Proteomic Characterization of Novel Alternative Splice Variant Proteins in Human Epidermal Growth Factor Receptor 2/Neu–Induced Breast Cancers

Published OnlineFirst April 13, 2010; DOI: 10.1158/0008-5472.CAN-09-2631 Published Online First on April 13, 2010 as 10.1158/0008-5472.CAN-09-2631

Integrated Systems and Technologies Cancer Research Proteomic Characterization of Novel Alternative Splice Variant Proteins in Human Epidermal Growth Factor Receptor 2/neu–Induced Breast Cancers

Rajasree Menon and Gilbert S. Omenn

Abstract Multifaceted alternative splicing in cancer cells greatly diversifies protein structure independently of genome changes, but the characterization of cancer-associated splice variants is quite limited. In this study, we used mass spectrometric data to interrogate a custom-built database created with three-frame translations of mRNA sequences from Ensembl and ECgene to find alternative splice variant proteins. In mass spectrometric files from liquid chromatography tandem mass spectrometry (LC-MS/MS) analyses of normal mouse mammary glands or mammary tumors derived from conditional human epidermal growth factor receptor 2 (Her2)/neu transgenic mice, we identified a total of 608 alternative splice variants, of which peptides from 216 proteins were found only in the tumor sample. Among the 608 splice variants were 68 novel proteins that were not completely matched to any known protein sequence in mice, for which we found known functional motifs. Biological process enrichment analysis of the splice variants identified suggested the involvement of these proteins especially in cell motility and translation initiation. The cancer-associated differentially expressed splice variant proteins offer novel biomarker candidates that may function in breast cancer progression or metastasis. Cancer Res; 70(9); OF1–10. ©2010 AACR.

Introduction frame translations of mRNA sequences from the ECgene and Ensembl databases (5, 6). The ECgene database is a large By means of alternative splicing and post-translational publicly available alternative splice variant database. The modifications, one gene can generate a variety of proteins. peptide sequences identified are analyzed using Blast and Alternative splice events that affect the protein-coding region Blat searches and integrated to distinct proteins. We are an- ofthemRNAwillgiverisetoproteinsthatdifferintheir alyzing proteomic data sets from mouse models for several sequence and activities. Alternative splicing within the non- human cancers. Our study of the KRasG12D/Ink4a-Arf mouse coding regions of the RNA can result in changes in regulatory model of human pancreatic ductal adenocarcinoma identi- elements such as translation enhancers or RNA stability do- fied known and novel alternative splice variants from mouse mains, which may dramatically influence protein expression plasma and found significant differential expression in pro- (1). Alternative splicing has been associated with such dis- teins of the mutant compared with normal (6). Here, we pres- eases as growth hormone deficiency, Fraser syndrome, cystic ent the alternative splice variant analysis of data from fibrosis, spinal muscular atrophy, and myotonic dystrophy LC-MS/MS analyses of tumor and normal mammary tissue (2, 3). In cancers, there are examples of every kind of alter- from a mouse model of human epidermal growth factor native splicing, including alternative individual splice sites, receptor 2 (her2)/neu–driven breast cancer (7). Many novel alternative exons, and alternative introns (4). and known splice variants were detected only in the tumor We have devised a proteomic informatics approach to sample. These variants may affect the mechanisms of cancer identify alternative splice variants of both known and novel progression and metastasis. proteins. Briefly, we search mass spectrometric data against a custom-built, nonredundant database created with three- Materials and Methods

Authors' Affiliation: Center for Computational Medicine and Whiteaker and colleagues (7) performed LC-MS/MS of Bioinformatics, University of Michigan, Ann Arbor, Michigan tumor and normal mammary tissue from a conditional Note: Supplementary data for this article are available at Cancer human epidermal growth factor receptor 2/neu–driven Research Online (http://cancerres.aacrjournals.org/). mouse model of breast cancer, identifying 6,758 peptides Corresponding Author: Rajasree Menon, Center for Computational Medicine and Bioinformatics, University of Michigan, 2017 Palmer Com- representing >700 proteins. We downloaded their mzXML mons Building, 100 Washtenaw Avenue, Ann Arbor, MI 48109-2218. files containing the spectral information from the Peptide- Phone: 734-615-9720; Fax: 7346156553; E-mail: [email protected]. Atlas (8). The original study reported that cancerous and nor- doi: 10.1158/0008-5472.CAN-09-2631 mal tissues were harvested from five doxycycline-inducible, ©2010 American Association for Cancer Research. MMTV-rtTA/TetO-NeuNT mice and five normal mice,

www.aacrjournals.org OF1

Menon and Omenn

respectively, processed separately into tissue lysates. Two Paulovich at the Fred Hutchinson Cancer Research Center in pools were prepared, containing equal mass of protein, and Seattle, WA. RNA purification and the qRT-PCR methods digested by trypsin for mass spectrometric analysis. The were the same as described (6). mzXML files were searched against our modified ECgene Among the 45 novel peptides identified only in the tumor database for alternative splice variant analysis using the sample,wewereabletodesignprimerpairswithoptimal X!Tandem software (9). The modified ECgene database was properties for 32; these primers amplified the novel mRNA constructed by combining the Ensembl 40 and ECgene data- sequences corresponding to each of those 32 peptides (Sup- bases (mm8, build 1) as previously described (6). plementary Table S1). The expression of rodent glyceralde- Figure 1 summarizes the analytic work flow that was hyde 3-phosphate dehydrogenase (gapdh) was determined slightly modified from the method used previously that uti- as an internal control. The analyses were done on tissue sam- lized both the TransProteomicPipeline and the Michigan ples from five pairs of normal and tumor-containing mice, Peptide-to-Protein Integration (MPPI) analyses; the Trans- and the mean mRNA expression values and SDs were calcu- ProteomicPipeline Q3Ratio and XPRESS applications were lated accordingly. According to Whiteaker and colleagues (7), necessary for the quantitation of acrylamimde-labeled plas- tumor-containing and normal mice were paired at weaning ma samples (6). No such labeling was performed in and were matched with respect to age, sex, litter, cage, and the Her2/neu breast cancer analysis, so MPPI was sufficient. treatment protocols. Peptides that were identified by the X!Tandem search with a false discovery rate of <1% (based on peptides identified from Annotation of novel peptides reverse sequences) were used in our first peptide-to-protein To characterize the novel peptides identified, tools includ- integration (MPPI) analysis. For the threshold applied on ing ELM and Motif Scan were used. ELM is a resource peptide identifications to give a false discovery rate of <1%, for predicting functional sites in eukaryotic proteins (10). they have to be identified either with the X!Tandem expect Motif Scan scans a sequence against protein profile data- value of <0.001 or with three or more spectra with an expect bases (11). The parameters used for searching functional value of <0.01. We applied a threshold to the final integrated motifs in Motif Scan were frequent match producers (“prosite alternative splice proteins so that each protein had to be patterns”) and prosite profiles. We also used the Berkeley identified by two or more distinct peptides or, if identified Drosophila Genome Project's Splice Site Prediction by Neu- by a single peptide, by three or more spectra with an expect ral Network (12) predicting alternative splice sites that may value of <0.01. have generated these novel peptides.

