:p.Arg445Ile ADGRG4 X 135431135 A>A/C NM_153834.3:c.5270A>C NP_722576.3:p.Asp1757Ala AKNA 9 117124731 G>G/A NM_030767.4:c.1871C>T NP_110394.3:p.Pro624Leu ALG10B 12 38714929 A>G/G NM_001013620.3:c.1336A>G NP_001013642.1:p.Ile446Val Bergeron A, et al. J Clin Pathol 2020;0:1–5. doi: 10.1136/jclinpath-2019-205783 Supplementary material J Clin Pathol ANKRD44 2 197990689 G>G/A NM_001195144.1:c.334C>T NP_001182073.1:p.His112Tyr ARMC4 10 28250610 C>C/A NM_018076.2:c.1273G>T NP_060546.2:p.Asp425Tyr BCL6B 17 6928019 C>C/CCAG NM_181844.3:c.729_731dupCAG NP_862827.1:p.Ser244dup BPIFB4 20 31673898 C>C/T NM_182519.2:c.854C>T NP_872325.2:p.Thr285Met C12ORF29 12 88440676 G>C/C NM_001009894.2:c.712G>C NP_001009894.2:p.Val238Leu C4ORF22 4 81529518 T>C/C NM_001206997.1:c.365T>C NP_001193926.1:p.Ile122Thr CBX2 17 77757739 G>G/A NM_005189.2:c.497G>A NP_005180.1:p.Arg166Gln CDC27 17 45229253 T>T/G NM_001114091.1:c.1007A>C NP_001107563.1:p.Lys336Thr CDC27 17 45229254 T>T/G NM_001114091.1:c.1006A>C NP_001107563.1:p.Lys336Gln CDH1 16 68846080 C>C/T NM_004360.3:c.1051C>T NP_004351.1:p.Gln351Ter CDK11A 1 1638961 C>C/T NM_024011.2:c.1132G>A NP_076916.2:p.Glu378Lys CEP128 14 80963847 G>G/C NM_152446.3:c.3260C>G NP_689659.2:p.Pro1087Arg CEP44 4 175225452 G>A/A NM_001145314.1:c.439G>A NP_001138786.1:p.Gly147Ser CSMD3 8 113657433 C>C/T NM_198123.1:c.3215G>A NP_937756.1:p.Arg1072Lys CTDSP2 12 58217736 AGG>AGG/A NM_005730.3:c.639_640delCC NP_005721.3:p.Leu214HisfsTer24 CX3CR1 3 39307802 C>C/T NM_001171174.1:c.295G>A NP_001164645.1:p.Asp99Asn ESD 13 47354101 C>T/T NM_001984.1:c.569G>A NP_001975.1:p.Gly190Glu FER1L6,FER1L6-AS1 8 125015458 C>C/T NM_001039112.2:c.1571C>T NP_001034201.2:p.Ser524Leu FGD6 12 95604290 T>C/C NM_018351.3:c.770A>G NP_060821.3:p.Gln257Arg FGL1 8 17731961 G>A/A NM_004467.3:c.314C>T NP_004458.3:p.Pro105Leu GBP2 1 89575909 T>T/A NM_004120.4:c.1403A>T NP_004111.2:p.Asp468Val GRIN3B 19 1004740 T>T/C NM_138690.1:c.1240T>C NP_619635.1:p.Trp414Arg HAUS4 14 23421618 A>A/C NM_017815.2:c.249T>G NP_060285.2:p.Ile83Met HEYL 1 40092267 G>G/T NM_014571.3:c.899C>A NP_055386.1:p.Ser300Ter HLA-DRB5 6 32489939 T>C/C NM_002125.3:c.113A>G NP_002116.2:p.Gln38Arg HOMEZ 14 23745840 C>C/G NM_020834.2:c.597G>C NP_065885.2:p.Gln199His IL13RA2 X 114248386 GA>GA/G NM_000640.2:c.466delT NP_000631.1:p.Ser156LeufsTer6 KCNJ12 17 21319650 CGAG>CGAG/C NM_021012.4:c.1000_1002delGAG NP_066292.2:p.Glu334del KCNJ12 17 21319767 C>C/G NM_021012.4:c.1113C>G NP_066292.2:p.Ser371Arg KIR3DL2 19 55370581 T>T/A NM_006737.3:c.997T>A NP_006728.2:p.Ser333Thr KMT2D 12 49426460 A>G/G NM_003482.3:c.12028T>C NP_003473.3:p.Ser4010Pro KRT19 17 39684321 G>G/C NM_002276.4:c.179C>G NP_002267.2:p.Ala60Gly