Characterization of the Pirna Pathway During Viral Infection in Drosophila Melanogaster Marine Petit

Characterization of the piRNA pathway during viral infection in Drosophila Melanogaster Marine Petit

To cite this version:

Marine Petit. Characterization of the piRNA pathway during viral infection in Drosophila Melanogaster. Virology. Université Pierre et Marie Curie - Paris VI, 2016. English. ￿NNT : 2016PA066258￿. ￿tel-01444696￿

HAL Id: tel-01444696 https://tel.archives-ouvertes.fr/tel-01444696 Submitted on 10 Jul 2017

HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés.

1 Acknowledgements

Quiero agradecer profundamente a la Dra. Maria-Carla SALEH que me abrió las puertas de su laboratorio aun cuando no estaba convencida de ser lo suficientemente buena para la ciencia. Carla, yo se que mi PhD no fue un trabajo fácil para vos pero finalmente, luego de tanto luchar, lo lograste!!! Amo la ciencia, empecé a confiar en mi trabajo y en mi misma y me gustaría continuar (mejor dicho voy a continuar) en este camino. Siempre estaré agradecida por esta oportunidad y aunque se que aun tengo un largo camino por recorrer nunca voy a olvidarme de lo que aprendí con vos. Muchas gracias!!

Vane, no estoy segura de poder tener las palabras adecuadas pero lo voy a intentar!!! Fuiste mi apoyo día a día siempre allí para contestar mis preguntas, mis dudas (que eran muchas!!) y para darme fuerzas, apoyándome durante estos 3 años. Compartimos oficina, algunos mates y muchos recuerdos. Muchísimas gracias por tu dedicación, sos el mejor maestro que pude tener….nunca pierdas tu paciencia que es invalorable!! Y estoy convencida que un día la ciencia de tus sueños, la del cuaderno de laboratorio compartido, la del pensamiento global y colectivo para alcanzar un mismo objetivo va a llegar!!! ;-)

I would like to thank Dr. PERONNET, who presides the jury of my Thesis, and also the rest of members of the jury: Dr. Pelisson, Dr. Imler, Dr. Chambeyron and Dr. Van Rij who kindly accepted to read, correct and discuss my PhD work, which is for me a real honor.

I want to thank also all the members of the VIA laboratory, who shared these years with me. I met lovely people, in a great place. Lorena, thank you for all our talks, for your daily smile and kindness. You are a really nice person, never change. “Vale la pena vivir con intensidad, y te podés caer una, dos, tres, veinte veces, pero recuerda que te podés levantar y volver a empezar. (…) Derrotados son los que dejan de luchar, muertos son los que no luchan por vivir”. José Mujica Juan, I appreciated our long conversations in the fly room, your eternal and repeated questions about French grammar, and your humor. Val, without your patience and your understanding, my survival curve in the lab would have been dramatic. Thanks to you I survived, and I spent great moments at the bench. Herve, I gave you a lot of work, now it is time to thank you for the huge amount of libraries you made for me. Keep your energy and good mood. Lionel, maybe one day the student will exceed the teacher, who knows? Perhaps, that one day, I will start my own Kinder Surprise collection. I would like to thank you for all your work, kind explanations and, above all, for the enormous patience you had with the piRNA project. Yasu, you are the most peaceful person in the lab (which is, actually, not very difficult), it was a pleasure to spend these few months with you. Virginia, I am glad to have met you. I hope you enjoy your time in Paris. Brigitte, you were a precious help in all my administrative tasks, always present reactive and listening. Thanks to you, all my missions were great successes.

2 Margot, Bertsy and Irena, I was sincerely happy to have met you, and I will always keep nice memories from our time together. I would also like to thank all current and former members of the PVP team, for our joint lab meetings, their support, interesting discussions and all the time spent together. I would like to thank Francis Jiggins and his team, for the lovely time I spent in Cambridge University, all the scientific discussions we had and everything I learned over there.

Of course, all these weeks and week-ends spent in Pasteur, would not have been the same without my “pasteurians team”. Thanks to Nina, Celia and Magali, for all our coffee breaks, beers, lunchs, parties etc... You were always there for me, whatever the situation, always supportive and positive. You embellished my time here and you changed me (in a good way). Thanks also to all the people I met in Pasteur and Paris-7 university, Cedric, Elise, Quentin, Benoit, Melissa, Severine, Laure, Cecile…

Je souhaiterais remercier mes baroudeuses, Pachka et Caroline, qui, depuis de nombreuses années sont à mes côtés et avec qui j’ai partagé de nombreux voyages et de nombreuses découvertes. Vous êtes des amours ! Love

Je remercie affectueusement mes parents qui m’ont encouragés, aidés et ce depuis toujours. Finalement, tout ces accomplissements n’auraient pas été possible sans le soutien inconditionnel et sincère de ma famille. Merci à mon frère qui a toujours été présent et compréhensif ! Je tiens également à remercier ma grand-mère, qui a toujours cru en moi et qui est si fière de voir sa petite fille devenir docteur. J’ai eu la chance de faire des études et je compte bien en profiter.

Boris, je sais que ces trois années n’ont pas été une partie de plaisir, mais malgré tout tu restes à mes côtés, tu es ma motivation, mon confident, et je t’en suis grandement reconnaissante. Merci pour ton amour.

« Le courage, c’est d’aimer la vie et de regarder la mort d’un regard tranquille ; c’est d’aller à l’idéal et de comprendre le réel ; c’est d’agir et de se donner aux grandes causes sans savoir quelle récompense réserve à notre effort l’univers profond, ni s’il lui réserve une récompense. Le courage, c’est de chercher la vérité et de la dire ; c’est de ne pas subir la loi du mensonge triomphant qui passe, et de ne pas faire écho, de notre âme, de notre bouche et de nos mains aux applaudissements imbéciles et aux huées fanatiques. » Jean Jaurès, « Discours à la jeunesse », 1903.

3 Abstract

In insects, the small interfering RNA (siRNA) pathway is the major antiviral response. In recent years, the piwi-interacting RNA (piRNA) pathway has been also implicated in antiviral defense in mosquitoes infected with arboviruses. The aim of my thesis was to characterize the involvement of the piRNA pathway in antiviral defense in Drosophila melanogaster. I first showed that following virus infection, the survival and viral titers of Piwi, Aubergine, Argonaute-3, and Zucchini mutant flies were similar to those of wild type flies. Then, by studying an array of viruses that infect the fruit fly acutely or persistently or are vertically transmitted through the germ line, I showed that no viral piRNAs are produced during infection in adult Drosophila melanogaster. Finally, using the next generation sequencing data generated during viral infections, I showed the presence of piRNAs derived from protein coding gene and suggested their potential role in regulating the immune status of the host during viral infection. This work improves the current understanding of the antiviral response in insects. It shows that, in contrast to what was observed in mosquitoes, the piRNA pathway is not directly implicated in antiviral defence in adult Drosphila melanogaster and that viral piRNAs production depends on the biology of the host–virus combination rather than being part of a general antiviral process.

4 Résumé

Chez les insectes, la voie des petits ARNs interférants (siARN) joue un rôle majeur dans la réponse antivirale. Ces dernières années, il a été montré que les petits ARNs interagissant avec les protéines PIWI (piARNs) sont impliqués dans la défense des moustiques face aux infections arbovirales. Le but de mon travail de thèse fut de caractériser l’implication de la voie des piARNs dans la réponse antivirale de la Drosophila melanogaster, utilisée ici comme un organisme modèle. Dans un premier temps, j’ai demontré qu’à la suite d’une infection virale, la survie et le titre viral chez les drosophiles mutées pour les protéines Piwi, Aubergine, Argonaute-3 et Zucchini, ne présente aucune différence avec les données observées pour les drosophiles sauvages. Ensuite, via l’utilisation de virus provoquant une infection aigue, persistante ou se transmettant de manière verticale par les cellules germinales, j’ai montré l’absence de production de piRNAs viraux durant l’infection chez les drosophiles adultes. Finalement, l’utilisation de mes données de séquencage m’a permis d’observer la production de piARNs dérivant d’un gène codant une protéine impliquée dans la réponse antivirale. Suggérant ainsi un rôle hypothétique des piARNs dans la régulation de l’immunité de l’hôte durant l’infection virale. Mes travaux visent à améliorer la compréhension de la réponse immunitaire antivirale chez l’insecte. Je montre que la fonction antivirale de la voie des piRNA dépend plus de la biologie de l’hôte et du virus que de la réponse antivirale en elle-même.

5 TABLE OF CONTENTS

ACKNOWLEDGEMENTS ...... 2

ABSTRACT ...... 4

RESUME ...... 5

LIST OF FIGURES AND TABLES ...... 7

ABBREVIATIONS ...... 8

GENERAL INTRODUCTION ...... 10 THE INSECT’S INVADERS ...... 11 THREATS FROM OUTSIDE ...... 11 THREATS FROM INSIDE ...... 17 SEVERAL DEFENSES, ONE MECHANISM: RNA INTERFERENCE ...... 24 RNA INTERFERENCE PATHWAY ...... 24 RNA INTERFERENCE: PROTECTION AGAINST THE NON-SELF...... 28 INNATE IMMUNITY STRATEGY: THE FLEXIBILITY ...... 30 OUTLINE OF THIS THESIS ...... 31 BIBLIOGRAPHY ...... 32

ON THE IMPORTANCE OF FLY GENETIC BACKGROUND ...... 38 PROTOCOLS OVERVIEW ...... 40 VIRUSES CHECKING AND CLEANING ...... 40 CONTROL OF WOLBACHIA INFECTION IN FLIES ...... 41 THE GENETIC BACKGROUND: INTROGRESSION PROTOCOL ...... 42 THE PIRNA PATHWAY MUTANT FLIES: SELECTION, CHARACTERISTICS AND ROUTINE WORKS...... 45 BIBLIOGRAPHY ...... 51

THE PIRNA PATHWAY IS NOT REQUIRED FOR ANTIVIRAL DEFENSE IN DROSOPHILA MELANOGASTER ...... 53

VIRAL INFECTION, TRANSPOSON EXPRESSION AND PIRNAS ...... 77

DISCUSSION & PERSPECTIVES ...... 91 A DIRECT ROLE OF THE PIRNA PATHWAY IN ANTIVIRAL DEFENSE IN DIPTERA ? ...... 92 INDIRECT ROLE OF THE PIRNA PATHWAY IN ANTIVIRAL DEFENSE IN DROSOPHILA ...... 94 BIBLIOGRAPHY ...... 97

6

List of Figures and Tables

Figure 1. Insect viruses diversity ...... 13 Figure 2. Classification and molecular structure of transposable elements ...... 19 Figure 3. TEs content in insect genomes ...... 20 Figure 4. Consequences of transposable elements mobility on host gene (adpated from Feschotte 2008 (106)) ...... 22 Figure 5. RNA interference pathway in Drosophila melanogaster ...... 27 Figure 6. Experimental design for the backcross protocol ...... 44 Figure 7. Scheme of PIWI subfamily and Zucchini protein domains and the mutations used in this work...... 45 Figure 8. Survival of backcrossed Ago-3, Aub and Zuc mutant flies compared to wild-type and parental strains...... 47 Figure 9. Piwi mutant alleles...... 49 Figure 10. Expression level of the housekeeping gene rp49 ...... 80 Figure 11. Transposon expression following DCV and DAV infection ...... 81 Figure 12. small RNAs covering the Hsp70Aa and Hsp70Ab coding sequence in Drosophila melanogaster ..... 86 Figure 13. small RNAs covering the Hsp cluster in Drosophila melanogaster ...... 88

Table 1. Primers used to detect virus and Wolbachia infection in flies ...... 41 Table 2. piRNA mutants description ...... 46 Table 3. qPCR primers list ...... 80 Table 4. Copy number in the Drosophila melanogaster genome of the 24 transposons used in this study ...... 83

7

Abbreviations

Ago-2 : Argonaute-2 Ago-3 : Argonaute-3 Aub : Aubergine CrPV: Cricket paralysis virus DAV : Drosophila A virus Dcr-1: Dicer-1 Dcr-2: Dicer-2 DCV: Drosophila C virus dpi: day post-infection dsDNA: double-stranded DNA dsRNA: double-stranded RNA DXV: Drosophila X virus endo-siRNA: endogenous small interfering RNA exo-siRNA: exogenous small interfering RNA IIV: Invertebrate Iridescent virus LTR: Long terminal repeats Mbp: Million base pair miRNA: micro-RNA PAMP: Pathogen-associated molecular pattern PCR: Polymerase chain reaction piRNA: piwi-interacting RNA PRR: pattern recognition receptor qPCR: quantitative polymerase chain reaction RdRp: RNA dependent RNA polymerase RISC : RNA interfence silencing complex RNAi: RNA interference RT-PCR: Reverse-transcriptase polymerase chain reaction SINV: Sindbis virus siRNA: small interfering RNA ssDNA: single-stranded DNA ssRNA: single-stranded RNA TEs: Transposable elements

8

TIR: Terminal inverted repeats vsiRNAs: viral small interfering RNA Zuc: Zucchini

9

Chapter 1

General Introduction

10 Chapter 1: General Introduction

Insects represent the most diverse group of animals on earth, with about 1 million identified species (1, 2). They can be found in nearly all environments and are involved in important functions such as pollinators of flowering plants, nutrient recycling through wood degradation, dispersal of fungi and soil turnover. They can also be involved in the control of other animal population size; some vertebrates and even some insects are insectivorous (3). From a human standpoint, insects can act as pests like parasitic lice and bed bugs, vectors of diseases as mosquitoes and flies, and destructors as termites, locusts and weevils (4). As every organism in earth, insects are exposed to different menaces. In the first part of this manuscript I will resume the different threats encountered by insects in nature with special focus on virus threats.

The insect’s invaders

Threats from outside

Dangers

Predation

Insects have a wide variety of predators including birds, reptiles and amphibians. Most born insects do not survive to reproductive age; approximately 50% of their mortality can be attributed to predation (5). Insects have developed a wide range of defense mechanisms to survive predation (6). One of them is chemical defense. Indeed, to keep predators at bay, or to warn their fellow insects, they produce chemical defenses that are secreted and spread easily in the environment (7). Gullan and Cranston (8) divided the chemical defenses in two classes. Class I corresponds to chemicals that irritate, injure, poison or drug predators. In contrast, class II chemical defenses, essentially harmless, stimulate scent and taste receptors to discourage feeding by predators. In addition to these chemical defenses, insects have developed mechanistic defenses such as camouflage that allow them to mimic their environment (color, form…) and hide from predators (9-11). Even if predation is one of the major threats for insects, pathogen infection can also be deleterious for insect populations due to their large impact on insect ecology.

11 Chapter 1: General Introduction

Microbial Diseases

Microorganisms such as bacteria, fungi and viruses can either be detrimental or beneficial for host organisms. Insects, as every other organism, have to face microorganism during their lifetime (12). Insects rely solely on their innate immune system to protect themselves against infectious microbes. Their immune defense system is multilayered; the first line of defense is mechanical while the other layers are related to humoral and cellular response. The most effective mechanical defense is the avoidance of the pathogen agent. When the pathogen enters in contact with the insect, the cuticle, which covers the insect body, prevents the entry of microbes into the body cavity through the epidermis (13). The epithelia of the intestinal and respiratory tracts (trachea) are also lined by chitinous membranes that avert direct contact between cells and microbes. In the gut, which constitutes the main route of infection, the secretion of digestive enzymes, a low pH and the production of reactive oxygen species maintain an environment hostile to microbial survival (14, 15). Once these physical and chemical barriers are breached and the pathogen reaches the hemocoel, its presence triggers a humoral and a cellular response to the infection. This defense is based on the recognition of conserved pathogen-derived molecular motifs, called pathogen-associated molecular patterns (PAMPs), by host-encoded pattern-recognition receptors (PRRs) (16-18). In insects, PAMP recognition by PRRs induces the rapid activation of the Toll, Imd, and Jak/Stat signal-transduction pathways, which lead to both humoral (e.g., secretion of antimicrobial peptides, lysozymes, or other microbe-targeting substances) and cellular (e.g., programmed cell death and autophagy) defense responses (19-23). These pathways were first described in studies of insect host defense against bacteria and fungi and were later shown to function in antiviral defense (24-27). Another evolutionarily conserved defense mechanism against viral infection is active in insects, the RNA interference (RNAi) mechanism (28, 29).

Focus on viral infection

Insects, as all living organisms, are infected by different viruses (Fig. 1). A unique feature of viruses is their need to be inside a host cell to replicate. Restricted by their genome size, many viruses hijack the host cell machinery to complete their replication cycle. The release of new virions allows the infection of new hosts and the survival of the virus. Their genetic material,

12 Chapter 1: General Introduction made from either DNA or RNA, carries genetic information to produce proteins essential for their survival (30).

Reverse-transcribing RNA viruses viruses DNA viruses

Genome replication cycle RNA RNA RNA DNA DNA DNA

Virion (+)RNA dsRNA ssRNA ssDNA dsDNA contents (-)RNA dsDNA Metaviridae Bidnaviridae Bunyaviridae Dicistroviridae Reoviridae Baculoviridae Errantivirus Densovirus Examples Tospovirus DCV Idnoreovirus Alphabaculovirus Parvoviridae La Crosse virus CrPV Birnaviridae Betabaculovirus Hepandensovirus Rhabdoviridae Flaviviridae DXV Polydnaviridae Ambidensovirus Sigma Virus West Nile virus Bracovirus Ephemovirus Dengue virus Ascoviridae Vesiculovirus Togaviridae Ascovirus Orthomyxoviridae Sindbis virus Iridoviridae Thogotovirus Chikungunya Iridovirus (IIV6) Quaranjavirus Picorna-like Nora

Figure 1. Insect viruses diversity Table representing a non-exhaustive list of insect viruses. The classification is based on the virus biology and replication cycle, the different classes correspond to the Baltimore Classification.

DNA viruses

Most DNA viruses replicate in the nucleus of host cells, and share common features with the host such as the transcription mechanism to produce mRNA and viral proteins (31). Baculoviruses are currently the most studied double-stranded DNA (dsDNA) insect viruses, mostly due to their role as biological pesticides in the agriculture field (32). These viruses are also well known for their versatility as gene expression and transduction vectors in mammals (30, 33). Baculoviruses infect different hosts, like mosquito larvae or sawflies but their main hosts are caterpillars from the order Lepidoptera (34). Iridoviruses, another class of dsDNA viruses, are able to infect insects and terrestrial isopods (crustaceans) that inhabit damp and aquatic habitats. Invertebrate iridescent viruses (IIVs) cause the opalescent hues observed in heavily infected hosts (35). The invertebrate iridescent viruses are classed from I to VI, they infect in nature a range of 108 species of invertebrates (36) almost 69% of the insect clade. The most common host is the aquatic stage of Diptera, especially mosquitoes.

13 Chapter 1: General Introduction

Insects can also be infected by single-stranded DNA (ssDNA) viruses from the Parvoviridae family. They can be found in 5 insect orders, and are also able to infect mammals (37, 38). As they are not well described, further studies are needed to characterize their replication cycle in insects and their pathogenesis.

RNA viruses

Up to date, 40 families of RNA viruses have been identified with a broad host range including vertebrates and invertebrates (39). RNA viruses are classified in function of different criteria, such as the nature of their genome, that can be single-stranded or double-stranded (ssRNA or dsRNA) and the polarity of the genome that can be positive- or negative-sense RNA. RNA viruses can also harbor segmented genomes (40). The principal characteristic of RNA viruses is the synthesis of a RNA template from a RNA guide strand, this process is catalyzed by the RNA dependent RNA polymerase enzyme (RdRp) encoded by the virus (41). RdRps from different RNA virus families share multiple conserved sequence motifs. This protein plays a crucial role in viral infection: due to its high error rate induced by the lack of proof reading activity, it increases genome variability and therefore diversity and evolution of virus (42). A large number of RNA viruses can infect the insect clade, 5 families of ssRNA Nodaviridae, Dicistroviridae, Flaviviridae, Iflaviridae, Tetraviridae and one family of dsRNA Reoviridae (Fig. 1) (30). Most viral infections in insects are asymptomatic, which makes insects major vectors for several viruses (see below). Nonetheless some viral infections cause symptomatic and lethal infections in the host. Currently the most studied insect viruses are those that infect insects with an impact in agriculture, such as bees and wasps; in human health such as mosquitoes; in research such as the model insect Drosophila melanogaster.

Arboviruses

Gubler et al. (43) define an arthropod-borne virus (arbovirus) as: “A virus which in nature can infect hematophagous arthropods after ingestion of vertebrate infected blood. It multiplies in arthropod’s tissues and is transmitted by bite to other susceptible vertebrates.” Arboviruses classification as a group is not based on virus phylogeny but on the cycling of the virus between invertebrate and vertebrate hosts. Indeed, arboviruses belong to different virus families such as Bunyaviridae, Flaviridae, Reoviridae and Togaviridae (44).

14 Chapter 1: General Introduction

The mosquito-borne Yellow fever virus and tick-borne Louping i11 virus were the first arboviruses to be discovered in 1901 (45). Today, more than 500 arboviruses have been discovered (46). Some of them are associated with human diseases such as Dengue, Chikungunya, and Zika virus. Moreover arboviruses are zoonotic, meaning that they can cause disease in both animals and humans. For example West-Nile virus and Rift valley fever virus (47, 48) infect birds and animals such as cows, sheeps, goats, respectively. Various factors are responsible for the recent expansion of geographic and host range for arboviruses (reviewed in Bichaud, 2014 (49)) : - Viral adaptation to new host/vector - Influence of commercial transportation and global trading in the spread of the vector and the infected host - Expansion of humans into new ecosystems - Global warming and the impact on the arthropod population (mosquitoes, sandflies, blackflies, ticks, etc) distribution

Viral transmission

The most important step for the dynamics of viral infection is the transmission step from one host to another. Understanding the basis of this mechanism is essential to control disease. Moreover the transmission step will determine the spread and the persistence of the pathogen population. Horizontal transmission is defined as the transmission of a pathogen from one host to another from the same generation. This type of transmission can be further classified in direct or indirect route. Direct route includes air-borne, food-borne and venereal transmission (50, 51), while indirect route involves an intermediate biological host, like a mosquito vector (52, 53). Horizontal transmission of the virus increases the infection prevalence but the efficiency of the transmission route depends of different factors, such as high host population density and high pathogen replication rate (54). Viruses can also be vertically transmitted from the mother to its offspring via transovarial or transovum transmission. Transovarial transmission is the process by which the progeny of infected females is directly infected in the egg stage within the ovary before release (55). In contrast, transovum transmission implies the infection of the egg during the movement in the oviduct (56).

15 Chapter 1: General Introduction

Different studies in mosquitoes have shown that vertical transmission is favored for insect specific viruses compared to arboviruses (57, 58). Vertical transmission of insect viruses is widespread in nature and it is favored by long-term cohabitation between the pathogen and the host (59). As a consequence, vertically transmitted viruses are often less virulent than horizontally transmitted viruses (60).

Insects as virus vector

To constitute an efficient vector, insects need to acquire, maintain and transmit the pathogen. This vectorial capacity (61) is determined by extrinsic factors such as insect lifespan, population density and contact between both host and vector, and by intrinsic factors such as the insect ability to be infected by viruses and ability to transmit the virus to a new host, among others (62). Arbovirus infection in insect vector starts by the ingestion of an infected blood meal, then the virus passes through the midgut to reach the hemocoel and finally reach the salivary gland to be transmitted to a vertebrate host during blood feeding (63). All these steps represent either physical and/or immune barriers, that constitute constrains for the viral population and create a sharp reduction in population. For insect vectors of plant viruses, the situation differs and two ways of transmission have been described: - Mechanical transmission: it does not involve any replication inside the vector - Biological transmission: it implies reproduction inside the vector One can also refer to “circulative” for viruses that are transmitted only if the virus is transported across cell membranes and carried internally within the vector body cavity. The circulative viruses are further divided into two subgroups, propagative viruses, i.e., those that replicate in their arthropod vectors (similar to the arboviruses) and nonpropagative viruses. “Noncirculative” viruses do not cross vector cell membranes and are carried externally on the cuticle lining of the vector’s mouthparts or foregut (52). The molecular and physiological basis for virus-vector interactions that regulate transmission are not well understood. It is however clear that genetic elements within both the virus and the vector ultimately determine if a particular species or individual within a species of arthropod is able to be a vector for a particular virus strain (64). Environmental or abiotic factors also play a role in determining virus-vector interactions, but in general these factors seem to

16 Chapter 1: General Introduction influence the efficiency of the interaction rather than to determine the ability of the interaction to take place (65).

Threats from inside

Predators and pathogens are not the only threats that insects encounter. Genomic elements, called Transposable Elements (TEs), also affect insect populations, and as viruses, they can be deleterious or beneficial for the host genome.

Transposition history

“The history of the earth is recorded in the layers of its crust; the history of all organisms is inscribed in the chromosomes” H. Kihara.

The discovery of transposition

Transposable elements (TEs) or transposons were first call “jumping genes”. They invade genomes via transposition, which is the ability to replicate and spread in the genome as primarily “selfish” genetic units. Transposons and transposition mechanism were first discovered in 1950 in maize by Barbara McClintock (66). Her work showed that genetic factors were able to change their locations within and between chromosomes and therefore control the expression of some genes. Despite the observation of jumping genes by McClintock, the possibility that TEs could influence genetic polymorphisms and therefore genetic diversity was for the most part ignored. The acceptation of the McClintock’s theory started in the late seventies when the phenomenon of hybrid dysgenesis was described in Drosophila associated to the transposon P element (67). P elements can proliferate throughout the genome, disrupting many genes and killing progeny. Hybrid dysgenesis arrives when crosses between specific lines of Drosophila melanogaster (carrying or not an inhibitor of P element) lead to various genetic changes including sterility, increased mutations and recombination rates review in Bregliano et al. and Kidwell (68, 69). Following their initial discovery, TEs were described in several different organisms by molecular biologists that were interested either in genomes composition or in sequences of mutant alleles (70-73).

17 Chapter 1: General Introduction

Transposable elements classification

TEs have been found in all the eukaryotic species investigated so far (74), with only one exception: Plasmodium Falciparum (75). TEs vary in terms of structure, transposition mechanism, size, genome organization (76). This diversity led to the need of a TEs classification by scientists. Finnegan initiated the first one in 1989 (77). Today the unified classification done by Wicker 2007 (78) is used. The class I TEs is composed of RNA-mediated transposons, divided in five orders based on their mechanistic features, genomic organization and reverse transcriptase phylogeny: LTR retrotransposons, DIRS-like elements, Penelope-like elements, LINEs and SINEs. Their transposition is done via a copy-paste mechanism, first the DNA is transcribed in a RNA intermediate and then it is reverse transcribed into DNA by TE encoding reverse transcriptase. This new DNA copy can move and be inserted into a new genomic location. Class I TEs are similar to retroviruses (Fig. 2). Class II TEs are DNA-mediated transposons, a class subdivided in two subclasses distinguished by their transposition mechanism. The first subclass contains TEs characterized by their terminal inverted repeats (TIR) sequence of variable length. They usually transpose via a cut and paste mechanism with the help of their transposase. The second subclass contains transposons with a specific replication type. It includes the Helitron family, that replicates via a rolling circle system (79). It also includes Mavericks, giant transposons bordered by long TIR (80); they encode their own integrase and DNA polymerase. It has been proposed that an excised Maverick can self-replicate with its own polymerase and integrate into the genome using its integrase (81).

