US008513209B2 a2) United States Patent (10) Patent No.: US8,513,209 B2 Olsonetal. (45) Date of Patent: Aug. 20, 2013
(54) MICRO-RNAS OF THE MIR-15 FAMILY 2008/0220423 Al 9/2008 Moller et al. MODULATE CARDIOMYOCYTE SURVIVAL 2009/0053718 Al 2/2009 Naguibnevaetal. 2009/0092980 Al 4/2009 Arenzetal. AND CARDIAC REPAIR 2009/0131356 Al 5/2009 Baderetal. 2009/0176723 Al 7/2009 Brownetal. (75) Inventors: Eric Olson, Dallas, TX (US); Eva van 2009/0214477 Al 8/2009 Betz et al. Rooij, Boulder, CO (US) 2009/0221685 Al 9/2009 Esau et al. 2009/0226528 Al 9/2009 Czechet al. (73) Assignee: The Board of Regents, The University 2009/0281167 Al 11/2009 Shenet al. tT Svst ‘Austin. TX (US 2009/0286969 Al 11/2009 Esau etal. of Texas System, Austin, (US) 2009/0286973 Al 11/2009 Manoharan et al. TX 2009/0291906 Al 11/2009 Esau et al. (*) Notice: Subject to any disclaimer, the term of this 2009/0291907 Al 11/2009 Esauetal. patent is extended or adjusted under 35 2009/0293148 Al 11/2009 Renetal. USS.C. 154(b) by 0 days. 2009/0298174 Al* 12/2009 Esauetal. eccccccceee 435/375 2009/0306181 Al* 12/2009 Ikedaetal. . . 514/44A . 2009/0326049 Al 12/2009 Aristarkhovet al. = (21) Appl. No.: 12/742,233 2010/0029003 Al 2/2010 Bartel et al. . 2010/0069471 Al 3/2010 Manoharan et al. (22) PCTFiled: Nov. 10, 2008 2010/0087512 Al 4/2010 Tuschletal. 2010/0087513 Al 4/2010 Tuschletal. (86) PCT No.: PCT/US2008/083020 2010/0093837 Al 4/2010 Tuschletal. 2010/0099748 Al 4/2010 Tuschletal. § 371 (c)(1), 2010/0113284 Al 5/2010 Aristarkhovetal. (2), (4) Date: Aug, 24, 2010 2010/0113561 Al 5/2010 Tuschlet al. FOREIGN PATENT DOCUMENTS (87) PCT Pub. No.: WO2009/062169 EP 1627925 Al 2/2006 PCT Pub. Date: May14, 2009 EP 1676914 Al 7/2006 EP 1777301 A2 4/2007 (65) Prior Publication Data EP 1959012 A2 8/2008 EP 2105145 Al 9/2009 US 2010/0317713 Al Dec. 16, 2010 EP 2113567 Al 11/2009 JP 2006-506469 2/2006 Related U.S. Application Data JP 2006-519008 8/2006 . ae Continued (60) Provisional application No. 60/986,798,filed on Nov. (Continued) 9, 2007. OTHER PUBLICATIONS
(51) Int. Cl. Lagos-Quintanaet al.,“New microRNAs from mouse and human,” A6IK 48/00 (2006.01) RNA, vol.9: 175-179, 2003. a Lagos-Quintanaet al., “Identification of tissue-specific microRNAs (52) USPCU.S. Cl.oo. 514/44; 536/24.5; 536/24.1; 536/24.31 fiPOR MOUSCyCcATCTit BiolPHONY: VON1. DELI12:735-739,ODIs2002 . :. Sempere et al., “Expression profiling of mammalian microRNAs (58) meld of Classification Search uncoversa subset ofbrain-expressed microRNAswith possible roles one in murine and human neuronal differentiation”’ Genome Biology, See application file for complete search history. vol. 5:R13, 2004. Van Rooijj et al., “A signature patter of stress-responsive microRNAs (56) References Cited that can evoke cardiac hypertrophy and heart failure,’ Proc. Natl. Acad. Sci. USA, vol. 103: 18255-18260, 2006. U.S. PATENT DOCUMENTS Landgrafet al., “A mammalian microRNAexpression atlas based on 7,232,806 B2 6/2007 Tuschlet al. small RNAlibrary sequencing,” Cell, vol. 129, 1401-1414, 2007. 7,482,117 B2 1/2009 Cargill etal. Landgrafet al., “A mammalian microRNAexpressionatlas based on 7,582,744 B2 9/2009 Manoharan etal. small RNA library sequencing,” Cell, Supplementary Tables S12, 7,759,319 B2* 7/2010 Lolloetal. ww... 514/44R 2007. 2005/0026169 Al 2/2005 Cargill et al. . 2005/0059005 Al 3/2005 Tuschlet al. (Continued) 2005/0075492 Al 4/2005 Chenetal. 2005/0182011 Al 8/2005 Olsonet al. Primary Examiner — Kimberly Chong 2006/0058266 Al 3/2006 Manoharan etal. (74) Attorney, Agent, or Firm — Cooley LLP 2006/0105360 Al 5/2006 Croce et al. 2006/0165659 Al 7/2006 Croceet al. 2006/0185027 Al 8/2006 Bartelet al. (57) ABSTRACT 2006/0189557 Al 8/2006 Slack et al. A family of microRNAs, called the miR-15 family, which 2006/0247193 Al 11/2006 Taira et al. 2006/0252722 Al 11/2006 Lollo et al. includes miR-195, are shown to be up-regulated during 2007/0026403 Al 2/2007 Hatzigeorgiouetal. pathological cardiac remodeling and repress the expression 2007/0054287 Al 3/2007 Bloch of mRNAsrequired for cell proliferation and survival, with 2007/0213292 Al 9/2007 Stoffel et al. consequent loss of cardiomyocytes. Strategies to block 2007/0259827 Al 11/2007 Aronin et al. expression ofthe miR-15 family in the heart as a treatment for 2007/0287179 Al 12/2007 Tuschlet al. 2007/0292878 Al 12/2007 Raymond. diverse cardiac disease are provided. 2008/0050744 Al 2/2008 Brownetal. 2008/0176766 Al 7/2008 Brownetal. 27 Claims, 9 Drawing Sheets
US 8,513,209 B2 Page 2
(56) References Cited WO WO 2008/073920 A2 6/2008 WO WO 2008/073921 A2 6/2008 WO WO 2008/073922 A2 6/2008 FOREIGN PATENT DOCUMENTS WO WO 2008/073923 A2 6/2008 JP 2006-292367 10/2006 WO WO 2008/074328 A2 6/2008 WO WO 03/029459 A2 4/2003 WO WO2008/085797 A2 7/2008 WO WO 03/093441 A2 11/2003 WO WO2008/112226 A2 9/2008 — WO WO2004/043387 A2 5/2004 WO WO2008/116267 Al 10/2008 WO WO2004/076622 A2 9/2004 WO WO 2008/147430 A2 12/2008 WO WO 2005/013901 A2 2/2005 WO WO 2008/147839 Al 12/2008 WO WO2005/017145 Al 2/2005 WO WO 2009/012263 A2 1/2009 WO WO 2005/040419 Al 5/2005 WO WO 2009/043353 A2 4/2009 WO WO2005/056797 Al 6/2005 WO WO 2009/044895 Al 4/2009 WO WO2005/078096 A2 8/2005 WO WO2009/058818 A2 5/2009 WO WO 2005/078139 A2 8/2005 WO WO 2009/062169 A2 5/2009 WO WO2005/097205 A2 10/2005 WO WO2009/121031 Al 10/2009 WO WO2005/098029 A2 10/2005 WO WO2009/149182 Al 12/2009 WO WO2005/118806 A2 12/2005 WO WO 2010/036939 A2 4/2010 WO WO2006/020768 A2 2/2006 WO WO 2010/048585 A2 4/2010 WO WO 2006/048553 Al 5/2006 WO WO 2006/063356 Al 6/2006 WO WO 2006/071884 A2 7/2006 OTHER PUBLICATIONS WO WO 2006/108473 Al 10/2006 Van Rooij et al., “Control of stress-dependent cardiac growth and — WO WO2006/111512 Al 10/2006 gene expression by a microRNA,”Science, vol. 316: 575-579, 2007. — wo wo sooeseat “ Ioeoe Van Rooijj et al., “MicroRNA function during cardiac hypertrophy,” Wo WO 2007/000668 A2 1/2007 Abstract and Poster from 3rd Annual Symposium of the American WO WO 2007/021896 A? 3/2007 Heart Association Council on Basic Cardiovascular Sciences: Trans- WO WO 2007/033023 A2 3/2007 lation of Basic Insights Into Clinical Practice: Jul. 31-Aug. 3, 2006 WO WO 2007/044362 A2 4/2007 Keystone Conference Ceneter Keystone, CO. WO WO2007/053184 A2 5/2007 Ping et al., “The Study and Use of Antisens Oligonucleotide Tech- — WO WO2007/056826 Al 5/2007 nique in Cardiovascular Disease,” Chinese Journal of Clinical Phar- wo wo sooosoeor “ Seer macology and Therapeutics, vol. 11: 241-245, 2006. Wo WO 2007/090073 A2 8/2007 English Translation of Examination Report for Chinese Application Wo WO 2007/092181 A2 8/2007 No. 200880124495.1 issued Nov. 14, 2011. WO WO 2007/092182 A2 8/2007 Seranski, Supplementary European Search Report and Opinion for WO WO 2007/095387 A2 8/2007 European Application No. 08847645.2, 9 pages, European Patent WO WO 2007/103808 A2 9/2007 Office, Munich, mailed Jan. 27, 2012. WO WO 2007/112754 A2 10/2007 Young, Written Opinion of the International Search Authority for — WO WO 2007/147067 A2 12/2007 PCT/US2008/083020, 7 pages, mailed May 13, 2009. — WO WO2007/147409 A2 12/2007 x “« : » : = Wo WO 2008/024499 A2 3/2008 ‘oung, “International Search Report,” 4 pages, from International wo WO 2008/036776 A2 3/2008 Patent Application No. PCT/US08/83020, USPTO, Alexandria, Vir- WO WO 2008/042231 A2 4/2008 ginia, US (mailed May 13, 2009). WO WO 2008/043521 A2 4/2008 WO WO2008/061537 A2 5/2008 * cited by examiner U.S. Patent Aug.20, 2013 Sheet 1 of 9 US 8,513,209 B2
SHiw
PPL
excU
poje(nBeJ-umog
MO) ~~
[UCeCoNPREcLeV ae “gh ulnaulaje9 g1uabsuel De _ nai
UO sf
syiw
m-lI
poye|nBe-dy
nM pepueg
oM-S D1BIOUL soy
lar
h-leleltmrd
ulinaurgyeo od
ps A}
av AVL PIM
[eee]
ulneulojeo
Aq Aq Aq
LUO
pajejnbey payeinBay pajeinbey
yZ
a-Vb
pue
ainBbig U.S. Patent Aug.20, 2013 Sheet 2 of 9 US 8,513,209 B2
YUD
Gbsb
Pyle pBL-LJU yiw
LN
lu i
SYNNOJOIW
OS} Me]
B66)
yi DeLeleeVML-leP yl poye;nBeiumog
‘yuo £6
=S6L yyw lw
IM
m8
Nl
SVNHOlDIW qGZb
WUD.LM- 562
M-JURMCeM-NTanl-2eloltcm Yi uw poleinBoudn . Pe
yw gee yi
yi \belee eed
YUD yi
IM. pe)
(etm
WUD_LM be
yw rd
OP
eunbiy
= = U.S. Patent Aug.20, 2013 Sheet 3 of 9 US 8,513,209 B2
¢ © ® A 4 = Q. Ms miR-24 1.5 a
® ©. a os x fb) miR-125b 1.3 on are ra fe) a 7) << ye a miR-199a 2.1 © , a] = a miR-214 1.6 ™N ® 5 > F U.S. Patent Aug.20, 2013 Sheet 4 of 9 US 8,513,209 B2 a1uaBsuel), SiN|1ej | aur ORIPILD adAy-piiM SBONPUI SY9OM Z S49OM 9 GEL-WNYOJIA siushsuery S6L-yIwW — as x 9¢ € auly =G6L-yiW X odA}-pHIAA 62 ¢ ainBi4 U.S. Patent Aug.20, 2013 Sheet 5 of 9 US 8,513,209 B2 Teles Suyuaz0ys jenonpey or ow of oz 0 OL 09 os 06 on dna Cie SL cS SaIA1 | Am Ld UA AayoUEIp | BL me 2a1nt A’T | aM mec $0 Sz st o . ¥ é ve BL * smd | SSaUPIgT eM - aM Meer UNV BL * WEAA omy AM wo 390 co ecent ¥rQ 9 vt et et at z ‘ 31 mei od S61 At-PIL wu AA mee LACE LS sateen Sol VNU o-Vr anbi4 q U.S. Patent Aug.20, 2013 Sheet 6 of 9 US 8,513,209 B2 adAjousud Bi plz eIpsed edAy-py © MOUS 0} jie} So1UaHSuUe) PLZ-VNYOLDIIN g ein6i-4 U.S. Patent Aug.20, 2013 Sheet 7 of 9 US 8,513,209 B2 {L (6 'ON oN aI aI aI ai GI TGas) aT das) 035) das) oas) das) -WOVANNDONVINVIWISVOaWN ONONNNDDSNVWNVIVOOVOSYNA SO99DNNVNVVYNSOWOOVOaVN 5OD9NNvNVVVNDIVIDVOSWN -DDONNVWNVVVOVOVOOVOOVN NONNNNSNSNIvoOWINWOSVI ‘guebs S6}-y!u STLUtie eg ees O aeP LOC aa WZ Z syobe} 10}98} mele jeans 2d 8]9AD rey ae ‘bd peonpul-qag1 ete ae L-meT ee Ajurey UOISIAIP ‘ba caps WeQ SuljaAD gp-yiw 12194 i6194 zd94 |— Lon [199 bee act Tey Me ee yw | Le | sera a-v9 aunbi4 qd Vv U.S. Patent Aug.20, 2013 Sheet 8 of 9 US 8,513,209 B2 OV OV LO TLOVVLOWS OUWLYYTLY pue aseaoul 6 LSVVLOVOLV VVLVVVLV Jo AqniqelA powad Jsev/at/cp-gr S6E/ST/ soreor-ard yBnoiug "NSU! cos-are LV cos-an cr-ard LOS LO ¢ e ayAooAw LODE LOLS Buymoyoy G6L-YlwW S|}WUaYosS! LoS LID QPDOVDOVPVOVVYVAYHONSS\D azis ey LYOVOVLLOI LV) LYOOGVLLILWO PueJUL saseeiou! LYOVAWLLOLYS---S Aqiqeia + YO Ue WWII Jaye psonpeas ETT WLYD iflsi1weyos! Ainful LV ayAs0AW 10} LY f Ainful VO YOSVOV so/pue YVOVLVSOYOVVOL ~~ opt-al Joie} DV sqAd0AWW saseaiou! VY LYOOOVVOL-WLOVVLLS LYOVOUDOL-V LYOVOVYLL-VLYUVLLS uoouny (et BuLinp 1 De/pued pojoIpeid Liesay ‘on peipsesvoAww Jo ar VLYVLLOVEOS sasesjIapP LOWY ay) auojeq as) S8TTIMe} Ul LLOYD Z-JO4 4 7-494 payejniuiys OQWYPODVO VID UCI}OUNY EOS PU BNATH 7494 Jo OLIOYpLIYVODOY OLODSOL Weey snoueGoxs LOOULILVLyYvy |RAIAINS Panugsuod LOS uolssaisdxauaAo ; OPO D109SAS GSBESruysusT pue ELLLYWYWLL ay} LWW 4 VOUT JO} “AlaAodas []}eo9 Jo U! SaqYs Pue ALA SBACICLU) UONDUN YNWTONDSD uonesjsiuiwpy- WO Lf sisdusboibue paAsasuoz cso4 2uUabsue. cd94d }eUOADUNY "BILUBYDSI Yeu auay » UBLUN}Y > @SNO}W 7-494 7494 Z Boq ULNe JEHY (6T - ainbig (12 ‘on (oz (zz cz aI con ‘on «ox 'OK Oas) ar az at dE das) ous) oas) Ous) U.S. Patent Aug.20, 2013 Sheet 9 of 9 US 8,513,209 B2 ery OL G6T-ulW ST-ulW TUMORI ane, wa , WeeH wee MA (LUC yoeoidde md Rees ,aBuods, [EULION [LU Comets a1Ideds ze deIpsed mete] Erkan a-v8 aanBiy lep dq V US 8,513,209 B2 1 2 MICRO-RNAS OF THE MIR-15 FAMILY diac arrhythmias, endocrine disorders, and genetic mutations MODULATE CARDIOMYOCYTE SURVIVAL in cardiac contractile protein genes. While the hypertrophic AND CARDIAC REPAIR response is initially a compensatory mechanism that aug- ments cardiac output, sustained hypertrophy can lead to CROSS-REFERENCE TO RELATED dilated cardiomyopathy (DCM), heart failure, and sudden APPLICATIONS death. In the United States, approximately half a million individuals are diagnosed with heart failure each year, with a This application is a national stage application of Interna- mortality rate approaching 50%. The causes andeffects of cardiac hypertrophy have been extensively documented, but tional Application No. PCT/US2008/083020,filed Nov. 10, 10 the underlying molecular mechanisms have not been eluci- 2008, which claims the benefit of U.S. Provisional Applica- tion No. 60/986,798, filed Nov. 9, 2007, which is herein dated. Understanding these mechanismsis a major concern in the prevention and treatment of cardiac disease and will be incorporated by referencein its entirety. crucialas a therapeutic modality in designing new drugsthat STATEMENT OF GOVERNMENT SUPPORT specifically target cardiac hypertrophy andcardiac heart fail- 15 ure. This invention was made with grant support undergrantno. Treatment with pharmacological agents still represents the HL53351-06 from the NationalInstitutes of Health. The gov- primary mechanism for reducing or eliminating the manifes- ernmenthas certain rights in the invention. tations of heart failure. Diuretics constitute the first line of treatment for mild-to-moderate heart failure. If diuretics are DESCRIPTION OF THE TEXT FILE SUBMITTED 20 ineffective, vasodilatory agents, such as angiotensin convert- ELECTRONICALLY ing enzyme (ACE) inhibitors(e.g., enalopril and lisinopril) or inotropic agent therapy (i.e., a drug that improves cardiac The contents of the text file submitted electronically here- output by increasing the force ofmyocardial muscle contrac- with are incorporated herein by reference in their entirety: A tion) may be used. Unfortunately, many of these standard computer readable format copy ofthe Sequence Listing(file- 25 therapies have numerous adverse effects and are contraindi- name: MIRG_002__01US_SeqList_ST25 txt, date cated in some patients. Thus, the currently used pharmaco- recorded: Aug. 23, 2010,file size 4 kilobytes). logical agents have severe shortcomingsin particular patient populations. The availability ofnew,safe and effective agents FIELD OF THE INVENTION would undoubtedly benefit patients who either cannot use the 30 pharmacological modalities presently available, or who do The present invention relates generally to the fields of not receive adequate relief from those modalities. developmental biology and molecular biology. More particu- The adult heart is a dynamic organ capable of significant larly, it concerns gene regulation and cellular physiology in remodeling and hypertrophic growth as a meansof adapting cardiomyocytes. Specifically, the inventionrelates to a family function to altered workloads or injury. Hemodynamicstress of miRNAs, designated as the miR-15 family, that regulate 35 or neuroendocrine signaling associated with myocardial inf- cardiomyocyte survival and cardiac repair. Inhibition ofthese arction, hypertension, aortic stenosis, and valvular dysfunc- miRNAsprovides for reduced apoptosis in cardiac cells and tion evoke a pathologic remodeling response through the thus inhibits cardiac hypertrophy andheart failure. activation of intracellular signaling pathways and transcrip- tional mediators in cardiac myocytes. Activation of these BACKGROUND OF THE INVENTION 40 molecular pathways enhances cardiomyocyte size and pro- tein synthesis, induces the assembly of sarcomeres, and Heart disease and its manifestations, including coronary causes reexpression of fetal cardiac genes. Although aspects artery disease, myocardial infarction, congestive heart failure of the hypertrophic response after acute and chronic stress and cardiac hypertrophy, clearly present a major health risk in mayinitially augmentcardiac output, prolonged hypertrophy the United States today. The cost to diagnose, treat and sup- 45 is a major predictor of heart failure and sudden death. There port patients suffering from these diseases is well into the have been major advancesin the identification of genes and billions of dollars. Two particularly severe manifestations of signaling pathways involvedin this disease process, but the heart disease are myocardial infarction and cardiac hypertro- overall complexity of hypertrophic remodeling suggests that phy. With respect to myocardial infarction, typically an acute additional regulatory mechanisms remain to be identified. thrombocytic coronary occlusion occurs in a coronary artery 50 MicroRNAs (miRNAsor miRs) have recently been impli- as a result of atherosclerosis and causes myocardial cell cated in a numberofbiological processes including regula- death. Because cardiomyocytes, the heart muscle cells, are tion of developmental timing, apoptosis, fat metabolism, and terminally differentiated and generally incapableof cell divi- hematopoietic cell differentiation among others. mRNAsare sion, they are generally replaced by scar tissue when they die small, non-protein coding RNAs of about 18 to about 25 during the course of an acute myocardial infarction. Scar 55 nucleotides in length that regulate gene expression in a tissue is not contractile, fails to contribute to cardiac function, sequence-specific manner mRNAsact as repressors of target and often plays a detrimentalrole in heart function by expand- mRNAs by promoting their degradation, when their ing during cardiac contraction, or by increasing the size and sequences are perfectly complementary, or by inhibiting effective radius of the ventricle, for example, becoming translation, when their sequences contain mismatches. hypertrophic. 60 mRNAsare transcribed by RNA polymeraseII (pol II) or With respect to cardiac hypertrophy, one theory regards RNA polymeraseIII (pol IIT; see Qi et al. (2006) Cellular & this as a disease that resembles aberrant developmentand,as Molecular Immunology Vol. 3:411-419) andarise from initial such,raises the question ofwhether developmental signals in transcripts, termed primary miRNA transcripts (pri-miR- the heart can contribute to hypertrophic disease. Cardiac NAs), that are generally several thousand bases long and are hypertrophy is an adaptive response of the heart to virtually 65 derived from individual miRNA genes, from introns of pro- all forms of cardiac disease, including those arising from tein coding genes, or from poly-cistronic transcripts that often hypertension, mechanical load, myocardial infarction, car- encode multiple, closely related miRNAs. See review ofCar- US 8,513,209 B2 3 4 rington et al. (2003). Pri-miRNAs are processed in the family membersis inhibited by administering a nucleic acid nucleus by the RNase Drosha into about 70- to about 100- comprising one or more miR-15 binding sites. A miR-15 nucleotide hairpin-shaped precursors (pre-miRNAs). Fol- binding site may comprise a sequencethat is complementary lowing transport to the cytoplasm,the hairpin pre-miRNA is to aseed sequence ofmiR-15. The one or more miR-15 family further processed by Dicer to produce a double-stranded members may be miR-15a, miR-15b, miR-16-1, miR-16-2, miRNA (Leeet al., 1993). The mature miRNA strandis then miR-195, miR-424 and miR-497. incorporated into the RNA-induced silencing complex The present invention also provides a methodofpreventing (RISC), where it associates with its target mRNAs by base- pathologic hypertrophy or heart failure in a subject in need pair complementarity. In the relatively rare cases in which a thereof. In one embodiment, the method comprises identify- miRNA base pairs perfectly with an mRNAtarget, it pro- 10 ing a subject at risk of developing pathologic cardiac hyper- motes mRNA degradation. More commonly, miRNAs form trophyor heart failure; and inhibiting expression or activity of imperfect heteroduplexes with target mRNAs, affecting one or more miR-15 family membersin heart cells of said either mRNAstability or inhibiting mRNAtranslation. subject. In one embodiment, inhibiting comprises delivering The 5' portion of a miRNAspanning bases 2-8, termed the to the heart cells an inhibitor of one or more miR-15 family ‘seed’ region, is especially important for target recognition 15 members. In another embodiment, the subject at risk may (Krenz and Robbins, 2004; Kiriazis and Kranias, 2000). The exhibit one or more risk factors selected from the group sequence of the seed, together with phylogenetic conserva- consisting of uncontrolled hypertension, uncorrected valvu- tion of the target sequence, forms the basis for many current lar disease, chronic angina, recent myocardial infarction, con- target prediction models. Although increasingly sophisti- genital predisposition to heart disease, and pathological cated computational approachesto predict miRNAsandtheir 20 hypertrophy. targets are becoming available, target prediction remains a Antagomirs, antisense oligonucleotides, inhibitory RNA major challenge and requires experimental validation. molecules, nucleic acids comprising miR-15 binding sites or Ascribing the functions of miRNAsto the regulation of spe- other modulators of the expressionor activity of one or more cific mRNA targets is further complicated by the ability of miR-15 family members may be administered by any method individual miRNAsto base pair with hundreds of potential 25 knownto those in the art suitable for delivery to the targeted high and low affinity mRNA targets and by the targeting of organ, tissue, or cell type. For example, in certain embodi- multiple miRNAsto individual mRNAs. mentsof the invention, the modulator of one or more miR-15 The high sequence conservation of many miRNAsacross family members may be administered by parenteral admin- metazoan species suggests strong evolutionary pressure and istration, such as intravenousinjection,intraarterial injection, participation in essential biologic processes (Reinhart et al., 30 intrapericardial injection, or subcutaneous injection, or by 2000; Stark et al., 2005). Indeed, miRNAs have been shown direct injection into the tissue (e.g., cardiac tissue). In some to play fundamentalroles in diverse biological and pathologi- embodiments, the modulator of one or more miR-15 family cal processes, including cell proliferation, differentiation, members may be administered by oral, transdermal, intrap- apoptosis, and carcinogenesis in species ranging from Cae- eritoneal, subcutaneous, sustained release, controlled release, norhabditis elegans and Drosophila melanogaster to 35 delayed release, suppository, or sublingual routes of admin- humans. However, there remains limited information on the istration. In other embodiments, the modulator ofone or more role that miRNAsplay in cardiogenesis and molecular events