Study Toward the Development of Advanced

STUDY TOWARD THE DEVELOPMENT OF ADVANCED

DISSERTATION

Presented in partial fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of the Ohio State University

Leyi Wang B.S.,M.S.

Graduate Program in Veterinary Preventive Medicine

The Ohio State University

2009

Dissertation Committee:

Professor Chang-Won Lee, advisor

Professor Y.M. Saif,

Professor Daral J. Jackwood

Professor Jeffrey T. LeJeune

Leyi Wang

2009 ABSTRACT

Avian influenza is one of the most economically important diseases in poultry. Since it

was found in Italy in 1878, avian influenza virus has caused numerous outbreaks around

the world, resulting in considerable economic losses in poultry industry. In addition to affecting poultry, different subtypes of avian influenza viruses can infect many other

species, thus complicating prevention and control. Killed and fowlpox virus vectored HA

vaccines have been used in the field as one of effective strategies in a comprehensive

control program to prevent and control avian influenza. Live attenuated vaccines for

poultry are still under development. Live attenuated vaccines can closely mimic natural

infection inducing long-lasting humoral and cellular immunity. In addition, they may be

used for mass vaccination. However, concerns with spread of live vaccine viruses,

mutation into virulent strains from live attenuated viruses, and reassortment of vaccine

and field strains prevent recommending live vaccines as poultry vaccines in the field. For

this reason, there are increasing interests in the development of in ovo vaccines that can

reduce the risk of spreading the vaccine virus. Therefore, in the first three parts of our

study, we have explored several strategies (NS1 truncation, temperature sensitive (ts)

mutations, HA substitution, and non-coding region (NCR) mutations) to attenuate viruses

to reach this goal. In addition, NS1 truncation protein also can serve as a marker to

differentiate infected from vaccinated animals (DIVA). In the last part of this study, we

utilized two different strategies (NS1 protein and heterologous NA) to develop DIVA

vaccines for the control of triple reassortant (TR) H3N2 influenza in turkeys.

In the first part, we obtained several NS deletion genes from a parental non-stable virus,

A/turkey/Oregon/71-delNS1 (H7N3 and has 10 nucleotide deletion in the NS gene)

through passage in 10- or 14-day-old embryonated chicken eggs (ECE). Our results

showed that most NS deletion genes are competent as far as NS2 protein, an essential

structural protein, coding region is intact. Five NS1 truncation variants were obtained by

traditional virus purification, followed by in vitro, in vivo and in ovo characterization. We found that NS1 truncation variants replicated well both in Vero and CEF cells, compared to wild type viruses. In western blot analysis of infected cells, NS1 proteins of

A/turkey/Oregon/71-SEPRL, delNS1, Ddel-pc2, -pc4, and -pc5 could be detected while

NS1 protein of A/turkey/Oregon/71-Ddel-pc1 and -pc3 could not, although there was no difference of NP protein expression among different variants. By conducting in vivo experiment in two-week-old chickens, we found that two NS1 truncation variants

(A/turkey/Oregon/71-Ddel-pc3 and -pc4) were highly attenuated, induced high antibody titers and provided good protection in birds against a high dose heterologous virus challenge, which makes them suitable for potential live attenuated vaccine candidates.

However, when NS1 truncation variants were used to vaccinate 18-day old ECEs in the second part of our study, the hatchability of vaccinated groups was significantly lower than that of the PBS-control group, indicating there is a need for further attenuation.

Plasmid-based reverse genetics systems established for influenza A viruses make it easy to manipulate the genome of viruses. To further attenuate NS1 truncation variants, the ts mutations were then introduced into A/turkey/Oregon/71-SEPRL, and Ddel-pc3 and - iii

pc4. In vitro growth analysis showed that viruses containing ts mutations exhibited clear

ts phenotype in CEF cells while weak ts phenotype in MDCK cells. However, the

hatchability study illustrated that ts mutations did not help to further attenuate viruses,

indicating ts mutation could not work together with NS1 truncation strategy to further

attenuate virus in ovo. Meanwhile, we tested whether HA substitution could improve

hatchability of in ovo vaccination. Reassortant NS variant viruses with their HA genes

from A/mute swan/MI/06 (H5N1) or A/turkey/OH/313053/04 (H3N2) strain and the

remaining genes from two A/turkey/Oregon/71-Ddel-pc3 and -pc4 were generated by

reverse genetics. Previous testing demonstrated higher hatchability of A/mute

swan/MI/06 infected eggs compared to other H5 subtype strains tested. The in ovo study

showed that HA substitution had a different effect on hatchability of in ovo vaccination

and eggs inoculated with H3-NS1 truncation variants had higher hatchability than that of

H5-NS1 truncation variants.

In the third part, we explored the possibility of targeting NCRs to further attenuate NS1

truncation variants. Due to very limited NCR sequences available, we first sequenced the

NCRs of seven influenza A virus strains of different host origin and varying

pathogenicity using two recently developed methods. Sequence analysis showed there

were not only sequence and length variations present in the segment specific NCRs among different influenza strains but also sequence variations at the fourth nucleotide of

3’ NCR of polymerase genes. To confirm that different NCR sequences could affect virus replication cycles, we first tested the role of sequence changes in the NCRs in protein

expression using a green fluorescent protein (GFP) as a marker. Protein expression

experiment results showed that even a single nucleotide change in the NCR of PA or PB1

could affect GFP protein expression. In addition, we further confirmed that mutations in

NCR of PA alone or PA and PB1 combination affect virus replication by characterizing reverse genetically generated viruses in vitro. With more understanding of the role of

NCR in the virus replication cycle, we speculate targeting non-conserved parts of NCR to further attenuate NS1 truncation variants is feasible.

Since 2003, TR H3N2 influenza has been endemic in turkey populations in North

America. Both field and experimental evidence of current available avian- and swine- origin vaccines indicates there is an urgent need to update the vaccine strain and develop an effective vaccine to control this virus infection in turkeys. Therefore, in the last part of this study, two different strategies, NS1 protein or heterologous NA, were used to generate NS-based and NA-based DIVA vaccines by the traditional reassortant method.

In vivo evaluation of efficacy of DIVA vaccines was done in two-week old turkeys and breeder turkeys. The reassortant DIVA vaccines significantly reduced challenge virus shedding in the oviduct of breeder turkeys as well as trachea and cloaca of both young and breeder turkeys. Therefore, proper vaccination could effectively decrease egg production drop in the field. With an accompanying DIVA serological test, we expect those newly developed vaccines will be useful for the control of TR H3N2 influenza in turkeys.

In conclusion, this study provides new information on the development of live attenuated and DIVA vaccines for the control of avian influenza.

Dedicated to my parents, Ancheng Wang and Xiurong Ding,

my wife Bikun Zhou, and my daughter Sarah

ACKNOWLEDGENTS

First, I would like to thank my research advisor, Dr. Chang Won Lee, for his invaluable guidance, encouragement and support throughout the duration of my study, which made this thesis possible.

Special thanks to my committee members, Dr. Y.M. Saif, Dr. Daral J. Jackwood, and Dr.

Jeffrey T. LeJeune for their efforts, advice, and critical review of this manuscript.

I wish to thank all the past and present members of the Dr. Lee’s laboratory for their support and scientific contributions. I especially thank Megan Strother, Keumsuk Hong,

Dr. Zhuoming Qin and Dr. Mahesh Khatri for all assistance in my research.

Thanks are also extended to Dr. Gireesh Rajashekara Dr. Qiuhong Wang, Dr. Hadi

Yassine, and Todd Root for all their help.

Special thanks are to Hannah Gehrman and Robin Weimer for their indispensable help.

Finally, I want to thank my family for their love and support.

vii

VITA

May 10, 1978………………………..Born Liaocheng, Shandong province, P.R.China

1997-2001….………………………..B.S., Veterinary Medicine, College of Animal

Husbandry & Veterinary Medicine, Shandong

Agricultural University, Taian, Shandong, P.R.

China.

2001-2004…………………………...M.S. College of Veterinary Medicine, China

Agricultural University, Beijing, P.R. China.

2004-2006…………………………...Research Associate and Lecturer, Department of

Animal Science, College of Agriculture, Liaocheng

University, Liaocheng, Shandong, P.R. China.

2006-present………………………...Graduate Research Associate

Food Animal Health Research Program

Department of Veterinary Preventive Medicine

The Ohio State University, OH, U.S.A.

PUBLICATIONS

1. Leyi Wang and Chang-Won Lee. 2009. Sequencing and Mutational Analysis of the

Non-Coding Regions of Influenza A Virus. Veterinary Microbiology, 135: 239-247.

viii

2. S. P. S. Pillai, M. Pantin-Jackwood, S. J. Jadhao, D. L. Suarez, L. Wang, H. Yassine,

Y. M. Saif, C-W. Lee. 2009. Pathobiology of triple reassortant H3N2 influenza viruses in

breeder turkeys and its potential implication for vaccine studies in turkeys. Vaccine. Vol.

27, No. 6: 819-824.

3. L. Wang, D. L. Suarez, M. Pantin-Jackwood, M. Mibayashi, A. García-Sastre, Y. M.

Saif, C-W. Lee. 2008. Characterization of Influenza Virus Variants with Different Sizes

of the Non-structural (NS) Genes and Their Potential as a Live Influenza Vaccine in

Poultry. Vaccine, Vol. 26, No. 29-30: 3580-3586.

4. Chao Wang, Leyi Wang, Weitao Wang. 2006. Avian Influenza and its threat. Chinese

Journal of Animal Quarantine, 2:46-47.

5. Leyi Wang, Fei Ma. 2006. Diagnosing and Curing a Clinic Case of the Umbilical

Hernia of Milk Cow. Heilongjiang Journal of Animal Science and Veterinary Medicine,

7: 79-80.

6. Leyi Wang, Hong Ma. 2005. Application of the ELISA kit Made in China and USA for Detecting Antibody of Infectious bronchitis. Journal of Anhui Agricultural Sciences,

9: 1665-1713.

7. Leyi Wang. 2005. Development of ELISA Antibody Test Kit of Infectious Bronchitis.

Chinese Journal of Animal Quarantine, 9:25-26.

8. Shengxue Li, Leyi Wang, Wanfu Zhang. 2005. Research Progress on Chicken

Infectious Bronchitis. Livestock and Poultry Industry, 2:10-11.

9. Shengxue Li, Leyi Wang, Wanfu Zhang. 2005. Detecting Antibody of Chicken

Infectious Bronchitis by Using Imported ELISA Kit. Shanghai Journal of Animal

Husbandry and Veterinary Medicine, 2:32.

10. Leyi Wang, Fuyong Chen. 2005. Development of ELISA Antibody Test Kit of

Newcastle Disease. China Animal Husbandry & Veterinary Medicine, 2:43-45.

11. Leyi Wang. 2004. Cloning and Sequence Analysis of F Gene of Newcastle Disease

Virus Lasota Strain. China Poultry, 22:11-14.

12. Jishan Liu, Zhiqiang Shen, Lei Zhao, Leyi Wang, et al. 2002. Isolation and

Identification of the Pigeon’s Paramyxovirus. Guide to Chinese Poultry, 16:33-34.

FIELD OF STUDY

Major Field: Veterinary Preventive Medicine

Studies in Molecular Virology

TABLE OF CONTENTS

Page

ABSTRACT …………………………………...………..….…………….…………… ii

DEDICATION ………………………………………….…....….…….……………… vi

ACKNOWLEDGMENTS ……………………………..………….….………………. vii

VITA ……………………………………………………………….....………………. viii

LIST OF TABLES ………………………………………..……….…..……………… xiv

LIST OF FIGURES ……………………………………….…………..…………….… xv

CHAPTERS:

1. LITERATURE REVIEW

1.1 Avian influenza ……………………………………………………………………. 1 1.2 Influenza A viruses ………………………………………………………...……… 2 1.3 Influenza A virus structure and proteins…………..……………………………..… 3 1.4 Non-coding Regions of Influenza A virus ………………...………...... 9 1.5 Vaccines …………………...………………………………………………….…… 11

2. CHARACTERIZATION OF INFLUENZA VIRUS VARIANTS WITH DIFFERENT SIZES OF THE NON-STRUCTURAL (NS) GENES AND THEIR POTENTIAL AS A LIVE INFLUENZA VACCINE IN POULTRY xi

2.1 ABSTRACT …………………...…………………………………...…………… 54 2.2 INTRODUCTION ……………...…………………………………...…………… 55 2.3 MATERIALS AND MEHTODS …………………………………..…………… 57 2.4 RESULTS ……………………...…………………………………...…………… 62 2.5 DISCUSSION …………….…...………………….………………..…….……… 66 2.6 ACKNOWLEDGEMENTS …...………………….………………..………….… 69 2.7 REFERENCES ………………...……………….…………………...... 70

3. DEVELOPING LIVE ATTENUATED AVIAN INFLUENZA VIURS IN OVO VACCINES FOR POULTRY

3.1 ABSTRACT …………………...…………………………………...…………… 79 3.2 INTRODUCTION ……………...…………………………………...…………… 80 3.3 MATERIALS AND MEHTODS ……………………………………………..… 82 3.4 RESULTS AND DISCUSSION ……………….…………………...…………… 84 3.5 ACKNOWLEDGEMENTS …...………………….………………...…………… 87 3.6 REFERENCES ………………………………………………………………….. 87

4. SEQUENCING AND MUTATIONAL ANALYSIS OF THE NON-CODING REGIONS (NCRS) OF INFLUENZA A VIRUS

4.1 ABSTRACT …………………...…………………………………...…………… 94 4.2 INTRODUCTION ……………...…………………………………...…………… 95 4.3 MATERIALS AND MEHTODS ……………………………………………….. 97 4.4 RESULTS ……………………...……………….…………………………..…… 101 4.5 DISCUSSION …………….…...………………….………………...…………… 105 4.6 ACKNOWLEDGEMENTS …...………………….………………...…………… 111 4.7 REFERENCES ………………...……………….……………………………..… 111

xii

5. DEVELOPMENT OF DIVA (DIFFERENTIATION OF INFECTED FROM VACCINATED ANIMALS) VACCINES FOR THE CONTROL OF TRIPLE REASSORTANT H3N2 INFLUENZA IN TURKEYS