KRTAP4-7 17 39240661 C>G/G NM_033061.3:c.203C>G NP_149050.3:p.Thr68Ser Bergeron A, et al. J Clin Pathol 2020;0:1–5. doi: 10.1136/jclinpath-2019-205783 Supplementary material J Clin Pathol LRIT3 4 110790911 A>T/T NM_198506.4:c.1006A>T NP_940908.3:p.Met336Leu LYPD2 8 143833856 C>T/T NM_205545.1:c.14G>A NP_991108.1:p.Arg5Gln MAGED2 X 54836575 G>G/C NM_177433.1:c.466G>C NP_803182.1:p.Glu156Gln mars-08 10 45953767 A>G/G NM_145021.4:c.796T>C NP_659458.2:p.Tyr266His MUC16 19 9015382 C>C/T NM_024690.2:c.38206G>A NP_078966.2:p.Gly12736Ser MUC20 3 195452799 C>T/T NM_152673.2:c.812C>T NP_689886.2:p.Thr271Ile Bone MYO9A 15 72270565 A>A/C NM_006901.3:c.1791T>G NP_008832.2:p.Asn597Lys metastasis N/A 1 233518183 G>G/A NM_032435.2:c.2837G>A NP_115811.2:p.Arg946His NOTCH4 6 32191658 TAGC>TAGC/T NM_004557.3:c.45_47delGCT NP_004548.3:p.Leu16del NTN4 12 96131895 A>G/G NM_021229.3:c.613T>C NP_067052.2:p.Tyr205His OR2T35 1 248801592 C>C/T NM_001001827.1:c.968G>A NP_001001827.1:p.Gly323Asp OR9K2 12 55523586 AT>A/A NM_001005243.1:c.38delT NP_001005243.1:p.Leu13CysfsTer22 OTC X 38226617 G>G/A NM_000531.5:c.151G>A NP_000522.3:p.Glu51Lys OTOP3 17 72937851 G>A/A NM_178233.2:c.437G>A NP_839947.1:p.Arg146Gln PFKM 12 48534616 G>G/A NM_001166686.1:c.1516G>A NP_001160158.1:p.Val506Ile PFKM 12 48534652 C>A/A NM_001166686.1:c.1552C>A NP_001160158.1:p.Gln518Lys PGLYRP2 19 15582863 C>T/T NM_052890.3:c.1181G>A NP_443122.3:p.Arg394Gln PIK3CB 3 138417865 C>C/T NM_006219.2:c.1654G>A NP_006210.1:p.Glu552Lys PKD1L2 16 81161473G>G/GTACTGCCAAGCCTGGGGAAA2892.3:c.6241_6242insGCTTTCCCCAGGCTTGGCA NP_443124.3:p.Thr2081SerfsTer? PLD2 17 4720469 C>T/T NM_002663.4:c.1730C>T NP_002654.3:p.Thr577Ile PRR21 2 240982116 C>A/A NM_001080835.1:c.284G>T NP_001074304.1:p.Arg95Leu PRSS3 9 33797928 G>G/GCC NM_007343.3:c.473_474insCC NP_031369.2:p.Arg158SerfsTer11 PRSS3 9 33797930 GAC>GAC/G NM_007343.3:c.478_479delAC NP_031369.2:p.Thr160SerfsTer4 PTEN 10 89720804 ACTTT>ACTTT/A NM_000314.4:c.956_959delCTTT NP_000305.3:p.Thr319LysfsTer24 REPS1 6 139242207 T>T/C NM_031922.3:c.1393A>G NP_114128.3:p.Met465Val RFPL4B 6 112671015 C>C/G NM_001013734.2:c.105C>G NP_001013756.2:p.Ile35Met RHOA 3 49405978 C>C/T NM_001664.2:c.160G>A NP_001655.1:p.Glu54Lys ROBO2 3 75986750 C>C/T NM_001128929.2:c.106C>T NP_001122401.1:p.Gln36Ter SLC39A11 17 70645032 G>A/A NM_001159770.1:c.860C>T NP_001153242.1:p.Ala287Val SPHKAP 2 228882558 C>C/G NM_001142644.1:c.3012G>C NP_001136116.1:p.Lys1004Asn SPTA1 1 158631146 C>C/G NM_003126.2:c.2518G>C NP_003117.2:p.Glu840Gln SRR 17 2218895 A>A/G NM_021947.1:c.41A>G NP_068766.1:p.Lys14Arg TACC3 4 1729988 G>A/A NM_006342.2:c.859G>A NP_006333.1:p.Gly287Ser Bergeron A, et al.
