Role of Ancient Ubiquitous Protein 1 in Hepatic Apob Degradation and VLDL Production

Role of Ancient Ubiquitous Protein 1 in Hepatic ApoB Degradation and VLDL production

Mostafa Zamani

A thesis submitted in conformity with the requirements for the degree of Master of Science

Department of Biochemistry University of Toronto

Role of Ancient Ubiquitous Protein 1 in Hepatic ApoB Degradation and VLDL production

Mostafa Zamani

Master of Science

Department of Biochemistry University of Toronto

2016

Abstract

Apolipoprotein B-100 (apoB100) is the main structural protein of atherogenic lipoproteins and is a key risk factor for development of coronary heart disease. The molecular mechanisms that regulate apoB100 degradation or secretion are not clearly understood but evidence supports intracellular lipid supply as a major decisive factor. Ancient Ubiquitous Protein 1 (AUP1) has been found to be present on the surface of Lipid Droplets (LDs), and has been implicated in ER-Associated Degradation. AUP1 knockdown dramatically increased levels of cellular apoB100 and facilitated secretion of apoB100 containing VLDL-sized particles from HepG2 cells. Knocking down AUP1 also increased Triglyceride (TG) levels in apoB100 containing VLDL particles. AUP1 was found to interact with apoB100 intracellularly based on co-immunoprecipitation experiments as well as in situ proximity ligation assay. Finally, modulating AUP-1 altered LD size in HepG2 cells and its knockdown increased the average size of LDs.

Acknowledgments

I would like to thank my family, especially my beautiful mom. I thank Dr. Khosrow Adeli for his generous support and guidance and the members of my thesis advisory committee. I also thank Rianna Zhang, our lab technician, for helping and teaching me how to do different experiments. And I appreciate my lab mates for making everything more enjoyable, especially Mark Naples, Sarah Farr and Jennifer Taher.

iii

Table of Contents

Acknowledgments ...... iii

Table of Contents ...... iv

List of Tables ...... vi

List of Abbreviations ...... ix

Introduction ...... 1 1. Overview of lipid metabolism ...... 1 1.1. Exogenous lipid pathway ...... 1 1.2. Endogenous lipid pathway ...... 2 1.3. Reverse Cholesterol Transport ...... 2 1.4. Lipoproteins ...... 2 1.5. Apolipoprotein B-100 ...... 4 1.6. Lipid Droplets (LDs) ...... 5 1.7. Regulation of ApoB100 and VLDL assembly ...... 7 1.7.1. Regulation of ApoB100 expression and translation ...... 7 1.7.2. Co-translation regulation of apoB100 ...... 7 1.7.6. Crosstalk between the ERAD and post-ER quality control pathways ...... 15 1.8. Ancient ubiquitous protein 1 ...... 17 1.9. Rationale of the study ...... 18 1.10. Objectives of the study ...... 19

Material and Methods ...... 20 2.1. Cell Culture ...... 20 2.2. Treatment ...... 20 2.3. siRNA Transfection ...... 20 2.4. In situ Proximity Ligation Assay (PLA) ...... 21 2.5. RNA Extraction and Reverse transcription polymerase chain reaction (RT-PCR) ...... 21 2.6. Immunoblotting ...... 22 2.7. Crosslinking and Co-immunoprecipitation (Co-IP) ...... 23 2.8. Metabolic Labeling, Ultracentrifugation and Fractionation ...... 23 2.9. Triglyceride Labeling, Lipid Extraction and Thin Layer Chromatography (TLC) ...... 24 2.10. Immunofluorescent Staining and Confocal Microscopy ...... 25 iv

2.11. Lipid Droplet Fluorescent Staining and Confocal Microscopy ...... 25

Results ...... 27 3.1. Endogenous AUP1 physically interacts with apoB100 in HepG2 cells and controls its degradation ...... 27 3.1.1. Inhibition of proteasome in HepG2 cells decreases apoB100 degradation and promotes cellular apoB100 accumulation ...... 27 3.1.2. AUP1 interaction with apoB100 in HepG2 cells ...... 29 3.2. Co-Immunoprecipitation experiments ...... 30 3.3. Knockdown of AUP1 decreased ubiquitination level of apoB in HepG2 cells...... 31 3.3.1. AUP1 knockdown in HepG2 cells ...... 31 3.3.2. AUP1 and ubiquitination ...... 32 3.4. Knockdown of AUP1 increased both accumulated cellular apoB and secreted apoB in HepG2 cells...... 33 3.5. Knockdown of AUP1 increased secretion of VLDL-sized apoB100 containing particles…………………………………………………………………………………………………………………………....34 3.6. Knockdown of AUP1 increased metabolically labeled TG in VLDL-sized particles secreted from HepG2 cells with or without MER-ERK inhibition ...... 38 3.7. AUP1 knockdown increased the average size of LDs in HepG2 cells ...... 38

Discussion ...... 42 4.1 AUP1 as an important regulator of apoB degradation in HepG2 cells ...... 43 4.2 AUP1 as an important regulator of VLDL Secretion in HepG2 cells ...... 44 4.3 AUP1 as an important regulator of LD size in HepG2 cells ...... 45 4.4 Future directions and concluding marks ...... 47

References ...... 45

List of Tables

Table 1) Lipoprotein Subclasses ...... 4

Table 2) List of primers ...... 22

List of Figures

Figure 1) Lipoprotein composition ...... 3

Figure 2) Dual role of autophagy in hepatic and lipoprotein metabolism ...... 15

Figure 3) Different domain of AUP1 ...... 18

Figure 4) Schematic representation of the steps involved in labeling, ultracentrifugation and fractionation ...... 24

Figure 5) Effect of MG132 on cellular and media apoB100 in HepG2 cells ...... 28

Figure 6) AUP1 immunostaining of HepG2 cells ...... 29

Figure 7) AUP1 interacts with apoB100 in HepG2 cells ...... 30

Figure 8) AUP1-apoB100 Co-Immunoprecipitation ...... 31

Figure 9) siRNA-mediated knockdown of AUP1 ...... 32

Figure 10) AUP1 knockdown decreases levels of ubiquitinated apoB100 ...... 33

Figure 11) AUP1 knockdown increases levels of cellular apoB...... 34

Figure 12) AUP1 knockdown increased VLDL-sized apoB100-containing lipoprotein particles secreted from HepG2 cells treated with U0124 under lipid rich condition...... 36

Figure 13) AUP1 knockdown increased VLDL-sized apoB100-containing lipoprotein particles secreted from HepG2 cells treated with U0126 under lipid rich condition...... 37

Figure 14) AUP1 increased levels of TG in VLDL-sized lipoprotein particles ...... 39

Figure 15) AUP1 increased the average size of LDs...... 41

Figure 16) A schematic model shows AUP1 involves in VLDL-sized apoB100-containing lipoprotein particle assembly and secretion in HepG2 cells...... 46

vii

viii

List of Abbreviations

3-MA 3-methyladenine

ABCA1 ATP binding cassette transporter A1

ABCG1 ATP binding cassette transporter G1

ADRP adipose differentiation-related protein

ANOVA two-way analysis of variation apoA-I apolipoprotein A-I apoB apolipoprotein B apobec-1 apoB mRNA editing complex-1

ATG autophagy-related

ATGL adipose triglyceride lipase

BODIPY boron-dipyrromethene

BSA bovine serum albumin

CE cholesterol ester

CEH cholesterol ester hydrolase

CETP cholesteryl ester transfer protein

CM chylomicron

DAPI 4',6-diamidino-2-phenylindole

DGAT-2 diacylglycerol acyltransferase-2

DHA docosahexaenoic acid

DMEM Dulbecco’s Modified Eagle Medium

DMSO dimethyl sulfoxide

EDTA ethylenediaminetetraacetic acid

EGTA ethylene glycol tetraacetic acid

ERAD ER-associated degradation

FA fatty acid

FFAs free fatty acids

HCL hydrochloric acid

HDL high-density-lipoprotein

HRP horseradish peroxidase

IDL intermediate-density-lipoprotein

LAL lysosomal acid lipase FBS fetal bovine serum

LCAT lecithin-cholesterol acyltransferase

LDL low-density-lipoprotein

LDL-C LDL-cholesterol

LDL-R LDL-receptor

LDs cytoplasmic lipid droplets

LPL lipoprotein lipase

McA McArdle-RH7777

MCDM methionine and choline-deficient medium mTOR mammalian target of rapamycin

MTP microsomal triglyceride transfer protein

NaCl sodium chloride

NC negative control

OA oleic acid

PBS phosphate buffer saline

PCSK9 proprotein convertase subtilisin/kexin type 9

PDI protein disulphide isomerase

PI3-K phosphoinositide-3 kinase

PUFAs polyunsaturated fatty acids

PVDF polyvinylidene fluoride

RTC reverse cholesterol transport

SDS sodium dodecyl sulfate

SDS-PAGE SDS-polyacrylamide gel electrophoresis

SR-BI scavenger receptor class B type 1

SREBP sterol regulatory element-binding protein

TBST Tris-buffered saline with tween

TEMED N,N,N’,N’,-tetramethylethylenediamine

TG triglyceride

TGH triglyceride hydrolase

TIP47 tail-interacting protein of 47 kDa

Tris tris(hydroxymethyl)aminomethane

VLDL very-low-density-lipoprotein

Introduction

1. Overview of lipid metabolism

Upon consumption of a meal, dietary fats and lipids are absorbed by our intestine and are eventually released into our bloodstream. Fats and lipid are insoluble in the blood stream, and therefore, the body packages them with specific complexes called lipoproteins. Lipoproteins are made of lipids and amphipathic proteins called apolipoproteins, hence the name. The process by which the body absorbs and uses exogenous lipids is called the exogenous lipid pathway and the intestine is the main organism involved, however, liver is the main organism in control of the body’s endogenous lipid metabolism. During fasting states, liver is responsible for providing peripheral organs with cholesterol and fatty acids via synthesis and export triacylglycerol (TG)-rich and cholesterol-rich particles, called lipoproteins. These two main lipid pathways are described in more detail below.

1.1. Exogenous lipid pathway

Intestine is the organ involved in the exogenous lipid pathway. Lipoproteins produced by the liver are called chylomicrons. Chylomicrons are the largest lipoproteins, and are mainly composed of TGs. They are released into the lymphatic system by the intestine and eventually they get into the circulation, and provide adipose, skeletal and cardiac muscle tissues with dietary fats. Lipoprotein Lipase (LPL), a soluble enzyme located mainly on the surface of endothelial cells in peripheral tissues, hydrolyzes TGs in chylomicrons (and other types of lipoproteins) and free fatty acids (FFA) which can then be taken up more efficiently into the cells(1). Chylomicron remnants are then cleared from the circulation with the help of specific receptors (LDL receptors) on the liver (2). Delay in clearing these particles from circulation is a major risk factor for the onset of atherosclerotic cardiovascular disease (CVD).

1.2. Endogenous lipid pathway

Very low-density lipoproteins (VLDLs) are produced by the liver in the fasting state, and are secreted directly into the bloodstream. Like chylomicrons, LPL acts on VLDLs to hydrolyze fatty acids and produce a denser lipoprotein, intermediate-density lipoproteins (less TG content), and eventually low-density lipoproteins (LDL). These lipoproteins are then cleared by LDL receptors located on the liver as well. LDL cholesterol is a major risk factor for CVD(3). LDLs have the highest levels of cholesterol among lipoproteins. Cholesterol is the main precursor of many steroid hormones, bile acids, and is essential in cell membrane homeostasis. Many core enzymes in the pathway for cholesterol synthesis are targets of pharmaceutical drugs such as statins. Statins, a successful class of cholesterol-lowering drugs, inhibit hydroxy-3-methyglutaryl coenzyme A (HMG-CoA) reductase, which is the key committed step for cholesterol synthesis (4).

1.3. Reverse Cholesterol Transport

High-density lipoproteins are a special type of lipoprotein, involved in reverse cholesterol transport. In this pathway excess cholesterol is taken up from peripheral tissues by HDL particles and delivered to the liver. Scavenger receptor BI (SR-BI), an HDL receptor, mediates selective uptake of cholesterol from HDLs. HDL particles are synthesized and secreted by our liver and intestine. They circulate in the blood, and attract free cholesterol. HDL also interacts with other lipoproteins; such as VLDLs. Cholesteryl ester transfer protein (CETP) is an enzyme that transfers TG from VLDL to HDL and transfers cholesterol from HDL particles to VLDL particles in exchange (5).

1.4. Lipoproteins

Lipoproteins are composed of a cholesteryl ester and triacylglycerol core surfaced by a monolayer of phospholipids, non-esterified cholesterol and different apolipoproteins. This structure helps lipoproteins to circulate freely in our blood stream. Below (fig.1) I have drawn a simple representation of lipoproteins and their different components. Their lipid to protein ratio and their specific apolipoproteins characterizes different categories of

lipoproteins. Usually, the lower the ratio of proteins, the lower the density of that lipoprotein will be. For example, chylomicrons are considered lowest density lipoproteins and accordingly they have the lowest ratio of proteins to lipids.