5.1 ABSTRACT …………………...…………………………………...…………… 125 5.2 INTRODUCTION ……………...…………………………………...…………… 126 5.3 MATERIALS AND MEHTODS ……………………………………..………… 129 5.4 RESULTS ……………………...……………….…………………………..…… 131 5.5 DISCUSSION …………….…...………………….………………...…………… 134 5.6 ACKNOWLEDGEMENTS …...………………….………………...…………… 137 5.7 REFERENCES ………………...……………….…………………………..…… 137

BIBLIOGRAPHY ………………………………………………………………… 144

xiii

LIST OF TABLES

Table Page

2.1 Pathogenicity and transmission of D-del NS variants in 2-week-old SPF chickens ………………………………………………………………………………………… 74

6 2.2 Protection of D-del NS variants infected birds after challenge with 10 EID50 of heterologous H7N2 virus ……………………………...……………………………… 75

3.1 Hatchability of eggs vaccinated with different NS deletion variants ……….……. 90

2 3.2 Hatchability of eggs vaccinated with 10 EID50/0.1ml of reassortant viruses with or without ts mutations ……………….………………………………..………………… 91

2 3.3 Hatchability of eggs vaccinated with 10 EID50/0.1ml of H5 or H3 subtype NS deletion variants …………………………………………………………………….… 92

4.1 Influenza A virus strains used in this study …………….…..…………….………. 116

4.2 Sequence comparison of the 3’ and 5’ NCR of each gene segment ……...……..... 117

4.3 Recombinant viruses generated by reverse genetics that contain specific NCR sequence changes in PA and PB1 segments …………….……………………………. 120

5.1 Protection of young turkeys vaccinated with inactivated DIVA vaccines after 6 challenge with 10 EID50/ 0.2ml of A/turkey/OH/313053/04…………...……………. 141

5.2 Protection of breeder turkeys vaccinated with inactivated DIVA vaccines after 6 challenge with 10 EID50/0.2ml of A/turkey/OH/313053/04 ……….…………….….. 142

5.3 Result of histopathologic lesion in different tissues from breeder turkeys at 7 day- post-challenge……….……………………………………………………..………….. 143

xiv

LIST OF FIGURES

Figures Page

2.1 Identification of NS genes of different sizes after passaging the TK/OR/71-delNS1 virus in embryonating chicken eggs (ECEs) of different ages ...... 76

2.2 Schematic diagram of the NS genes (a) and predicted NS1 protein (b) that were identified by cloning and subsequent sequencing ………………………………….… 77

2.3 Western blot analysis of the NS1 protein ……...... …………………………... 78

3.1 Comparative growth analysis of reassortant viruses with or without ts mutations in CEF (A) and MDCK (B) cells at 37°C and 41°C, respectively ……………….……... 93

4.1 Schematic diagram of GFP reporter plasmid construct and plasmids containing different sequences in NCRs …………………………………….………………….... 121

4.2 Effect of PB1 (A) or PA (B) NCR sequences on reporter gene expression…...….. 122

4.3 Growth curves of recombinant viruses on CEF cells …………………….………. 124

CHAPTER 1

1. LITERATURE REVIEW

1.1 Avian influenza

Avian influenza (AI) is a highly infectious viral disease, caused by avian influenza viruses (AIV). It has a long history and the first description of this disease can date back to

1878 in northern Italy (117). Many species of birds are susceptible to infection by AIV.

Wild aquatic birds are believed to be the major reservoir for influenza A viruses (64).

Although infections caused by AIV in them are asymptomatic, wild aquatic birds can excrete virus in feces for long periods and all of the subtypes of influenza A virus are found in wild aquatic birds (47, 168, 221). AI can be transmitted between birds through an indirect fecal-oral route (223). Healthy aquatic or land-based birds normally have influenza infection after contact with contaminated water or food sources contaminated by infected aquatic birds (166). Recently, it was demonstrated that live bird or poultry market served as another reservoir for AIV (60, 132, 220). Many species of birds and poultry are sold in markets, thus increasing opportunities of transmission of virus to susceptible poultry flocks.

Once AI is circulating in poultry population, it can be transmitted from farm to farm by direct and indirect contact. In poultry, viral infection can cause asymptomatic infection, mild respiratory disease and decreased egg production (low pathogenic AI (LPAI)) or a severe systemic disease with high morbidity and mortality (highly pathogenic AI (HPAI))

(201). Genomes of the three human influenza pandemic viruses are known to partially

derive from influenza virus of avian origin (7, 82, 175, 203). Previously, it was found that

AIVs replicate poorly in humans (8), and human influenza viruses also replicate poorly in

ducks (65). Therefore, AIVs need change or adaptation in an intermediated host before they

can cross species barrier (84). However, in 1997 Hong Kong H5N1 AIV directly infected human and caused 33.3% mortality (29, 194). Since then, there have been several outbreaks of human infection directly caused by different subtypes of AIVs (72). Most of human cases resulted from exposure to virus-infected poultry (132). Although they could cause human infection, AIVs still have not acquired the ability to transmit efficiently among humans. If AIV acquires ability to transmit efficiently among humans, new human influenza pandemic will inevitably occur. This possibility raises great concerns and

governments and researchers actively work to develop effective prevention strategies

including drugs and vaccines (131). In addition to threatening human health, AI outbreaks

cause heavy economic losses and adversely affect poultry industry. Since 1959, there have

been at least 28 outbreaks or epidemics of HPAI, however, none of the outbreaks has

reached the scales of the H5N1 epizootic from Asia to Europe and Africa since 2003 (117).

1.2 Influenza A viruses

Influenza viruses are enveloped, negative sense, segmented RNA viruses, belonging to

Orthomyxoviridae family which includes three genera, influenza virus A, B, and C,

according to the antigenic differences between their nucleoproteins (NP) and matrix

proteins (M) (94). These three genera viruses can infect humans. Only influenza A virus

causes pandemics and infects birds and all AIVs are type A influenza viruses. Influenza A

2 viruses contain eight single stranded segments encoding 10 or 11 known proteins

depending on virus strains (26, 128). They are further classified into many different

subtypes based on their two surface glycoproteins, haemagglutinin (HA) and

neuraminidase (NA). Currently, there are 16 known HA subtypes and 9 NA subtypes (47).

Two major mechanisms, antigenic drift and shift, allow influenza A viruses to evade the

host immune responses (94). Antigenic drift, the cause of annual epidemics of influenza,

occurs in RNA viruses due to the lack of proofreading function of RNA dependent RNA polymerases. In addition, high vaccination pressure also drives the viruses to evolve (13).

Therefore, there is a need for yearly updating of human influenza vaccines. In addition to antigenic drift, influenza A viruses also utilize antigenic shift to evade host immunity,

because when two different influenza A viruses infect one cell, reassortment will occur

between them to create new viruses as the results of their segmented genome characteristic.

This was the mechanism which generated the 1957 and 1968 pandemic viruses (82).

1.3 Influenza A virus structure and proteins

Influenza A viruses are pleomorphic virions and possess a lipid membrane derived from the

host cell during the budding step. This lipid envelope contains three viral proteins, HA,

NA, and M2. HA and NA are spike glycoproteins which are embedded in the lipid bilayer.

Beneath the viral envelope there is a M1 protein. Inside the shell of M1 lie the

ribonucleoprotein (RNP) complexes. RNP complexes including the viral RNA segments

bound to the polymerase protein (PB2, PB1, and PA) and the nucleoprotein (NP) are the

core of virus particle.

3 HA protein is one of important surface glycoproteins. In virions, HA proteins associate as

homotrimers. Its functions include binding to α2,6- and α2,3-linked sialyl receptors on the

host cell surface, mediating the fusion of the viral and cellular membrane, and inducing

neutralizing antibodies (188). The receptor-binding site locates within the globular head of

the molecule. It is well known that HA proteins of human influenza A viruses preferentially

bind to α2,6-linked sialyl receptors, whereas human viruses preferentially bind to α2,3-

linked sialyl receptors (30, 167). It was demonstrated that one or two amino acid mutations

in the HA are sufficient for the change of receptor-binding specificity of different subtype

viruses (122). Regarding the H3 subtype viruses, a HA protein with a glutamine in position

226 prefers binding to α2,3-linked sialyl receptors, while a HA protein with a leucine at this

position prefers binding to α2,6-linked sialyl receptors (122). For the H1subtype viruses,

Asparagine or Glutamine at position 190 controls preferential biding to α2,6- and α2,3-

linked sialyl receptors, respectively (51). Recently, Yen et al. demonstrated that changes

(amino acid change between S and N at position 227 or with the residue 158 glycosylation

site removed) in receptor binding domain of HA affect systemic spread of H5N1 virus,

indicating that HA confers pathogenicity (227). The fusion of HA protein with viral and

cellular membrane is acid pH dependent. The HA is first synthesized as a precursor

polypeptide, HA0. Low pH environment makes its structure change, and thus HA protein is

susceptible to host protease. HA cleavage is a prerequisite for viral fusion and thus for viral

infectivity (87, 99). HA proteins of human influenza and LPAI viruses have a single

Arginine at the HA cleavage site, and can be cleaved by typsine-like protease present in

bird intestinal tract or human and bird respiratory tract. However, HA proteins of HPAI H5 and H7 subtypes contain multiple basic amino acids at the cleavage site, and can be cleaved

4 by ubiquitous subtilisin-like cellular proteases present in most host tissues (67, 219). Once precursor HA0 is cleaved into HA1 and HA2, the newly exposed N-terminal of the HA2 peptide then acts to fuse the viral envelope to the cellular membrane of the host cell. Hence, many vaccine strains for H5 subtype are currently generated by removing the basic amino acid at the HA cleavage site of highly pathogenic strains to make it low pathogenic strains

(189).

NA also is a glycoprotein expressed on the viral surface, which exists as a homotetramer.

Its major biological role is to cleave the terminal sialic acid residues that are receptors for

HA protein to release progeny viral particles from infected cells, otherwise progeny viral particles attach the host cell surface to form large aggregates (145). Deletion in the stalk of

NA protein can impair the ability of enzyme to release influenza virus from host cells thus affecting virus infectivity (21, 40, 115). In contrast, the 1997 Hong Kong H5N1 chicken viruses contain 19-amino-acid deletion in the stalk of NA. Accordingly, chicken H5N1 viruses acquire another carbohydrate at position 158 of HA to compensates for the decreased enzymatic activity of the viral NA and thus improve virus fitness (123). It is also possible that this deletion in NA may be required for the adaptation of influenza viruses from wild aquatic birds to domestic chickens.

Influenza A virus M2 protein, an integral membrane protein, is encoded by the spliced mRNA of Matrix gene. M2 protein has ion channel activity and is also involved in viral assembly and morphogenesis (71, 95, 150, 212). The M2 transmembrane domain has ion channel activity while the cytoplasmic tail domain has an important role in viral assembly and morphogenesis. During virus uncoating process, its ion channel activity allows

5 transport of H+ ions into interior of viral particles which dissociate M1 protein from RNP complexes for nuclear import (19). In addition, Sakaguchi et al. found that ion channel activity of the influenza virus M2 protein also affects glycoprotein HA and NA transport through the Golgi apparatus (173). Recently, the M2 cytopasmic tail domain was modified to develop effective influenza A virus vaccines which will be discussed further in later section (217).

The M1 protein is a collinear transcription product of Matrix gene which is different from the mechanism encoding the M2 protein. In viral particles, the M1 protein forms an intermediate layer to separate integral membrane proteins and RNP from the viral envelope integral membrane proteins (171). The M1 protein is the most highly conserved protein of influenza A viruses (70), which plays a critical role in virus assembly and budding (2, 55).

Earlier studies revealed that the M1 protein contributed to virus virulence as well as growth, and thus this protein was as a target to attenuate A/WSN/33 virus (110, 184).

The polymerase proteins, components of RNPs, are critical for virus transcription and replication. Studies showed that PB2 has cap-binding for host cell pre-mRNAs (58) and endonuclease activities (151, 181). In addition to its biological activities, PB2 is associated with pathogenicity and host range restriction of influenza virus. A reverse genetics method identified a single amino acid change at position 627 of PB2 protein responsible for different virulence level of Hong Kong H5N1 influenza A viruses in mice (62). Moreover, the change from Glu to Lys at this position of PB2 also is associated with virus host tropism. Recent evidence demonstrated PB1 protein instead of PB2 protein has the active site of endonuclease activity to generate cap primers for viral mRNA synthesis (58, 105).

6 During virus replication, PB1 protein also catalyzes the sequential addition of nucleotides

during RNA chain elongation (14). Kawaoka et al. showed that avian derived PB1

segments were associated with both the 1957 and 1968 pandemics of influenza, together

with the novel surface protein (HA and NA) (82). Recently, it was demonstrated that the

PB1 gene segment was responsible for the high virulence of the 1918 pandemic influenza

virus (146). PA is also involved in the viral RNA replication and transcription. Zurcher et

al. found that deletions and mutation introduced into Carboxyl-terminal part of PA protein

abolished polymerase activity and thus inhibited transcription (231). In addition, PA

protein is proved to degrade co-expressed proteins in infected cells, indicating its protease

activity (174).

NP protein is one of major protein components of ribonucleoprotein (RNP) (152) which

plays an essential structural role in encapsidating the virus genomes into RNPs. NP protein also directs nuclear import of the genome and is essential for vRNA synthesis in the nucleus (140). NP encapsulates the genome in a sequence-independent manner and interactions with the viral polymerase for viral RNA synthesis (1, 9). In addition to its function in RNA synthesis, a temperature-sensitive mutant of NP has been recently used to identify a late role for NP in virion assembly. Progeny viruses of NP mutant exhibited an abnormal morphology but virus genome transcription, replication, and protein synthesis were not affected (139).