Load more

Recommended publications
  • Defining Functional Interactions During Biogenesis of Epithelial Junctions
    ARTICLE Received 11 Dec 2015 | Accepted 13 Oct 2016 | Published 6 Dec 2016 | Updated 5 Jan 2017 DOI: 10.1038/ncomms13542 OPEN Defining functional interactions during biogenesis of epithelial junctions J.C. Erasmus1,*, S. Bruche1,*,w, L. Pizarro1,2,*, N. Maimari1,3,*, T. Poggioli1,w, C. Tomlinson4,J.Lees5, I. Zalivina1,w, A. Wheeler1,w, A. Alberts6, A. Russo2 & V.M.M. Braga1 In spite of extensive recent progress, a comprehensive understanding of how actin cytoskeleton remodelling supports stable junctions remains to be established. Here we design a platform that integrates actin functions with optimized phenotypic clustering and identify new cytoskeletal proteins, their functional hierarchy and pathways that modulate E-cadherin adhesion. Depletion of EEF1A, an actin bundling protein, increases E-cadherin levels at junctions without a corresponding reinforcement of cell–cell contacts. This unexpected result reflects a more dynamic and mobile junctional actin in EEF1A-depleted cells. A partner for EEF1A in cadherin contact maintenance is the formin DIAPH2, which interacts with EEF1A. In contrast, depletion of either the endocytic regulator TRIP10 or the Rho GTPase activator VAV2 reduces E-cadherin levels at junctions. TRIP10 binds to and requires VAV2 function for its junctional localization. Overall, we present new conceptual insights on junction stabilization, which integrate known and novel pathways with impact for epithelial morphogenesis, homeostasis and diseases. 1 National Heart and Lung Institute, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK. 2 Computing Department, Imperial College London, London SW7 2AZ, UK. 3 Bioengineering Department, Faculty of Engineering, Imperial College London, London SW7 2AZ, UK. 4 Department of Surgery & Cancer, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Extraction of Dynamic Patterns from Static Rna Expression Data: an Application to Hematological Neoplasms
    EXTRACTION OF DYNAMIC PATTERNS FROM STATIC RNA EXPRESSION DATA: AN APPLICATION TO HEMATOLOGICAL NEOPLASMS Relatore: Barbara Di Camillo Correlatore: Dott.ssa Alessandra Trojani Laureando: Giulia Bianchi ANNO ACCADEMICO 2012/2013 Nothing worth gaining was ever gained without effort. Theodore Roosevelt Index Section 1 INTRODUCTION 1 1.1. Extraction of temporal dynamics from gene expression data 2 1.2. Chronic Lymphocytic Leukemia 3 1.3. IgM Monoclonal Gammopathy of Undetermined Significance and Waldenstrӧm’s Macroglobulinemia 4 Section 2 DATA 7 2.1. CLL Data set 8 2.2. WM/MGUS Data set 8 Section 3 SAMPLE PROGRESSION DISCOVERY 10 3.1. Methods 10 3.2. SPD step by step 12 3.2.1. Input format 12 3.2.2. Gene filtering 12 3.2.3. Clustering 13 3.2.4. Construct MSTs – Compare modules and MSTs 14 3.2.5. Identify modules similar in terms of progression 16 3.3. Results and discussion 17 Section 4 PARAMETER SETTING 19 4.1. Input configuration 19 4.2. Result evaluation 20 4.3. Conclusions 26 Section 5 APPLICATION TO CHRONIC LYMPHOCYTIC LEUKEMIA 28 5.1. Gene selection 28 5.2. SPD results 29 Section 6 APPLICATION TO WALDENSTRÖM’S MACROGLOBULINEMIA AND IgM MGUS 39 6.1. Gene selection 39 6.2. SPD results 40 Section 7 DISCUSSION 45 Acknowledgements 49 Section 8 REFERENCES 51 Section 9 APPENDIX 55 i Section 1 INTRODUCTION Development and evolution of a disease are dynamic processes that, from a molecular point of view, involve changes in some gene expression levels in the involved organs and cells. A possible approach to study the behavior of such dynamic phenomena is to sample individuals, tissues or other relevant units at subsequent time-points throughout the progression.