Quantitative reverse transcription-PCR validations of Differential expression of known alternative splice novel peptides variants Quantitative reverse transcription-PCR (qRT-PCR) was The MPPI method integrates the peptide identifications to performed to observe the differential mRNA expression of a set of proteins and reduces the final set of proteins while novel peptides in tumor versus normal samples. The mRNA retaining all of the peptide identifications (6). The integrated samples from the mammary tissues of tumor-bearing and list of proteins is given in Supplementary Table S2, combin- normal mice were provided by the laboratory of Dr. Amanda ing those identified with unique peptide and those based on

Figure 1. The flow chart displaying the analytic work flow of the X!Tandem search results for the identification of alternative splice variant proteins.

OF2 Cancer Res; 70(9) May 1, 2010 Cancer Research

Splice Isoforms in Her2/neu Breast Cancer Model

the total number of distinct peptides and spectra (6). For the summarized in Table 1. The total of 608 distinct alterna- analysis of differential expression analysis, we focused our tive splice variants includes 540 known and 68 novel pro- attention to the proteins that were identified by unique pep- teins with peptides that did not align to any known mouse tides. If the known variant with unique peptides was identi- protein sequence; details of each protein are given in Sup- fied only in one sample type, we considered it as differentially plementary Table S2. Based on one or more distinct pep- expressed if its unique peptide was identified by three or more tide identifications, we found 216 more distinct proteins spectra with the X!Tandem expect value of <0.01. from the tumor sample than from the normal sample A spectral counting method was used to determine the (505:289). A similar ratio was found when the threshold differential expression of proteins based on peptides that for protein identification based on peptides was more strin- were identified from both tumor and normal tissue samples. gent (Table 1). The total number of spectra that were identified with the X!Tandem expect value of <0.01 for a particular protein Novel protein identifications was used as the spectral count value. The normalized spec- Detailed peptide sequence analysis showed 68 proteins tral counts for the proteins were statistically validated using (54 proteins from the tumor sample and 23 proteins from G test (13). G test is a likelihood ratio test for goodness-of-fit. the control sample) with peptide sequences that did not The calculated G value was then used to assess whether align with known mouse protein sequences. These proteins the protein was differentially expressed according to the χ2 are considered novel identifications. There were nine novel distribution table with one degree of freedom. The proteins proteins found to be in common from both samples. Among with G larger than 3.84 are differentially expressed with P <0.05. these 68 novel proteins, we found splice variants resulting from new translation start sites, new splice sites, extension Protein interactions or shortening of exons, deletion or switch of exons, intron Ontology enrichment analysis was performed to assess retention, and translation in an alternative reading frame overall functional character of the tumor-associated variants. (Supplementary Table S3). The gene symbols of the tumor-associated variants, including the differentially expressed variants and the novel variants qRT-PCR validations of novel variants found only in the tumor sample, were uploaded into Meta- As described in Materials and Methods, we were able Core, a systems biology pathway analysis tool (14). The Me- to design optimal primers for 32 of the 45 novel peptides taCore enrichment analysis matches the data set to terms in found only in the tumor sample. Reverse transcription- the GeneGo functional ontologies, providing a ranked repre- PCR (RT-PCR) successfully amplified each of the mRNAs sentation of ontologies that are most saturated or “enriched” corresponding to these 32 peptide sequences (Fig. 2A) in with the input data. For this sample set, we used a general both normal and tumor samples. The novel mRNA for enrichment category, GeneGo Biological Processes. This eukaryotic translation initiation factor 4B (eIf4b) showed ontology represents prebuilt networks of manually curated amplification only in the tumor sample in the sample pair protein-protein, protein-compound/metabolite, or protein- shown in Fig. 2A; three of the other four sample pairs assayed nucleic acid interactions, assembled by GeneGo scientific for this eIf4b novel mRNA did amplify in the normal. Al- annotators based on curated literature evidence. Each Gene- though the novel peptide from lethal (3) malignant brain Go Process Network represents a comprehensive biological tumor like protein 3 (l3mbtl3) variant shows weak amplifi- process with a specific functional theme. Similar analysis cations in the gel image, faint bands of correct size were was done using the gene symbols of all alternative splice visible in the gel under UV light. variants identified in the tumor sample. Curiously, the RT-PCR gel showed that the primers we Direct protein interactions were displayed by the Cytoscape designed for the novel peptide “EYPDRIMNTFSLTTP- Michigan Molecular Interactions (MiMI) plugin (15) using the TYGDLNHLVSATMSGVTTCLR” of tubulin, β 2c (tubb2c) 460 parent gene symbols of the 505 alternative splice variants amplified a product of 201 bp in size instead of the 63 bp identified from the tumor sample. The Cytoscape MiMI plugin expected. The primers were “gagtacccagaccgcatcat” (EYP- enables one to connect to the MiMI database and view the in- DRI) and “tggttgagatcgccataggt” (TYGDLN). These primer teractions. The MiMI database gathers data from well-known sequences occur with 5′ and 3′ ends of a peptide sequence protein interaction databases and deep merges the informa- (67 amino acids) of known variant of tubb2c gene; the am- tion. We used the protein interactions from the Human Pro- plification of the 201-bp band we observed was actually tein Reference Database (HPRD) in MiMI. All the information the mRNA sequence that translated to this known peptide. in the Human Protein Reference Database has been manually Hence, we validated only 31 instead of 32 novel peptides at extracted from the literature by expert biologists who read, the mRNA level. interpreted, and analyzed the published data. Figure 2B shows the relative mRNA expressions corresponding to the 31 novel peptides by qRT-PCR. Except Results for peptides from clathrin heavy peptide and superoxide dis- mutase 1 soluble (sod1), the mean RNA expression values of Summary of alternative splice variant identifications all peptides, along with their SDs, from the sets of five pairs Numbers of alternative splice variant protein identi- of samples indicated increased mRNA expression in the fications from the X!Tandem search analyses (Fig. 1) are tumor samples.