Nonstructural proteins (NS1 and NEP) were encoded by the NS gene, the smallest gene of influenza A virus. The NS1 is encoded by a co-linear mRNA whereas the NEP is encoded by a spliced mRNA (93). The NS1 protein is designated as a non-structural protein because

7 it is synthesized in virus infected cells, but is not present in virions. It is a multifunctional

protein, which includes RNA binding domain and effector domain (213). The RNA

binding domain is located in the N-terminal 73 amino-acids, and is involved in the

prevention of interferon induction and the interferon antiviral effects (88), while the

effector domain is the remaining 157 amino-acids and carries out various functions through

binding several host-cell proteins (59). NS1 protein binds and sequesters double strand

RNA through its RNA-binding domain (39, 214) and thus prevents activation of protein

kinase R and the 2′-5′ oligoadenylate synthetase/RNase L antiviral pathway (11, 130). In

addition, NS1 protein can inhibits host cell mRNA processing and blocks nuclear export of

polyadenylated cellular transcripts by binding two host cellular protein, the 30 kDa protein

subunit of the cleavage and polyadenylation specificity factor and poly (A) binding protein

II, through its effector domain (112, 136, 157). Garcia-Sastre et al. demonstrated that

influenza A virus lacking the NS1 gene replicated in interferon-deficient systems,

indicating the NS1 protein is a virulence factor by inhibiting interferon-mediated antiviral

responses of the host and NS1 protein is not absolutely essential for virus replication in

vitro (53). Therefore, several vaccine virus strains generated by deleting partial carboxyl end sequence of NS1 gene were demonstrated to protect different experimental animals

when administrated as live vaccines (6, 160, 162, 202). Interestingly, 15-nucleotide

deletion at coding positions 612 to 626 of H5N1 swine influenza virus plays a critical role

in virus attenuation in chicken (230). In contrast, Long et al. reported that NS1 protein with

15 nucleotide deletions from position 263 to 277 contributed to virulence of H5N1 AIVs

(111). In addition to the role in inhibiting host cellular antiviral activities, the NS1 protein

could promote viral mRNA translation and control viral RNA replication (3, 42). Recently,

8 it was shown that the glutamic acid at position 92 of NS1 protein confers virulence of

H5N1/97 virus and resistance to antiviral cytokines (178). Studies also showed that

upregulation of the expression of proinflammaotry cytokines by this protein in mice and

pigs directly contribute to virulent phenotype of H5N1/97 virus (109, 178). The NEP,

previously named nonstructural protein 2 (NS2), actually was found to be one of viral

structural proteins (161), and mediates the nuclear export of viral RNPs during virus

replication (141).

1.4 Non-coding Regions of Influenza A virus

All gene segments of influenza A viruses contains non-coding regions (NCR) at their 5’

and 3’ ends that flank the coding region (94). Sequence analysis indicated that each

segment NCRs have segment specific parts with differing sizes, but contain 13 and 12

(except the 4th nucleotide) conserved nucleotides at their 5’ and 3’ terminal ends,

respectively, among all eight segments in all influenza A viruses (37). However, among the

highly conserved region of 3’ vRNA, there is one natural variation (either C or U) at the 4th nucleotide position. Before our study, all polymerase genes (PB2, PB1, and PA) were considered carrying C at this position, whereas NA or M segments carry either C or U

(104). It was found that C4-containing promoter down-regulates the transcription but up- regulates the replication of the NA segment, compared to the U4 promoter, and the mRNA/vRNA ration was increased up to 20-fold by C4 to U4 substitution (103).

Moreover, a large structural change in virus promoter due to a single nucleotide natural variation (U4 to C4) contributes to the differential transcription and replication of NA by viral polymerases (104). If this is applicable to all gene segments, a virus containing a C4

9 promoter in all 8 vRNA should have much lower titers than that of a virus with U4 promoter in all gene segments. On the contrary, a recent study showed that the viral titer of

C4 virus is slightly higher than that of U4 virus (35).

In vitro studies demonstrated that the promoter for transcription is located within the 3’ and

5’ NCR (86, 107). There are three proposed secondary structures of vRNA promoter, the panhandle, fork, and corkscrew structures. Initially, panhandle structure model of secondary structure was proposed for the influenza A virus RNA promoter, based on the 16 and 15 terminal nucleotides which displayed partial and inverted complementarity. Several lines of evidence suggest that, interacting with RNA-dependent RNA polymerase proteins, this panhandle structure has replication and packaging signals and also plays a regulatory role in viral transcription initiation, termination, and polyadenylation (46, 68, 116).

However, the importance of panhandle structure model has been questioned. It has been shown that both vRNA 5’ end and 3’ end interact with polymerase independently, but the

3’ end has lower affinity than the 5’ end. In addition, vRNA 3’ end mutants which was found to be inactive as template in in vitro transcription were activated by vRNA 5’ mutant which contains compensatory mutations. These mutational analyses led to the proposal of new model for virus RNA promoter, RNA-fork model. This RNA-fork structure is partly double stranded (residues 10 to 15 of 3’ end and 11 to 16 of 5’ end) and partly single- stranded (the two ends) (46). This model was supported by an in vivo study showing that important promoter signals resided at positions 6-14 with respect to the 3’ end but not at the

3’ terminal base (226). In contrast, the corkscrew model containing two short hair-pin loop structures was proposed based on an extensive series of single-nucleotide substitutions in the proximal element of the vRNA promoter structure (44). In this model, short-range, two-

10 base pair stem-loop structures (2:9, 3:8) support that exposed single-stranded RNA tetra- loop structures (4-7) could interact with viral polymerase. In vitro experiments suggest that hairpin loops at both the 5’ and 3’ ends of the vRNA are required for endonuclease activity

(100) and stability (17), and the 5’ hairpin loop is also required for polyadenylation (154).

The segment specific regions play important roles in controlling the viral life cycles.

Deletions of both ends of NA segment specific NCRs or replacement of the NA specific region with that of PB1 or NS segments decrease the NA-specific vRNA in infected cells and in virions (229). This indicated that NCR segment specific parts affect the replication of influenza A virus NA segment (229). In addition, nucleotide insertion or changes in the

NA segment NCR specific parts down regulate replication, which further proved that NCR specific parts play a critical role in virus replication. In addition to roles of NCR segment specific parts in virus replication, deletion of both the 3’ and 5’ NCR NS segment-specific

parts drastically reduced the incorporation efficiency of NS vRNA, demonstrating that

NCR segment specific parts are also important for NS vRNA incorporation. Moreover, 3’

segment-specific non-coding sequence plays a more crucial role than 5’ NCR segment

specific region in the incorporation of NS vRNA into virions (48).

1.5 Vaccines

Vaccines have been used to prevent and control diseases for a long history. With help of

vaccines, several diseases, such as human polio, have been under control and even

eradiated (170). In case of poultry, influenza vaccines can be used to decrease morbidity

and mortality, drops in egg production, and to reduce virus excretion in infected birds as

well as possibility of virus spread among birds and flocks (196). There are different kinds

11 of vaccines developed by several strategies to protect poultry against AIV, which include inactivated whole virus vaccines, live attenuated vaccines, recombinant viral vectored and subunit vaccines, virus-like particle vaccines, and DNA vaccines. Currently, there are two types of vaccines commercially available for poultry, inactivated whole AIV and recombinant fowl pox vectored vaccines in the U.S. (199).

Inactivated vaccines

The inactivated whole AIV vaccines are most popular vaccines in practice. Vaccine viruses

are prepared from allantoic fluids of embryonated chicken eggs, inactivated by chemical

reagents including formalin and β-propiolactone, and emulsified with mineral oil and

administered by a parenteral route (191). Inactivated vaccines can induce humoral antibody response against not only HA and NA protein but also internal proteins. Before the 1970s,

AI vaccination was not permitted in the U.S., because AI results in only regional problems and vaccination compromises tracking natural field infections (33). Since the 1970s,

inactivated vaccines have been used in the U.S. to control outbreak of LPAI in certain

states which had frequent AI outbreaks, thus they became a viable alternative for control

strategies (61, 153). However, a good inactivated vaccine should combine with a

Differentiation of Infected from Vaccinated Animals (DIVA) strategy. For example,

application of an inactivated vaccine (A/chicken/Pakistan/95 (H7N3)) successfully

eradicated LPAI caused by H7N1 viruses in Italy (20). The H7N3 inactivated vaccine

contained same HA subtype with the field virus, but different NA subtype, thus the

availability of a serological test capable of screening specific antibodies against different

NA allowed the differentiation between infected and vaccinated animals (20). However, the

12 inactivated vaccines have several disadvantages including parenteral delivery,

incompatibility with DIVA when the field strain is same with the vaccine strain and no

commercial serological test available to detect infection in birds vaccinated with

inactivated vaccines.

Live attenuated vaccines

There are increasing interests in developing live attenuated vaccines. Vaccination with a

live attenuated vaccine strain can closely mimic natural infection. Virus antigens are

presented to the host immune system via both exogenous and endogenous pathways, thus

inducing not only humoral but also cellular and mucosal immune response (133).

Moreover, they have the advantage of painless aerosol administration, which allow a rapid

mass vaccination to both increase the level of resistance of the poultry population from infection and reduce viral shedding. There is already a licensed live attenuated (att), cold- adapted (ca), temperature sensitive (ts) reassortant vaccine for humans in Russia and U.S.

(10, 83). However, applications of live attenuated AIV vaccines in poultry have been prevented by concerns about possibility of virus transmission from vaccinated to healthy

birds and mutations of viruses from low pathogenic to highly pathogenic type. Developing

in ovo vaccine can be an alternative way to reduce those risks in poultry. There are several

strategies which have been used to develop live attenuated AI vaccines. Modification of

HA cleavage site of HPAI viruses is one necessary step to attenuate viruses when developing vaccines for HPAI (189). The presence of a polybasic cleavage site in the HA protein is one of significant virulence determinants. Multiple basic residues from insertion or mutation at the HA cleavage site will allow generation of highly pathogenic viruses from

13 the low pathogenic viruses (101). In general, the introduction of multiple basic residues at the cleavage site could increase the range of host cell proteases which can affect cleavage, and activation of the HA protein results in systemic spread of the viruses in hosts. Deleting the multi-basic amino acid sequence adjacent to the HA cleavage site in general modifies highly pathogenic strains into low pathogenic strains (180, 193).

Modification of NS1 protein is one of new approaches used to attenuate influenza viruses.

Garcia-Sastre, et al. illustrated that human influenza viruses (A/PR/8/34) lacking NS1 gene could only replicate in interferon deficient systems, which highlight the function of NS1 protein as interferon antagonists and its relation to viral virulence and pathogenicity (53).

Based on this rationale, many studies utilized NS1 protein as a target to attenuate influenza

A viruses to develop live attenuated vaccine strains. It was first demonstrated that influenza

A and B viruses encoding altered viral NS1 proteins are highly attenuated in the mouse host, but provide protection from challenge with wild-type viruses (202). This study presented evidence that modification of the interferon antagonist, NS1 protein, is applicable to the rational generation of vaccines for influenza viruses, which was supported by several studies in mouse model (41, 43). However, mouse is not a natural host for human influenza virus which could not accurately reflect the condition of natural host. Macaques are among the closest genetic relatives to humans after great apes and have been shown to reproduce human pathology and immune responses very well. They have been recently used to evaluate efficacy of NS1-truncated live influenza virus vaccine (6). A single dose immunization with a NS1-truncated influenza virus (TX91 NS1▲126) elicited robust humoral and cellular immunity to influenza virus and was effective in protecting macaques from homologous challenge. Vaccinated macaques with NS1-truncated viruses

14 showed a transient local and systemic inflammatory response without productive

respiratory infection and lung pathology (6). Therefore, NS1 truncation constitutes a

promising means of attenuating influenza viruses for developing live vaccines. This

strategy was also extensively tested in other hosts including horse, pig, and poultry.

Equine influenza viruses with three different sizes of truncated NS1 protein (NS1-126, 99,

and 73) were shown to be attenuated in eggs, MDCK, and also in mice (160). These

attenuated equine NS1 truncated virus vaccine candidates have also been shown to be

attenuated and effective against equine influenza in horses (24). With those same truncated

NS1 proteins, swine influenza viruses were also attenuated in pigs, and virus attenuation

was correlated with the amount of interferon α/β induction in vitro (185). The most

attenuated swine influenza virus with truncated NS1 protein (TX98 NS1▲126) induced a strong protective immune response against a homosubtypic H3N2 challenge and a partial protective immune response against a heterosubtypic H1N1 swine influenza virus challenge (162). Moreover, vaccinated pigs with truncated NS1 vaccine strain were seronegative for NS1 protein, indicating the potential use of the TX98 NS1▲126 as a vaccine to differentiate infected from vaccinated animals.

Naturally occurring strains of NS deletion variants with large or small deletion have been shown to be attenuated in a chicken model, suggesting the strategy of NS1 truncation

would also be successful in poultry (23, 230). Stell et al. demonstrated that live attenuated

H5N1 vaccine candidates could be generated by reverse genetics through modifications of

HA cleavage site and PB2 627 amino acid and truncations of NS1 protein, which can

provide complete protection against homologous highly pathogenic H5N1 virus challenge

in mice and chickens and high level of protection against hetergologous H5N1 virus

15 challenge (190). Together, modification of NS1 protein alone or together with other strategies could be used to generate live attenuated vaccine strains which could provide protection against homologous or even heterologous challenge. In addition, there is less possibility for NS1-truncated viruses to revert back to its virulent types due to large deletion.

Cold adaptation has been used to attenuate influenza viruses to produce live attenuated vaccine strains. This strategy was first used in influenza virus strain A/Ann Arbor/6/60

(H2N2) by serially passaging the virus in primary chick kidney cells or embryonated chicken eggs at lower temperatures (119). When the cold adapted virus strain is applied to experimental animal models, they replicate efficiently in the cooler environment of the upper respiratory tract where they induce local and systemic immune response, but poorly in the warmer environment of the lower respiratory tract where wild type virus usually causes pathogenic lesion (129). The attenuated strain can serve as a master strain to donate its internal genes to generate live attenuated vaccines carrying the HA and NA genes of interest. Compared to its wild type virus, there are total of 11 amino acid mutations in the attenuated A/Ann Arbor/6/60 (32). Among those mutations, Jin et al. demonstrated that five mutations in three gene segments (PB2, PB1, and NP) that contribute to the temperature sensitive and attenuation phenotype of the attenuated strain (74). Importantly, this kind of cold adapted temperature sensitive vaccine was found to be genotypically stable (63). By using the internal gene backbone of attenuated A/Ann Arbor/6/60 strain,

H5N1, H6N1, H7N3, and H9N2 subtype vaccine strain viruses generated by reverse genetics could provide safe and efficacious protection against wild type virus challenge in mice and ferrets (25, 27, 78, 106). For example, human live attenuated H5N1 candidate

16 vaccines with their modified H5 HA and wild type N1 NA of Hong Kong and Vietnam

H5N1 isolate and remaining gene segments derived from the cold-adapted influenza A

vaccine donor strain, A/Ann Arbor/6/60 (H2N2), were generated by reverse genetics.