18 Chapter 1: General Introduction

Class I: retrotransposons Class II: DNA transposons

LTR (copia, gypsy ...) TIR ( mariner, PiggyBac...)

5’ LTR gag PR INT RT RNaseH LTR 3’ 5’ TIR Transposase TIR 3’

non-LTR (LINE, Penelope...) Helitrons

5’ gag RT Poly A 3’ 5’ A ZN REP Helicase T 3’

Mavericks

C-INT ATP CyP Pol B TIR 5’ TIR 3’ Figure 2. Classification and molecular structure of transposable elements Left: Class I, retrotransposons. LTR-retrotransposons: they resemble to exogenous retroviruses with two Long Terminal Repeat (LTR) sequences flanking the coding sequence containing the functional polyproteins, the capsid (gag) and the protease (PR), integrase (66), reverse-transcriptase (RT), RNaseH compacted in the polymerase (82) area. Non-LTR retrotransposons: the element is composed of two coding regions, one with the gag protein and another containing the reverse transcriptase (RT). A poly A tail protects the 3’ extremities of non-LTR retrotransposons. Right: Class II, DNA transposons. The best known are the TIR DNA transposons, which contain a transposase coding sequence flanked by Terminal Inverted Repeat (TIR) which excises the TE out of the donor position and re-integrates it into the genome. Helitrons are DNA transposons with several coding region containing different coding sequence, Zinc-finger like (ZN), a Replication initiator (Rep) and an Helicase. Their sequence starts typically by a 5’ A and terminates by a stem loop (in red) following by a 3’ T. Their size can be variable. Mavericks elements are a family of giant DNA transposons that can have multiple coding region, usually they are composed of different coding sequence such as C-integrase (C-INT), packaging ATPase (ATP), cysteine protease (CyP) and a DNA polymerase B (PolB). The coding sequences are flanked by two long TIR sequence. Their size can be variable depending on the element.

Relationship between organism and transposons

Transposable elements and host genome evolve in a close relationship. This relationship is regulated by the interaction between the TE replication system, their movement within the host genome, and the genome surveillance mechanism.

Transposons variations: species and individual levels

The proportion of the genome occupied by TEs is not a constant parameter (Fig. 3), it varies within and between species (83-85). Organisms with similar genetic and biological

19 Chapter 1: General Introduction complexity may have huge variations in genome size due to differences in TE content (86). Different studies were performed in insects, for example on Aedes albopictus mosquitoes, where a large degree of intraspecific variation was observed. Some genomes are 2,5 fold bigger than others, the size can pass from 620 to 1600 Mbp (87). The main hypothesis according to this observation proposes that the genome of Aedes albopictus is composed of a different amount of highly repetitive DNA. Numerous studies show that retrotransposons are major actors in promoting the rapid increase or decrease of a genome size according to their transposition mechanism (88-90). The reasons why the amount of repeated sequences in the genomes within organisms of a species might differ are not well understood and need further studies (91). Still the increasing numbers of transposon insertions in the host genome have consequences on gene expression, regulation and function.

D. melanogaster

D. simulans

D. yakuba

D. virilis

D. ananassae

C. quinquefascidus Ae. aegypty

A. Gambia Bombyx mori

Apis melifera

Nasonia vitripennis

01020304050 percentage of the genome composed of TEs Figure 3. TEs content in insect genomes Analysis of the percentage of genome occupied by TEs (class I and class II) in different insects. The insect phylogeny is adapted from Flybase (http://flybase.org/blast/species_tree.png), TEs content was compiled from different sources: the drosophila group (92), the mosquito group (93, 94), Bombyx mori (95), and the Honeybee consortium for Hymenoptera, Apis melifera and Nasonia vitripennis (96, 97).

20 Chapter 1: General Introduction

Gene regulation via transposition

TEs are defined as mutagens because the transposition of TEs copies can lead to insertions in gene sequences or gene regulatory areas, and can result into gene disruption (98, 99). TEs movements can be detrimental for the genome but can also have a positive impact on genome by increasing the genetic diversity of organisms (100). Currently different sorts of TEs insertions are described in the literature (Fig. 4). Here I present some examples observed in Drosophila melanogaster to illustrate gene regulation via transposition. The first example concerns the insertion of the Doc1420 element in the CHKov1 gene followed by a complex duplication of both gene and inserted element which are responsible for resistance to Sigma virus infection in Drosophila melanogaster (101). Doc1420 insertion is dated to 90,000 years ago but it was recently selected as insecticide resistance allele and antiviral (102). The second example concerns the domestication of a TE element, which corresponds to the integration of TE copy in the genome and its selection as a new gene. In Drosophila melanogaster the best known domestication example is the two TEs Het-A and Tart that assume the function of telomeres and telomerase (103, 104). These functions are essential for the survival of drosophila species because it protects the chromosomes from degradation and fusion with neighboring chromosomes (105). In contrast to other organisms, Drosophila telomeres are devoid of short DNA repeat sequences made by the telomerase but are composed of the telomere specific transposons Het-A and Tart.

21 Chapter 1: General Introduction

gene

Cis-element

A Transcriptional

promoter B

Cis-disruption C anti-sense

D

silencing

Figure 4. Consequences of transposable elements mobility on host gene (adpated from Feschotte 2008 (106)) TEs mobility produces different consequences on gene expression at the transcriptional level. By an insertion in the promoter region (A), the transposable element (green) can introduce an alternative transcription start site. It can also be inserted in an area containing a cis-element (B) and lead to the deregulation of gene expression. TEs can be inserted within an intron sequence and drive anti-sense transcription (C) and/or interfere with the sense transcription. Finally, a TE inserted in introns or exons can trigger the formation of heterochromatin (pale green ovals) and potentially silence the transcription of neighbor gene(s) (D).

22 Chapter 1: General Introduction

Stress and transposition

Living organisms permanently encounter stress such as variation in climatic factors, interaction with other organisms, presence of toxins or chemicals. A distinction between biotic and abiotic stress can be done. Biotic stress is the one caused by another organism, while abiotic stress is produced by environmental factors such as sunlight, humidity and wind. In order to survive organisms need to adapt to stress through tolerance or resistance (107, 108). The re-organization of the genome induced by TEs movements can play an essential role in host response to stress, facilitating the adaptation of populations and species facing changing environment. For example, Gonzalez et al. 2008 (109) showed that fly adaptation to climate was related to TEs insertions. As mentioned above, the allele of the gene CHKov1 where the Doc1420 element is inserted induces resistance to Sigma virus infection (101). And one insertion in the gene Cyp6g1 provides insecticide resistance to the flies (110). All these examples put in evidence the importance of TEs insertions in the acquisition of new gene functions for insect survival.

Transposon defense: a way to survive

Host-transposon arms race

The balance between TEs genome defenses and TEs damage confer an important role of TEs in evolution and gene regulation of the host organism (111, 112). In this arms race different mechanism to regulate TE expression exist. To move and invade the host genome TEs need the production of proteins. TEs can be autonomous, producing their own proteins (113, 114), or non-autonomous, when they require the production of proteins from the cell or from other TEs for their movements (115). These proteins production is the limiting step for the replication and the spread of transposons. One interesting example comes from the P-element in Drosophila: P-element contains three introns. Two of them are spliced ubiquitously, whereas the third intron is only spliced in the germline and is necessary for the production of the full length transposase, restricting the P- element activity to germline only (116). On the other hand, TEs are regulated by the host defense mechanisms against transposition. Whereas natural selection is widely considered as the dominant force limiting TE proliferation (117), the arms race between TEs and the host genomes has driven the evolution

23 Chapter 1: General Introduction of the recently discovered Piwi-interacting RNA (piRNA) and endogenous small interfering RNA (endo-siRNA) pathways, which have profound impacts on gene regulation and epigenetic silencing of TEs (see below) (118-121).

Several defenses, one mechanism: RNA interference

As mentioned earlier, insects face threats during their life and, in order to survive, they need to defend themselves against these menaces. RNA interference (RNAi), a branch of the innate immune response in insects, is a biological mechanism guided by small RNA molecules (from 21 to 30 nt) enabling the sequence-specific recognition of cognate nucleic-acid target sequences and their degradation, translational arrest or transcriptional regulation. In insects, RNAi-based responses mediate robust antiviral defense and protection against transposition. In the next section I will describe the different RNAi pathways found in insects and their involvement in defense.

RNA interference pathway miRNA

MicroRNAs were the first class of small RNAs to be discovered. They were identified by Lee et al. in 1993 (122) in the nematode C. elegans. Today we know that miRNAs are found in all kingdoms, and that they are highly conserved among them (123-125). The main function of miRNAs is to regulate host gene expression by initiating the degradation of their targets or by blocking their translation (125, 126). Their activity is essential in the regulation of organ development, cellular differentiation and homeostasis (127, 128). Mutations in this pathway disrupt development and often lead to embryonic lethality (129, 130). The miRNA pathway (Fig. 5B) is initiated by the expression of genome-encoded miRNA gene transcripts. These primary miRNAs are capable of folding back on themselves to form one or more dsRNA stem-loop structures that trigger the pathway. The primary miRNAs are processed in the cell nucleus by a protein complex formed by Drosha and Pasha to produce the precursor miRNA, which is exported to the cytoplasm (131, 132). Precursor-miRNAs are then further processed into 21- to 23-nt small dsRNA (miRNA) duplexes by another enzymatic complex formed by Dicer-1 (Dcr-1) and Loquacious (LOQS)-PA or LOQS-PB

24 Chapter 1: General Introduction

(133, 134). The miRNA duplex produced in this reaction is loaded into the AGO1-containing RNA-induced silencing complex (RISC). One strand of the duplex, the miRNA*, is released from the complex and quickly degraded, forming a mature RISC that contains only one small RNA strand (135). RISCs harboring miRNAs primarily target protein-coding mRNAs, producing either translational inhibition or mRNA degradation. Target recognition by miRNA does not require perfect homology. The miRNA pathway is active in both somatic and germline tissues.

siRNA

Small interfering RNA (siRNA) are small RNAs with a variable length depending on the organism (21-24 nt) that can bind specifically to RNA and restrict gene expression via mRNA cleavage. The siRNA pathway was discovered in 1990’s in plants, when Napoli and Jorgensen (82) overexpressed the enzyme chalcone synthetase (CHS) and obtained white flowers instead of the purple ones expected. This discovery lead, during the years that followed, to unravel the molecular basis and functions of the siRNA pathway (136, 137). The siRNA pathway (Fig. 5A) can be triggered in cells by either endogenous or exogenous dsRNA molecules. Endogenous dsRNA molecules are produced from long genomic transcripts capable of forming extensive fold-back structures or double-stranded regions generated by intermolecular hybridization of overlapped transcripts (138, 139). Exogenous dsRNA molecules can be derived from any environmental source, such as viral dsRNA molecules. In the siRNA pathway, dsRNA is recognized and processed in the cytoplasm by Dicer-2 (Dcr-2) into 21-nt siRNA duplexes harboring 2-nt 3′ overhangs (140). After being diced, siRNA duplexes are loaded into the Ago-2-containing RISC. The biogenesis and loading of siRNA duplexes into the RISC require the activity of LOQS and R2D2 as Dcr-2 cofactors. The LOQS-PD isoform and R2D2 are required for the production of siRNAs derived from endogenous dsRNA triggers, and R2D2 is primarily recruited in the production of virus-derived siRNAs (vsiRNAs) (141, 142). Once loaded into the RISC, one strand of the siRNA duplex, termed the passenger strand, is eliminated from the RISC. The single-stranded siRNA that remains in the RISC, termed the guide strand, is then 2′-O-methylated at its 3′- terminal nucleotide by the RNA methyltransferase DmHEN1 (143, 144), resulting in a mature, active RISC. Sequence-specific recognition mediated by the retained siRNA guide strand, which requires complete complementarity, then induces target RNA cleavage via the

25 Chapter 1: General Introduction slicing activity of Ago-2. Although endogenous siRNA targets are mostly transposons and protein-coding mRNAs, vsiRNAs recognize virus-derived sequences. As with the miRNA pathway, the siRNA pathway is ubiquitously expressed.

piRNA

A third RNA interference pathway, the piwi-interacting RNA pathway (piRNA) was recently described (Fig. 5C). Molecules initiating the piRNA pathway are ssRNA precursors transcribed from chromosomal loci that mostly consist of remnants of transposable element sequences, called piRNA clusters (111). Biogenesis of piRNAs involves two steps, primary processing and secondary amplification. Production of piRNAs is Dicer independent and mainly relies on the activity of PIWI proteins, a subclass of the AGO family (145). Primary piRNAs are processed from ssRNA transcripts derived from piRNA clusters. Zucchini endonuclease (Zuc) cleaves primary piRNA precursors and generates the 5′ end of mature piRNAs (146-148). The cleaved precursor is loaded into PIWI or Aubergine (Aub) proteins and then trimmed by an unknown nuclease to reach its final length. After trimming, piRNAs undergo a final 3′-end 2′-O-methyl nucleotide modification catalyzed by DmHEN1 (143, 144) to yield mature piRNAs. Primary piRNAs harbor a 5′ uridine bias (U1) (149). Cleavage of the complementary active transposon RNA by primary piRNAs loaded into Aub proteins initiates the second round of biogenesis, which leads to the production of secondary piRNAs that are loaded into Ago-3. During this ping-pong, or amplification, cycle, Aub and Ago-3 proteins loaded with secondary piRNAs mediate the cleavage of complementary RNA, generating new secondary piRNAs that are similar in sequence to the piRNA that initiated the cycle. The complementary secondary piRNAs usually have a 10-nt overlap and contain an adenine at position 10 (A10) (150). Most data indicate that the piRNA pathway is mainly active in germline tissues, where it acts as a genome guardian by cleaving transposons RNA or transcriptionally silencing transposable elements.

26 Chapter 1: General Introduction

ABCexo-siRNA endo-siRNA miRNA piRNA Pol II Pol II

miRNA gene piRNA cluster

pri-miRNA Viral Viral Secondary genome replication piRNA precursor structure intermediate AAA Drosha Structured Pasha Transposons Viral long dsRNA loci Pol II

Transposon

pre-miRNA Exportin5 Dicer2 Dicer2 R2D2 LOQS

siRNAs Nucleus siRNAs Dicer1 LOQS Cytoplasm

pre-miRNA SAM PIWI Ago2

Hen1 5’U 2’-OCH SAH PIWI/Aub PIWI/Aub 3 methylation miRNA duplex

Zuc primary piRNA RISCRRISRISCC pathway Ago2 RISC Gasz 2’-OCH 3 passenger strand Ago1 Armitage PIWI/Aub mitochondria

5’U

Triming RISC

Ago1 miRNA* miRNA PIWI/Aub SAM

5’U Hen1 SAH methylation

secondary piRNA pathway

Aub

5’U 2’-OCH3

Ago-3 Ago-3 Ping-pong amplification A

A 2’-OCH

2’-OCH3 3

U 5’

3 2’-OCH

Aub

Figure 5. RNA interference pathway in Drosophila melanogaster (A) Exo and endo-siRNA pathway: dsRNAs are processed by Dicer-2 (Dcr-2) and its co-factor R2D2 for exo- siRNA or LOQ-S for endo-siRNA, and generates siRNA duplexes. This complex loads the siRNA duplex into Argonaute-2 (Ago-2) protein. The passenger strand is unwound and released, the guide strand stays into Ago-2 and its 3’ extremities are protected by the addition at the 3’ end of a 2’-O-methyl modification catalyzed by the methyltransferase HEN1. (B) miRNA pathway: miRNA genes are transcribed into a primary miRNA (pri-miRNA) transcript, which is cleaved by Drosha and Pasha complex to give a short miRNA precursor (pre-miRNA). This pre-miRNA is

27 Chapter 1: General Introduction exported to the cytoplasm, where it is processed by Dicer-1 (Dcr-1) and LOQ-S to generate a miRNA duplex. The duplex is loaded on Ago1-RISC complex. One strand, the miRNA*, is released. The other strand, the miRNA, guides translational repression of target RNAs. (C) piRNA pathway: piRNAs of 24-29 nucleotides long are derived from a ssRNA precursor, a piRNA cluster. In the primary processing, piRNAs coming from the cleavage of the piRNA precursor are processed and loaded on PIWI protein in the cytoplasm. Then the 5’ extremities of piRNAs will be matured by the Zucchini (Zuc) protein and its co-factors. The methyltransferase HEN1 adds at the 3’ end the 2’-O-methyl modification. The secondary processing, the amplification cycle, generates additional piRNAs. Antisense piRNAs are loaded in PIWI or Aub, while sense piRNAs are loaded in Ago-3. S-adenosyl methionine (SAM); S-adenosyl homocysteine (SAH) ; Polymerase II (pol II).

RNA interference: protection against the non-self. miRNAs, gene expression and immunity

During a viral infection, cells, tissues and entire organisms need to develop a defense strategy. This results in modifications in the expression of genes involved in immunity and in different cellular processes. Since miRNAs are gene regulators, their potential role in immunity was long suspected and, indeed, miRNAs protect the infected host against the non-self through the modulation of the self. miRNAs can be produced from both host and virus. We observe host miRNAs, which regulate viral transcript (151), viral miRNAs that regulate host transcripts (152, 153) and viral miRNAs that can regulate viral transcripts via the host miRNA machinery (154). miRNA regulation can impact different cellular processes and thus change many factors that influence viral infection. For example in mosquitoes, studies showed that miRNA expression influence the viral tropism of certain viruses. For example, in Ae. aegypti miR-275 depletion affects egg production and blood digestion, two important mechanisms for virus life cycle and transmission (155). miRNA can also directly impact immune pathways. For example, Ae. aegypti miR-375, detected after blood meal, targets the 5’UTRs of the Toll immune pathway components Cactus and REL1 (156). Other examples of miRNA gene regulation during host- pathogen interactions were observed in cases of arboviruses infections in mosquitoes. The expression in vitro of the KUN-miR-1 during West Nile infection, up-regulates the GATA4 mRNA and induces protein accumulation that supports viral replication (152).

28 Chapter 1: General Introduction

During DNA virus infection miRNA produced by the virus can induce viral cycle modifications, as for Nudivirus-1 pag1 miRNA, which down regulates the viral early gene hhi1 to induce viral latency (157). siRNAs, outsiders recognition and elimination

The major issue in the battleground is the detection and neutralization of outsiders. In all organisms the crucial step for viral defense concerns the recognition of self versus non-self. Viral dsRNA is key for the detection of a viral infection. As a replicative intermediate of all known viruses (except retroviruses), its recognition by the exo-siRNA pathway contributes to the defense system of insects (28, 29, 158). This recognition step will lead to the degradation of the viral genome in the cytoplasm of the infected cells, and allows in some cases the clearance of the virus. Several evidences suggest the importance of RNAi in diptera antiviral immunity. First, flies with mutations in known RNAi pathway components are hypersensitive to RNA virus infections and develop a dramatic increase in viral load (28, 29, 158); second, many insect viruses, encode suppressors of RNAi that counteract the immune defense of the insect (159-161). Finally, the rapid evolution of RNAi pathway genes compared with miRNA pathway genes in Drosophila also suggests an ongoing arms race between insect viruses and hosts, and highlight the importance of RNAi as antiviral defenses (162). piRNAs and endo-siRNAs, insiders recognition and control

As previously described, TEs represent threats for insect viability and species sustainability. Therefore a good protection system is important to avoid genome invasion. piRNAs are the genome guardians. Indeed, the piRNA pathway is restricted to the germline and regulates the accumulation of TEs to avoid their transmission to the progeny (111). Furthermore the piRNAs synthetized in the germline are maternally transmitted and allow the protection of the genome during the development stage (120, 163), constituting an inherited defense. During many years it was assumed that TE movements were restricted to germline, but recently transposition in somatic cells was also observed (121, 164). Insects have selected different silencing mechanisms for somatic and germline TEs. In a general manner, endo- siRNAs have been privileged to silence TEs in somatic cells while piRNAs do it in germline cells (138).

29 Chapter 1: General Introduction

Innate immunity strategy: the flexibility

The observation that RNAi pathways are conserved across eukaryotes means that the common ancestor of these organisms had a functional RNAi pathway billion years ago (165, 166). Its conservation highlights the importance of the RNAi process on the adaptation to different threats. This ability relays, in part, on the evolutionary rate of the Argonaute proteins, the core component of the RNAi machinery. Indeed, Lewis et al. 2016 (167) showed not only that Drosophila Ago-2 and Ago-3 proteins have a high evolutionary rate, but also that the gene turnover (number of gains and losses per million years) of Ago-2 and Piwi/Aub are important. These observations along with other studies where duplications of Argonaute and Piwi proteins are observed in the diptera clade (167-170), confirmed a high selective pressure on these proteins. In a more global approach Argonaute proteins with diverse functions and different copy number were found across different eukaryotic clades (171), illustrating the dynamism of their evolution. All these duplication events possibly drive the acquisition of new functions for RNAi proteins, as exemplified for the involvement of the piRNA pathway in antiviral response in mosquito (172-174) besides the classical transposition control role.

30 Chapter 1: General Introduction

Outline of this thesis

In insects, especially in Diptera, it was observed that different small RNAs pathways play a role in the defense against different genome parasites such as viruses and TEs. This work focuses on the involvement of the piRNA pathway on antiviral defense in Drosophila melanogaster. In chapter 2, I describe the protocol to homogenize the genetic background of the different mutant flies used in my studies. The chapter 3, presents the main results of my research concerning the study of viral piRNAs in diptera. I observed that, unlike mosquitoes, Drosophila melanogaster does not produce viral piRNAs, independently from the type of viruses, the infection state or the viral transmission route. I demonstrate that adult Drosophila melanogaster flies do not require the production of viral piRNAs to mount an efficient antiviral response. Following these results, I investigate whether the production of piRNAs are affected by stress due to viral infection, and this is the subject of Chapter 4. Finally, chapter 5 is dedicated to a general discussion on the results of this thesis and some perspectives to understand TEs impact during infection in Drosophila melanogaster.

31 Chapter 1: General Introduction

Bibliography

1. May R.M BRJH (1990) How many species? Philosophical transactions of the royal society- biological science 330(1257). 2. May B (2009) Insect Biodiversity: science and society (Wiley). 3. G.R D (1989) The Human Use of Insects as Food and as Animal Feed. Bulletin of the Entomological Society of America 35(1):22-36. 4. Berenbaum MR (1995) The chemistry of defense: theory and practice. Proc Natl Acad Sci U S A 92(1):2-8. 5. Sih A, Crowley P, Mcpeek M, Petranka J, & Strohmeier K (1985) Predation, Competition, and Prey Communities - a Review of Field Experiments. Annu Rev Ecol Syst 16:269-311. 6. Bowers MD (1990) Recycling plant natural products for insect defense. Insect defenses), pp 353-383. 7. Blum M (2012) Chemical defense of arthropods (Elsevier). 8. Gullan PJ, and Peter S. Cranston (2009) The insects: an outline of entomology. 9. Rettenmeyer CW (1970) Insect mimicry. Annual review of Entomology 15:43-74. 10. Belwood JJ (1990) Anti-predator defences and ecology of neotropical forest katydids, especially the Pseudophyllinae. The tettigoniidae: biology, systematics and evolution:8-26. 11. Mallet JaJ, M. (1999) Evolution of diversity in wrning color and mimicry: polymorphisms, shifting balance, and speciation. Annu Rev Ecol Syst:201-233. 12. Hoffmann JA, Kafatos FC, Janeway CA, & Ezekowitz RA (1999) Phylogenetic perspectives in innate immunity. Science 284(5418):1313-1318. 13. Uvell H & Engstrom Y (2007) A multilayered defense against infection: combinatorial control of insect immune genes. Trends Genet 23(7):342-349. 14. Lemaitre B & Hoffmann J (2007) The host defense of Drosophila melanogaster. Annu Rev Immunol 25:697-743. 15. Tzou P, De Gregorio E, & Lemaitre B (2002) How Drosophila combats microbial infection: a model to study innate immunity and host-pathogen interactions. Curr Opin Microbiol 5(1):102-110. 16. Eleftherianos I, Millichap PJ, ffrench-Constant RH, & Reynolds SE (2006) RNAi suppression of recognition protein mediated immune responses in the tobacco hornworm Manduca sexta causes increased susceptibility to the insect pathogen Photorhabdus. Dev Comp Immunol 30(12):1099-1107. 17. Werner T, Borge-Renberg K, Mellroth P, Steiner H, & Hultmark D (2003) Functional diversity of the Drosophila PGRP-LC gene cluster in the response to lipopolysaccharide and peptidoglycan. J Biol Chem 278(29):26319-26322. 18. Ramet M, et al. (2001) Drosophila scavenger receptor CI is a pattern recognition receptor for bacteria. Immunity 15(6):1027-1038. 19. Meister M, Lemaitre B, & Hoffmann JA (1997) Antimicrobial peptide defense in Drosophila. Bioessays 19(11):1019-1026. 20. Vidal S, et al. (2001) Mutations in the Drosophila dTAK1 gene reveal a conserved function for MAPKKKs in the control of rel/NF-kappaB-dependent innate immune responses. Genes Dev 15(15):1900-1912. 21. Agaisse H & Perrimon N (2004) The roles of JAK/STAT signaling in Drosophila immune responses. Immunol Rev 198:72-82. 22. Lemaitre B, et al. (1995) A recessive mutation, immune deficiency (imd), defines two distinct control pathways in the Drosophila host defense. Proc Natl Acad Sci U S A 92(21):9465-9469. 23. Hoffmann JA & Reichhart JM (2002) Drosophila innate immunity: an evolutionary perspective. Nat Immunol 3(2):121-126. 24. Gottar M, et al. (2002) The Drosophila immune response against Gram-negative bacteria is mediated by a peptidoglycan recognition protein. Nature 416(6881):640-644. 25. Michel T, Reichhart JM, Hoffmann JA, & Royet J (2001) Drosophila Toll is activated by Gram-positive bacteria through a circulating peptidoglycan recognition protein. Nature 414(6865):756-759. 26. Ferrandon D, Imler JL, Hetru C, & Hoffmann JA (2007) The Drosophila systemic immune response: sensing and signalling during bacterial and fungal infections. Nat Rev Immunol 7(11):862-874. 27. Ligoxygakis P, Pelte N, Hoffmann JA, & Reichhart JM (2002) Activation of Drosophila Toll during fungal infection by a blood serine protease. Science 297(5578):114-116. 28. Wang XH, et al. (2006) RNA interference directs innate immunity against viruses in adult Drosophila. Science 312(5772):452-454. 29. Galiana-Arnoux D, Dostert C, Schneemann A, Hoffmann JA, & Imler JL (2006) Essential function in vivo for Dicer-2 in host defense against RNA viruses in drosophila. Nat Immunol 7(6):590-597.