    [Show full text]
  • Protein Identities in Evs Isolated from U87-MG GBM Cells As Determined by NG LC-MS/MS
    Protein identities in EVs isolated from U87-MG GBM cells as determined by NG LC-MS/MS. No. Accession Description Σ Coverage Σ# Proteins Σ# Unique Peptides Σ# Peptides Σ# PSMs # AAs MW [kDa] calc. pI 1 A8MS94 Putative golgin subfamily A member 2-like protein 5 OS=Homo sapiens PE=5 SV=2 - [GG2L5_HUMAN] 100 1 1 7 88 110 12,03704523 5,681152344 2 P60660 Myosin light polypeptide 6 OS=Homo sapiens GN=MYL6 PE=1 SV=2 - [MYL6_HUMAN] 100 3 5 17 173 151 16,91913397 4,652832031 3 Q6ZYL4 General transcription factor IIH subunit 5 OS=Homo sapiens GN=GTF2H5 PE=1 SV=1 - [TF2H5_HUMAN] 98,59 1 1 4 13 71 8,048185945 4,652832031 4 P60709 Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 - [ACTB_HUMAN] 97,6 5 5 35 917 375 41,70973209 5,478027344 5 P13489 Ribonuclease inhibitor OS=Homo sapiens GN=RNH1 PE=1 SV=2 - [RINI_HUMAN] 96,75 1 12 37 173 461 49,94108966 4,817871094 6 P09382 Galectin-1 OS=Homo sapiens GN=LGALS1 PE=1 SV=2 - [LEG1_HUMAN] 96,3 1 7 14 283 135 14,70620005 5,503417969 7 P60174 Triosephosphate isomerase OS=Homo sapiens GN=TPI1 PE=1 SV=3 - [TPIS_HUMAN] 95,1 3 16 25 375 286 30,77169764 5,922363281 8 P04406 Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 SV=3 - [G3P_HUMAN] 94,63 2 13 31 509 335 36,03039959 8,455566406 9 Q15185 Prostaglandin E synthase 3 OS=Homo sapiens GN=PTGES3 PE=1 SV=1 - [TEBP_HUMAN] 93,13 1 5 12 74 160 18,68541938 4,538574219 10 P09417 Dihydropteridine reductase OS=Homo sapiens GN=QDPR PE=1 SV=2 - [DHPR_HUMAN] 93,03 1 1 17 69 244 25,77302971 7,371582031 11 P01911 HLA class II histocompatibility antigen,
    [Show full text]
  • Cellular and Molecular Signatures in the Disease Tissue of Early
    Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of
    [Show full text]
  • Placenta-Derived Exosomes Continuously Increase in Maternal
    Sarker et al. Journal of Translational Medicine 2014, 12:204 http://www.translational-medicine.com/content/12/1/204 RESEARCH Open Access Placenta-derived exosomes continuously increase in maternal circulation over the first trimester of pregnancy Suchismita Sarker1, Katherin Scholz-Romero1, Alejandra Perez2, Sebastian E Illanes1,2,3, Murray D Mitchell1, Gregory E Rice1,2 and Carlos Salomon1,2* Abstract Background: Human placenta releases specific nanovesicles (i.e. exosomes) into the maternal circulation during pregnancy, however, the presence of placenta-derived exosomes in maternal blood during early pregnancy remains to be established. The aim of this study was to characterise gestational age related changes in the concentration of placenta-derived exosomes during the first trimester of pregnancy (i.e. from 6 to 12 weeks) in plasma from women with normal pregnancies. Methods: A time-series experimental design was used to establish pregnancy-associated changes in maternal plasma exosome concentrations during the first trimester. A series of plasma were collected from normal healthy women (10 patients) at 6, 7, 8, 9, 10, 11 and 12 weeks of gestation (n = 70). We measured the stability of these vesicles by quantifying and observing their protein and miRNA contents after the freeze/thawing processes. Exosomes were isolated by differential and buoyant density centrifugation using a sucrose continuous gradient and characterised by their size distribution and morphology using the nanoparticles tracking analysis (NTA; Nanosight™) and electron microscopy (EM), respectively. The total number of exosomes and placenta-derived exosomes were determined by quantifying the immunoreactive exosomal marker, CD63 and a placenta-specific marker (Placental Alkaline Phosphatase PLAP).