Immunized mice were fully protected against homologous and heterologous wild type

H5N1 viruses from different genetic sublineages (195). In 2004, it was illustrated that those same five mutations in PB2, PB1, and NP responsible for ts and att phenotype were sufficient to impart ts and attenuation phenotype in ferrets to A/Puerto Rico/8/34 (H1N1)

(75). Subsequently, AIV A/Guinea Fowl/Hong Kong/WF10/99 (H9N2) with those specific mutations also showed temperature sensitive phenotype in vitro, however, those mutations did not sufficiently attenuate the AIV in vivo, which required additional attenuation by HA tag in PB1 segment (187). No additional studies have been done to further confirm whether those mutations from human attenuated donor viruses contribute to attenuating AIVs.

Recently, a live cold-adapted attenuated H9N2 influenza vaccine by adaptation of viruses in embryonated chicken eggs at 25 °C was developed (102). Genetic analysis revealed that there were 44 amino acid mutations in the vaccine strain compared to its wild type virus, among which 7 amino acid mutations are the same to those in the human cold-adapted

A/Ann Arbor/6/60. This is the first report of developing cold adapted temperature sensitive

AIV strain by serial passage of wild type virus in lower temperature. This cold-adapted attenuated AIV strain could protect chickens from egg production drop and mortality (102).

It remains to be determined whether this cold adapted, temperature sensitive, and attenuated avian strains can serve as a donor strain to attenuate other subtypes of AIVs.

Targeting M1 or M2 protein to attenuate influenza virus is a new area for live vaccine development. M1 is a major structural component of the virion and has many functions

17 during viral replication. One of regions in M1 protein responsible for RNA-binding

domains is a series of basic amino acids at amino acid positions 101 to 105, which are

involved in RNP binding and nuclear localization. The R101S-R105S double mutant had a

weaker binding of M1 to RNPs and a temperature sensitive phenotype (110). When

inoculated into mice, this double mutant was highly attenuated, compared to wild type

A/WSN/33, and mice vaccinated with this mutant were fully protected from lethal

challenge with wild type virus (110). On the other hand, M2 also can be a target for

attenuation of viruses. Transmembrane domain has the protein’s ion channel activity which

plays a critical role in the early stage of the viral life cycle between the steps of virus

penetration and uncoating (216). M2del29-31 mutant virus with defective M2 ion channel

activity was found to be attenuated in mice but not in cell culture (216). Mice immunized

with this mutant were protected against challenge with lethal doses of influenza virus.

Recently, M2 cytoplasmic tail domain was also found to be involved in viral assembly and

morphogenesis (71). Deletion in M2 cytoplasmic domain of A/WSN/33 strain caused

defective growth phenotype of mutant viruses in vitro (71, 126, 127), suggesting that

modification of this domain could be used in developing live attenuated vaccine against

other subtypes of influenza viruses. Watanabe et al. tested several different sizes of

deletions of M2 cytoplasmic tail using A/Vietnam/1203/04 (H5N1), and found that mutant with 11 amino acid deletion from the C terminus in M2 protein grew as well as the wild- type virus but replicated in mice less efficiently (217). After further modification of HA sequence at cleavage site, mutant virus could protect mice against challenge with lethal doses of homologous and antigenically distinct heterologous H5N1 viruses (217). Studies

18 of M1 or M2 protein to attenuate influenza virus are limited and it remains to be

determined whether these strategies are strain or subtype specific.

Since 1990s, modification of NCRs of influenza A virus has been used to attenuate viruses.

It was shown that influenza A virus with its NA segment noncoding sequences replaced by

that of influenza B virus NS gene was attenuated, immunogenic, and protective against

challenge virus in mice, thus demonstrating a new strategy to develop live attenuated

vaccine strains (134). Attenuation of virus by this way is due to changes in the cis signal sequences, thus resulting in a reduction of transcription and replication of the NA gene segment (114). Although promoter mutational studies showed that base pairing of nucleotide 10-12 of the 3’ end of the vRNA promoter with nucleotide 11-13 of 5’ end of

the vRNA promoter was shown to be essential for efficient virus replication in MDBK cells, influenza viruses containing their conserved base pairs replaced with alternative base pairs can be generated (45). Double mutations at position 12’-11 from G-C to U-A in NA vRNA promoter was found to attenuate the virus significantly. This mutation did not

dramatically affect the vRNA replication, but significantly reduced the levels of mRNA

and protein by affecting the polyadenylation of mRNA (45). Viruses with this double

mutation were highly attenuated in mice, and mice with a single immunization of

attenuated viruses were protected against challenge with a lethal dose of wild type

influenza virus (186). In 2003, Catchpole et al. showed that the same mutations in NS or

PA gene vRNA promoters also attenuate virus in vitro, and mutations decrease both vRNA

and mRNA levels (22). In other studies mutations in NCR severely affected virus viability,

as it was shown that viruses with random mutations or insertions introduced in NCR of NA

19 segment were not stable and their progeny viruses acquired a complete phenotypical

reversion (12).

Recombinant viral vectored vaccines

Recombinant viral vectored vaccines provide an alternative to conventional inactivated

whole virus vaccines. Genes of interest flanked by enhancer-promoter and terminator

regulatory sequences are inserted into the viral vectors. When the viral vectored vaccine is

delivered to the host, the inserted protein of interest is expressed, and it induces cellular and

humoral immune responses. In case of influenza, eliciting neutralizing antibodies against

two major surface proteins, HA and NA, is basis of protective humoral immunity. In

general, antibodies against the HA can block viral infectivity by interfering either with viral

attachment to its receptor on host cell surface or with fusion between viral and host cellular endosomal membrane (85). In contrast, antibodies against the NA can inhibit the release of progeny viruses from infected cells thus affecting the yield and spread of virus (36). In addition, recombinant viral vectored influenza vaccines comply with a DIVA program and have a trait of mass vaccination through aerosol sprays or drinking water for poultry thus reducing the cost of administration (eg. infectious laryngotracheitis virus (118, 210) and

Newcastle disease virus (200) vectored vaccines). There are many different viral vectored vaccines being studied that express either HA alone or HA and NA together. In general, viral vectored vaccines could be classified into two types, DNA and RNA virus vectored

vaccines. DNA virus vectors include pox virus (90, 91, 125, 198), adenovirus (57, 205,

209), infectious laryngotracheitis virus (118, 210). RNA virus vectors comprise of

Newcastle disease virus (54, 147, 200, 211), vesicular stomatitis virus (79, 80, 163),

20 parainfluenza virus 5 (204). Many factors determining selection of a viral vector for a recombinant vaccine include host range of the vector, replication in the target host, expression level of inserted influenza virus genes, and safety.

Although there are so many experimental viral vectored vaccines, fowlpox virus vectored

AI-H5 vaccine is the only licensed vaccine being used in chickens in the U.S. (18). This vaccine can be administered at 1 day of age in the hatchery, thus improving the biosecurity and quality control of vaccination. This vaccine was found to be effective against nine different highly pathogenic H5 AI challenge viruses of different geographic and spatial backgrounds by reducing detectable infection rates and virus shedding titers (198).

Moreover, the ability to reduce challenge virus shedding in the oropharynx was positively correlated with HA gene sequence homology between challenge viruses and vaccine. In this study, one of challenge viruses, A/emu/Texas/39924/93, had 88.8% HA amino acid similarity with the vaccine and significantly reduced the shedding of challenge virus from the oropharynx, while A/chicken/Queretaro/14588/95 which had 89.1% similarity with vaccine did not reduce challenge virus shed, suggesting factors other than HA sequence similarity between vaccine and challenge strain affect ability to prevent virus shedding in vaccinated chickens. To improve efficacy of fowlpox virus vectored vaccine against heterologous virus with divergent HA sequence, a recombinant fowlpox virus co- expressing H5 HA and N1 NA genes of AIV was generated. Vaccinated chickens were protected against both homologous and heterologous HA subtype AIVs of the same NA subtype with vaccine, further confirming that NA can significantly contribute to the protective immune response (156). Although effectiveness of fowlpox virus vectored vaccine has been demonstrated, there is a potential pitfall for practical use that fowlpox

21 virus vectored vaccines will not give uniform immunization to chickens with prior

vaccination against fowlpox virus and prior exposure to field fowlpox virus could also result in limited protection by this vaccine (197). Compared to fowlpox virus, vaccinia virus has a wide host range including human beings, monkeys, cattle, mice. Due to the

safety concerns with poxvirus vectored vaccines in human, a replication-deficient vaccinia

virus Ankara was developed (124). This strain is host range restricted, usually replicates in

chicken primary cells, and had been proved to be a safe and effective vaccine against

human smallpox (124). Recombinant modified vaccine virus Ankara expressing the HA

gene of influenza virus A/Vietnam/1194/04 (H5N1) is highly immunogenic in mice (91).

Immunized mice were protected from infection with not only the homologous virus but

also the heterologous H5N1virus A/Indonesia/5/05. Recently, Kreijtz et al. found that the

vaccine strain also confers protection against H5N1 influenza virus infections in nonhuman

primate model, macaques, which guarantees further clinical development (90). The

modified Vero cells can also be used as a feasible alternative to primary chicken cells to

produce nonreplicating vaccinia virus vectors which express the influenza virus H5 HA

(125).

Human adenoviruses have been proved to be suitable recombinant vaccine vectors for

expression of foreign antigens. Recombinant replication competent adenoviruses

expressing genes of several other viruses were good vaccine candidates (28, 77, 113),

however, the biosafety of this recombinant vectors remains to be assessed, as they have the

possibility to integrate its genome into host. To avoid this risk, replication incomplete

adenoviruses have been constructed by deleting the E1 gene which is required for virus

replication. For production of vaccine strains, replication incompetent recombinant

22 adenoviruses expressing foreign genes can be produced only in a complementing cell line,

293 cells, which expresses E1 proteins (57). Replication-defective human adenovirus serotype 5 has been used to encode influenza A/PR/8 (H1N1) HA for vaccine development

(209). This vaccine was shown to be safe and effective in humans. In addition, this study showed that the potency of adenovirus vectored vaccines was not interfered by pre-existing immunity to adenovirus (209). It is high likely that adverse effect of pre-existing immunity to adenovirus on vaccine efficacy was negated by high vaccine doses. Alternatively, to reduce impact of high levels of pre-existing immunity against human adenovirus on the expression of influenza HA gene, Singh et al. utilized bovine adenovirus subtype 3 which was not cross-neutralized by immunity against human adenovirus serotype 5 (5) as a vector to express influenza H5 protein (183). This vector can overcome high level of vector immunity, indicating that it could serve as a supplement to human adenovirus vectors for vaccine development during a pandemic situation. Several studies recently show that mice and chickens vaccinated with the human adenovirus serotype 5 vectored H5 vaccines could be protected against H5N1 virus challenges (52, 66). In addition, this human adenovirus vectors expressing HA and NP of H3N2 swine influenza virus can also provide complete protection to pigs by preventing nasal shedding of challenge virus and lung lesions (224).

Although using this replication defective adenovirus vector has the advantages in terms of safety, high titers of virus are needed to vaccinate target animals to elicit an ideal immune response.

Infectious laryngotracheitis virus (ILTV), belonging to the Alphaherpesvirinae, has been attenuated as a recombinant vector by deleting viral nonessential genes encoding dUTPase

(UL50), or ILTV-specific UL0 protein (118, 210). This type of viral vectored vaccine has

23 the advantage as a bivalent live virus vaccine against infectious laryngotracheitis and AI and mass application is feasible (4). Vaccinated chickens with ILTV recombinants expressing the HA of A/chicken/Italy/8/98 (H5N2) or A/chicken/Italy/445/99 (H7N1) were protected against infectious laryngotracheitis and AI after challenge (118, 210). Further experiments showed that although the ILTV recombinant expressing H5 HA was effective against homologous influenza virus challenge, it did not provide good protection against heterologous AIV challenge (148). By increasing expression of inserted genes and matching amino acid sequence between vaccine and challenge virus, vaccine efficacy was significantly increased. In addition, coimmunization with ILTV recombinants expressing both HA and NA completely blocked challenge virus replication (148). It remains to be determined whether efficacy of ILTV-based AI vaccines is affected in birds with prior immunity to ILTV.

Reverse genetics systems established for negative sense RNA viruses make it possible to manipulate the genome of viruses, thus allowing the generation of recombinant virus vectors that include Newcastle disease virus (NDV), vesicular stomatitis virus (VSV), and human parainfluenza virus 5 (hPIV5) (138). NDV has been extensively studied as a recombinant vector to express foreign genes of many pathogens including influenza virus.