32 Chapter 1: General Introduction

30. Hu Z, Xinwen Chen, and Xiulian Sun (2002) Molecular biology of insect viruses. Advances in microbial control of insect pests, (Springer US), pp 83-107. 31. Weller SK (2005) DNA Virus Replication. Microbiology and Microbial Infections, ed Wilson's Ta). 32. Moscardi F (1999) Assessment of the application of baculoviruses for control of Lepidoptera. Annu Rev Entomol 44:257-289. 33. Kost TA & Kemp CW (2016) Fundamentals of Baculovirus Expression and Applications. Adv Exp Med Biol 896:187-197. 34. Herniou EA, Olszewski JA, Cory JS, & O'Reilly DR (2003) The genome sequence and evolution of baculoviruses. Annu Rev Entomol 48:211-234. 35. Bellet AJ (1968) The iridescent virus group. Advances in virus research 13:225-246. 36. Williams T (2008) Natural invertebrate hosts of iridoviruses (Iridoviridae). Neotropical entomology 37(6):615-632. 37. Tijssen P & Bergoin M (1995) Densonucleosis Viruses Constitute an Increasingly Diversified Subfamily among the Parvoviruses. Semin Virol 6(5):347-355. 38. Hueffer K & Parrish CR (2003) Parvovirus host range, cell tropism and evolution. Current Opinion in Microbiology 6(4):392-398. 39. Tanada Y. ; Kaya H (2012) Insect Pathology (Harcourt Brace Jovanovich). 40. Murphy FA, Fauquet, C.M., Bishop, D.H., Ghabrial, S.A., Jarvis, A., Martelli, G.P., Mayo, M.A. and Summers, M.D. (2012) Virus taxonomy: classification and nomenclature of viruses (Springer Science & Business Media). 41. Ahlquist P (2002) RNA-dependent RNA polymerases, viruses, and RNA silencing. Science 296(5571):1270-1273. 42. Crotty S, Cameron CE, & Andino R (2001) RNA virus error catastrophe: Direct molecular test by using ribavirin. P Natl Acad Sci USA 98(12):6895-6900. 43. Gubler DJ (2001) Human arbovirus infections worldwide. Ann N Y Acad Sci 951:13-24. 44. Karabatsos N (1985) International Catalogue of Arboviruses, including certain other Viruses of vertebrates. 45. Calisher CH & Gould EA (2003) Taxonomy of the virus family flaviviridae. Adv Virus Res 59:1-19. 46. Shope RE (1994) The discovery of arbovirus diseases. Ann N Y Acad Sci 740:138-145. 47. Dauphin G, Zientara S, Zeller H, & Murgue B (2004) West Nile: worldwide current situation in animals and humans. Comp Immunol Microbiol Infect Dis 27(5):343-355. 48. Flick R & Bouloy M (2005) Rift Valley fever virus. Curr Mol Med 5(8):827-834. 49. Bichaud L, et al. (2014) Arthropods as a source of new RNA viruses. Microb Pathog 77:136-141. 50. Singh R, et al. (2010) RNA viruses in hymenopteran pollinators: evidence of inter-Taxa virus transmission via pollen and potential impact on non-Apis hymenopteran species. PLoS One 5(12):e14357. 51. Chen YP, Pettis JS, Collins A, & Feldlaufer MF (2006) Prevalence and transmission of honeybee viruses. Appl Environ Microbiol 72(1):606-611. 52. Gray SM & Banerjee N (1999) Mechanisms of arthropod transmission of plant and animal viruses. Microbiol Mol Biol Rev 63(1):128-148. 53. Belliure B, Janssen A, Maris PC, Peters D, & Sabelis MW (2005) Herbivore arthropods benefit from vectoring plant viruses. Ecol Lett 8(1):70-79. 54. P.W E (1994) Vectors Vertical Transmission and evolution of virulence. Evolution of infectious disease, ed P.W E (Oxford University press, New-York), pp 35-56. 55. Rosen L, Shroyer DA, Tesh RB, Freier JE, & Lien JC (1983) Transovarial transmission of dengue viruses by mosquitoes: Aedes albopictus and Aedes aegypti. Am J Trop Med Hyg 32(5):1108-1119. 56. Fine PEM (1975) Vectors and vertical transmission: an epidemiologic perspective. annals of the new york academy of sciences 266:173-194. 57. Bolling BG, Eisen L, Moore CG, & Blair CD (2011) Insect-specific flaviviruses from Culex mosquitoes in Colorado, with evidence of vertical transmission. Am J Trop Med Hyg 85(1):169-177. 58. Hogenhout SA, Ammar el D, Whitfield AE, & Redinbaugh MG (2008) Insect vector interactions with persistently transmitted viruses. Annu Rev Phytopathol 46:327-359. 59. Lequime S & Lambrechts L (2014) Vertical transmission of arboviruses in mosquitoes: a historical perspective. Infect Genet Evol 28:681-690. 60. Lipsitch M, Siller S, & Nowak MA (1996) The evolution of virulence in pathogens with vertical and horizontal transmission. Evolution 50(5):1729-1741. 61. Saul AJ, Graves PM, & Kay BH (1990) A Cyclical Feeding Model for Pathogen Transmission and Its Application to Determine Vectorial Capacity from Vector Infection-Rates. J Appl Ecol 27(1):123-133. 62. Kramer LD & Ciota AT (2015) Dissecting vectorial capacity for mosquito-borne viruses. Curr Opin Virol 15:112-118.

33 Chapter 1: General Introduction

63. Mellor PS (2000) Replication of arboviruses in insect vectors. J Comp Pathol 123(4):231-247. 64. W.J. T (1994) Genetics of insect vector competence for arboviruses. Advance in Disease Vector Research 10:93-108. 65. S.C. W (1997) Vector biology in arboviral pathogenesis. Viral pathogenesis, ed N N (Lippincott-Raven, Philadelphia), pp 329-352. 66. Mc CB (1951) Chromosome organization and genic expression. Cold Spring Harb Symp Quant Biol 16:13-47. 67. Kidwell MG, Kidwell JF, & Sved JA (1977) Hybrid Dysgenesis in DROSOPHILA MELANOGASTER: A Syndrome of Aberrant Traits Including Mutation, Sterility and Male Recombination. Genetics 86(4):813-833. 68. Bregliano JC, et al. (1980) Hybrid dysgenesis in Drosophila melanogaster. Science 207(4431):606-611. 69. Kidwell MG (1983) Evolution of hybrid dysgenesis determinants in Drosophila melanogaster. Proc Natl Acad Sci U S A 80(6):1655-1659. 70. Lidholm DA, Lohe AR, & Hartl DL (1993) The transposable element mariner mediates germline transformation in Drosophila melanogaster. Genetics 134(3):859-868. 71. Romans P, Bhattacharyya RK, & Colavita A (1998) Ikirara, a novel transposon family from the malaria vector mosquito, Anopheles gambiae. Insect Mol Biol 7(1):1-10. 72. O'Brochta DA, Warren WD, Saville KJ, & Atkinson PW (1994) Interplasmid transposition of Drosophila hobo elements in non-drosophilid insects. Mol Gen Genet 244(1):9-14. 73. Kempken F & Windhofer F (2001) The hAT family: a versatile transposon group common to plants, fungi, animals, and man. Chromosoma 110(1):1-9. 74. Feschotte C & Pritham EJ (2007) DNA transposons and the evolution of eukaryotic genomes. Annu Rev Genet 41:331-368. 75. Gardner MJ, et al. (2002) Genome sequence of the human malaria parasite Plasmodium falciparum. Nature 419(6906):498-511. 76. Jurka J, Kapitonov VV, Kohany O, & Jurka MV (2007) Repetitive sequences in complex genomes: structure and evolution. Annu Rev Genomics Hum Genet 8:241-259. 77. Finnegan DJ (1989) Eukaryotic transposable elements and genome evolution. Trends Genet 5(4):103- 107. 78. Wicker T, et al. (2007) A unified classification system for eukaryotic transposable elements. Nat Rev Genet 8(12):973-982. 79. Kapitonov VV & Jurka J (2001) Rolling-circle transposons in eukaryotes. Proc Natl Acad Sci U S A 98(15):8714-8719. 80. Feschotte C & Pritham EJ (2005) Non-mammalian c-integrases are encoded by giant transposable elements. Trends Genet 21(10):551-552. 81. Pritham EJ, Putliwala T, & Feschotte C (2007) Mavericks, a novel class of giant transposable elements widespread in eukaryotes and related to DNA viruses. Gene 390(1-2):3-17. 82. Napoli C, Lemieux C, & Jorgensen R (1990) Introduction of a Chimeric Chalcone Synthase Gene into Petunia Results in Reversible Co-Suppression of Homologous Genes in trans. Plant Cell 2(4):279-289. 83. Bosco G, Campbell P, Leiva-Neto JT, & Markow TA (2007) Analysis of Drosophila species genome size and satellite DNA content reveals significant differences among strains as well as between species. Genetics 177(3):1277-1290. 84. Vieira J & Charlesworth B (1999) X chromosome DNA variation in Drosophila virilis. Proc Biol Sci 266(1431):1905-1912. 85. Biemont C (2008) Genome size evolution: within-species variation in genome size. Heredity (Edinb) 101(4):297-298. 86. Kidwell MG (2002) Transposable elements and the evolution of genome size in eukaryotes. Genetica 115(1):49-63. 87. Rai KS & Black WC (1999) Mosquito genomes: Structure, organization, and evolution. Adv Genet 41:1-33. 88. Boulesteix M, Weiss M, & Biemont C (2006) Differences in genome size between closely related species: The Drosophila melanogaster species subgroup. Mol Biol Evol 23(1):162-167. 89. Bennetzen JL, Ma JX, & Devos K (2005) Mechanisms of recent genome size variation in flowering plants. Ann Bot-London 95(1):127-132. 90. Liu GR, et al. (2003) Genomic diversification among archival strains of Salmonella enterica serovar typhimurium LT7. J Bacteriol 185(7):2131-2142. 91. Elliott TA & Gregory TR (2015) Do larger genomes contain more diverse transposable elements? BMC Evol Biol 15:69. 92. Drosophila 12 Genomes C, et al. (2007) Evolution of genes and genomes on the Drosophila phylogeny. Nature 450(7167):203-218.

34 Chapter 1: General Introduction

93. Nene V, et al. (2007) Genome sequence of Aedes aegypti, a major arbovirus vector. Science 316(5832):1718-1723. 94. Arensburger P, Hice RH, Wright JA, Craig NL, & Atkinson PW (2011) The mosquito Aedes aegypti has a large genome size and high transposable element load but contains a low proportion of transposon-specific piRNAs. Bmc Genomics 12:606. 95. Mita K, et al. (2004) The genome sequence of silkworm, Bombyx mori. DNA Res 11(1):27-35. 96. Honeybee Genome Sequencing C (2006) Insights into social insects from the genome of the honeybee Apis mellifera. Nature 443(7114):931-949. 97. Werren JH, et al. (2010) Functional and evolutionary insights from the genomes of three parasitoid Nasonia species. Science 327(5963):343-348. 98. Kleckner N, Roth J, & Botstein D (1977) Genetic engineering in vivo using translocatable drug- resistance elements. New methods in bacterial genetics. J Mol Biol 116(1):125-159. 99. Bingham PM, Kidwell MG, & Rubin GM (1982) The molecular basis of P-M hybrid dysgenesis: the role of the P element, a P-strain-specific transposon family. Cell 29(3):995-1004. 100. Kidwell MG & Lisch DR (2000) Transposable elements and host genome evolution. Trends Ecol Evol 15(3):95-99. 101. Magwire MM, Bayer F, Webster CL, Cao C, & Jiggins FM (2011) Successive increases in the resistance of Drosophila to viral infection through a transposon insertion followed by a Duplication. PLoS Genet 7(10):e1002337. 102. Aminetzach YT, Macpherson JM, & Petrov DA (2005) Pesticide resistance via transposition-mediated adaptive gene truncation in Drosophila. Science 309(5735):764-767. 103. Levis RW, Ganesan R, Houtchens K, Tolar LA, & Sheen FM (1993) Transposons in place of telomeric repeats at a Drosophila telomere. Cell 75(6):1083-1093. 104. Pardue ML & Debaryshe P (2011) Adapting to life at the end of the line: How Drosophila telomeric retrotransposons cope with their job. Mob Genet Elements 1(2):128-134. 105. Blackburn EH (1991) Structure and function of telomeres. Nature 350(6319):569-573. 106. Feschotte C (2008) Transposable elements and the evolution of regulatory networks. Nat Rev Genet 9(5):397-405. 107. Rose MR, Vu LN, Park SU, & Graves JL, Jr. (1992) Selection on stress resistance increases longevity in Drosophila melanogaster. Exp Gerontol 27(2):241-250. 108. Feder ME & Hofmann GE (1999) Heat-shock proteins, molecular chaperones, and the stress response: evolutionary and ecological physiology. Annu Rev Physiol 61:243-282. 109. Gonzalez J, Lenkov K, Lipatov M, Macpherson JM, & Petrov DA (2008) High rate of recent transposable element-induced adaptation in Drosophila melanogaster. PLoS Biol 6(10):e251. 110. Daborn PJ, et al. (2002) A single p450 allele associated with insecticide resistance in Drosophila. Science 297(5590):2253-2256. 111. Aravin AA, Hannon GJ, & Brennecke J (2007) The Piwi-piRNA pathway provides an adaptive defense in the transposon arms race. Science 318(5851):761-764. 112. McDonald JH (1998) Improved tests for heterogeneity across a region of DNA sequence in the ratio of polymorphism to divergence. Mol Biol Evol 15(4):377-384. 113. Kim AI, Belyaeva ES, & Aslanian MM (1990) Autonomous transposition of gypsy mobile elements and genetic instability in Drosophila melanogaster. Mol Gen Genet 224(2):303-308. 114. Kapitonov VV & Jurka J (2006) Self-synthesizing DNA transposons in eukaryotes. Proc Natl Acad Sci U S A 103(12):4540-4545. 115. Brookfield JF (1993) The generation of sequence similarity in SINEs and LINEs. Trends Genet 9(2):38- 39. 116. Laski FA, Rio DC, & Rubin GM (1986) Tissue specificity of Drosophila P element transposition is regulated at the level of mRNA splicing. Cell 44(1):7-19. 117. Charlesworth B & Langley CH (1986) The evolution of self-regulated transposition of transposable elements. Genetics 112(2):359-383. 118. Pelisson A, Sarot E, Payen-Groschene G, & Bucheton A (2007) A novel repeat-associated small interfering RNA-mediated silencing pathway downregulates complementary sense gypsy transcripts in somatic cells of the Drosophila ovary. J Virol 81(4):1951-1960. 119. Yin H & Lin H (2007) An epigenetic activation role of Piwi and a Piwi-associated piRNA in Drosophila melanogaster. Nature 450(7167):304-308. 120. Brennecke J, et al. (2008) An epigenetic role for maternally inherited piRNAs in transposon silencing. Science 322(5906):1387-1392. 121. Ghildiyal M, et al. (2008) Endogenous siRNAs derived from transposons and mRNAs in Drosophila somatic cells. Science 320(5879):1077-1081.

35 Chapter 1: General Introduction

122. Lee RC, Feinbaum RL, & Ambros V (1993) The C. elegans heterochronic gene lin-4 encodes small RNAs with antisense complementarity to lin-14. Cell 75(5):843-854. 123. Lee CT, Risom T, & Strauss WM (2007) Evolutionary conservation of microRNA regulatory circuits: an examination of microRNA gene complexity and conserved microRNA-target interactions through metazoan phylogeny. DNA Cell Biol 26(4):209-218. 124. Ambros V (2004) The functions of animal microRNAs. Nature 431(7006):350-355. 125. Bartel DP (2004) MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116(2):281-297. 126. He L & Hannon GJ (2004) MicroRNAs: small RNAs with a big role in gene regulation. Nat Rev Genet 5(7):522-531. 127. Asgari S (2013) MicroRNA functions in insects. Insect Biochem Mol Biol 43(4):388-397. 128. Behura SK (2007) Insect microRNAs: Structure, function and evolution. Insect Biochem Mol Biol 37(1):3-9. 129. Du T & Zamore PD (2005) microPrimer: the biogenesis and function of microRNA. Development 132(21):4645-4652. 130. Kloosterman WP & Plasterk RH (2006) The diverse functions of microRNAs in animal development and disease. Dev Cell 11(4):441-450. 131. Denli AM, Tops BB, Plasterk RH, Ketting RF, & Hannon GJ (2004) Processing of primary microRNAs by the Microprocessor complex. Nature 432(7014):231-235. 132. Lee Y, et al. (2004) MicroRNA genes are transcribed by RNA polymerase II. EMBO J 23(20):4051- 4060. 133. Forstemann K, et al. (2005) Normal microRNA maturation and germ-line stem cell maintenance requires Loquacious, a double-stranded RNA-binding domain protein. PLoS Biol 3(7):e236. 134. Saito K, Ishizuka A, Siomi H, & Siomi MC (2005) Processing of pre-microRNAs by the Dicer-1- Loquacious complex in Drosophila cells. PLoS Biol 3(7):e235. 135. Miyoshi K, Tsukumo H, Nagami T, Siomi H, & Siomi MC (2005) Slicer function of Drosophila Argonautes and its involvement in RISC formation. Genes Dev 19(23):2837-2848. 136. Hammond SM, Bernstein E, Beach D, & Hannon GJ (2000) An RNA-directed nuclease mediates post- transcriptional gene silencing in Drosophila cells. Nature 404(6775):293-296. 137. Zamore PD, Tuschl T, Sharp PA, & Bartel DP (2000) RNAi: double-stranded RNA directs the ATP- dependent cleavage of mRNA at 21 to 23 nucleotide intervals. Cell 101(1):25-33. 138. Czech B, et al. (2008) An endogenous small interfering RNA pathway in Drosophila. Nature 453(7196):798-802. 139. Okamura K, Balla S, Martin R, Liu N, & Lai EC (2008) Two distinct mechanisms generate endogenous siRNAs from bidirectional transcription in Drosophila melanogaster. Nat Struct Mol Biol 15(6):581- 590. 140. Lee YS, et al. (2004) Distinct roles for Drosophila Dicer-1 and Dicer-2 in the siRNA/miRNA silencing pathways. Cell 117(1):69-81. 141. Marques JT, et al. (2013) Functional specialization of the small interfering RNA pathway in response to virus infection. PLoS Pathog 9(8):e1003579. 142. Mirkovic-Hosle M & Forstemann K (2014) Transposon defense by endo-siRNAs, piRNAs and somatic pilRNAs in Drosophila: contributions of Loqs-PD and R2D2. PLoS One 9(1):e84994. 143. Horwich MD, et al. (2007) The Drosophila RNA methyltransferase, DmHen1, modifies germline piRNAs and single-stranded siRNAs in RISC. Curr Biol 17(14):1265-1272. 144. Saito K, et al. (2007) Pimet, the Drosophila homolog of HEN1, mediates 2'-O-methylation of Piwi- interacting RNAs at their 3' ends. Genes Dev 21(13):1603-1608. 145. Siomi MC, Sato K, Pezic D, & Aravin AA (2011) PIWI-interacting small RNAs: the vanguard of genome defence. Nat Rev Mol Cell Biol 12(4):246-258. 146. Ipsaro JJ, Haase AD, Knott SR, Joshua-Tor L, & Hannon GJ (2012) The structural biochemistry of Zucchini implicates it as a nuclease in piRNA biogenesis. Nature 491(7423):279-283. 147. Mohn F, Handler D, & Brennecke J (2015) Noncoding RNA. piRNA-guided slicing specifies transcripts for Zucchini-dependent, phased piRNA biogenesis. Science 348(6236):812-817. 148. Nishimasu H, et al. (2012) Structure and function of Zucchini endoribonuclease in piRNA biogenesis. Nature 491(7423):284-287. 149. Saito K, et al. (2006) Specific association of Piwi with rasiRNAs derived from retrotransposon and heterochromatic regions in the Drosophila genome. Genes Dev 20(16):2214-2222. 150. Gunawardane LS, et al. (2007) A slicer-mediated mechanism for repeat-associated siRNA 5' end formation in Drosophila. Science 315(5818):1587-1590. 151. Hussain M & Asgari S (2010) Functional analysis of a cellular microRNA in insect host-ascovirus interaction. J Virol 84(1):612-620.

36 Chapter 1: General Introduction

152. Hussain M, et al. (2012) West Nile virus encodes a microRNA-like small RNA in the 3' untranslated region which up-regulates GATA4 mRNA and facilitates virus replication in mosquito cells. Nucleic Acids Res 40(5):2210-2223. 153. Besnard-Guerin C, Jacquier C, Pidoux J, Deddouche S, & Antoniewski C (2015) The cricket paralysis virus suppressor inhibits microRNA silencing mediated by the Drosophila Argonaute-2 protein. PLoS One 10(3):e0120205. 154. Singh CP, Singh J, & Nagaraju J (2012) A baculovirus-encoded MicroRNA (miRNA) suppresses its host miRNA biogenesis by regulating the exportin-5 cofactor Ran. J Virol 86(15):7867-7879. 155. Bryant B, Macdonald W, & Raikhel AS (2010) microRNA miR-275 is indispensable for blood digestion and egg development in the mosquito Aedes aegypti. Proc Natl Acad Sci U S A 107(52):22391-22398. 156. Hussain M, Walker T, O'Neill SL, & Asgari S (2013) Blood meal induced microRNA regulates development and immune associated genes in the Dengue mosquito vector, Aedes aegypti. Insect Biochem Mol Biol 43(2):146-152. 157. Wu YL, et al. (2011) A non-coding RNA of insect HzNV-1 virus establishes latent viral infection through microRNA. Sci Rep 1:60. 158. van Rij RP, et al. (2006) The RNA silencing endonuclease Argonaute 2 mediates specific antiviral immunity in Drosophila melanogaster. Genes Dev 20(21):2985-2995. 159. Korber S, Shaik Syed Ali P, & Chen JC (2009) Structure of the RNA-binding domain of Nodamura virus protein B2, a suppressor of RNA interference. Biochemistry 48(11):2307-2309. 160. Qi N, et al. (2011) RNA binding by a novel helical fold of b2 protein from wuhan nodavirus mediates the suppression of RNA interference and promotes b2 dimerization. J Virol 85(18):9543-9554. 161. van Mierlo JT, et al. (2012) Convergent evolution of argonaute-2 slicer antagonism in two distinct insect RNA viruses. PLoS Pathog 8(8):e1002872. 162. Obbard DJ, Jiggins FM, Halligan DL, & Little TJ (2006) Natural selection drives extremely rapid evolution in antiviral RNAi genes. Curr Biol 16(6):580-585. 163. Le Thomas A, et al. (2014) Transgenerationally inherited piRNAs trigger piRNA biogenesis by changing the chromatin of piRNA clusters and inducing precursor processing. Genes Dev 28(15):1667- 1680. 164. Kazazian HH, Jr. (2004) Mobile elements: drivers of genome evolution. Science 303(5664):1626-1632. 165. Cerutti H & Casas-Mollano JA (2006) On the origin and functions of RNA-mediated silencing: from protists to man. Curr Genet 50(2):81-99. 166. Roger AJ & Hug LA (2006) The origin and diversification of eukaryotes: problems with molecular phylogenetics and molecular clock estimation. Philos Trans R Soc Lond B Biol Sci 361(1470):1039- 1054. 167. Lewis SH, Salmela H, & Obbard DJ (2016) Duplication and Diversification of Dipteran Argonaute Genes, and the Evolutionary Divergence of Piwi and Aubergine. Genome Biol Evol 8(3):507-518. 168. Scott JC, et al. (2010) Comparison of Dengue Virus Type 2-Specific Small RNAs from RNA Interference-Competent and -Incompetent Mosquito Cells. Plos Neglect Trop D 4(10). 169. Hain D, et al. (2010) Natural Variation of the Amino-Terminal Glutamine-Rich Domain in Drosophila Argonaute2 Is Not Associated with Developmental Defects. Plos One 5(12). 170. Campbell CL, Black WC, Hess AM, & Foy BD (2008) Comparative genomics of small RNA regulatory pathway components in vector mosquitoes. Bmc Genomics 9. 171. Mukherjee K, Campos H, & Kolaczkowski B (2013) Evolution of Animal and Plant Dicers: Early Parallel Duplications and Recurrent Adaptation of Antiviral RNA Binding in Plants. Mol Biol Evol 30(3):627-641. 172. Vodovar N, et al. (2012) Arbovirus-derived piRNAs exhibit a ping-pong signature in mosquito cells. PLoS One 7(1):e30861. 173. Schnettler E, et al. (2013) Knockdown of piRNA pathway proteins results in enhanced Semliki Forest virus production in mosquito cells. J Gen Virol 94(Pt 7):1680-1689. 174. Miesen P, Ivens A, Buck AH, & van Rij RP (2016) Small RNA Profiling in Dengue Virus 2-Infected Aedes Mosquito Cells Reveals Viral piRNAs and Novel Host miRNAs. PLoS Negl Trop Dis 10(2):e0004452.

37

Chapter 2

On the importance of fly genetic background

38 Chapter 2: On the importance of fly genetic background

To study the potential impact of viral piRNAs production in Drosophila antiviral response, it is necessary to consider the effect of different environmental factors that play a role on immune response, as fly infection with bacteria, co-infection with other viruses, temperature, diet, among others. Some of these environmental factors can be controlled in the laboratory, and allow for a better interpretation of the results when studying the immune response of the insect. The impact of some other factors, like the genetic background, are less known. In 1994, Hirsch et al.(1) showed a significant difference in behavior between two heterogenic strains of Drosophila melanogaster when studying impact of early experience on brain development. Following this observation, the concept of the genetic background as an important factor affecting the outcome of biological phenomena was formulated. In the nature as in the laboratory a range of different genetic backgrounds are found. This variability is related to evolution and chromosome rearrangements. Only few analyses report the real impact of the genetic background on phenomena as stress (2, 3), lifespan (4, 5) or pigmentation (6, 7). The most compelling was performed on the gene Indy, first shown to confer longer lifespan to flies (8), only to demonstrate years later that the effect on lifespan disappeared when the genetic background effect was removed (4). The genetic background effect is of crucial importance when analyzing immune response in insect, as exemplified by the case of bacterial infection in D. melanogaster (9). The authors described 16 immune genes that have polymorphisms leading to genetic variation for resistance and tolerance to the same bacterial infection.