Figure 1) Lipoprotein composition Lipoprotein core is composed of non-polar cholesterol esters and triglycerides. They are surfaced by a monolayer of amphipathic lipids, including free cholesterol and phospholipids. They are oriented in a way that the polar groups face the surface of lipoproteins. A number of proteins, called apolipoproteins, are also present and play key structural and functional roles.

However, lipoproteins can also be categorized based on the nature of their apolipoproteins. Lipoproteins have one or more apolipoproteins and in table 1 I have categorized lipoproteins based on this.

Table 1) Lipoprotein Subclasses

Lipoproteins Size (nm) Apolipoproteins Source

Chylomicrons 350 B-48, A-I, A-II, C, E Intestine

VLDL 75 B-100, C, E Liver

IDL 40 B-100, C, E Liver

LDL 20 B-100 Liver

HDL 5 A-I, A-II, C, E Liver and Intestine

1.5. Apolipoprotein B-100

Of particular interest to my studies was Apolipoprotein B-100 (apoB100). ApoB100 is produced by the liver and is the main structural protein of several types of lipoproteins such as VLDLs, IDLs, and LDLs. Lipids (cholesterol and triglycerides) are insoluble in the blood circulation and so they are transported inside complexes called lipoproteins. Abnormal levels of these lipoproteins are a major risk factor in multitude of diseases such as coronary atherosclerosis and dyslipidemia (6-8). The apoB100 gene is constitutively transcribed and translated in hepatocytes and therefore, the major regulatory pathway of this protein is through intracellular degradation (9).

ApoB-100 is a 550-kDa hydrophobic glycoprotein that is synthesized by our hepatocytes (9). Our intestine produces a shorter form of this protein, called apoB-48. ApoB-100, with 4536 amino acids, is one of the largest known proteins (8, 10). Glycosylation, as well as the formation of disulfide bonds, are a necessary step in this

protein’s folding and function. ApoB-100 has a predicted pentapartite structure, with alternating α-helices and β-strand domains. It has an amphipathic nature and therefore can bind lipids and interact with aqueous environment simultaneously (11).

The molecular mechanisms that regulate apoB100 degradation or secretion are not clearly understood but evidence supports sufficient lipid supply as a major decisive factor (6, 12). ApoB100 is a very hydrophobic protein that requires co-translational lipidation to correctly fold and in the absence of adequate lipid supply apoB100 nascent chains misfold and are targeted for degradation. Studies suggest the involvement of endoplasmic reticulum (ER)-associated degradation (ERAD) and the post-ER degradative pathways (13). These pathways will be explained with greater detail in the following pages, however, before that, in order to get a better understanding of how hepatic lipid metabolism is regulated, I will introduce lipid droplets (LDs), cellular storage places for neutral lipids.

1.6. Lipid Droplets (LDs)

LDs are considered as dynamic organelles that store cellular fats and are responsible to make it available to the cell (or body) in times of need. Many researchers have recently turned to studying these organelles, and their importance in various cellular events is now appreciated more than ever. LDs have an interesting structure. LDs are composed of a lipid ester core surfaced by a phospholipid monolayer (14). They are among the most conserved organelles and are found in different organs and cells types (15). However, they are of particular interest in adipocytes and hepatocytes. Adipocytes act as a reservoir for our body’s TG content and usually contain one big LD, easily recognizable as a white sphere, surrounded with smaller LDs (16).

Given that FFA is a major source of cellular energy and, due to their toxicity can’t be freely available inside the cytoplasm, LDs are usually found in close proximity to both mitochondria and perixosomes, which facilitates β-oxidation of FFAs upon their release from LDs (17). Hepatocytes also contain large quantities of LDs, which provide TG for VLDL assembly. Although, hepatocytes contain enzymes for de novo lipid synthesis, most

of the VLDL-associated lipids are indeed derived from cytosolic lipid stores as opposed to newly synthesized TGs (18). Deregulation of LD hydrolysis and accumulation of hepatic LDs have been associated with certain types of diseases such as hepatic steatosis or insulin resistance (19, 20).

Proteomic studies have revealed various LD-associated proteins (21). Perilipin family of proteins was among the first categorized LD-associated proteins (22). Recently Ancient Ubiquitous Protein 1 (AUP1) was also found to be highly present on the surface of LDs (23). AUP1 is an ER-associated protein and is involved in ER-associated degradation (ERAD) of proteins (24). AUP1 will be discussed in much greater detail later. Also, another important factor in the biology of LDs is that different lipases usually associate with LDs in both adipocytes and hepatocytes. TG stored in hepatic LDs can be hydrolyzed in a process called lipolysis (25).

Lipases are enzymes responsible for hydrolyzing LDs. There are different tissue specific lipases, such as adipose tissue glycerol lipase (ATGL), an important lipase highly expressed in white adipose tissue (26) (WAT), with low hepatic expression. Similarly, hormone sensitive lipase (HSL) (27) has low hepatic expression levels but has been shown increase hepatic β-oxidation indicating a role for a network of lipases that can regulate hepatic TG hydrolysis. Unlike ATGL and HSL, triacylglycerol hydrolase (TGH) is a lipase that is highly expressed in the liver and is localized to the ER by an unusual retrieval sequence (28, 29). Presence of Lysosomal acid lipase (LAL) is suggestive of a role for lysosomes in hepatic lipid metabolism(30) as LAL knockout mice have been shown to accumulate hepatic TG and CE in their liver (31), and some additional lysosomal lipases are also involved in hydrolyzing the remnants of TG-rich lipoproteins taken up by receptor-mediated endocytosis. *

* Part of this text is reproduced in the from a review article written by me

1.7. Regulation of ApoB100 and VLDL assembly

1.7.1. Regulation of ApoB100 expression and translation

Located on the short arm of the chromosome 2 in humans, apoB gene spans a 43kbp region (32). The gene is expressed mainly in the liver as well as intestine. This gene produces two different versions of apolipoprotein B, a short version called apoB48 in our intestines and a longer version called apoB100 in our liver. Various mutations in apoB gene have been associated with familial hypobetalipoproteinemia (FHBL) and familial hypercholesterolemia (FHC), which causes defects in absorption and transportation (33) of fats or increased levels of circulating lipoproteins (34), respectively.

ApoB48 has 48 percent length of the full apoB protein, apoB100, hence the name. The process by which apoB-48 is formed is called RNA editing. Apolipoprotein B mRNA editing enzyme, catalytic polypeptide 1 (APOBEC-1) generates a stop codon (UAA) at residue 2153 in the mRNA transcript of apoB gene. APOBEC-1 is only expressed in the intestine (35). However, the apoB gene is transcribed and translated constitutively in both our liver and intestine, and so the regulation of apoB100 is mostly though intracellular degradative pathways (13).

1.7.2. Co-translation regulation of apoB100

Endoplasmic reticulum associated degradation (ERAD) is responsible for targeting misfolded proteins for degradation via the ubiquitin proteasome system. ERAD pathway majorly mediates apoB degradation in HepG2 cells (36). Recent studies by our laboratory and others have shown that apoB associates with many proteins involved in ERAD pathway, mostly molecular chaperones known as Hsps (heat-shock proteins) (37, 38). We have previously shown the important role of BiP, an ER luminal chaperone, in proteasomal targeting and the ER quality control of misfolded apoB (39). These studies suggest that interaction of apoB chains with lipids may reduce BiP-mediated ER retention and facilitate transport of apoB out of the ER.

Alternatively, nascent apoB chains retained by BiP (via interaction at the luminal side of the ER membrane) may then be targeted to the proteasome via interaction with p97, a cytosolic ATPase anchored to the ER membrane (37). Suzuki et al. have shown that lipidated apoB can be dislocated from the ER lumen to the surface of lipid droplets (LDs) (40). These investigators suggest that LDs can also act as sites of proteasomal degradation of lipidated apoB molecules. In addition, Ancient Ubiquitous Protein 1 (AUP1) an ER- associated protein has also been found to be present on the surface of LDs. AUP1 with, 410 amino acids, is highly suggested to be involved in ERAD. The hydrophobic domain near AUP1 N-terminus, called lipid droplet targeting (LDT) domain, is important for its localization to both LDs and ER membranes. Next to this domain is an acyltransferase (AT) domain, with weak acyltransferase activity. At its C-terminus, AUP1 has a G2 binding region (G2BR) and a coupling of ubiquitin conjugation to ERAD (CUE) domain (41). AUP1 binds the E2 ubiquitin conjugase G2 (Ube2g2) via its G2 binding region.

AUP1 co-purifies with gp78 and has been shown to recruit ubiquitin-conjugating enzyme Ubc7 to the surface of LDs (23, 42). This process was recently shown to be involved in ERAD of HMG-CoA reductase and Insig-1 at the LD surface, which suggests a key role for AUP1 in maintenance of cholesterol homeostasis (42). But the potential role of AUP1 in regulating ApoB ERAD is still unknown. A review of ERAD pathway follows this section.

1.7.2.1. An overview of ERAD pathway

ERAD pathway is responsible for degradation of various proteins. Proteasome, a protein-degrading complex, is involved in this process. In late 1980’s, Lippincott-Schwartz et al, showed that TCR (T-Cell Receptor) complex protein can be degraded in a non- lysosomal compartment (43). Another study on a mutant cystic fibrosis conductance regulator (CFTR) signified the importance of a pre-Golgi lysosomal pathway involved in the degradation of ∆F508 mutant, a main mutation responsible for cystic fibrosis disease, studies showed that this mutant is degraded prematurely and therefore do not exist on the surface of epithelial cells of cystic fibrosis patients (44)Using inhibitor studies, it was

shown that degradation of ∆F508 mutant is proteasome dependent (45). Also other studies in yeast, pointed out that the yeast ubiquitin-conjugating enzymes Ubc6p and Ubc7p were involved in the biogenesis and degradation of mutant Sec61p, a central subunit of the ER translocation channel (46). Furthermore it was shown that when not folded correctly, carboxypeptidase Y (CPY*), a protein in the lumen of ER, is also degraded in an Ubc7p-dependent manner. This was an interesting finding, since both of Ubc6p and Ubc7p are localized to the cytoplasmic face of the ER. Ubc6p is an ER- associate membrane protein while Ubc7p is cytoplasmic protein that is recruited to the ER membrane by a protein called Cue1p9. These proved that in order for proteins to be degraded by ERAD, they must be transported back into the cytoplasm, in a process called retrograde transport. These pivotal papers paved the way for further studies to identify components of this degradative pathway, largely known as the ERAD pathway (47).

ERAD is not only responsible for degradation of proteins that are misfolded (ER quality control) but it can also be used as a regulatory mechanism. HMG-CoA reductase (48), an important enzyme for synthesis of Cholesterol is an important example of this. ERAD pathway selectively controls stability of HMG-CoA reductase to control cholesterol homeostasis. When levels of cholesterol is low, HMG-CoA reductase is a stable protein with a long half-life, when however, levels of cholesterol increases, HMG-CoA reductase is degraded rapidly through ER-associated degradation (49). Insig-1 and/or Insig-2 recruits ubiquitin ligases specifically to HMG-CoA reductase in a sterol dependent manner (50, 51)

1.7.2.2. Protein Degradation by the Ubiquitin–Proteasome Pathway

When ubiquitin, a small regulatory protein, is added to a substrate it’s called ubiquitination. Ubiquintated proteins are usually targeted for degradation by the ubiquitin- proteasome pathway. Three different classes of enzymes are involved in ubiquitin addition. The enzymes are ubiquitin-activating enzymes (E1s), ubiquitin-conjugating enzymes (E2s), and ubiquitin ligases (E3s), respectively. E1 forms an ATP dependent thioester linkage with ubiquitin. This is followed by subsequent transfer of ubiquitin protein to E2 by forming an isopeptide bond. E3 then transfers the ubiquitin onto the target

protein. E3 ligases are responsible for specificity of the reactions since they work on specific substrate proteins. One (mono-ubiquitination) or several ubiquitin (poly- ubiquitination) proteins can be added to a protein, specifying different cellular fates. Mono- ubiquitination plays a role in protein localization and cellular trafficking. However, poly- ubiquitination results in targeting a protein for degradation by proteasome.

1.7.2.3. Deubiquitination

Most of biological reactions are reversible. Ubiquitination is also not an exception to this general rule. Deubiquitinating enzymes (DUB), a large class of proteases, are enzymes responsible for removing ubiquitin chains from proteins. There are about hundreds of DUB genes in humans. These genes can be classified into two main categories, cysteine proteases and metalloproteases. A large percentage of DUBs are associated with proteasome. The proteasome, usually called 26s proteasome, generally recognizes substrate through their ubiquitin chains. In an ATP-dependent process, then, the proteins are unfolded and are degraded. However, ubiquitin groups are in large part separated by deubiquitinating enzymes that are associated with proteasome.