Advantages of NDV-vectored influenza HA vaccines include mass vaccination and elicitation of dual immunity against two important poultry diseases. Recombinant ND- vectored H5 HA vaccines have been licensed for use in China and Mexico (199). To investigate the possibility of NDV as a recombinant viral vector, the H1 of influenza

A/WSN/33 virus has been incorporated between the phosphoprotein and Matrix genes of a

Hitchner B1 strain (135). Mice vaccinated twice with the recombinant vector showed a

24 strong humoral antibody response against influenza virus and were completely protected

against influenza virus challenge with a lethal dose of WSN, which demonstrated the potential of recombinant NDV as a vaccine vector (135). However, when the same B1 strain engineered to express H7 of a LPAI virus was used to vaccinate chickens, they provided only 40% protection against HPAI virus and highly virulent NDV (200). In this study, even transfectant NDV vaccine without insert of HA gene provided 70% protection

for NDV challenge, indicating that NDV B1 strain is probably too attenuated (200). As

NDV B1 strain virus used in these studies is nonfusogenic, to increase immunogenicity of

B1 strain, Park et al. modified the cleavage site of the F protein to generate fusogenic recombinant virus (147). Meanwhile, they enhanced incorporation of the H7 HA protein into recombinant NDV virions by inserting only HA protein ectodomain which is combined with the transmembrane and cytoplasmic domains derived from the F protein of

NDV. A single immunization of chickens with this improved vaccine virus strain provided not only 90% protection against HPAI virus, but also 100% protection against a virulent

NDV. In addition to B1 strain, LaSota NDV vaccine strain is another attenuated strain used as viral vector to express foreign genes including influenza HA gene (54, 69). The HA gene of A/Bar-headed goose/Qinghai/3/2005 (H5N1) was inserted into the same region between the phosphoprotein and Matrix genes of LaSota strain as B1 strain (54). A single vaccination induced complete protection of chickens from challenge with a lethal dose of both velogenic NDV and homologous and heterologous HPAI viruses. In addition, vaccinated mice were also completely protected from homologous and heterologous lethal virus challenge. When the H5 HA gene of A/chicken/Italy/8/98 (H5N2) was inserted into another intergenic region between fusion and hemagglutinin-neuraminidase genes of clone

25 30 derived from LaSota strain, recombinant vectored H5 vaccine provided chickens with

complete protection against lethal NDV and highly pathogenic homologous H5N2 virus

challenge(211), however, only partial protection against lethal infection with hetergologous

HPAI virus was conferred to vaccinated chickens (169). Different protection levels of those recombinant vector vaccines against heterologous HPAI viruses could result from different

HA protein expression levels due to the different insertion site of HA gene (149). Further studies are needed to better understand the contribution of insertion site of HA gene to the protection levels. In addition, the effect of pre-existing immunity to NDV on NDV- vectored influenza vaccine efficacy remains to be determined.

Like NDV, VSV as a vaccine vector also has been extensively used to express foreign antigens, which is capable of providing protection against many diseases including influenza (79, 164). The initial studies reported high-level expression of HA protein from recombinant VSV expressing the HA protein of the WSN strain and efficient incorporation of the HA protein into the virions, indicating the feasibility of recombinant VSV as a vaccine vector (92). After immunization of mice, although there was some pathogenesis associated with the VSV vector itself, recombinant VSV-HA induced high levels of neutralizing antibody against influenza virus and mice were protected from challenge with a lethal dose of the WSN virus (164). To further attenuate VSV, Roberts et al. created new

VSV vectors expressing influenza HA by introducing a truncated cytoplasmic domain of the VSV G protein (CT1-HA) or deleting VSV G protein (ΔG-HA) (163). The new VSV vectors were completely attenuated in mouse model. CT1-HA vector provided complete protection from lethal influenza virus challenge after intranasal immunization. The VSV vector lacking G gene seems more promising, as it is also protective and has the advantage

26 of not inducing neutralizing antibodies to the vector itself (163). This replication-

incompetent vector was recently shown to induce protective immunity in mice against

challenge with either highly pathogenic H5N1 (177) or A/WSN/33 (H1N1) (163) or in

chickens against challenge with highly pathogenic H7N1 (80). Although VSV does not cause neurological disease in natural hosts, it was found that VSV can be neuroinvasive following intranasal inoculation of mice (142). By using the VSV vectors lacking G gene

may eliminates this risk.

Despite the many advantages and promising protective efficacies of recombinant vectored

vaccines, issues relating to pre-existing immunity to the vector itself need to be addressed.

Recombinant subunit vaccines

Recombinant subunit vaccines are produced using single or several influenza proteins

which are expressed from prokaryotic or eukaryotic systems and then purified.

Recombinant subunit vaccines have the advantage to differentiate vaccinated animals from

naturally infected animals. Also, this kind of vaccine is safe to manufacture and use, as the

vaccine contents are not infectious viruses. The baculovirus-insect cell expression system is

one of the most widely used systems in developing recombinant subunit vaccines (31, 36,

76, 207). FluBlok, a trivalent recombinant HA human influenza vaccine, contains purified

HA proteins produced using this expression system (31). Three times more HA protein in

the FluBlok vaccine than that of inactivated influenza vaccines are needed to elicit

comparable humoral immune responses. Mechanism of action of FluBlok is same with that

of inactivated influenza vaccines (31). In addition, clinical studies showed that high dose of

FluBlok was shown to be well tolerated in elderly adults and to induce serum antibody

27 responses which are comparable or superior to the inactivated vaccines (206). FluBlok has

been in phase III trials in the United States. In addition to its usefulness in developing human seasonal influenza vaccines, baculovirus-insect cell expression system has been used to develop poultry subunit vaccines against highly pathogenic H5N1 (108, 225). Other expression systems including the bacterial expression system and plant-expression system have also been explored to produce influenza subunit vaccines (179, 182). Protein expression using bacteria system is cheaper than the baculovirus-insect cell system. Since bacterial expression systems do not have eukaryotic post-translational protein modification machinery, it is uncertain if expressed antigens would possess correct protein structure and stimulate neutralizing antibodies (176). A recent study compared the antibody responses against recombinant HA proteins of H5N1 AIV expressed in insect cells and bacteria (179).

It was found that neutralizing antibodies against antigens produced from bacteria are lower than those against antigens expressed in insect cells, indicating the bacterial expression system may not be suitable for producing recombinant influenza subunit vaccines (179).

Recently, the plant expression system has been tested to express HA of AIVs. Neutralizing serum antibodies against HA protein were induced from immunized mice, demonstrating the potential of plant-produced HA-based subunit vaccines (182).

Virus-like particle vaccines

Virus-like particles (VLPs) are structures that morphologically resemble a native virion, but

are lacking the genetic materials required for viral replication and infection (81). VLPs are

produced from simultaneous expression of viral structural proteins by a self-assembly

process. VLPs have the combined advantages of safety of inactivated vaccines and

28 inducing humoral and cellular immunity of live vaccines (15, 16). These characteristics make them attractive vaccine candidates. For influenza viruses, structural proteins produced in in vitro systems assemble into VLPs which are released into culture medium.

During this process, viral glycoproteins are incorporated into VLPs by mimicking the viral budding process. Influenza VLPs were generated by different expression systems which include DNA plasmid transfection with T7 RNA polymerase (56), plasmid-driven expression vectors (137), or recombinant baculoviruses (98, 155). An earlier study reported that all structural proteins were required for formation of VLPs (56). In addition, the expression levels of viral proteins determine efficient formation of influenza VLPs. In this study, a vaccinia virus-based system has been used to generate VLPs, in which recombinant vaccinia virus is used to infect COS-1 cell and provides T7 RNA polymerase for expressing influenza viral proteins (56). Subsequently, plasmid-driven systems are available to generate influenza VLPs with high yield (137). Using the latter systems, replication-incompetent influenza VLPs were generated by knockouting NS2 protein, were able to infect mammalian cells, and provided mice from lethal influenza virus challenge

(218). In contrast, NS gene-deficient VLPs generated by this plasmid-driven system showed very poor immunogenicity and low protection efficacy, further confirming that the role of NS1 in forming VLPs in this production system (218). Because both systems required all or most virus structural proteins to form VLPs, they are not suitable for large- scale production of VLPs. In addition to aforementioned systems, the insect-cell based baculovirus protein production systems are developed and widely used to produce influenza VLPs (98, 155). So far, the major viral proteins required for controlling influenza

VLP formation are still unknown. Recent studies demonstrated that M1 protein interacts

29 with the cytoplasmic tails of HA and NA driving the virus assembly and budding processes, as mutations in the cytoplasmic tails of the viral glycoproteins impair virus

budding (98, 228). Using single-gene baculovirus recombinants, Latham and Galarza found

that VLPs can be formed and released from cells expressing M1 protein alone, supporting

the role of M1 in assembly and release of virus particles (98). Based on that M1 protein is

the driving force in virus budding, many studies have illustrated that influenza VLP

vaccines consisting of at least M1 and HA proteins produced from the recombinant

baculovirus expression system have good immunogenicity and protective efficacy against

H1N1 (121, 158), H3N2 (50), H5N1 (15, 120), and H9N2 (155) in mice and ferret model.

In addition, Bright et al. showed that immune responses induced by VLP vaccines are

equal or superior to those of current licensed human killed vaccine (16). Although VLP

vaccines in those studies provide good protection against homologous virus challenge, few

studies demonstrated VLPs also conferred protective immunity to heterologous virus (15,

120, 158). To enhance protection of VLP vaccines against heterologous and even heterosubtypic virus strains, several strategies have been explored, including incorporation of immunostimulatory cytokines in VLPs (172) or utilization of bivalent VLP vaccines (34,

159). Like inactivated trivalent influenza virus vaccines used in humans, bivalent influenza

VLPs containing different subtypes of HA (H1 and H3) were tested in mice (159). Bivalent

VLP vaccines induce protective immunity against both homologous subtype virus strains as well as heterologous strains. Importantly, bivalent influenza VLP vaccines showed an improved protection against the heterologous strain compared to the monovalent VLP vaccines, suggesting a potential advantage for the application of multivalent influenza VLP vaccine in broadening the cross-protection (159). In consistent with this finding, bivalent

30 VLP vaccines consisting of highly pathogenic H5N1 clade 1 and 2 isolates broaden the

immune response against H5N1 isolates (34). Although VLP vaccines hold many promises

as other candidate vaccine against both seasonal and pandemic influenza based on pre- clinical evidence, further studies are needed to test them in animal models more closely

related to humans and to validate their value in preventing animal influenza.

DNA vaccines

DNA vaccine relies on the administration of expression plasmids coding for a protective

antigen into the host (38). The antigen is expressed from the gene inserted in the plasmid

under control of a eukaryotic promoter by the host tissue transcription/translation

machinery, and processed and presented on MHC class I and II molecules, thus activating

cellular and humoral immune responses (38). Unlike recombinant virus vectored vaccine,

there are no immune responses against a DNA plasmid vector. Therefore, booster

immunizations with DNA vaccines are feasible until desired levels are achieved. In

addition, DNA vaccines allow for differentiation between infected and vaccinated animals.

Since early 1990’s, DNA vaccines have been studied in several different species, including

chickens, swine, mice and ferrets (97, 143, 192, 208, 222). It was found that influenza

DNA vaccines can elicit both humoral and cell-mediated immunity which provide host

against influenza virus challenge (215). In general, immunogenicity and efficacy of DNA

vaccine is low after a single immunization (144) and booster immunization or coinjection

of plasmids coding for immunomodulatory genes is required (96, 97, 144). In poultry,

several studies have explored and confirmed the efficacy of DNA vaccines (49, 89, 165,

192). However, the high dosage of DNA vaccines required by intramuscular injection is an

31 obstacle for their application in the field. Although the gene gun delivery system could

reduce the dosage (49, 89), this method is not feasible for field use. A recent study reported

that construction optimization of DNA vaccines by using better promoter and codon

optimized HA gene could decrease vaccine dose necessary for inducing complete

protection in chickens (73). Considering low immunogenicity and high cost of DNA

vaccines, additional studies including identification of better promoters to increase

expression of insert genes are required.

In summary, much progress has been made in influenza vaccine development over past

years. In addition to humoral immune responses elicited by all types of vaccines, most of

them induce cellular immune response in hosts. Although they can decrease morbidity and

mortality, drops in egg production, reduce virus shedding in infected birds, and prevent

transmission, vaccines can not completely prevent infection, especially in the field.

Moreover, all vaccines still face one evitable challenge that there are many different AI subtypes that do not crossreact serologically and major antigenic determinants of viruses constantly change allowing viruses to escape host immune responses. Therefore, vaccines alone will not prevent and control AI, and it is necessary to apply a comprehensive control program including biosecurity, routine surveillance and diagnostics, vaccination, elimination of infected poultry, evaluation of vaccine effectiveness, and education to prevent and control AI.

32 REFERENCES

1. Albo, C., A. Valencia, and A. Portela. 1995. Identification of an RNA binding region within the N-terminal third of the influenza A virus nucleoprotein. J Virol 69:3799-806.

2. Ali, A., R. T. Avalos, E. Ponimaskin, and D. P. Nayak. 2000. Influenza virus assembly: effect of influenza virus glycoproteins on the membrane association of M1 protein. J Virol 74:8709-19.

3. Aragon, T., S. de la Luna, I. Novoa, L. Carrasco, J. Ortin, and A. Nieto. 2000. Eukaryotic translation initiation factor 4GI is a cellular target for NS1 protein, a translational activator of influenza virus. Mol Cell Biol 20:6259-68.

4. Bagust, T. J., Guy, J. S. 1997. Laryngotracheitis, p. 527-539. In H. J. B. B.W. Calnek, C. W. Beard, L. R. McDougald & Y. M. Saif (ed.), Diseases of Poultry, 10th ed. Iowa State University Press, Ames.

5. Bangari, D. S., S. Shukla, and S. K. Mittal. 2005. Comparative transduction efficiencies of human and nonhuman adenoviral vectors in human, murine, bovine, and porcine cells in culture. Biochem Biophys Res Commun 327:960-6.

6. Baskin, C. R., H. Bielefeldt-Ohmann, A. Garcia-Sastre, T. M. Tumpey, N. Van Hoeven, V. S. Carter, M. J. Thomas, S. Proll, A. Solorzano, R. Billharz, J. L. Fornek, S. Thomas, C. H. Chen, E. A. Clark, K. Murali-Krishna, and M. G. Katze. 2007. Functional genomic and serological analysis of the protective immune response resulting from vaccination of macaques with an NS1-truncated influenza virus. J Virol 81:11817-27.

7. Bean, W. J., M. Schell, J. Katz, Y. Kawaoka, C. Naeve, O. Gorman, and R. G. Webster. 1992. Evolution of the H3 influenza virus hemagglutinin from human and nonhuman hosts. J Virol 66:1129-38.

8. Beare, A. S., and R. G. Webster. 1991. Replication of avian influenza viruses in humans. Arch Virol 119:37-42.

9. Beaton, A. R., and R. M. Krug. 1986. Transcription antitermination during influenza viral template RNA synthesis requires the nucleocapsid protein and the absence of a 5' capped end. Proc Natl Acad Sci U S A 83:6282-6.

10. Belshe, R. B. 2004. Current status of live attenuated influenza virus vaccine in the US. Virus Res 103:177-85.

11. Bergmann, M., A. Garcia-Sastre, E. Carnero, H. Pehamberger, K. Wolff, P. Palese, and T. Muster. 2000. Influenza virus NS1 protein counteracts PKR- mediated inhibition of replication. J Virol 74:6203-6.