As the main objective of my work was to determine whether the piRNA pathway displays an antiviral effect in Drosophila melanogaster, to lead a pertinent study I had to compare flies for which differences in environmental factors and genetic background had been erased. This chapter explains the technical procedures followed to homogenize the flies used in my studies.

39 Chapter 2: On the importance of fly genetic background

Protocols overview

Viruses checking and cleaning (estimated time: 15 days)

The purpose of this first step is to detect and clean the majority of the viruses infecting Drosophila melanogaster. Drosophila laboratory stocks are commonly infected with Drosophila C virus (DCV), Drosophila A virus (DAV), or Nora virus, described as persistent in flies (10-12), but not vertically transmitted. These viral infections produce a permanent activation of the RNAi-mediated antiviral response from which the effects on the biology of the fly are ignored. To clear viruses infecting the wild-type and mutant flies stocks, I followed the egg-bleaching protocol as described in Merkling et al. (13). Briefly the protocol consist of: 1) Construct a cage with an apple juice plate and add yeast paste to increase the efficiency of this procedure. Put around 50 flies in the cage and incubate at 25°C overnight in order to let them lay eggs. 2) Collect eggs with a sterile brush to avoid genotype mixing and contaminations. Place the collected eggs on a nylon filter to wash them in demineralized water. 3) Bleach the eggs with a 50/50 solution of household bleach during 10 minutes, the timing of this step is important because it can compromise the embryos viability. Wash the bleach from eggs by rinsing 5 min in fresh water three times. 4) Collect the cleaned eggs from the nylon filter and place them on a piece of filter paper. Place this paper in a vial containing standard Bloomington media and incubate at 25°C until adults emerge, approximately 10 days. To confirm the absence of viruses in the newly emerged flies, perform RNA extraction followed of RT-PCR on different viruses (Table 1, list of primers used for the detection of each virus).

40 Chapter 2: On the importance of fly genetic background

Viruses Primers (5’-3’) Size expected GTTGCCTTATCTGCTCTG DCV 1195 pb CGCATAACCATGCTCTTCTG CCAGATCACCCGAACTGAAT FHV1 933 pb CGACCGATGGAAACCACAGTTC CGTCACAACAACCCAAACAG FHV2 700 pb CCACCGCTAGAACACCATCT CGTCGAGTATTAGCGGCTTC DXV 490 pb a GCCCTACGGAGTCCACATTA TCAAGGCATTCGATCCCTAC DXV 519 pb b CCATACGCGTTGTGTATTCG ATGGCGCCAGTTAGTGCAGACCT Nora 338 pb CCTGTTGTTCCAGTTGGGTTCGA GACCTTCTCCGGCCTCAGCG CrPv 518 pb GACCTAGGGTTGCTTCAGGTGC AGAGTGGCTGTGAGGCAGAT DAV 246 pb GCCATCTGACAACAGCTTGA

bacteria TGGTCCAATAAGTGATGAAGAAAC Wolbachia1 610 pb AAAAATTAAACGCTACTCCA TTTGCAAGTGAAACAGAAGG Wolbachia 784 pb 2 GCTTTGCTGGCAAAATGG

Table 1. Primers used to detect virus and Wolbachia infection in flies

Control of Wolbachia infection in flies (estimated time: 1 month)

Wolbachia is an endosymbiont infecting a high proportion of insects (14). Several studies show that the presence of Wolbachia in Drosophila melanogaster induces protection against DCV, Nora and Flock House virus (FHV) infections (15). In addition to its role as resistant factor against infection, Wolbachia impacts fly development and behavior according to the sex of the individual (16). The presence of Wolbachia on fly stocks can be detected by sequencing the DNA extracted from flies and the elimination of the bacteria is performed via a tetracycline treatment of flies. The main steps, according to Merkling et al. 2015 (13), are as follow:

41 Chapter 2: On the importance of fly genetic background

1) Transfer the flies to tubes containing Bloomington media with tetracycline (0,25mg.ml-1) and let them lay eggs during 3 days. Remove the parent flies and incubate the tube at 25°C. 2) When progeny emerge, transfer them in a new tube containing Bloomington media and tetracycline, and repeat the previous step up to F3. 3) Transfer the F3 flies to tubes with fresh Bloomington media without tetracycline. 4) To verify Wolbachia elimination, extract total DNA from flies and perform a PCR with primers specific for Wolbachia ribosomal RNA (16S rRNA).

The genetic background: introgression protocol (time estimated: 6 months)

All the different piRNA mutants available in the scientific community were generated with different genetic tools (EMS mutagenesis, P element insertion) and in different genetic backgrounds (Table 2). To study the potential impact of piRNA mutant flies on viral immunity I wanted to compare the susceptibility of these flies and the wild- type flies to viral infections. It was then necessary to eliminate the effect of genetic background as well as to homogenize mutants with respect to different gene alleles that can confer resistance to viral infection, such as Pastrel for DCV and CrPV infection (17, 18) or Ref(2)P for Sigma infection (19, 20). The introgression principle was used to bring all the flies into the same genetic background. Introgression allows transferring an allelic version of one or more genes from a donor to a recipient organism (21), here from a piRNA mutant fly to our wild-type fly. Based on described studies, I designed a protocol in three steps to clean the genetic background of piRNA pathway mutant flies (21, 22):

1) First, design oligonucleotide primers specific to the mutation of interest. This step is important to follow the mutation during all the introgression procedure (Table 2). 2) Begin the introgression protocol by selecting 5 males carrying the mutation, cross them with female flies w1118 which have a balancer. Select the F1 males that carry the mutation of interest and the balancer coming from the female (Fig. 6A). 3) Start the first step of the introgression: cross the F1 progeny male with w1118 virgin female. Incubate the tube during 10 days at 25°C. When the adults emerge, select F2 virgin

42 Chapter 2: On the importance of fly genetic background females that show the phenotype corresponding to the balancer used in the previous step (Fig. 6B). 4) Second step of the introgression backcross cycle: Cross individual F2 virgin female with individual w1118 male to form couples, let the flies lay eggs during 3 days at 25°C (Fig. 6C) Collect all females in individual eppendorf tubes and extract DNA following the Squishing buffer procedure: smash flies in Squishing buffer (10mM Tris-HCl pH8, 1mM EDTA, 25mM NaCl and 200 g/ml Proteinase K), incubated during 30 min at 37°C and stop the reaction by heating at 95°C during 2 min. Then perform a PCR with the specific oligonucleotide primers for the mutation and sequence all the amplicons to identify mutations. Add negative control to the PCR (without template), a negative control containing w1118 flies for the sequencing, and a positive control that is the original mutant fly. Based on the sequencing results, select four lines coming from isofemales carrying the mutation. In parallel, incubated the embryos coming from the selected isolines at 25°C for 10 days. When adults emerge select virgin females and restart all the procedure 10 times. It is assumed that 10 backcrosses are needed to get a cleaned genetic background (Fig. 6D). 5) Addition of a balancer: Balancer chromosomes keep homozygous lethal or sterile mutations from being lost from a population and they prevent multiple alleles on the same chromosome from being separated by meiotic recombination. Take F1 female of your selected isolines and cross them with w1118 male carrying the balancer. Let the tube incubate at 25°C and when adult emerge transfer them in new tube containing fresh Bloomington media to amplify the fly stock (Fig. 6E). 6) After 10 backcrosses select male and virgin female from the same isoline, and cross them (Fig. 7F). When flies laid eggs, extract DNA from both adult male and female, to select the tube containing a couple carrying the mutation. Let the tube at 25°C for approximately 10 days. 7) To be certain that the balanced flies have the mutation of interest, extract DNA via the Squishing buffer protocol, perform a PCR with specific oligonucleotide primers and sequence the amplicon to identify the double peak.

43 Chapter 2: On the importance of fly genetic background

A + X aub a ; ; 3 x ++; ; Y Cyo a a TM3 parental strain

B

+ aub 3 ; ; a x +++; ; + Ya TM3

C aub + +++; ; x + ; ; * + TM3

D aub + ; + ; + x + ; ; + * +

x10 aub + ; ; + +

E + aub * + ; ; + x + ; ; + Cyo +

F aub aub + ; ; + x + ; ; + CyO CyO *

aub + ; ; + CyO backcrossed strain

Figure 6. Experimental design for the backcross protocol Steps followed to introgress the Aubergine (Aub) mutant flies in the wild-type background. The same steps were followed to introgress Zucchini mutant flies. For Agornaute-3 mutants, since the gene is located in the third chromosome, the first step (A) of the introgression was done using + ; +/CyO ; + flies, and the final stock balancing step (F) was done using + ; +/TM3 ; + balancer line. Aside from these changes, the same general crossing scheme was followed. The a indicates parental Aubergine chromosomes. The +;+;+ correspond to wild- type flies, here the w1118 genotype. The * corresponds to genome identification by PCR and DNA sequencing.

44 Chapter 2: On the importance of fly genetic background

The piRNA pathway mutant flies: selection, characteristics and routine works.

PIWI PAZ PIWI 843 aa 0 100 200 300 400 500 600 700 800 piwi1 piwi2 insertion P{PZ} in exon1 insertion P{ry11} in exon4 Aubergine PAZ 866 aa PIWI

0 100 200 300 400 500 600 700 800 QC42 HN2 Y93 Stop Q622 Stop Argonaute3 867 aa PAZ PIWI

0 100 200 300 400 500 600 700 800

t3 t2 W452Stop deletion N513 to D523 Zucchini PDLc 253aa

0 100 200 SG63 HM27 H168 Y Q5 Stop

Figure 7. Scheme of PIWI subfamily and Zucchini protein domains and the mutations used in this work.

PIWI, Aubergine and Argonaute-3 proteins belong to the PIWI subfamily of Argonaute protein family. They harbor a PAZ (Piwi-Argonaute-Zwille) domain, with RNA binding capacity, and a PIWI domain, that catalyzes the sequence specific recognition and cleavage of the target RNA molecule. Zucchini protein belongs to phospholipase D (PLD) family of proteins, contains a PLD like domain and has endoribonuclease activity. Both mutations on PIWI protein, piwi1 and piwi2, are produced by the insertion of transposable element at positions 154 and 410 respectively, producing a truncated protein. Mutations on Aubergine (Aub), Argonaute-3 (Ago-3) and Zucchini (Zuc) genes were generated by ethyl methanesulfatone mutagen treatment. In AubQC42, AubHN2, Ago-3t3, and ZucHM27 mutant alleles the original amino acids were substituted by STOP codons. In Ago-3t2 mutant allele the deletion between the positions 513 and 523, produced a truncated protein. In ZucSG63 mutant allele the replacement of histidine (H) by a Tyrosine (Y), led to a hypomorphic mutant.

I worked with four different mutants; three of them are mutants for the PIWI proteins Aubergine (Aub), Argonaute-3 (Ago-3) and PIWI, and one for the exonuclease Zucchini (Zuc). All of these mutants were generated with different mutagens and in different wild-type background (Table 2) before the introgression steps. These flies are not viable in homozygosis, thus obtaining piRNA pathway mutants necessitated a crossing between heterozygote mutants for different alleles. Different mutant alleles are available for the same proteins; according to the literature (23, 24) I selected (Fig. 7):

45 Chapter 2: On the importance of fly genetic background

- AubHN2 and AubQC42; first detected during a study where all the sterile mutants for the chromosome 2 were selected (25). - Ago3t2 and Ago3t3; characterization of these mutants in Li et al. 2009 (26) - Piwi1 and Piwi2; mutants produced and described in Lin and Spradling 1997 (27) - ZucHM27 and ZucSG63; described in Pane et al. 2007 (28)

Mutants Genetic Mutagens Genotype Oligonucleotides primers (5’-3’) name background Ethyl CGGCTTGCCTTCTCTCGCTT ZucchiniHM27 +;cnbwZucHM27/Cyo;+ +;Cnbw;+ methanesulfonate TTCGAATGGGCAAGCGCATG Ethyl AAACGTGGCTGTGAGTTTGT ZucchiniSG63 ywc;prcpxspZucSG63/Cyo;+ ywc;prcpxsp;+ methanesulfonate TTTGGCGGATTCAATAAAGC Ethyl TACAAGAGTTTCGCCAAATCA Argonaute-3t2 Bw1;st1Ago-3t2/TM6B; Tb+ Bw1;st1;Tb+ methanesulfonate TTGCAGCATAACGATCATCTC Ethyl TACAAGAGTTTCGCCAAATCA Argonaute-3t3 Bw1;st1Ago-3t3/TM6B; Tb1 Bw1;st1;Tb1 methanesulfonate TTGCAGCATAACGATCATCTC Ethyl CTAGATTAACCCCAACTAAGC AubergineHN2 +;AubHN2cn1bw1/Cyo;+ +;cn1bw1;+ methanesulfonate GTGGAGAAGTAGCGGAAAGAC w1118;cn1bw1;P Ethyl w1118;AubQC42cn1bw1/Cyo;P TTCGAACCCAGCTTCTGTGAG AubergineQC42 (sevRasl.v12)F methanesulfonate (sevRasI.v12)FK1 ATACAAGAAAGACCGTCGCAG K1 Piwi1 P-element activity w1118;P(PZ)Piwi1/Cyo;+ w1118;P(PZ) ;+ NA Piwi2 P-element activity w1118;P(ry11)Piwi2/Cyo+ ;+ w1118;P(ry11);+ NA Table 2. piRNA mutants description

After the introgression procedure, we chose three isolines for each mutant. The behavior of each isoline was tested by measuring susceptibility to viral infection. I used two different viruses, DCV and DXV, to inject flies and compared the survival between w1118, the original parental strains and the three isolines for each mutant. Figure 8 shows the survival curve for all the mutants backcrossed in the w1118 background. All the isolines tested display a similar susceptibility to viral infection. For Argonaute-3 mutants infected with DCV the isolines are more resistant to infection when compared to the parental strain, but behave similarly to the w1118 strain. For Aubergine mutants the same behavior is observed: the isolines are more susceptible to DCV infection when compared to parental strains (Fig. 8B1) but display the same sensitivity as w1118 flies. Interestingly, for Zucchini mutants (Fig. 8C1 and C2) the three isolines present the same behavior, and display an increased resistance to viral infection with DCV and DXV than w1118 .

As all the isolines tested behave similarly, I selected the isoline 2 for Ago-3 and isolines 1 for both Aub and Zuc mutants for the rest of the study.

46 Chapter 2: On the importance of fly genetic background

For the Piwi mutants used in the study, it was not possible to apply the introgression protocol. The major issue was related to the primers designed to follow the mutation. I designed primers to detect the piwi1 and piwi2 P-element insertion in piwi gene (Fig. 9A and B) but it was not possible to obtain a clean amplicon, even with different combinations of primers (Fig. 9C and D). I used an alternative way to verify the presence of the mutation, to observe the phenotype induced by the mutation. This phenotype corresponds to atrophied ovaries, which are visible after ovaries dissection under a magnifying glass (Fig. 9E).

A1 DCV A2 DXV

100 100

80 80

t2/t3 60 60

40

Ago3 40 survival (%)

20 20

0 0 02468 024681012 day post-infection day post-infection B1 B2

100 100

80 80

60 60 HN2/QC42

40 40 Aub survival (%)

20 20

0 0 0246810024681012 day post-infection day post-infection C1 C2

100 100

80 80

60 60

HM27/SG63 40 40 survival (%) Zuc 20 20

0 0 02468101202468101214 day post-infection day post-infection

Figure 8. Survival of backcrossed Ago-3, Aub and Zuc mutant flies compared to wild-type and parental strains.

The backcrossed Ago-3, Aub and Zuc mutant lines, their respective parental mutant lines and wild-type (w1118) flies were inoculated with 2 TCID50 of DCV or 100 TCID50 of DXV and fly survival was determined. Dashed

47 Chapter 2: On the importance of fly genetic background lines correspond to the control of injection, Tris. Full lines correspond to the viral injection. Blue lines represent the mutant flies in the w1118 genetic background. Pink lines correspond to the parental strain and black lines to the w1118 strain.

48 Chapter 2: On the importance of fly genetic background A piwi1 3’ piwi1 5’

1000 3000 5000 7000 9000 11000 13000 15000 17000

lac Z Hsp70 pESS7 rosy wwpUCB

p5’ p3’

P {PZ}

lac ZPI.PZ ry+t7.2 amp R kan R

B piwi2 5’ piwi2 3’

1000 3000 5000 7000 9000 11000 13000

rosy w pBR322 w

p5’ p3’

P {ry11}

ry+t7.2 amp R

C piwi1 5’ piwi1 3’

1118 1118 w w male 1male 2 male 1 femalefemale 1 2 femalefemale 1 2 male 2

D piwi2 5’ piwi2 3’

1118 1118 w w male 1 male 1male 2 femalefemale 1 2 male 2 femalefemale 1 2 E

x128 x128

Figure 9. Piwi mutant alleles. Map of the P-element inserted in piwi1 (A) and piwi2 (B). The red lines correspond to the piwi gene and the arrowheads to its orientation. The blue, purple and orange arrows correspond to the specific primers designed to

49 Chapter 2: On the importance of fly genetic background follow the mutation. PCR reaction on mutant flies was analyzed on 1% agarose gels. For piwi1 (C) and piwi2 (D), all the primers designed produced a non-specific amplification. The same amplification pattern is observed in w1118 used as a positive control. (E) Brightfield image of ovaries from w1118 strains (left) and piwi mutants (right). Note the atrophy in the piwi mutants.

50 Chapter 2: On the importance of fly genetic background

Bibliography

1. Hirsch HV & Tompkins L (1994) The flexible fly: experience-dependent development of complex behaviors in Drosophila melanogaster. J Exp Biol 195:1-18. 2. Greenberg AJ, Moran JR, Coyne JA, & Wu CI (2003) Ecological adaptation during incipient speciation revealed by precise gene replacement. Science 302(5651):1754-1757. 3. Hoffmann AAaW, Y. (2008) Detecting genetic responses to environnemental change. Nature reviews Genetics 9(6):421-432. 4. Toivonen JM, et al. (2007) No influence of Indy on lifespan in Drosophila after correction for genetic and cytoplasmic background effects. PLoS Genet 3(6):e95. 5. Neretti N, et al. (2009) Long-lived Indy induces reduced mitochondrial reactive oxygen species production and oxidative damage. Proc Natl Acad Sci U S A 106(7):2277-2282. 6. Jeong S, et al. (2008) The evolution of gene regulation underlies a morphological difference between two Drosophila sister species. Cell 132(5):783-793. 7. Rebeiz M, et al. (2009) Evolution of the tan locus contributed to pigment loss in Drosophila santomea: a response to Matute et al. Cell 139(6):1189-1196. 8. Rogina B, Reenan RA, Nilsen SP, & Helfand SL (2000) Extended life-span conferred by cotransporter gene mutations in Drosophila. Science 290(5499):2137-2140. 9. Lazzaro BP, Sceurman BK, & Clark AG (2004) Genetic basis of natural variation in D. melanogaster antibacterial immunity. Science 303(5665):1873-1876. 10. Golubovsky MD & Plus N (1982) Mutability studies in two Drosophila melanogaster isogenic stocks, endemic for C picornavirus and virus-free. Mutat Res 103(1):29-32. 11. Plus N, Croizier G, Jousset FX, & David J (1975) Picornaviruses of laboratory and wild Drosophila melanogaster: geographical distribution and serotypic composition. Ann Microbiol (Paris) 126(1):107- 117. 12. Habayeb MS, Ekengren SK, & Hultmark D (2006) Nora virus, a persistent virus in Drosophila, defines a new picorna-like virus family. J Gen Virol 87(Pt 10):3045-3051. 13. Merkling SH & van Rij RP (2015) Analysis of resistance and tolerance to virus infection in Drosophila. Nat Protoc 10(7):1084-1097. 14. Werren JH & Windsor DM (2000) Wolbachia infection frequencies in insects: evidence of a global equilibrium? Proc Biol Sci 267(1450):1277-1285. 15. Teixeira L, Ferreira A, & Ashburner M (2008) The bacterial symbiont Wolbachia induces resistance to RNA viral infections in Drosophila melanogaster. PLoS Biol 6(12):e2. 16. Reynolds KT, Thomson LJ, & Hoffmann AA (2003) The effects of host age, host nuclear background and temperature on phenotypic effects of the virulent Wolbachia strain popcorn in Drosophila melanogaster. Genetics 164(3):1027-1034. 17. Magwire MM, et al. (2012) Genome-wide association studies reveal a simple genetic basis of resistance to naturally coevolving viruses in Drosophila melanogaster. PLoS Genet 8(11):e1003057. 18. Martins NE, et al. (2014) Host adaptation to viruses relies on few genes with different cross-resistance properties. Proc Natl Acad Sci U S A 111(16):5938-5943. 19. Fleuriet A (1988) Maintenance of a Hereditary Virus - the Sigma-Virus in Populations of Its Host, Drosophila-Melanogaster. Evol Biol 23:1-30. 20. Contamine D, Petitjean AM, & Ashburner M (1989) Genetic-Resistance to Viral-Infection - the Molecular-Cloning of a Drosophila Gene That Restricts Infection by the Rhabdovirus-Sigma. Genetics 123(3):525-533. 21. Bai JY, Zhang Q, & Jia XP (2006) Comparison of different foreground and background selection methods in marker-assisted introgression. Yi Chuan Xue Bao 33(12):1073-1080. 22. Ryder E, et al. (2004) The DrosDel collection: a set of P-element insertions for generating custom chromosomal aberrations in Drosophila melanogaster. Genetics 167(2):797-813. 23. Brennecke J, et al. (2007) Discrete small RNA-generating loci as master regulators of transposon activity in Drosophila. Cell 128(6):1089-1103.

51 Chapter 2: On the importance of fly genetic background

24. Vagin VV, et al. (2006) A distinct small RNA pathway silences selfish genetic elements in the germline. Science 313(5785):320-324. 25. Schupbach T & Wieschaus E (1991) Female sterile mutations on the second chromosome of Drosophila melanogaster. II. Mutations blocking oogenesis or altering egg morphology. Genetics 129(4):1119- 1136. 26. Li C, et al. (2009) Collapse of germline piRNAs in the absence of Argonaute3 reveals somatic piRNAs in flies. Cell 137(3):509-521. 27. Lin H & Spradling AC (1997) A novel group of pumilio mutations affects the asymmetric division of germline stem cells in the Drosophila ovary. Development 124(12):2463-2476. 28. Pane A, Wehr K, & Schupbach T (2007) zucchini and squash encode two putative nucleases required for rasiRNA production in the Drosophila germline. Dev Cell 12(6):851-862.

52

Chapter 3

The piRNA pathway is not required for antiviral defense in Drosophila melanogaster

Published as: Marine Petit, Vanesa Mongelli, Lionel Frangeul, Hervé Blanc, Francis Jiggins, Maria-Carla Saleh. Proceeding National Academy of Science USA (PNAS), 113(29), doi: 10.1073.

53

piRNA pathway is not required for antiviral defense in Drosophila melanogaster

Marine Petita,b, Vanesa Mongellia,1, Lionel Frangeula, Hervé Blanca, Francis Jigginsc, and Maria-Carla Saleha,1 aViruses and RNA Interference, Institut Pasteur, CNRS Unité Mixte de Recherche 3569, 75724 Paris Cedex 15, France; bSorbonne Universités, Université Pierre et Marie Curie, Institut de Formation Doctorale, 75252 Paris Cedex 05, France; and cDepartment of Genetics, University of Cambridge, Cambridge CB2 3EH, United Kingdom

Edited by Anthony A. James, University of California, Irvine, CA, and approved May 28, 2016 (received for review May 18, 2016) Since its discovery, RNA interference has been identified as involved Production of piRNAs is Dicer-independent and relies mainly in many different cellular processes, and as a natural antiviral on the activity of Piwi proteins, a subclass of the Argonaute family response in plants, nematodes, and insects. In insects, the small (13). Primary piRNAs are processed from single-stranded RNA interfering RNA (siRNA) pathway is the major antiviral response. In precursors, which are transcribed mostly from chromosomal loci recent years, the Piwi-interacting RNA (piRNA) pathway also has consisting mainly of remnants of TE sequences, termed piRNA been implicated in antiviral defense in mosquitoes infected with clusters (14). In D. melanogaster, the cleavage of primary piRNA arboviruses. Using Drosophila melanogaster and an array of viruses precursors and generation of 5′ end of mature piRNAs were re- that infect the fruit fly acutely or persistently or are vertically trans- cently linked to Zucchini endonuclease (Zuc) activity (15–18). The mitted through the germ line, we investigated in detail the extent cleaved precursor is loaded into Piwi family Argonaute proteins to which the piRNA pathway contributes to antiviral defense in Piwi or Aubergine (Aub) and then trimmed by a still-unknown adult flies. Following virus infection, the survival and viral titers of nuclease to reach its final length, which can vary from 24 to 30 nt. Piwi, Aubergine, Argonaute-3, and Zucchini mutant flies were sim- For example, piRNAs have a size centered around 25 nt in the ilar to those of wild type flies. Using next-generation sequencing of fruit fly, but centered around 28 nt in Aedes mosquitoes. After small RNAs from wild type and siRNA mutant flies, we showed that trimming, piRNAs undergo a final 3′ end 2′-O-methyl nucleotide no viral-derived piRNAs were produced in fruit flies during different modification catalyzed by the methyltransferase Hen1 (11, 19) to types of viral infection. Our study provides the first evidence, to our become mature piRNAs. Primary piRNAs harbor a 5′ uridine bias knowledge, that the piRNA pathway does not play a major role in (U1) and are usually antisense to TE transcripts (20). The cleavage antiviral defense in adult Drosophila and demonstrates that viral- of complementary active transposon RNA by primary piRNAs – derived piRNA production depends on the biology of the host virus loaded into Aub proteins initiates the second biogenesis round combination rather than being part of a general antiviral process and leads to the production of secondary piRNAs that are loaded in insects. in Argonaute-3 protein (Ago-3). During this ping-pong or amplification cycle, Aub and Ago-3 proteins loaded with secondary antiviral RNAi | insect | virus | small RNA | piRNA piRNAs mediate the cleavage of complementary RNA to generate new secondary piRNAs identicalinsequencetothepiRNAthat hree main small RNA-based silencing pathways have been de- initiated the cycle. Because target slicing by Piwi proteins occurs Tscribed in animals: the microRNA (miRNA), small interfering RNA (siRNA), and Piwi-interacting RNA (piRNA) pathways. These Significance pathways are involved in the regulation of different key biological processes, including organism development (1), defense against viral In animals, one of the main forms of RNA interference involves pathogens (2), and genome protection from transposable element Piwi-interacting RNAs (piRNAs),whichprotectgenomesagainst (TE) activity (3). Despite their different biological functions, all three the activity of transposable elements. Several groups have recently pathways use small RNAs (from 21 to 30 nt) to guide the sequence- described piRNAs from viruses in mosquitoes and suggested their specific recognition of target sequences by an Argonaute protein involvement in antiviral defense. To understand the extent to family member. which the piRNA pathway contributes to antiviral defense in in- The siRNA pathway is a major antiviral defense mechanism in sects, we used Drosophila melanogaster and different viruses. Us- insects (4–10). This pathway is triggered in host cells by the presence ing high-throughput sequencing, we were unable to find any of viral double-stranded RNA (vdsRNA) derived from viral repli- evidence of piRNAs from viruses in flies. Furthermore, flies lacking cation intermediates, genomes of dsRNA viruses, overlapping components of the piRNA pathway were not unusually susceptible transcripts of DNA viruses, or secondary viral genome structures. In to viral infection. Taken together, our results indicate that funda- Drosophila melanogaster,vdsRNAisrecognizedandprocessedinto mental differences have arisen between the antiviral defenses of 21-nt-long viral siRNAs (vsiRNAs) by Dicer-2 protein (Dcr-2), a flies and mosquitoes since theylastsharedacommonancestor type III RNA endonuclease. Once diced, double-stranded vsiRNAs >200 Mya. are first loaded into the RNA-induced silencing complex (RISC), then unwound, and one strand is ejected from the complex. Single- Author contributions: M.P., V.M., and M.-C.S. designed research; M.P. and H.B. performed stranded vsiRNAs are finally methylated in their 3′ end nucleotide research; F.J. contributed new reagents/analytic tools; M.P., V.M., L.F., and M.-C.S. analyzed 2’-OH group by Hen1 methyltransferase (11). Through the activity data; and V.M. and M.-C.S. wrote the paper. of its main catalytic component, the RNase H type nuclease The authors declare no conflict of interest. Argonaute-2 protein (Ago-2), RISC guides the sequence-specific This article is a PNAS Direct Submission. recognition and cleavage of viral target RNAs (12), leading to Freely available online through the PNAS open access option. viral genome degradation and, consequently, restriction of viral Data deposition: The sequence reported in this paper has been deposited in the Na- tional Center for Biotechnology Information’s Sequence Read Archive (accession no. replication. PRJNA302884). The piRNA pathway has been identified as the main protection 1To whom correspondence may be addressed. Email: [email protected] or carla. mechanism against the activity of TEs in animal genomes. The [email protected]. biogenesis of piRNAs involves twosteps,theprimaryprocess- This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. ing mechanism and the secondaryamplificationmechanism. 1073/pnas.1607952113/-/DCSupplemental. www.pnas.org/cgi/doi/10.1073/pnas.1607952113 PNAS Early Edition | 1of10