miR-15 family members may be administered by a catheter that can contribute to heart disease. system. Thepresent invention also encompassesa transgenic, non- SUMMARYOF THE INVENTION 40 human mammal, the cells ofwhichfail to express a functional form of one or more miR-15 family members(e.g. miR-15a, Thepresent invention provides a method oftreating patho- miR-15b, miR-16-1, miR-16-2, miR-195, miR-424 and miR- logic cardiac hypertrophy, heart failure, or myocardial infare- 497). In another embodiment, the present invention includes tion in a subject in need thereof. In one embodiment, the a transgenic, non-human mammal, the cells of which com- method comprises identifying a subject having cardiac hyper- 45 prise a coding region of a miR-15 family member under the trophy, heart failure, or myocardial infarction; and inhibiting control of a heterologous promoter active in the cells of said expression oractivity ofone or more miR-15 family members non-human mammal. In some embodiments, the mammalis in heart cells of said subject. In another embodiment, the a mouse. method further comprises administering to the subject a sec- The present invention provides a methodfor identifying a ond therapy. The second therapy maybe, for example, a beta 50 modulator of a miR-15 family member comprising (a) con- blocker, an ionotrope, a diuretic, ACE inhibitor, AII antago- tacting a cell with a candidate compound; (b) assessing activ- nist, BNP, a Ca++-blocker, and ERA, or an HDACinhibitor. ity or expression of an miR-15 family member; and (c) com- In some embodiments of the invention, inhibiting the paring the activity or expressionin step (b) with the activity or expression oractivity ofone or more miR-15 family members expression in the absence of the candidate compound, comprises administering an antagomir ofone or more miR-15 55 wherein a difference between the measured activities or family members. In one embodiment, the expressionor activ- expression indicates that the candidate compoundis a modu- ity of one or more miR-15 family members is inhibited by lator of said miR-15 family member. The cell may be con- administering an antisense oligonucleotide that targets the tacted with the candidate compoundin vitro or in vivo. The mature sequence of a miR-15 family member.In yet another candidate compound maybea protein, a peptide, a polypep- embodiment, expression or activity of one or more miR-15 60 tide, a polynucleotide, an oligonucleotide, or small molecule. family members is inhibited by administering an inhibitory The modulator ofa miR-15 family member may be an agonist RNA molecule, wherein the inhibitory RNA molecule com- or inhibitor of the miR-15 family member. The modulator of prises a double stranded region that is at least partially iden- amiR-15 family member maybe an agonistor inhibitor of an tical and complementary to a mature sequence of a miR-15 upstream regulator of the miR-15 family member. family member. The inhibitory RNA molecule may be a 65 The presentinvention also provides a pharmaceutical com- ribozyme, siRNA or shRNA molecule. In still another position comprising an inhibitor of one or more miR-15 fam- embodiment, expression or activity of one or more miR-15 ily members. In one embodiment, the composition 1s formu- US 8,513,209 B2 5 6 lated for injection. In another embodiment, the region among miR-15 family members allows for an addi- pharmaceutical composition is combined with a kit for tional approach to knockdownthe whole miR-15 family. This administration, such as parenteral or catheter administration. approach entails overexpression of multiple miR-15 binding sites underthe control of a cardiac specific promoter, such as BRIEF DESCRIPTION OF THE DRAWINGS the alpha myosin heavy chain promoter (aMHC). Each ofthe miR-15 binding sites contains a sequence complementary to The following drawings form part of the present specifica- the sequenceof the conserved seed region and allows for the tion and are includedto further demonstrate certain aspects of scavenging of all family members, thereby preventing them the present invention. The invention maybebetter understood from binding to their endogenoustargets. by reference to one or more of these drawings in combination 10 with the detailed description of specific embodiments pre- sented herein. DETAILED DESCRIPTION OF ILLUSTRATIVE FIG. 1. miRNAexpression during cardiac hypertrophy. A. EMBODIMENTS H&Estained sections of representative hearts from mice fol- lowing sham andthoracic aortic banding (TAB)for 21 days 15 The present invention is based, in part, on the discovery and from wild-type (WT) and activated calcineurin trans- that members of the miR-15 family of microRNAs, such as genic (CnA Tg) mice. Scale bar equals 2 mm. B. Numbers of miR-195, are upregulated in myocardial tissue from human miRNAsthat were regulated in response to CnA or TABare failing hearts as well as in animal models of pathologic car- indicated. Although some changes were unique for either diac hypertrophy. Cardiac overexpression ofmiR-195 is suf- TAB or CnA-induced hypertrophy, most miRNAsthat were 20 induced or repressed overlapped for the different hyper- ficient to induce cardiac hypertrophy andcanleadto a dilated trophic stimuli. C. Northern blot analysis of particular miR- phenotype. Accordingly, the present invention provides NAs in WT and CnA Tg hearts. U6 RNA wasdetected as a methods of treating or preventing various forms of heart loading control. disease in a subject by inhibiting the expression oractivity of FIG. 2. miRNA expression in humanheart failure. North- 25 one or more members of the miR-15 family in heart cells of ern blot analysis ofmiRNAsin 4 normaland6 failing human the subject. hearts. The average fold-change ofeach miRNAinthe failing The miR-15 family is a small family of microRNAsthat samples is shownatthe right. includes miR-195, miR-16-1, miR-15a, miR-15b, miR-16-2, FIG. 3. Cardiac specific over-expression ofmiRNA 195 is miR-424, and miR-497. Four of the miR-15 family members sufficient to drive cardiomyopathy. H&E stained sections of 30 are expressedas three clustered transcripts (FIG. 6A). MiR- hearts from wild-type (WT) and twodifferent lines of miR- 195 and miR-497 are expressedas a cluster from the intron of 195 transgenic (Tg) animals. miRNA-195 Tg line 3 animals a gene located on chromosome 17. There are two copies of died two weeks after birth due to cardiac dilation. Northern miR-16 located on different chromosomes. One copy (miR- blot analysis on hearts from WTand miR-195 transgenic lines 16-1)is expressed as a cluster with miR-15a from an intron of 1 and 3 confirming a 26.5-fold and 29.2-fold cardiac specific 35 miRNA over-expression, respectively. a gene encoded on chromosome 13. The second copy (miR- FIG. 4. Overexpression of miR-195 induces cardiac dys- 16-2) is expressed as a cluster with 15b from the intron of the function due to cardiac growth. A. Echocardiographic analy- SMC4gene located on chromosome 3. MiR-424is expressed ses indicate miR-195 transgenic (Tg) mice showleft ventricu- from the X chromosome. The pre-miRNA sequences(e.g. lar (LV) dilation and wall thinning, resulting in a decreased 40 stem loop sequences) for each ofthe miR-15 family members fractional shortening compared to wild-type (WT)litter- are listed below: mates. B. Heart weight to body weight ratio increases in response to cardiac specific overexpression of miR-195. C. Realtime PCR analysis shows an upregulation of hyper- Human pre-miR-195 (SEQ ID NO: trophic genes in miR-195 Tg animals compared to WT ani- 45 AGCUUCCCUG GCUCUAGCAG CACAGAAAUA UUGGCACAGG mals (n=3). *P<0.05 compared to wild-type. FIG. 5. Cardiac remodeling specific for miR-195. Over- GAAGCGAGUC UGCCAAUAUU GGCUGUGCUG CUCCAGGCAG expression of miR-195 induces cardiac growth at 2 weeks of GGUGGUG age, which within 6 weeksprogressesto a dilated phenotype. Cardiac over-expression of miR-214 has no phenotypic 50 Human pre-miR-497 effect, indicating the specific effect of miR-195 on cardiac (SEQ ID NO: pathology. Scale bar equals 2 mm. CCACCCCGGU CCUGCUCCCG CCCCAGCAGC ACACUGUGGU FIG. 6. MiR-195is part of the miR-15 family that targets UUGUACGGCA CUGUGGCCAC GUCCAAACCA CACUGUGGUG pro-survival proteins. A. MiR-195 is part of the miR-15 fam- ily that consists of five different miRs: miR-15, miR-16, 55 UUAGAGCGAG GGUGGGGGAG GCACCGCCGA GG miR-195, miR-424, and miR-497. Four ofthe miR-15 family Human pre-miR-16-1 membersare expressed as three clusters of two miRNAs.B. (SEQ ID NO: MiR-15 family members target proteins involved in prolif- GUCAGCAGUG CCUUAGCAGC ACGUAAAUAU UGGCGUUAAG eration, survival and anti-apoptosis. Thus, up-regulation of AUUCUAAAAU UAUCUCCAGU AUUAACUGUG CUGCUGAAGU miR-195 results in down-regulation ofthese mRNAsandcell 60 death. AAGGUUGAC FIG. 7. MiR-195 target sequence in the 3' UTR of FGF2 mRNA. Human pre-miR-16-2 FIG. 8. Enhanced expression ofmiR-15 family members in (SEQ ID NO: GUUCCACUCU AGCAGCACGU AAAUAUUGGC GUAGUGAAAU samples from failing human hearts. A. Left panel shows RNA 65 blots from normal human hearts and right panel shows RNA AUAUAUUAAA CACCAAUAUU ACUGUGCUGC UUUAGUGUGA C blots from failing human hearts. B. The conserved seed US 8,513,209 B2 7 8 -continued activity of one or more miR-15 family members. In one embodiment, the method comprises identifying a subject hav- Human pre-miR-15a ing cardiac hypertrophy, heart failure, or myocardial infarc- (SEQ ID NO: 5) tion; and inhibiting expression or activity of one or more CCUUGGAGUA AAGUAGCAGC ACAUAAUGGU UUGUGGAUUU miR-15 family membersin heart cells of said subject. “Heart UGAAAAGGUG CAGGCCAUAU UGUGCUGCCU CAAAAAUACA AGG cells” as used herein include cardiomyocytes, cardiac fibro- blasts, and cardiac endothelial cells. In another embodiment, Human pre-miR-15b the method comprises administering to the subject an inhibi- (SEQ ID NO: 6) UUGAGGCCUU AAAGUACUGU AGCAGCACAU CAUGGUUUAC tor of one or more miR-15 family members. Instill another 10 embodiment, the method comprises identifying a subject at AUGCUACAGU CAAGAUGCGA AUCAUUAUUU GCUGCUCUAG risk of developing pathologic cardiac hypertrophy or heart failure and inhibiting expression or activity of one or more AAAUUUAAGG AAAUUCAU miR-15 family members in heart cells of the subject. The Human pre-miR-424 subject at risk of developing pathologic cardiac hypertrophy (SEQ ID No: 19) 15 or heart failure may exhibit one or moreriskfactors including, CGAGGGGAUA CAGCAGCAAU UCAUGUUUUG AAGUGUUCUA for example, uncontrolled hypertension, uncorrected valvular AAUGGUUCAA AACGUGAGGC GCUGCUAUAC CCCCUCGUGG disease, chronic angina, recent myocardial infarction, con- genital predispositionto heart disease or pathological hyper- GGAAGGUAGA AGGUGGGG trophy. In certain embodiments, the subject at risk may be Eachof the pre-miRNA sequences for each miR-15 family 20 diagnosed as having a genetic predisposition to cardiac hypertrophy. In some embodimentsofthe invention, the sub- member is processed into a mature sequence and star a ject at risk may have a familialhistory ofcardiac hypertrophy. sequence. The star sequence is processed from the other In another embodiment, the present invention provides a strand of the stem loop structure. The mature and star methodof preventing cardiac hypertrophy anddilated cardi- sequences for each of the miR-15 family membersis given 25 omyopathy in a subject in need thereof comprising inhibiting below: expression oractivity ofone or more miR-15 family members in heart cells of the subject. In yet a further embodiment, the present invention provides a methodof inhibiting progression Human mature miR-195 UAGCAGCACAGAAAUAUUGGC (SEQ ID NO: 7) ofcardiac hypertrophy ina subject in need thereofcomprising 30 inhibiting expression or activity of one or more miR-15 fam- Human miR-195* ily membersin heart cells of the subject. In further embodi- CCAAUAUUGGCUGUGCUGCUCC (SEQ ID NO: 8) ments, the present invention provides a method of increasing Human mature miR-497 exercise tolerance, reducing hospitalization, improving qual- CAGCAGCACACUGUGGUUUGU (SEQ ID NO: 9) ity of life, decreasing morbidity, and/or decreasing mortality 35 in a subject with heart failure or cardiac hypertrophy com- Human miR-497* prising inhibiting expression or activity of one or more miR- CAAACCACACUGUGGUGUUAGA (SEQ ID NO: 10) 15 family membersin heart cells of the subject. Human mature miR-16-1/m1R-16-2 Thus, the present invention provides methodsfor the treat- UAGCAGCACGUAAAUAUUGGCG (SEQ ID NO: 11) ment of cardiac hypertrophy, heart failure, or myocardial 40 infarction utilizing inhibitors of miR-15 family members, Human miR-16-1* CCAGUAUUAACUGUGCUGCUGA (SEQ ID NO: 12) such as miR-195, miR-15a, miR-15b, miR-16-1, miR-16-2, miR-424, and miR-497. Preferably, administration of an Human miR-16-2* inhibitor of a miR-15 family memberresults in the improve- CCAAUAUUACUGUGCUGCUUUA (SEQ ID NO: 13) ment of one or more symptomsof cardiac hypertrophy, heart Human mature miR-15a 45 failure, or myocardialinfarction in the subject, or in the delay UAGCAGCACAUAAUGGUUUGUG (SEQ ID NO: 14) in the transition from cardiac hypertrophyto heart failure. The one or more improved symptoms may be, for example, Human miR-15a* increased exercise capacity, increased cardiac ejection vol- CAGGCCAUAUUGUGCUGCCUCA (SEQ ID NO: 15) ume, decreased left ventricular end diastolic pressure, Human mature miR-15b 50 decreased pulmonary capillary wedge pressure, increased UAGCAGCACAUCAUGGUUUACA (SEQ ID NO: 16) cardiac output, increased cardiac index, lowered pulmonary artery pressures, decreased left ventricular end systolic and Human miR-15b* CGAAUCAUUAUUUGCUGCUCUA (SEQ ID NO: 17) diastolic dimensions, decreased left and right ventricular wall stress, decreased wall tension, increased quality of life, and Human mature miR-424 55 decreased disease related morbidity or mortality. In addition, CAGCAGCAAUUCAUGUUUUGAA (SEQ ID NO: 20) use of inhibitors of miR-15 family members may prevent Human miR-424* cardiac hypertrophy andits associated symptoms from aris- CAAAACGUGAGGCGCUGCUAU (SEQ ID NO: 21) ing. In one embodiment, administration of an inhibitor ofone or more miR-15 family members to a subject suffering from Althoughthe seed region (e.g. bases spanning 2 to 8 nucle- 60 myocardial infarction may reduce infarct size by decreasing otides ofmature miRNA sequence) for all family membersis the loss of heart cells. In another embodiment, cardiac func- highly conserved (AGCAGCAC; SEQ ID NO:18), the 3' end tion is stabilized in a subject suffering from myocardial inf- of the mature miRNA differs among the different family arction following administration of an inhibitor of one or members(FIG. 6A). more miR-15 family members. Thepresent invention provides a method oftreating patho- 65 Inhibition of microRNA function may be achieved by logic cardiac hypertrophy, heart failure, or myocardial infare- administering antisense oligonucleotides targeting a mature tion in a subject in need thereof by inhibiting expression or sequence of a miR-15 family member. The antisense oligo- US 8,513,209 B2 9 10 nucleotides may be ribonucleotides or deoxyribonucleotides. Another approach for inhibiting the function of a miR-15 Preferably, the antisense oligonucleotides have at least one family memberis administering an inhibitory RNA molecule chemical modification. Antisense oligonucleotides may be having a double strandedregionthatis at least partially iden- comprised of one or more “locked nucleic acids”. “Locked tical and partially complementary to a mature sequenceofthe nucleic acids” (LNAs) are modified ribonucleotides that con- miR-15 family member. The inhibitory RNA molecule may tain an extra bridge betweenthe 2' and 4' carbonsofthe ribose be a double-stranded, small interfering RNA (siRNA)or a sugar moiety resulting in a “locked” conformation that con- short hairpin RNA molecule (shRNA) comprising a stem- fers enhanced thermalstability to oligonucleotides contain- loop structure. The double-stranded regions of the inhibitory ing the LNAs. Alternatively, the antisense oligonucleotides RNA molecule may comprise a sequence that is at least may comprise peptide nucleic acids (PNAs), which contain a 10 partially identical and partially complementary, e.g. about peptide-based backbonerather than a sugar-phosphate back- 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% iden- bone. Other chemical modifications that the antisense oligo- tical and complementary, to the mature miRNA sequence. In nucleotides may contain include, but are not limited to, sugar some embodiments, the double-stranded regions of the modifications, such as 2'-O-alkyl (e.g. 2'-O-methyl, 2'-O- inhibitory RNA comprise a sequencethat is at least substan- methoxyethyl), 2'-fluoro, and 4' thio modifications, and back- 15 tially identical and substantially complementary to the bone modifications, such as one or more phosphorothioate, mature miRNA sequence. “Substantially identical and sub- morpholino, or phosphonocarboxylate linkages (see, for stantially complementary”refers to a sequencethatis at least example, U.S. Pat. Nos. 6,693,187 and 7,067,641, which are about 95%, 96%, 97%, 98%, or 99% identical and comple- herein incorporated by reference in their entireties). In some mentary to a target polynucleotide sequence. In other embodiments, suitable antisense oligonucleotides are 2'-O- 20 embodiments, the double-stranded regions of the inhibitory methoxyethyl “gapmers” which contain 2'-O-methoxyethyl- RNA molecule may contain 100% identity and complemen- modified ribonucleotides on both 5' and 3' ends with at least tarity to the target miRNA sequence. ten deoxyribonucleotides in the center. These “gapmers”are The inhibitory nucleotide molecules described hereinpref- capable of triggering RNase H-dependent degradation erably target a mature sequence ofone or more miR-15 family mechanisms of RNA targets. Other modifications of anti- 25 members(e.g. SEQ ID NOs: 7, 9, 11, 14, 16, and 20) or a star sense oligonucleotides to enhancestability and improveeffi- sequence of one or more miR-15 family members (e.g. SEQ cacy, such as those described in U.S. Pat. No. 6,838,283, ID NOs: 8, 10, 12, 13, 15, 17, and 21). Insome embodiments, whichis herein incorporated by reference in its entirety, are inhibitors of miR-15 family members are antagomirs com- knownintheart andare suitable for use in the methods ofthe prising a sequence that is perfectly complementary to a invention. Preferable antisense oligonucleotides useful for 30 mature sequence ofa miR-15 family member. In one embodi- inhibiting the activity ofmicroRNAsare about 19 to about 25 ment, an inhibitor of a miR-15 family memberis an antago- nucleotides in length. Antisense oligonucleotides may com- mir having a sequencethat is partially or perfectly comple- prise a sequencethatis at least partially complementary to a mentary to SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, mature miRNA sequence,e.g. at least about 75%, 80%, 85%, SEQ ID NO: 14, SEQ ID NO: 16, or SEQ ID NO:20. In 90%, 95%, 96%, 97%, 98%, or 99% complementary to a 35 another embodiment, an inhibitor of a miR-15 family mem- mature miRNA sequence. In some embodiments, the anti- ber is an antagomir having a sequence that is partially or sense oligonucleotide may be substantially complementary perfectly complementary to SEQ ID NO: 8, SEQ ID NO:10, to amature miRNAsequence,thatis at least about 95%, 96%, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID 97%, 98%, or 99% complementary to a target polynucleotide NO: 17, or SEQ ID NO:21. sequence. In one embodiment, the antisense oligonucleotide 40 In some embodiments, inhibitors of one or more miR-15 comprises a sequence that is 100% complementary to a family members are chemically-modified antisense oligo- mature miRNA sequence. nucleotides. In one embodiment, an inhibitor of a miR-15 In some embodiments, the antisense oligonucleotides are family member is a chemically-modified antisense oligo- antagomirs. “Antagomirs” are single-stranded, chemically- nucleotide comprising a sequence substantially complemen- modified ribonucleotides that are at least partially comple- 45 tary to SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO: 11, SEQ mentary to the miRNA sequence. Antagomirs may comprise ID NO: 14, SEQ ID NO: 16, or SEQ ID NO:20. In another one or more modified nucleotides, such as 2'-O-methy]-sugar embodiment, an inhibitor of a miR-15 family memberis a modifications. In some embodiments, antagomirs comprise chemically-modified antisense oligonucleotide comprising a only modified nucleotides. Antagomirs may also comprise sequence substantially complementary to SEQ ID NO:8, one or more phosphorothioate linkages resulting in a partial 50 SEQ ID NO:10, SEQ ID NO: 12, SEQ ID NO:13, SEQ ID or full phosphorothioate backbone.To facilitate in vivo deliv- NO: 15, SEQ ID NO: 17, or SEQ ID NO:21. As used herein ery andstability, the antagomir maybe linked to a cholesterol “substantially complementary”refers to a sequencethatis at or other moiety at its 3' end. Antagomirs suitable for inhibit- least about 95%, 96%, 97%, 98%, 99%, or 100% comple- ing miRNAs may be about 15 to about 50 nucleotides in mentary to a target polynucleotide sequence (e.g. mature or length, more preferably about 18 to about 30 nucleotides in 55 precursor miRNA sequence). length, and most preferably about 20 to about 25 nucleotides Antisense oligonucleotides may comprise a sequence that in length.