33 12. Bergmann, M., and T. Muster. 1996. Mutations in the nonconserved noncoding sequences of the influenza A virus segments affect viral vRNA formation. Virus Res 44:23-31.

13. Boni, M. F., J. R. Gog, V. Andreasen, and M. W. Feldman. 2006. Epidemic dynamics and antigenic evolution in a single season of influenza A. Proc Biol Sci 273:1307-16.

14. Braam, J., I. Ulmanen, and R. M. Krug. 1983. Molecular model of a eucaryotic transcription complex: functions and movements of influenza P proteins during capped RNA-primed transcription. Cell 34:609-18.

15. Bright, R. A., D. M. Carter, C. J. Crevar, F. R. Toapanta, J. D. Steckbeck, K. S. Cole, N. M. Kumar, P. Pushko, G. Smith, T. M. Tumpey, and T. M. Ross. 2008. Cross-clade protective immune responses to influenza viruses with H5N1 HA and NA elicited by an influenza virus-like particle. PLoS ONE 3:e1501.

16. Bright, R. A., D. M. Carter, S. Daniluk, F. R. Toapanta, A. Ahmad, V. Gavrilov, M. Massare, P. Pushko, N. Mytle, T. Rowe, G. Smith, and T. M. Ross. 2007. Influenza virus-like particles elicit broader immune responses than whole virion inactivated influenza virus or recombinant hemagglutinin. Vaccine 25:3871-8.

17. Brownlee, G. G., and J. L. Sharps. 2002. The RNA polymerase of influenza a virus is stabilized by interaction with its viral RNA promoter. J Virol 76:7103-13.

18. Bublot, M., N. Pritchard, J. S. Cruz, T. R. Mickle, P. Selleck, and D. E. Swayne. 2007. Efficacy of a fowlpox-vectored avian influenza H5 vaccine against Asian H5N1 highly pathogenic avian influenza virus challenge. Avian Dis 51:498- 500.

19. Bui, M., G. Whittaker, and A. Helenius. 1996. Effect of M1 protein and low pH on nuclear transport of influenza virus ribonucleoproteins. J Virol 70:8391-401.

20. Capua, I., C. Terregino, G. Cattoli, F. Mutinelli, and J. F. Rodriguez. 2003. Development of a DIVA (Differentiating Infected from Vaccinated Animals) strategy using a vaccine containing a heterologous neuraminidase for the control of avian influenza. Avian Pathol 32:47-55.

21. Castrucci, M. R., and Y. Kawaoka. 1993. Biologic importance of neuraminidase stalk length in influenza A virus. J Virol 67:759-64.

22. Catchpole, A. P., L. J. Mingay, E. Fodor, and G. G. Brownlee. 2003. Alternative base pairs attenuate influenza A virus when introduced into the duplex region of the conserved viral RNA promoter of either the NS or the PA gene. J Gen Virol 84:507-15.

34 23. Cauthen, A. N., D. E. Swayne, M. J. Sekellick, P. I. Marcus, and D. L. Suarez. 2007. Amelioration of influenza virus pathogenesis in chickens attributed to the enhanced interferon-inducing capacity of a virus with a truncated NS1 gene. J Virol 81:1838-47.

24. Chambers, T. M., M. Quinlivan, T. Sturgill, A. Cullinane, D. W. Horohov, D. Zamarin, S. Arkins, A. Garcia-Sastre, and P. Palese. 2009. Influenza A viruses with truncated NS1 as modified live virus vaccines: pilot studies of safety and efficacy in horses. Equine Vet J 41:87-92.

25. Chen, H., Y. Matsuoka, D. Swayne, Q. Chen, N. J. Cox, B. R. Murphy, and K. Subbarao. 2003. Generation and characterization of a cold-adapted influenza A H9N2 reassortant as a live pandemic influenza virus vaccine candidate. Vaccine 21:4430-6.

26. Chen, W., P. A. Calvo, D. Malide, J. Gibbs, U. Schubert, I. Bacik, S. Basta, R. O'Neill, J. Schickli, P. Palese, P. Henklein, J. R. Bennink, and J. W. Yewdell. 2001. A novel influenza A virus mitochondrial protein that induces cell death. Nat Med 7:1306-12.

27. Chen, Z., C. Santos, A. Aspelund, L. Gillim-Ross, H. Jin, G. Kemble, and K. Subbarao. 2009. Evaluation of live attenuated influenza a virus h6 vaccines in mice and ferrets. J Virol 83:65-72.

28. Chengalvala, M. V., B. M. Bhat, R. Bhat, M. D. Lubeck, S. Mizutani, A. R. Davis, and P. P. Hung. 1994. Immunogenicity of high expression adenovirus- hepatitis B virus recombinant vaccines in dogs. J Gen Virol 75 ( Pt 1):125-31.

29. Claas, E. C., A. D. Osterhaus, R. van Beek, J. C. De Jong, G. F. Rimmelzwaan, D. A. Senne, S. Krauss, K. F. Shortridge, and R. G. Webster. 1998. Human influenza A H5N1 virus related to a highly pathogenic avian influenza virus. Lancet 351:472-7.

30. Connor, R. J., Y. Kawaoka, R. G. Webster, and J. C. Paulson. 1994. Receptor specificity in human, avian, and equine H2 and H3 influenza virus isolates. Virology 205:17-23.

31. Cox, M. M., and J. R. Hollister. 2009. FluBlok, a next generation influenza vaccine manufactured in insect cells. Biologicals 37:182-9.

32. Cox, N. J., F. Kitame, A. P. Kendal, H. F. Maassab, and C. Naeve. 1988. Identification of sequence changes in the cold-adapted, live attenuated influenza vaccine strain, A/Ann Arbor/6/60 (H2N2). Virology 167:554-67.

33. Crawford, J., B. Wilkinson, A. Vosnesensky, G. Smith, M. Garcia, H. Stone, and M. L. Perdue. 1999. Baculovirus-derived hemagglutinin vaccines protect against lethal influenza infections by avian H5 and H7 subtypes. Vaccine 17:2265- 74.

35 34. Crevar, C. J., and T. M. Ross. 2008. Elicitation of protective immune responses using a bivalent H5N1 VLP vaccine. Virol J 5:131.

35. de Wit, E., M. I. Spronken, T. M. Bestebroer, G. F. Rimmelzwaan, A. D. Osterhaus, and R. A. Fouchier. 2004. Efficient generation and growth of influenza virus A/PR/8/34 from eight cDNA fragments. Virus Res 103:155-61.

36. Deroo, T., W. M. Jou, and W. Fiers. 1996. Recombinant neuraminidase vaccine protects against lethal influenza. Vaccine 14:561-9.

37. Desselberger, U., V. R. Racaniello, J. J. Zazra, and P. Palese. 1980. The 3' and 5'-terminal sequences of influenza A, B and C virus RNA segments are highly conserved and show partial inverted complementarity. Gene 8:315-28.

38. Dhama, K., M. Mahendran, P. K. Gupta, and A. Rai. 2008. DNA vaccines and their applications in veterinary practice: current perspectives. Vet Res Commun 32:341-56.

39. Donelan, N. R., C. F. Basler, and A. Garcia-Sastre. 2003. A recombinant influenza A virus expressing an RNA-binding-defective NS1 protein induces high levels of beta interferon and is attenuated in mice. J Virol 77:13257-66.

40. Els, M. C., G. M. Air, K. G. Murti, R. G. Webster, and W. G. Laver. 1985. An 18-amino acid deletion in an influenza neuraminidase. Virology 142:241-7.

41. Falcon, A. M., A. Fernandez-Sesma, Y. Nakaya, T. M. Moran, J. Ortin, and A. Garcia-Sastre. 2005. Attenuation and immunogenicity in mice of temperature- sensitive influenza viruses expressing truncated NS1 proteins. J Gen Virol 86:2817- 21.

42. Falcon, A. M., R. M. Marion, T. Zurcher, P. Gomez, A. Portela, A. Nieto, and J. Ortin. 2004. Defective RNA replication and late gene expression in temperature- sensitive influenza viruses expressing deleted forms of the NS1 protein. J Virol 78:3880-8.

43. Ferko, B., J. Stasakova, J. Romanova, C. Kittel, S. Sereinig, H. Katinger, and A. Egorov. 2004. Immunogenicity and protection efficacy of replication-deficient influenza A viruses with altered NS1 genes. J Virol 78:13037-45.

44. Flick, R., G. Neumann, E. Hoffmann, E. Neumeier, and G. Hobom. 1996. Promoter elements in the influenza vRNA terminal structure. RNA 2:1046-57.

45. Fodor, E., P. Palese, G. G. Brownlee, and A. Garcia-Sastre. 1998. Attenuation of influenza A virus mRNA levels by promoter mutations. J Virol 72:6283-90.

46. Fodor, E., D. C. Pritlove, and G. G. Brownlee. 1994. The influenza virus panhandle is involved in the initiation of transcription. J Virol 68:4092-6.

36 47. Fouchier, R. A., V. Munster, A. Wallensten, T. M. Bestebroer, S. Herfst, D. Smith, G. F. Rimmelzwaan, B. Olsen, and A. D. Osterhaus. 2005. Characterization of a novel influenza A virus hemagglutinin subtype (H16) obtained from black-headed gulls. J Virol 79:2814-22.

48. Fujii, K., Y. Fujii, T. Noda, Y. Muramoto, T. Watanabe, A. Takada, H. Goto, T. Horimoto, and Y. Kawaoka. 2005. Importance of both the coding and the segment-specific noncoding regions of the influenza A virus NS segment for its efficient incorporation into virions. J Virol 79:3766-74.

49. Fynan, E. F., R. G. Webster, D. H. Fuller, J. R. Haynes, J. C. Santoro, and H. L. Robinson. 1993. DNA vaccines: protective immunizations by parenteral, mucosal, and gene-gun inoculations. Proc Natl Acad Sci U S A 90:11478-82.

50. Galarza, J. M., T. Latham, and A. Cupo. 2005. Virus-like particle (VLP) vaccine conferred complete protection against a lethal influenza virus challenge. Viral Immunol 18:244-51.

51. Gamblin, S. J., L. F. Haire, R. J. Russell, D. J. Stevens, B. Xiao, Y. Ha, N. Vasisht, D. A. Steinhauer, R. S. Daniels, A. Elliot, D. C. Wiley, and J. J. Skehel. 2004. The structure and receptor binding properties of the 1918 influenza hemagglutinin. Science 303:1838-42.

52. Gao, W., A. C. Soloff, X. Lu, A. Montecalvo, D. C. Nguyen, Y. Matsuoka, P. D. Robbins, D. E. Swayne, R. O. Donis, J. M. Katz, S. M. Barratt-Boyes, and A. Gambotto. 2006. Protection of mice and poultry from lethal H5N1 avian influenza virus through adenovirus-based immunization. J Virol 80:1959-64.

53. Garcia-Sastre, A., A. Egorov, D. Matassov, S. Brandt, D. E. Levy, J. E. Durbin, P. Palese, and T. Muster. 1998. Influenza A virus lacking the NS1 gene replicates in interferon-deficient systems. Virology 252:324-30.

54. Ge, J., G. Deng, Z. Wen, G. Tian, Y. Wang, J. Shi, X. Wang, Y. Li, S. Hu, Y. Jiang, C. Yang, K. Yu, Z. Bu, and H. Chen. 2007. Newcastle disease virus-based live attenuated vaccine completely protects chickens and mice from lethal challenge of homologous and heterologous H5N1 avian influenza viruses. J Virol 81:150-8.

55. Gomez-Puertas, P., C. Albo, E. Perez-Pastrana, A. Vivo, and A. Portela. 2000. Influenza virus matrix protein is the major driving force in virus budding. J Virol 74:11538-47.

56. Gomez-Puertas, P., I. Mena, M. Castillo, A. Vivo, E. Perez-Pastrana, and A. Portela. 1999. Efficient formation of influenza virus-like particles: dependence on the expression levels of viral proteins. J Gen Virol 80 ( Pt 7):1635-45.

57. Graham, F. L., J. Smiley, W. C. Russell, and R. Nairn. 1977. Characteristics of a human cell line transformed by DNA from human adenovirus type 5. J Gen Virol 36:59-74.

37 58. Hagen, M., T. D. Chung, J. A. Butcher, and M. Krystal. 1994. Recombinant influenza virus polymerase: requirement of both 5' and 3' viral ends for endonuclease activity. J Virol 68:1509-15.

59. Hale, B. G., W. S. Barclay, R. E. Randall, and R. J. Russell. 2008. Structure of an avian influenza A virus NS1 protein effector domain. Virology 378:1-5.

60. Halvorson, D. A. 2002. The control of H5 or H7 mildly pathogenic avian influenza: a role for inactivated vaccine. Avian Pathol 31:5-12.

61. Halvorson, D. A. 1998. The strengths and weaknesses of vaccines as a control tool., p. 223-227, In: Proceedings of the Fourth International Symposium on Avian Influenza. U.S. Animal Health Association, Athens, Georgia.

62. Hatta, M., P. Gao, P. Halfmann, and Y. Kawaoka. 2001. Molecular basis for high virulence of Hong Kong H5N1 influenza A viruses. Science 293:1840-2.

63. Herlocher, M. L., H. F. Maassab, and R. G. Webster. 1993. Molecular and biological changes in the cold-adapted "master strain" A/AA/6/60 (H2N2) influenza virus. Proc Natl Acad Sci U S A 90:6032-6.

64. Hinshaw, V. S., R. G. Webster, W. J. Bean, and G. Sriram. 1980. The ecology of influenza viruses in ducks and analysis of influenza viruses with monoclonal antibodies. Comp Immunol Microbiol Infect Dis 3:155-64.

65. Hinshaw, V. S., R. G. Webster, C. W. Naeve, and B. R. Murphy. 1983. Altered tissue tropism of human-avian reassortant influenza viruses. Virology 128:260-3.

66. Hoelscher, M. A., S. Garg, D. S. Bangari, J. A. Belser, X. Lu, I. Stephenson, R. A. Bright, J. M. Katz, S. K. Mittal, and S. Sambhara. 2006. Development of adenoviral-vector-based pandemic influenza vaccine against antigenically distinct human H5N1 strains in mice. Lancet 367:475-81.