    [Show full text]
  • Whole Exome Sequencing in Families at High Risk for Hodgkin Lymphoma: Identification of a Predisposing Mutation in the KDR Gene
    Hodgkin Lymphoma SUPPLEMENTARY APPENDIX Whole exome sequencing in families at high risk for Hodgkin lymphoma: identification of a predisposing mutation in the KDR gene Melissa Rotunno, 1 Mary L. McMaster, 1 Joseph Boland, 2 Sara Bass, 2 Xijun Zhang, 2 Laurie Burdett, 2 Belynda Hicks, 2 Sarangan Ravichandran, 3 Brian T. Luke, 3 Meredith Yeager, 2 Laura Fontaine, 4 Paula L. Hyland, 1 Alisa M. Goldstein, 1 NCI DCEG Cancer Sequencing Working Group, NCI DCEG Cancer Genomics Research Laboratory, Stephen J. Chanock, 5 Neil E. Caporaso, 1 Margaret A. Tucker, 6 and Lynn R. Goldin 1 1Genetic Epidemiology Branch, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 2Cancer Genomics Research Laboratory, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 3Ad - vanced Biomedical Computing Center, Leidos Biomedical Research Inc.; Frederick National Laboratory for Cancer Research, Frederick, MD; 4Westat, Inc., Rockville MD; 5Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; and 6Human Genetics Program, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD, USA ©2016 Ferrata Storti Foundation. This is an open-access paper. doi:10.3324/haematol.2015.135475 Received: August 19, 2015. Accepted: January 7, 2016. Pre-published: June 13, 2016. Correspondence: [email protected] Supplemental Author Information: NCI DCEG Cancer Sequencing Working Group: Mark H. Greene, Allan Hildesheim, Nan Hu, Maria Theresa Landi, Jennifer Loud, Phuong Mai, Lisa Mirabello, Lindsay Morton, Dilys Parry, Anand Pathak, Douglas R. Stewart, Philip R. Taylor, Geoffrey S. Tobias, Xiaohong R. Yang, Guoqin Yu NCI DCEG Cancer Genomics Research Laboratory: Salma Chowdhury, Michael Cullen, Casey Dagnall, Herbert Higson, Amy A.
    [Show full text]
  • Identification of Key Pathways and Genes in Dementia Via Integrated Bioinformatics Analysis
    bioRxiv preprint doi: https://doi.org/10.1101/2021.04.18.440371; this version posted July 19, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Identification of Key Pathways and Genes in Dementia via Integrated Bioinformatics Analysis Basavaraj Vastrad1, Chanabasayya Vastrad*2 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karnataka, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2021.04.18.440371; this version posted July 19, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract To provide a better understanding of dementia at the molecular level, this study aimed to identify the genes and key pathways associated with dementia by using integrated bioinformatics analysis. Based on the expression profiling by high throughput sequencing dataset GSE153960 derived from the Gene Expression Omnibus (GEO), the differentially expressed genes (DEGs) between patients with dementia and healthy controls were identified. With DEGs, we performed a series of functional enrichment analyses. Then, a protein–protein interaction (PPI) network, modules, miRNA-hub gene regulatory network and TF-hub gene regulatory network was constructed, analyzed and visualized, with which the hub genes miRNAs and TFs nodes were screened out. Finally, validation of hub genes was performed by using receiver operating characteristic curve (ROC) analysis.