“Partially complementary”refers to a sequencethat is substantially complementary to a precursor miRNA is at least about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, sequence (pre-miRNA)for one or more miR-15 family mem- or 99% complementary to a target polynucleotide sequence. bers (e.g. pre-miR-195, pre-miR-497, pre-miR-424, pre- The antagomirs maybeat least about 75%, 80%, 85%, 90%, 60 miR-15a, pre-miR-15b, pre-miR-16-1, or pre-miR-16-2). In 95%, 96%, 97%, 98%, or 99% complementary to a mature some embodiments, the antisense oligonucleotide comprises miRNAsequence.In some embodiments, the antagomir may a sequencethat is substantially complementary to a sequence be substantially complementary to a mature miRNA located outside the stem-loop region of the pre-miRNA sequence, thatis at least about 95%, 96%, 97%, 98%, or 99% sequence. In one embodiment, an inhibitor of a miR-15 fam- complementary to a target polynucleotide sequence. In other 65 ily memberis an antisense oligonucleotide having a sequence embodiments, the antagomirs are 100% complementary to that is substantially complementary to a pre-miRNA the mature miRNA sequence. sequence selected from the group consisting of SEQ ID NO: US 8,513,209 B2 11 12 1, SEQ ID NO:2, SEQID NO: 3, SEQID NO: 4, SEQID NO: The nucleic acid may contain 1, 2,3, 4, 5, 6, 7, 8, 9, 10, 12, 15, 5, SEQ ID NO:6, and SEQ ID NO:19. or 20 miR-15 binding sites. The multiple miR-15 binding In other embodiments of the invention, inhibitors of one or sites may be adjacent or may be separated by spacersof1, 2, more miR-15 family members may be inhibitory RNA mol- 3, 4, 5, 6, 7, 8, 9, 10 or more nucleotides. ecules, such as ribozymes, siRNAs, or shRNAs. In one In another embodiment, an expression vector may be used embodiment, an inhibitor of a miR-15 family memberis an to deliveran inhibitor ofone or more miR-15 family members inhibitory RNA molecule comprising a double-stranded to a cell or subject. A “vector” is a composition of matter region, wherein the double-stranded region comprises a which can be used to deliver a nucleic acid of interest to the sequence having 100% identity and complementarity to a interior of a cell. Numerous vectors are known in the art mature sequence of a miR-15 family member (e.g. SEQ ID 10 including, but not limited to, linear polynucleotides, poly- NOs: 7, 9, 11, 14, 16, and 20). In another embodiment, an nucleotides associated with ionic or amphiphilic compounds, inhibitor of a miR-15 family memberis an inhibitory RNA plasmids, and viruses. Thus, the term “vector” includes an molecule comprising a double-stranded region, wherein the autonomously replicating plasmid or a virus. Examples of double-stranded region comprises a sequence having 100% viral vectors include, but are not limited to, adenoviral vec- identity and complementarity to a star sequence of a miR-15 15 tors, adeno-associated virus vectors, retroviral vectors, and family member(e.g. SEQ ID NOs: 8, 10, 12, 13, 15, 17, and the like. An expression construct can be replicated in a living 21). In some embodiments, inhibitors of one or more miR-15 cell, or it can be made synthetically. For purposes of this family members are inhibitory RNA molecules which com- application, the terms “expression construct,” “expression prise a double-stranded region, wherein said double-stranded vector,” and “vector,” are used interchangeably to demon- region comprises a sequence of at least about 75%, 80%, 20 strate the application of the invention in a general, illustrative 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity and sense, and are not intended to limit the invention. complementarity to a mature sequence of one or more miR- In one embodiment, an expression vector for expressing an 15 family members. inhibitor ofone or more miR-15 family members comprises a Multiple members of the miR-15 family (e.g. miR-15a, promoter operably linked to a polynucleotide encoding an miR-15b, miR-16-1, miR-16-2, miR-195, miR-424, and 25 antisense oligonucleotide, wherein the sequence of the miR-497) maybe inhibited simultaneously by administering expressed antisense oligonucleotide is partially or perfectly multiple inhibitors, wherein each inhibitor targets a separate complementary to a mature sequence of one or more miR-15 miR-15 family member. For example, in some embodiments, family members. The phrase “operably linked” or “under at least two membersof the miR-15 family are inhibited by transcriptional control” as used herein meansthat the pro- administering two separate inhibitors. In other embodiments, 30 moteris in the correct location andorientation in relation to a at least three members of the miR-15 family are inhibited by polynucleotide to control the initiation of transcription by administering three separate inhibitors. In still other embodi- RNA polymerase and expression of the polynucleotide. In ments, at least four members of the miR-15 family are inhib- another embodiment, an expression vector for expressing an ited by administering four separate inhibitors. In further inhibitor of one or more miR-15 family members comprises embodiments,at least five members of the miR-15 family are 35 one or more promoters operably linked to a polynucleotide inhibited by administering five separate inhibitors. In one encoding a shRNAor siRNA, wherein the expressed shRNA embodiment,all six members ofthe miR-15 family are inhib- or siRNA comprises a double stranded regionthatis identical ited by administering six separate inhibitors. and complementary or partially identical and partially In another embodiment, an inhibitor of miR-15 family complementary to a mature sequence of one or more miR-15 function is a nucleic acid comprising one or more miR-15 40 family members. “Partially identical and partially comple- binding sites. The seed region (AGCAGCAC; SEQ ID NO: mentary”refers to a sequencethatis at least about 75%, 80%, 18) of all the miR-15 family membersis highly conserved. 85%, 90%, 95%, 96%, 97%, 98%, or 99% identical and Therefore, a nucleic acid comprising a binding site having complementary to a target polynucleotide sequence. substantial complementarity to the miR-15 seed sequence In certain embodiments, the nucleic acid encoding a poly- would bind all membersof the miR-15 family. This approach 45 nucleotide of interest is under transcriptional control of a has been analogized to the use of a sponge to “soak up” the promoter. A “promoter”refers toa DNA sequence recognized effective miR-15 family members, thereby reducing the over- by the synthetic machinery ofthecell, or introduced synthetic all pool ofmiRNAsthat could impacta given target sequence. machinery, required to initiate the specific transcription of a The term “miR-15 binding site” as used herein refers to a gene. The term promoterwill be used hereto refer to a group nucleotide sequence that is capable of binding a mature 50 of transcriptional control modules that are clustered around sequence of miR-15a, miR-15b, miR-16-1, miR-16-2, miR- the initiation site for RNA polymeraseI, II, or III. 195, miR-424, miR-497, or combinationsthereof. Preferably, In some embodiments, the human cytomegalovirus (CMV) a miR-15 binding site comprises a sequencethat is substan- immediate early gene promoter, the SV40 early promoter, the tially complementary to the miR-15 seed sequence. The seed Rous sarcomavirus long terminal repeat, rat insulin pro- sequence or seed region refers to nucleotides 2-8 of the 5' 55 moter, and glyceraldehyde-3-phosphate dehydrogenase pro- portion of the mature miRNA sequence. In one embodiment, moter can be used to obtain high-level expression of the the miR-15 binding site comprises the a sequence that is coding sequence of interest. The use of other viral or mam- substantially complementary to of SEQ ID NO: 18. The malian cellular or bacterial phage promoters which are well- inhibitory nucleic acid comprising one or more miR-15 bind- knownin the art to achieve expression ofa coding sequence of ing sites may be from about 20 to about 500 nucleotides in 60 interest is contemplated as well, provided that the levels of length, about 25 to about 400 nucleotides in length, about 30 expression are sufficient for a given purpose. to about 300 nucleotides in length, about 40 to about 200 By employing a promoter with well-known properties, the nucleotides in length, or about 50 to about 100 nucleotides in level and pattern of expression of the polynucleotideof inter- length. For example, the nucleic acid may be 20, 21, 22, 23, est following transfection or transformation can be opti- 24, 25, 26, 27, 28, 29, 30,35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 65 mized. Further, selection of a promoter that is regulated in 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, responseto specific physiologic signals can permit inducible 200, 225, 250, 275, 300, 350, 400, 500 nucleotides in length. expression of the gene product. Tables 1 and 2 list several US 8,513,209 B2 13 14 regulatory elements that may be employed, in the context of expression construct (Table 1 and Table 2). Additionally, any the present invention, to regulate the expression of the poly- promoter/enhancer combination (as per the Eukaryotic Pro- nucleotide of interest (e.g. inhibitor of miR-15 family mem- moter Data Base EPDB)could also be used to drive expres- bers). This list is not intended to be exhaustive of all the sion of the gene. Eukaryotic cells can support cytoplasmic possible elements involved in the promotion of gene expres- sion but, merely, to be exemplary thereof. transcription from certain bacterial promotersifthe appropri- Below is a list of viral promoters, cellular promoters/en- ate bacterial polymerase is provided, either as part of the hancers and inducible promoters/enhancers that could be delivery complex or as an additional genetic expression con- used in combination with the polynucleotide of interest in an struct. TABLE1 Promoter and/or Enhancer Promotetr/Enhancer References Immunoglobulin Heavy Chain Banerji et al., 1983; Gilles et al., 1983; Grossched| et al., 1985; Atchinsonet al., 1986, 1987; Imler et al., 1987; Weinbergeret al., 1984; Kiledjian et al., 1988; Porton et al.; 1990 Immunoglobulin Light Chain Queenet al., 1983; Picard et al., 1984 T-Cell Receptor Luriaet al., 1987; Winoto et al., 1989; Redondo et al.; 1990 HLA DQ aand/or DQ 6 Sullivan et al., 1987 §-Interferon Goodbournet al., 1986; Fujita et al., 1987; Goodbourn etal., 1988 Interleukin-2 Greeneet al., 1989 Interleukin-2 Receptor Greeneet al., 1989; Lin et al., 1990 MHCClass II 5 Kochet al., 1989 MHCClass II HLA-DRa Sherman etal., 1989 f-Actin Kawamotoet al., 1988; Ng etal.; 1989 Muscle Creatine Kinase (MCK) Jaynes et al., 1988; Horlick et al., 1989; Johnson et al., 1989 Prealbumin (Transthyretin) Costaet al., 1988 Elastase I Ornitz et al., 1987 Metallothionein (MTII) Karin et al., 1987; Culottaet al., 1989 Collagenase Pinkert et al., 1987; Angel et al., 1987a Albumin Pinkert et al., 1987; Troncheet al., 1989, 1990 a-Fetoprotein Godboutet al., 1988; Campereet al., 1989 t-Globin Bodineet al., 1987; Perez-Stableet al., 1990 6-Globin Trudel etal., 1987 c-fos Cohenet al., 1987 c-HA-ras Triesman, 1986; Deschampset al., 1985 Insulin Edlundet al., 1985 Neural Cell Adhesion Molecule Hirshet al., 1990 (NCAM) q,-Antitrypain Latimeret al., 1990 H2B (TH2B) Histone Hwanget al., 1990 Mouseand/or Type I Collagen Ripe et al., 1989 Glucose-Regulated Proteins Changet al., 1989 (GRP94 and GRP78) Rat Growth Hormone Larsenet al., 1986 Human Serum Amyloid A (SAA) Edbrookeetal., 1989 Troponin I (TN I) Yutzey et al., 1989 Platelet-Derived Growth Factor Pechet al., 1989 (PDGF) Duchenne Muscular Dystrophy Klamutet al., 1990 Sv40 Banerji et al., 1981; Moreauet al., 1981; Sleigh et al., 1985; Firak et al., 1986; Herr et al., 1986; Imbraet al., 1986; Kadeschet al., 1986; Wang et al., 1986; Ondeket al., 1987; Kuhlet al., 1987; Schaffner et al., 1988 Polyoma Swartzendruberet al., 1975; Vasseuret al., 1980; Katinkaet al., 1980, 1981; Tyndell et al., 1981; Dandolo et al., 1983; de Villiers et al., 1984; Hen et al., 1986; Satake et al., 1988; Campbell and/or Villarreal, 1988 Retroviruses Kriegler et al., 1982, 1983; Levinson et al., 1982; Kriegler et al., 1983, 1984a, b, 1988; Boszeet al., 1986; Miksicek et al., 1986; Celanderet al., 1987; Thiesen et al., 1988; Celanderet al., 1988; Choi et al., 1988; Reisman et al., 1989 Papilloma Virus Campoet al., 1983; Luskyet al., 1983; Spandidos and/or Wilkie, 1983; Spalholz et al., 1985; Lusky et al., 1986; Cripe et al., 1987; Gloss et al., 1987; Hirochika et al., 1987; Stephens et al., 1987 Hepatitis B Virus Bullaet al., 1986; Jameel etal., 1986; Shauletal., 1987; Spandauet al., 1988; Vannice et al., 1988 Human Immunodeficiency Virus Muesinget al., 1987; Hauberet al., 1988; Jakobovits et al., 1988; Feng etal., 1988; Takebe US 8,513,209 B2 15 16 TABLE1-continued Promoter and/or Enhancer Promotetr/Enhancer References et al., 1988; Rosen etal., 1988; Berkhoutet al., 1989; Laspia et al., 1989; Sharp etal., 1989; Braddocketal., 1989 Cytomegalovirus (CMV) Weberet al., 1984; Boshart et al., 1985; Foecking et al., 1986 Gibbon Ape Leukemia Virus Holbrooketal., 1987; Quinn et al., 1989 TABLE 2 be identified in vitro or in vivo by including a marker in the expression construct. Such markers would confer an identi- Inducible Elements 15 fiable changeto the cell permitting easy identificationof cells Element Inducer References containing the expression construct. Usually the inclusion of a drug selection markeraids in cloning andin the selection of MT II Phorbol Ester (TFA) Palmiter et al., 1982; transformants, for example, genes that confer resistance to Heavy metals Haslinger et al., 1985; Searle et al., 1985; Stuart neomycin, puromycin, hygromycin, DHFR, GPT, zeocin and 20 et al., 1985; Imagawa histidinol are useful selectable markers. Alternatively, et al., 1987, Karin et al., enzymes such as herpes simplex virus thymidine kinase (tk) 1987; Angelet al., 1987b; McNeall et al., 1989 or chloramphenicol acetyltransferase (CAT) may be MMTV (mouse Glucocorticoids Huanget al., 1981; Lee employed. Immunologic markers also can be employed. The mammary tumorvirus) et al., 1981; Majors etal., selectable marker employedis not believed to be important, 1983; Chandleret al., 25 1983; Ponta et al., 1985; so long as it is capable of being expressed simultaneously Sakaiet al., 1988 with the nucleic acid encoding a gene product. Further §-Interferon poly(@)x Tavernieret al., 1983 examples of selectable markers are well known to one of skill poly(re) in the art. Adenovirus 5 E2 EIA Imperiale et al., 1984 Collagenase Phorbol Ester (TPA) Angelet al., 1987a 30 There are a numberof ways in which expression vectors Stromelysin Phorbol Ester (TPA) Angelet al., 1987b may be introducedinto cells. In certain embodiments of the SV40 Phorbol Ester (TPA) Angelet al., 1987b invention, the expression construct comprises a virus or engi- Murine MX Gene Interferon, Hug et al., 1988 Newcastle Disease neered construct derived from a viral genome. Theability of Virus certain viruses to enter cells via receptor-mediated endocyto- GRP78 Gene A23187 Resendezet al., 1988 35 sis, to integrate into host cell genomeandexpressviral genes a-2-Macroglobulin IL-6 Kunzet al., 1989 stably andefficiently have made them attractive candidates Vimentin Serum Rittling et al., 1989 MHCClass I Gene Interferon Blanar et al., 1989 for the transfer offoreign genes into mammaliancells (Ridge- H-2kb way, 1988; Nicolas and Rubenstein, 1988; Baichwal and HSP70 EIA, SV40 Large T Tayloret al., 1989, 1990a, Sugden, 1986; Temin, 1986). Antigen 1990b 40 Oneofthe preferred methodsfor in vivo delivery involves Proliferin Phorbol Ester-TPA Mordacq et al., 1989 Tumor Necrosis Factor PMA Henselet al., 1989 the use of an adenovirus expression vector. “Adenovirus Thyroid Stimulating Thyroid Hormone Chatterjee et al., 1989 expression vector” is meant to include those constructs con- Hormone a@ Gene taining adenovirus sequencessufficient to (a) support pack- aging of the construct and (b) to express an antisense poly- Ofparticular interest are muscle specific promoters, and 45 nucleotide (or other inhibitory polynucleotide) that has been moreparticularly, cardiac specific promoters. These include clonedtherein. The expression vector comprises a genetically the myosin light chain-2 promoter (Franz etal., 1994; Kelly et engineered form of adenovirus. Knowledge of the genetic al., 1995), the alpha actin promoter (Mossetal., 1996), the organization of adenovirus, a 36 kB, linear, double-stranded troponin 1 promoter (Bhavsar et al., 1996); the Na*/Ca?* DNAvirus, allows substitution of large pieces of adenoviral exchanger promoter (Barnes et al., 1997), the dystrophin DNA with foreign sequences up to 7 kB (Grunhaus and promoter (Kimuraet al., 1997), the alpha7 integrin promoter Horwitz, 1992). In contrastto retrovirus, the adenoviral infec- (Ziober and Kramer, 1996), the brain natriuretic peptide pro- tion of host cells does not result in chromosomalintegration moter (LaPointe etal., 1996) and the alpha B-crystallin/small because adenoviral DNA canreplicate in an episomal manner heat shock protein promoter (Gopal-Srivastava, 1995), alpha without potential genotoxicity. Also, adenovirusesare struc- myosin heavy chain promoter (Yamauchi-Takihara et al., 55 turally stable, and no genome rearrangement has been 1989) and the ANF promoter (LaPointe etal., 1988). detected after extensive amplification. Adenovirus can infect A polyadenylation signal may be includedto effect proper virtually all epithelial cells regardless oftheir cell cycle stage. polyadenylation of the gene transcript where desired. The Adenovirusis particularly suitable for use as a genetrans- nature of the polyadenylation signal is not believed to be fer vector because of its mid-sized genome, ease of manipu- crucial to the successful practice of the invention, and any 60 lation, high titer, wide target cell range and high infectivity. such sequence may be employed such as human growth hor- Both ends of the viral genome contain 100-200 base pair mone and SV40 polyadenylation signals. Also contemplated inverted repeats (ITRs), which are cis elements necessary for as an elementofthe expression cassette is a terminator. These viral DNA replication and packaging. elements can serve to enhance message levels and to mini- Other than the requirement that the adenovirus vector be mize read through from the cassette into other sequences. 65 replication defective, or at least conditionally defective, the In certain embodimentsofthe invention,the cells contain- nature ofthe adenovirus vectoris not believedto be crucial to ing nucleic acid constructs ofthe present invention, a cell may the successful practice of the invention. The adenovirus may US 8,513,209 B2 17 18 be of any of the 42 different known serotypes or subgroups cell types. However, integration and stable expression require A-F. Adenovirus type 5 of subgroup C is the preferred starting the division of host cells (Paskindet al., 1975). material in order to obtain the conditional replication-defec- Other viral vectors may be employed as expression con- tive adenovirus vector for use in the present invention. This is structs in the present invention. Vectors derived from viruses because Adenovirus type 5 is a human adenovirus about such as vaccinia virus (Ridgeway, 1988; Baichwal and Sug- which a great deal of biochemical and genetic information is den, 1986; Coupar et al., 1988) adeno-associated virus (AAV) known, andit has historically been used for most construc- (Ridgeway, 1988; Baichwal and Sugden, 1986; Hermonat tions employing adenovirus as a vector. and Muzycska, 1984) and herpesviruses may be employed. They offer several attractive features for various mammalian The typical vector according to the present invention is cells (Friedmann, 1989; Ridgeway, 1988; Baichwal and Sug- replication defective and will not have an adenovirus E1 den, 1986; Couparet al., 1988; Horwichetal., 1990). region. Thus, it will be most convenient to introduce the In order to effect expression of sense or antisense gene polynucleotide encoding the gene of interest at the position constructs, the expression construct must be delivered into a from which the El-coding sequences have been removed. cell. This delivery may be accomplishedin vitro, as in labo- However, the position of insertion of the construct within the ratory procedures for transformingcells lines, or in vivo or ex adenovirus sequences is not critical to the invention. The vivo, as in the treatment of certain disease states. One mecha- polynucleotide encoding the gene of interest may also be nism for delivery is via viral infection where the expression inserted in lieu of the deleted E3 region in E3 replacement construct is encapsidated in an infectious viral particle. vectors, as described by Karlssonet al. (1986), or in the E4 Several non-viral methods for the transfer of expression region where a helpercell line or helper virus complements constructs into cultured mammalian cells also are contem- the E4 defect. plated by the present invention. These include calcium phos- Adenovirus vectors have been used in eukaryotic gene phate precipitation (Graham and Van Der Eb, 1973; Chen and expression (Levrero et al., 1991; Gomez-Foix et al., 1992) Okayama, 1987; Rippeet al., 1990) DEAE-dextran (Gopal, and vaccine development (Grunhausand Horwitz, 1992; Gra- 1985), electroporation (Tur-Kaspaet al., 1986; Potteret al., ham and Prevec, 1991). Recently, animal studies suggested 25 1984), direct microinjection (Harland and Weintraub, 1985), that recombinant adenovirus could be used for gene therapy DNA-loaded liposomes (Nicolau and Sene, 1982; Fraley et (Stratford-Perricaudet and Perricaudet, 1991; Stratford-Per- al., 1979) and lipofectamine-DNA complexes,cell sonication ricaudetet al., 1990; Rich et al., 1993). Studies in adminis- (Fechheimer et al., 1987), gene bombardment using high tering recombinant adenovirus to different tissues include velocity microprojectiles (Yang et al., 1990), and receptor- trachea instillation (Rosenfeld et al., 1991; Rosenfeld et al., mediated transfection (Wu and Wu, 1987; Wu and Wu,1988). 