1.7.2.5. ApoB100 degradation through ERAD

Since apoB100 stability directly affects hepatic VLDL and LDL production, understanding the details of its metabolism and degradation has always been enthusiastically perused by both academia and industry. Up until groundbreaking research by Sven Olof-Olofsson (52) and other researchers in late 80’s, it was thought that biogenesis of proteins are the most important factor contributing to the levels of a protein cells. It was, however, shown that the turnover of newly synthesized apoB100 is mainly regulated through degradative mechanisms and not transcriptional activity of apoB100 in hepatocytes (53). ApoB100 requires co-translational lipidation to correctly fold and is targeted for degradation through ERAD in the absence of adequate lipid supply. Generally a temporary arrest causes the newly synthesized apoB100 to loop out of ER and be exposed to the cytosol (54). Many proteins interact with apoB100 during its translation. ER chaperons that reside in ER such as Grp78 (aka BiP) increasingly bind

apoB100 in lipid poor conditions (39). ApoB100 also binds proteins involved HRD1 (ERAD-associated E3 ubiquitin-protein ligase) and Derlin-1 (degradation in endoplasmic reticulum protein 1) (39). Our laboratory showed that glucosamine-induced endoplasmic reticulum stress can cause ApoB100 degradation through a Grp78 mediated process (55). Grp78 transcription levels are significantly upregulated under ER stress, which triggers Unfolded Protein Response (UPR) and prolonged apoB-Grp78 binding facilitates ERAD associated degaradation of apoB100 (9). Recently it was shown that overexpression of the ubiquitin ligase gp78 in HepG2 cells can also cause ubiquitination and subsequently degradation of apoB100 (56). Naïve apoB100 chains associate with Sec61 translocon (57), suggesting that retro-translocation of arrested apoB could occur through the translocon itself. Some studies suggest that the 70 KDa N-terminal region of apoB100 may be cleaved within the ER and then secreted out of the cells. This may happen by ER-60, and ER luminal protease (58).

1.7.3. Autophagy

Autophagy is a complex process in which cellular organelles and malformed proteins are targeted to lysosomes. There are three different known types of autophagy, macroautophagy, microautophagy and chaperone-mediated autophagy or CMA (59). Macroautophagy is the process by which a double membrane vesicle, called autophagosome, surround organelles and aggregated proteins and brings them to the lysosomes (60). Autophagy-related proteins (ATGs), main protein components of macroautophagy, are involved in initiation, elongation and fusion of autophagosome with lysosomes (61). Microtubule-associated protein light chain 3 (LC3) is usually used as a marker of autophagy, it is a protein with a 17kDa molecular mass that is found in different cell types. Upon activation of autophagy, LC3 (LC3-I), the cytosolic version of LC3, is attached to phosphatidylethanolamine and forms what is known as LC3-II, which is found on the surface autophagosome membranes (62).

1.7.4. Autophagic degradation of ApoB100 protein

As explained, synthesis of VLDL particles initiates within the ER lumen during translation of apoB100. With the help of microsomal triglyceride transfer protein (MTP), apoB100 is lipidated to form a nascent VLDL particle (63). These nascent particles then further mature by fusing with TG rich particles in the cytoplasm of the cells. In the absence of sufficient lipid supply, apoB100 loops into the cytoplasm and is sent for proteasomal degradation by ERAD (64). However, recent studies indicate that autophagy can also play an important role in degradation of apoB100. Ohsaki et al showed that cytoplasmic lipid droplets (CLDs) are sites where proteasomal and autophagic degradation of apoB100 converge (65).

In addition to this serendipitous finding, they also observed the accumulation of apoB100 around CLDs in Huh7 cells and showed that the accumulation was markedly increased when autophagy was inhibited by 3-MA. Interestingly, there was also an increase in LC3 co-localization with these crescents upon inhibition of the proteasome supporting that CLDs might acts as a site to hold misfolded apoB100 without aggregation for further degradation through autophagy (65). Additional studies have shown that ω-3 polyunsaturated fatty acids (PUFAs) such as eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) results in degradation of apoB100 following ER exit, in a process called post-ER pre-secretory photolytic (PERPP) pathway (66). This degradation is due to increased generation of lipid peroxidation products that results in oxidative damage of nascent VLDL particles and formation of large aggregates by apoB100.

Aggregation was increased upon inhibition of autophagy and decreased upon induction of autophagy. Co-localization of LC3-GFP with apoB100 was increased in McArdle cells in the presence of DHA and these effects were not present after atg7 knockdown, which increased apoB100 recovery from the media (67). To confirm the effects in vivo, mice injected with DHA showed a decrease in VLDL secretion and increased hepatic lipid peroxide (66). Interestingly, basal apoB100 degradation in primary rodent hepatocytes was also shown to be regulated by lipid peroxidation as desferrioxamine (an iron chelator) or vitamin E increased apoB100 recovery (53).

Induction of ER stress caused by glucosamine-treatment is also linked to elimination of apoB100 in an autophagy-dependent manner (68). McArdle-7777 cells treated with glucosamine resulted in a significant increase in apoB100-GFP-LC3 puncta that was reversed by the addition of 3-MA and an elevated endogenous LC3-II conversion.

Interestingly, addition of PBA, a chemical that facilitates protein folding, prevented ER stress-induced apoB100 autophagic degradation; however, it did not inhibit DHA- induced apoB100 autophagy in primary hepatocytes of rats (68). This suggests there are different mechanisms governing apoB-autophagic degradation under ER stress compared to that induced by DHA. Familial hypobetalipoproteinemia (FHBL) is a genetic disease characterized by low levels of plasma LDL-cholesterol and apoB100. A31p was identified as a non-truncating missense ApoB mutation in heterozygous carriers of FHBL, and resulted in a significant decrease in apoB100 secretion when stably expressed in McArdle cells (69).

This mutated protein, to a large part, escaped ER associated degradation and was mostly degraded by autophagy. Interestingly, expressing A31P also decreased endogenous apoB100 recovery. This suggests that in physiological instances autophagic degradation of apoB100 may be an important regulator of VLDL secretion. In fact, apoB100 is under the regulatory control of insulin and recent studies have shown that insulin-dependent apoB100 degradation (IDAD) secretion is regulated by autophagy (70). An insulin dependent reduction in VLDL secretion was inhibited by wortmannin, a PI3-kinase inhibitor, in primary hepatocytes from Apobec- 1-/- mice. From these studies, class II PI3-kinases appeared to be the key enzymes regulating the reduction in VLDL. Interestingly, insulin treatment of primary hepatocytes from Atg5-deficient mice showed no effect on apoB100 recovery, suggesting that autophagy is required for the degradation of apoB100 in insulin-stimulated hepatocytes (67). However conversely, Sparks et al, showed that overexpression of phosphatase and tensin homologue (PTEN) or transfection of a kinase-deficient mutant Vps34 kinase (Class III PI3K) in McArdle cells blocked insulin suppression of apoB100 secretion thereby suggesting a role for Class I and Class III PI3K in the generation of PIP3 and PI3P in IDAD, respectively (71).

Notably, increased PIP3 generation from ER-localized Class I PI3K led to increased interaction of apoB100 with sortilin (71); a sorting protein localized to the Golgi apparatus that targets various ligands to the lysosome (72). Increased hepatic expression of sortilin is linked to a reduction in apoB100 secretion via lysosomal targeting. Sortilin has been shown to bind and facilitate the secretion of proprotein convertase subtilisin/kexin type 9 (PCSK9) in primary hepatocytes of mice. PCSK9 plays an important role in the regulation of LDL-cholesterol levels by binding to and degrading the LDL receptor (LDLR). The affinity of PCSK9 for the LDL receptor (LDLR) increases in a lower pH, unlike LDL, and circulating PCSK9 decreases the number of LDLR by binding and targeting them for degradation in lysosomes causing an increase in LDL cholesterol (73). Sortilin can bind and facilitate PCSK9 secretion in primary hepatocytes from mice (74). Interestingly, PCSK9 overexpression can inhibit apoB100 intracellular degradation via autophagosome/lysosome pathway and result in increased apoB100 secretion in different mice models irrespective of the LDL receptor (75). These data supports the complex role that autophagy plays in regulating VLDL secretion and degradation (Fig. 2).

1.7.5. Lipophagy

Given that roles of different Atgs have been attributed to different stages of autophagy, functional studies led to the discovery of various roles of autophagy in cellular processes. Of particular interest to my thesis, Atg knockdown studies revealed an association between autophagy and lipid metabolism, now known as lipophagy (76). In the initial discovery of lipophagy, autophagy impairment in hepatocytes via Atg5 knockdown resulted in increased TG levels when hepatocytes were challenged with a lipid load, indicating for the first time that autophagy played a critical role in hepatic lipid metabolism. LD and LC3 colocalization indicated a direct association between LDs and autophagosomes and this was confirmed by electron microscopy in which double membrane vesicles were shown to surround LDs. This novel discovery (76) has sparked great interest in studying the contribution of autophagy in hepatic lipid homeostasis.

Figure 2) Dual role of autophagy in hepatic and lipoprotein metabolism A) Autophagy directly targets LDs to mobilize FFAs, which can then be incorporated with apoB100 to form mature VLDL particles for secretion (red arrows). B) Alternatively, autophagy can degrade misfolded apoB100 and pre-mature VLDLs (blue arrows). The mechanisms involving selection of apoB100 containing lipoprotein particles for autophagic degradation is not well understood.

1.7.6. Crosstalk between the ERAD and post-ER quality control pathways

The ubiquitin-proteasome system (UPS) is known to degrade short lived and misfolded ubiquitinated proteins that are small enough to enter the narrow pore of the barrel-shaped proteasome. Autophagy, however, can degrade much larger structures including protein aggregates and damaged organelles (77). There is now emerging

evidence indicating mechanistic links between autophagy and the proteasome (78). Ubiquitination and specific autophagy receptors are thought to be involved in targeting protein aggregates that cannot be degraded by the proteasome to autophagosomes for lysosomal degradation.

Autophagy has also been shown to cooperate with the proteasome pathway when that route is overwhelmed, and to participate in crosstalk with apoptosis. When the proteasome is inhibited or overloaded, there is often compensatory upregulation of autophagy to reduce the burden of ubiquitinated substrates. Blockage of autophagy usually leads to reduce proteasome degradation due to an accumulation of p62 that competes for components of the proteasomal machinery. Different pools of the same protein may undergo degradation by different proteolysis pathways (p62 itself is one example) (79, 80).

Ubiquitination is a mechanism employed by both pathways. K48 ubiquitin chain type (ubiquitination on lysine 48) is the most abundant and serves as the canonical signal for degradation by the proteasome. K63 ubiquitin chain types (ubiquitination on lysine 63) are the signal for degradation by aggresomes and the autophagy pathway (referred to as selective autophagy) (79).

Indeed, available evidence on apoB degradation strongly suggests the involvement and possible coordination of both pathways, however the molecular mechanisms that orchestrate such coordinated degradation at various steps during apoB transit in the secretory pathway are currently unknown. Also recent studies have revealed the additional involvement of autophagy in lipid droplet dynamics and hydrolysis (76). The breakdown of LDs by autophagy was termed “lipophagy”. Following this key discovery, a number of other instances where lipophagy may play a role have been reported including a defect in normal autophagy in the induction of alcohol-induced hepatic steatosis and activation of autophagy and a reduction in LDs during hepatic fibrogenesis.

Thus, autophagy appears to play a critical role in hepatic lipid and lipoprotein metabolism by functioning to turn over cellular LDs, and thereby regulate the amount of

TG stored in the liver, as well as secreted as part of VLDL. This is likely a key mechanism that homeostaticially provides lipid for VLDL assembly. However, how lipophagy is selectively regulated and distributes lipid for VLDL assembly remains unknown.

1.8. Ancient ubiquitous protein 1

Ancient Ubiquitous Protein 1 (AUP1), an ER-associated protein that is also found to be highly present on the surface of LDs is involved in ER-associated degradation of proteins. It is part of a complex called AUP1 was recently shown to be involved in ERAD of HMG-CoA reductase and Insig-1 at the LD surface, which suggests a key role for in maintenance of cholesterol homeostasis (42). But the potential role of AUP1 in regulating VLDL Assembly and Secretion is not yet known. AUP1 localization to both LDs and ER membranes is mainly due to a hydrophobic domain close to its N-terminus, called lipid droplet targeting (LDT) domain (23, 81).

AUP1 also has a predicted acyltransferase domain, a known G2 binding (G2BR) region and a coupling of ubiquitin conjugation to ERAD (CUE) domain at its C-terminus (41). Bioinformatics’ analysis of AUP1 suggests it has a length of 410 amino acids. Also located on the chromosome 2 in humans, AUP1 was first recognized to play an important role in the inside out signaling in platelets. It was shown to bind to cytoplasmic tails of the integrin alpha (IIb) beta (3).

Recently, however, researchers started to study its role on LDs and ERAD. It’s been shown that AUP1, through its G2BR domain, can bind and bring ubiquitin- conjugating enzyme E2 G2 (Ube2g2) to LDs. The CUE domain on the other hand, can bind ubiquitin, which suggest a role for AUP1 as a regulator of ERAD pathway.

Figure 3) Different domain of AUP1

AUP1is present on the ER and LDs. This is due to lipid droplet targeting (LDT) domain. Acyltransferase (AT) domain, has a weak acyltransferase activity. AUP1 has a G2 binding region (G2BR) that binds E2 ubiquitin conjugase G2 (Ube2g2) and a coupling of ubiquitin conjugation to ERAD (CUE) domain that binds ubiquitin (Ub). Adapted from Daniel Lohmann thesis from University of Bohn.