6 more work is needed to fully understand the extent to which the

A ) 5.103 3 piRNA pathway contributes to antiviral defense not only in mos- – 2 quitoes, but also in the context of other insect virus interactions. 1000 D. melanogaster is a powerful insect model for studying virus–host 800 counts (x10 interactions (32, 33). Mutants for virtually all genes encoded by the 600 0 5 1015 20 25 30 genome of the fruit fly are publicly available, and Drosophila viruses read counts read distance 400 from several families have been isolated, their genomes sequenced,

200 ACGT and their biological characteristics described. These include Dro- 0 18 19 20 21 22 23 24 25 26 27 2829 30 31 ACGT sophila Cvirus[DCV;(+)ssRNA Dicistroviridae], Drosophila Xvirus 1 5 10 15 20 25 sequence length sequence coordinates [DXV; bisegmented dsRNA, Birnaviridae], Drosophila Avirus [DAV; (+)ssRNA, unclassified, related to Permutotetraviridae], Nora B 70 1.103 virus [NoraV; (+)ssRNA, unclassified, related to Picornaviridae], and 50 D. melanogaster sigma virus [DMelSV, (−)ssRNA, Rhabdoviridae]

counts 30 (34). Infection of flies with viruses from other insect hosts, such as 200 10 SINV, a mosquito-infecting arbovirus; Flock house virus [FHV; 5 1015 20 25 30 bisegmented (+)ssRNA, Nodaviridae], originally isolated from the read counts read 100 distance grass grub Costelytra zealandica (35), and the rice stem borer larvae-

ACGT isolated Invertebrate iridescent virus 6 [IIV-6; dsDNA, Iridoviridae] 0 18 19 20 21 22 23 24 25 26 27 28 29 30 (36), among others, is also possible under laboratory conditions. ACGT 1 5 10 15 20 25 Despite the numerous molecular tools available to decipher sequence length sequence coordinates C antiviral responses in flies, and the fact that viral small RNAs with 35 2.103 the length of piRNAs were first reported in fly tissues (24), no 25 further work addressing the antiviral role of piRNAs has been 400 15

counts performed in Drosophila. Only two studies published before the 5 discovery of vpiRNA highlighted a functional link between piRNA 200 5 1015 20 25 30 pathway and antiviral defense in flies. Piwi mutant flies were found read counts distance to be more susceptible to both DXV and West Nile virus [WNV; 0 (+)ssRNA, Flaviviridae] infections, and Aub mutant flies were 18 19 20 21 22 23 24 25 26 27 28 29 30 sequence length found to be more susceptible to DXV (10, 37). ACGTACGT 1 5 10 15 20 25 sequence coordinates In the present work, we aimed to characterize the impact of the piRNA pathway on the fly antiviral response. We sought to un- Fig. 1. Loss of secondary piRNAs for Idefix TE in the Aubergine mutant derstand whether the viral-derived piRNAs are part of the general strains. (Left) Size distribution of β-eliminated small RNAs extracted from antiviral process, or whether their production depends on the 1118 w (A), Aub parental mutant strain (B), and backcrossed Aub (C)mutant biology of the host–virus combination. Our results indicate that – flies. (Right)Frequencymapofthedistancebetween2426 nt small RNAs the piRNA pathway does not play a major direct role in antiviral that mapped to opposite strands of the Idefix sequence. A peak is observed at position 10 for w1118,butnotforeitheroftheAub mutant strains. The defense in Drosophila, and that vpiRNAs are not produced in the relative nucleotide frequencies per position of the 24–26 nt small RNAs that fruit fly during different types of viral infection. We speculate that map the sense and antisense of the genome are shown in red and green, during speciation and diversification of the piRNA pathway respectively. The intensity varies in correlation with frequency. A nucleotide proteins in insects, the piRNA pathway evolved solely to repress bias (U1 and A10) is observed for w1118, but not for the Aub mutant strains. transposon activity in the fruit fly while expanding to an antiviral role in mosquitoes. between nucleotides 10 and 11, the complementary secondary Results piRNAs typically have a 10-nt overlap and contain an adenine at Isogenization and Characterization of piRNA Mutant Flies on the w1118 position 10 (A10) (14, 21). Isogenic Background. To reduce genetic background effects when Unlike the siRNA pathway that seems to be ubiquitously studying the impact of the piRNA pathway mutants on antiviral expressed in insect tissues, most experimental data indicate that response, we backcrossed Zuc, Aub,andAgo-3 mutants to wild type the piRNA pathway is active mainly in germ-line tissues. Never- (WT) flies (w1118)sotheywereinsimilargeneticbackgrounds(SI theless, endogenous piRNAs also have been identified in various Appendix,Fig.S1A). For each generation, we genotyped the flies by somatic tissues from fly, mouse, and macaque, as well as in mos- PCR to retain only those carrying the mutant allele (SI Appendix,Fig. quito head and thorax (22, 23). S1). After 10 backcrosses, we compared the phenotypes from the new The piRNA pathway was recently implicated in antiviral defense Aub (Fig. 1 and SI Appendix,Figs.S3andS4), Ago-3,andZuc (SI in insects. The antiviral activity of the piRNA pathway was first Appendix,Figs.S2–S4)backcrossedlineswiththeparentallinesby suggested in 2010, when viral small RNAs with the length of piRNAs performing small RNA deep sequencing and analyzing piRNA pro- were detected in Drosophila ovarian somatic sheet (OSS) cells (24). duction. Small RNAs ranging from 19 to 30 nt were recovered and Since then, work on the subject has centered exclusively on sequenced in mutant and WT flies, as well as in the parental mutant mosquito-arbovirus experimental systems. In Aedes mosquitoes and lines. Data analysis was centered on the following features: (i)overall cell lines, an expanded family of Piwi proteins is expressed in so- small RNA production, (ii)productionofpiRNAsfromtheTEIdefix matic tissues, and viral-derived piRNAs (vpiRNAs) are produced (Fig. 1 and SI Appendix,Fig.S2), (iii)productionofpiRNAsfromthe from the genomes of several arboviruses (23, 25–29). Functional germ-line piRNA cluster 42AB (SI Appendix,Fig.S3), and (iv)pro- links among the piRNA pathway, arbovirus replication, and duction of piRNAs from the somatic piRNA cluster Flamenco (SI vpiRNA production have been described as well. Depletion of Piwi-4 Appendix,Fig.S4). Fig. 1 B and C show that loss of Aub strongly protein was found to enhance replication of Semliki Forest virus impacted the secondary piRNA population from the Idefix TE se- [SFV; (+)ssRNA, Togaviridae]withoutinterferingwithvpiRNA quence. In addition, loss of Aub interrupted the piRNA ping-pong production in Aag2 cells (30), whereas both Piwi-5 and Ago-3 were cycle on the germ-line 42AB cluster (SI Appendix,Fig.S3C;lossof shown to be required for the biogenesis of piRNAs from Sindbis A10 bias). In contrast, the loss of Ago-3, which participates in the virus [SINV; (+)ssRNA, Togaviridae]inthesamecellline(31). ping-pong amplification cycle, produced piRNAs with a ping-pong Nevertheless, functional in vivo experimental data are scarce, and signature and the U1-A10 bias (SI Appendix,Figs.S3D and S4D)due

2of10 | www.pnas.org/cgi/doi/10.1073/pnas.1607952113 Petit et al.

A

B

C

Fig. 2. piRNA mutant flies are no more sensitive to viral infection than WT flies. Group of 20 flies control or piRNA mutants, Ago-3t2/t3, AubHN2/QC42 and Piwi1/2 were infected by injection with three different viruses: DCV (2 TCID50)(A), DXV (100 TCID50)(B), and SINV (5,000 PFU) (C). (Upper)Survivalwasmonitored daily. Each experiment was repeated three times. Data shown are mean ± SD. Dashed lines correspond to Tris injection to control the effect of injection on fly survival. Control (w1118) flies are shown in blue; mutant flies, in red. For Piwi1/2 flies, the dark-gray/light-gray lines correspond to the heterozygote control. Differences in survival between control and piRNA mutant flies were not statistically significant [log-rank (Mantel–Cox) test]. (Lower)Viraltiterwasde- termined for a group of five flies in triplicate for each genotype. The viral titration was done at 0, 2, and 4 dpi for DCV (A)andat0,3,and6dpiforDXV (B)andSINV(C). No significant difference (two-way ANOVA) between the different genotypes was observed.

Petit et al. PNAS Early Edition | 3of10

A 100 21pb 10 )

3 6 6 2 0 counts 2 0 5 10 15 20 25 30 distance 10 24-26pb 1 TA CG A T number of reads (x10 0 0 CG 18 19 20 21 22 23 24 25 26 27 28 29 30 0 2000 4000 6000 8000 1 5 10 15 20 25 sequence length setanidroocemoneg setanidroocecneuqes B 21pb 100 20 150 )

2 0 10

100 counts 200 8 0 5 10 15 20 25 30 distance 4 24-26pb 4 2 ACGT number of reads number of reads

number of reads (x10 0 0 ACGT 1 5 10 15 20 25 18 19 20 21 22 23 24 25 26 27 28 29 30 0 1000 2000 3000 sequence length genome coordinates sequence coordinates

C 2,5 200 21pb ) 50 2 2

12 0 counts 1,5 200 0 5 10 15 20 25 8 distance 24-26pb 2 4 reads of number ACGT

number of reads (x10 0 0 ACGT 1 5 10 15 20 25 18 19 20 21 22 23 24 25 26 27 28 29 0 4000 8000 sequence length genome coordinates sequence coordinates

Fig. 3. No viral-derived piRNAs are produced during acute infection of flies. (Left) Size distribution of β-eliminated small RNAs extracted from w1118 Dro- sophila infected with DCV (A), DXV segment A (B), and SINV (C). (Center) Profile of 21 nt and 24–26 nt small viral RNAs that mapped along the viral genome of interest. The sense and antisense small RNAs are shown in red and green, respectively. Uncovered regions are represented as gray lines. (Right)Frequencymap of the distance between 24–26 nt small RNAs that mapped to opposite strands of the viral genome. No peak is observed at position 10. The relative nucleotide frequencies per position of the 24–26 nt viral small RNAs that map the sense and antisense of the viral genome are shown in red and green, respectively. The intensity varies in correlation with the frequency. No nucleotide bias (U1 and A10) is observed. to the Aub-Aub ping-pong that is still active in the absence of Ago-3 and secondary (Aub and Ago-3)piRNAbiogenesispathways. (38, 39). All mutants produced similar profiles when mapped We inoculated control, Piwi, Aub,andAgo-3 mutant flies with two to Flamenco (SI Appendix, Fig. S4), a specific piRNA cluster of Drosophila viruses, DCV and DXV, and one mosquito-infecting somatic cells (40). Finally, the loss of Zucchini protein led to the arbovirus, SINV. We assessed fly survival and virus accumulation absence of primary piRNAs for Idefix, 42AB, and Flamenco (SI after inoculation. We did not find any difference in mortality of Appendix, Figs. S2B, S3B, and S4B). It is noteworthy that in the control and mutant flies following infection; all flies died between absence of Zucchini, the ping-pong signature and the U1-A10 6 and 10 d postinfection (dpi) with DCV and DXV (Fig. 2 A and bias were still present, because the loss of primary piRNAs B, Upper). increased detection of the secondaries. Even in the absence of lethality, it is possible that piRNA mu- We also compared primary and secondary piRNAs in whole tant flies cannot successfully control viral loads, which would in- flies versus ovaries. Germ line-dominant piRNA clusters, as well dicate a role of the piRNA pathway in viral defense. To test this, as somatic dominant piRNA clusters and TEs, were readily de- we collected fly samples at 0, 2 and 4 dpi with DCV and at 0, 3 and tectable in both conditions (SI Appendix, Fig. S5). 6 dpi with DXV. We measured viral load by 50% tissue culture Through the foregoing analyses, we established not only the be- infective dose (TCID50). We did not find differences in DCV or havior of the backcrossed mutant flies as the parental lines regarding DXV accumulation between control and piRNA mutant flies at piRNA production, but also the capacity of our bioinformatic pipe- any time point analyzed (Fig. 2 A and B, Lower). When inoculating lines to detect somatic and germ-line piRNAs. All experiments with Zuc mutant flies with DCV and DXV we observed a significant Aub, Ago-3, and Zuc mutant flies were performed in backcrossed resistance to virus infection in these flies that is not associated to flies, whereas the Piwi mutant was used in its original genetic the Pastrel gene allele (41) because flies were backcrossed. Similar background. to the others piRNA mutants, no difference in viral load was ob- served (SI Appendix,Fig.S6A and B). In the case of SINV inocu- piRNA Mutant Flies Are No More Susceptible to Viral Infections than lations, neither control nor piRNA mutant flies succumbed after WT Flies. To determine the impact of the piRNA pathway on anti- infection, as SINV developed a persistent infection (Fig. 2C, Upper). viral immunity, we studied the effect of acute viral infections on fly We assessed SINV accumulation by plaque assay in fly sam- mutants for key components of both primary (Zuc and Piwi) ples collected at 0, 3, and 6 dpi, and again found no differences

4of10 | www.pnas.org/cgi/doi/10.1073/pnas.1607952113 Petit et al.

A viral small RNA

120 )

3 5 5 21nt ) ) 4 3 4 80 0 3 8 10 2 counts (x10 6 051015202530 distance 24-26nt 4 2 T number of reads (x10 number of reads (x10 2 1 GT CG C

0 0 AA 18 19 20 21 22 23 24 25 26 27 28 29 30 31 01000200030004000 15 10 15 20 25 sequence length genome coordinates (nt) read coordinates (nt) B viral small RNA 4

60 )

21nt 2 10 ) 2

) 3 4 40 2 3 0 counts (x10 2 0 5 10 15 20 25 30 2 24-26nt distance

1 T 1 number of reads (x10 number of reads (x10 0 CGT CG

0 AA 18 19 20 21 22 23 24 25 26 27 28 29 30 0 2000 4000 6000 8000 1 5 10 15 20 25 sequence length genome coordinates (nt) read coordinates (nt)

C viral small RNA 400 21nt 15 10

) 0 3 6 2 400 counts 2 0 5 10 15 20 25 30 20 24-26nt distance

1 number of reads 10 T

number of reads (x10 0 CGT CG 0 AA 18 19 20 21 22 23 24 25 26 27 28 29 0 2000 4000 6000 8000 10000 1 5 10 15 20 25 sequence length genome coordinates (nt) read coordinates (nt)

Fig. 4. Drosophila persistently infected with viruses do not produce viral-derived piRNAs. (Left) Size distribution of β-eliminated small RNAs extracted from Drosophila persistently infected with DCV (A), DAV (B), and NoraV (C). (Center)Profileof21ntand24–26 nt small RNA reads that mapped along the viral genome of interest. The sense and antisense small RNAs are shown in red and green, respectively. Uncovered regions are represented as gray lines. (Right) Frequency map of the distance between 24–26 nt small RNAs that mapped to opposite strands of the viral genome. No peak is observed at position 10. The relative nucleotide frequencies per position of the 24–26 nt viral small RNAs that map the sense and antisense of the viral genome are shown in red and green, respectively. The intensity varies in correlation with the frequency. No nucleotide bias (U1 and A10) is observed. in SINV load among the different genotypes (Fig. 2C, Lower and flies has not yet been addressed, nor has the production of SI Appendix, Fig. S6C). Taken together, these results show that vpiRNAs in vivo. To investigate this, we inoculated WT (w1118)flies piRNA Zuc, Piwi, Aub,andAgo-3 mutants are no more susceptible with DCV, DXV, or SINV. Infected flies were sampled at 2 dpi for to DCV, DXV, or SINV infections than control flies, suggesting DCV and at 3 dpi for DXV and SINV after inoculation, and small that neither primary nor secondary piRNA biogenesis pathways RNAs ranging from 19 to 30 nt were recovered and subjected to play a major antiviral role for these viruses in adult Drosophila. β-elimination to enrich small RNA molecules harboring a 3′ end 2′-O-methyl nucleotide modification, such as mature siRNAs or No Viral-Derived piRNAs Are Produced in Flies During Acute Viral piRNAs (43). Following high-throughput sequencing, the analysis of Infection. The potential of the piRNA pathway to recognize and size distribution for DCV-, DXV-, and SINV-derived small RNAs process viral RNAs in Drosophila has been demonstrated in the showed a sharp peak of 21 nt enrichment, characteristic of vsiRNAs OSS cell line (24). Because OSS cells do not express Aub and produced by Dcr-2 activity during the RNAi antiviral response Ago-3 proteins, only the primary piRNA biogenesis step is active (Fig. 3 A–C, Left). vsiRNAs represented 63%, 88%, and 90% of in these cells (42), and consequently, only primary 25–30 nt all viral reads for DCV, DXV, and SINV respectively, and were vpiRNAs with a U1 bias were observed (24). The implication of distributed across the entire viral genomes and derived from secondary piRNA biogenesis pathway in vpiRNAs production in both negative and positive strands of viral replication intermediates

Petit et al. PNAS Early Edition | 5of10

A viral small RNA 10000 21nt 250

) 25 200 4 0 5000 counts 150

2 0 5 10 15 20 25 30 24-26nt 40 distance

1 T CG

number of reads (x10 0 T

20 CG 0 AA 18 19 20 21 22 23 24 25 26 27 28 29 0 1000 2000 3000 4000 5000 6000 1 5 10 15 20 25 sequence length genome coordinates (nt) read coordinates (nt)

viral small RNA B 2000 21nt 80 140 0 ) 3

counts 100 1000 6 60 0 5 10 15 20 25 30 30 24-26nt 4 distance number of reads number of reads T 10 2 0 number of reads (x10

10 CGT CG 0 AA 1818 20 21 22 23 24 25 26 27 28 29 30 31 0 1000 2000 3000 4000 5000 6000 1 5 10 15 20 25 read coordinates (nt) sequence length genome coordinates (nt) C viral small RNA 21nt 450 25 5000 ) 4 0 350

3 counts 5000 250 0 5 10 15 20 25 30 2 24-26nt distance 80 T number of reads 1 G

40 C number of reads (x10

0 GT C

0 AA 18 19 20 21 22 23 24 25 26 27 28 29 30 31 0 1000 2000 3000 4000 5000 6000 1 5 10 15 20 25 sequence length genome coordinates (nt) read coordinates (nt)

Fig. 5. There is no production of viral-derived piRNAs during Sigma virus infection. (Left) Size distribution of β-eliminated small RNAs extracted from Drosophila injected with DmelSV. RNA was extracted at 12 dpi for the w1118 (A)and22a (B) strains of Drosophila. E320 corresponds to a fly strain persistently infected with DmelSV (C). (Center)Profileof21ntand24–26 nt small viral RNA that mapped along the viral genome of interest. The sense and antisense small RNAs are shown in red and green, respectively. Uncovered regions are represented as gray lines. (Right) Frequency map of the distance between 24–26 nt small RNAs that mapped to opposite strands of the viral genome. No peak is observed at position 10. The relative nucleotide frequencies per position of the 24–26 nt viral small RNAs that map the sense and antisense of the viral genome are shown in red and green, respectively. The intensity varies in correlation with the frequency. No nucleotide bias (U1 and A10) is observed.

(Fig. 3 A–C, Center and SI Appendix,TableS9). Only a small pro- sequenced. During SINV infection, as expected, the amount of viral portion of virus-derived small RNAs corresponded to the expected small RNAs in Dcr-2 mutant flies was close to zero (SI Appendix, size of vpiRNAs of 24–26 nt: 5.7%, 0.4%, and 0.2% of all small RNA Fig. S7A), whereas Ago-2 mutant flies accumulated vsiRNAs of reads for DCV, DXV, and SINV, respectively (Fig. 3 A–C, Center 21 nt from both polarities to a greater extent (SI Appendix,Fig. and SI Appendix,TableS9). These reads, distributed along complete S7B). In no case were vpiRNAs detectable, and the few small RNAs viral genomes, were derived mainlyfromtheviralpositivestrandand in the size range of piRNAs did not exhibit a piRNA signature. In did not exhibit any of the characteristic biochemical biases described DCV and DXV infection, there was a significant accumulation of for piRNA: uridine at the 5′ end position (U1), adenosine at the small RNAs of positive polarity in both Dcr-2 and Ago-2 mutant tenth position (A10), and 10 nt overlaps between sense and antisense flies (SI Appendix,Figs.S7C and D and S8). Analysis of the small sequences (Fig. 3 A–C, Right). RNA reads corresponding to the size of piRNAS did not reveal any We next analyzed the production of vpiRNAs in flies deficient vpiRNAs, and the few reads that accounted for piRNA size did not for the siRNA pathway—Dcr-2 and Ago-2 null mutants—to test display a ping-pong signature or U1-A10 bias (SI Appendix,Figs.S7 whether the absence of the main antiviral mechanism could reveal C and D and S8). Taken together, and considering the capability of a contribution of the piRNA pathway to the antiviral response. our sequencing and bioinformatics pipeline to detect either somatic We inoculated Dcr-2 and Ago-2 mutant flies with DCV, DXV, or or germ-line piRNAs, these data suggest that vpiRNAs are not SINV. As for WT flies, small RNAs ranging from 19 to 30 nt were produced in adult WT flies during DCV, DXV, and SINV acute recovered, samples were subjected to β-elimination and deep- infections, and that in the absence of a fully functional antiviral

6of10 | www.pnas.org/cgi/doi/10.1073/pnas.1607952113 Petit et al.

A viral small RNA 40 21nt 1000 15

) 30 3 10 3 0 counts 5 1000 2 0 5 10 15 20 25 30 40 24-26nt distance number of reads

1 GT 0 C A number of reads (x10 20 GT C

0 A 18 19 20 21 22 23 24 25 26 27 28 29 30 0 50 100 150 200 15 10 15 20 25 sequence length genomes coordinates (x103) read coordinates (nt) B 1000 viral small RNA 10 21nt 3.0 500 0 140 2.6

10 counts 2.2 100 2.0 40 5 10 15 20 25 30 24-26nt distance number of reads 60 number of reads 0 20 40 0 CGT CGT AA 18 19 20 21 22 23 24 25 26 27 28 29 30 0 50 100 150 200 1 5 10 15 20 25 sequence length genomes coordinates (x103) read coordinates (nt) C viral small RNA 40 ) 13 2 10 21nt ) ) 11 4 2 0 9 2 40 counts (x10 7 80 0 5 10 15 20 25 30 1 0 distance 1 2 number of reads (x10 number of reads (x10

4 24-26nt GTACGT 0 AC 18 19 20 21 22 23 24 25 26 27 28 29 30 0 50 100 150 200 1 5 10 15 20 25 sequence length genomes coordinates (x103) read coordinates (nt)

Fig. 6. The infection of Drosophila with a DNA virus does not lead to viral-derived piRNA production. (Left)SizedistributionofsmallRNAsextractedfrom Drosophila injected with IIV6 (28). w1118 (A), Dcr-2L811fsX (B), and Ago-2414 (C)mutantstrainsofDrosophila.(Center)Profileof21ntand24–26 nt small viral RNAs that mapped along the viral genome of interest. The sense and antisense small RNAs are shown in red and green, respectively. Uncovered regions are represented as gray lines. (Right)Frequencymapofthedistancebetween24–26 nt small RNAs that mapped to opposite strands of the viral genome. No peak is observed at position 10. The relative nucleotide frequencies per position of the 24–26 nt viral small RNAs that map the sense and antisense of the viral genome are shown in red and green, respectively. The intensity varies in correlation with the frequency. No nucleotide bias (U1 and A10) is observed.