1992), muscle injection (Ragotet al., 1993), peripheral intra- Someofthese techniques may be successfully adapted for in venous injections (Herz and Gerard, 1993) and stereotactic Vivo or ex Vivo use. inoculation into the brain (Le Gal La Salle et al., 1993). Once the expression construct has been delivered into the Retroviral vectors are also suitable for expressing inhibi- cell the nucleic acid encoding the gene of interest may be tors of miR-15 family membersin cells. The retroviruses are 35 positioned and expressedatdifferent sites. In certain embodi- a group of single-stranded RNA viruses characterized by an ments, the nucleic acid encoding the gene may be stably ability to convert their RNA to double-stranded DNA in integrated into the genomeofthe cell. This integration may be infected cells by a process of reverse-transcription (Coffin, in the cognate location and orientation via homologous 1990). The resulting DNAthenstably integrates into cellular recombination (gene replacement)or it may be integrated in chromosomes as a provirus and directs synthesis of viral 40 a random, non-specific location (gene augmentation). In yet proteins. The integration results in the retention of the viral further embodiments, the nucleic acid may be stably main- gene sequencesin the recipient cell and its descendants. The tained in the cell as a separate, episomal segment of DNA. retroviral genomecontainsthree genes, gag, pol, and env that Such nucleic acid segments or “episomes” encode sequences code for capsid proteins, polymerase enzyme, and envelope sufficient to permit maintenance andreplication independent components, respectively. A sequence found upstream from 45 of or in synchronization with the host cell cycle. How the the gag gene contains a signal for packaging of the genome expression construct is delivered to acell and where in the cell into virions. Two long terminal repeat (LTR) sequences are the nucleic acid remains is dependent on the type of expres- presentat the 5' and 3' ends ofthe viral genome. These contain sion construct employed. strong promoter and enhancer sequences and are also In another embodiment of the invention, the expression required for integration in the host cell genome (Coffin, 50 construct may simply consist of naked recombinant DNA or 1990). plasmids. Transfer of the construct may be performed by any In order to construct a retroviral vector, a nucleic acid of the methods mentioned above which physically or chemi- encoding a geneofinterest is insertedinto the viral genome in cally permeabilize the cell membrane. This is particularly the place of certain viral sequences to produce a virus that is applicable for transfer in vitro but it may be applied to in vivo replication-defective. In order to produce virions, a packag- 55 use as well. Dubensky et al. (1984) successfully injected ing cell line containing the gag,pol, and env genes but without polyomavirus DNAin the form ofcalcium phosphateprecipi- the LTR and packaging components is constructed (Mann et tates into liver and spleen of adult and newborn mice demon- al., 1983). When a recombinant plasmid containing a cDNA, strating active viral replication and acute infection. Ben- together with the retroviral LTR and packaging sequencesis venisty and Neshif (1986) also demonstrated that direct introduced into this cell line (by calctum phosphate precipi- intraperitoneal injection of calctum phosphate-precipitated tation for example), the packaging sequence allows the RNA plasmids results in expression of the transfected genes. It is transcript of the recombinant plasmid to be packaged into envisioned that DNA encoding a polynucleotide of interest viral particles, which are then secreted into the culture media may also be transferred in a similar manner in vivo and (Nicolas and Rubenstein, 1988; Temin, 1986; Mann etal., express the gene product. 1983). The media containing the recombinantretrovirusesis In still another embodimentof the invention for transfer- then collected, optionally concentrated, and used for gene ring a naked DNA expression constructinto cells may involve transfer. Retroviral vectors are able to infect a broad variety of particle bombardment. This method dependson the ability to US 8,513,209 B2 19 20 accelerate DNA-coated microprojectiles to a high velocity cardiac cell) by any numberof receptor-ligand systems with allowing them to pierce cell membranesandenter cells with- or without liposomes. For example, epidermal growth factor out killing them (Klein et al., 1987). Several devices for (EGF) maybeusedas the receptor for mediated delivery of a accelerating small particles have been developed. One such nucleic acid into cells that exhibit upregulation ofEGF recep- device relies on a high voltage discharge to generate an elec- tor. Mannosecan be usedto target the mannose receptor on trical current, which in turn provides the motive force (Yang liver cells. Also, antibodies to CD5 (CLL), CD22 (ym- et al., 1990). The microprojectiles used have consisted of phoma), CD25 (T-cell leukemia) and MAA (melanoma) can biologically inert substances such as tungsten or gold beads. similarly be used as targeting moieties. Selected organs includingthe liver, skin, and muscle tissue In particular example, the polynucleotide may be admin- a of rats and mice have been bombarded in vivo (Yanget al., 10 istered in combination with a cationic lipid. Examples of 1990; Zelenin et al., 1991). This may require surgical expo- cationic lipids include, but are not limited to, lipofectin, sure of the tissueor cells, to eliminate any intervening tissue DOTMA, DOPE, and DOTAP. The publication of between the gun andthe target organ, i.e., ex vivo treatment. W00071096, whichis specifically incorporated by reference, Again, DNA encodinga particular polynucleotide of interest describes different formulations, such as a DOTAP:choles- maybedelivered via this method andstill be incorporated by 15 terol or cholesterol derivative formulation that can effectively the present invention. be used for gene therapy. Other disclosures also discuss dif- In a further embodiment of the invention, the expression ferent lipid or liposomal formulations including nanopar- construct may be entrapped in a liposome. Liposomes are ticles and methods of administration; these include, but are vesicular structures characterized by a phospholipid bilayer not limited to, U.S. Patent Publication 20030203865, membraneand an inner aqueous medium. Multilamellarlipo- 20 20020150626, 20030032615, and 20040048787, which are somes have multiple lipid layers separated by aqueous specifically incorporated by reference to the extent they dis- medium. They form spontaneously when phospholipids are close formulations and other related aspects ofadministration suspended in an excess of aqueous solution. The lipid com- and delivery of nucleic acids. Methods used for forming ponents undergo self-rearrangement before the formation of particles are also disclosed in U.S. Pat. Nos. 5,844,107, 5,877, closed structures and entrap water and dissolved solutes 25 302, 6,008,336, 6,077,835, 5,972,901, 6,200,801, and 5,972, between the lipid bilayers (Ghosh and Bachhawat, 1991). 900, which are incorporated by reference for those aspects. Also contemplated are lipofectamine-DNA complexes. In certain embodiments, gene transfer may more easily be In certain embodimentsofthe invention,the liposome may performed under ex vivo conditions. Ex vivo gene therapy be complexed with a hemagglutinating virus (HVJ). This has refers to the isolation of cells from an animal, the delivery of been shownto facilitate fusion with the cell membrane and 30 a nucleic acid into the cells in vitro, and then the return of the promote cell entry of liposome-encapsulated DNA (Kaneda modified cells back into an animal. This may involve the et al., 1989). In other embodiments, the liposome may be surgical removalof tissue/organs from an animalorthe pri- complexed or employed in conjunction with nuclear non- mary culture of cells andtissues. histone chromosomalproteins (HMG-1) (Kato et al., 1991). The present invention also includes methods for scaveng- In yet further embodiments, the liposome may be complexed 35 ing or clearing inhibitors ofmiR-15 family members follow- or employed in conjunction with both HVJ and HMG-1. In ing treatment. The method may comprise overexpressing that such expression constructs have been successfully hybridization sites for inhibitors of the miR-15 family mem- employed in transfer and expression of nucleic acid in vitro bers in cardiac tissue. In one embodiment, the method com- and in vivo, then they are applicable for the present invention. prises overexpression of hybridization sites for inhibitors of Where a bacterial promoter is employed in the DNA con- 40 the miR-15 family members in cardiac muscle using a heart struct, it also will be desirable to include within the liposome muscle specific promoter (e.g. a-MHC). In another embodi- an appropriate bacterial polymerase. ment, the hybridization site may comprise a sequence of a Other expression constructs which can be employed to seed region from a miR-15 family member. In another deliver a nucleic acid encoding a particular geneinto cells are embodiment, the hybridization site may comprise the receptor-mediated delivery vehicles. These take advantage of 45 sequence of SEQ ID NO: 18. In some embodiments, the the selective uptake ofmacromolecules by receptor-mediated hybridization site may contain a sequencethat is complemen- endocytosis in almostall eukaryotic cells. Because ofthe cell tary to a sequence from the 3'UTRof one or moretargets of a type-specific distribution of various receptors, the delivery miR-15 family member, such as FGF2, TGFb-inducedfactor can be highly specific (Wu and Wu, 1993). 2, BCL9I, BCL2L, CDC25A,cyclin E1, cyclin D1, or cyclin Receptor-mediated gene targeting vehicles generally con- 50 D2. sist of two components: a cell receptor-specific ligand and a In another embodimentofthe invention, an inhibitor ofone DNA-binding agent. Several ligands have been used for or more miR-15 family members is administered to the sub- receptor-mediated gene transfer. The most extensively char- ject in combination with other therapeutic modalities. Cur- acterized ligands are asialoorosomucoid (ASOR) (Wu and rent medical managementof cardiac hypertrophyin theset- Wu, 1987) and transferrin (Wagner et al., 1990). Recently, a 55 ting of a cardiovascular disorder includes the use of at least synthetic neoglycoprotein, which recognizes the same recep- twotypes of drugs: inhibitors of the renin-angiotensin system tor as ASOR,has been usedas a gene delivery vehicle (Ferkol and B-adrenergic blocking agents (Bristow, 1999). Therapeu- et al., 1993; Perales et al., 1994) and epidermal growth factor tic agents to treat pathologic hypertrophy in the setting of (EGF)hasalso been used to deliver genes to squamouscar- heart failure include angiotensin II converting enzyme (ACE) cinomacells (Myers, EPO 0273085). 60 inhibitors and B-adrenergic receptor blocking agents (Eich- In other embodiments,the delivery vehicle may comprise a horn and Bristow, 1996). Other pharmaceutical agents that ligand and a liposome. For example, Nicolau et al. (1987) have been disclosed for treatment of cardiac hypertrophy employed lactosyl-ceramide, a galactose-terminal asialgan- include angiotensin II receptor antagonists (U.S. Pat. No. glioside, incorporated into liposomes and observed an 5,604,251) and neuropeptide U antagonists (WO 98/33791). increase in the uptake of the insulin gene by hepatocytes. 65 Non-pharmacological treatment is primarily used as an Thus, it is feasible that a nucleic acid encoding a particular adjunct to pharmacological treatment. One means of non- gene also maybespecifically delivered into a cell type (e.g. pharmacological treatment involves reducing the sodium in US 8,513,209 B2 21 22 the diet. In addition, non-pharmacological treatment also to treat hypertrophy with inhibitors of miR-15 family mem- entails the elimination of certain precipitating drugs, includ- bers intermittently, such as within a brief window during ing negative inotropic agents (e.g., certain calcium channel disease progression. blockers and antiarrhythmic drugs like disopyramide), car- Pharmacological therapeutic agents and methods of diotoxins(e.g., amphetamines), and plasma volume expand- > administration, dosages, etc., are well knowntothoseof skill ers (e.g., nonsteroidal anti-inflammatory agents and gluco- in the art (see for example, the “Physicians Desk Reference”, corticoids). Klaassen’s “The Pharmacological Basis of Therapeutics”, Thus,in additionto the therapies described above, one may “Remington’s Pharmaceutical Sciences”, and “The Merck Index, Eleventh Edition”, incorporated herein by reference in also provide to the subject more “standard” pharmaceutical relevant parts), and may be combined with the invention in cardiac therapies with the inhibitor of one or more miR-15 light of the disclosures herein. Some variation in dosage will family members. Examples of other therapies include, with- necessarily occur depending on the condition of the subject out limitation, so-called “beta blockers,” anti-hypertensives, being treated. The person responsible for administration will, cardiotonics, anti-thrombotics, vasodilators, hormone in any event, determine the appropriate dose for the individual antagonists, iontropes, diuretics, endothelin receptor antago- subject, and such individual determinations are within the nists, calcium channel blockers, phosphodiesterase inhibi- skill of those of ordinary skill in the art. tors, ACE inhibitors, angiotensin type 2 antagonists and Non-limiting examples of a pharmacological therapeutic cytokine blockers/inhibitors, and HDAC inhibitors. The com- agent that may be used in the present invention include an bination therapy also may involve inhibiting the expression or antihyperlipoproteinemic agent, an antiarteriosclerotic agent, activity of additional miRNAsinvolved in cardiac remodel- 20 an antithrombotic/fibrinolytic agent, a blood coagulant, an ing such as miR-499, miR-208, miR-208b and miR-21. Com- antiarrhythmic agent, an antihypertensive agent, a vasopres- bination therapy mayalso include overexpression of particu- sor, a treatment agent for congestive heart failure,an antiangi- lar microRNAs, such as miR-29. nal agent, an antibacterial agent or a combination thereof. Combinations maybe achieved by contacting cardiac cells In addition, it should be noted that any ofthe following may with a single composition or pharmacological formulation 25 be used to develop newsets of cardiac therapy target genes as that includes an inhibitor of one or more miR-15 family B-blockers were used in the present examples (see below). membersanda standard pharmaceutical agent, or by contact- While it is expected that many of these genes may overlap, ing the cell with two distinct compositions or formulations,at new genetargets likely can be developed. the same time, wherein one composition includes the inhibi- In certain embodiments, administration of an agent that lowers the concentration of one of more blood lipids and/or tor of a miR-15 family memberand the other includes the lipoproteins, known herein as an “antihyperlipoproteinemic,” standard pharmaceutical agent. Alternatively, the therapy using an inhibitor ofa miR-15 family member mayprecede or may be combined with a cardiovascular therapy according to the present invention, particularly in treatment of atherscle- follow administration of the other agent(s) by intervals rang- ing from minutes to weeks. In embodiments where the stan- rosis and thickenings or blockages of vascular tissues. In certain embodiments, an antihyperlipoproteinemic agent dard pharmaceutical agent and the inhibitor of a miR-15 may comprise an aryloxyalkanoic/fibric acid derivative, a family memberare applied separately to the cell, one would generally ensure that a significant period of time did not resin/bile acid sequesterant, a HMG CoAreductase inhibitor, a nicotinic acid derivative, a thyroid hormoneor thyroid hor- expire between the time of each delivery, such that the phar- maceutical agent and inhibitor of a miR-15 family member moneanalog, a miscellaneous agent or a combination thereof. 0 Non-limiting examples of aryloxyalkanoic/fibric acid deriva- would still be able to exert an advantageously combined effect on the cell. In such instances, it is contemplated that one tives include beclobrate, enzafibrate, binifibrate, ciprofibrate, clinofibrate, clofibrate (atromide-S), clofibric acid, etofibrate, would typically contact the cell with both modalities within fenofibrate, gemfibrozil (lobid), nicofibrate, pirifibrate, ron- about 12-24 hours of each other and, morepreferably, within about 6-12 hours ofeach other, with a delay time ofonly about ifibrate, simfibrate and theofibrate. Non-limiting examples of 5 resins/bile acid sequesterants include cholestyramine (choly- 12 hours being mostpreferred. In somesituations, it may be desirable to extend the timeperiodfor treatmentsignificantly, bar, questran), colestipol (colestid) and polidexide. Non-lim- iting examples of HMG CoA reductase inhibitors include however, where several days (2, 3, 4, 5, 6 or 7) to several weeks (1, 2, 3, 4, 5, 6, 7 or 8) lapse between the respective lovastatin (mevacor), pravastatin (pravochol) or simvastatin (zocor). Non-limiting examples of nicotinic acid derivatives administrations. include nicotinate, acepimox, niceritrol, nicoclonate, nico- It also is conceivable that more than one administration of either an inhibitor of a miR-15 family member, or the other mol and oxiniacic acid. Non-limiting examples of thyroid hormonesandanalogsthereof include etoroxate, thyropropic pharmaceutical agent will be desired. In this regard, various combinations may be employed. By way of illustration, acid and thyroxine. Non-limiting examples of miscellaneous antihyperlipo- wherethe inhibitor of a miR-15 family memberis “A”and the other pharmaceutical agent is “B,” the following permuta- 5 proteinemics include acifran, azacosterol, benfluorex, (f-ben- zalbutyramide, carnitine, chondroitin sulfate, clomestrone, tions based on 3 and 4 total administrations are exemplary: detaxtran, dextran sulfate sodium, 5,8,11,14,17-eicosapen- taenoic acid, eritadenine, furazabol, meglutol, melinamide, mytatrienediol, ornithine, y-oryzanol, pantethine, pentaeryth- A/B/A B/A/B B/B/A A/AB B/A/A A/B/B B/B/B/A B/B/A/B 60 ritol tetraacetate, a-phenylbutyramide, pirozadil, probucol A/A/B/B A/B/A/B A/B/B/A B/B/A/A B/A/B/A B/A/A/B B/B/B/A (lorelco), B-sitosterol, sultosilic acid-piperazine salt, tiad- A/A/A/B B/A/A/A A/B/A/A A/A/B/A A/B/B/B B/A/B/B B/B/A/B enol, triparanol and xenbucin. A non-limiting example of an antiarteriosclerotic includes pyridinol carbamate. Other combinationsare likewise contemplated. In certain embodiments, administration of an agent that Treatment regimens would vary depending on the clinical 65 aids in the removal or prevention of blood clots may be situation. However, long-term maintenance would appearto combined with administration of a modulator, particularly in be appropriate in most circumstances. It also may be desirable treatment of athersclerosis and vasculature (e.g., arterial) US 8,513,209 B2 23 24 blockages. Non-limiting examples of antithrombotic and/or celiprolol, cetamolol, epanolol, indenolol, mepindolol, fibrinolytic agents include anticoagulants, anticoagulant metipranolol, metoprolol, moprolol, nadolol, nipradilol, antagonists, antiplatelet agents, thrombolytic agents, throm- oxprenolol, penbutolol, pindolol, propanolol, talinolol, terta- bolytic agent antagonists or combinationsthereof. In certain tolol, timolol andtoliprolol. embodiments, antithrombotic agents that can be administered 5 Non-limiting examples of an agent that prolong repolar- orally, such as, for example, aspirin and wafarin (coumadin), ization, also known as a Class II antiarrhythmic agent, are preferred. include amiodarone (cordarone) and sotalol (betapace). Non-limiting examples of anticoagulants include aceno- Non-limiting examples of a calcium channel blocker, oth- coumarol, ancrod, anisindione, bromindione, clorindione, erwise known as a Class IV antiarrythmic agent, include an coumetarol, cyclocumarol, dextran sulfate sodium, dicuma- 10 arylalkylamine (e.g., bepridile, diltiazem, fendiline, gallo- rol, diphenadione, ethyl biscoumacetate, ethylidene dicou- pamil, prenylamine, terodiline, verapamil), a dihydropyri- marol, fiuindione, heparin, hirudin, lyapolate sodium, dine derivative (felodipine, isradipine, nicardipine, nife- oxazidione, pentosan polysulfate, phenindione, phenprocou- dipine, nimodipine, nisoldipine, nitrendipine) a piperazinde mon, phosvitin, picotamide, tioclomarol and warfarin. derivative (e.g., cinnarizine, flunarizine, lidoflazine) or a Non-limiting examples of antiplatelet agents include aspi- 15 micellaneous calctum channel blocker such as bencyclane, rin, a dextran, dipyridamole (persantin), heparin, sulfinpyra- etafenone, magnesium, mibefradil or perhexyline. In certain none(anturane) andticlopidine (ticlid). embodiments a calcium channel blocker comprises a long- Non-limiting examples ofthrombolytic agents includetis- acting dihydropyridine (nifedipine-type) calcium antagonist. sue plaminogen activator (activase), plasmin, pro-urokinase, Non-limiting examples of miscellaneous antiarrhythmic urokinase (abbokinase) streptokinase (streptase), anistre- 20 agents include adenosine (adenocard), digoxin (lanoxin), plase/APSAC (eminase). acecamide, ajmaline, amoproxan,aprindine, bretylium tosy- In certain embodiments wherein a patient is suffering from late, bunaftine, butobendine, capobenic acid, cifenline, dis- a hemorrhageoran increased likelihood ofhemorrhaging, an opyranide, hydroquinidine, indecamide, ipatropium bro- agent that may enhance blood coagulation may be used. Non- mide, lidocaine, lorajmine, lorcamide, meobentine, limiting examples of blood coagulation promoting agents 25 moricizine, pirmenol, prajmaline, propafenone, pyrinoline, include thrombolytic agent antagonists and anticoagulant quinidine polygalacturonate, quinidine sulfate and viquidil. antagonists. Non-limiting examples of anticoagulant antago- Non-limiting examples of antihypertensive agents include nists include protamine and vitamine K1. sympatholytic, alpha/beta blockers, alpha blockers, anti-an- Non-limiting examples of thrombolytic agent antagonists giotensin II agents, beta blockers, calctum channel blockers, include amiocaproic acid (amicar) and tranexamic acid (am- 30 vasodilators and miscellaneous antihypertensives. stat). Non-limiting examples of antithrombotics include Non-limiting examples of an alpha blocker, also known as anagrelide, argatroban, cilstazol, daltroban, defibrotide, an a-adrenergic blocker or an a-adrenergic antagonist, enoxaparin, fraxiparine, indobufen, lamoparan, ozagrel, include amosulalol, arotinolol, dapiprazole, doxazosin, picotamide, plafibride, tedelparin,ticlopidine andtriflusal. ergoloid mesylates, fenspiride, indoramin, labetalol, nicer- Non-limiting examples of antiarrhythmic agents include 35 goline, prazosin, terazosin,tolazoline, trimazosin and yohim- Class I antiarrhythmic agents (sodium channel blockers), bine. In certain embodiments, an alpha blocker may comprise Class II antiarrhythmic agents (beta-adrenergic blockers), a quinazoline derivative. Non-limiting examples of quinazo- Class III antiarrhythmic agents (repolarization prolonging line derivatives include alfuzosin, bunazosin, doxazosin,pra- drugs), Class IV antiarrhythmic agents (calcium channel zosin, terazosin and trimazosin. In certain embodiments, an blockers) and miscellaneous antiarrhythmic agents. 