1.9. Rationale of the study

Liver is an important organ in regulating whole body lipid homeostasis. Aberrant hepatic lipid metabolism can lead to many lipid disorders such as hepatic steatosis or

dyslipidemia. Liver is responsible for providing peripheral tissues with cholesterol and fatty acids in the fasting state. Hepatocytes have large quantities of LDs that can provide TG and FFA and help maturation of VLDLs. VLDLs have apoB100 as their structural protein; this protein is co-translationally lipidated and in the absence of adequate lipid is targeted for degradation. Therefore it’s important for hepatocytes to monitor and regulate apoB100 biogenesis and cellular lipid content. For hepatocytes to efficiently do this, they need a protein that can be present both on the machinery that monitors translation and degradation of proteins as well as organelles that provide lipids. AUP1 is such a protein. AUP1 is a ubiquitous protein that is present on the surface of LDs as well as ER. On ER, it can bind proteins, facilitate their ubiquitination and target them to proteasomes for degradation. AUP1 is also present on surface of LDs and can modulate LD clustering. Hence we hypothesized that AUP1 might specifically regulate apoB100 degradation. We also hypothesized that AUP1 may also regulate hepatic lipid content by modulating lipid droplets and the assembly and secretion of VLDL from HepG2 cells. Given that in HepG2 cells apoB100 is mainly degraded through proteasomal pathways, we used this hepatoma cancer cell line as the main model for our studies. However, by inhibiting MEK/ERK pathway in these cell lines, our laboratory developed a more physiologically relevant model to study apoB100 degradation. We utilised both of these models to perform our studies.

1.10. Objectives of the study

The specific question of this thesis were:

1. Does AUP1 regulate apoB100 degradation?

2. Can AUP1 reduce/enhance VLDL secretion?

3. What role does AUP1 play in regulating hepatic cellular lipid content?

4. Is AUP1 involved in hepatic LD clustering?

Material and Methods

2.1. Cell Culture

HepG2 cells were purchased from American Type Culture Collection (ATCC), and were maintained in Alpha Modification of Eagle's Medium (AMEM) (Wisent) containing 10% fetal bovine serum (FBS) and 1% Penicillin-Streptomycin. Cells were split with the ratio of 1:3 twice a week. For all experiments, HepG2 cells were cultured in high glucose Dulbecco's Modified Eagle's Medium (DMEM) (Wisent) containing 10% fetal bovine serum (FBS) only.

2.2. Treatment

Treatment concentrations were chosen based on previously published results and/or after confirmation that the appropriate modulation of LC3 levels could be achieved without causing cytotoxicity. OA (Sigma-Aldrich Canada Ltd., Oakville, ON) was stored in 34 mg aliquots that were dissolved in 500 µL ethanol (Caledon Laboratories, Georgetown, ON) before use. Class III PI3-K inhibitor 3-MA (Sigma-Aldrich Canada Ltd., Oakville, ON) was dissolved in water to make a 6 mg/mL stock solution. mTOR inhibitor Torin 1 (Tocris Bioscience, Bristol, UK) was dissolved in dimethyl sulfoxide (DMSO) (Sigma-Aldrich Canada Ltd., Oakville, ON) to make a 1 mM stock solution, which was diluted to make a 100 µM working solution. Both HepG2 cells 20 and primary hepatocytes were treated with 0.4 mM OA, 100 µM 3-MA, and 250 nM Torin 1. In all cases, media were removed from wells and replaced with fresh 1 mL of appropriate DMEM. Treatment time was 4 hours, except for pulse chase experiments described in Section 2.8.

2.3. siRNA Transfection

Cells were seeded in collagen I coated 6-well plates on Day 1 (0.6 x 10 cells per well in 10% FBS-DMEM). Forward transfection was performed on Day 2 with Lipofectamine® RNAiMAX Reagent (Life Technologies) according to company’s protocol (the final concentration of siRNA was 5 nM). On Day 4, post 48-hour transfection, cells were either lysed for immunoblotting or total RNA extraction. Silencer® Select Negative

Control No. 1 siRNA (NCsi), Silencer® Select Pre-designed siRNA targeting human AUP1 (AUP1si) and Opti-MEM® I Reduced Serum Medium were purchased from Life Technologies.

2.4. In situ Proximity Ligation Assay (PLA)

In situ PLA employed a pair of oligonucleotide labeled secondary antibodies (PLA probes). If two antigens interact with each other, after each antibody binds to its epitope on antigen, with close proximity, two oligonucleotides will be close enough to be able to form a circle under ligation condition. Rolling circle amplification (RCP) is then applied to amplify this circle and the signal will be then visualized as an individual fluorescent red dot. These dots are oligonucleotides that are complementary to the RCP sequence and correspond to a single protein interaction. The Duolink in Situ kit used for our experiment was purchased from Olink Biosciences, Sweden. Anti-human AUP1 (Cell Signaling) and anti-human apoB (mouse monoclonal antibody 1D1) antibodies were diluted in 1:100 and were incubated with cells for overnight. Every step was done according to Duolink in Situ kit's manual. For these experiments, cells were seeded in 8-well slides (ibidi GmbH, Martinsried).

2.5. RNA Extraction and Reverse transcription polymerase chain reaction (RT-PCR)

Total RNA was extracted from cells using RNeasy Plus Mini Kit (QIAGEN). Reverse transcription (RT) was performed with High capacity cDNA Reverse transcription Kit (ABi) using 0.2 µg of total RNA for each sample. 1 µL of 4-fold diluted cDNA was subjected to polymerase chain reaction (PCR) using Maxima Hot Start Tag (Life Technologies). PCR was done with 28 cycles for AUP1, 26 cycles for apolipoprotein C III (apoC3), and 20 cycles for 18s rRNA. RT-PCR products were checked by running on 2% agarose gel. Densitometry was done with AlphaEaseFC (Alpha Innotech). The information of the primers is listed Table 2.

Table 2) List of primers

Human NCBI Primer Sequence (5’ → 3’) Size (bp) Gene Accession

L GGAAGCGAATGAGGAGTTTG AUP1 NM_181575.4 128 R GCAATCTGGGGTGTCTTTGT

L GGCTGCCTGAGACCTCAATA apoC3 NM_000040.1 133 R GTGGGGTAGGAGAGCACTGA

L TAAGTCCCTGCCCTTTGTACACA 18S NR_003286 71 rRNA R GATCCGAGGGCCTCACTAAAC

2.6. Immunoblotting

Samples were separated on SDS-PAGE and transferred to polyvinylidene difluoride (PVDF) membrane (PerkinElmer Life Sciences, Inc.). Blocking was done with 5% milk in 1 x PBST for 4 hours at room temperature, followed by Incubation with primary antibody (1% BSA in 1 x PBST) for overnight at 4 °C. Incubation with secondary antibody (5% milk in 1 x PBST) was performed at room temperature for 1 hour. Western Lightening Plus Enhanced chemiluminescence substrate was purchased from PerkinElmer Life Sciences, Inc. The signal was exposed to HyBlot CL premium autoradiography films (Denville Scientific Inc.). Densitometry was done with AlphaEaseFC (Alpha Innotech). The antibodies were purchased as follows: Anti-human apolipoprotein B and anti-human transferring (Midland BioProducts), anti-human AUP1 (Cell Signaling), anti-p97 (Progen Biotechnik), anti-Ubiquitin (Enzo Life Sciences), anti-β-actin, rabbit anti-goat IgG HRP and Normal goat serum (Sigma-Aldrich), sheep anti-mouse IgG HRP and donkey anti- rabbit IgG HRP (GE Healthcare).

2.7. Crosslinking and Co-immunoprecipitation (Co-IP)

Cells were treated with DMSO or 25µM of MG132 for 2 hours, followed by crosslinking with dithiobis (succinimidyl propionate) (DSP, Thermo Scientific) according to the company’s protocol. Cells were lysed and a set of cell lysate aliquots (each containing 1mg of total protein) was subjected to immunoprecipitation with different antibodies (normal goat serum, anti-human apoB antibody, anti-human transferrin antibody) respectively. The IPed samples were subjected to immunoblotting against human AUP1, apoB, transferrin and p97 separately.

2.8. Metabolic Labeling, Ultracentrifugation and Fractionation

Cells were transfected with 5 nM of NCsi or AUP1si followed by treatments of 5 µM of U0124/U0126 for overnight and 0.4 mM of OA for 4 hours in collagen-coated 6-well plates. Cells were pre-pulsed in Met/Cys-free DMEM (Wisent) containing 10% FBS, 5 µM of U0124/U0126 and 0.4 mM of OA for 1 hour, and followed by pulse with 50µCi/mL of 35S-Met/Cys for 3.5 hours. For each plate, cells were lysed and 5 µL of cell lysate was used for TCA count (Fig. 4a). The media was pooled up (about 6 mL per plate). Media was adjusted to the density of 1.1 g/mL with NaBr. 4 mL of adjusted media was subjected to ultracentrifugation by overlaid with 1.06, 1.02 and 1.006 g/mL NaBr gradients (Fig. 4b). Ultracentrifuged using Beckman Optima LE-80K Ultracentrifuge with SW41 Ti rotor at 37,000 rpm for 18 hours at 12 °C (Fig. 4c), samples were then manually fractionated (980 µL per fraction, 12 fractions per sample) (Fig. 4d). The fractions # 1-2 were VLDL-sized, # 3-5 were LDL-sized, # 6-8 were IDL-sized, and # 9-12 were HDL-sized lipoprotein particles. The fractions were immunoprecipitated against apoB first and apoE second, and then followed by SDS-PAGE (Fig. 4e). The gels were fixed, amplified and dried on filter paper. Expose the gels to HyBlot CL premium autoradiography films (Denville Scientific Inc.) at -80 °C, 1 day for apoB and 5 days for apoE (Fig. 4f). The apoB100 and apoE bands were cut and counted for 35S (Fig. 4g and Fig. 4h). The CPM values were normalized to cell lysate total TCA counts (Fig. 4e).

Figure 4) Schematic representation of the steps involved in labeling, ultracentrifugation and fractionation

2.9. Triglyceride Labeling, Lipid Extraction and Thin Layer Chromatography (TLC)

Cells were transfected with NCsi or AUP1si for 48 hours as described above, and applied 5µM of U0124 or U0126 treatment for overnight. Label the cells in DMEM containing 10% FBS, 6 µCi of 3H-Glycerol / mL, 5µM of U0124 or U0126 and 0.4 mM of OA for 4 hours. The media was subjected to ultracentrifugation and fractionation as described above. VLDL-sized lipoprotein particle fractions and HDL-sized lipoprotein

particle fractions were pooled up separately. Lyse the cells with methanol: H2O (1:1) solution for lipid extraction. Add methanol into the pooled VLDL-sized fractions and HDL- sized fractions with the ratio of methanol: media as 1:1. The cell lysate and media samples were subjected to lipid extraction using NaCl saturated H2O, glacial acetic acid and

CHCI3. Collected and dried chloroform phase containing lipids in glass tubes. Add egg yolk carrier containing lipid standard mixture to dissolve dried lipids, and then run samples on TLC sheet (Millipore) with hexane, diethyl ether and glacial acetic acid mixture. Lipids were visualized on TLC sheet using iodine vapor. Cut TG spots and count for 3H.

2.10. Immunofluorescent Staining and Confocal Microscopy

Cells were seeded in 12-well plates containing collagen I coated coverslips. Cells were transfected with siRNA (some experiment without transfection), followed by different treatments as needed. For immunofluorescent staining, cells were fixed with 4% paraformaldehyde, permeablized with 0.2% Triton X-100 and block with 5% BSA. The primary antibodies (same ones used for immunoblotting) were used at 1:1000 dilutions. Alexa Fluro 488 goat anti-rabbit IgG H+L (Life Technologies), Alexa Fluro 594 donkey anti-goat IgG H+L (Life Technologies) and DAPI (Santacruz Biotechnology Inc.) were used at 1:1000 dilutions. Confocal images were captured with a Quorum spinning disk confocal microscope (Quorum Technologies Inc.). Imaging analysis was performed using Volocity 6.3 software (PerkinElmer).

2.11. Lipid Droplet Fluorescent Staining and Confocal Microscopy

Cells were seeded in 12-well plates containing collagen I coated coverslips. Cells were transfected with siRNA, followed by 5µM of U0124 or U0126 overnight treatment and 0.4mM of OA 4-hour treatment. To stain the total LDs, cells were fixed with 4% paraformaldehyde for 15 minutes at 4 °C, permeabilized with 0.2% saponin for 10 minutes at room temperature, and stained with 2 µg/mL of BODIPY 493/503 (Life Technologies) for 1 hour at room temperature. To stain newly formed LDs, cells were treated with 0.4 mM of OA containing 6 µM of BODIPY 558/568 C12 (Life Technologies) for 4 hours, and then were fixed with 4% paraformaldehyde for 15 minutes at 4 °C and permeablized with

0.2% saponin for 10 minutes at room temperature. The nuclei were stained with 1 µg/mL of DAPI for 10 minutes at room temperature. The coverslips were mounted with Dako fluorescent mounting media (Dako North America Inc.). Confocal images were captured with a Quorum spinning disk confocal microscope (Quorum Technologies Inc.). Imaging analysis was performed using Volocity 6.3 software (PerkinElmer).