www.aacrjournals.org Cancer Res; 70(9) May 1, 2010 OF3

Menon and Omenn

Table 1. Summary of total number of alternative splice proteins after the analyses shown in Fig. 1

Total alternative splice variant identifications based on All identifications ≥3 distinct peptides 2 distinct peptides 1 distinct peptide

Detected in tumor 505 (54) 349 (39) 86 (4) 70 (11) Detected in normal 289 (23) 207 (17) 45 (2) 37 (4) Detected in both 186 (9) 116 (6) 7 6 (1)

NOTE: The novel protein identifications are given in parentheses.

LC-MS/MS data can be of low accuracy; however, the vali- sion by PCR, had functional motif annotations that may be dation of 31 of the 32 novel peptides by qRT-PCR provides potentially significant in cancers. confidence to our findings. Supplementary Fig. S1 contains Two variants with interesting annotations for BRCA. the MS/MS spectra of the following 16 novel peptides. • The peptide sequence “FSRAEAEGPGQACPPRPFPC” is in the second intronic region of the leucine-zipper- Annotation of novel peptides upregulated in tumor containing LZF (rogdi) gene. Using Splice Site Prediction sample by Neural Network, we found a predicted donor splice ELM and Motif Scan analyses were used (see Materials site “gactgaggtgaggtg” in which the novel peptide was and Methods) to find functional motifs in the novel peptides. identified as a coding sequence, with a Splice Site The following 16 novel peptides identified only in the tumor Prediction score of 0.93. Many functional motifs were sample by proteomic analysis, with increased mRNA expres- identified in this section of intronic sequence including

Figure 2. A, electrophoresis gel images showing the RT-PCR amplifications. The original picture was cropped using Adobe Photoshop. RT-PCR analyses of 31 novel peptides in breast tissue lysates from Her2/neu mice with breast tumors and normal mice. The amplifications are loaded as pairs (left, tumor; right, normal). Gapdh was used as the positive control (fourth panel). Last lane, molecular weight markers. The primers designed for novel tubb2c variant sequence amplified a peptide sequence of the known tubb2c variant, which is 201-bp long. B, quantification of mRNA using Real-time PCR. Messenger RNA levels of 31 novel variants were measured by real-time quantitative RT-PCR in breast tissue lysates of normal and tumor mice using a SyberGreen PCR assay (five mice per group). The values in the tumor sample are shown relative to the level of expression in the normal. Columns, mean of the relative expression level in the tumor; bars, SD.

OF4 Cancer Res; 70(9) May 1, 2010 Cancer Research

Splice Isoforms in Her2/neu Breast Cancer Model

LIG_BRCT_BRCA1_1, a phosphopeptide motif that ENSMUSP00000055535, this peptide was translated in a directly interacts with low affinity with the BRCT (car- different frame and contains a CK2 phosphorylation site. boxy terminal) domain of the breast cancer gene BRCA1. • Amino acids “YPPSSAGERGGFNKPG” of the peptide • The University of California at Santa Cruz Blat analysis “YPPSSAGERGGFNKPGGPMDEGPDL” aligned to the showed that the peptide “GSGLVPTLGRGAETPVSGA- end of the intronic 9 region of the RNA-binding protein GATRGLSR” identified from a tumor sample aligns to EWS (ewsr1) and the remaining part of the novel peptide the first intronic region of transcription factor sox7. matched to the exon 10 sequence. The part of the peptide Predicted splice sites and the same LIG_BRCT_BRCA1_1 from the intronic region has a CK2 phosphorylation site. motif were found in this intronic region. • Amino acids “DAP” of the peptide “ITFDDHKNGSCGV- Two variants annotated with tyrosine-based sorting SYIAQEPDAP” are from the intron 40 of filamin β ( flnb); signal motif. Tyrosine-based sorting signal motif mediates a CK2 phosphorylation site is found at this intronic re- rapid internalization from the cell surface (16). Tyrosine- gion. In addition, the amino acid sequence “AQEPDAP” based internalization of the neu proto-oncogene product is a motif recognized by SH3 domains with a noncano- (17) makes the following two novel variants interesting. nical class I recognition specificity. • A novel variant of tyrosine 3-monooxygenase/trypto- • Peptide “EARSLSDGGPADSVEAAK,” which identified phan 5-monooxygenase activation protein (ywhah) was the novel variant of nucleosome assembly protein 1-like identified the by peptide “RARLAEQASAMKAVTELNEP”; 4, is translated from the Ensembl exon1-exon 3 junction this peptide has seven amino acids missing when com- of the nap1l4 gene. We found that the “SLSD” amino pared with the known ywhah peptide sequence “RAR- acids match a CK2 phosphorylation site. LAEQAERYDDMASAMKAVTELNEP.” The missing • A novel variant of pyruvate kinase muscle (pkm2) was “ERYDDMA” sequence has the tyrosine-based sorting identified by the peptide “GHPGPEVWGGAGCGHGV- signal motif. CIFPAAVGAVEASFK”; “GHPGPEVWGGAGCGHGVCIF” • Peptide “IYYSFGALKLGCFNFPLLKFL,” identified by three is from the middle section of exon 6 (ENSMUSE00000- distinct spectra in tumor samples, did not align to any 218447) and “PAAVGAVEASFK” is from the middle known mouse gene region by the University of California section of exon 9 (ENSMUSE00000533471). Two N- at Santa Cruz Blat, but aligned perfectly to a region in myristoylation and one PKC phosphorylation sites mouse chromosome 7. Blat alignment showed sequence were found in this peptide sequence. conservation in dog, horse, human, orangutan, and rat. • A variant of ferritin heavy chain 1 was identified by ELM functional motifs TRG_ENDOCYTIC_2 and LIG_ “ATETARLLPGTALAEAQSPLRRLTLTQAPPR,” which MAPK_2 were found in this peptide. TRG_ENDOCYTIC_2 aligned to the 5′UTR sequence; PKC phosphorylation is a tyrosine-based sorting signal responsible for inter- and N-myristoylation sites are present here. action with the μ subunit of adaptor protein complex. • Peptide “ PPPSLSLLAPSPSLLALGALAAAWA- LIG_MAPK_2 is a mitogen-activated protein kinase dock- SAAGPLSGRFSMVIDNGIV” is from the translation of ing motif. entire intron 5 of peroxiredoxin-5 (prdx5) gene; N-myris- Twelve variants with casein kinase II phosphorylation, toylation and PKC phosphorylation sites are found in protein kinase phosphorylation, and N-myristoylation this peptide sequence. sites (listed alphabetically). Increased level of phosphor- • Peptide “GTRGDGEGDGGDPVTAR” is translated from ylation of the proteins related to breast cancers has been Ensembl exon 1 (ENSMUSE00000468886) of Ras-related observed in many studies (18, 19). protein Rap-1b (rap1b). Currently annotated rap1b • Peptide “AICPLVPPLPGQVIHHCQSLS” aligned to the 5′ protein does not contain the exon 1 sequence. Exon 1 of untranslated region (UTR) of the Rho GDP dissociation rap1b contains CK2 phosphorylation, N-myristoylation, inhibitor α (arhgdia) gene; this region contains CK2 and PKC phosphorylation sites. phosphorylation and N-myristoylation sites. • Peptide “RGQKPPAMPQPVPTA” aligned to known ribo- • A variant of casein α s1 (csn1s1) was identified by somal protein S3 (rps3) with a deletion of 87 amino acids peptide “SEEQAMASAQEAMTP,” translated from the between “RGQ” and “PPAMPQPVPTA.” Unlike the pep- end of exon 8 (ENSMUSE00000597730), exon 9 tides annotated above, this peptide shows deletions of (ENSMUSE00000695124), and the end of intron 9. This two CK2 and one PKC phosphorylation sites. sequence contains a CK2 phosphorylation site, USP7 NTD domain–binding motif variant, and a major Differentially expressed known alternative splice TRAF2-binding consensus motif. variants • Peptide “RHSPSVNFHPDSTFD” aligned to the first intro- We found 53 known splice variants that were identified by nic region of the CTD small phosphatase-like protein unique peptides as differentially expressed by our analysis (ctdspl) gene. Glutamine amidotransferase type 1 domain (Supplementary Table S4 lists these variants with their and a CK2 phosphorylation site were found in this peptide. unique peptides; Table 2). • A variant of ATP-dependent RNA helicase (ddx17) was identified by “DSAAPAAAPTAEAPPPPSVITRPEPQALPSS- Motif Scan analysis VIR” that aligned to the 5′UTR region. In contrast to pep- Supplementary Table S5 shows all the motifs identified tides identified from the known Ensembl variant in differentially expressed known splice variants using