40 antihypertensive agent is both an alpha and beta adrenergic Non-limiting examples of sodium channel blockers antagonist. Non-limiting examples of an alpha/beta blocker include Class IA, Class IB and Class IC antiarrhythmic comprise labetalol (normodyne, trandate). agents. Non-limiting examples of Class IA antiarrhythmic Non-limiting examples of anti-angiotensin I] agents agents include disppyramide (norpace), procainamide (pron- include angiotensin converting enzymeinhibitors and angio- estyl) and quinidine (quinidex). Non-limiting examples of 45 tensin II receptor antagonists. Non-limiting examples of Class IB antiarrhythmic agents include lidocaine (xylocalne), angiotensin converting enzyme inhibitors (ACE inhibitors) tocamide (tonocard) and mexiletine (mexitil). Non-limiting include alacepril, enalapril (vasotec), captopril, cilazapril, examples of Class IC antiarrhythmic agents include encam- delapril, enalaprilat, fosinopril, listnopril, moveltopril, perin- ide (enkaid) and flecamide (tambocor). dopril, quinapril and ramipril. Non-limiting examples of an Non-limiting examplesof a beta blocker, otherwise known angiotensin II receptor blocker, also knownas an angiotensin asa B-adrenergic blocker, a B-adrenergic antagonist or a Class II receptor antagonist, anANG receptorblocker or anANG-II II antiarrhythmic agent, include acebutolol (sectral), alpre- type-1 receptor blocker (ARBS), include angiocandesartan, nolol, amosulalol, arotinolol, atenolol, befunolol, betaxolol, eprosartan, irbesartan, losartan and valsartan. bevantolol, bisoprolol, bopindolol, bucumolol, bufetolol, Non-limiting examples of a sympatholytic include a cen- bufuralol, bunitrolol, bupranolol, butidrine hydrochloride, 55 trally acting sympatholytic or a peripherially acting sym- butofilolol, carazolol, carteolol, carvedilol, celiprolol, ceta- patholytic. Non-limiting examples of a centrally acting sym- molol, cloranolol, dilevalol, epanolol, esmolol (brevibloc), patholytic, also known as an central nervous system (CNS) indenolol, labetalol, levobunolol, mepindolol, metipranolol, sympatholytic, include clonidine (catapres), guanabenz metoprolol, moprolol, nadolol, nadoxolol, nifenalol, (wytensin) guanfacine (tenex) and methyldopa (aldomet). nipradilol, oxprenolol, penbutolol, pindolol, practolol, prone- 60 Non-limiting examples of a peripherally acting sym- thalol, propanolol (inderal), sotalol (betapace), sulfinalol, patholytic include a ganglion blocking agent, an adrenergic talinolol, tertatolol, timolol, toliprolol and xibinolol. In cer- neuron blocking agent, a B-adrenergic blocking agent or a tain embodiments, the beta blocker comprises an aryloxypro- alpha] -adrenergic blocking agent. Non-limiting examples of panolamine derivative. Non-limiting examples of arylox- a ganglion blocking agent include mecamylamine(inversine) ypropanolamine derivatives include acebutolol, alprenolol, 65 and trimethaphan (arfonad). Non-limiting examples of an arotinolol, atenolol, betaxolol, bevantolol, bisoprolol, bopin- adrenergic neuron blocking agent include guanethidine(is- dolol, bunitrolol, butofilolol, carazolol, carteolol, carvedilol, melin) and reserpine (serpasil). Non-limiting examples of a US 8,513,209 B2 25 26 B-adrenergic blocker include acenitolol (sectral), atenolol dazole derivatives include clonidine, lofexidine, phentola- (tenormin), betaxolol (kerlone), carteolol (cartrol), labetalol mine, tiamenidine and tolonidine. Non-limiting examples of (normodyne,trandate), metoprolol (lopressor), nadanol(cor- quanternary ammonium compoundsinclude azamethonium gard), penbutolol (levatol), pindolol (visken), propranolol bromide, chlorisondamine chloride, hexamethonium, penta- (inderal) and timolol (blocadren). Non-limiting examples of cynium bis(methylsulfate), pentamethonium bromide, pento- alpha] -adrenergic blocker include prazosin (minipress), dox- linium tartrate, phenactropinium chloride and trimethidinium azocin (cardura) and terazosin (hytrin). methosulfate. Non-limiting examples ofreserpine derivatives In certain embodiments a cardiovasculator therapeutic include bietaserpine, deserpidine, rescinnamine, reserpine agent may comprise a vasodilator(e.g., a cerebral vasodilator, and syrosingopine. Non-limiting examples of sulfonamide a coronary vasodilator or a peripheral vasodilator). In certain 10 derivatives include ambuside, clopamide, furosemide, inda- preferred embodiments, a vasodilator comprises a coronary pamide, quinethazone, tripamide and xipamide. vasodilator. Non-limiting examples of a coronary vasodilator Vasopressors generally are used to increase blood pressure include amotriphene, bendazol, benfurodil hemisuccinate, during shock, which may occur during a surgical procedure. benziodarone, chloracizine, chromonar, clobenfurol, cloni- Non-limiting examples of a vasopressor, also known as an trate, dilazep, dipyridamole, droprenilamine, efloxate, eryth- 15 antihypotensive, include amezinium methyl] sulfate, angio- rityl tetranitrane, etafenone, fendiline, floredil, ganglefene, tensin amide, dimetofrine, dopamine, etifelmin, etilefrin, herestrol bis(B-diethylaminoethy! ether), hexobendine,itra- gepefrine, metaraminol, midodrine, norepinephrine, min tosylate, khellin, lidoflanine, mannitol hexanitrane, pholedrine and synephrine. medibazine, nicorglycerin, pentaerythritol tetranitrate, pen- Non-limiting examples of agents for the treatment of con- trinitrol, perhexyline, pimethylline, trapidil, tricromyl, tri- 20 gestive heart failure include anti-angiotensin II agents, after- metazidine, trolnitrate phosphate and visnadine. load-preload reduction treatment, diuretics and inotropic In certain embodiments, a vasodilator may comprise a agents. chronic therapy vasodilator or a hypertensive emergency In certain embodiments, an animal patient that can not vasodilator. Non-limiting examples of a chronic therapy tolerate an angiotensin antagonist may be treated with a com- vasodilator include hydralazine (apresoline) and minoxidil 25 bination therapy. Such therapy may combine administration (oniten). Non-limiting examples of a hypertensive emer- of hydralazine (apresoline) and isosorbide dinitrate (isordil, gency vasodilator include nitroprusside (nipride), diazoxide sorbitrate). (hyperstat IV), hydralazine (apresoline), minoxidil (loniten) Non-limiting examples of a diuretic include a thiazide or and verapamil. benzothiadiazine derivative (e.g., althiazide, bendroflumet- Non-limiting examples of miscellaneous antihyperten- 30 hazide, benzthiazide, benzylhydrochlorothiazide, buthiazide, sives include ajmaline, y-aminobutyric acid, bufeniode, cicle- chlorothiazide, chlorothiazide, chlorthalidone, cyclopenthi- tainine, ciclosidomine, a cryptenamine tannate, fenoldopam, azide, epithiazide, ethiazide, ethiazide, fenquizone, hydro- flosequinan, ketanserin, mebutamate, mecamylamine, meth- chlorothiazide, hydroflumethiazide, methyclothiazide, meti- yldopa, methyl 4-pyridyl ketone thiosemicarbazone, crane, metolazone, paraflutizide, polythizide, muzolimine, pargyline, pempidine, pinacidil, piperoxan, pri- 35 tetrachloromethiazide, trichlormethiazide), an organomercu- maperone, a protoveratrine, raubasine, rescimetol, ril- rial (e.g., chlormerodrin, meralluride, mercamphamide, mer- menidene, saralasin, sodium nitrorusside, ticrynafen, tri- captomerin sodium, mercumallylic acid, mercumatilin methaphan camsylate, tyrosinase and urapidil. dodium, mercurouschloride, mersaly]), a pteridine(e.g., fur- Incertain embodiments, an antihypertensive may comprise therene, triamterene), purines (e.g., acefylline, 7-morpholi- an arylethanolamine derivative, a benzothiadiazine deriva- 40 nomethyltheophylline, pamobrom, protheobromine, theo- tive, a N-carboxyalkyl(peptide/lactam) derivative, a dihydro- bromine), steroids including aldosterone antagonists (e.g., pyridine derivative, a guanidine derivative, a hydrazines/ph- canrenone,oleandrin, spironolactone), a sulfonamide deriva- thalazine, an imidazole derivative, a quanternary ammonium tive (e.g., acetazolamide, ambuside, azosemide, bumetanide, compound,a reserpine derivative or a suflonamidederivative. butazolamide, chloraminophenamide, clofenamide, clopam- Non-limiting examples of arylethanolamine derivatives 45 ide, clorexolone, diphenylmethane-4,4'-disulfonamide, dis- include amosulalol, bufuralol, dilevalol, labetalol, proneth- ulfamide, ethoxzolamide, furosemide, indapamide, mefru- alol, sotalol and sulfinalol. Non-limiting examples of ben- side, methazolamide, piretanide, quinethazone, torasemide, zothiadiazine derivatives include althizide, bendroflumethi- tripamide, xipamide), a uracil (e.g., aminometradine, ami- azide, benzthiazide, benzylhydrochlorothiazide, buthiazide, sometradine), a potassium sparing antagonist (e.g., chlorothiazide, chlorthalidone, cyclopenthiazide, cyclothiaz- 50 amiloride, triamterene) or a miscellaneous diuretic such as ide, diazoxide, epithiazide, ethiazide, fenquizone, hydrochlo- aminozine, arbutin, chlorazanil, ethacrynic acid, etozolin, rothizide, hydroflumethizide, methyclothiazide, meticrane, hydracarbazine, isosorbide, mannitol, metochalcone, metolazone, paraflutizide, polythizide, tetrachlormethiazide muzolimine, perhexyline, ticrnafen and urea. and trichlormethiazide. Non-limiting examples of N-car- Non-limiting examples of a positive inotropic agent, also boxyalkyl(peptide/lactam) derivatives include alacepril, cap- 55 known as a cardiotonic, include acefylline, an acetyldigi- topril, cilazapril, delapril, enalapril, enalaprilat, fosinopril, toxin, 2-amino-4-picoline, aminone, benfurodil hemisucci- lisinopril, moveltipril, perindopril, quinapril and ramipril. nate, bucladesine, cerberosine, camphotamide, convalla- Non-limiting examples of dihydropyridine derivatives toxin, cymarin, denopamine,deslanoside, digitalin, digitalis, include amlodipine, felodipine, isradipine, nicardipine, nife- digitoxin, digoxin, dobutamine, dopamine, dopexamine, dipine, nilvadipine, nisoldipine and nitrendipine. Non-limit- 60 enoximone, erythrophleine, fenalcomine, gitalin, gitoxin, ing examples of guanidine derivatives include bethanidine, glycocyamine, heptaminol, hydrastinine, ibopamine,a lana- debrisoquin, guanabenz, guanacline, guanadrel, guanazod- toside, metamivam, milrinone, nerifolin, oleandrin, ouabain, ine, guanethidine, guanfacine, guanochlor, guanoxabenz and oxyfedrine, prenalterol, proscillaridine, resibufogenin, scil- guanoxan. Non-limiting examples of hydrazines/phthala- laren, scillarenin, strphanthin, sulmazole, theobromine and zines include budralazine, cadralazine, dihydralazine, 65 xamoterol. endralazine, hydracarbazine, hydralazine, pheniprazine, In particular embodiments, an intropic agent is a cardiac pildralazine and todralazine. Non-limiting examples of imi- glycoside, a beta-adrenergic agonist or a phosphodiesterase US 8,513,209 B2 27 28 inhibitor. Non-limiting examples of a cardiac glycoside ally comprised within a lipid vehicle, or may comprise includes digoxin (lanoxin) and digitoxin (crystodigin). Non- administering an expression vector that expresses said one or limiting examples ofa B-adrenergic agonistinclude albuterol, more miR-15 family members in said subject. The expression bambuterol, bitolterol, carbuterol, clenbuterol, clorprenaline, vector may be viral expression vector, such as an adenoviral a denopamine,dioxethedrine, dobutamine (dobutrex), dopam- expression vector, or a non-viral expression vector, such as ine (intropin), dopexamine, ephedrine, etafedrine, ethylnore- one comprised within a lipid vehicle. The method mayfurther pinephrine, fenoterol, formoterol, hexoprenaline, ibopamine, comprise a non-miR-15 family membertherapy (i.e. another isoetharine, isoproterenol, mabuterol, metaproterenol, meth- microRNAor other appropriate therapy). oxyphenamine, oxyfedrine, pirbuterol, procaterol, protoky- The present invention also encompasses a pharmaceutical lol, reproterol, rimiterol, ritodrine, soterenol, terbutaline, tre- 10 composition comprising an inhibitor of one or more miR-15 toquinol, tulobuterol and xamoterol. Non-limiting examples family members (e.g. miR-195, miR-497, miR-424, miR- of a phosphodiesterase inhibitor include aminone(inocor). 15a, miR-15b, miR-16-1, and miR-16-2). The pharmaceuti- Antianginal agents may comprise organonitrates, calcium cal composition may comprise any inhibitor of a miR-15 channel blockers, beta blockers and combinations thereof. family memberas described herein, such as an antagomir, an Non-limiting examples of organonitrates, also known as 15 antisense oligonucleotide, an inhibitory RNA molecule, anda nitrovasodilators, include nitroglycerin (nitro-bid,nitrostat), nucleic acid comprising one or more miR-15 bindingsites. isosorbide dinitrate (isordil, sorbitrate) and amy]nitrate (as- Whereclinical applications are contemplated, pharmaceuti- pirol, vaporole). cal compositions will be prepared in a form appropriate for Endothelin (ET) is a 21-aminoacid peptide that has potent the intended application. Generally, this will entail preparing physiologic and pathophysiologic effects that appear to be 20 compositions that are essentially free of pyrogens, as well as involved in the developmentofheart failure. The effects ofET other impurities that could be harmful to humansor animals. are mediated through interaction with two classes of cell Colloidal dispersion systems, such as macromolecule surface receptors. The type A receptor (ET-A)is associated complexes, nanocapsules, microspheres, beads, and lipid- with vasoconstriction and cell growth while the type B recep- based systems including oil-in-water emulsions, micelles, tor (ET-B) is associated with endothelial-cell mediated 25 mixed micelles, and liposomes, may be used as delivery vasodilation and with the release of other neurohormones, vehicles for the oligonucleotide inhibitors of microRNA such as aldosterone. Pharmacologic agents that can inhibit function or constructs expressing inhibitory nucleotides. either the production of ET orits ability to stimulate relevant Commercially available fat emulsions that are suitable for cells are known in the art. Inhibiting the production of ET delivering the nucleic acids ofthe inventionto tissues, such as involvesthe use ofagents that block an enzyme termed endot- 30 cardiac muscle tissue, include Intralipid®, Liposyn®, Lipo- helin-converting enzymethat is involved in the processing of syn® II, Liposyn® III, Nutrilipid, and other similar lipid the active peptide from its precursor. Inhibiting the ability of emulsions. A preferred colloidal system for use as a delivery ETto stimulate cells involves the use of agents that block the vehicle in vivo is a liposome(i.e., an artificial membrane interaction ofET withits receptors. Non-limiting examples of vesicle). The preparation and use of such systems is well endothelin receptor antagonists (ERA) include Bosentan, 35 knownin the art. Exemplary formulations are also disclosed Enrasentan, Ambrisentan, Darusentan, Tezosentan, Atrasen- in USS. Pat. No. 5,981,505; U.S. Pat. No. 6,217,900; U.S. Pat. tan, Avosentan, Clazosentan, Edonentan, sitaxsentan, TBC No. 6,383,512; U.S. Pat. No. 5,783,565; U.S. Pat. No. 7,202, 3711, BQ 123, and BQ 788. 227; U.S. Pat. No. 6,379,965; U.S. Pat. No. 6,127,170; U.S. In certain embodiments, the secondary therapeutic agent Pat. No. 5,837,533; U.S. Pat. No. 6,747,014; and WO03/ may comprise a surgery of some type, which includes, for 40 093449, which are herein incorporated by reference in their example, preventative, diagnostic or staging, curative and entireties. palliative surgery. Surgery, and in particular a curative sur- One will generally desire to employ appropriate salts and gery, may be used in conjunction with other therapies, such as buffers to render delivery vehicles stable and allow for uptake the present invention and one or more other agents. by target cells. Buffers also will be employed when recom- Such surgical therapeutic agents for vascular and cardio- 45 binant cells are introduced into a patient. Aqueous composi- vascular diseases and disorders are well known to those of tions ofthe present invention comprise an effective amount of skill in the art, and may comprise, but are not limited to, the delivery vehicle or cells, dissolved or dispersed in a phar- performing surgery on an organism, providing a cardiovas- maceutically acceptable carrier or aqueous medium. The cular mechanical prostheses, angioplasty, coronary artery phrases “pharmaceutically acceptable” or “pharmacologi- reperfusion, catheter ablation, providing an implantable car- 50 cally acceptable”refer to molecular entities and compositions dioverter defibrillator to the subject, mechanical circulatory that do not produce adverse, allergic, or other untoward reac- support or a combination thereof. Non-limiting examples ofa tions when administered to an animal or a human. As used mechanical circulatory support that may be used in the herein, “pharmaceutically acceptable carrier” includes sol- present invention comprise an intra-aortic balloon counter- vents, buffers, solutions, dispersion media, coatings, antibac- pulsation, left ventricular assist device or combination 55 terial and antifungal agents, isotonic and absorption delaying thereof. agents andthe like acceptable for use in formulating pharma- In another embodiment, the present invention provides a ceuticals, such as pharmaceuticals suitable for administration methodoftreating or preventing a musculoskeletal disorder to humans. The use of such media and agents for pharmaceu- in a subject in need thereof comprising (a) identifying a tically active substances is well known in the art. Except subject having orat risk ofa musculoskeletal disorder; and (b) 60 insofar as any conventional media or agent is incompatible increasing the expression and/oractivity of one or more miR- with the active ingredients of the present invention, its use in 15 family members in skeletal muscle cells of said subject. therapeutic compositions is contemplated. Supplementary The disorder may be selected from the group consisting of active ingredients also can be incorporated into the composi- muscular dystrophy, disuse atrophy, muscle wasting in tions, provided they do not inactivate the vectors or cells of response to anti-gravity and denervation. Increasing the 65 the compositions. expression and/or activity may comprise administering said The active compositions of the present invention may one or more miR-15 family membersto said subject, option- include classic pharmaceutical preparations. Administration US 8,513,209 B2 29 30 ofthese compositions accordingto the present invention may the active ingredient(s) plus any additional desired ingredient be via any common route so long as the target tissue is from a previously sterile-filtered solution thereof. available via that route. This includes oral, nasal, or buccal. The compositions of the present invention generally may Alternatively, administration may be by intradermal, subcu- be formulated in a neutral or salt form. Pharmaceutically- taneous, intramuscular, intraperitoneal or intravenousinjec- acceptable salts include, for example, acid addition salts tion, or by direct injection into cardiac tissue. Pharmaceutical (formed with the free amino groups ofthe protein) derived compositions comprising miRNA inhibitors or expression from inorganic acids (e.g., hydrochloric or phosphoric acids, constructs encoding inhibitory polynucleotides may also be or from organic acids (e.g., acetic, oxalic, tartaric, mandelic, and thelike. Salts formed with the free carboxyl groups ofthe administered by catheter systemsor systemsthat isolate coro- protein can also be derived from inorganic bases (e.g., nary circulation for delivering therapeutic agentsto the heart. sodium, potassium, ammonium,calcium, or ferric hydrox- Various catheter systems for delivering therapeutic agents to ides) or from organic bases(e.g., isopropylamine, trimethy- the heart and coronary vasculature are known in the art. Some lamine,histidine, procaine andthe like. non-limiting examples of catheter-based delivery methods or Upon formulation, solutionsare preferably administered in coronary isolation methods