Results

3.1. Endogenous AUP1 physically interacts with apoB100 in HepG2 cells and controls its degradation

3.1.1. Inhibition of proteasome in HepG2 cells decreases apoB100 degradation and promotes cellular apoB100 accumulation

As explained earlier proteasomal degradation is a major degradative pathway in HepG2 cells that selectively degrades misfolded or not fully lipidated apoB100. HepG2 cells were starved (methionine/Cysteine free media) and then were pulsed with [35S] methionine/Cysteine for 30 minutes, then cells were washed and the media was changed to normal media and cells were incubated for 2 hours with 25 µM MG132, a proteasomal inhibitor. ApoB from lysates and media was IPed and then ran on SDS slab gels, and the results were visualized using phosphor imaging and measured through ImageJ software by densitometry (Fig. 5). As expected, there was a significant increase in cellular apoB100 in MG132 treated cells. This indicates that proteasomal inhibition decreases degradation of apoB100.

Figure 5) Effect of MG132 on cellular and media apoB100 in HepG2 cells

HepG2 cells were treated with DMSO or 25µM of MG132 for 3 hours. Cells were pre-pulsed for 1 hour, and followed by pulse with 100µCi/mL of 35S-Met/Cys for 3 hours. Total cell lysates were immunoprecipitated against apoB100 first and then followed by SDS-PAGE. The gels were fixed, amplified and dried on filter paper. The dried gels were exposed to phosphorimaging and measured through ImageJ software by densitometry. Relative percentage was showed in the figures. T-test was done for statistic analysis, n = 3, * P < 0.05, # P < 0.01, $ P < 0.001.

Since it’s been shown that AUP1 is involved in mammalian ERAD pathway, and depletion of this protein impairs degradation of misfolded ER proteins, I hypothesized that AUP1 may regulate degradation of apoB in HepG2 cells through the ERAD pathway. I first tried to stain for AUP1 in HepG2 cells treated with 0.4 mM oleate (Fig. 6). AUP1 was ubiquitously present in the cytoplasm of hepG2 cells with concentrated puncta visible.

Figure 6) AUP1 immunostaining of HepG2 cells

Cells were fixed, permeabilized and stained with primary antibody against AUP1, followed by a secondary antibody, and confocal microscopy.

3.1.2. AUP1 interaction with apoB100 in HepG2 cells

To study proximity of endogenous AUP1 protein in HepG2 cells with apoB100 a Proximity Ligation Assay (PLA) was performed. In PLA a pair of oligonucleotide labeled secondary antibodies (PLA probes) generate a signal only when the two PLA probes interact in close proximity. The signal from each detected pair of PLA probes is visualized as an individual fluorescent spot. Red spots indicate direct interaction between AUP1 and ApoB100 (Fig. 7). This experiment confirmed the interaction of endogenous AUP1 with ApoB100. Furthermore, the interaction was more evident in presence of MG132, a proteasome inhibitor, compared to non-treated (NT) samples. This might be due to the fact that apoB is accumulated in the cells under MG132 treatment.

Figure 7) AUP1 interacts with apoB100 in HepG2 cells

HepG2 cells were labeled with two primary antibodies: ApoB (mouse) and AUP1 (rabbit). Protein interactions (red fluorescent signals) were revealed by PLA anti-rabbit minus probe and PLA anti- mouse plus probes. Cells were incubated in the presence or absence of 360M oleic acid and either DMSO or MG132 for three hours. Nuclei were stained with DAPI (blue). Scale bars: 25 µM. n = 3.

3.2. Co-Immunoprecipitation experiments

We further crosslinked proteins together and used co-immunoprecipitation to investigate if we can pull down AUP1 by IP-ing for apoB and vice versa. When cells were treated with MG132, IPed-apoB sample presented specific AUP1 signal. IPed-apoB sample also showed clear p97 band with or without MG132, and p97 signal was slightly stronger in presence of MG132 than the signal in absence of MG132. This was similar to our previous published data in 2009(39). No similar AUP1 and p97 bands were found in IPed- transferrin or IPed-normal goat serum sample (Fig. 8).

DSP MG132 - + IP IP 4,12% 4,12% IP input NGS apoB Trans IP input NGS apoB Trans AUP1

apoB100

Transferrin

p97

Figure 8) AUP1-apoB100 Co-Immunoprecipitation

HepG2 cells were treated with DMSO or 25µM of MG132 for 2 hours, followed by crosslinking with DSP for 30 minutes, and then stopped the reaction using 1M Tris (pH 7.5). Cell lysates containing 1 mg of total protein were subjected to immunoprecipitation for apoB100 followed by immunoblotting for AUP1. (Results obtained with the help of Rianna Zhang, Lab Technician)

3.3. Knockdown of AUP1 decreased ubiquitination level of apoB in HepG2 cells.

3.3.1. AUP1 knockdown in HepG2 cells

To determine if we can specifically knockdown AUP1, HepG2 cells were transfected with 5 nM of either scramble (negative control, NC) siRNA or siRNA against AUP1 for 48 hours. Firstly, we checked the knockdown efficiency. RT-PCR results showed AUP1 was successfully knocked down with a 70% decline in the mRNA level (Fig. 9A) and a 92% decrease at the protein level (Fig. 9B). Although some residual

activity of AUP1 may remain after its reduction by siRNA, the reduction of AUP1 was significant enough to study the effect of its knockdown on various cellular mechanisms.

Figure 9) siRNA-mediated knockdown of AUP1

HepG2 cells were transfected with 5 nM of NCsi or AUP1si for 48 hours. The total RNA was extracted and mRNA level of AUP1 was measured by RT-PCR. 18S rRNA was used for normalization. (B) HepG2 cells were transfected with 5 nM of NCsi or AUP1si for 48 hours. Cell lysate was subjected to immunoblotting. β-actin was measured for normalization (Results obtained with the help of Rianna Zhang, Lab Technician).

3.3.2. AUP1 and ubiquitination

Since AUP1 is known to be involved in ubiquitination of other protein substrates such as HMG CoA reductase, we measured ubiquitination level of apoB in NCsi or

AUP1si transfected HepG2 cells under MG132 treatment or control DMSO. Knockdown of AUP1 increased apoB cellular mass, and this was more observable in cells treated with MG132. In MG132 samples, while cellular mass of apoB was increased by almost more than 5 fold, the amount of ubiquitinated apoB only to apoB mass was decreased compared to cells treated with DMSO (Fig. 10).

3.4. Knockdown of AUP1 increased both accumulated cellular apoB and secreted apoB in HepG2 cells.

Since we found AUP1’s potential involvement in apoB ubiquitination, and other studies have indicated that AUP1 engages in protein ER quality control, we investigated whether knockdown of AUP1 could affect protein level of apoB in HepG2 cells by performing western blotting experiment (Fig. 11). With exogenous OA treatment of HepG2 cells, cellular apoB mass was significantly increased upon knockdown of AUP1. Secreted apoB also showed a trend toward an increase. However, the change was not statistically significant.

Figure 10) AUP1 knockdown decreases levels of ubiquitinated apoB100

HepG2 cells were treated with or without 25 µM of MG132 and apoB in cell lysates were collected by immunoprecipitation with polyclonal antibody to human apoB and protein A Sepharose, as described above. After several washes with PBS, IPed apoB was ran on SDS-PAGE (5%), transferred to nitrocellulose and immunoblotted with monoclonal antibodies to apoB and then ubiquitin, n = 2.

Figure 11) AUP1 knockdown increases levels of cellular apoB. Cell lysates and media from AUPsi and NCsi treated cells were collected and resolved on SDS- PAGE. Depending on the size of the proteins, a different percentage of SDS-PAGE was used. Proteins were transferred onto nitrocellulose membranes and blotted for apoB, beta-actin, and albumin. Data was corrected with beta-actin. T-test was done for statistic analysis, n = 3, * P < 0.05, # P < 0.01, $ P < 0.001.

3.5. Knockdown of AUP1 increased secretion of VLDL-sized apoB100 containing particles

Our previous work had shown that MEK-ERK inhibitor U0126 rescues VLDL assembly allowing for production and secretion of large VLDL-sized apoB100-containing particles (82). To test whether AUP1 played a role in VLDL-sized apoB100-containing particle assembly and secretion in HepG2, we performed metabolic labeling and lipoprotein fractionation in HepG2 cells under different conditions.

We found knockdown of AUP1 significantly increased VLDL1-sized apoB100- containing particles secreted from HepG2 cells without MEK-ERK inhibition (U0124 was used as negative control of U0126) by 400%, while the peak of the control protein (apoE)-

containing particles was not shifted (Fig. 12). The same experiment was performed in U0126 treated HepG2 cells. Similarly, knockdown of AUP1 significantly increased VLDL1- sized and VLDL2-sized apoB100-containing particles by 250% and 100% respectively, while the peak of apoE-containing particles was still not shifted. When we performed the same experiment under all the conditions side by side, we observed that the effects of U0126 and knockdown of AUP1 on VLDL-sized apoB100-containing particle secretion in HepG2 cells were somewhat additive (Fig. 13).

Figure 12) AUP1 knockdown increased VLDL-sized apoB100-containing lipoprotein particles secreted from HepG2 cells treated with U0124 under lipid rich condition.

HepG2 cells were transfected with 5 nM of NCsi or AUP1si for 48 hours, followed by 5 µM of U0124 overnight treatment and 0.4 mM of OA 4-hour treatment. Cells were pre-pulsed for 1 hour, and followed by pulse with 50µCi/mL of 35S-Met/Cys for 3.5 hours. Ultracentrifugation and lipoprotein particle fractionation were performed. The fractions were immunoprecipitated against apoB100 first and apoE second, and then followed by SDS-PAGE. The gels were fixed, amplified and dried on filter paper. The dried gels were exposed to autoradiography films at -80 °C. ApoB100 and apoE bands were cut and counted for 35S. The CPM values were normalized to cell lysate total TCA counts. (Results obtained with the help of Rianna Zhang, Lab Technician) Relative percentage was showed in the figures. T-test was done for statistic analysis, n = 3, * P < 0.05, # P < 0.01, $ P < 0.001.

Figure 13) AUP1 knockdown increased VLDL-sized apoB100-containing lipoprotein particles secreted from HepG2 cells treated with U0126 under lipid rich condition.

HepG2 cells were transfected with 5 nM of NCsi or AUP1si for 48 hours, followed by 5 µM of U0126 overnight treatment and 0.4 mM of OA 4-hour treatment. Cells were pre-pulsed for 1 hour, and followed by pulse with 50µCi/mL of 35S-Met/Cys for 3.5 hours. Ultracentrifugation and lipoprotein particle fractionation were performed. The fractions were immunoprecipitated against apoB first and apoE second, and then followed by SDS-PAGE. The gels were fixed, amplified and dried on filter paper. The dried gels were exposed to autoradiography films at -80 °C. ApoB100 and apoE bands were cut and counted for 35S. The CPM values were normalized to cell lysate total TCA counts. Relative percentage was showed in the figures. (Results obtained with the help of Rianna Zhang, Lab Technician) For all the experiments, unpaired t-test was done for statistic analysis, n = 3, * P < 0.05, # P < 0.01, $ P < 0.001.

3.6. Knockdown of AUP1 increased metabolically labeled TG in VLDL- sized particles secreted from HepG2 cells with or without MER-ERK inhibition

Since VLDL-sized apoB100 containing particles are enriched with TG, we hypothesized that knockdown of AUP1 increased TG content in these large particles. To test our hypothesis, we employed HepG2 cells and metabolically labeled TG using 3H- Glycerol, and then measured labeled TG levels in cell lysate, VLDL-sized portion and HDL-sized portion. We found that under U0124 and lipid rich condition, knockdown of AUP1 significantly increased metabolically labeled TG level both in cell lysate (by 9%) and VLDL-sized portion (by 59%), but did not change the level in HDL-sized portion (Fig. 14A). Very similarly, when MER-ERK pathway was inhibited by U0126 under lipid rich condition, knockdown of AUP1 significantly increased metabolically labeled TG level in VLDL-sized portion (by 108%), but still did not change the level in HDL-sized portion (Fig. 14B).

3.7. AUP1 knockdown increased the average size of LDs in HepG2 cells

It is well known that LDs provide lipids for VLDL-sized apoB100 containing particle assembly. Therefore, we further used BODIPY 493/503 to visualize total LDs in HepG2 cells (Figure 5C). The fluorescence imaging results showed that knockdown of AUP1 significantly increased the average size of LDs both under U0124 treatment (by 89%) and under U0126 treatment (by 76%). Similarly, U0126 significantly increased the average size of LDs for both NCsi transfected HepG2 cells (by 49%) and AUP1si transfected HepG2 cells (by 40%) (Fig. 15). Knockdown of AUP1 or U0126 only showed a trend towards increased number of LDs, but this was not significant (data not shown).