    [Show full text]
  • Genetic Variability in a Holstein Population Using SNP Markers and Their Use for Monitoring Mating Strategies
    https://doi.org/10.22319/rmcp.v10i3.4842 Article Genetic variability in a Holstein population using SNP markers and their use for monitoring mating strategies Kathy Scienski a,b,c Angelo Ialacci c Alessandro Bagnato c Davide Reginelli d Marina Durán-Aguilar e Maria Giuseppina Strillacci c* a Texas A&M University, College Station. Interdisciplinary Program in Genetics. Texas, USA. b Texas A&M University. Department of Animal Science, Texas, USA. c Università degli Studi di Milano. Department of Veterinary Medicine, Via Trentacoste 2, 20134 Milano, Italy. d Università degli Studi di Milano. Azienda Agraria Didattico Sperimentale Angelo Menozzi, Landriano, Pavia, Italy. e Universidad Autónoma de Querétaro. Facultad de Ciencias Naturales. Querétaro. México. * Corresponding author: [email protected] Abstract: As genotyping costs continue to decrease, the demand for genotyping has increased among farmers. In most livestock herds, an important issue is controlling the increase in inbreeding coefficient. While this remains a large motive to genotype, producers are often unaware of the other benefits that genotyping could bring. The aim of this study was to demonstrate that SNP chips could be used as an effective herd management tool by utilizing a population of Italian Holstein-Friesian cattle. After filtering, the total number 643 Rev Mex Cienc Pecu 2019;10(3):643-663 of animals and SNPs retained for analyses were 44 and 27,365, respectively. The principal component analyses (PCA) were able to identify a sire and origin-of-sire effect within the herd, while determining that sires do not influence individual genomic selection index values. The inbreeding coefficients calculated from genotypes (FIS) provided a glimpse into the herd’s heterozygosity and determined that the genetic variability is being well maintained.
    [Show full text]
  • Mouse Sptbn5 Conditional Knockout Project (CRISPR/Cas9)
    https://www.alphaknockout.com Mouse Sptbn5 Conditional Knockout Project (CRISPR/Cas9) Objective: To create a Sptbn5 conditional knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Sptbn5 gene (NCBI Reference Sequence: NM_001370938 ; Ensembl: ENSMUSG00000074899 ) is located on Mouse chromosome 2. 66 exons are identified, with the ATG start codon in exon 1 and the TAA stop codon in exon 66 (Transcript: ENSMUST00000156159). Exon 15~17 will be selected as conditional knockout region (cKO region). Deletion of this region should result in the loss of function of the Mouse Sptbn5 gene. To engineer the targeting vector, homologous arms and cKO region will be generated by PCR using BAC clone RP23-250P21 as template. Cas9, gRNA and targeting vector will be co-injected into fertilized eggs for cKO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Exon 15 starts from about 25.37% of the coding region. The knockout of Exon 15~17 will result in frameshift of the gene. The size of intron 14 for 5'-loxP site insertion: 1113 bp, and the size of intron 17 for 3'-loxP site insertion: 923 bp. The size of effective cKO region: ~1526 bp. The cKO region does not have any other known gene. Page 1 of 7 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 13 14 15 16 17 18 19 66 Targeting vector Targeted allele Constitutive KO allele (After Cre recombination) Legends Exon of mouse Sptbn5 Homology arm cKO region loxP site Page 2 of 7 https://www.alphaknockout.com Overview of the Dot Plot Window size: 10 bp Forward Reverse Complement Sequence 12 Note: The sequence of homologous arms and cKO region is aligned with itself to determine if there are tandem repeats.