67. Horimoto, T., K. Nakayama, S. P. Smeekens, and Y. Kawaoka. 1994. Proprotein-processing endoproteases PC6 and furin both activate hemagglutinin of virulent avian influenza viruses. J Virol 68:6074-8.

68. Hsu, M. T., J. D. Parvin, S. Gupta, M. Krystal, and P. Palese. 1987. Genomic RNAs of influenza viruses are held in a circular conformation in virions and in infected cells by a terminal panhandle. Proc Natl Acad Sci U S A 84:8140-4.

69. Huang, Z., S. Elankumaran, A. S. Yunus, and S. K. Samal. 2004. A recombinant Newcastle disease virus (NDV) expressing VP2 protein of infectious bursal disease virus (IBDV) protects against NDV and IBDV. J Virol 78:10054-63.

70. Ito, T., O. T. Gorman, Y. Kawaoka, W. J. Bean, and R. G. Webster. 1991. Evolutionary analysis of the influenza A virus M gene with comparison of the M1 and M2 proteins. J Virol 65:5491-8.

38 71. Iwatsuki-Horimoto, K., T. Horimoto, T. Noda, M. Kiso, J. Maeda, S. Watanabe, Y. Muramoto, K. Fujii, and Y. Kawaoka. 2006. The cytoplasmic tail of the influenza A virus M2 protein plays a role in viral assembly. J Virol 80:5233- 40.

72. Jia, N., S. J. de Vlas, Y. X. Liu, J. S. Zhang, L. Zhan, R. L. Dang, Y. H. Ma, X. J. Wang, T. Liu, G. P. Yang, Q. L. Wen, J. H. Richardus, S. Lu, and W. C. Cao. 2009. Serological reports of human infections of H7 and H9 avian influenza viruses in northern China. J Clin Virol 44:225-9.

73. Jiang, Y., K. Yu, H. Zhang, P. Zhang, C. Li, G. Tian, Y. Li, X. Wang, J. Ge, Z. Bu, and H. Chen. 2007. Enhanced protective efficacy of H5 subtype avian influenza DNA vaccine with codon optimized HA gene in a pCAGGS plasmid vector. Antiviral Res 75:234-41.

74. Jin, H., B. Lu, H. Zhou, C. Ma, J. Zhao, C. F. Yang, G. Kemble, and H. Greenberg. 2003. Multiple amino acid residues confer temperature sensitivity to human influenza virus vaccine strains (FluMist) derived from cold-adapted A/Ann Arbor/6/60. Virology 306:18-24.

75. Jin, H., H. Zhou, B. Lu, and G. Kemble. 2004. Imparting temperature sensitivity and attenuation in ferrets to A/Puerto Rico/8/34 influenza virus by transferring the genetic signature for temperature sensitivity from cold-adapted A/Ann Arbor/6/60. J Virol 78:995-8.

76. Johansson, B. E. 1999. Immunization with influenza A virus hemagglutinin and neuraminidase produced in recombinant baculovirus results in a balanced and broadened immune response superior to conventional vaccine. Vaccine 17:2073-80.

77. Johnson, D. C., G. Ghosh-Choudhury, J. R. Smiley, L. Fallis, and F. L. Graham. 1988. Abundant expression of herpes simplex virus glycoprotein gB using an adenovirus vector. Virology 164:1-14.

78. Joseph, T., J. McAuliffe, B. Lu, L. Vogel, D. Swayne, H. Jin, G. Kemble, and K. Subbarao. 2008. A live attenuated cold-adapted influenza A H7N3 virus vaccine provides protection against homologous and heterologous H7 viruses in mice and ferrets. Virology 378:123-32.

79. Kahn, J. S., A. Roberts, C. Weibel, L. Buonocore, and J. K. Rose. 2001. Replication-competent or attenuated, nonpropagating vesicular stomatitis viruses expressing respiratory syncytial virus (RSV) antigens protect mice against RSV challenge. J Virol 75:11079-87.

80. Kalhoro, N. H., J. Veits, S. Rautenschlein, and G. Zimmer. 2009. A recombinant vesicular stomatitis virus replicon vaccine protects chickens from highly pathogenic avian influenza virus (H7N1). Vaccine 27:1174-83.

39 81. Kang, S. M., J. M. Song, F. S. Quan, and R. W. Compans. 2009. Influenza vaccines based on virus-like particles. Virus Res.

82. Kawaoka, Y., S. Krauss, and R. G. Webster. 1989. Avian-to-human transmission of the PB1 gene of influenza A viruses in the 1957 and 1968 pandemics. J Virol 63:4603-8.

83. Kendal, A. P. 1997. Cold-adapted live attenuated influenza vaccines developed in Russia: can they contribute to meeting the needs for influenza control in other countries? Eur J Epidemiol 13:591-609.

84. Kida, H., T. Ito, J. Yasuda, Y. Shimizu, C. Itakura, K. F. Shortridge, Y. Kawaoka, and R. G. Webster. 1994. Potential for transmission of avian influenza viruses to pigs. J Gen Virol 75 ( Pt 9):2183-8.

85. Kida, H., R. G. Webster, and R. Yanagawa. 1983. Inhibition of virus-induced hemolysis with monoclonal antibodies to different antigenic areas on the hemagglutinin molecule of A/seal/Massachusetts/1/80 (H7N7) influenza virus. Arch Virol 76:91-9.

86. Kim, H. J., E. Fodor, G. G. Brownlee, and B. L. Seong. 1997. Mutational analysis of the RNA-fork model of the influenza A virus vRNA promoter in vivo. J Gen Virol 78 ( Pt 2):353-7.

87. Klenk, H. D., R. Rott, M. Orlich, and J. Blodorn. 1975. Activation of influenza A viruses by trypsin treatment. Virology 68:426-39.

88. Kochs, G., A. Garcia-Sastre, and L. Martinez-Sobrido. 2007. Multiple anti- interferon actions of the influenza A virus NS1 protein. J Virol 81:7011-21.

89. Kodihalli, S., J. R. Haynes, H. L. Robinson, and R. G. Webster. 1997. Cross- protection among lethal H5N2 influenza viruses induced by DNA vaccine to the hemagglutinin. J Virol 71:3391-6.

90. Kreijtz, J. H., Y. Suezer, G. de Mutsert, J. M. van den Brand, G. van Amerongen, B. S. Schnierle, T. Kuiken, R. A. Fouchier, J. Lower, A. D. Osterhaus, G. Sutter, and G. F. Rimmelzwaan. 2009. Recombinant modified vaccinia virus Ankara expressing the hemagglutinin gene confers protection against homologous and heterologous H5N1 influenza virus infections in macaques. J Infect Dis 199:405-13.

91. Kreijtz, J. H., Y. Suezer, G. van Amerongen, G. de Mutsert, B. S. Schnierle, J. M. Wood, T. Kuiken, R. A. Fouchier, J. Lower, A. D. Osterhaus, G. Sutter, and G. F. Rimmelzwaan. 2007. Recombinant modified vaccinia virus Ankara- based vaccine induces protective immunity in mice against infection with influenza virus H5N1. J Infect Dis 195:1598-606.

40 92. Kretzschmar, E., L. Buonocore, M. J. Schnell, and J. K. Rose. 1997. High- efficiency incorporation of functional influenza virus glycoproteins into recombinant vesicular stomatitis viruses. J Virol 71:5982-9.

93. Lamb, R. A., P. W. Choppin, R. M. Chanock, and C. J. Lai. 1980. Mapping of the two overlapping genes for polypeptides NS1 and NS2 on RNA segment 8 of influenza virus genome. Proc Natl Acad Sci U S A 77:1857-61.

94. Lamb, R. A., Krug, R.M. 2001. Orthomyxoviridae: the viruses and their replication, p. 1487–1531. In D. M. Knipe, Howley, P.M. (ed.), Fields Virology, vol. fourth ed. Lippinncott Williams & Wilkins, Philadelphia, PA.

95. Lamb, R. A., S. L. Zebedee, and C. D. Richardson. 1985. Influenza virus M2 protein is an integral membrane protein expressed on the infected-cell surface. Cell 40:627-33.

96. Larsen, D. L., N. Dybdahl-Sissoko, M. W. McGregor, R. Drape, V. Neumann, W. F. Swain, D. P. Lunn, and C. W. Olsen. 1998. Coadministration of DNA encoding interleukin-6 and hemagglutinin confers protection from influenza virus challenge in mice. J Virol 72:1704-8.

97. Larsen, D. L., and C. W. Olsen. 2002. Effects of DNA dose, route of vaccination, and coadministration of porcine interleukin-6 DNA on results of DNA vaccination against influenza virus infection in pigs. Am J Vet Res 63:653-9.

98. Latham, T., and J. M. Galarza. 2001. Formation of wild-type and chimeric influenza virus-like particles following simultaneous expression of only four structural proteins. J Virol 75:6154-65.

99. Lazarowitz, S. G., and P. W. Choppin. 1975. Enhancement of the infectivity of influenza A and B viruses by proteolytic cleavage of the hemagglutinin polypeptide. Virology 68:440-54.

100. Leahy, M. B., D. C. Pritlove, L. L. Poon, and G. G. Brownlee. 2001. Mutagenic analysis of the 5' arm of the influenza A virus virion RNA promoter defines the sequence requirements for endonuclease activity. J Virol 75:134-42.

101. Lee, C. W., D. A. Senne, and D. L. Suarez. 2006. Development and application of reference antisera against 15 hemagglutinin subtypes of influenza virus by DNA vaccination of chickens. Clin Vaccine Immunol 13:395-402.

102. Lee, J. S., H. S. Kim, and S. H. Seo. 2008. Genetic characterization and protective immunity of cold-adapted attenuated avian H9N2 influenza vaccine. Vaccine 26:6569-76.

103. Lee, K. H., and B. L. Seong. 1998. The position 4 nucleotide at the 3' end of the influenza virus neuraminidase vRNA is involved in temporal regulation of

41 transcription and replication of neuraminidase RNAs and affects the repertoire of influenza virus surface antigens. J Gen Virol 79 ( Pt 8):1923-34.

104. Lee, M. K., S. H. Bae, C. J. Park, H. K. Cheong, C. Cheong, and B. S. Choi. 2003. A single-nucleotide natural variation (U4 to C4) in an influenza A virus promoter exhibits a large structural change: implications for differential viral RNA synthesis by RNA-dependent RNA polymerase. Nucleic Acids Res 31:1216-23.

105. Li, M. L., P. Rao, and R. M. Krug. 2001. The active sites of the influenza cap- dependent endonuclease are on different polymerase subunits. Embo J 20:2078-86.

106. Li, S., C. Liu, A. Klimov, K. Subbarao, M. L. Perdue, D. Mo, Y. Ji, L. Woods, S. Hietala, and M. Bryant. 1999. Recombinant influenza A virus vaccines for the pathogenic human A/Hong Kong/97 (H5N1) viruses. J Infect Dis 179:1132-8.

107. Li, X., and P. Palese. 1992. Mutational analysis of the promoter required for influenza virus virion RNA synthesis. J Virol 66:4331-8.

108. Lin, Y. J., M. C. Deng, S. H. Wu, Y. L. Chen, H. C. Cheng, C. Y. Chang, M. S. Lee, M. S. Chien, and C. C. Huang. 2008. Baculovirus-derived hemagglutinin vaccine protects chickens from lethal homologous virus H5N1 challenge. J Vet Med Sci 70:1147-52.

109. Lipatov, A. S., S. Andreansky, R. J. Webby, D. J. Hulse, J. E. Rehg, S. Krauss, D. R. Perez, P. C. Doherty, R. G. Webster, and M. Y. Sangster. 2005. Pathogenesis of Hong Kong H5N1 influenza virus NS gene reassortants in mice: the role of cytokines and B- and T-cell responses. J Gen Virol 86:1121-30.

110. Liu, T., and Z. Ye. 2005. Attenuating mutations of the matrix gene of influenza A/WSN/33 virus. J Virol 79:1918-23.

111. Long, J. X., D. X. Peng, Y. L. Liu, Y. T. Wu, and X. F. Liu. 2008. Virulence of H5N1 avian influenza virus enhanced by a 15-nucleotide deletion in the viral nonstructural gene. Virus Genes 36:471-8.

112. Lu, Y., X. Y. Qian, and R. M. Krug. 1994. The influenza virus NS1 protein: a novel inhibitor of pre-mRNA splicing. Genes Dev 8:1817-28.

113. Lubeck, M. D., R. J. Natuk, M. Chengalvala, P. K. Chanda, K. K. Murthy, S. Murthy, S. Mizutani, S. G. Lee, M. S. Wade, B. M. Bhat, and et al. 1994. Immunogenicity of recombinant adenovirus-human immunodeficiency virus vaccines in chimpanzees following intranasal administration. AIDS Res Hum Retroviruses 10:1443-9.

114. Luo, G., M. Bergmann, A. Garcia-Sastre, and P. Palese. 1992. Mechanism of attenuation of a chimeric influenza A/B transfectant virus. J Virol 66:4679-85.

42 115. Luo, G., J. Chung, and P. Palese. 1993. Alterations of the stalk of the influenza virus neuraminidase: deletions and insertions. Virus Res 29:141-53.

116. Luo, G. X., W. Luytjes, M. Enami, and P. Palese. 1991. The polyadenylation signal of influenza virus RNA involves a stretch of uridines followed by the RNA duplex of the panhandle structure. J Virol 65:2861-7.

117. Lupiani, B., and S. M. Reddy. 2009. The history of avian influenza. Comp Immunol Microbiol Infect Dis 32:311-23.

118. Luschow, D., O. Werner, T. C. Mettenleiter, and W. Fuchs. 2001. Protection of chickens from lethal avian influenza A virus infection by live-virus vaccination with infectious laryngotracheitis virus recombinants expressing the hemagglutinin (H5) gene. Vaccine 19:4249-59.

119. Maassab, H. F., and D. C. DeBorde. 1985. Development and characterization of cold-adapted viruses for use as live virus vaccines. Vaccine 3:355-69.