www.aacrjournals.org Cancer Res; 70(9) May 1, 2010 OF5

Menon and Omenn

Table 2. Differentially expressed known alternative splice variants that were identified by unique peptides

Splice variant ID (gene symbol; ENSMUSP0000XXXXXXX) Sample Expression in tumor

0100045 (akr1b3), 0099394 (aoc3), 0028610 (cat), 0026148 (cbr2), Both Down 0069209 (ephx2), ref|NP_001116075.1| (fcgbp), 0101805 (fhl3), 0087494 (ldb3), 0022148 (mccc2), 0061227 (pgm2), 0058321 (ptrf) 0099634 (acadvl), 0026495 (atp5a1), 0091371(cryab), 0030742 (mecr), Normal Down gb|EDL35553.1| (pdlim3), 0023161(srl) 0042351(acaa1a), 0035829 (akap12), 0018186 (cyb5x3), 0021220 (nme1), Both Up 0000590 (rdx), 0032998 (rps3), 0038113 (tardbp), 0030187 (tln), 0022369 (vcl), 0024866 (xdh) 0047665 (adk), 0050076 (adrm1), 0031447 (anxa3), 0054634 (cdc42), Tumor Up 0032779 (ctsc), 0021062 (ddx5), 0032992 (eif3c), 0054583 (fbln1), 0037268 (hnrnpu1l), 0030547 (hspg2), 0034426 (kars), 0007814 (khsrp), 0044827 (mybbp1a), 0016771 (myh9), 0001480 (npepps), 0029941(pdlim5), 0018803 (pnpo), 0111309 (ranbp1), 0034524 (rexo2), 0016072 (rrbp1), 0045073(sf3b3), 0047410(tax1bp3), 0099807(uba2), 0075782(ubqln1), 0033540(vbp1), 0070427(zyx)