    [Show full text]
  • Figure S1. Basic Information of RNA-Seq Results. (A) Bar Plot of Reads Component for Each Sample
    Figure S1. Basic information of RNA-seq results. (A) Bar plot of reads component for each sample. (B) Dot plot shows the principal component analysis (PCA) of each sample. (C) Venn diagram of DEGs for three time points, the overlap part of the circles represents common differentially expressed genes between combinations. Figure S2. Scatter plot of DEGs for each time point. The X and Y axes represent the logarithmic value of gene expression. Red represents up-regulated DEG, blue represents down-regulated DEG, and gray represents non-DEG. Table S1. Primers used for quantitative real-time PCR analysis of DEGs. Gene Primer Sequence Forward 5’-CTACGAGTGGATGGTCAAGAGC-3’ FOXO1 Reverse 5’-CCAGTTCCTTCATTCTGCACACG-3’ Forward 5’-GACGTCCGGCATCAGAGAAA-3’ IRS2 Reverse 5’-TCCACGGCTAATCGTCACAG-3’ Forward 5’-CACAACCAGGACCTCACACC-3’ IRS1 Reverse 5’-CTTGGCACGATAGAGAGCGT-3’ Forward 5’-AGGATACCACTCCCAACAGACCT-3’ IL6 Reverse 5’-CAAGTGCATCATCGTTGTTCATAC-3’ Forward 5’-TCACGTTGTACGCAGCTACC-3’ CCL5 Reverse 5’-CAGTCCTCTTACAGCCTTTGG-3’ Forward 5’-CTGTGCAGCCGCAGTGCCTACC-3’ BMP7 Reverse 5’-ATCCCTCCCCACCCCACCATCT-3’ Forward 5’-CTCTCCCCCTCGACTTCTGA-3’ BCL2 Reverse 5’-AGTCACGCGGAACACTTGAT-3’ Forward 5’-CTGTCGAACACAGTGGTACCTG-3’ FGF7 Reverse 5’-CCAACTGCCACTGTCCTGATTTC-3’ Forward 5’-GGGAGCCAAAAGGGTCATCA-3’ GAPDH Reverse 5’-CGTGGACTGTGGTCATGAGT-3’ Supplementary material: Differentially expressed genes log2(SADS-CoV_12h/ Qvalue (SADS-CoV _12h/ Gene Symbol Control_12h) Control_12h) PTGER4 -1.03693 6.79E-04 TMEM72 -3.08132 3.66E-04 IFIT2 -1.02918 2.11E-07 FRAT2 -1.09282 4.66E-05
    [Show full text]
  • Αii-Spectrin and Βii-Spectrin Do Not Affect Tgfβ1-Induced Myofibroblast Differentiation
    Cell and Tissue Research https://doi.org/10.1007/s00441-018-2842-x REGULAR ARTICLE αII-spectrin and βII-spectrin do not affect TGFβ1-induced myofibroblast differentiation Bram Piersma1 & Olaf Y. Wouters1 & Ruud A. Bank1 Received: 16 May 2017 /Accepted: 10 April 2018 # The Author(s) 2018 Abstract Mechanosensing of fibroblasts plays a key role in the development of fibrosis. So far, no effective treatments are available to treat this devastating disorder. Spectrins regulate cell morphology and are potential mechanosensors in a variety of non-erythroid cells, but little is known about the role of spectrins in fibroblasts. We investigate whether αII- and βII-spectrin are required for the phenotypic properties of adult human dermal (myo)fibroblasts. Knockdown of αII- or βII-spectrin in fibroblasts did not affect cell adhesion, cell size and YAP nuclear/cytosolic localization. We further investigated whether αII- and βII-spectrin play a role in the phenotypical switch from fibroblasts to myofibroblasts under the influence of the pro-fibrotic cytokine TGFβ1. Knockdown of spectrins did not affect myofibroblast formation, nor did we observe changes in the organization of αSMA stress fibers. Focal adhesion assembly was unaffected by spectrin deficiency, as was collagen type I mRNA expression and protein deposition. Wound closure was unaffected as well, showing that important functional properties of myofibroblasts are unchanged without αII- or βII-spectrin. In fact, fibroblasts stimulated with TGFβ1 demonstrated significantly lower endogenous mRNA levels of αII- and βII-spectrin. Taken together, despite the diverse roles of spectrins in a variety of other cells, αII- and βII-spectrin do not regulate cell adhesion, cell size and YAP localization in human dermal fibroblasts and are not required for the dermal myofibroblast phenotypical switch.
    [Show full text]