RNAi pathway, the piRNA pathway is not able to engage in an during RNAi antiviral response (Fig. 4, Left). vsiRNAs were dis- antiviral response based on the production of viral small RNAs. tributed across the complete viral genomes, matched both positive and negative viral strands, and represented 69.97% of the short No Viral-Derived piRNAs Are Detected in Persistently Infected Flies. RNA reads for DCV, 67.40% of those for NoraV, and 82.33% of Insects develop viral persistent infections as a common outcome. those for DAV (Fig. 4, Center and SI Appendix, Table S9). In During a persistent infection, the virus replicates but has rela- contrast, viral-derived small RNAs of the expected size for tively little effect on host fitness. It has been proposed that the vpiRNAs (24–26 nt) represented only 2.89%, 1.66%, and 0.73% siRNA pathway is boosted during persistent infection by the of the reads for DCV, NoraV, and DAV respectively (Fig. 4 and production of more abundant and distinct vsiRNAs (44). Those SI Appendix, Table S9). Reads were derived mainly from the vsiRNAs are generated from a viral DNA form. Because en- viral positive strand and did not display any of the signatures of dogenous piRNAs sources are host genome-encoded DNA piRNAs (Fig. 4, Center and Right). Taken together, our data show clusters, we thought that this viral-derived DNA could constitute that during persistent viral infections, D. melanogaster does not the source of vpiRNAs. Thus, we decided to analyze the pres- produce vpiRNAs. ence of vpiRNAs in fly stocks persistently infected with DCV, NoraV, or DAV. Small RNAs ranging from 19 to 30 nt were No Viral-Derived piRNAs Are Detected in Flies Infected with a recovered from persistently infected flies, and the samples were Vertically Transmitted Drosophila Virus. Although one study has subjected to β-elimination and deep-sequenced. DCV-, NoraV-, reported the presence of endogenous piRNA-like small RNAs in and DAV-derived small RNA profiles displayed the expected fly heads and imaginal discs (22), piRNA pathway components 21-nt vsiRNAs accumulation peak, a product of Dcr-2 activity are expressed and piRNAs produced predominantly in the fly

Petit et al. PNAS Early Edition | 7of10

germ-line tissues and surrounding somatic cells (45). DMelSV is and (v) no vpiRNAs are detected during infection with DmelSV, a vertically transmitted natural Drosophila virus that is able to DXV, and FHV, shown to infect ovarian cells (51, 52). Taken to- replicate in fly germ-line tissues (46, 47). To study whether gether, these results indicate that the piRNA pathway is not in- vpiRNA production is restricted to viruses able to replicate in volved in the antiviral response mediated by vpiRNAs. In addition, germ-line tissues, we analyzed the presence of these small RNA our capacity to detect somatic piRNAs from ovarian somatic sheet species in flies infected with DMelSV. We used three Drosophila cells when performing deep sequencing of ovaries indicates that we strains: a line (22a) naturally susceptible to DMelSV (48), a line are not missing a very low number of vpiRNAs that could have been (E320) persistently infected with the same virus (46), and w1118 generated by this cell type. Indeed, Flamenco has been proposed as WT flies. We inoculated w1118 and 22a flies with DMelSV. Small an ovarian somatic sheet cells-only piRNA cluster, and as such RNA populations present in WT and 22a line-infected flies were validates the sensitivity of our deep-sequencing methodology. analyzed at 12 dpi. Small RNAs from the E320 line were ana- Before vpiRNAs were described, Zambon et al. (10) and lyzed in 4- to 6-d-old flies. In all cases, small RNAs ranging from Chotkowski et al. (37) reported that Piwi and Aub mutant flies 19 to 30 nt were recovered, and the samples were subjected to were more sensitive to DXV and WNV infection, displaying an β-elimination (except for 22a flies) and deep-sequenced. As accelerated death and higher viral loads compared with WT flies. shown in Fig. 5, DMelSV infection produced abundant vsiRNAs The fact that we did not observe the same phenotype in flies that distributed across the complete viral genomes, matching both are backcrossed leads us to believe that their observation is based positive and negative viral strands. For the small RNAs of 24–26 on a genetic background effect. The background effect was nt, no vpiRNAs were detected. This finding indicates that viruses acknowledged in recent publications (53), and there is consid- that specifically infect the germ line as well as somatic tissues are erable natural genetic variation among Drosophila lines in their also controlled by the siRNA antiviral response and do not trigger a susceptibility to the viruses that we have studied. Thus, our re- piRNA-mediated antiviral response in adult flies. sults reinforce the importance of studying mutants in the same genetic backgrounds to avoid misleading interpretations. No Viral-Derived piRNAs Are Detected in Flies Infected with Other Along with the genetic background, our results also allow us to Model Viruses. IIV-6 and FHV are not natural Drosophila viruses. rule out effects due to superinfection. Indeed, a recent study found Nevertheless, both are able to replicate in D. melanogaster under that about 40% of fly stocks are persistently infected with different experimental conditions (49–51). IIV-6 is commonly used as a DNA viruses (54). As described in Materials and Methods,ourflystocks virus model, and we thought that vpiRNAs could originate from a were treated to eliminate Wolbachia (antibiotic treatment) and DNA source, as is the case for endogenous piRNAs. In contrast, persistent viruses (bleach treatment of the embryos); therefore, FHV is a single-stranded positive-sense RNA virus that has been previous infections and genetic background are not issues when extensively used to study antiviral responses in flies. Work from our analyzing our results. laboratory has demonstrated that during FHV infection of both flies It has been shown that genes involved in pathogen defense evolve and the S2 Drosophila cell line, an FHV-derived DNA form was much faster than the rest of the genome. Ago-2 is a clear example of produced that was implicated in the establishment of persistent in- this observation (55). Interestingly, genes in the piRNA pathway, fections (44). Based on the same rationale that we used for IIV-6, we including Piwi and Aub,alsoevolveveryrapidly,whichhasbeen hypothesized that the FHV DNA form could constitute a vpiRNAs suggested to be caused by adaptation to the ever-changing land- source. We analyzed published small RNA libraries (SRA 048623 scape of transposition activity in the fly (55, 56). The possibility that and SRA 045427) for the presence of vpiRNAs. As in all of the through regulation of transposons in somatic and germ-line tissues, previous conditions and as shown in Fig. 6 for IIV-6, we were not the piRNA pathway could tune or control in a subtle manner the able to detect viral small RNAs with the characteristic signature of immune state of the host by genes involved in immunity cannot be piRNAs in D. melanogaster. disregarded. A curious example arises when studying the Flamenco locus, which is located downstream of the DIP1 gene and is the Discussion source of piRNAs that silence various transposable elements. The piRNA pathway was recently implicated in antiviral defense Flamenco-derived piRNAs are produced exclusively from the plus in insects. This pathway is based on small RNAs and was first strand of the genome, indicating transcription from the DIP1 gene identified as the main mechanism controlling TE activity in an- toward the centromere (40). Recently, DIP1 was reported to be imal genomes. Despite the fact that viral-derived piRNAs were involved in antiviral immunity against DCV, but not against DXV first suggested to be present in Drosophila OSS cells (24), and (57). Fly mutants for DIP1 are hypersensitive to DCV infection, and that Aubergine (10) and Piwi (37) mutant flies appeared to be the authors postulated that DIP1 is a novel antiviral gene. The fact more sensitive to viral infection, none of these studies actively that Flamenco-derived piRNAs in somatic tissues in the ovary are sought to prove or disprove the existence of viral piRNAs in produced from transcription from the DIP1 gene (40) allows us to Drosophila. The reports that followed used arboviral infections hypothesize that DIP1-mediated DCV sensitivity is dependent on of mosquitoes or mosquito cells in culture as model systems. We the presence of piRNAs targeting the DIP1 gene. In this way, the decided to carry out a comprehensive study on the role of the piRNA pathway or, more precisely, the production of piRNAs from piRNA pathway during viral infection in D. melanogaster. Using the Flamenco locus, would not have a direct and general effect as an an array of RNAi mutants, an array of viruses corresponding to antiviral but instead would have an indirect and virus-specific effect. different families with (+)ssRNA, dsRNA, and dsDNA genomes Alternatively, it could be presumed that the piRNA pathway that, naturally or not, infect the fly, our phenotypic observations exhibits an antiviral effect in Drosophila larvae or embryos. This of the impact of viral infection on piRNA mutants via measures hypothesis merits further study together with the antiviral re- of fly survival and viral loads, as well as high-throughput sequencing, sponse during development in flies and other model insects. we demonstrate that (i)mutantadultfliesforkeycomponentsof Interestingly, whereas flies encodethreePiwiproteins(Piwi,Aub, the piRNA pathway (Zuc, Piwi, Aub, and Ago-3) are no more and Ago-3), the Piwi family is expanded to eight members (Piwi 1–7 susceptible than WT flies to two Drosophila viruses (DCV and and Ago-3) in the mosquito Aedes aegypti and to seven members in DXV) and an arbovirus (SINV); (ii) no vpiRNAs are produced Culex pipiens (58). It is tempting to speculate that during speciation during acute infections with DCV, DXV, SINV, DMelSV, IIV6, and diversification of piRNA pathway proteins, the piRNA pathway and FHV; (iii) no vpiRNAs are produced during persistent in- gained additional functions in addition to the repression of trans- fections with DCV, NoraV, DAV, or DMelSV; (iv) in the ab- poson activity in mosquitoes, while remaining focused exclusively sence of the siRNA pathway (Ago-2 and Dcr-2 mutants), no on the control of transposons in the fly. Alternatively, it could be vpiRNAs are produced during DCV, DXV, and SINV infection; proposed that the piRNA pathway has lost an ancestral antiviral

8of10 | www.pnas.org/cgi/doi/10.1073/pnas.1607952113 Petit et al.

function since the last common ancestor of flies and mosquitoes. We RNA Extraction and Library Production. For each virus infection, small RNA was believe that our results shed light on the complexity of the antiviral specifically extracted with the mirVana miRNA Isolation Kit (Ambion) from response in insects and reflect the diversity of action of the canonical 150–200 flies at 2 dpi for DCV, 3 dpi for DXV and SINV, and 12 dpi for DMelSV. – RNAi pathways in invertebrates. For each sample, 19 29 nt small RNAs were purified from a 15% acrylamide/ bisacrylamide (37.5:1), 7 M urea gel as described previously (62). Purified RNAs Materials and Methods were used for library preparation using the NEBNext Multiplex Small RNA Li- brary Prep for Illumina (New England Biolabs) with the 3′ adapter from In- Fly Strains and Husbandry. Flies were maintained on a standard cornmeal diet tegrated DNA Technologies (linker 1) and in-house–designed indexed primers. (Bloomington) at a constant temperature of 25 °C. Fly stocks are listed in SI Libraries were diluted to 4 nM and sequenced using the NextSeq 500 High- Appendix, Table S10. All fly lines were cleaned of possible chronic infections Output Kit v2 (Illumina) (75 cycles) on a NextSeq 500 sequencer (Illumina). Reads as described previously (59, 60). In brief, eggs were collected in agar/apple were analyzed with in-house Perl scripts. plates, treated with 50% bleach for 10 min, washed with water, and transferred to fresh vials. To eliminate Wolbachia infection, flies were Bioinformatics Analysis of Small RNA Libraries. The quality of fastq files was treated for two generations with 0.05 mg/mL of tetracycline hydrochloride assessed using graphs generated by FastQC (www.bioinformatics.babraham.ac. (Sigma-Aldrich) in the medium. In addition, all fly stocks were analyzed by uk/projects/fastqc/). Using cutadapt (https://cutadapt.readthedocs.io/en/stable/), RT-PCR with specific pairs of primers for CrPv, DAV, DXV, DCV, FHV, and NoraV. low-quality bases and adaptors were trimmed from each read. Only reads with acceptable quality were retained. FastQC generated a second set of graphics on the fastq files created by cutadapt (63). Reads were mapped to Virus Production and Titration. DCV and DXV stocks were prepared on low- genomes using bowtie1 (64) with the −v1(onemismatchbetweentheread passage S2 cells, and titers were measured by end-point dilution. S2 cells (2.5 × 105 and its target). bowtie1 generates results in sam format. All sam files were cells per well in a 96-well plate) were inoculated with 10-fold dilution of virus analyzed by the samtools package (38) to produce bam indexed files. To an- stocks. At 7 and 14 dpi, the cytopathic effect was analyzed. Titers were calculated alyze these bam files graphs were generated using custom R scripts and the as TCID50 according to a published method (61). SINV viral stocks were produced on a BHK cell line, and virus titer (PFU/mL) was determined by a plaque assay on Bioconductor Rsamtools and Shortreads libraries (65). BHK cells. To quantify viral load in flies, three pools of five flies each were analyzed at 0, 2, Statistical Analysis. Each experiment was repeated independently three and 4 dpi for DCV infection and at 0, 3, and 6 dpi for SINV and DXV infection. DCV times. Error bars represent SD. Statistical significance of survival data were calculated with a log-rank (Mantel–Cox) test. The statistical significance of and DXV viral loads were measured by TCID50,andSINVviralloadwasmeasured by a plaque assay. viral load in flies was calculated by two-way ANOVA.

Viral Infections and Survival Assays. The infection experiments were conducted ACKNOWLEDGMENTS. We thank members of the M.-C.S. laboratory for fruitful using 4- to 6-d-old flies. Infections were done by intrathoracic injection (Nanoject II discussions, M. Vignuzzi for a critical reading of the manuscript, and M. Simonelig and J. Brennecke for Piwi pathway mutant flies. This work was supported by the apparatus; Drummond Scientific) of 50 nLofaviralsuspensionin10mMTris,pH8. European Research Council (Grants FP7/2007-2013 ERC StG 242703 and FP7/2013- An injection of the same volume of 10 mM Tris, pH 8 served as a mock-infected 2019 ERC CoG 615220), the French Government’sInvestissementd’Avenir pro- control. Infected flies were kept at 25 °C and changed to fresh vials every 2 d. gram, the Laboratoire d’Excellence Integrative Biology of Emerging Infectious Survival of infected flies was measured daily by counting the number of dead flies Diseases project (Grant ANR-10-LABX-62-IBEID), and the Domaines d’Intérêt in each test tube. Survival data were evaluated using a log-rank (Mantel–Cox) test. Majeur Ile-de-France program on infectious diseases (M.-C.S.).

1. Mishima Y (2012) Widespread roles of microRNAs during zebrafish development and 20. Saito K, et al. (2006) Specific association ofPiwiwithrasiRNAsderivedfromretrotransposon beyond. Dev Growth Differ 54(1):55–65. and heterochromatic regions in the Drosophila genome. Genes Dev 20(16):2214–2222. 2. Bronkhorst AW, van Rij RP (2014) The long and short of antiviral defense: Small RNA-based 21. Gunawardane LS, et al. (2007) A slicer-mediated mechanism for repeat-associated immunity in insects. Curr Opin Virol 7:19–28. siRNA 5′ end formation in Drosophila. Science 315(5818):1587–1590. 3. Vagin VV, et al. (2006) A distinct small RNA pathway silences selfish genetic elements 22. Yan Z, et al. (2011) Widespread expression of piRNA-like molecules in somatic tissues. in the germline. Science 313(5785):320–324. Nucleic Acids Res 39(15):6596–6607. 4. Campbell CL, et al. (2008) Aedes aegypti uses RNA interference in defense against 23. Morazzani EM, Wiley MR, Murreddu MG, Adelman ZN, Myles KM (2012) Production Sindbis virus infection. BMC Microbiol 8:47. of virus-derived ping-pong-dependent piRNA-like small RNAs in the mosquito soma. 5. Keene KM, et al. (2004) RNA interference acts as a natural antiviral response to PLoS Pathog 8(1):e1002470. O’nyong-nyong virus (Alphavirus;Togaviridae)infectionofAnopheles gambiae. Proc 24. Wu Q, et al. (2010) Virus discovery by deep sequencing and assembly of virus-derived Natl Acad Sci USA 101(49):17240–17245. small silencing RNAs. Proc Natl Acad Sci USA 107(4):1606–1611. 6. Galiana-Arnoux D, Dostert C, Schneemann A, Hoffmann JA, Imler JL (2006) Essential 25. Scott JC, et al. (2010) Comparison of dengue virus type 2-specific small RNAs from RNA function in vivo for Dicer-2 in host defense against RNA viruses in drosophila. Nat interference-competent and -incompetent mosquito cells. PLoS Negl Trop Dis 4(10):e848. Immunol 7(6):590–597. 26. Hess AM, et al. (2011) Small RNA profiling of Dengue virus–mosquito interactions 7. Myles KM, Wiley MR, Morazzani EM, Adelman ZN (2008) Alphavirus-derived small implicates the PIWI RNA pathway in anti-viral defense. BMC Microbiol 11:45. RNAs modulate pathogenesis in disease vector mosquitoes. Proc Natl Acad Sci USA 27. Brackney DE, et al. (2010) C6/36 Aedes albopictus cells have a dysfunctional antiviral 105(50):19938–19943. RNA interference response. PLoS Negl Trop Dis 4(10):e856. 8. Sánchez-Vargas I, et al. (2009) Dengue virus type 2 infections of Aedes aegypti are 28. Vodovar N, et al. (2012) Arbovirus-derived piRNAs exhibit a ping-pong signature in modulated by the mosquito’sRNAinterferencepathway.PLoS Pathog 5(2):e1000299. mosquito cells. PLoS One 7(1):e30861. 9. van Rij RP, et al. (2006) The RNA silencingendonucleaseArgonaute2mediatesspecific 29. Léger P, et al. (2013) Dicer-2- and Piwi-mediated RNA interference in Rift Valley fever antiviral immunity in Drosophila melanogaster. Genes Dev 20(21):2985–2995. virus-infected mosquito cells. J Virol 87(3):1631–1648. 10. Zambon RA, Vakharia VN, Wu LP (2006) RNAi is an antiviral immune response against 30. Schnettler E, et al. (2013) Knockdown of piRNA pathway proteins results in enhanced a dsRNA virus in Drosophila melanogaster. Cell Microbiol 8(5):880–889. Semliki Forest virus production in mosquito cells. JGenVirol94(Pt 7):1680–1689. 11. Horwich MD, et al. (2007) The Drosophila RNA methyltransferase, DmHen1, modifies 31. Miesen P, Girardi E, van Rij RP (2015) Distinct sets of PIWI proteins produce arbovirus germline piRNAs and single-stranded siRNAs in RISC. Curr Biol 17(14):1265–1272. and transposon-derived piRNAs in Aedes aegypti mosquito cells. Nucleic Acids Res 12. Martinez J, Patkaniowska A, Urlaub H, Lührmann R, Tuschl T (2002) Single-stranded 43(13):6545–6556. antisense siRNAs guide target RNA cleavage in RNAi. Cell 110(5):563–574. 32. Sabin LR, Hanna SL, Cherry S (2010) Innate antiviral immunity in Drosophila. Curr Opin 13. Siomi MC, Sato K, Pezic D, Aravin AA (2011) PIWI-interacting small RNAs: The vanguard of Immunol 22(1):4–9. genome defence. Nat Rev Mol Cell Biol 12(4):246–258. 33. Wang JH, Valanne S, Rämet M (2010) Drosophila as a model for antiviral immunity. World J 14. Aravin AA, Hannon GJ, Brennecke J (2007) The Piwi-piRNA pathway provides an Biol Chem 1(5):151–159. adaptive defense in the transposon arms race. Science 318(5851):761–764. 34. Huszar T, Imler JL (2008) Drosophila viruses and the study of antiviral host defense. 15. Ipsaro JJ, Haase AD, Knott SR, Joshua-Tor L, Hannon GJ (2012) The structural biochemistry Adv Virus Res 72:227–265. of Zucchini implicates it as a nuclease in piRNA biogenesis. Nature 491(7423):279–283. 35. Dearing SC, Scotti PD, Wigley PJ, Dhana SD (1980) A small RNA virus isolated from the 16. Nishimasu H, et al. (2012) Structure and function of Zucchini endoribonuclease in grass grub, Costelytra zealandica (Coleoptera, Scarabaeidae). New Zeal J Zool 7(2): piRNA biogenesis. Nature 491(7423):284–287. 267–269. 17. Mohn F, Handler D, Brennecke J (2015) Noncoding RNA: piRNA-guided slicing specifies 36. Fukaya M, Nasu S (1966) A chilo iridescent virus (CIV) from the rice stem borer, Chilo transcripts for Zucchini-dependent, phased piRNA biogenesis. Science 348(6236):812–817. suppressalis Walker (Lepidoptera: Pyralidae). Appl Entomol Zool 1(2):69–72. 18. Han BW, Wang W, Li C, Weng Z, Zamore PD (2015) piRNA-guided transposon cleavage 37. Chotkowski HL, et al. (2008) West Nile virus infection of Drosophila melanogaster initiates Zucchini-dependent, phased piRNA production. Science 348(6236):817–821. induces a protective RNAi response. Virology 377(1):197–206. 19. Saito K, et al. (2007) Pimet, the Drosophila homolog of HEN1, mediates 2′-O-meth- 38. Li C, et al. (2009) Collapse of germline piRNAs in the absence of Argonaute3 reveals ylation of Piwi-interacting RNAs at their 3′ ends. Genes Dev 21(13):1603–1608. somatic piRNAs in flies. Cell 137(3):509–521.

Petit et al. PNAS Early Edition | 9of10

39. Huang H, et al. (2014) AGO3 Slicer activity regulates mitochondria-nuage localization 52. Teninges D, Ohanessian A, Richard-Molard C, Contamine D (1979) Isolation and biological of Armitage and piRNA amplification. JCellBiol206(2):217–230. properties of Drosophila Xvirus.JGenVirol42(2):241–254. 40. Malone CD, et al. (2009) Specialized piRNA pathways act in germline and somatic 53. Chandler CH, Chari S, Dworkin I (2013) Does your gene need a background check? tissues of the Drosophila ovary. Cell 137(3):522–535. How genetic background impacts the analysis of mutations, genes, and evolution. 41. Magwire MM, et al. (2012) Genome-wide association studies reveal a simple genetic Trends Genet 29(6):358–366. basis of resistance to naturally coevolving viruses in Drosophila melanogaster. PLoS 54. Webster CL, et al. (2015) The discovery, distribution, and evolution of viruses associated Genet 8(11):e1003057. with Drosophila melanogaster. PLoS Biol 13(7):e1002210. 42. Lau NC, et al. (2009) Abundant primary piRNAs, endo-siRNAs, and microRNAs in a 55. Obbard DJ, Welch JJ, Kim KW, Jiggins FM (2009) Quantifying adaptive evolution in – Drosophila ovary cell line. Genome Res 19(10):1776 1785. the Drosophila immune system. PLoS Genet 5(10):e1000698. 43. Elmer K, Helfer S, Mirkovic-Hösle M, Förstemann K (2014) Analysis of endo-siRNAs in 56. Kolaczkowski B, Hupalo DN, Kern AD (2011) Recurrent adaptation in RNA interference Drosophila. Methods Mol Biol 1173:33–49. genes across the Drosophila phylogeny. Mol Biol Evol 28(2):1033–1042. 44. Goic B, et al. (2013) RNA-mediated interference and reverse transcription control the 57. Zhang Q, et al. (2015) DIP1 plays an antiviral role against DCV infection in Drosophila persistence of RNA viruses in the insect model Drosophila. Nat Immunol 14(4):396–403. melanogaster. Biochem Biophys Res Commun 460(2):222–226. 45. Theron E, Dennis C, Brasset E, Vaury C (2014) Distinct features of the piRNA pathway 58. Campbell CL, Black WC 4th, Hess AM, Foy BD (2008) Comparative genomics of small in somatic and germ cells: From piRNA cluster transcription to piRNA processing and RNA regulatory pathway components in vector mosquitoes. BMC Genomics 9:425. amplification. Mob DNA 5(1):28. 59. Teixeira L, Ferreira A, Ashburner M (2008) The bacterial symbiont Wolbachia induces 46. Carpenter JA, Obbard DJ, Maside X, Jiggins FM (2007) The recent spread of a vertically resistance to RNA viral infections in Drosophila melanogaster. PLoS Biol 6(12):e2. transmitted virus through populations of Drosophila melanogaster. Mol Ecol 16(18): 60. Merkling SH, van Rij RP (2015) Analysis of resistance and tolerance to virus infection in 3947–3954. – 47. Wilfert L, Jiggins FM (2010) Host-parasite coevolution: Genetic variation in a virus Drosophila. Nat Protoc 10(7):1084 1097. population and the interaction with a host gene. JEvolBiol23(7):1447–1455. 61. Reed LJ, Muench H (1938) A simple method of estimating fifty per cent endpoints. Am – 48. Magwire MM, Bayer F, Webster CL, Cao C, Jiggins FM (2011) Successive increases in the JHyg27:493 497. resistance of Drosophila to viral infection through a transposon insertion followed by a 62. Gausson V, Saleh MC (2011) Viral small RNA cloning and sequencing. Methods Mol duplication. PLoS Genet 7(10):e1002337. Biol 721:107–122. 49. Bronkhorst AW, et al. (2012) The DNA virus Invertebrate iridescent virus 6 is a target 63. Martin M (2011) Cutadapt removes adapter sequences from high-throughput sequencing of the Drosophila RNAi machinery. Proc Natl Acad Sci USA 109(51):E3604–E3613. reads. EMBnet.journal 17(1), dx.doi.org/10.14806/ej.17.1.200. 50. Dasgupta R, Selling B, Rueckert R (1994) Flock house virus: A simple model for 64. Langmead B, Trapnell C, Pop M, Salzberg SL (2009) Ultrafast and memory-efficient studying persistent infection in cultured Drosophila cells. Arch Virol Suppl 9:121–132. alignment of short DNA sequences to the human genome. Genome Biol 10(3):R25. 51. Thomson TC, Schneemann A, Johnson J (2012) Oocyte destruction is activated during 65. Morgan M, Grimshaw A (2009) High-throughput computing in the sciences. viral infection. Genesis 50(6):453–465. Methods Enzymol 467:197–227.

10 of 10 | www.pnas.org/cgi/doi/10.1073/pnas.1607952113 Petit et al.

Supplementary fig. 1

Petit et al.

AB

C Gene allele Parental genotype Primers surrounding mutation 5’-TACAAGAGTTTCGCCAAATCA-3’ Ago-3 t2 Bw1;st1Ago-3t2/TM6B; Tb+ 5’-TTGCAGCATAACGATCATCTC-3’ 5’-TACAAGAGTTTCGCCAAATCA-3’ Ago-3 t3 Bw1;st1Ago-3t3/TM6B; Tb1 5’-TTGCAGCATAACGATCATCTC-3’ 5’-CTAGATTAACCCCAACTAAGC-3’ Aub HN2 +;AubHN2cn1bw1/Cyo;+ 5’-GTGGAGAAGTAGCGGAAAGAC-3’ w1118;AubQC42cn1bw1/Cyo;P(sevR 5’-TTCGAACCCAGCTTCTGTGAG-3’ Aub QC42 asI.v12)FK1 5’-ATACAAGAAAGACCGTCGCAG-3’ 5’-CGGCTTGCCTTCTCTCGCTT-3’ Zuc HM27 +;cnbwZucHM27/Cyo;+ 5’-TTCGAATGGGCAAGCGCATG-3’ 5’-AAACGTGGCTGTGAGTTTGT-3’ Zuc SG63 ywc;prcpxspZucSG63/Cyo;+ 5’-TTTGGCGGATTCAATAAAGC-3’

Fig. S1. Backcross design (A) Backcrossed schematic inspired by Presgraves review in Trends in Genetics 2008 (65). Grey bars represent w1118 chromosome, the asterisk is the mutation of interest, here Ago-3 t2 t3 HN2 QC42 HM27 SG63 or , Aub or and Zuc or and the blue color represents the genetic background of the mutant strains. All females used for the backcross were virgin. After each crossing, isofemales were selected and a region of the DNA spanning the mutation was sequenced to confirm the presence of the mutation. After each crossing, isofemales were selected and a region of the DNA spanning the mutation was sequenced to confirm the presence of the mutation. After 10 generations, it was assumed that the genetic background of the mutant flies is identical to the one of the wild type strains. (B) Genotype comparison between parental strains and backcrossed flies. (C) Primers used to follow the mutations during backcrosses.