Motif Scan with prosite patterns and prosite profiles as search selected for validation were successfully amplified from tu- parameters. Table 3A shows the top five frequently occurring mor and control tissue lysates. In the original study by prosite patterns in the 53 known differentially expressed splice Whiteaker and colleagues (7), a quantitative multiple reac- variants. CK2 phosphorylation, PKC phosphorylation, and tion monitoring mass spectrometry (MRM-MS) analysis N-myristoylation sites were found 1.5 times more frequently was performed to confirm the overexpression of 15 biomark- in differentially expressed variants than in 53 randomly select- er candidates in the tumor tissue lysate. We were able to ed normal proteins. We refer to these 53 known alternative identify 10 of these proteins in our splice variant analysis splice variants along with the 45 novel proteins found only (Supplementary Table S7). Overall, we found 216 more dis- in tumor sample as “tumor-associated variants.” tinct proteins in the tumor sample than in the normal tissue. Although differential detection of a peptide in two such sam- Protein interaction networks ples may be due to sampling issues in LC-MS/MS experi- Statistically significant biological process networks by ments, the large difference observed here is probably due Metacore analyses of tumor-associated variants (Table 3B) to a higher abundance of many cellular proteins and greater and all variants identified in the tumor sample (Supplemen- cellularity in tumor tissue versus normal. tary Table S6). Cytoskeleton rearrangement, integrin-mediated Functional motif analyses of the differentially expressed cell adhesion, and translation initiation are found in com- known variant and novel sequences showed frequent occur- mon among the top ranking networks from both analyses. rences of N-myristoylation, PKC, and CK2 phosphorylation Figure 3 shows the direct protein interactions displayed by sites. Elevated levels of CK2 have long been associated with the Cystoscape MiMI plugin. This figure shows 177 of 460 increased cell growth and proliferation both in normal and input gene symbols interacting. The gene names in bold cancer cells (21). The field of protein myristoylation is still denote the differentially expressed alternative splice variants, in its infancy; however, Shrivastav and colleagues (22) re- including many of the variants annotated above. Neverthe- ported a potent inhibitor for N-myristoylation as a novel mo- less, it is important to mention here the limitation of these lecular target for cancer. PKC is a family of serine/threonine interaction analyses as we are using only the alternative kinases that is involved in the transduction of signals for cell splice variants identified in the tumor sample, which is a proliferation and differentiation. Mackay and colleagues (23) small subset of the total proteome in this tissue. suggested PKCs as potential targets for antibreast cancer drug. The direct protein-protein interactions of 179 proteins Discussion identified in the tumor sample displayed by the Cytoscape plugin (Fig. 3) point to the possible involvement of these Alternative splicing allows a single gene to generate mul- variants in Her2/neu breast cancer mechanisms. The interac- tiple mRNAs, which can be translated into functionally and tions between differentially expressed variants of cell division structurally diverse proteins (20). In this study of the Her2/ cycle 42 (cdc42), radixin (rdx), arhgdia, and methionyl amino- neu mouse model of human breast cancers, we identified a peptidase (metap2) are noteworthy (Fig. 3). Known and novel total of 608 distinct splice variants from tumor and control peptides of arhgdia were identified by our analysis. Arhgdia samples; 68 proteins were proteins with novel peptides that directly interacts with the ezrin/rdx/moesin-CD44 system, were not previously reported in protein databases. With qRT- initiating the activation of the Rho subfamily members PCR, the mRNA sequences of 31 novel peptide sequences including cdc42, which then regulate the reorganization of

OF6 Cancer Res; 70(9) May 1, 2010 Cancer Research

Splice Isoforms in Her2/neu Breast Cancer Model

actin filaments (24). Actin reorganization is a key step components (actin microfilaments and microtubules), estab- in metastasis (25). The novel peptide of arhgdia is from lishment and disruption of cell matrix and homotypic/ the 5′UTR sequence that contains a CK2 phosphorylation heterotypic cell-cell adhesions, and extracellular proteolysis site and a N-myristoylation site. Arhgdia, cdc42, and rdx (31). The GeneGo enrichment analysis showed cdc42, fibulin are previously implicated in breast cancer mechanisms 1 (fbln1), rdx, talin (tln), vinculin (vcl), and zyxin (zyx) were (26–28). But the role of metap2 is not yet clear. Tucker and involved in cell motility (Table 3B). colleagues (29) analyzed the expression of metap2 in cancer CDC42 is a small GTPase of the Rho subfamily, which reg- patient samples by immunohistochemistry; moderate-to- ulates signaling pathways that control diverse cellular func- high staining was identified in the majority of breast, colon, tions including cell morphology, migration, endocytosis, and lung, ovarian, and prostate carcinomas examined. In our cell cycle progression (32), and is increased in human breast analysis, the peptide that identified the variant for metap2 tumors (26). Phosphorylation activates cdc42; a potential site is a novel peptide from the currently annotated 5′UTR for protein kinase–mediated phosphorylation, corresponding region. The qRT-PCR analysis showed an increased mRNA to serine185, has been identified in the amino acid sequence expression of this novel peptide in tumor sample (Fig. 2B). of Cdc42 (33). The Ensembl variant of cdc42, “EN- The common top-ranking biological processes by the SMUSP00000054634,” which was overexpressed in tumor, GeneGo enrichment analysis of tumor-associated and all had the same protein length of 191 amino acids as its other variants identified in the tumor sample were cytoskeleton known variant “ENSMUSP00000030417.” However, “EN- rearrangement, integrin-mediated cell adhesion, and transla- SMUSP00000054634” has an additional PKC site (aa 185–187). tion initiation (Table 3B). Cytoskeleton rearrangement and Fbln1 is upregulated in breast cancer (34). By Motif Scan integrin-mediated cell adhesion are essential parts of cell search, we found that the fbln1 variant ENSMUSP00000054583, motility processes (30). We found biologically interesting identified in tumor, did not have the cyclic AMP (cAMP)– and functional annotations for variants involved in cell motility cyclic guanosine 3′,5′-monophosphate (cGMP)–dependent and translation initiation processes. PKC site reported for the other known Ensembl variant of fbln1, ENSMUSP00000105058. Instead, this variant had addi- Cell motility tional one CK2 and three PKC phosphorylation sites. cGMP- Motility and invasiveness of breast cancer cells are the dependent protein kinase II inhibits cell proliferation (35), result of a number of cell activities: directional migration whereas CK2 and PKC phosphorylations are known to activate underpinned by the dynamic organization of cytoskeletal many oncoproteins (36, 37).

Table 3. Functional annotations of differentially expressed alternative splice variants

A. Top five Prosite patterns identified using Motif Scan in the 53 differentially expressed known alternative splice variants compared with 50 randomly selected proteins identified from normal sample. The number in parentheses indicate the number of occurences of Prosite patterns or frequent match producers Prosite patterns in differentially expressed known variants Prosite patterns in randomly selected normal proteins

CK2 phosphorylation site (558) PKC phsophorylation site (393) N-myristoylation (486) CK2 phosphorylation site (382) PKC phsophorylation site (466) N-myristoylation (326) N-glycosylation site (127) N-glycosylation site (94) Amidation site (55) cAMP- and cGMP-dependent PKC site (48)

B. Statistically significant GeneGo biological process networks among the differentially expressed splice variants by the Metacore Ontology enrichment analysis Network process P Gene symbols of differentially expressed alternative splice variants