Figure 14) AUP1 increased levels of TG in VLDL-sized lipoprotein particles

Cells were transfected with NCsi or AUP1si for 48 hours, and were treated with 5µM of U0124 (A) or U0126 (B) for overnight. Label the cells in DMEM containing 10% FBS, 6 µCi of 3H- Glycerol / mL, 5µM of U0124 or U0126 and 0.4 mM of OA for 4 hours. The media was subjected to ultracentrifugation and fractionation. VLDL-sized lipoprotein particle fractions and HDL-sized lipoprotein particle fractions were pooled up separately. Lipids were extracted from cell lysate, VLDL-sized lipoprotein particle fractions and HDL-sized lipoprotein particle fractions separately. Lipid samples were separated on TLC sheets, followed by visualization with iodine vapor. TG spots were cut and counted for 3H. (Results obtained with the help of Rianna Zhang, Lab Technician) * P < 0.05, # P < 0.01, $ P < 0.001.

Figure 15) AUP1 increased the average size of LDs. Cells were transfected with NCsi or AUP1si, followed by 5µM of U0124 or U0126 overnight treatment and 0.4mM of OA 4-hour treatment. After fixation and permeabilization, cells were stained with 2 µg/mL of BODIPY 493/503 to visualize the total LDs. Nuclei were stained with DAPI. Confocal images were captured with a Quorum spinning disk confocal microscope. The average size of LDs was analyzed using Volocity 6.3 software. (Results obtained with the help of Rianna Zhang, Lab Technician). Unpaired t-test was done for statistic analysis, n = 6, * P < 0.05, # P < 0.01, $ P < 0.001.

Discussion

Lipid droplets are among the most important regulators of lipid metabolism in hepatocytes and act as dynamic storage places for neutral lipids. Not much is known about how LDs are regulated by LD-associated proteins. ApoB100 is one of the LD- associated proteins and, in the absence of adequate lipids, is degraded by both proteasomal and non-proteasomal pathways. Mature VLDLs are fully lipidated apoB100s that are secretion competent. The mechanisms by which hepatocytes regulate degradation of apoB and its lipidation are still not fully understood. Results of the present study provide evidence for AUP1 as a modulator of apoB100 degradation and VLDL assembly. In fasting states, hepatocytes are responsible for providing peripheral tissues with lipids via secretion VLDL-sized apoB100-containing particles. Assembly and secretion of these particles are complex and need coordination between many cellular pathways and organelles. Interestingly most of the factors involved in these events are not known. Lipid droplets provide lipids via microsomal triglyceride transfer protein (MTP) to apoB for lipidation. It’s been shown that hepatic overexpression of MTP results in increased in vivo secretion of VLDL- TG and -apoB (83). ApoB acts as a vehicle to transport lipids out of the cells and interference in this process may lead to hepatic steatosis and other disorders (84). The amount of VLDL-sized apoB-containing particles secreted from the cells is dependent on the availability of apoB and the amount of lipids (85, 86).

We have previously studied the role of MEK-ERK inhibition in correcting VLDL- sized apoB100-containing particle assembly and secretion in HepG2. This was achieved in parallel with an increase in cellular and microsomal TG mass, and elevations in mRNA levels of DGAT1 and DGAT2 (87). However, the molecular mechanism remains unknown. In recent years, AUP1 has been reported to be involved in quality control of misfolded proteins in the ER and LD clustering (23, 24, 42, 88). In my studies presented in this thesis, I tried to understand the role AUP1 plays in VLDL-sized apoB100-containing particle assembly and secretion in HepG2 cells.

4.1 AUP1 as an important regulator of apoB degradation in HepG2 cells

First, we were interested to see if AUP1 and apoB can interact. We showed this interaction (between AUP1 and apoB) by using a proximity ligation assay (PLA). PLA results visually showed a direct evidence for the interaction. Interestingly the number of red dots, representing each interaction, was increased upon proteasomal inhibition, compared to DMSO control (Fig. 6). This was in support of my earlier experiment, showing levels of cellular apoB are increased in HepG2 cells under MG132 treatment (Fig. 7). Co-IP experiments done by Rianna Zhang, our laboratory technician, also showed that AUP1 could be immunoprecipitated by apoB. Also, similar to my PLA studies, the Co-IP signal was much stronger when proteasome pathway was inhibited by MG132. Since the proteasomal degradation of apoB is very active in HepG2 cells, when not inhibited, it might degrade most of apoB in these cells, and so, those apoB binding to AUP1 might mostly have been already targeted to degradation, and the rest of the apoB pool might have been too low to be detected by Western Blot.

The next step was to investigate if AUP1 is involved in the degradation of apoB in HepG2 cells. When levels of AUP1 were lowered by siRNA knockdown, more apoB was accumulated in cells (Fig. 10, Fig. 11). This might contribute more apoB available for transporting lipids out of cells. AUP1 possesses specific domains that are involved in ubiquitination of proteins, and it was previously shown that knockdown of AUP1 blunted sterol-accelerated ubiquitination of HMG-CoA reductase in SV-589 cells (42). In our experiments, in AUP1 knockdown samples, we saw less ubiquitination of apoB100 in HepG2 cells compared to NCsi samples, suggesting a role for AUP1 in ubiquitination of apoB100. This is an interesting result, since ubiquitination is usually considered a necessary step for proteasomal targeting of proteins, and this might suggest that increased levels of cellular apoB in AUP1 knockdown samples were due to lower levels of ubiquitinated apoB100 and so more apoB100 is available for VLDL-sized particle assembly. Interestingly ubiquitination also regulates VLDL assembly in HepG2 cells, and thus we were also interested to investigate the role of AUP1 in VLDL assembly (38).

4.2 AUP1 as an important regulator of VLDL Secretion in HepG2 cells

Given the importance of AUP1 in apoB ubiquitination, we also hypothesized that AUP1 regulates VLDL assembly and secretion in HepG2 cells. It is important to mention that HepG2 cell only secrete smaller, denser VLDLs. These differ from the large VLDL particles secreted by normal primary hepatocytes (VLDL-1 and VLDL-2). In some of the figures, secreted lipoproteins from HepG2 cells are labelled as VLDLs, LDLs, IDLs, and HDLs. All of these particles are essentially lipoproteins but with different density and are different from similarly named particles in circulation. A significantly higher number of VLDL1-sized apoB100-containing particles were secreted from HepG2 cells upon AUP1 knockdown compared to the control (NSci). This was interesting as knockdown of AUP1 increased VLDL-sized apoB100-containing particle assembly and secretion in HepG2 cells regardless of MEK-ERK inhibition. It is noticeable that there was a somewhat additive effect of knockdown of AUP1 and MEK-ERK inhibitor U0126 on VLDL secretion. Our previous study showed that U0126 rescued VLDL-sized particle assembly and secretion, and in our study reported here suggested that when HepG2 cells were treated with AUP1 siRNA, cells could assemble and secret even more VLDL-sized particles. This might be due to different mechanisms underlying the effects of AUP1si and U0126. Moreover, we found that U0126 treated HepG2 cells only slightly decreased mRNA level of AUP1. This also implied decreased AUP1 mRNA level might play an additive role in the whole mechanism of U0126 effect on VLDL-sized particle assembly and secretion.

Interestingly, more metabolically labeled TG was detected in large VLDL particles secreted from HepG2 cells in presence or absence of MEK-ERK inhibitor. Since the majority of lipids in VLDLs come from LDs, we investigated the availability of cellular lipids. In order to do this, we investigated metabolically labeled TG in HepG2 cells with AUP1 knockdown. As expected, knockdown of AUP1 significantly increased metabolically labeled TG in VLDL-sized particles, but not in HDL-sized particles. When cells were treated with MER-ERK inhibitor negative control U0124, we even detected more metabolically labeled cellular TG, but not under U0126 treatment. This might be due to a

greater effect of MEK-ERK inhibition on VLDL-TG compared to AUP1 knockdown. In other words, only under somewhat basal condition, AUP1si effect on cellular TG could be revealed. The underlying mechanism needs to be investigated in the future by measuring mRNA levels of key genes involved in lipogenesis, and those genes involved in lipolysis. However, the preliminary data shown here indicates that VLDL portion of secreted lipoproteins in HepG2 cells following AUP1 knockdown has a lower density, and therefore lipid (TG) content.

4.3 AUP1 as an important regulator of LD size in HepG2 cells

The average size of LDs was enlarged by knockdown of AUP1 both in presence or absence of MEK-ERK inhibitor U0126. Our results suggested that knockdown of AUP1 changed both apoB and TG availability for VLDL-sized apoB100-containing particle assembly and secretion in HepG2 cells. We used BODIPY 493/503 directly staining all the LDs in the cells. Our results were in contradiction from studies done previously on the role of AUP1 on LD clustering. It was previously shown that AUP1 induces cluster formation (81). In their article, Lohmnan et al. show that a fraction of AUP1 is mono- ubiquitinated at lysine residues and that this process depends on AUP1’s internal CUE domain. AUP1 that is not ubiquitintated do not induce lipid droplet clustering. However, they used a different type of cell line. It is also important to notice that the increase we observed in the average size of LDs could be directly due to cellular TG accumulation.

Figure 16) A schematic model shows AUP1 involves in VLDL-sized apoB100-containing lipoprotein particle assembly and secretion in HepG2 cells.

Here is a schematic depiction of the effect of AUP1 on some aspects of hepatic lipid metabolism. (a) AUP1 interacts with apoB100 both on the surface of LDs and on the ER membrane. (b) AUP1 is involved in ubiquitination of apoB100 in HepG2 cells through E2 conjugase Ube2g2; ubiquitinated apoB is targeted for proteasomal degradation (a, blue arrows). However, knockdown of AUP1 stabilizes apoB100 protein by lowering its ubiquitination probably by blocking the access of Ube2g2 to apoB100 (a, red arrows). (b) Knockdown of AUP1 also increased levels of cellular TG levels in HepG2 cells. (c) Knockdown of AUP1 increased the average size of LDs. Here, the larger lipid droplet shown represents LDs with no AUP1 on their surface (d) Overall, knockdown of AUP1 drives HepG2 cells to assemble and secret more VLDL-sized apoB100-containing lipoprotein particles. The larger VLDL-sized apoB100-containing lipoprotein particles also have higher levels of TG.

4.4 Future directions and concluding marks

Experiments in this thesis have suggested a role for AUP1 in regulating hepatic lipid metabolism but no single thesis can provide a complete view, and so answers to many questions have been left behind. Lipid droplets are believed to form at the ER membrane and increase in size by fusion (89). Recent proteomic studies suggest that LD- associated proteins have extensive functional properties such as cellular signaling, protein degradation and membrane trafﬁcking (90). Adipose differentiation related protein (ADRP), a LD associated protein, knockout in Lep (ob/ob) mice was shown to increase VLDL secretion and decrease hepatic TG (91). ADRP knockout also improved glucose tolerance and insulin sensitivity in liver and muscle while no change on lipogenic gene expression was observed (91). Furthermore, Bell, M. et al reported that double knockdown of TIP47 and ADRP increased LD size, decreased LD number and produced insulin resistance in AML12 mouse liver cells (92). Interestingly absence of ADRP has been shown to protect mice from hepatic ER stress (93)Another LD-associate protein, Cideb, localizes to both ER and LDs, and has two domains to bind apoB and localize to LDs respectively. These two domains are both required for Cideb promoting TG-enriched VLDL-sized lipoprotein particle assembly and secretion (94) These findings suggest a close connection between ER and cytoplasmic LDs and that some LD associated proteins can majorly regulate hepatic VLDL assembly and secretion.

HepG2 cells have a dominantly active proteasomal pathway. During previous years our lab have developed a more physiologically relevant HepG2 model cell with less active ERAD. This model can effectively be used to study various aspects of apoB100 degradation. When overactive MEK-ERK pathway in these cell lines is inhibited and exogenous OA is provided most of the apoB100 proteins form full VLDL-sized particles and get secreted from these cells, normalizing lipoprotein secretion profile. Therefore,

some of the experiments in this thesis were also done in presence of a MEK-ERK inhibitor. Interestingly, MEK/ERK inhibition by U0126 has also been shown to reduce apoB100 ubiquitination (38). It has also been shown that MEK/ERK pathway cross talks with ERAD and blockage of MEK/ERK pathway in some cell lines can result in blockage of ER stress-mediated GRP78 up-regulation (95, 96).

However, it is important to investigate how much of this effect can be seen in primary cell types and also in vivo. An interesting experiment, therefore, could be to freshly isolate primary hamster hepatocytes and measure their media lipoprotein profile upon treatment with AUP1si. Systematic delivery of siRNA, also, has been shown to be able to lower levels of targeted protein. Therefore, it will be interesting to study systematic lowering of AUP1 through siRNA and further study whether it can postpone or facilitate development of specific lipid disorders such as insulin resistance and hepatic steatosis, as one of the main phenotypes of hepatic steatosis is accumulation of cellular lipid droplets. Aberrant levels AUP1, therefore, might be a contributing factor to hepatic steatosis.