suitable for use in the present a manner compatible with the dosage formulation and in such invention are disclosed in U.S. Pat. No. 6,416,510; U.S. Pat. amountas is therapeutically effective. The formulations may No. 6,716,196; U.S. Pat. No. 6,953,466, WO 2005/082440, easily be administered in a variety of dosage forms such as WO 2006/089340, U.S. Patent Publication No. 2007/ injectable solutions, drug release capsules and the like. For 0203445, U.S. Patent Publication No. 2006/0148742, and parenteral administration in an aqueous solution, for U.S. Patent Publication No. 2007/0060907, which are all example, the solution generally is suitably buffered and the herein incorporated by reference in their entireties. Such liquid diluentfirst rendered isotonic for example with suffi- compositions would normally be administered as pharmaceu- cient saline or glucose. Such aqueoussolutions may be used, tically acceptable compositions, as described supra. for example, for intravenous, intramuscular, subcutaneous The active compounds mayalso be administered parenter- and intraperitoneal administration. Preferably, sterile aque- ally or intraperitoneally. By way ofillustration, solutions of ous media are employedas is knownto those of skill in theart, the active compounds as free base or pharmacologically particularly in light of the present disclosure. By way of acceptable salts can be prepared in water suitably mixed with illustration, a single dose may be dissolved in 1 ml of isotonic a surfactant, such as hydroxypropylcellulose. Dispersions NaC]solution and either added to 1000 ml ofhypodermocly- can also be preparedin glycerol, liquid polyethylene glycols, sis fluid or injected at the proposedsite of infusion, (see for and mixtures thereofandin oils. Under ordinary conditions of example, “Remington’s Pharmaceutical Sciences” 15th Edi- storage and use, these preparations generally contain a pre- tion, pages 1035-1038 and 1570-1580). Some variation in servative to prevent the growth of microorganisms. dosage will necessarily occur depending on the condition of The pharmaceutical forms suitable for injectable use or the subject being treated. The person responsible for admin- catheter delivery include, for example, sterile aqueous solu- istration will, in any event, determine the appropriate dose for tionsor dispersions andsterile powders for the extemporane- the individual subject. Moreover, for human administration, ous preparation ofsterile injectable solutions or dispersions. preparations should meetsterility, pyrogenicity, general Generally, these preparationsare sterile and fluid to the extent safety and purity standards as required by FDA Office of that easy injectability exists. Preparations should be stable Biologics standards. under the conditions of manufacture and storage and should Any of the compositions described herein may be com- be preserved against the contaminating action ofmicroorgan- 40 prised in a kit. In a non-limiting example, an inhibitor of one isms, such as bacteria and fungi. Appropriate solvents or or more miR-15 family members, such as an antagomur, is dispersion media may contain, for example, water, ethanol, included in a kit. The kit may contain two or more, three or polyol (for example, glycerol, propylene glycol, and liquid more, four or more, five or more, or six inhibitors for each polyethylene glycol, and the like), suitable mixtures thereof, miR-15 family member. By way of example, the kit may and vegetable oils. The properfluidity can be maintained, for 45 contain an inhibitor of miR-195 andan inhibitor ofmiR-15a. example, by the use of a coating, such as lecithin, by the All possible combinations of inhibitors for miR-15 family maintenance of the required particle size in the case of dis- members are contemplated by the invention. The kit may persion and by the use of surfactants. The prevention of the further include water and/or buffers to stabilize the inhibitory action of microorganisms can be brought about by various polynucleotides. The kit may also include one or more trans- antibacterial and antifungal agents, for example, parabens, fection reagent(s) to facilitate delivery of the miRNA inhibi- chlorobutanol, phenol, sorbic acid, thimerosal, and the like. torsto cells. In manycases,it will be preferable to include isotonic agents, The components of the kits may be packaged either in for example, sugars or sodium chloride. Prolonged absorp- aqueous media or in lyophilized form. The container means tion of the injectable compositions can be brought about by of the kits will generally include at least one vial, test tube, the use in the compositions ofagents delaying absorption, for 55 flask, bottle, syringe or other container means, into which a example, aluminum monostearate and gelatin. componentmaybeplaced, and preferably, suitably aliquoted. Sterile injectable solutions may be prepared by incorporat- Where there is more than one componentin the kit (labeling ing the active compounds in an appropriate amount into a reagent and label may be packagedtogether), the kit also will solvent along with any other ingredients (for example as generally contain a second, thirdor other additional container enumerated above) as desired, followed byfiltered steriliza- into which the additional components may be separately tion. Generally, dispersions are prepared by incorporating the placed. However, various combinations of components may various sterilized active ingredients into a sterile vehicle be comprised in a vial. The kits of the present invention also which containsthe basic dispersion medium andthe desired will typically include a means for containing the nucleic other ingredients, e.g., as enumerated above. In the case of acids, and any other reagent containers in close confinement sterile powders for the preparation of sterile injectable solu- for commercial sale. Such containers may include injection or tions, the preferred methods of preparation include vacuum- blow-moldedplastic containers into which the desired vials drying and freeze-drying techniques which yield a powder of are retained. US 8,513,209 B2 31 32 Whenthe componentsofthe kit are provided in one and/or member. In some embodiments, assessing the activity of the moreliquid solutions, the liquid solution is an aqueous solu- miR-15 family member comprises assessing expression or tion, with a sterile aqueous solution being particularly pre- activity of a gene regulated by the miR-15 family member. ferred. Genes regulated by miR-15 family members include, for However, the components of the kit may be provided as example, FGF2, TGFb-induced factor 2, BCL9I, BCL2L, dried powder(s). When reagents and/or componentsare pro- CDC25A,cyclin E1, cyclin D1, and cyclin D2. Thosein the vided as a dry powder, the powder can be reconstituted by the art will be familiar with a variety ofmethodsfor assessing the addition ofa suitable solvent. It is envisioned that the solvent activity or expression of genes regulated by miR-15 family mayalso be provided in another container means. members. Such methodsinclude, for example, northern blot- The container means will generally include at least one ting, RT-PCR, ELISA, or western blotting. vial, test tube, flask, bottle, syringe and/or other container It will, of course, be understood that all the screening means, into which the nucleic acid formulations are placed, methods of the present invention are useful in themselves preferably, suitably allocated. The kits may also comprise a second container meansfor containing a sterile, pharmaceu- notwithstanding the fact that effective candidates may not be found. The invention provides methodsfor screening for such tically acceptable buffer and/or other diluent. 15 Such kits may also include components that preserve or candidates, not solely methodsoffinding them. maintain the miRNA inhibitors or that protect against their As used herein the term “candidate substance”refers to any degradation. Such components may be RNAse-freeor protect molecule that may potentially modulate the function ofmiR- against RNAses. Such kits generally will comprise, in suit- 15 family members. Onewill typically acquire, from various able means,distinct containers for each individual reagent or commercial sources, molecular libraries that are believed to solution. meetthe basic criteria for useful drugs in an effort to “brute A kit will also include instructions for employing the kit force” the identification of useful compounds. Screening of components as well the use of any other reagent not included such libraries, including combinatorially-generated libraries in the kit. Instructions may include variations that can be (e.g., antagomir libraries), is a rapid and efficient way to implemented. A kit may also include utensils or devices for screen large numberofrelated (and unrelated) compoundsfor administering the miRNA inhibitor by various administration activity. Combinatorial approaches also lend themselves to routes, such as parenteral or catheter administration. rapid evolution of potential drugs by the creation of second, Tt is contemplated that such reagents are embodiments of third, and fourth generation compounds modeled on active, kits ofthe invention. Such kits, however, are not limited to the but otherwise undesirable compounds. Non-limiting particular items identified above and may include any reagent examples of candidate compounds that may be screened used for the manipulation or characterization of miRNA. according to the methods of the present invention are pro- The present invention further comprises methodsfor iden- teins, peptides, polypeptides, polynucleotides, oligonucle- tifying modulators of miR-15 family members. Identified otides or small molecules. Modulators of miR-15 family inhibitors of the function of one or more miR-15 family members may also be agonistsor inhibitors ofupstream regu- membersare useful in the prevention or treatmentor reversal lators of any one of the miR-15 family members. of cardiac hypertrophy or heart failure. Modulators (e.g. A quick, inexpensive and easy assay to run is an in vitro inhibitors) of miR-15 family members may be included in assay. Such assays generally use isolated molecules, can be pharmaceutical compositions for the treatment of cardiac run quickly and in large numbers, thereby increasing the disorders according to the methodsofthe present invention. amountof information obtainable in a short period of time. A These assays may comprise random screening of large 40 variety ofvessels may be usedto run the assays, including test libraries of candidate compounds; alternatively, the assays tubes, plates, dishes and other surfaces such as dipsticks or may be used to focus on particular classes of compounds beads. selected with an eye towards structural attributes that are A technique for high throughput screening of compounds believed to make them more likely to inhibit the expression is described in WO 84/03564, whichis herein incorporated by and/or function of miR-15 family members. 45 reference in its entirety. Large numbers of small antagomir To identify a modulator of a miR-15 family member, one compounds may be synthesized on a solid substrate, such as generally will determine the function of a miR-15 family plastic pins or some other surface. Such molecules can be memberin the presence and absence of the candidate com- rapidly screening for their ability to hybridize to miR-15 pound. For example, a method generally comprises: family members. (a) providing a candidate compound; 50 The present invention also contemplates the screening of (b) admixing the candidate compound with a miR-15 fam- compounds for their ability to modulate expression and/or ily member; function of one or more miR-15 family membersin cells. (c) measuring activity of the miR-15 family member; and Various cell lines, including those derived from skeletal (d) comparingtheactivity in step (c) with the activity in the muscle cells, can be utilized for such screening assays, absenceof the candidate compound, 55 including cells specifically engineered for this purpose. Pri- wherein a difference between the measuredactivities indi- mary cardiac cells also may be used, as can the H9C2cellline. cates that the candidate compoundis a modulator ofamiR-15 In vivo assays involve the use of various animal models of family member. heart disease, including transgenic animals, that have been Assays also may be conductedin isolated cells, organs, or in engineered to have specific defects, or carry markers that can living organisms. 60 be used to measure the ability of a candidate compound to Assessing the activity or expression of a miR-15 family reach andaffect different cells within the organism. Due to member may comprise assessing the expression level of the their size, ease of handling, and information on their physi- miR-15 family member. Thosein theart will be familiar with ology and genetic make-up, mice are a preferred embodi- a variety of methods for assessing RNA expression levels ment, especially for transgenics. However, other animals are including, for example, northern blotting or RI-PCR.Assess- suitable as well, includingrats, rabbits, hamsters, guinea pigs, ing the activity or expression of the miR-15 family member gerbils, woodchucks, cats, dogs, sheep, goats, pigs, cows, may comprise assessing the activity of the miR-15 family horses and monkeys (including chimps, gibbons and US 8,513,209 B2 33 34 baboons). Assays for inhibitors may be conducted using an example, in one embodiment, the agonist may be a polynucle- animal model derived from any of these species. otide comprising a sequence of SEQ ID NO:1, SEQ ID NO: Treatmentofanimals with test compoundswill involve the 2, SEQID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: administration of the compound, in an appropriate form, to 6, or SEQ ID NO:19. The polynucleotide comprising the a the animal. Administration will be by any route that could be mature sequence of a miR-15 family member maybe single utilized for clinical purposes. Determining the effectiveness stranded or double stranded. The polynucleotides may con- of a compound in vivo may involve a variety of different tain one or more chemical modifications, such as locked criteria, including but notlimited to alteration ofhypertrophic nucleic acids, peptide nucleic acids, sugar modifications, signaling pathways and physical symptoms of hypertrophy. such as 2'-O-alkyl (e.g. 2'-O-methyl, 2'-O-methoxyethyl), Also, measuring toxicity and dose response can be performed 10 2'-fluoro, and 4' thio modifications, and backbone modifica- in animals in a more meaningful fashion than in in vitro or in tions, such as one or more phosphorothioate, morpholino, or cyto assays. phosphonocarboxylate linkages. In one embodiment, the In one embodiment, the present invention provides a polynucleotide comprising a miR-15 family member method ofregulating cardiac cell survival comprising admin- sequence is conjugated to cholesterol. In another embodi- istering to cardiac cells a modulator of one or more miR-15 15 ment, the agonist ofamiR-15 family membermay be an agent family members. In another embodiment, the modulator is an distinct from the miR-15 family memberthat acts to increase, agonist ofthe expressionor activity ofa miR-15 family mem- supplement, or replace the function of the miR-15 family ber. In another embodiment, cardiaccell survival is decreased member. In another embodiment, the miR-15 family agonist following administration of an agonist of a miR-15 family may be expressed in vivo from a vector. member. In another embodiment, the modulator of a miR-15 20 In one embodiment, the present invention provides a family memberis an inhibitor of the expression or activity of method for treating pathologic cardiac hypertrophy, heart a miR-15 family member.In still another embodiment, car- failure, or myocardial infarction in a subject in need thereof diac cell survival is increased following administration of an comprising: identifying a subject having cardiac hypertrophy, inhibitor of a miR-15 family member. heart failure, or myocardial infarction; and administering an In a further embodiment, the present invention provides a 25 inhibitor of one or more miR-15 family membersto the sub- method of regulating apoptosis of cardiac cells comprising ject. In certain embodiments of the invention the miR-15 administering to cardiac cells a modulator of one or more family inhibitor may be identified by a method comprising: miR-15 family members. In another embodiment, the modu- (a) contacting a cell with a candidate compound;(b) assessing lator is an agonist of the expression or activity of a miR-15 activity or expression of a miR-15 family member; and (c) family member. In another embodiment, apoptosis of cardiac 30 comparing the activity or expression in step (b) with the cells is increased following administration of an agonist of a activity or expression in the absence of the candidate com- miR-15 family member. In another embodiment, the modu- pound, wherein a reduction in the activity or expression ofthe lator ofamiR-15 family memberis an inhibitor ofthe expres- miR-15 family memberin the cell contacted with the candi- sion or activity of a miR-15 family member.In still another date compound comparedto the activity or expression in the embodiment, apoptosis of cardiac cells is decreased follow- 35 cell in the absence of the candidate compound indicates that ing administration of an inhibitor of a miR-15 family mem- the candidate compoundis an inhibitor of the miR-15 family ber. In some embodiments, the expression of FGF2, TGFb- member. induced factor 2, BCL9I, BCL2L, CDC25A, cyclin E1, A particular embodimentofthe present invention provides cyclin D1, or cyclin D2 is increased ina cell by contacting the transgenic animals that lack one or both functionalalleles of cell with a miR-15 family inhibitor. In other embodiments, 40 a miR-15 family member. Also, transgenic animals that expression ofFGF2, TGFb-inducedfactor 2, BCL9I, BCL2L, express miR-15 family members under the control of an CDC25A,cyclin E1, cyclin D1, or cyclin D2 is decreased in inducible, tissue selective or a constitutive promoter, recom- a cell by contacting the cell with a miR-15 family agonist. binant cell lines derived from such animals, and transgenic Thus, the present invention includes a method ofregulating embryos may be useful in determining the exactrole that the expression ofFGF2, TGFb-inducedfactor 2, BCL9I, BCL2L, 45 miR-15 family memberplays in the developmentanddiffer- CDC25A,cyclin El, cyclin D1, or cyclin D2 in a cell com- entiation ofcardiomyocytes and in the developmentofpatho- prising contacting the cell with a modulator of a miR-15 logic cardiac hypertrophy and heart failure. Furthermore, family member. In one embodiment, the expression of FGF2, these transgenic animals may provide an insight into heart TGFb-induced factor 2, BCL9I, BCL2L, CDC25A,cyclin development. The use of constitutively expressed miR-15 E1, cyclin D1, or cyclin D2 is decreased in the cell following 50 family members provides a model for over- or unregulated administration of a miR-15 family agonist. In another expression. Also, transgenic animals that are “knocked out” embodiment, the expression of FGF2, TGFb-induced factor for one or more miR-15 family members, in one or both 2, BCL9I, BCL2L, CDC25A,cyclin E1, cyclin D1, or cyclin alleles, are contemplated. D2 is increased in the cell following administration of a In a general embodiment, a transgenic animalis produced miR-15 family inhibitor. 