Cytoskeleton_regulation of cytoskeleton rearrangement 4.45E-09 actn,cdc42,flnb,rdx,tln,vcl,ywhaz,zyx Cell adhesion_integrin-mediated cell-matrix adhesion 2.91E-08 actn,cdc42,flnb,rhogdia,rdx,tln,vcl,zyx Immune_phagocytosis 7.27E-05 actn,cdc42,rdx,vcl,vcp Cell adhesion_amyloid proteins 1.40E-04 actn,cdc42,flnb,hspg2,nrxn3,rhogdia Response to hypoxia and oxidative stress 2.99E-04 cat,gapdh,gsto1,prdx5,sod1,xdh Cell adhesion_platelet aggregation 3.52E-04 actn,tln,pla2,rap1b Development_neurogenesis: axonal guidance 5.79E-04 actn, cdc42, myh9,rdx,rhogdia,ywhah Cell adhesion_synaptic contact 5.98E-04 actn,cdc42,nrxn3,ywhah Cytoskeleton_intermediate filaments 1.47E-03 actn,tubb2c,ywhah Translation_translation initiation 1.89E-03 eif4b,rpl6,rps2,rps3,rps24

www.aacrjournals.org Cancer Res; 70(9) May 1, 2010 OF7

Menon and Omenn

Figure 3. Protein interaction network displayed by the MiMI-Cytoscape plugin. The parent gene symbols of the alternative splice variants found only in the tumor sample were used as the input gene list. Only the direct interactions between the input genes are shown. For example, note the interactions of cdc42, rdx, arhgdia, and metap2 (see text, Discussion).

The proline-rich motifs in specific variants of rdx (EN- sists of a FERM domain, binds an NPxY motif within the SMUSP00000000590), vcl (ENSMUSP00000022369), and zyx cytoplasmic tail of most integrin subunits and strengthens (ENSMUSP00000070427) participate in delivering actin integrin adhesion to the extracellular matrix. According to monomers to specific cellular locations where actin-rich Huang and colleagues (39), the Cdk5 phosphorylation of membrane protrusions, such as ruffles, filopodia, and micro- the longer variant of tln1 at Ser425 controls its turnover, ad- spikes, are formed. These protrusions are necessary for cell hesion stability, and, ultimately, cell migration. The absence motility (38). Interestingly, the other known variants of these of FERM domain and cdk5 binding sites in the shorter genes did not contain the proline-rich region. The EN- variant suggests an alternative role of this protein in cell SMUSP00000070427 variant of zyx had two more CK2 phos- adhesion and cell migration. phorylation sites than the other known variant of zyx. We found ENSMUSP00000103533, the shortest variant of Translation initiation tln1 (121-aa long), only in the tumor sample, whereas the Translation initiation was another top-ranking process in peptides from the longer variant, ENSMUSP00000030187 the GeneGo enrichment analysis. Ribosomal proteins and (2,541-aa long), were found in both samples. The longer translational regulation have been implicated in the control variant is upregulated in tumor (Table 2). Tln is involved in of cellular transformation, tumor growth, aggressiveness, and cytoskeleton rearrangement and integrin-mediated cell adhe- metastasis (40), including differential expression in breast sion (Table 3B). The amino terminal head of tln, which con- cancer (41–43). We identified differentially expressed known

OF8 Cancer Res; 70(9) May 1, 2010 Cancer Research

Splice Isoforms in Her2/neu Breast Cancer Model

and novel variants of ribosomal proteins and eukaryotic tein (tardbp) differed from the canonical peptide sequence translation intiation factors (Supplementary Tables S3 by four amino acids (“GSMQ” instead of “ACGL”). Tardbp and S4). We identified novel peptides from 5′UTR regions is a DNA- and RNA-binding protein that regulates transcrip- of 12 genes (Supplementary Table S3), which suggests alter- tion and splicing. The substitution of the amino acids in the native translation start sites in these genes. The identifica- novel variant may affect its DNA-binding function. tion of 13 eukaryotic translation initiation factors and 19 We found tumor-associated peptides from the noncoding ribosomal proteins (Supplementary Table S2) from tumor intronic regions of genes; these variants may be involved in sample compared with 4 eukaryotic translation initiation fac- breast cancer mechanisms. We noted in Results the occur- tors and 4 ribosomal proteins in control sample (Supplemen- rence of functional motifs that bind with breast cancer gene tary Table S2) indicates more complex RNA translation brca1 in the intronic regions of rogdi and sox7 genes, where mechanisms in this Her2/neu cancer model. The expression we identified novel peptides. Messenger RNA expression of of ENSMUSP00000032992, the longer eIf3c variant, is in- the novel peptides from the rogdi and sox7 gene showed increased in the tumor sample. This protein contains a bipar- creased mRNA expressions in tumor samples (Fig. 2B). tite nuclear localization signal (Supplementary Table S5), Novel peptides aligned to 5′UTR regions suggest alterna- which suggests that it may be transported to the nucleus. tive translation initiation sites. Variants of ddx17 and There is some evidence of eIf3c occurring in the nucleus con- l3mbt3 were identified by such peptides. Ddx17 (p72) is sistent with reports of intranuclear protein translation and reported to be part of the transcriptional complex that binds regulation of protein translation by interaction with the to many Sp1 sites on the BRCA2 promoter to activate its COP9 signalosome (44). A novel variant of eukaryotic trans- transcription by inducing histone acetylations (49). The lation initiation factor 4 subunit b (eIf4b) was upregulated human-l (3)mbt3 gene has been mapped to chromosome ∼6-fold in tumor, as shown in Fig. 2B, by qRT-PPCR; further- 20q12. Major genetic alterations of this region, including more, its amplification failed in two control samples of the large deletions and translocations, have not been reported; five sample pairs assayed. eIf4b is a RNA-binding protein that however, amplification of 20q11-13 is common in breast greatly enhances the activity of eIf4a. cancers and correlates with poor prognosis (50). A known variant of rps3, ENSMUSP00000032998, identified In summary, this study has identified known and novel by a unique peptide, showed increased expression in tumor. splice variants including many with higher expression in This variant has a proline-rich region that is absent in the tumor tissue from mice with doxycycline-inducible, MMTV- other known variant of the same gene. RpS3 is critically in- rtTA/TetO-NeuNT–mediated breast cancer versus wild-type volved in translation as a component of the 40S ribosomal mice. These tumor-associated splice variant proteins may subunit and participates in the processing of DNA damage, have roles in many mechanisms related to breast cancer functioning as a damage DNA endonuclease (45). A novel progression and metastasis. The functional motif analyses variant of the same gene identified by “RGQKPPAMPQPVP- of novel peptides show the presence or absence of many rel- TA,” with increased mRNA expression by qRT-PCR, has a evant functional sites. These data suggest that alternative deletion of 87 aa when compared with the known variant. splice variant proteins are a potential source of candidate The absence of two CK2 and one PKC phosphorylation sites biomarkers for Her2/neu and other breast cancers. Further in this novel variant may influence its function in translation studies will be necessary to elucidate the splice mechanisms, or DNA repair. to delineate major subtypes of breast cancer, and to evaluate these variant proteins as potential biomarkers in humans. Differentially expressed novel variants Except for the novel peptides of clathrin heavy peptide and Disclosure of Potential Conflicts of Interest sod1, all the other 29 novel peptides validated by qRT-PCR showed increased mRNA expressions in the tumor sample No potential conflicts of interest were disclosed. (Fig. 2B). These novel peptides were identified only in the Acknowledgments tumor sample by proteomic analysis, which suggests their potential roles in breast cancer mechanisms. The inverse cor- We thank Dr. Amanda Paulovich and Travis Lorentzen for providing the relation observed for the mRNA protein expression of clathrin tissue samples for RT-PCR validations, Dr. Ram Menon for providing access heavy peptide and sod1 peptides might be due to numerous to his laboratory to perform RT-PCRs, Dr. David States for early encouragement in this series of studies, and Denise Taylor-Moon for assistance with manuscript factors, including negative feedback by the protein variant preparation. on mRNA synthesis, post-transcriptional control of protein translation, protein modifications, and different time course Grant Support features. There are several studies showing varying correlation between mRNA and protein abundance ratios (46, 47). National Cancer Institute/SAIC contract N01-CO-12400/Sub-k 23XS110, Identification of a novel peptide from the pkm2 gene is of MTTC GR 687, and U54 DA021519 National Center for Integrative Biomedical Informatics. interest as pkm2 is known to play metabolic roles in breast The costs of publication of this article were defrayed in part by the payment cancer (48). Two N-myristoylation sites and a PKC phosphor- of page charges. This article must therefore be hereby marked advertisement in ylation site were found in this peptide sequence. The novel accordance with 18 U.S.C. Section 1734 solely to indicate this fact. peptides of arhgdia, fth1, pkm2, prd5, and rap1b had N-myr- Received 07/27/2009; revised 02/15/2010; accepted 02/15/2010; published istoylation sites. The novel peptide of tar DNA-binding pro- OnlineFirst 04/13/2010.