I’ve shown that AUP1 knockdown can increase the average size of LDs in HepG2 cells. However, this is in contrast with some previous publications (81). This can be due to the different cell lines used in their experiments. For our experiment, we used HepG2 cells, a commonly used hepatoma cancer cell line to study hepatic lipid metabolism, however in their experiments, Daniel Lohman et al. (81) used COS7 fibroblasts, they state that their choice is due to the fact that these cell lines show a slight amount of clustering. It is, therefore, important to use other cell lines and also primary hepatocytes, to investigate the effect of AUP1 in LD clustering. Both studies may be true, as there are many proteins with contradictory effects based on the experimental conditions and cell types they are expressed in. It will also be interesting to study factors that might contribute to this paradoxical phenotype. Hepatocytes have a different lipid metabolism from other cell types, given that hepatocytes are the only cell types responsible for the production of VLDL and apoB100. An interesting study, therefore, would be to isolate cytoplasmic LDs by density gradient ultracentrifugation and further study how levels of different LD- associated proteins are altered in different cell lines.

Also, while experiments presented in this thesis have shown that AUP1 is important for apoB degradation, AUP1 can have other roles in the dynamics of apoB100 as well. For example, both AUP1 and apob100 are found on LDs, and so AUP1 can potentially be involved in relocation of apoB100 into LDs. As no single protein acts in isolation, it's important to investigate other proteins that AUP1 can potentially bind to in order to better understand the various roles of this ubiquitous protein. For example, it will be interesting to see if AUP1 effect is through the E2 conjugase Ube2g2. In order to do that, we can knockdown both Ube2g2 and AUP1 or AUP1. Also overexpression studies of AUP1 can be interesting. This should tested in different models, such as McA-RH7777 rat liver cells and primary hepatocytes. Since VLDL-sized apoB100-containing lipoprotein particle can be normally assembled and secreted in these models, we should also investigate whether overexpression of AUP1 can decrease VLDL-sized particle assembly and secretion in these models, and whether this decrease will be dependent on E2 conjugase Ube2g2.

Given that AUP1 knockdown significantly increased levels of cellular TG in HepG2 cells, and also given potential involvement of AUP1 in some cellular signalling pathways (97, 98), it could be interesting to investigate whether AUP1 knockdown can alter expression levels of major genes involved in lipogenesis and lipolysis. For example, a qPCR with a set of specific primers designed for genes involved in lipogenesis and lipolysis can be performed to compare AUP1si treated cells with NCsi treated cells.

This work reported here showed evidence for a role of AUP1 in VLDL-sized particle assembly and secretion via affecting both apoB and lipid biogenesis. This might provide a potential pharmaceutical target aimed at fighting hepatic steatosis. Much more work is needed to elucidate the mechanisms underlying the role of AUP1 in VLDL production and hepatic lipid homeostasis.

References

1. Flier JS, Underhill LH, Eckel RH. Lipoprotein lipase. N Engl J Med. 1989;320(16):1060- 8.

2. Cooper AD. Hepatic uptake of chylomicron remnants. J Lipid Res. 1997 Nov;38(11):2173-92.

3. Chambless LE, Heiss G, Folsom AR, Rosamond W, Szklo M, Sharrett AR, et al. Association of coronary heart disease incidence with carotid arterial wall thickness and major risk factors: the Atherosclerosis Risk in Communities (ARIC) Study, 1987-1993. Am J Epidemiol. 1997 Sep 15;146(6):483-94.

4. Stancu C, Sima A. Statins: mechanism of action and effects. J Cell Mol Med. 2001;5(4):378-87.

5. Lagrost L, Gambert P, Dangremont V, Athias A, Lallemant C. Role of cholesteryl ester transfer protein (CETP) in the HDL conversion process as evidenced by using anti-CETP monoclonal antibodies. J Lipid Res. 1990 Sep;31(9):1569-75.

6. Shelness GS, Ingram MF, Huang XF, DeLozier JA. Apolipoprotein B in the rough endoplasmic reticulum: translation, translocation and the initiation of lipoprotein assembly. J Nutr. 1999;129(2):456S-62S.

7. Segrest JP, Jones MK, Mishra VK, Pierotti V, Young SH, Bor\'en J, et al. Apolipoprotein B-100: conservation of lipid-associating amphipathic secondary structural motifs in nine species of vertebrates. J Lipid Res. 1998;39(1):85-102.

8. Segrest JP, Jones MK, De Loof H, Dashti N. Structure of apolipoprotein B-100 in low density lipoproteins. J Lipid Res. 2001;42(9):1346-67.

9. Rutledge AC, Su Q, Adeli K. Apolipoprotein B100 biogenesis: a complex array of intracellular mechanisms regulating folding, stability, and lipoprotein assembly. Biochemistry and cell biology. 2010;88(2):251-67.

10. Olofsson S, Bor\'en J. Apolipoprotein B secretory regulation by degradation. Arterioscler Thromb Vasc Biol. 2012;32(6):1334-8.

11. Johs A, Hammel M, Waldner I, May RP, Laggner P, Prassl R. Modular structure of solubilized human apolipoprotein B-100 Low resolution model revealed by small angle neutron scattering. J Biol Chem. 2006;281(28):19732-9.

12. Fisher EA, Ginsberg HN. Complexity in the secretory pathway: the assembly and secretion of apolipoprotein B-containing lipoproteins. J Biol Chem. 2002;277(20):17377- 80.

13. Taghibiglou C, Rudy D, Van Iderstine SC, Aiton A, Cavallo D, Cheung R, et al. Intracellular mechanisms regulating apoB-containing lipoprotein assembly and secretion in primary hamster hepatocytes. J Lipid Res. 2000;41(4):499-513.

14. Brown DA. Lipid droplets: proteins floating on a pool of fat. Current Biology. 2001;11(11):R446-9.

15. Martin S, Parton RG. Lipid droplets: a unified view of a dynamic organelle. Nature reviews Molecular cell biology. 2006;7(5):373-8.

16. Brasaemle DL. Thematic review series: adipocyte biology. The perilipin family of structural lipid droplet proteins: stabilization of lipid droplets and control of lipolysis. J Lipid Res. 2007 Dec;48(12):2547-59.

17. Ducharme NA, Bickel PE. Minireview: lipid droplets in lipogenesis and lipolysis. Endocrinology. 2008;149(3):942-9.

18. Gibbons GF, Wiggins D. Intracellular triacylglycerol lipase: its role in the assembly of hepatic very-low-density lipoprotein (VLDL). Adv Enzyme Regul. 1995;35:179-98.

19. Greenberg AS, Coleman RA, Kraemer FB, McManaman JL, Obin MS, Puri V, et al. The role of lipid droplets in metabolic disease in rodents and humans. J Clin Invest. 2011 Jun;121(6):2102-10.

20. Roingeard P, Hourioux C. Hepatitis C virus core protein, lipid droplets and steatosis. J Viral Hepat. 2008;15(3):157-64.

21. Yang L, Ding Y, Chen Y, Zhang S, Huo C, Wang Y, et al. The proteomics of lipid droplets: structure, dynamics, and functions of the organelle conserved from bacteria to humans. J Lipid Res. 2012 Jul;53(7):1245-53.

22. Londos C, Brasaemle DL, Schultz CJ, Segrest JP, Kimmel AR. Perilipins, ADRP, and other proteins that associate with intracellular neutral lipid droplets in animal cells. Seminars in cell & developmental biology; Elsevier; 1999.

23. Spandl J, Lohmann D, Kuerschner L, Moessinger C, Thiele C. Ancient ubiquitous protein 1 (AUP1) localizes to lipid droplets and binds the E2 ubiquitin conjugase G2 (Ube2g2) via its G2 binding region. J Biol Chem. 2011;286(7):5599-606.

24. Klemm EJ, Spooner E, Ploegh HL. Dual role of ancient ubiquitous protein 1 (AUP1) in lipid droplet accumulation and endoplasmic reticulum (ER) protein quality control. J Biol Chem. 2011;286(43):37602-14.

25. Goldberg IJ. Lipoprotein lipase and lipolysis: central roles in lipoprotein metabolism and atherogenesis. J Lipid Res. 1996 Apr;37(4):693-707.

26. Ong KT, Mashek MT, Bu SY, Greenberg AS, Mashek DG. Adipose triglyceride lipase is a major hepatic lipase that regulates triacylglycerol turnover and fatty acid signaling and partitioning. Hepatology. 2011;53(1):116-26.

27. Reid BN, Ables GP, Otlivanchik OA, Schoiswohl G, Zechner R, Blaner WS, et al. Hepatic overexpression of hormone-sensitive lipase and adipose triglyceride lipase promotes fatty acid oxidation, stimulates direct release of free fatty acids, and ameliorates steatosis. J Biol Chem. 2008 May 9;283(19):13087-99.

28. Lehner R, Verger R. Purification and characterization of a porcine liver microsomal triacylglycerol hydrolase. Biochemistry (N Y ). 1997;36(7):1861-8.

29. LEHNER R, CUI Z, Vance D. Subcellullar localization, developmental expression and characterization of a liver triacylglycerol hydrolase. Biochem J. 1999;338:761-8.

30. Rustan AC, Nossen JØ, Tefre T, Drevon CA. Inhibition of very-low-density lipoprotein secretion by chloroquine, verapamil and monensin takes place in the Golgi complex. Biochimica et Biophysica Acta (BBA)-Molecular Cell Research. 1987;930(3):311-9.

31. Du H, Heur M, Duanmu M, Grabowski GA, Hui DY, Witte DP, et al. Lysosomal acid lipase-deficient mice: depletion of white and brown fat, severe hepatosplenomegaly, and shortened life span. J Lipid Res. 2001 Apr;42(4):489-500.

32. Huang LS, Miller DA, Bruns GA, Breslow JL. Mapping of the human APOB gene to chromosome 2p and demonstration of a two-allele restriction fragment length polymorphism. Proc Natl Acad Sci U S A. 1986 Feb;83(3):644-8.

33. Schonfeld G, Lin X, Yue P. Familial hypobetalipoproteinemia: genetics and metabolism. Cellular and molecular life sciences. 2005;62(12):1372-8.

34. Pulai JI, Neuman RJ, Groenewegen AW, Wu J, Schonfeld G. Genetic heterogeneity in familial hypobetalipoproteinemia: Linkage and non‐linkage to the apoB gene in caucasian families. Am J Med Genet. 1998;76(1):79-86.

35. Chester A, Scott J, Anant S, Navaratnam N. RNA editing: cytidine to uridine conversion in apolipoprotein B mRNA. Biochimica et Biophysica Acta (BBA)-Gene Structure and Expression. 2000;1494(1):1-13.

36. Dixon JL, Furukawa S, Ginsberg H. Oleate stimulates secretion of apolipoprotein B- containing lipoproteins from Hep G2 cells by inhibiting early intracellular degradation of apolipoprotein B. J Biol Chem. 1991;266(8):5080-6.

37. Fisher EA, Lapierre LR, Junkins RD, McLeod RS. The AAA-ATPase p97 facilitates degradation of apolipoprotein B by the ubiquitin-proteasome pathway. J Lipid Res. 2008;49(10):2149-60.

38. Fisher EA, Khanna NA, McLeod RS. Ubiquitination regulates the assembly of VLDL in HepG2 cells and is the committing step of the apoB-100 ERAD pathway. J Lipid Res. 2011 Jun;52(6):1170-80.

39. Rutledge AC, Qiu W, Zhang R, Kohen-Avramoglu R, Nemat-Gorgani N, Adeli K. Mechanisms Targeting Apolipoprotein B100 to Proteasomal Degradation Evidence That Degradation Is Initiated by BiP Binding at the N Terminus and the Formation of a p97 Complex at the C Terminus. Arterioscler Thromb Vasc Biol. 2009;29(4):579-85.

40. Suzuki M, Otsuka T, Ohsaki Y, Cheng J, Taniguchi T, Hashimoto H, et al. Derlin-1 and UBXD8 are engaged in dislocation and degradation of lipidated ApoB-100 at lipid droplets. Mol Biol Cell. 2012;23(5):800-10.

41. Stevanovic A, Thiele C. Monotopic topology is required for lipid droplet targeting of ancient ubiquitous protein 1. J Lipid Res. 2013;54(2):503-13.

42. Jo Y, Hartman IZ, DeBose-Boyd RA. Ancient ubiquitous protein-1 mediates sterol- induced ubiquitination of 3-hydroxy-3-methylglutaryl CoA reductase in lipid droplet-- associated endoplasmic reticulum membranes. Mol Biol Cell. 2013;24(3):169-83.

43. Bonifacino JS, Suzuki CK, Lippincott-Schwartz J, Weissman AM, Klausner RD. Pre- Golgi degradation of newly synthesized T-cell antigen receptor chains: intrinsic sensitivity and the role of subunit assembly. J Cell Biol. 1989 Jul;109(1):73-83.

44. Cheng SH, Gregory RJ, Marshall J, Paul S, Souza DW, White GA, et al. Defective intracellular transport and processing of CFTR is the molecular basis of most cystic fibrosis. Cell. 1990;63(4):827-34.

45. Jensen TJ, Loo MA, Pind S, Williams DB, Goldberg AL, Riordan JR. Multiple proteolytic systems, including the proteasome, contribute to CFTR processing. Cell. 1995;83(1):129-35.

46. Sommer T, Jentsch S. A protein translocation defect linked to ubiquitin conjugation at the endoplasmic reticulum. . 1993.