55 by the integration of a given transgene into the genomein a An agonist of a miR-15 family member may be a poly- mannerthat permits the expression of the transgene. Methods nucleotide comprising a mature sequence or a star sequence for producing transgenic animals are generally described by from a miR-15 family member. In one embodiment, the poly- Wagner and Hoppe(U.S. Pat. No. 4,873,191; incorporated nucleotide comprises the sequence of SEQ ID NO: 7, SEQ ID herein by reference), and Brinsteret al. (1985; incorporated NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ 60 herein by reference). IDNO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQID NO:15, Typically, a gene flanked by genomic sequencesis trans- SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO:20, or SEQ ID ferred by microinjection into a fertilized egg. The microin- NO: 21. In another embodiment, the agonist of a miR-15 jected eggs are implantedinto a host female, and the progeny family member may be a polynucleotide comprising the pri- are screened for the expression of the transgene. Transgenic miRNA orpre-miRNA sequence for a miR-15 family mem- 65 animals may be produced from the fertilized eggs from a ber(e.g. pre-miR-195, pre-miR-497, pre-miR-424, pre-miR- number of animals including, but not limited to reptiles, 15a, pre-miR-15b, pre-miR-16-1, or pre-miR-16-2). For amphibians, birds, mammals, and fish. US 8,513,209 B2 35 36 DNA clones for microinjection can be prepared by any involve disorders in several cardiac autonomic properties, meansknowninthe art. For example, DNA clones for micro- including sympathetic, parasympathetic, and baroreceptor injection can be cleaved with enzymesappropriate for remov- responses. The phrase “manifestations of heart failure” is ing the bacterial plasmid sequences, and the DNA fragments used broadly to encompassall ofthe sequelae associated with electrophoresed on 1% agarose gels in TBE buffer, using heart failure, such as shortness of breath, pitting edema, an standard techniques. The DNA bandsare visualized by stain- enlarged tender liver, engorged neck veins, pulmonary rales ing with ethidium bromide, and the band containing the and the like including laboratory findings associated with expression sequences is excised. The excised band is then heart failure. placed in dialysis bags containing 0.3 M sodium acetate, pH The term “treatment” or grammatical equivalents encom- 7.0. DNA is electroeluted into the dialysis bags, extracted 10 passes the improvementand/or reversal of the symptoms of with a 1:1 phenol:chloroform solution and precipitated by heart failure (i.e., the ability of the heart to pump blood). two volumesof ethanol. The DNAis redissolved in 1 ml of “Improvementin the physiologic function” of the heart may low salt buffer (0.2 M NaCl, 20 mM Tris, pH 7.4, and 1 mM be assessed using any of the measurements described herein EDTA)andpurified on an Elutip-D™column. The column is (e.g., measurementof ejectionfraction, fractional shortening, first primed with 3 ml of high salt buffer (1 M NaCl, 20 mM 15 left ventricular internal dimension, heart rate, etc.), as well as Tris, pH 7.4, and 1 mM EDTA) followed by washing with 5 any effect upon the animal’s survival. In use of animal mod- mlof low salt buffer. The DNA solutions are passed through els, the response of treated transgenic animals and untreated the column three times to bind DNAto the column matrix. transgenic animals is compared using any of the assays After one wash with 3 mloflow salt buffer, the DNA is eluted described herein (in addition, treated and untreated non- with 0.4 ml high salt buffer and precipitated by two volumes 20 transgenic animals may be included as controls). A com- of ethanol. DNA concentrations are measured by absorption pound which causes an improvement in any parameter asso- at 260 nm in a UV spectrophotometer. For microinjection, ciated with heart failure used in the screening methodsof the DNA concentrations are adjusted to 3 ug/ml in 5 mM Tris, pH instant invention may thereby be identified as a therapeutic 7.4 and 0.1 mM EDTA. Other methods for purification of compound. DNA for microinjection are described in Palmiter et al. 25 The term “dilated cardiomyopathy”refers to a type ofheart (1982); and in Sambrooket al. (2001). failure characterized by the presence of a symmetrically In an exemplary microinjection procedure, female mice six dilated left ventricle with poor systolic contractile function weeksofage are inducedto superovulate with a 5 IU injection and, in addition, frequently involves the right ventricle. (0.1 cc, ip) of pregnant mare serum gonadotropin (PMSG; The term “compound”refers to any chemical entity, phar- Sigma) followed 48 hourslater by a 5 IU injection (0.1 cc, ip) 30 maceutical, drug, and the like that can be used to treat or ofhuman chorionic gonadotropin (hCG; Sigma). Females are prevent a disease, illness, sickness, or disorder of bodily placed with males immediately after hCG injection. Twenty- function. Compounds comprise both known and potential one hours after hCG injection, the mated females are sacri- therapeutic compounds. A compound can be determinedto be ficed by C02 asphyxiation or cervical dislocation and therapeutic by screening using the screening methods of the embryos are recovered from excised oviducts and placed in 35 present invention. A “known therapeutic compound”refersto Dulbecco’s phosphate buffered saline with 0.5% bovine a therapeutic compoundthat has been shown(e.g., through serum albumin (BSA; Sigma). Surrounding cumuluscells are animal trials or prior experience with administration to removed with hyaluronidase (1 mg/ml). Pronuclear embryos humans)to be effective in such treatment. In other words, a are then washed and placed in Earle’s balancedsalt solution known therapeutic compoundis not limited to a compound containing 0.5% BSA (EBSS) in a 37.5° C. incubator with a 40 efficacious in the treatmentofheart failure. humidified atmosphere at 5% CO,, 95% air until the time of As used herein, the term “cardiac hypertrophy”refers to injection. Embryos can be implanted at the two-cell stage. the process in which adult cardiac myocytes respondto stress Randomly cycling adult female miceare paired with vasec- through hypertrophic growth. Such growth is characterized tomized males. C57BL/6 or Swiss mice or other comparable by cell size increases without cell division, assembling of strains can be used for this purpose. Recipient females are 45 additional sarcomeres within the cell to maximize force gen- mated at the same time as donor females. At the time of eration, and an activation of a fetal cardiac gene program. embryotransfer, the recipient females are anesthetized with Cardiac hypertrophyis often associated with increased risk of an intraperitoneal injection of 0.015 ml of 2.5% avertin per morbidity and mortality, and thus studies aimed at under- gram of body weight. The oviducts are exposed bya single standing the molecular mechanismsof cardiac hypertrophy midline dorsal incision. An incision is then made through the 50 could have a significant impact on human health. body wall directly over the oviduct. The ovarian bursa is then As used herein, the term “modulate” refers to a change or torn with watchmakers forceps. Embryosto be transferred are an alteration in a biological activity. Modulation may be an placed in DPBS (Dulbecco’s phosphate buffered saline) and increase or a decrease in protein activity, a change in kinase in the tip of a transfer pipet (about 10 to 12 embryos). The activity, a change in binding characteristics, or any other pipet tip is inserted into the infundibulum and the embryos 55 changein the biological, functional, or immunological prop- transferred. After the transfer, the incision is closed by two erties associated with the activity of a protein or other struc- sutures. ture of interest. The term “modulator” refers to any molecule As used herein, the term “heart failure” is broadly used to or compound which is capable of changing oraltering bio- mean any condition that reduces the ability of the heart to logical activity as described above. pumpblood. As a result, congestion and edema develop in the 60 The term “f-adrenergic receptor antagonist” refers to a tissues. Most frequently, heart failure is caused by decreased chemical compound or entity that is capable of blocking, contractility ofthe myocardium,resulting from reduced coro- either partially or completely, the beta (B) type of adrenore- nary blood flow; however, many other factors may result in ceptors (1.e., receptors of the adrenergic system that respond heart failure, including damage to the heart valves, vitamin to catecholamines, especially norepinephrine). Some (-adr- deficiency, and primary cardiac muscle disease. Though the 65 energic receptor antagonists exhibit a degree of specificity for precise physiological mechanisms of heart failure are not one receptor subtype (generally 6,); such antagonists are entirely understood, heart failure is generally believed to termed “B,-specific adrenergic receptor antagonists” and US 8,513,209 B2 37 38 “B.,-specific adrenergic receptor antagonists.” The term practice of the invention, and thus can be considered to con- B-adrenergic receptor antagonist” refers to chemical com- stitute preferred modes for its practice. However, those of pounds that are selective and non-selective antagonists. skill in the art should, in light of the present disclosure, Examples of f-adrenergic receptor antagonists include, but appreciate that many changes can be made in the specific are not limited to, acebutolol, atenolol, butoxamine,carteolol, embodiments which are disclosed andstill obtain a like or esmolol, labetolol, metoprolol, nadolol, penbutolol, pro- similar result without departing from the spirit and scope of panolol, and timolol. The use of derivatives of known (-adr- the invention. energic receptor antagonists is encompassed by the methods of the present invention. Indeed any compound, which func- EXAMPLES tionally behaves as a B-adrenergic receptor antagonist is 10 encompassed by the methods of the present invention. Example 1 The terms “angiotensin-converting enzyme inhibitor” or “ACEinhibitor”refer to a chemical compoundorentity that Regulation of Cardiac Hypertrophy and Heart is capable of inhibiting, either partially or completely, the Failure by Stress-Responsive miRNAs enzyme involved in the conversion of the relatively inactive 15 angiotensin I to the active angiotensinI] in the rennin-angio- In light of their involvement in modulating cellular pheno- tensin system. In addition, the ACE inhibitors concomitantly types, the inventors have hypothesized that miRNAs may inhibit the degradation of bradykinin, which likely signifi- play a role in regulating the response of the heart to cardiac cantly enhances the antihypertensive effect ofthe ACE inhibi- stress, which is knownto result in transcriptional and trans- tors. Examples ofACE inhibitors include, but are not limited 20 lational changes in gene expression. To investigate the poten- to, benazepril, captopril, enalopril, fosinopril, lisinopril, qui- tial involvement of miRNAs in cardiac hypertrophy, a side- april and ramipril. The use of derivatives of known ACE by-side miRNA microarray analysis was performed in two inhibitors is encompassed by the methods of the present established mouse models of cardiac hypertrophy, using a invention. Indeed any compound, which functionally behaves microarray that represented 186 different miRNAs. Mice that as an ACE inhibitor, is encompassed by the methods of the 25 were subjected to thoracic aortic banding (TAB), which present invention. induces hypertrophy by increasedafterload on the heart (Hill As used herein, the term “genotypes”refers to the actual et al., 2000), were compared to sham operated animals. In a genetic make-up of an organism, while “phenotype”refers to second model, transgenic mice expressing activated cal- physical traits displayed by an individual. In addition, the cineurin (CnA) in the heart, which results in a severe, well- “phenotype” is the result of selective expression of the 30 characterized form of hypertrophy (Molkentin et al., 1998), genome(1.e., it is an expression of the cell history and its were compared to wild-type littermates (FIG. 1A). RNA iso- response to the extracellular environment). Indeed, the lated from hearts ofmice subjected to TAB showedincreased human genomecontains an estimated 30,000-35,000 genes. expression of 27 miRNAs compared to sham-operated con- In each cell type, only a small (1.e., 10-15%)fraction ofthese trols, and CnA Tg mice showed increased expression of 33 genes are expressed. 35 miRNAs compared with non-transgenic littermate controls, The use of the word “a”or “an” when used in conjunction of which 21 were up-regulated in both models. Similarly, with the term “comprising” in the claims and/or the specifi- TAB and CnA-induced hypertrophy were accompanied by cation may mean “one,” but it is also consistent with the reduced expression of 15 and 14 miRNAs,respectively, of meaning of “one or more,” “at least one,” and “one or more which 7 miRNAs were down-regulated in common (FIG. than one.” 40 1B). Northern analysis of expression of these miRNAs and It is contemplated that any embodiment discussed herein previous microarray analyses (Baradet al., 2004; Sempere et can be implemented with respect to any method or composi- al., 2004; Shingaraet al., 2005; Babaket al., 2004; Liu etal., tion of the invention, and vice versa. Furthermore, composi- 2004) indicate that they are expressed in a wide range of tions andkits ofthe invention can be used to achieve methods tissues. of the invention. 45 Based on their relative expression levels, conservation of Throughout this application, the term “about” is used to human, rat and mouse sequences, and levels of expression indicate that a value includes the standard deviation of error during hypertrophy, the inventors focused on 11 up- and 5 for the device or method being employed to determine the down-regulated miRNAs. Northern blot analysis ofRNA iso- value. lated from cardiac tissue from WT and CnA Tg animals The use of the term “or” in the claims is used to mean 50 confirmed an increased expression ofmiR-21, miR-23, miR- “and/or” unless explicitly indicated to refer to alternatives 24, miR-125b, miR-195, miR-199a, and miR-214, and only or the alternatives are mutually exclusive, although the decreased expression of miR-29c, miR-93, miR-150 and disclosure supports a definition that refers to only alternatives miR-181b (FIG. 1C). Collectively, these data indicate that and “and/or.” distinct miRNAsare regulated during cardiac hypertrophy, Asusedin this specification and claim(s), the words “com- 55 suggesting the possibility that they might function as modu- prising” (and any form ofcomprising, such as “comprise” and lators of this process. “comprises”), “having” (and any form of having, such as Ventricular hypertrophy develops in response to numerous “have” and “has”), “including” (and any form of including, forms of cardiac stress and often leads to heart failure in such as “includes” and “include”) or “containing” (and any humans (Arad et al., 2002). Northern blot analysis of the form of containing, such as “contains” and “contain’’) are 60 hypertrophy-regulated miRNAsin idiopathic end-stagefail- inclusive or open-ended and do not exclude additional, unre- ing human hearts showed increased expression of miR-24, cited elements or methodsteps. miR-125b, miR-195, miR-199a and miR-214, while the The following examples are includedto further illustrate expression for miR-23 appeared to be variable within the various aspects of the invention. It should be appreciated by non-failing and failing groups (FIG. 2). No changein expres- those of skill in the art that the techniques disclosed in the 65 sion of miR-21, miR-27, miR-29c, miR-93, miR-150 and examples which follow represent techniques and/or compo- miR-181b was found (data not shown). Thus, the altered sitions discovered by the inventors to function well in the pattern ofmiRNA expression in the failing human heart over- US 8,513,209 B2 39 40 lapped with that of the hypertrophic mouseheart, suggesting miRNA-195 belongs to a small family of microRNAs,the that these miRNAsrepresent a molecular signature ofadverse miR-15 family, which contains miR-195, miR-16-1, miR- cardiac remodeling. 15a, miR-15b, miR-16-2, miR-424, and miR-497. Four ofthe miR-15 family members are expressed as three clustered Example 2 transcripts (FIG. 6A). Using a variety of bioinformatics approaches, potential mRNAtargets for miR-195 were iden- Cardiac Over-Expression of miR-195 is Sufficient to tified. Several ofthe identified target mRNAs encodeproteins Drive Cardiac Hypertrophy involved in cell proliferation, survival and anti-apoptosis (FIG. 6B). Oneof the predicted targets for the miR-15 family MiR-24, miR-195 and miR-214 were overexpressed spe- 10 is FGF2, which has been shown to promote cardiac repair cifically in the heart under the control of the a-myosin heavy (FIG.7). All members of the miR-15 family are up-regulated chain (MHC)promoter. F1 offspring could not be obtained in failing human hearts, indicating that this family ofmicroR- for miR-24, suggesting that cardiac over-expression of this NAsplays a key role in pathological cardiac remodeling (FIG.8). Since all the miR-15 family members share a con- miRNA causes embryoniclethality. Since all offspring of the 15 served seed sequence, all miR-15 family members could be miR-195 transgenic (Tg) line 3 died in the first two weeks inhibited simultaneously by targeting the seed sequence. One after birth due to heart failure (FIG. 3), the Tg line 1 for such approach entails overexpression of a nucleic acid con- miR-195, which was viable, was used for further studies. taining multiple binding sites, which comprise a sequence Northern blot analysis showed miR-195 to be expressed at complementary to the seed sequence. The nucleic acid would levels ~25-fold above normal in Tg line 1 (FIG. 3). Over- 20 “scavenge” or “sponge” all separate members because of expression of miR-195 initially induced cardiac growth with their overlap in seed region and consequently overlap in target disorganization of cardiomyocytes, which progressed to a sequence (FIG. 8B) (Ebert et al., 2007). dilated phenotype by 6 weeks of age. Although there were All publications, patents, and patent applications discussed some fibrotic lesions, the dramatic increase in size of indi- and cited herein are incorporated herein by reference in their vidual myocytes in miR-195 Tg mice comparedto wild-type 25 entireties. All ofthe compositions and methods disclosed and (WT) was morestriking (FIG.3). claimed herein can be made and executed without undue Echocardiography on 6 week-old animals showed that experimentation in light of the present disclosure. While the miR-195 Tg mice displayed thinning of the left ventricular compositions and methods of this invention have been walls (AWs and PWs),an increase in left ventricular diameter described in termsofpreferred embodiments,it will be appar- (LVIDd and LVIDs) anda deterioration in cardiac function, as 30 ent to those of skill in the art that variations may be applied to indicated by decreased fractional shortening (FIG. 4A). Heart the compositions and methods, and in the steps or in the weightto body weight ratios were also dramatically increased sequence of steps of the methods described herein without in miR-195 Tg animals compared to WTlittermates, indicat- departing from the concept, spirit and scope of the invention. ing that over-expression of miR-195 wassufficient to stimu- Morespecifically, it will be apparentthat certain agents which late cardiac growth (FIG. 4B). Real-time PCR analysis on 35 are both chemically and physiologically related may be sub- cardiac tissue from miR-195 Tg animals comparedto their stituted for the agents described herein while the same or WTlittermates, revealed dramatic up-regulation ofthe hyper- similar results would be achieved.All such similar substitutes trophic markersatrial natriuretic factor (ANF), b-type natri- and modifications apparent to those skilled in the art are uretic protein (BNP) and B-myosin heavy chain (BMHC) in deemed to be within the spirit, scope and concept of the response to cardiac over-expression of miR-195 (FIG. 4C). 40 invention as defined by the appended claims. In contrast to the dramatic effects of overexpression of miR-195 on cardiac structure, function, and gene expression, X. REFERENCES cardiac over-expression of miR-214 at levels comparable to those of miR-195 had no phenotypic effect (FIGS. 4C and 5, The following references, to the extent that they provide and data not shown). Thus, the cardiac remodeling induced in 45 exemplary procedural or other details supplementary to those the miR-195 Tg animals is specifically due to functional set forth herein, are specifically incorporated herein by refer- effects ofthis miRNArather than a general non-specific effect ence. resulting from miRNA over-expression. These results indi- . Pat. No. 4,873,191 cate that increased expression of miR-195 induces hyper- . Pat. No. 5,604,251 trophic signaling leading to cardiac failure. Since miR-195 50 . Pat. No. 5,844,107 belongs to a small family of related miRNAs, the miR-15 . Pat. No. 5,877,302 family, other family membersare also likely to participate in . Pat. No. 5,972,900 cardiac disease. . Pat. No. 5,972,901 The ability of miR-195 to promote cardiac growth con- . Pat. No. 6,008,336 trasts with that of miR-1, a muscle-specific miRNA that 55 . Pat. No. 6,077,835 inhibits cardiac growth by suppressing the expression of the . Pat. No. 6,200,801 bHLHprotein Hand2 (Zhao et al., 2005). miR-1 is highly . Publn. 20020150626 expressed in the adult heart, but miR-195 is apparently . Publn. 20030032615 capable of over-riding the inhibitory influence of miR-1 on . Publn. 20030203865 cardiac growth. 60 USS. Publn. 20040048787 It is especially interesting that overexpression in cardi- Abraham etal., Mol. Med., 8:750-760, 2002. omyocytes of the miRNAs that were down-regulated during Ambros, Cell, 113(6):673-676, 2003. hypertrophy caused an apparent reduction in cell size, an Angel et al., Cell, 49:729, 1987b. effect opposite than that evoked by the upregulated miRNAs. Angel et al., Mol. Cell. Biol., 7:2256, 1987a. Oneinterpretation of these results is that these miRNAsnor- 65 Aradet al., Hum. Mol. genet., 11:2499-2506, 2002. mally function to suppress growth and are therefore down- Atchison andPerry, Ce//, 46:253, 1986. regulated to enhance hypertrophy. Atchison and Perry, Ce//, 48:121, 1987. US 8,513,209 B2 41 42 Babaket al., RNA 10:1813-1819, 2004. Fraley et al., Proc. Natl. Acad. Sci. USA, 76:3348-3352, 1979. Baichwal and Sugden, In: Gene Transfer, Kucherlapati (Ed.), Franzet al., Cardioscience, 5(4):235-43, 1994. Plenum Press, NY, 117-148, 1986. Friedmanet al., Genes Devel., 3:1314, 1989. Baldwin and Haddad, J. Appi. Physiol., 90:345-357, 2001. Fujita et al., Ced/, 49:357, 1987. Banerji et al., Ce//, 27(2 Pt 1):299-308, 1981. Ghosh and Bachhawat,In: Liver Diseases, Targeted Diagno- Banerji et al., Ce//, 33(3):729-740, 1983. sis and Therapy Using Specific Receptors andLigands, Wu Barad et al., Genome Res. 14:2486-2494, 1997. et al. (Eds.), Marcel Dekker, NY, 87-104, 1991. Barneset al., J. Biol. Chem., 272(17):11510-11517, 1997. Ghosh-Choudhury et al., EMBO J, 6:1733-1739, 1987. Benvenisty and Neshif, Proc. Natl. Acad. Sci. USA, 83(24): Gilles et al., Cell, 33:717, 1983. 9551-9555, 1986. 10 Gloss et al., EMBO J,, 6:3735, 1987. Berkhoutet al., Ce//, 59:273-282, 1989. Godboutet al., Mol. Cell. Biol., 8:1169, 1988. Bhaysar et al., Genomics, 35(1):11-23, 1996. Gomez-Foix et al., J. Biol. Chem., 267:25129-25134, 1992. Blanar et al., EMBO J, 8:1139, 1989. Goodbourn and Maniatis, Proc. Natl. Acad. Sci. USA, Bodine and Ley, EMBO J., 6:2997, 1987. 85:1447, 1988. Boshart et al., Cell, 41:521, 1985. 15 Goodbournet al., Cell, 45:601, 1986. Bosze et al., EMBO J, 5(7):1615-1623, 1986. Gopal, Mol. Cell Biol., 5:1188-1190, 1985. Braddocket al., Ce//, 58:269, 1989. Gopal-Srivastavaet al., J. Mol. Cell. Biol. 15(12):7081-7090, Brenneckeet al., Ce//, 113:25-36, 2003. 