Supplementary figure 2 Petit et al. A w1118 5.103

1000 6.103 800

600 counts read counts read 400 2.103 200 0 18 19 20 21 22 23 24 25 26 27 28 29 30 31 0 5 1015 20 25 30 sequence length distance ACGT ACGT 1 5 10 15 20 25 sequence coordinates B Parental strains Backcrossed strains

20 40

15 6 10 N.A N.A 4 read counts read read counts read 5 2

0 0 20 21 22 23 24 25 26 27 19 20 21 22 23 24 25 26 27 28 sequence length sequence length

N.A N.A

C

18 2000 1000 60 600 300 14 40 400 200

10 counts 20 counts (x10) read counts read

read counts read 200 100 0 0 6 0 18 19 20 21 22 23 24 25 26 27 28 29 30 0 5 1015 20 25 30 18 19 20 21 22 23 24 25 26 27 28 29 30 0 5 1015 20 25 30 sequence length distance sequence length distance ACGT ACGT ACGT ACGT 1 5 10 15 20 25 1 5 10 15 20 25 sequence coordinates sequence coordinates

Fig. S2. Analysis of small RNAs profile for Idefix TE for w1118, Zucchini-/- and Argonaute-3-/- strains. Size distribution of small RNAs extracted from w1118 (A), parental strains and backcrossed flies for Zuc -/- (B) and Ago-3 -/- (C). Frequency map for Ago-3 -/- of the distance between 24-26nt small RNAs that mapped to opposite strands of the Idefix sequence. A peak is observed at position 10 for w1118 but not Ago-3 -/- strains. For Zuc -/- (B) plots are not shown because read counts are too low. Relative nucleotide frequency per position of the 24-26nt viral small RNAs that map the sense and anti-sense of the genome, in red and green respectively. The intensity varied in correlation with the frequency. A nucleotide bias (U1 and A10) is observed for w 1118 but not for Ago-3-/- strains.

Supplementary Figure 3 Petit et al. A w1118

5 5.10 5.106 2.105

1.105 3.106 counts

read counts 6.104 1.106 2.104 0 18 19 20 21 22 23 24 25 26 27 28 29 30 31 051015 202530 sequence length distance ACGT ACGT 15 10 15 20 25 sequence coordinates B Parental strains Backcrossed strains

1.104 3.104

3 3 4.10 4 3.10 6.103 2.10 3.103 2.103 3 counts counts read counts 2.10 3 counts read 4 1.103 2.10 1.10 1.103 0 0 0 0 18 19 20 21 22 23 24 25 26 27 28 29 30 31 0 5 10 15 20 25 30 18 19 20 21 22 23 24 25 26 27 28 29 30 31 051015 202530 sequence length distance sequence length distance ACGT ACGT ACGT ACGT 1 5 10 15 20 25 1 5 10 15 20 25 C sequence coordinates sequence coordinates

5.104 1.105 1.105 5.103 4 5.103 1.10 9.104 3.103 6.103 4.103 counts read counts read counts read counts 7.104 1.103 2.103 3.103 0 0 18 19 20 21 22 23 24 25 26 27 28 29 30 31 0 5 10 15 20 25 30 18 19 20 21 22 23 24 25 26 27 28 29 30 31 051015 202530 sequence length distance sequence length distance ACGT ACGT ACGT ACGT 1 5 10 15 20 25 15 10 15 20 25 D sequence coordinates sequence coordinates

5.104 1.105

1.105 5.105 6.103 1.104 6.104 3.105 counts read counts read read counts read counts 5.103 2.103 1.105 2.104 0 0 18 19 20 21 22 23 24 25 26 27 28 29 30 31 051015 20 25 30 18 19 20 21 22 23 24 25 26 27 28 29 30 31 051015 202530 sequence length distance sequence length distance ACGT ACGT ACGT ACGT 1 5 10 15 20 25 15 10 15 20 25 sequence coordinates sequence coordinates

Fig. S3. Analysis of small RNAs profile on the piRNA cluster 42AB for w1118, Zucchini-/-, Aubergine-/- and Argonaute-3-/- strains.

Size distribution of small RNAs extracted from w1118 (A), parental strains and backcrossed flies for Zuc -/- (B), Aub-/- (C) and Ago-3 -/- (D). Frequency map of the distance between 24-26nt small RNAs that mapped to opposite strands of the 42AB sequence. A peak is observed at position 10 for w1118, for Zuc-/- and Ago-3 -/- strains but not for either of the Aub-/-. Relative nucleotide frequency per position of the 24-26nt viral small RNAs that map the sense and anti-sense of the genome, in red and green respectively. The intensity varied in correlation with the frequency. A nucleotide bias (U1 and A10) is observed for w1118, Zuc-/- and Ago-3 -/- but not for Aub-/- strains.

Supplementary figure 4 Petit et al. A w1118 5.105

5 1.10 1.106 8.104

4 6.10 6.105

4.104 counts read counts read

2.104 2.105 0 18 19 20 21 22 23 24 25 26 27 28 29 30 31 0 5 10 15 20 25 30 sequence length distance ACGT ACGT B 1 5 10 15 20 25 Parental strains sequence coordinates Backcrossed strains 2.104 4 3.103 3.10

2.104 2.103 3.103

3 1.104 1.10 2.103 counts 1.103 read counts read counts read counts read 5.103 500 1.103

0 0 0 0 18 19 20 21 22 23 24 25 26 27 28 29 30 0 5 1015 20 25 30 18 19 20 21 22 23 24 25 26 27 28 29 30 31 0 5 1015 20 25 30 sequence length distance sequence length distance ACGT ACGT ACGT ACGT C 1 5 10 15 20 25 1 5 10 15 20 25 sequence coordinates sequence coordinates

1.105 1.105

4 1,5.10 3.104 2.104 4.104 1.104 counts 1.104 counts

3 counts read 5.10 4 read counts read 4 3.10 2.10 5.103

0 0 18 19 20 21 22 2324 25 26 27 28 29 30 31 0 5 1015 20 25 30 18 19 20 21 22 23 24 25 26 27 28 29 30 31 0 5 10 15 20 25 30 sequence length distance sequence length distance ACGT ACGT ACGT ACGT 1 5 10 15 20 25 1 5 10 15 20 25 D sequence coordinates sequence coordinates

2.105 1.105 16.103 6.104 5.103 2.104 12.103 4.104 4.103 counts counts 4 3 read counts read 4 1.10 8.10 2.10 counts read 3.103 4.103 0 0 18 19 20 21 22 23 24 25 26 27 28 29 30 31 0 5 1015 20 25 30 18 19 20 21 22 23 24 25 26 27 28 29 30 31 0 5 1015 20 25 30 sequence length distance sequence length distance ACGT ACGT ACGT ACGT 1 5 10 15 20 25 1 5 10 15 20 25 sequence coordinates sequence coordinates Fig. S4. Analysis of small RNAs profile on the piRNA cluster Flamenco for w1118, Zucchini-/-, Aubergine-/- and Argonaute-3-/- strains.

Size distribution of small RNAs extracted from w1118 (A), parental strains and backcrossed flies for Zuc -/- (B), Aub-/- (C) and Ago-3 -/- (D). Frequency map of the distance between 24-26nt small RNAs that mapped to opposite strands of the Flamenco sequence. A peak is observed at position 10 for w1118 , Zuc-/- and Ago-3 -/- but not for either of the Aub-/- strains. Relative nucleotide frequency per position of the 24-26nt viral small RNAs that map the sense and anti-sense of the genome, in red and green respectively. The intensity varied in correlation with the frequency. A nucleotide bias (U1 and A10) is observed for w1118, Zuc-/- and Ago-3 -/- strains but not for Aub-/-.

Supplementary figure 5 Petit et al. A )

1 5 10

2.105 6 12.104 2 counts (x10 8.104 0 5 10 15 20 25 30

Flies distance read counts read 4.104 ACGT ACGT 0 1 5 10 15 20 25 A2 sequence coordinates ) 1.106 6 3 3.105 1

5 counts (x10 2.10 0 5 1015 20 25 30 distance 1.105 Ovaries read counts read

0 ACGTACGT 18 19 20 21 22 23 24 25 26 27 28 29 30 31 1 5 10 15 20 25 sequence length sequence coordinates B1 ) 6 5 1.106 3

1.105 1 counts (x10

Flies 0 5 1015 20 25 30 6.104 distance read counts read

2.104 ACGTACGT 0 1 5 10 15 20 25 B2 sequence coordinates

) 15 1.106 6

5 2.105 counts (x10

Ovaries 0 5 1015 20 25 30 read counts read 1.105 distance

5.104

0 ACGTACGT 18 19 20 21 22 23 24 25 26 27 28 29 30 31 1 5 10 15 20 25 sequence length sequence coordinates C1 ) 1.104 3 25 15 5 counts (x10 3 0 5 1015 20 25 30 Flies 1.10 distance read counts read 500 ACGTACGT 0 1 5 10 15 20 25 C2 sequence coordinates ) 2.104 4 6 4.103 4 3.103 2 counts (x10 0 5 1015 20 25 30 distance Ovaries read counts read 1.103

0 18 19 20 21 22 23 24 25 26 27 28 29 30 31 ACGTACGT 1 5 10 15 20 25 sequence length sequence coordinates

Fig. S5. Comparison of small RNAs profiles from ovaries and whole flies for piRNA clusters and TEs. 1118 1118 Left panel: Size distribution of small RNAs extracted from w flies (A1, B1 and C1) or w ovaries

(A2, B2 and C2). The size distribution is similar between whole flies and ovaries for germline dominant piRNA cluster 42AB (A), somatic dominant piRNA cluster Flamenco (B) and Gypsy 6 TE (C). Right panel: Frequency map of the distance between 24-26nt small RNAs mapped to opposite strands of the sequence. A peak is observed at position 10 for both whole flies and ovaries. Relative nucleotide frequency per position of the 24-26nt viral small RNAs that map the sense and anti-sense of the genome sequence, in red and green respectively for germline dominant piRNA cluster 42AB (A), somatic dominant piRNA cluster Flamenco (B) and Gypsy 6 TE (C). The intensity varied in correlation with frequency.

Supplementary figure 6 Petit et al. A 100 ns ns 10 80

60

DCV 40 5 ns **** percent survival percent 20 virus titer (log10 PFU/5flies) 0 0 02468 024 B day post-infection day post-infection ns 100

10 ns 80

60 ns DXV 40 5 **** percent survival percent 20 virus titer (log10 PFU/5flies) 0 0 0 2 4 6 8 10 12 036 C day post-infection day post-infection

ns 100 8 ns 7 ns 80 6

60 5 4 SINV 40 3 percent survival percent 2 20

virus titer (log10 PFU/5flies) 1 0 0 0 2 4 6 8 10 12 036 day post-infection day post-infection

Fig. S6. Characterization of DCV, DXV and SINV infection in wild type and Zucchini-/- flies. Group of 20 flies wild type (w1118) and Zucchini -/- (ZucHM27/SG63), were infected by injection with 2 TCID50 of DCV (A), 100 TCID50 of DXV (B) and 5000 TCID50 of SINV (C). Data shown are mean and the standard deviation. Control (w1118) flies are in blue and mutant flies in red. Dashed lines correspond to the control Tris injection. All experiments were independently performed three times. Left panels: Survival after infection was monitored daily. Right panels: viral titers for a group of 3 x 5 flies at 0, 2, 4 dpi (DCV) or at 0, 3, 6 dpi (DXV and SINV). No significant difference between control and mutant flies was observed.

Supplementary Figure 7 Petit et al. A 2 21pb 20 N.A 0 6 24-26pb 4 0,8

read counts 0,4 N.A

2 number of reads 0 0 0 4000 8000 18 19 20 21 22 23 24 25 B sequence length genome coordinates (nt) 2500 10

) 21pb 50 2 1500 ) 3 0 counts 500 15 5 0 5 10 15 20 25 30 distance 20 24-26pb T G C

5 A T read counts (x10 10 G number of reads (x10 C

0 0 A 18 19 20 21 22 23 24 25 26 27 28 29 30 1 5 10 15 20 25 sequence length 0 4000 8000 sequence coordinates C genome coordinates (nt) 50 4 21pb 3 )

3 2 2 8 1

0 counts (x10) 0 5 10 15 20 25 30 24-26pb distance 4 2 ACGT read counts (x10 number of reads (x10) 0 0 18 19 20 21 22 23 24 2526 27 28 29 30 31 0 2000 4000 6000 8000 ACGT 1 5 10 15 20 25 D sequence length genome coordinates sequence coordinates

10 8 21pb 10 ) 3 4 6 2

0 counts (x10) 2 0 5 10 15 20 25 30 distance 1 6 24-26pb ACGT read counts (x10

number of reads (x10) 2 0 0 18 19 20 21 22 23 24 2526 27 28 29 30 31 ACGT 0 2000 4000 6000 8000 1 5 10 15 20 25 sequence length sequence coordinates genome coordinates

Fig. S7. Small RNAs profile in siRNA mutant flies after SINV and DCV infection. Left panel: Size distribution of β-eliminated small RNAs extracted from Drosophila injected with SINV (A, B) and DCV (C, D). RNA was extracted at 3 dpi for Dcr-2-/- (A, C) and 2 dpi for Ago-2-/- (B, D) flies. Central panel: Profile of 21nt and 24-26nt small viral RNAs that mapped along the SINV and the DCV genome. The sense and anti-sense small RNAs are in red and green, respectively. Right panel: Frequency map of the distance between 24-26nt small RNAs that mapped to opposite strands of the viral genome. No peak observed at the position 10. Relative nucleotide frequency per position of the 24-26nt viral small RNAs that map the sense and anti-sense of the viral genome, in red and green respectively. The intensity varied in correlation with the frequency. No nucleotide bias (U1 and A10) is observed.

Supplementary Figure 8 Petit et al. A 20 2 21pb 30 6 20

1 counts 10 0 4 0 5 10 15 20 25 30 0,8 24-26pb distance T read counts number of reads of number 2 0,4 CG A T

0 CG 0 A 18 19 20 21 22 23 24 25 26 27 28 29 30 0 1000 2000 3000 1 5 10 15 20 25 sequence coordinates B sequence length genome coordinates

50 21pb 60

) 10 4

counts 20 0 5 0 5 10 15 20 25 30 1 24-26pb distance 10 number of reads of number ACGT read counts (x10 0 0 ACGT 18 19 20 21 22 23 24 25 26 27 28 29 30 31 0 1000 2000 3000 1 5 10 15 20 25 sequence length genome coordinates sequence coordinates C 6 21pb 10 20 4

) 6 2 4 2 counts 2 0 0 51015202530 3 distance 24-26pb 2 3 2 read counts (x10

1 number of reads (x10) 1 0 0 ACGTACGT 18 19 20 21 22 23 24 25 26 27 28 29 30 0 1000 2000 3000 1 5 10 15 20 25 sequence length genome coordinates sequence coordinates D 20 21pb 5 50

) 10 2 3 12 0 counts (x10) 1 8 10 0 5 10 15 20 25 30 distance 24-26pb 8 4 read counts (x10 number of reads (x10) 4

0 0 18 19 20 21 22 23 24 25 26 27 28 29 30 ACGTACGT 0 1000 2000 3000 1 5 10 15 20 25 sequence length genome coordinates sequence coordinates

Fig. S8. Small RNAs profile in siRNA mutant flies after DXV infection. Left panel: Size distribution of β-eliminated small RNAs extracted from Drosophila injected with DXV. RNA was extracted at 2 dpi for Ago-2-/- (B,D) and 3 dpi for Dcr-2-/- (A, D) flies. Central panel: Profile of

21nt and 24-26nt small viral RNAs that mapped along DXVA genome (A, B) and DXVB genome (C, D). The sense and anti-sense small RNAs are in red and green, respectively. Right panel: Frequency map of the distance between 24-26nt small RNAs that mapped to opposite strands of the viral genome. No peak observed at the position 10. Relative nucleotide frequency per position of the 24- 26nt viral small RNAs that map the sense and anti-sense of the viral genome, in red and green respectively. The intensity varied in correlation with the frequency. No nucleotide bias (U1 and A10) is observed.

Table S9. Deep sequencing results summary

type of % % viral % 21pb % 24- virus Fly strain % Dmel infection remaining reads (a) (b) 26pb (c) w1118 86.99 13.01 35.6 63,00 5.7 DCV Dcr2 93.11 6.89 3.35 16,00 16.7 Ago2 94.58 5.42 2.47 15,00 13.6 w1118 89.37 10.63 33.81 88,00 0.4 DXVA Dcr2 94.89 5.11 0.75 15,00 12.1 Ago2 93.66 6.34 2.19 16,00 9.27 acute w1118 89.37 10.63 33.81 88,00 0.52 DXVB Dcr2 94.89 5.11 0.75 16,00 9.91 Ago2 93.66 6.34 2.19 18,00 5.7 w1118 88.93 11.07 33.4 90,00 0.2 SINV Dcr2 94.64 5.36 0.39 50,00 5.3 Ago2 92.5 7.5 6.9 51,00 14.3 Ago3t1/ DAV 62.75 37.25 5.43 82.33 0.73 TM6B persistent Ago3t3/ DCV 86.17 13.83 1.88 69,97 2,89 TM6Bb Nora PGRP 87.13 13.83 0.43 67,40 1,66 w1118 94.07 5.93 18.46 69,70 0,23 acute Sigma 22a 84.34 15.66 2.86 68,24 0,56 persistent E320 89.26 10.74 16.54 68,60 0,42 w1118 40.85 59.15 0.97 84,07 1,64 acute IIV6 Dcr2 15.97 84.03 0,01 31,53 22,12 Ago2 48.7 51.3 3.86 74,12 3,76

(a) proportion of remaining small RNA reads that map to the viral genome (b) proportion of viral reads displaying a length of 21 pb (c) proportion viral reads displaying a length of 24-26 pb

Table S10. Genotype of the flies used in the study

Experiment Fly name Fly genotype

w1118 +;+;+

Acute Dcr2 -/- +;Dcr2L811fsX;+ infection

Ago2 -/- +;+;Ago2 414/TM6, Sb1Tb1

Ago3 t1 bw1;st1 Ago3t1/TM6B;Tb+

Persistent Ago3 t3 bw1;st1 Ago3t3/TM6B;Tb+ infection ywPry+;dipt-LacZ,pW+;DSR-gfp;+;PGRP- PGRP Lce12/TM6B

w1118 +;+;+

Sigma infection 22a Reference (48)

E320 Reference (46)

w1118 +;+;+

yd2 w1118, P{ry+t7.2=ey-FLP.N}2 ; IIV6 infection Dcr2-/- Dcr2L811fsX ; +

Ago2 -/- w*;+ ; AGO2414/TM6, Sb1 Tb1

Chapter 4

Viral infection, transposon expression and piRNAs

77 Chapter 4: Viral infection, transposon expression and piRNAs Overview

It is accepted that the activity of transposable elements can be induced by biotic and abiotic stresses in various organisms. However, information on how stress induces the activity of TEs remains scarce. Most studies linking transposition and stress response come from the plant field (1-3). For example, plant retrotransposons Tnt1A or Tto1 were found to respond to both biotic and abiotic stresses, with their promoters being activated by compounds derived from bacterial or viral infections, and hormones as salicylic acid (3-5). In animals, works studying the relationship between transposition and stress response are fewer and most of them are focused on abiotic stresses, as temperature (6-8) or as oxidative stress (9-11). The effect of infectious stress on transposition is not well documented in animals.

As discussed in the introduction, TEs expression may lead to their amplification, mobility and relocation in the host genome causing either mutations in gene coding regions, modifications on transcriptional regulation of promoter regions or de-repression of epigenetic marks. These mutagenic changes may be either advantageous or deleterious for the organism, for this reason, the control of TEs expression, mobility and insertion site is tightly regulated (12-14). In animals, both endo-siRNA and piRNA pathways regulate TEs activity in somatic and germline tissue respectively (15, 16).

In Chapter 3 I found that viral piRNAs were not produced during viral infections in flies and, therefore, that the piRNA pathway does not play a direct antiviral role in flies. However, the possibility that through regulation of transposons in somatic and germ-line tissues or by the production of piRNAs derived from protein-coding genes, the piRNA pathway could tune or control in a subtle manner the antiviral state of the host by genes involved in immunity or other physiological processes cannot be disregarded. To initiate this area of study in the laboratory, I attempted to answer two main questions: 1. is TE expression regulated during viral infections in Drosophila melanogaster?; and 2. do piRNAs and endo-siRNAs populations change during viral infection? If that is the case, is it possible to link these changes to the regulation of the antiviral response in Drosophila melanogaster?

78 Chapter 4: Viral infection, transposon expression and piRNAs

To answer these questions, I studied the accumulation of 24 TEs by RT-qPCR, following fly infection with two different viruses, DCV and DAV. I also analyzed endo-siRNAs and piRNAs populations in infected flies. The development of this project, allowed me to start my bioinformatics learning. The next pages will briefly describe my main observations.

Infection stress as a regulator of transposable elements expression.

In order to study if stress from viral infection induces TEs activity in flies, I infected 3-5 days old wild type female flies with two Drosophila viruses, DCV and DAV (17, 18). Following inoculation, the heads and bodies of flies were collected at 2 days post infection (dpi) or 3 dpi for DCV and DAV respectively. Mock-infected flies were used as control. Expression of TEs was determined by quantitative real-time RT-PCR (19) (Table 3). I selected and analyzed a total of 24 transposable elements belonging to different classes (DNA Transposons, LTR- transposons and non-LTR-transposons), based on bibliographical research (20) and used the ribosomal protein Rp49 as housekeeping gene (Fig. 10) .

Category Name Forward 5’-3’ Reverse 5’-3’ Bari2 ATGCCGTCCAGCTAATCAAT TCGGTACCATGTCTCCAAATC Bari1 CCTAGTGCCAGTCCGGTAAA TCTTTTAGCCTGCGACGAAT DNA transposons H-element AAACTGTTCTGGACGGATGG TTATGGCGGGATAAATTGGA S-element TTTAAATCGTGCGGGAAAAG TTCGCATAATAAGGCGGTCT I-element CCCCAACTCTAACTCCGACA CTGTTTCGTACCCGATTCGT F-element TGATCGACTTCGCAGTTACG TATCGGCGGAGGTGAATTAG Non-LTR R1 GCGATTGTTCAAGGAGGAAA TCCCAGCGCAATATCACATA Retrotransposons Jockey ACCACTAGCATTTGCCCAAC AGGGGCATTTCGCTTTAGAT Juan CTTTCCAAACGCTCATCACA TGGAGCGATGTGTTGCTTAG Micropia CGCTTTGAAACCGAAGAGAC CATACACCGCGTAACATTCG McClintock CCCTAATCCGTTTTCCCAAT CTGGTCGGTTCTGGTCAAAT 297 GGTGATCCAGAAACCCTTCA TGTCCGTCCAAGTTCCTTTC 17.6 TAAACCCCAGACCCCTAACC AAGTGTTTGTCTGCGGCTTT Springer GTCGCCTCGATTTCACGTAT GTCAGGCTTCCCTGTCTGAG Transpac CGGATACTGATCCATGACGA TACGGAATTTGGGTTTCTCG Roo TTAAGGGCGAGTCGGTAGAA GACCACGCATTTCAAGGTTT LTR Flea AGTCCCTTTCAAGCTCGTCA TAGAGAATCCATGGGCCAAC retrotransposons Quasimodo GCCAGATTCGTCACATCTCA TTGCCTCTTGTCTGTTGTCG Rover CAGGCAGTTTCTGGAGGAAG AGGCGGTTTCAGCTGAGTTA Opus TCAAGCTGTCGAGAGAAGCA GGAGAGGCGTTGGTCATAAA HMS-Beagle ACTTCGGTAATGCACCGTTC CGTCCATTGGTTCTGGTCTT Blood GACCAAAGCCCTTGACCATA GGCCACCCCTCTTCTTTTTA Burdock TCGCAGTCCAAAAACAATCA ACCTCTGGGGTGTTCACTGT Idefix ATGGCAGTCCCACAACTCTC TTGTTCCACTTGGTTGACGA

79 Chapter 4: Viral infection, transposon expression and piRNAs Table 3. qPCR primers list

40 tris DCV 30 DAV Ct 20

10

0 head body

Figure 10. Expression level of the housekeeping gene rp49 Rp49 was amplified in heads (left column) and body (right column) of mock-infected (Tris) or virus infected (DCV or DAV) flies. Each bar represents the mean of 3 biological replicates and error bars are the 10th-90th percentile. The statistical comparison of Rp49 expression level between the samples of different treatments was done using Dunett’s multiple comparison test and no significant difference were observed. Blue color corresponds to the Tris injection, red to DCV infection and green to DAV infection.

80 Chapter 4: Viral infection, transposon expression and piRNAs A 40 Head

30

∆Ct 20 LTR-transposons Idefix Burdock 10 Blood HMS-Beagle Opus Rover Quasimodo 0 Tris DCV DAV Flea Roo B Transpac Springer 40 Body 17,6 297 McClintock micropia 30

∆Ct 20

10

0 Tris DCV DAV CD 40 Head 40 Body

DNA-transposons 30 30 Bari1 ∆ Ct Bari2 20 20 H-element S-element

10 10

0 0 Tris DCV DAV Tris DCV DAV EF

40 Head 40 Body non-LTR-transposons 30 30 Juan ∆Ct Jockey R1 20 20 F-element I-element

10 10

0 0 Tris DCV DAV Tris DCV DAV

Figure 11. Transposon expression following DCV and DAV infection

Expression level of 24 transposons determined by RT-qPCR. Flies were infected with 2 TCID50/50nl of DCV and 75 TCID50/50nl for DAV. Transposons are represented by family: LTR (A, B), non-LTR (C, D) and DNA transposons (E, F). Each bar represents the mean of 3 biological replicates for a specific TE and error bars are the 10th-90th percentile. Results were normalized on the Rp49 gene expression level (ΔCt). Statistical

81 Chapter 4: Viral infection, transposon expression and piRNAs comparison of the TEs expression level between mock infected (Tris) and viral infected (DCV or DAV) flies was done using Dunett’s multiple compatison test.

I did not find statistically significant changes in the expression level of the different transposons tested in heads (somatic tissue) and bodies (germline tissue) of non-infected, DCV or DAV infected flies (Fig. 11). These results suggest that viral infections do not impact TE expression.