47. Meusser B, Hirsch C, Jarosch E, Sommer T. ERAD: the long road to destruction. Nat Cell Biol. 2005;7(8):766-72.

48. Jo Y, DeBose-Boyd RA. Control of cholesterol synthesis through regulated ER- associated degradation of HMG CoA reductase. Crit Rev Biochem Mol Biol. 2010;45(3):185-98.

49. Nakanishi M, Goldstein JL, Brown MS. Multivalent control of 3-hydroxy-3- methylglutaryl coenzyme A reductase. Mevalonate-derived product inhibits translation of mRNA and accelerates degradation of enzyme. J Biol Chem. 1988 Jun 25;263(18):8929- 37.

50. Tsai YC, Leichner GS, Pearce MM, Wilson GL, Wojcikiewicz RJ, Roitelman J, et al. Differential regulation of HMG-CoA reductase and Insig-1 by enzymes of the ubiquitin- proteasome system. Mol Biol Cell. 2012 Dec;23(23):4484-94.

51. Sever N, Song BL, Yabe D, Goldstein JL, Brown MS, DeBose-Boyd RA. Insig- dependent ubiquitination and degradation of mammalian 3-hydroxy-3-methylglutaryl-CoA reductase stimulated by sterols and geranylgeraniol. J Biol Chem. 2003 Dec 26;278(52):52479-90.

52. Bostrom K, Wettesten M, Boren J, Bondjers G, Wiklund O, Olofsson SO. Pulse-chase studies of the synthesis and intracellular transport of apolipoprotein B-100 in Hep G2 cells. J Biol Chem. 1986 Oct 15;261(29):13800-6.

53. Fisher EA, Pan M, Chen X, Wu X, Wang H, Jamil H, et al. The triple threat to nascent apolipoprotein B Evidence for multiple, distinct degradative pathways. J Biol Chem. 2001;276(30):27855-63.

54. Adeli K, Wettesten M, Asp L, Mohammadi A, Macri J, Olofsson S. Intracellular assembly and degradation of apolipoprotein B-100-containing lipoproteins in digitonin- permeabilized HEP G2 cells. J Biol Chem. 1997;272(8):5031-9.

55. Qiu W, Kohen-Avramoglu R, Mhapsekar S, Tsai J, Austin RC, Adeli K. Glucosamine- induced endoplasmic reticulum stress promotes ApoB100 degradation: evidence for Grp78-mediated targeting to proteasomal degradation. Arterioscler Thromb Vasc Biol. 2005 Mar;25(3):571-7.

56. Liang J, Kim T, Fang S, Yamaguchi J, Weissman AM, Fisher EA, et al. Overexpression of the tumor autocrine motility factor receptor Gp78, a ubiquitin protein ligase, results in increased ubiquitinylation and decreased secretion of apolipoprotein B100 in HepG2 cells. J Biol Chem. 2003;278(26):23984-8.

57. Pariyarath R, Wang H, Aitchison JD, Ginsberg HN, Welch WJ, Johnson AE, et al. Co- translational interactions of apoprotein B with the ribosome and translocon during lipoprotein assembly or targeting to the proteasome. J Biol Chem. 2001 Jan 5;276(1):541- 50.

58. Su Q, Tsai J, Xu E, Qiu W, Bereczki E, Santha M, et al. Apolipoprotein B100 acts as a molecular link between lipid‐induced endoplasmic reticulum stress and hepatic insulin resistance. Hepatology. 2009;50(1):77-84.

59. Klionsky DJ. Autophagy. Current Biology. 2005;15(8):R282-3.

60. Yang Z, Klionsky DJ. Eaten alive: a history of macroautophagy. Nat Cell Biol. 2010;12(9):814-22.

61. Yorimitsu T, Klionsky DJ. Autophagy: molecular machinery for self-eating. Cell Death & Differentiation. 2005;12:1542-52.

62. Klionsky DJ, Abdalla FC, Abeliovich H, Abraham RT, Acevedo-Arozena A, Adeli K, et al. Guidelines for the use and interpretation of assays for monitoring autophagy. Autophagy. 2012;8(4):445-544.

63. Hussain MM, Shi J, Dreizen P. Microsomal triglyceride transfer protein and its role in apoB-lipoprotein assembly. J Lipid Res. 2003;44(1):22-32.

64. Liao W, Chang BH, Mancini M, Chan L. Ubiquitin‐dependent and‐independent proteasomal degradation of apoB associated with endoplasmic reticulum and golgi apparatus, respectively, in HepG2 cells. J Cell Biochem. 2003;89(5):1019-29.

65. Ohsaki Y, Cheng J, Fujita A, Tokumoto T, Fujimoto T. Cytoplasmic lipid droplets are sites of convergence of proteasomal and autophagic degradation of apolipoprotein B. Mol Biol Cell. 2006;17(6):2674-83.

66. Pan M, Cederbaum AI, Zhang Y, Ginsberg HN, Williams KJ, Fisher EA. Lipid peroxidation and oxidant stress regulate hepatic apolipoprotein B degradation and VLDL production. J Clin Invest. 2004;113(9):1277.

67. Andreo U, Guo L, Chirieac DV, Tuyama AC, Montenont E, Brodsky JL, et al. Insulin- stimulated degradation of apolipoprotein B100: roles of class II phosphatidylinositol-3- kinase and autophagy. PloS one. 2013;8(3):e57590.

68. Qiu W, Kohen-Avramoglu R, Mhapsekar S, Tsai J, Austin RC, Adeli K. Glucosamine- Induced Endoplasmic Reticulum Stress Promotes ApoB100 Degradation Evidence for Grp78-Mediated Targeting to Proteasomal Degradation. Arterioscler Thromb Vasc Biol. 2005;25(3):571-7.

69. Zhong S, Magnolo AL, Sundaram M, Zhou H, Yao EF, Di Leo E, et al. Nonsynonymous mutations within APOB in human familial hypobetalipoproteinemia: evidence for feedback inhibition of lipogenesis and postendoplasmic reticulum degradation of apolipoprotein B. J Biol Chem. 2010 Feb 26;285(9):6453-64.

70. Bostr\om K, Boren J, Wettesten M, Sj\oberg A, Bondjers G, Wiklund O, et al. Studies on the assembly of apo B-100-containing lipoproteins in HepG2 cells. J Biol Chem. 1988;263(9):4434-42.

71. Sparks JD, O’Dell C, Chamberlain JM, Sparks CE. Insulin-dependent apolipoprotein B degradation is mediated by autophagy and involves class I and class III phosphatidylinositide 3-kinases. Biochem Biophys Res Commun. 2013;435(4):616-20.

72. Chamberlain JM, O’Dell C, Sparks CE, Sparks JD. Insulin suppression of apolipoprotein B in McArdle RH7777 cells involves increased sortilin 1 interaction and lysosomal targeting. Biochem Biophys Res Commun. 2013;430(1):66-71.

73. Norata GD, Tibolla G, Catapano AL. Targeting PCSK9 for hypercholesterolemia. Annu Rev Pharmacol Toxicol. 2014;54:273-93.

74. Gustafsen C, Kjolby M, Nyegaard M, Mattheisen M, Lundhede J, Buttenschøn H, et al. The hypercholesterolemia-risk gene SORT1 facilitates PCSK9 secretion. Cell metabolism. 2014;19(2):310-8.

75. Sun H, Samarghandi A, Zhang N, Yao Z, Xiong M, Teng BB. Proprotein convertase subtilisin/kexin type 9 interacts with apolipoprotein B and prevents its intracellular degradation, irrespective of the low-density lipoprotein receptor. Arterioscler Thromb Vasc Biol. 2012 Jul;32(7):1585-95.

76. Singh R, Kaushik S, Wang Y, Xiang Y, Novak I, Komatsu M, et al. Autophagy regulates lipid metabolism. Nature. 2009;458(7242):1131-5.

77. Kn\aevelsrud H, Simonsen A. Fighting disease by selective autophagy of aggregate- prone proteins. FEBS Lett. 2010;584(12):2635-45.

78. Driscoll JJ, De Chowdhury R. Molecular crosstalk between the proteasome, aggresomes and autophagy: translational potential and clinical implications. Cancer Lett. 2012;325(2):147-54.

79. Kirkin V, McEwan DG, Novak I, Dikic I. A role for ubiquitin in selective autophagy. Mol Cell. 2009;34(3):259-69.

80. Su M, Mei Y, Sinha S. Role of the Crosstalk between Autophagy and Apoptosis in Cancer. J Oncol. 2013;2013:102735.

81. Lohmann D, Spandl J, Stevanovic A, Schoene M, Philippou-Massier J, Thiele C. Monoubiquitination of ancient ubiquitous protein 1 promotes lipid droplet clustering. PloS one. 2013;8(9).

82. Tsai J, Qiu W, Kohen-Avramoglu R, Adeli K. MEK-ERK inhibition corrects the defect in VLDL assembly in HepG2 cells: potential role of ERK in VLDL-ApoB100 particle assembly. Arterioscler Thromb Vasc Biol. 2007 Jan;27(1):211-8.

83. Tietge UJ, Bakillah A, Maugeais C, Tsukamoto K, Hussain M, Rader DJ. Hepatic overexpression of microsomal triglyceride transfer protein (MTP) results in increased in vivo secretion of VLDL triglycerides and apolipoprotein B. J Lipid Res. 1999 Nov;40(11):2134-9.

84. Cefalu AB, Pirruccello JP, Noto D, Gabriel S, Valenti V, Gupta N, et al. A novel APOB mutation identified by exome sequencing cosegregates with steatosis, liver cancer, and hypocholesterolemia. Arterioscler Thromb Vasc Biol. 2013 Aug;33(8):2021-5.

85. Stillemark-Billton P, Beck C, Boren J, Olofsson SO. Relation of the size and intracellular sorting of apoB to the formation of VLDL 1 and VLDL 2. J Lipid Res. 2005 Jan;46(1):104-14.

86. Hussain MM, Shi J, Dreizen P. Microsomal triglyceride transfer protein and its role in apoB-lipoprotein assembly. J Lipid Res. 2003 Jan;44(1):22-32.

87. Tsai J, Qiu W, Kohen-Avramoglu R, Adeli K. MEK-ERK inhibition corrects the defect in VLDL assembly in HepG2 cells: potential role of ERK in VLDL-ApoB100 particle assembly. Arterioscler Thromb Vasc Biol. 2007 Jan;27(1):211-8.

88. Lohmann D, Spandl J, Stevanovic A, Schoene M, Philippou-Massier J, Thiele C. Monoubiquitination of ancient ubiquitous protein 1 promotes lipid droplet clustering. PloS one. 2013;8(9).

89. Wilfling F, Haas JT, Walther TC, Farese Jr RV. Lipid droplet biogenesis. Curr Opin Cell Biol. 2014;29:39-45.

90. Mashek DG, Khan SA, Sathyanarayan A, Ploeger JM, Franklin MP. Hepatic lipid droplet biology: Getting to the root of fatty liver. Hepatology. 2015.

91. Chang BH, Li L, Saha P, Chan L. Absence of adipose differentiation related protein upregulates hepatic VLDL secretion, relieves hepatosteatosis, and improves whole body insulin resistance in leptin-deficient mice. J Lipid Res. 2010 Aug;51(8):2132-42.

92. Bell M, Wang H, Chen H, McLenithan JC, Gong DW, Yang RZ, et al. Consequences of lipid droplet coat protein downregulation in liver cells: abnormal lipid droplet metabolism and induction of insulin resistance. Diabetes. 2008 Aug;57(8):2037-45.

93. Fuchs CD, Claudel T, Kumari P, Haemmerle G, Pollheimer MJ, Stojakovic T, et al. Absence of adipose triglyceride lipase protects from hepatic endoplasmic reticulum stress in mice. Hepatology. 2012;56(1):270-80.

94. Ye J, Li JZ, Liu Y, Li X, Yang T, Ma X, et al. Cideb, an ER-and lipid droplet-associated protein, mediates VLDL lipidation and maturation by interacting with apolipoprotein B. Cell metabolism. 2009;9(2):177-90.

95. Dai R, Chen R, Li H. Cross-talk between PI3K/Akt and MEK/ERK pathways mediates endoplasmic reticulum stress-induced cell cycle progression and cell death in human hepatocellular carcinoma cells. Int J Oncol. 2009;34(6):1749-57.

96. Zhang LJ, Chen S, Wu P, Hu CS, Thorne RF, Luo CM, et al. Inhibition of MEK blocks GRP78 up-regulation and enhances apoptosis induced by ER stress in gastric cancer cells. Cancer Lett. 2009;274(1):40-6.

97. Kato A, Oshimi K. Ancient ubiquitous protein 1 and Syk link cytoplasmic tails of the integrin α IIb β 3. Platelets. 2009;20(2):105-10.

98. Kato A, Kawamata N, Tamayose K, Egashira M, Miura R, Fujimura T, et al. Ancient ubiquitous protein 1 binds to the conserved membrane-proximal sequence of the cytoplasmic tail of the integrin α subunits that plays a crucial role in the inside-out signaling of αIIbβ3. J Biol Chem. 2002;277(32):28934-41.