www.aacrjournals.org Cancer Res; 70(9) May 1, 2010 OF9

Menon and Omenn

References 1. Bracco L, Kearsey J. The relevance of alternative RNA splicing to 27. Fernando H, Martin TA, Douglas-Jones A, Kynaston HG, Mancel RE, pharmacogenomics. Trends Biotechnol 2003;21:346–53. Jiang WG. Expression of the ERM family members (ezrin, radixin and 2. Faustino NA, Cooper TA. Pre-mRNA splicing and human disease. moesin) in breast cancer. Exp Ther Med 2010;1:153–60. Genes Dev 2003;17:419–37. 28. Ellenbroek S, Collard J. Rho GTPases: functions and association 3. Garcia-Blanco MA, Baraniak AP, Lasda EL. Alternative splicing in with cancer. Clin Exp Metastasis 2007;24:657–72. disease and therapy. Nat Biotech 2004;22:535–46. 29. Tucker LA, Zhang Q, Sheppard GS, et al. Ectopic expression of 4. Venables JP, Klinck R, Bramard A, et al. Identification of alternative methionine aminopeptidase-2 causes cell transformation and splicing markers for breast cancer. Cancer Res 2008;68:9525–31. stimulates proliferation. Oncogene 2008;27:3967–76. 5. Fermin D, Allen B, Blackwell T, et al. Novel gene and gene model 30. Lauffenburger DA, Horwitz AF. Cell migration: a physically integrated detection using a whole genome open reading frame analysis in molecular process. Cell 1996;84:359–69. proteomics. Genome Biol 2006;7:R35. 31. Bracke ME, Maeseneer D, Marck V, et al. Cell motility and breast 6. Menon R, Zhang Q, Zhang Y, et al. Identification of novel alternative cancer metastasis. Metastasis Breast Cancer 2007:47–75. splice isoforms of circulating proteins in a mouse model of human 32. Vega FM, Ridley AJ. Rho GTPases in cancer cell biology. FEBS Lett pancreatic cancer. Cancer Res 2009;69:300–9. 2008;582:2093–101. 7. Whiteaker JR, Zhang H, Zhao L, et al. Integrated pipeline for mass 33. Forget MA, Desrosiers RR, Gingras D, Beliveau R. Phosphorylation spectrometry-based discovery and confirmation of biomarkers dem- states of Cdc42 and RhoA regulate their interactions with Rho onstrated in a mouse model of breast cancer. J Proteome Res 2007; GDP dissociation inhibitor and their extraction from biological 6:3962–75. membranes. Biochem J 2002;361:243–54. 8. PeptideAtlas. 2009 (cited; Available from: http://www peptideatlas 34. Greene LM, Twal WO, Duffy MJ, et al. Elevated expression and org/repository/). altered processing of fibulin-1 protein in human breast cancer. Br J 9. Craig R, Beavis RC. TANDEM: matching proteins with tandem mass Cancer 2003;88:871–8. spectra. Bioinformatics 2004;20:1466–7. 35. Swartling FJ, Ferletta M, Kastemar M, Weiss WA, Westermark B. 10. The Eukaryotic Linear Motif resource for Functional Sites in Proteins: Cyclic GMP-dependent protein kinase II inhibits cell proliferation, Functional site prediction. 2009 (cited; Available from: http://elm.eu.org/). Sox9 expression and Akt phosphorylation in human glioma cell lines. 11. MyHits: MotifScan. 2009 (cited; Available from: http://myhits.isb-sib. Oncogene 2009;28:3121–31. ch/cgi-bin/motif_scan). 36. Luscher B, Kuenzel EA, Krebs EG, Eisenman RN. Myc oncoproteins 12. Berkeley Drosophila Genome Project: Splice Site Prediction by are phosphorylated by casein kinase II. EMBO J 1989;8:1111–9. Neural Network 2008 (cited; Available from: http://www.fruitfly.org/ 37. Boyle DM, van der Walt LA. Enhanced phosphorylation of progester- seq_tools/splice.html). one receptor by protein kinase C in human breast cancer cells. J 13. Ambatipudi KS, Lu B, Hagen FK, Melvin JE, Yates JR. Quantitative Steroid Biochem 1988;30:239–44. analysis of age specific variation in the abundance of human female 38. Holt MR, Koffer A. Cell motility: proline-rich proteins promote protru- parotid salivary proteins. J Proteome Res 2009;8:5093–102. sions. Trends Cell Biol 2001;11:38–46. 14. Nikolsky Y, Ekins S, Nikolskaya T, Bugrim A. A novel method for gen- 39. Huang C, Rajfur Z, Yousefi N, Chen Z, Jacobson K, Ginsberg MH. eration of signature networks as biomarkers from complex high Talin phosphorylation by Cdk5 regulates Smurf1-mediated talin head throughput data. Toxicol Lett 2005;158:20–9. ubiquitylation and cell migration. Nat Cell Biol 2009;11:624–30. 15. Gao J, Ade AS, Tarcea VG, et al. Integrating and annotating the 40. Zhu Y, Lin H, Li Z, Wang M, Luo J. Modulation of expression of interactome using the MiMI plugin for cytoscape. Bioinformatics ribosomal protein L7a (rpL7a) by ethanol in human breast cancer 2009;25:137–8. cells. Breast Cancer Res Treat 2001;69:29–38. 