Nevertheless I did notice variations of the Ct values for some TEs. For example, for the LTR- transposon Burdock, I observed an extended distribution in head tissue for the DCV infected flies (fig. 11A). The same trend was observed for the non-LTR transposons, Juan and Jockey (fig. 11E). I also observed a decreased variability for the LTR-transposons Burdock, Blood and HMS-Beagle in the body of DAV infected flies (fig. 11B). To know if the difference observed in TE variability were correlated to the number of TEs copy in the drosophila genome, I used the data from flybase to count all the TEs copy (table 4). I couldn’t establish a correlation within the number of TEs copy in the genome and the level of TEs variability; suggesting that the variation of TE expression and active TEs copy number are independent mechanisms.

82 Chapter 4: Viral infection, transposon expression and piRNAs copy on copy on copy on copy on copy on copy on Category name total 2R 2L 3R 3L X 4 Bari2 0 2 2 0 0 1 5 DNA Bari1 1 1 2 0 1 1 6 transposons H 18 18 15 5 13 0 69 S 14 6 16 12 8 6 62 17.6 4 3 2 7 5 0 21 297 13 14 9 17 25 3 81 Burdock 8 4 4 0 4 2 22 Mc Clintock 2 1 0 4 0 1 8 Idefix 3 5 1 6 2 0 17 micropia 4 1 5 2 1 0 13 blood 4 14 5 4 2 0 29 LTR opus 12 6 8 7 3 0 36 retrotransposons rover 1 0 2 0 5 0 8 quasimodo 6 5 2 10 4 2 29 flea 11 3 2 4 9 1 30 roo 28 30 26 35 35 0 154 transpac 1 1 2 0 2 0 6 springer 7 5 3 9 5 0 29

HMS-Beagle 4 12 4 1 7 0 28

Juan 2 1 2 1 5 0 11 Jockey 19 16 16 19 23 4 97 Non-LTR R1a1 6 2 1 4 10 3 26 retrotransposons F 21 12 13 17 6 5 74 I 11 9 7 3 9 2 41

Table 4. Copy number in the Drosophila melanogaster genome of the 24 transposons used in this study

Even if my results do not show differences in TE expression at 2 and 3 days post infection, it would be interesting to perform the same study at different times points of infection but also during acute and persistent infection. This study could shed light on the relationship between infectious status and TEs expression. Additionally, the study of the TE mobility during infection, by the use of techniques such as Southern Blot or Transposons display technique (21, 22), could shed light on the impact of viral infection on TEs movement in the host genome.

83 Chapter 4: Viral infection, transposon expression and piRNAs

Infection stress and RNAi pathways

I next investigated whether endo-siRNA or piRNA populations change during viral infections. One of the genomic sources for both small RNAs species are transposons. Yet, endogenous piRNAs that do not contain transposon sequences are abundantly expressed in somatic tissue of Drosophila (23-25). Some of these piRNAs derive from protein-coding genes, suggesting that they contribute to the regulation of mRNA turnover. By analyzing the behavior of endo- siRNAs and piRNAs in virus infected flies I expect to detect changes on the distribution and abundance of these small RNAs. I analyzed the small RNA libraries described in Chapter 3 of this Thesis. They represent a dataset with a large spectrum of viruses and infection types: three acute viral infections (DCV, DXV and SINV), three persistent viral infections (Nora, DAV and DCV), the vertically transmitted Sigma Virus. As controls I used small RNA libraries available in the laboratory from bacteria-infected and mock-infected flies.

The small RNA libraries were processed through a bioinformatic pipeline with 3 main steps: 1. the libraries were mapped to a rRNA database in order to exclude ribosomal small RNAs 2. the remaining reads were mapped against a miRNA database and miRNAs were excluded 3. the remaining reads were sorted by their size in endo-siRNAs (21nt long) and piRNAs (24 to 29nt long) and mapped against the Drosophila melanogaster genome (version 6).

84 Chapter 4: Viral infection, transposon expression and piRNAs

To visualize alignments of small RNAs on the Drosophila genome, I used the Integrative Genome Browser (IGV) (26, 27), that gives the possibility to observe all the samples on one screen, allowing for better comparison. A precise and carefully study on the coverage of the Drosophila genome by endo-siRNAs and piRNAs following viral infection needing much more time that the available to finish my PhD, I decided to concentrate in some ‘case studies’. Thus, I focus my first analysis on the Hsp70 gene. Hsp70 was shown to be a major actor of the stress response (28) and to be involved in the fly antiviral response against DCV and CrPv (29).

85 Chapter 4: Viral infection, transposon expression and piRNAs

A Hsp70Aa Infection Virus genotype Hsp70Ab type 1118 Ø w

1118 Mock Ø w Ø w1118

Acute Bacteria w1118

Nora/DAV 43 Persistent Nora/DCV Ago-3t3 /TM6Bb Nora PGRP

Persistent Sigma E320 w1118 Acute Sigma 22a SINV w1118 Acute DCV w1118

DXV w1118

B 1118 Ø w

1118 Mock Ø w Ø w1118

Acute Bacteria w1118

Nora/DAV 43 Persistent Nora/DCV Ago-3t3 /TM6Bb Nora PGRP

Persistent Sigma E320 w1118 Acute Sigma 22a SINV w1118 Acute DCV w1118

DXV w1118

Figure 12. small RNAs covering the Hsp70Aa and Hsp70Ab coding sequence in Drosophila melanogaster

Using the Integrative Genome Viewer (IGV) program (27, 28). 13 tracks from different type of infections in Drosophila melanogaster were plotted. Blue track: w1118 mock infected. Pink track: w1118 infected with the gram-negative bacterium Vibrio Cholera. Purple track: persistently infected flies with Nora virus, Drosophila A Virus (DAV) or Drosophila C Virus (DCV), the “/” indicate a co-infection in flies. Orange track: flies infected persistently (E320) or acutely (w1118 and 22a) with Sigma virus. Green track: w1118 acute infection with Drosophila C Virus (DCV), Drosophila X Virus (DXV) and Sindbis virus (SINV). Track scale is up to 600 reads and grey color corresponds to uncovered regions. (A) Coverage for the 24-29 nt long small RNAs (B) Coverage for the 21 nt small long RNAs.

When I studied the coverage on small RNAs of the genome sequence of Hsp70, I observed that piRNAs (Fig. 3A), but not endo-siRNAs (Fig. 3B), cover the coding region of Hsp70 only in persistently infected flies and in late Sigma Virus acute infected flies. In virus acutely

86 Chapter 4: Viral infection, transposon expression and piRNAs infected flies, mock infected flies and bacteria-infected flies, the presence of piRNAs was not detected. The specificity of this observation was further confirmed by analyzing the small RNA coverage of one Hsp cluster, in another genomic location, where no particular accumulation of piRNAs nor endo-siRNAs was found (Fig. 4A and B).

Further studies are needed in order to confirm the nature of these Hsp 70-derived small RNAs (determine ping-pong signature, U1-A10 bias, etc) and their biological function (determine the expression levels of Hsp70 transcripts in presence/absence of infection). Although preliminary, my results suggest not only that endogenous small RNAs populations vary during viral infections, and that that these variations seem to be dependent on the nature of the infection (persistent vs acute) and the pathogen identity (virus vs bacteria), but also that piRNAs derived from protein coding genes could regulate their expression.

87 Chapter 4: Viral infection, transposon expression and piRNAs A Hsp67Bc Hsp67Bb Hsp22CG4461 Hsp26 Hsp67Ba Infection Virus genotype type 1118 Ø w

1118 Mock Ø w Ø w1118

Acute Bacteria w1118

Nora/DAV 43 Persistent Nora/DCV Ago-3t3 /TM6Bb Nora PGRP

Persistent Sigma E320 w1118 Acute Sigma 22a SINV w1118 Acute DCV w1118

DXV w1118 B 1118 Ø w

1118 Mock Ø w Ø w1118

Acute Bacteria w1118

Nora/DAV 43 Persistent Nora/DCV Ago-3t3 /TM6Bb Nora PGRP

Persistent Sigma E320 w1118 Acute Sigma 22a SINV w1118 Acute DCV w1118

DXV w1118

Figure 13. small RNAs covering the Hsp cluster in Drosophila melanogaster

Using the Integrative Genome Viewer (IGV) program (27, 28). 13 tracks from different type of infections in Drosophila melanogaster were plotted. Blue track: w1118 mock infected. Pink track: w1118 infected with the gram- negative bacterium Vibrio Cholera. Purple track: persistently infected flies with Nora virus, Drosophila A Virus (DAV) or Drosophila C Virus (DCV), the “/” indicate a co-infection in flies. Orange track: flies infected persistently (E320) or acutely (w1118 and 22a) with Sigma virus. Green track: w1118 acute infection with Drosophila C Virus (DCV), Drosophila X Virus (DXV) and Sindbis virus (SINV). Track scale is up to 600 reads and grey color corresponds to uncovered regions. (A) Coverage for the 24-29 nt long small RNAs (B) Coverage for the 21 nt small long RNAs.

Bibliography

88 Chapter 4: Viral infection, transposon expression and piRNAs

1. Dellaporta SL, et al. (1984) Endogenous Transposable Elements Associated with Virus- Infection in Maize. Cold Spring Harb Sym 49:321-328. 2. Walbot V (1992) Reactivation of Mutator Transposable Elements of Maize by Ultraviolet- Light. Mol Gen Genet 234(3):353-360. 3. Grandbastien M, et al. (2005) Stress activation and genomic impact of Tnt1 retrotransposons in Solanaceae. Cytogenet Genome Res 110(1-4):229-241. 4. Grandbastien MA, et al. (1997) The expression of the tobacco Tnt1 retrotransposon is linked to plant defense responses. Genetica 100(1-3):241-252. 5. Hirochika H & Otsuki H (1995) Extrachromosomal Circular Forms of the Tobacco Retrotransposon-Tto1. Gene 165(2):229-232. 6. Hoffmann AA, Hallas RJ, Dean JA, & Schiffer M (2003) Low potential for climatic stress adaptation in a rainforest Drosophila species. Science 301(5629):100-102. 7. Imasheva AG, Loeschcke V, Zhivotovsky LA, & Lazebny OE (1998) Stress temperatures and quantitative variation in Drosophila melanogaster. Heredity (Edinb) 81 ( Pt 3):246-253. 8. Hansen PJ (2009) Effects of heat stress on mammalian reproduction. Philos Trans R Soc Lond B Biol Sci 364(1534):3341-3350. 9. Wang MC, Bohmann D, & Jasper H (2003) JNK signaling confers tolerance to oxidative stress and extends lifespan in Drosophila. Dev Cell 5(5):811-816. 10. Migliaccio E, et al. (1999) The p66shc adaptor protein controls oxidative stress response and life span in mammals. Nature 402(6759):309-313. 11. Finkel T & Holbrook NJ (2000) Oxidants, oxidative stress and the biology of ageing. Nature 408(6809):239-247. 12. Finnegan DJ (1992) Transposable elements. Curr Opin Genet Dev 2(6):861-867. 13. McDonald JF (1998) Transposable elements, gene silencing and macroevolution. Trends in ecology & evolution 13(3):94-95. 14. Yang G, Zhang F, Hancock CN, & Wessler SR (2007) Transposition of the rice miniature inverted repeat transposable element mPing in Arabidopsis thaliana. Proc Natl Acad Sci U S A 104(26):10962-10967. 15. Brennecke J, et al. (2007) Discrete small RNA-generating loci as master regulators of transposon activity in Drosophila. Cell 128(6):1089-1103. 16. Czech B, et al. (2008) An endogenous small interfering RNA pathway in Drosophila. Nature 453(7196):798-802. 17. Jousset FX, Plus N, Croizier G, & Thomas M (1972) [Existence in Drosophila of 2 groups of picornavirus with different biological and serological properties]. C R Acad Sci Hebd Seances Acad Sci D 275(25):3043-3046. 18. Plus N, Croizier G, Jousset FX, & David J (1975) Picornaviruses of laboratory and wild Drosophila melanogaster: geographical distribution and serotypic composition. Ann Microbiol (Paris) 126(1):107-117. 19. Freeman WM, Walker SJ, & Vrana KE (1999) Quantitative RT-PCR: pitfalls and potential. Biotechniques 26(1):112-122, 124-115. 20. Lu J & Clark AG (2010) Population dynamics of PIWI-interacting RNAs (piRNAs) and their targets in Drosophila. Genome Res 20(2):212-227. 21. Daniels SB, Peterson KR, Strausbaugh LD, Kidwell MG, & Chovnick A (1990) Evidence for horizontal transmission of the P transposable element between Drosophila species. Genetics 124(2):339-355. 22. Van den Broeck D, et al. (1998) Transposon Display identifies individual transposable elements in high copy number lines. Plant J 13(1):121-129.

89 Chapter 4: Viral infection, transposon expression and piRNAs 23. Robine N, et al. (2009) A broadly conserved pathway generates 3'UTR-directed primary piRNAs. Curr Biol 19(24):2066-2076. 24. Saito K, et al. (2009) A regulatory circuit for piwi by the large Maf gene traffic jam in Drosophila. Nature 461(7268):1296-1299. 25. Senti KA & Brennecke J (2010) The piRNA pathway: a fly's perspective on the guardian of the genome. Trends Genet 26(12):499-509. 26. Robinson JT, et al. (2011) Integrative genomics viewer. Nat Biotechnol 29(1):24-26. 27. Thorvaldsdottir H, Robinson JT, & Mesirov JP (2013) Integrative Genomics Viewer (IGV): high-performance genomics data visualization and exploration. Brief Bioinform 14(2):178- 192. 28. Singh MP, Reddy MM, Mathur N, Saxena DK, & Chowdhuri DK (2009) Induction of hsp70, hsp60, hsp83 and hsp26 and oxidative stress markers in benzene, toluene and xylene exposed Drosophila melanogaster: role of ROS generation. Toxicol Appl Pharmacol 235(2):226-243. 29. Merkling SH, et al. (2015) The heat shock response restricts virus infection in Drosophila. Sci Rep 5:12758.

90

Chapter 5

Discussion & Perspectives

91 Chapter 5: Discussion & Perspectives

Three main small RNA-based silencing pathways have been described in animals: the microRNA (miRNA), the small interfering RNA (siRNA) and the Piwi-interacting RNA (piRNA) pathways. These pathways are involved in the regulation of different key biological processes such as organism development (1), defense against viral pathogens (2) and genome protection from transposable elements (TEs) activity (3) respectively. The identification of the siRNA pathway as the major antiviral defense mechanism in plants, nematodes, and insects led to a better understanding of host- pathogen interactions. Recently, different research works involved the piRNA pathway in antiviral defense in mosquitoes. The aim of my Thesis was to characterize the impact of the piRNA pathway on the fly antiviral response in order to understand whether the viral-derived piRNAs are part of the general antiviral process, or whether their production depends on the biology of the host–virus combination.

A direct role of the piRNA pathway in antiviral defense in Diptera ?

The diptera clade includes both mosquitoes and flies species. D. melanogaster has been the insect model of choice since the beggining of the last century (4). In recent years, there has been an increased interest in studying mosquitoes, the main vectors for human viral pathogens throughout the world (5, 6). With the numerous molecular tools available to decipher antiviral responses in flies, and the fact that viral small RNAs with the length of piRNAs were first reported in fly tissues (7), I undertook the challenge of addressing the antiviral role of piRNAs in Drosophila. In contrast to what has been observed in mosquitoes (8-11), my results clearly demonstrate that the piRNA pathway is not directly required for antiviral defense in Drosophila.

Mosquitoes and fruit flies diverged about 250 millions years ago (12, 13), but they still share a considerable number of features in terms of ecology, morphology and life strategy. For example, the malaria mosquito Anopheles gambiae and Drosophila melanogaster genomes, share 50% of sequence identity for proteins involved in immunity and defense (14). Yet, increasing numbers of ‘omics’ studies have taught us that not all aspects of immunity can directly be translated from Drosophila to the actual mosquito. In the particular case of small RNA-based silencing mechanisms,

92 Chapter 5: Discussion & Perspectives both mosquito and Drosophila melanogaster genomes contain the same gene copy number for Dicers and Argonautes of the siRNA and miRNA pathways (15). However, piRNA pathway represents the exception, with only one gene copy for Piwi, Aub and Ago-3 in the fruit fly genome, while seven copies of Piwi and 1 copy of Ago-3 in the Aedes aegypti genome. It therefore seems that siRNA and miRNA pathways conserved their function across species, and that the antiviral function of the piRNA pathway was either gained in mosquitoes or lost in flies.

The dichotomy between flies and mosquitoes is just the tip of the iceberg. Phylogenetic analyses of small RNA pathway components have indicated that loci encoding these molecules expanded or contracted during the course of the evolution of insects (16-18). For example, miRNA gene expansions are found in the pea aphid (Acyrthosiphon pisum), the Russian wheat aphid (Diuraphis noxia), and the housefly (Musca domestica). Gene expansions of siRNA are found in the locust (Locusta migratoria), the Russian wheat aphid, the red flour beetle (T. castaneum), the parasitoid wasp (Nasonia vitripennis), diverse species of Glossina (tsetse flies), the fruit fly, and the housefly (19). The piRNA pathway genes expanded in both pea and Russian wheat aphids, the parasitoid wasp, two types of ants (Camponotus floridanus and Harpegnathos saltator) and mosquitoes from the Aedes, Anopheles, and Culex genera. Duplication and diversification of small RNA pathways are widely present among insects, indicating that these changes are not rare and have occurred even at the species level.

Gene duplications are a frequent source of novelty in host genome defense repertoires, but the evolutionary fate of specific duplicates can vary. In most cases, one of the duplicated copies will be eliminated; alternatively, both copies may be retained but may acquire differentiated profiles of expression or different functions (20, 21). The frequent expansion of genes in the RNAi pathway is often accompanied by changes in their evolutionary rates. Some of these changes might be explained by the involvement of these genes in host-pathogen interactions. My studies point to the uniqueness of each natural pathosystem (i.e., the natural insect-virus system) that is essential to understanding the contribution of antiviral RNAi, and they show that in some cases the use of model systems may not yield generalizable concepts. Although time-consuming to determine, the contribution of the RNAi pathway to the antiviral

93 Chapter 5: Discussion & Perspectives response, as well as the interactions of RNAi with other immune pathways, should be established for each individual pathogen-insect combination.

Indirect role of the piRNA pathway in antiviral defense in Drosophila

Only a decade ago, the piRNA pathway was discovered as an important small RNAs mediated silencing mechanisms in animals (22). In essence, piRNAs associate with PIWI proteins and are essential for transposon silencing, primarily in germline cells (23). Yet, endogenous piRNAs that do not contain transposon sequences and derive from protein-coding genes, have also been identified in diptera (24). Transposons are known by their capacity to cause either mutations in gene coding regions, modifications on transcriptional regulation of promoter regions or de-repression of epigenetic marks through their mobility and relocation. Evolution has favored rigorous mechanisms to control transposon activity, the piRNA pathway being one of them. As transposon activity is influenced by biotic and abiotic stresses, viral infection could be a main player determining transposon activity. However, studies linking the effect of viral infection on piRNA-mediated regulation of TEs have not yet been addressed. Additionally, one could wonder whether the stress due to virus infection produces changes in piRNAs targeting gene-coding regions that will affect the immune status of the host.

When I analyzed the accumulation of transcripts from individual transposons in virus- infected flies, no differences were found, probably due to the individual variation during infection. In contrast, the development of high-throughput sequencing and the emergence of systems biology, allow a more general picture of host-pathogen relationships through the manipulation of big datasets. Indeed, the initial result I obtained on the presence of piRNAs covering the coding sequence of Hsp70 is very promising. In a general manner, heat shock proteins (Hsps) serve as molecular chaperones during protein interactions (25, 26). Among others, they are involved in maintenance of protein folding, the import/export and localization of proteins in organelles, decreasing the non-native protein aggregation, the modulation of protein degradation. Biotic and abiotic factors can induce Hsps expression (reviewed in Feder

94 Chapter 5: Discussion & Perspectives and Hofmann, 1999 (27). Among the family of Hsps, Hsp70 was shown as a major player during heat and hypoxia derived stresses (28, 29). It was also shown that Hsp70 is involved in antiviral defense in virus-infected flies (30). The observation that the Hsp70 coding sequence is covered on piRNAs, and not endo-siRNAs, only during persistent viral infections, strongly suggests that the piRNA pathway has an indirect role modulating the Hsp70 transcripts and the outcome (acute versus persistent) of the antiviral response. Moreover, this observation highlights, as many others works, that the immune response is not a linear signaling pathway but composed of a complex set of specific responses arising from a dynamic network.

As a general perspective, my work highlighted two new concepts on small RNA biology: 1- The existence of piRNA-derived from protein coding genes and their role in the regulation of gene expression. 2- The role of piRNA pathway regulating the immune status of the host during viral infection through transposon activity and/or piRNA-derived from gene coding regions. The dataset of small RNA libraries generated through my PhD constitute an ideal start point to investigate these concepts. First, through the protocol established in Chapter 2, the genetic background is identical, rendering comparisons possible. Second, small RNA libraries corresponding to different viruses and different type of infections are available. Third, small RNA libraries are beta eliminated or not, allowing to infer for biological characteristics of the small RNA population.

I would like to finish with a personal thought on how viruses might prompt host genome mutation, adaptation and evolution through the regulation of the piRNA pathway and transposon activity. One could imagine that virus infection would titer on/off the concentration of a given piRNA in germline with a concomitant change in transposon activity. That would induce transposition, and generate a progeny more/less adapted to a given signal (external or internal). Therefore, changes in the transposition landscape derived from the host-virus arms race, could result in a host resistant or tolerant to viral infection or a host in which viral transmission is maximized. Even if transposon activity is often deleterious, it generates genetic variation that becomes the cornerstone of natural selection. The interplay between

95 Chapter 5: Discussion & Perspectives viruses, piRNAs and regulation of gene expression could then be at the base of host- pathogen coevolution.

96 Chapter 5: Discussion & Perspectives

Bibliography

1. Mishima Y (2012) Widespread roles of microRNAs during zebrafish development and beyond. Dev Growth Differ 54(1):55-65. 2. Bronkhorst AW & van Rij RP (2014) The long and short of antiviral defense: small RNA- based immunity in insects. Curr Opin Virol 7:19-28. 3. Vagin VV, et al. (2006) A distinct small RNA pathway silences selfish genetic elements in the germline. Science 313(5785):320-324. 4. Hedges SB (2002) The origin and evolution of model organisms. Nat Rev Genet 3(11):838- 849. 5. Paupy C, Delatte H, Bagny L, Corbel V, & Fontenille D (2009) Aedes albopictus, an arbovirus vector: from the darkness to the light. Microbes Infect 11(14-15):1177-1185. 6. Nene V, et al. (2007) Genome sequence of Aedes aegypti, a major arbovirus vector. Science 316(5832):1718-1723. 7. Wu Q, et al. (2010) Virus discovery by deep sequencing and assembly of virus-derived small silencing RNAs. Proc Natl Acad Sci U S A 107(4):1606-1611. 8. Vodovar N, et al. (2012) Arbovirus-derived piRNAs exhibit a ping-pong signature in mosquito cells. PLoS One 7(1):e30861. 9. Morazzani EM, Wiley MR, Murreddu MG, Adelman ZN, & Myles KM (2012) Production of virus-derived ping-pong-dependent piRNA-like small RNAs in the mosquito soma. PLoS Pathog 8(1):e1002470. 10. Schnettler E, et al. (2013) Knockdown of piRNA pathway proteins results in enhanced Semliki Forest virus production in mosquito cells. J Gen Virol 94(Pt 7):1680-1689. 11. Miesen P, Girardi E, & van Rij RP (2015) Distinct sets of PIWI proteins produce arbovirus and transposon-derived piRNAs in Aedes aegypti mosquito cells. Nucleic Acids Res 43(13):6545-6556. 12. Gaunt MW & Miles MA (2002) An insect molecular clock dates the origin of the insects and accords with palaeontological and biogeographic landmarks. Mol Biol Evol 19(5):748-761. 13. Yeates DK & Wiegmann BM (1999) Congruence and controversy: toward a higher-level phylogeny of Diptera. Annu Rev Entomol 44:397-428. 14. Christophides GK, et al. (2002) Immunity-related genes and gene families in Anopheles gambiae. Science 298(5591):159-165. 15. Tomoyasu Y, et al. (2008) Exploring systemic RNA interference in insects: a genome-wide survey for RNAi genes in Tribolium. Genome Biol 9(1):R10. 16. Lewis SH, Salmela H, & Obbard DJ (2016) Duplication and Diversification of Dipteran Argonaute Genes, and the Evolutionary Divergence of Piwi and Aubergine. Genome Biol Evol 8(3):507-518. 17. Lu HL, et al. (2011) Expansion of genes encoding piRNA-associated argonaute proteins in the pea aphid: diversification of expression profiles in different plastic morphs. PLoS One 6(12):e28051. 18. Ortiz-Rivas B, et al. (2012) Evolutionary study of duplications of the miRNA machinery in aphids associated with striking rate acceleration and changes in expression profiles. BMC Evol Biol 12:216. 19. Hain D, et al. (2010) Natural variation of the amino-terminal glutamine-rich domain in Drosophila argonaute2 is not associated with developmental defects. PLoS One 5(12):e15264. 20. Hahn MW (2009) Distinguishing among evolutionary models for the maintenance of gene duplicates. J Hered 100(5):605-617. 21. Innan H & Kondrashov F (2010) The evolution of gene duplications: classifying and distinguishing between models. Nat Rev Genet 11(2):97-108. 22. Ghildiyal M & Zamore PD (2009) Small silencing RNAs: an expanding universe. Nat Rev Genet 10(2):94-108.

97 Chapter 5: Discussion & Perspectives

23. Ishizu H, Siomi H, & Siomi MC (2012) Biology of PIWI-interacting RNAs: new insights into biogenesis and function inside and outside of germlines. Genes Dev 26(21):2361-2373. 24. Robine N, et al. (2009) A broadly conserved pathway generates 3'UTR-directed primary piRNAs. Curr Biol 19(24):2066-2076. 25. Jakob U, Gaestel M, Engel K, & Buchner J (1993) Small heat shock proteins are molecular chaperones. J Biol Chem 268(3):1517-1520. 26. Hendrick JP & Hartl FU (1993) Molecular chaperone functions of heat-shock proteins. Annu Rev Biochem 62:349-384. 27. Feder ME & Hofmann GE (1999) Heat-shock proteins, molecular chaperones, and the stress response: evolutionary and ecological physiology. Annu Rev Physiol 61:243-282. 28. Enomoto Y, et al. (2006) Enhanced immunogenicity of heat shock protein 70 peptide complexes from dendritic cell-tumor fusion cells. J Immunol 177(9):5946-5955. 29. Azad P, Zhou D, Russo E, & Haddad GG (2009) Distinct mechanisms underlying tolerance to intermittent and constant hypoxia in Drosophila melanogaster. PLoS One 4(4):e5371. 30. Merkling SH, et al. (2015) The heat shock response restricts virus infection in Drosophila. Sci Rep 5:12758.

98

99