1995, Brinster et al., Proc. Natl. Acad. Sci. USA, 82(13):4438-4442, Graham and Prevec, In: Methods in Molecular Biology: Gene 1985. 20 Transfer and Expression Protocol, Murray (Ed.), Humana Bristow, Cardiology, 92:3-6, 1999. Press, Clifton, N.J., 7:109-128, 1991. Bulla and Siddiqui, J. Virol., 62:1437, 1986. Graham and Van Der Eb, Virology, 52:456-467, 1973. Calin et al., Proc. Natl. Acd. Sci. USA, 99:15524-15529, Graham etal., J. Gen. Virl., 36(1):59-74, 1977. 2002. Greeneet al., Immunology Today, 10:272, 1989 Campbell and Villarreal, Mo/. Cell. Biol., 8:1993, 1988. 25 Grishoket al., Cell, 106:23-34, 2001. Campere and Tilghman, Genes and Dev., 3:537, 1989. Grossched] and Baltimore, Ce//, 41:885, 1985. Campoet al., Nature, 303:77, 1983. Grunhaus and Horwitz, Seminar in Virology, 3:237-252, Carrington et al. Science, 301(5631):336-338, 2003. 1992. Celander and Haseltine, J. Virology, 61:269, 1987. Harland and Weintraub, J. Cell Biol., 101(3):1094-1099, Celanderet al., J. Virology, 62:1314, 1988. 30 1985. Chandleret al., Cell, 33:489, 1983. Haslinger and Karin, Proc. Natl. Acad. Sci. USA, 82:8572, Chang and Karin, Nature, 410(6824):37-40, 2001. 1985. Chang etal., Biochim. Biophys. Acta, 1092(2):153-160, 1991. Hauber and Cullen, J. Virology, 62:673, 1988. Changet al., Mol. Cell. Biol., 9:2153, 1989. Henet al., Nature, 321:249, 1986. Changet al., Nature, 430(7001):785-789, 2004. 35 Henselet al., Lymphokine Res., 8:347, 1989. Chatterjee et al., Proc. Natl. Acad. Sci. USA, 86:9114, 1989. Hermonat and Muzycska, Proc. Natl. Acad. Sci. USA, Chen and Okayama, Mol. Cell Biol., 7(8):2745-2752, 1987. 81:6466-6470, 1984. Chenet al., Mol. Cell Endocrinol., 162:45-55, 2000. Herr and Clarke, Ce//, 45:461, 1986. Chenetal., Science, 303(5654):83-86, 2004. Hersdorffer et al., DNA Cell Biol., 9:713-723, 1990. Choiet al., Cell, 53:519, 1988. 40 Herz and Gerard, Proc. Natl. Acad. Sci. USA, 90:2812-2816, Coffin, In: Virology, Fields et al. (Eds.), Raven Press, NY, 1993. 1437-1500, 1990. Hill et al., Circulation, 101:2863-2869, 2000. Cohenet al., J. Cell. Physiol., 5:75, 1987. Hirochikaet al., J. Virol., 61:2599, 1987. Costa et al., Mol. Cell. Biol., 8:81, 1988. Hirschet al., Mol. Cell. Biol., 10:1959, 1990. Couchet al., Am. Rev. Resp. Dis., 88:394-403, 1963. 45 Holbrooket al., Virology, 157:211, 1987. Couparet al., Gene, 68:1-10, 1988. Horlick and Benfield, Mol. Cell. Biol., 9:2396, 1989. Cripe et al., EMBO J., 6:3745, 1987. Horwichet al. J. Virol., 64:642-650, 1990. Culotta and Hamer, Mol. Cell. Biol., 9:1376, 1989. Huanget al., Ce//, 27:245, 1981. Dandoloet al., J Virology, 47:55-64, 1983. Huget al., Mol. Cell. Biol., 8:3065, 1988. De Villiers et al., Nature, 312(5991):242-246, 1984. 50 Hutvagneret al., PLoS Biol., 2(4):E98, 2004. Deschampsetal., Science, 230:1174-1177, 1985. Hwanget al., Mol. Cell. Biol., 10:585, 1990. Dubenskyet al., Proc. Natl. Acad. Sci. USA, 81:7529-7533, Imagawaet al., Ce//, 51:251, 1987. 1984. Imbra and Karin, Nature, 323:555, 1986. Durandet al., Ann. Med., 27:311-317, 1995. Imleret al., Mol. Cell. Biol., 7:2558, 1987. Ebert et al., Nat. Methods, 4:721-726, 2007. 55 Imperiale and Nevins, Mol. Cell. Biol., 4:875, 1984. Edbrookeet al., Mol. Cell. Biol., 9:1908, 1989. Ito and Roeder, Trends Endocrinol. Metab., 12:127-134, Edgerton and Roy, J. Appl. Physiol., 89:1224-1231, 2000. 2001. Edlundet al., Science, 230:912-916, 1985. Jakobovits et al., Mol. Cell. Biol., 8:2555, 1988. Eichhorn and Bristow, Circulation, 94:2285-2296, 1996. Jameel and Siddiqui, Mo/. Cell. Biol., 6:710, 1986. EPO 0273085 60 Jayneset al., Mol. Cell. Biol., 8:62, 1988. Fechheimer, et al., Proc Natl. Acad. Sci. USA, 84:8463-8467, Johnsonet al., Mol. Cell. Biol., 9:3393, 1989. 1987. Jones and Shenk, Ce//, 13:181-188, 1978. Feng and Holland, Nature, 334:6178, 1988. Kadesch and Berg, Mol. Cell. Biol., 6:2593, 1986. Ferkolet al., FASEB J, 7:1081-1091, 1993. Kanedaet al., Science, 243:375-378, 1989. Firak and Subramanian, Mol. Cell. Biol., 6:3667, 1986. 65 Karin et al., Mol. Cell. Biol., 7:606, 1987. Fitts et al., J Appl. Physiol., 89:823-839, 2000. Karlsson et al., EMBO J., 5:2377-2385, 1986. Foecking and Hofstetter, Gene, 45(1):101-105, 1986. Katinkaet al., Ce//, 20:393, 1980. US 8,513,209 B2 43 44 Katinkaet al., Nature, 290:720, 1981. Nicolas and Rubinstein, In: Vectors: A survey of molecular Katoet al, J, Biol. Chem., 266:3361-3364, 1991. cloning vectors and their uses, Rodriguez and Denhardt Kawamotoet al., Mol. Cell. Biol., 8:267, 1988. (Eds), Stoneham: Butterworth, 494-513, 1988. Kelly et al., J. Cell Biol., 129(2):383-396, 1995. Nicolau and Sene, Biochim. Biophys. Acta, 721:185-190, Kiledjian et al., Mol. Cell. Biol., 8:145, 1988. 5 1982. Kimuraet al., Dev. Growth Differ. 39(3):257-265, 1997. Nicolau et al., Methods Enzymol., 149:157-176, 1987. Kinugawaet al., Circ. Res., 89:591-598, 2001. Ojamaaet al., Endocrinology, 141:2139-2144, 2000. Kinugawaet al., J. Clin. Endocrinol. Metab., 86:5089-5090, Ondeket al., EMBO J, 6:1017, 1987. Ornitz et al., Mo/. Cell. Biol., 7:3466, 1987. 2001. Kiriazis and Kranias, Annu. Rev. Physiol., 62:321-351, 2000. ‘° Palmiteret al., Nature, 300:611, 1982. Klamut et al., Mol. Cell. Biol., 10:193, 1990. Pantos et al., Horm. Metab. Res., 38:308-313, 2006. Kleinet al., Nature, 327:70-73, 1987. Park et al., Mol. Cell., 19:643-653, 2005. Paskindet al., Virology, 67:242-248, 1975. Kochet al., Mol. Cell. Biol., 9:303, 1989. Pasquinelli and Ruvkun, Ann. Rev. Cell Dev. Biol., 18:495- Kreket al., Nat. Genet., 37:495-500, 2005. s 513, 2002. Krenz and Robbins, J. Am. Coll. Cardiol., 44:2390-2397, Pavri et al., Mo/. Cell., 18:83-96, 2005. 2004. PCT Appln. WO 0071096 Kriegler and Botchan, In: Eukarvotic Viral Vectors, Gluzman PCT Appin. WO 84/03564 (Ed.), Cold Spring Harbor: Cold Spring Harbor Labora- PCT Appln. WO 98/33791 tory, NY, 1982. 20 Pechet al., Mol. Cell. Biol., 9:396, 1989. Kriegler et al., Ce//, 38:483, 1984. Pelletier and Sonenberg, Nature, 334(6180):320-325, 1988. Kriegler et al., Ce//, 53:45, 1988. Perales et al., Proc. Natl. Acad. Sci. USA, 91:4086-4090, Kriegler and Botchan, Mol. Cell. Biol., 3:325, 1983a. 1994, Kriegler et al., In: Gene Expression, Alan Liss (Ed.), Hamer Perez-Stable and Constantini, Mo/. Cell. Biol., 10:1116, and Rosenberg, New York, 1983b. 25 1990. Kriitzfeldt et al., Nature, 438:685-689, 2005. Physicians Desk Reference Kuhl et al., Ce//, 50:1057, 1987. Picard and Schaffner, Nature, 307:83, 1984. Kunz et al., Nucl. Acids Res., 17:1121, 1989. Pinkert et al., Genes and Dev., 1:268, 1987. Lagos-Quintanaet al., Science, 294(5543):853-858, 2001. Ponta et al., Proc. Natl. Acad. Sci. USA, 82:1020, 1985. Porton et al., Mol. Cell. Biol., 10:1076, 1990. LaPointeet al., Hypertension 273 Pt 2):715-22, 1996. Potter et al., Proc. Natl. Acad. Sci. USA, 81:7161-7165, 1984. LaPointeet al., J. Biol. Chem., 263(19):9075-8, 1988. Queen and Baltimore, Ce//, 35:741, 1983. Larsenet al., Proc Natl. Acad. Sci. USA., 83:8283, 1986. Quinn et al., Mol. Cell. Biol., 9:4713, 1989. Laspiaet al., Cel/, 59:283, 1989. Racheret al., Biotechnology Techniques, 9:169-174, 1995. Latimeret al., Mol. Cell. Biol., 10:760, 1990. 35 Ragotet al., Nature, 361:647-650, 1993. Lauet al., Science, 294(5543):858-862, 2001. Redondoet al., Science, 247:1225, 1990. Le Gal La Salle et al., Science, 259:988-990, 1993. Reisman and Rotter, Mol. Cell. Biol., 9:3571, 1989. Lee and Ambros, Science, 294(5543):862-864, 2001. Remington’s Pharmaceutical Sciences, 15” ed., pages 1035- Lee et al., Nature, 294:228, 1981. 1038 and 1570-1580, Mack Publishing Company, Easton, Lee et al., Nucleic Acids Res., 12:4191-206, 1984. 40 Pa., 1980. Leunget al., Proc. Natl. Acad. Sci. USA, 48:18125-18130, Renan, Radiother. Oncol., 19:197-218, 1990. 2006. ResendezJr. et al., Mol. Cell. Biol., 8:4579, 1988. Levinsonet al., Nature, 295:79, 1982. Rich et al., Hum. Gene Ther. 4:461-476, 1993. Levrero et al., Gene, 101:195-202, 1991. Ridgeway, In: Vectors: A Survey ofMolecular Cloning Vec- Lin et al., Mol. Cell. Biol., 10:850, 1990. 45 tors and Their Uses, Rodriguez et al. (Eds.), Stoneham: Liu et al., Proc Natl Acad Sci USA 101:9740-9744, 2004. Butterworth, 467-492, 1988. Luria et al., EMBO J, 6:3307, 1987. Ripe et al., Mo/. Cell. Biol., 9:2224, 1989. Lusky and Botchan, Proc. Natl. Acad. Sci. USA, 83:3609, Rippe,et al., Mol. Cell Biol., 10:689-695, 1990. 1986. Rittling et al., Nuc. Acids Res., 17:1619, 1989. Lusky et al., Mo/. Cell. Biol., 3:1108, 1983. 50 Rosenet al., Cell, 41:813, 1988. Macejak and Sarnow, Nature, 353:90-94, 1991. Rosenfeldet al., Science, 252:431-434, 1991. Majors and Varmus, Proc. Natl. Acad. Sci. USA, 80:5866, Rosenfeld, et al., Ce//, 68:143-155, 1992. 1983. Roux et al., Proc. Natl. Acad. Sci. USA, 86:9079-9083, 1989. Mann etal., Ce//, 33:153-159, 1983. Sakaiet al., Genes and Dev., 2:1144, 1988. Mansenetal., Mol. Endocrinol., 15:2106-2114, 2001. 55 Sambrook and Russell, Molecular Cloning: A Laboratory Markowitz et al., J. Virol., 62:1120-1124, 1988. Manual 3” Ed., Cold Spring Harbor Laboratory Press, McNeall et al., Gene, 76:81, 1989. 2001. Meister and Tuschl, Nature, 431:343-9, 2004. Satake et al., J. Virology, 62:970, 1988. Miksiceket al., Cell, 46:203, 1986. Schaffneret al., J. Mol. Biol., 201:81, 1988. Molkentin et al., Ce// 93:215-228, 1998. 60 Schuyler and Yarbrough, Basic Res. Cardiol., 85:481-494, Mordacq and Linzer, Genes and Dev., 3:760, 1989. 1990. Moreauet al., Nucl. Acids Res., 9:6047, 1981. Searle et al., Mol. Cell. Biol., 5:1480, 1985. Morkin, Microsc. Res. Tech., 50:522-531, 2000. Sempereet al., Genome Biol 5:R13, 2004. Mosset al., Biol. Chem., 271(49):31688-31694, 1996. Sharp and Marciniak, Ce//, 59:229, 1989. Muesinget al., Cell, 48:691, 1987. 65 Shaul and Ben-Levy, EMBO J., 6:1913, 1987. Nayaet al., J Biol Chem, 275(7):4545-4548, 2000. Sherman etal., Mol. Cell. Biol., 9:50, 1989. Nget al., Nuc. Acids Res., 17:601, 1989. Shingaraet al., RNA 11:1461-1470, 2005. US 8,513,209 B2 45 46 Sleigh and Lockett, J EMBO, 4:3831, 1985. Tyndell et al., Nuc. Acids. Res., 9:6231, 1981. Spalholz et al., Ce//, 42:183, 1985. Vadaszovaet al., Physiol. Res. 53(1):S57-61, 2004. Spandau and Lee, J. Virology, 62:427, 1988. van Rooij et al., Proc. Natl. Acad. Sci. USA, 103(48):18255- Spandidos and Wilkie, EMBO J., 2:1193, 1983. 18260, 2006. Stephens and Hentschel, Biochem. J, 248:1, 1987. Vannice and Levinson, J. Virology, 62:1305, 1988. Stratford-Perricaudet and Perricaudet, In: Human Gene Varmuset al., Ce//, 25:23-36, 1981. Transfer, Eds, Cohen-Haguenauer and Boiron, John Vasseuret al., Proc Natl. Acad. Sci. USA, 77:1068, 1980. Libbey Eurotext, France, 51-61, 1991. Wagneret al., Proc. Natl. Acad. Sci. USA 87(9):3410-3414, Stratford-Perricaudet et al., Hum. Gene. Ther, 1:241-256, 1990. 1990. 10 Wang, and Calame, Ce//, 47:241, 1986. Stuart et al., Nature, 317:828, 1985. Weberet al., Cell, 36:983, 1984. Sullivan and Peterlin, Mol. Cell. Biol., 7:3315, 1987. Weiet al., J. Endocrinol. Invest., 28:8-11, 2005. Swartzendruber and Lehman, / Cell. Physiology, 85:179, Weinbergeret al. Mol. Cell. Biol., 8:988, 1984. 1975. Winoto and Baltimore, Cel/, 59:649, 1989. Takebe et al., Mol. Cell. Biol., 8:466, 1988. 15 Wonget al., Gene, 10:87-94, 1980. Tavernieret al., Nature, 301:634, 1983. Wuand Wu, Adv. Drug Delivery Rev., 12:159-167, 1993. Taylor and Kingston, Mol. Cell. Biol., 10:165, 1990a. Wuand Wu,Biochemistry, 27: 887-892, 1988. Taylor and Kingston, Mol. Cell. Biol., 10:176, 1990b. Wu and Wu, / Biol. Chem., 262:4429-4432, 1987. Taylor et al., J. Biol. Chem., 264:15160, 1989. Xu et al., Curr, Biol., 13:790-795, 2003. Temin, In: Gene Transfer, Kucherlapati (Ed.), NY, Plenum 20 Yamauchi-Takihara, et. al., Proc. Natl. Acad. Sci. USA, Press, 149-188, 1986. 86(10):3504-3508, 1989. The Merck Index, Eleventh Edition Yang and Russell, Proc. Natl. Acad. Sci. USA, 87:4144-4148, Thiesenet al., J. Virology, 62:614, 1988. 1990. Top et al., J. Infect. Dis., 124:155-160, 1971. Yao and Eghbali, Circ. Res. 71:831-839, 1992. Treisman, Cell, 46(4):567-174, 1986 25 Younget al., In: Handbook ofApplied Therapeutics, 7.1-7.12 Troncheet al., Mol. Biol. Med., 7:173, 1990. and 9.1-9.10, 1989. Troncheet al., Mo/. Cell Biol., 9(11):4759-4766, 1989. Yutzey et al., Mol. Cell. Biol., 9:1397, 1989. Trudel and Constantini, Genes and Dev., 6:954, 1987. Zelenin et al., FEBS Lett., 287(1-2):118-120, 1991. Tsika et al., Am. J. Physiol. Cell Physiol., 283:C1761-C1775, Zenget al., Cancer Res., 62(13):3630-3635, 2002. 2002. 30 Zhaoet al., Nature, 436:214-220, 2005. Tur-Kaspaet al., Mol. Cell Biol., 6:716-718, 1986. Ziober and Kramer, J. Bio. Chem., 271(37):22915-22, 1996. SEQUENCE LISTING <160> NUMBER OF SEQ ID NOS: 21 <210> SEQ ID NO 1 <211> LENGTH: 87 <212> TYPE: RNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 1 agcuucccug gcucuagcag cacagaaaua uuggcacagg gaagegaguc ugecaauauu 60 ggcugugeug cuccaggcag gguggug 87 <210> SEQ ID NO 2 <211> LENGTH: 112 <212> TYPE: RNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 2 ccaceceggu ccugcucceg ceccagcage acacuguggu uuguacggca cuguggecac 60 guccaaacca cacuguggug uuagagegag ggugggggag geaccgecga gg 112 <210> SEQ ID NO 3 <211> LENGTH: 89 <212> TYPE: RNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 3 gucagcagug ccuuagcage acguaaauau uggcguuaag auucuaaaau uaucuccagu 60 auuaacugug cugcugaagu aagguugac 89 US 8,513,209 B2 47 48 -continued <210> SEQ ID NO 4 <211> LENGTH: 81 <212> TYPE: RNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 4 guuccacucu agcagcacgu aaauauugg¢e guagugaaau auauauuaaa caccaauauu 60 acugugcuge uuuaguguga ¢c 81 <210> SEQ ID NO 5 <211> LENGTH: 83 <212> TYPE: RNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 5 ccuuggagua aaguagcage acauaauggu uuguggauuu ugaaaaggug caggcecauau 60 ugugcugecu caaaaauaca agg 83 <210> SEQ ID NO 6 <211> LENGTH: 98 <212> TYPE: RNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 6 uugaggcecuu aaaguacugu agcagcacau caugguuuac augcuacagu caagaugcega 60 aucauuauuu gcugcucuag aaauuuaagg aaauucau 98 <210> SEQ ID NO 7 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 7 uageagcaca gaaauauugg c 21 <210> SEQ ID NO 8 <211> LENGTH: 22 <212> TYPE: RNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 8 ccaauauugg cugugcugcu cc 22 <210> SEQ ID NO 9 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 9 cagcagcaca cugugguuug u 21 <210> SEQ ID NO 10 <211> LENGTH: 22 <212> TYPE: RNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 10 caaaccacac ugugguguua ga 22 <210> SEQ ID NO 11 <211> LENGTH: 22 <212> TYPE: RNA US 8,513,209 B2 49 50 -continued <213> ORGANISM: Homo sapiens <400> SEQUENCE: 11 uageagcacg uaaauauugg cg 22 <210> SEQ ID NO 12 <211> LENGTH: 22 <212> TYPE: RNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 12 ccaguauuaa cugugcugcu ga 22 <210> SEQ ID NO 13 <211> LENGTH: 22 <212> TYPE: RNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 13 ccaauauuac ugugcugeuu ua 22 <210> SEQ ID NO 14 <211> LENGTH: 22 <212> TYPE: RNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 14 uageagcaca uaaugguuug ug 22 <210> SEQ ID NO 15 <211> LENGTH: 22 <212> TYPE: RNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 15 caggccauau ugugcugecu ca 22 <210> SEQ ID NO 16 <211> LENGTH: 22 <212> TYPE: RNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 16 uageagcaca ucaugguuua ca 22 <210> SEQ ID NO 17 <211> LENGTH: 22 <212> TYPE: RNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 17 cgaaucauua uuugcugeuc ua 22 <210> SEQ ID NO 18 <211> LENGTH: 8 <212> TYPE: RNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 18 agcagcac <210> SEQ ID NO 19 <211> LENGTH: 98 <212> TYPE: RNA US 8,513,209 B2 51 52 -continued <213> ORGANISM: Homo sapiens <400> SEQUENCE: 19 cgaggggaua cagcagcaau ucauguuuug aaguguucua aaugguucaa aacgugagge 60 gceugcuauac ccccucgugg ggaagguaga aggugggg 98 <210> SEQ ID NO 20 <211> LENGTH: 22 <212> TYPE: RNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 20 cagcagcaau ucauguuuug aa 22 <210> SEQ ID NO 21 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Homo sapiens <400> SEQUENCE: 21 caaaacguga ggcgcugcua u 21 Whatis claimed is: 10. The method of claim 2, wherein the antisense oligo- 1. A methodof treating pathologic cardiac hypertrophy, nucleotide has at least one chemical modification. heart failure, or myocardial infarction in a subject in need 11. The method of claim 10, wherein said chemical modi- thereof comprising administering to said subject an inhibitor 30 fication is a sugar modification or a backbone modification. of two or more miR-15 family members, wherein the inhibi- 12. The method of claim 10, wherein said chemical modi- tor is a nucleic acid comprising a sequence that is substan- fication is a locked nucleic acid. tially complementary to the sequence of SEQ ID NO:18, and wherein the expressionor activity of said two or more miR-15 13. The methodof claim 2, wherein said antisense oligo- family members is reduced in the heart cells of the subject nucleotide is about 19 to about 25 nucleotides in length. following administration of the inhibitor. 35 14. The methodof claim 2, wherein said antisense oligo- 2. The method of claim 1, wherein the nucleic acid is an nucleotide is about 15 nucleotides in length. antisense oligonucleotide. 15. The method of claim 9, wherein said improved symp- 3. The methodof claim 1, wherein said two or more miR- toms include increased exercise capacity, increased cardiac 15 family membersare selected from the group consisting of ejection volume, decreasedleft ventricular end diastolic pres- miR-15a, miR-15b, miR-16, miR-195, miR-424, and miR- 40 sure, decreased pulmonary capillary wedge pressure, 497, increased cardiac output, increased cardiac index, lowered 4. The method of claim 2, wherein the antisense oligo- pulmonary artery pressures, decreased left ventricular end nucleotide comprises a sequence that is at least partially systolic and diastolic dimensions, decreased left and right complementary to a mature sequence of a miR-15 family ventricular wall stress, decreased wall tension, and reduction member. 45 5. The method of claim 4, wherein the antisense oligo- in infarct size. nucleotide comprises a sequence that is at least partially 16. The methodof claim 11, wherein the sugar modifica- complementary to a sequence selected from the group con- tion is a 2'-O-alkyl, 2'-O-methyl, 2'-O-methoxyethyl, sisting of: SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, 2'-fluoro, or 4'-thio modification. SEQ ID NO: 14, SEQ ID NO:16, and SEQ ID NO:20. 50 17. The method of claim 11, wherein the backbone modi- 6. The method of claim 1, wherein the inhibitor of two or fication is a phosphorothioate linkage. more miR-15 family members is administered by parenteral, 18. The methodof claim 1, wherein the nucleic acid con- oral, subcutaneous, intravenous, intramuscular, intradermal, sists of a sequence that is complementary to the sequence of intraperitoneal, transdermal, sustained release, controlled SEQ ID NO:18. release, delayed release, suppository, catheter, or sublingual 55 19. The method of claim 1, wherein the expression or administration or direct injection into cardiac tissue. activity of three or more miR-15 family members is reduced 7. The method of claim 1, further comprising administer- in the heart cells ofthe subject following administration ofthe ing to said subject a second therapy. inhibitor. 8. The method of claim 7, wherein said second therapy is 20. The method of claim 1, wherein the expression or selected from the group consisting of a beta blocker, an iono- 60 activity of all miR-15 family members is reduced in the heart trope, a diuretic, ACE-I, All antagonist, BNP, a Ca++-blocker, cells of the subject following administration of the inhibitor. an endothelin receptor antagonist, and an HDAC inhibitor. 21. The method of claim 1, wherein the nucleic acid com- 9. The methodof claim 1, wherein one or more symptoms prises a sequencethatis fully complementary to the sequence of pathologic cardiac hypertrophy, heart failure, or myocar- of SEQ ID NO:18. dial infarction is improvedin the subject following adminis- 65 22. The method of claim 5, wherein the antisense oligo- tration of the inhibitor of two or more miR-15 family mem- nucleotide comprises a sequencethatis at least 85% comple- bers. mentary to a sequence selected from the group consisting of: US 8,513,209 B2 53 54 SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQID NO: 14, SEQ ID NO: 16, and SEQ ID NO:20. 23. The method of claim 5, wherein the antisense oligo- nucleotide comprises a sequencethat is at least 95% comple- mentary to a sequence selected from the group consisting of: SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQID NO: 14, SEQ ID NO: 16, and SEQ ID NO:20. 24. The methodof claim 1, wherein the nucleic acid com- prises two or more binding sites, and wherein each binding site comprises a sequencethat is substantially complemen- 10 tary to the sequence of SEQ ID NO:18. 25. The method of claim 24, wherein each binding site comprises a sequence that is fully complementary to the sequence of SEQ ID NO:18. 26. The method of claim 24, wherein the nucleic acid is 15 expressed from a vector under the control of a cardiac-spe- cific promoter. 27. The methodof claim 26, wherein the cardiac-specific promoteris an alpha myosin heavy chain promoter. 20 ***** UNITED STATES PATENT AND TRADEMARKOFFICE CERTIFICATE OF CORRECTION PATENT NO. : 8,513,209 B2 Page 1 of 1 APPLICATION NO. : 12/742233 DATED : August 20, 2013 INVENTOR(S) : Eric Olsonet al. It is certified that error appears in the above-identified patent and that said Letters Patent is hereby corrected as shownbelow: On the Title Page: Thefirst or sole Notice should read-- Subject to any disclaimer, the term of this patent is extended or adjusted under 35 U.S.C. 154(b) by 93 days. Signed and Sealed this Twenty-seventh Day of January, 2015 Wrbtl. Fo Lea Michelle K. Lee Deputy Director ofthe United States Patent and Trademark Office