16. Bonifacino JS, Dell'Angelica EC. Molecular bases for the recognition 41. Sharma P, Sahni N, Tibshirani R, et al. Early detection of breast of tyrosine-based sorting signals. J Cell Biol 1999;145:923–6. cancer based on gene-expression patterns in peripheral blood cells. 17. Gilboa L, Ben-Levy R, Yarden Y, Henis YI. Roles for a cytoplasmic Breast Cancer Res 2005;7:R634–R44. tyrosine and tyrosine kinase activity in the interactions of neu recep- 42. Henry JL, Coggin DL, King CR. High-level expression of the tors with coated pits. J Biol Chem 1995;270:7061–7. ribosomal protein L19 in human breast tumors that overexpress 18. Cicenas J, Urban P, Vuaroqueaux V, et al. Increased level of phos- erbB-2. Cancer Res 1993;53:1403–8. phorylated akt measured by chemiluminescence-linked immunosor- 43. Al-Maghrebi MAY, Anim JT, Olalu AA. Up-regulation of eukaryotic bent assay is a predictor of poor prognosis in primary breast cancer elongation factor-1 subunits in breast carcinoma. Anticancer Res overexpressing ErbB-2. Breast Cancer Res 2005;7:R394–R401. 2005;25:2573–7. 19. Lee MY, Joung YH, Lim EJ, et al. Phosphorylation and activation of 44. Yahalom A, Kim TH, Winter E, Karniol B, von Arnim AG, Chamovitz STAT proteins by hypoxia in breast cancer cells. Breast 2006;15: DA. Arabidopsis eIF3e (INT-6) associates with both eIF3c and the 187–95. COP9 signalosome subunit CSN7. J Biol Chem 2001;276:334–40. 20. Wang H, Hubbell E, Hu J-s, et al. Gene structure-based splice variant 45. KimT-S,KimHD,KimJ.PKC[δ]-dependent functional switch of deconvolution using a microarry platform. Bioinformatics 2003;19: rpS3 between translation and DNA repair. Biochimica et Biophysica i315–22. Acta (BBA) - Mol Cell Res 2009;1793:395–405. 21. Trembley J, Wang G, Unger G, Slaton J, Ahmed K. Protein kinase 46. Gygi SP, Rochon Y, Franza BR, Aebersold R. Correlation between CK2 in health and disease. Cell Mol Life Sci 2009;66:1858–67. protein and mRNA abundance in yeast. Mol Cell Biol 1999;19: 22. Shrivastav A, Pasha MK, Selvakumar P, et al. Potent inhibitor of 1720–30. N-myristoylation: a novel molecular target for cancer. Cancer Res 47. Washburn MP, Koller A, Oshiro G, et al. Protein pathway and complex 2003;63:7975–8. clustering of correlated mRNA and protein expression analyses in Sac- 23. Mackay HJ, Twelves CJ. Protein kinase C: a target for anticancer charomycescerevisiae. Proc Natl Acad Sci U S A 2003;100:3107–12. drugs? Endocr Relat Cancer 2003;10:389–96. 48. Luftner D, Mesterharm J, Akrivakis C, et al. Tumor type M2 pyruvate 24. Takahashi K, Sasaki T, Mammoto A, et al. Direct interaction of the kinase expression in advanced breast cancer. Anticancer Res 2000; Rho GDP dissociation inhibitor with ezrin/radixin/moesin initiates 20:5077–82. the activation of the Rho small G protein. J Biol Chem 1997;272: 49. JinW,ChenY,DiGH,etal.Estrogenreceptor(ER)β or p53 23371–5. attenuates ERα-mediated transcriptional activation on the BRCA2 25. Daisuke Y, Shusaku K, Tadaomi T. Regulation of cancer cell motility promoter. J Biol Chem 2008;283:29671–80. through actin reorganization. Cancer Sci 2005;96:379–86. 50. Koga H, Matsui S, Hirota T, Takebayashi S, Okumura K, Saya H. 26. Fritz G, Brachetti C, Bahlmann F, Schmidt M, Kaina B. Rho GTPases A human homolog of Drosophila lethal(3)malignant brain tumor in human breast tumours: expression and mutation analyses and (l(3)mbt) protein associates with condensed mitotic chromosomes. correlation with clinical parameters. Br J Cancer 2002;87:635–44. Oncogene 1999;18:3799–809.

OF10 Cancer Res; 70(9) May 1, 2010 Cancer Research

Proteomic Characterization of Novel Alternative Splice Variant Proteins in Human Epidermal Growth Factor Receptor 2/neu− Induced Breast Cancers

Rajasree Menon and Gilbert S. Omenn

Cancer Res Published OnlineFirst April 13, 2010.

Updated version Access the most recent version of this article at: doi:10.1158/0008-5472.CAN-09-2631

Supplementary Access the most recent supplemental material at: Material http://cancerres.aacrjournals.org/content/suppl/2010/04/13/0008-5472.CAN-09-2631.DC1

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/early/2010/04/13/0008-5472.CAN-09-2631. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.