120. Mahmood, K., R. A. Bright, N. Mytle, D. M. Carter, C. J. Crevar, J. E. Achenbach, P. M. Heaton, T. M. Tumpey, and T. M. Ross. 2008. H5N1 VLP vaccine induced protection in ferrets against lethal challenge with highly pathogenic H5N1 influenza viruses. Vaccine 26:5393-9.

121. Matassov, D., A. Cupo, and J. M. Galarza. 2007. A novel intranasal virus-like particle (VLP) vaccine designed to protect against the pandemic 1918 influenza A virus (H1N1). Viral Immunol 20:441-52.

122. Matrosovich, M., A. Tuzikov, N. Bovin, A. Gambaryan, A. Klimov, M. R. Castrucci, I. Donatelli, and Y. Kawaoka. 2000. Early alterations of the receptor- binding properties of H1, H2, and H3 avian influenza virus hemagglutinins after their introduction into mammals. J Virol 74:8502-12.

123. Matrosovich, M., N. Zhou, Y. Kawaoka, and R. Webster. 1999. The surface glycoproteins of H5 influenza viruses isolated from humans, chickens, and wild aquatic birds have distinguishable properties. J Virol 73:1146-55.

124. Mayr, A., and K. Danner. 1978. Vaccination against pox diseases under immunosuppressive conditions. Dev Biol Stand 41:225-34.

125. Mayrhofer, J., S. Coulibaly, A. Hessel, G. W. Holzer, M. Schwendinger, P. Bruhl, M. Gerencer, B. A. Crowe, S. Shuo, W. Hong, Y. J. Tan, B. Dietrich, N. Sabarth, H. Savidis-Dacho, O. Kistner, P. N. Barrett, and F. G. Falkner. 2009. Nonreplicating vaccinia virus vectors expressing the H5 influenza virus hemagglutinin produced in modified Vero cells induce robust protection. J Virol 83:5192-203.

43 126. McCown, M. F., and A. Pekosz. 2006. Distinct domains of the influenza a virus M2 protein cytoplasmic tail mediate binding to the M1 protein and facilitate infectious virus production. J Virol 80:8178-89.

127. McCown, M. F., and A. Pekosz. 2005. The influenza A virus M2 cytoplasmic tail is required for infectious virus production and efficient genome packaging. J Virol 79:3595-605.

128. McGeoch, D., P. Fellner, and C. Newton. 1976. Influenza virus genome consists of eight distinct RNA species. Proc Natl Acad Sci U S A 73:3045-9.

129. Mills, J., V. Chanock, and R. M. Chanock. 1971. Temperature-sensitive mutants of influenza virus. I. Behavior in tissue culture and in experimental animals. J Infect Dis 123:145-57.

130. Min, J. Y., and R. M. Krug. 2006. The primary function of RNA binding by the influenza A virus NS1 protein in infected cells: Inhibiting the 2'-5' oligo (A) synthetase/RNase L pathway. Proc Natl Acad Sci U S A 103:7100-5.

131. Mounier-Jack, S., R. Jas, and R. Coker. 2007. Progress and shortcomings in European national strategic plans for pandemic influenza. Bull World Health Organ 85:923-9.

132. Mounts, A. W., H. Kwong, H. S. Izurieta, Y. Ho, T. Au, M. Lee, C. Buxton Bridges, S. W. Williams, K. H. Mak, J. M. Katz, W. W. Thompson, N. J. Cox, and K. Fukuda. 1999. Case-control study of risk factors for avian influenza A (H5N1) disease, Hong Kong, 1997. J Infect Dis 180:505-8.

133. Murphy, B. R., and K. Coelingh. 2002. Principles underlying the development and use of live attenuated cold-adapted influenza A and B virus vaccines. Viral Immunol 15:295-323.

134. Muster, T., E. K. Subbarao, M. Enami, B. R. Murphy, and P. Palese. 1991. An influenza A virus containing influenza B virus 5' and 3' noncoding regions on the neuraminidase gene is attenuated in mice. Proc Natl Acad Sci U S A 88:5177-81.

135. Nakaya, T., J. Cros, M. S. Park, Y. Nakaya, H. Zheng, A. Sagrera, E. Villar, A. Garcia-Sastre, and P. Palese. 2001. Recombinant Newcastle disease virus as a vaccine vector. J Virol 75:11868-73.

136. Nemeroff, M. E., S. M. Barabino, Y. Li, W. Keller, and R. M. Krug. 1998. Influenza virus NS1 protein interacts with the cellular 30 kDa subunit of CPSF and inhibits 3'end formation of cellular pre-mRNAs. Mol Cell 1:991-1000.

137. Neumann, G., T. Watanabe, and Y. Kawaoka. 2000. Plasmid-driven formation of influenza virus-like particles. J Virol 74:547-51.

44 138. Neumann, G., M. A. Whitt, and Y. Kawaoka. 2002. A decade after the generation of a negative-sense RNA virus from cloned cDNA - what have we learned? J Gen Virol 83:2635-62.

139. Noton, S. L., M. Simpson-Holley, E. Medcalf, H. M. Wise, E. C. Hutchinson, J. W. McCauley, and P. Digard. 2009. Studies of an influenza A virus temperature- sensitive mutant identify a late role for NP in the formation of infectious virions. J Virol 83:562-71.

140. O'Neill, R. E., R. Jaskunas, G. Blobel, P. Palese, and J. Moroianu. 1995. Nuclear import of influenza virus RNA can be mediated by viral nucleoprotein and transport factors required for protein import. J Biol Chem 270:22701-4.

141. O'Neill, R. E., J. Talon, and P. Palese. 1998. The influenza virus NEP (NS2 protein) mediates the nuclear export of viral ribonucleoproteins. Embo J 17:288-96.

142. Olitsky, A. B. S. a. P. K. 1938. Influence of host factors on neuroinvasiveness of vesicular stomatitis virus. J. Exp. Med. 67:201-227.

143. Olsen, C. W., M. W. McGregor, N. Dybdahl-Sissoko, B. R. Schram, K. M. Nelson, D. P. Lunn, M. D. Macklin, W. F. Swain, and V. S. Hinshaw. 1997. Immunogenicity and efficacy of baculovirus-expressed and DNA-based equine influenza virus hemagglutinin vaccines in mice. Vaccine 15:1149-56.

144. Operschall, E., J. Pavlovic, M. Nawrath, and K. Molling. 2000. Mechanism of protection against influenza A virus by DNA vaccine encoding the hemagglutinin gene. Intervirology 43:322-30.

145. Palese, P., K. Tobita, M. Ueda, and R. W. Compans. 1974. Characterization of temperature sensitive influenza virus mutants defective in neuraminidase. Virology 61:397-410.

146. Pappas, C., P. V. Aguilar, C. F. Basler, A. Solorzano, H. Zeng, L. A. Perrone, P. Palese, A. Garcia-Sastre, J. M. Katz, and T. M. Tumpey. 2008. Single gene reassortants identify a critical role for PB1, HA, and NA in the high virulence of the 1918 pandemic influenza virus. Proc Natl Acad Sci U S A 105:3064-9.

147. Park, M. S., J. Steel, A. Garcia-Sastre, D. Swayne, and P. Palese. 2006. Engineered viral vaccine constructs with dual specificity: avian influenza and Newcastle disease. Proc Natl Acad Sci U S A 103:8203-8.

148. Pavlova, S. P., J. Veits, G. M. Keil, T. C. Mettenleiter, and W. Fuchs. 2009. Protection of chickens against H5N1 highly pathogenic avian influenza virus infection by live vaccination with infectious laryngotracheitis virus recombinants expressing H5 hemagglutinin and N1 neuraminidase. Vaccine 27:773-85.

45 149. Peeters, B. P., Y. K. Gruijthuijsen, O. S. de Leeuw, and A. L. Gielkens. 2000. Genome replication of Newcastle disease virus: involvement of the rule-of-six. Arch Virol 145:1829-45.

150. Pinto, L. H., L. J. Holsinger, and R. A. Lamb. 1992. Influenza virus M2 protein has ion channel activity. Cell 69:517-28.

151. Plotch, S. J., M. Bouloy, I. Ulmanen, and R. M. Krug. 1981. A unique cap(m7GpppXm)-dependent influenza virion endonuclease cleaves capped RNAs to generate the primers that initiate viral RNA transcription. Cell 23:847-58.

152. Pons, M. W., I. T. Schulze, G. K. Hirst, and R. Hauser. 1969. Isolation and characterization of the ribonucleoprotein of influenza virus. Virology 39:250-9.

153. Price, R. J. 1982. Avian influenza in the United States (1964-1980), p. 178-179, In: Porceedings of the First International Symposium on Avian influenza. Carter Composition corporation, Richmond, USA.

154. Pritlove, D. C., L. L. Poon, L. J. Devenish, M. B. Leahy, and G. G. Brownlee. 1999. A hairpin loop at the 5' end of influenza A virus virion RNA is required for synthesis of poly(A)+ mRNA in vitro. J Virol 73:2109-14.

155. Pushko, P., T. M. Tumpey, F. Bu, J. Knell, R. Robinson, and G. Smith. 2005. Influenza virus-like particles comprised of the HA, NA, and M1 proteins of H9N2 influenza virus induce protective immune responses in BALB/c mice. Vaccine 23:5751-9.

156. Qiao, C. L., K. Z. Yu, Y. P. Jiang, Y. Q. Jia, G. B. Tian, M. Liu, G. H. Deng, X. R. Wang, Q. W. Meng, and X. Y. Tang. 2003. Protection of chickens against highly lethal H5N1 and H7N1 avian influenza viruses with a recombinant fowlpox virus co-expressing H5 haemagglutinin and N1 neuraminidase genes. Avian Pathol 32:25-32.

157. Qiu, Y., and R. M. Krug. 1994. The influenza virus NS1 protein is a poly(A)- binding protein that inhibits nuclear export of mRNAs containing poly(A). J Virol 68:2425-32.

158. Quan, F. S., C. Huang, R. W. Compans, and S. M. Kang. 2007. Virus-like particle vaccine induces protective immunity against homologous and heterologous strains of influenza virus. J Virol 81:3514-24.

159. Quan, F. S., D. Steinhauer, C. Huang, T. M. Ross, R. W. Compans, and S. M. Kang. 2008. A bivalent influenza VLP vaccine confers complete inhibition of virus replication in lungs. Vaccine 26:3352-61.

160. Quinlivan, M., D. Zamarin, A. Garcia-Sastre, A. Cullinane, T. Chambers, and P. Palese. 2005. Attenuation of equine influenza viruses through truncations of the NS1 protein. J Virol 79:8431-9.

46 161. Richardson, J. C., and R. K. Akkina. 1991. NS2 protein of influenza virus is found in purified virus and phosphorylated in infected cells. Arch Virol 116:69-80.

162. Richt, J. A., P. Lekcharoensuk, K. M. Lager, A. L. Vincent, C. M. Loiacono, B. H. Janke, W. H. Wu, K. J. Yoon, R. J. Webby, A. Solorzano, and A. Garcia- Sastre. 2006. Vaccination of pigs against swine influenza viruses by using an NS1- truncated modified live-virus vaccine. J Virol 80:11009-18.

163. Roberts, A., L. Buonocore, R. Price, J. Forman, and J. K. Rose. 1999. Attenuated vesicular stomatitis viruses as vaccine vectors. J Virol 73:3723-32.

164. Roberts, A., E. Kretzschmar, A. S. Perkins, J. Forman, R. Price, L. Buonocore, Y. Kawaoka, and J. K. Rose. 1998. Vaccination with a recombinant vesicular stomatitis virus expressing an influenza virus hemagglutinin provides complete protection from influenza virus challenge. J Virol 72:4704-11.

165. Robinson, H. L., L. A. Hunt, and R. G. Webster. 1993. Protection against a lethal influenza virus challenge by immunization with a haemagglutinin-expressing plasmid DNA. Vaccine 11:957-60.

166. Roche, B., C. Lebarbenchon, M. Gauthier-Clerc, C. M. Chang, F. Thomas, F. Renaud, S. van der Werf, and J. F. Guegan. 2009. Water-borne transmission drives avian influenza dynamics in wild birds: The case of the 2005-2006 epidemics in the Camargue area. Infect Genet Evol.

167. Rogers, G. N., and J. C. Paulson. 1983. Receptor determinants of human and animal influenza virus isolates: differences in receptor specificity of the H3 hemagglutinin based on species of origin. Virology 127:361-73.

168. Rohm, C., N. Zhou, J. Suss, J. Mackenzie, and R. G. Webster. 1996. Characterization of a novel influenza hemagglutinin, H15: criteria for determination of influenza A subtypes. Virology 217:508-16.

169. Romer-Oberdorfer, A., J. Veits, D. Helferich, and T. C. Mettenleiter. 2008. Level of protection of chickens against highly pathogenic H5 avian influenza virus with Newcastle disease virus based live attenuated vector vaccine depends on homology of H5 sequence between vaccine and challenge virus. Vaccine 26:2307- 13.

170. Roush, S. W., and T. V. Murphy. 2007. Historical comparisons of morbidity and mortality for vaccine-preventable diseases in the United States. JAMA 298:2155- 63.

171. Ruigrok, R. W., A. Barge, P. Durrer, J. Brunner, K. Ma, and G. R. Whittaker. 2000. Membrane interaction of influenza virus M1 protein. Virology 267:289-98.

47 172. Sailaja, G., I. Skountzou, F. S. Quan, R. W. Compans, and S. M. Kang. 2007. Human immunodeficiency virus-like particles activate multiple types of immune cells. Virology 362:331-41.

173. Sakaguchi, T., G. P. Leser, and R. A. Lamb. 1996. The ion channel activity of the influenza virus M2 protein affects transport through the Golgi apparatus. J Cell Biol 133:733-47.

174. Sanz-Ezquerro, J. J., S. de la Luna, J. Ortin, and A. Nieto. 1995. Individual expression of influenza virus PA protein induces degradation of coexpressed proteins. J Virol 69:2420-6.

175. Schafer, J. R., Y. Kawaoka, W. J. Bean, J. Suss, D. Senne, and R. G. Webster. 1993. Origin of the pandemic 1957 H2 influenza A virus and the persistence of its possible progenitors in the avian reservoir. Virology 194:781-8.

176. Schmidt, M., and D. R. Hoffman. 2002. Expression systems for production of recombinant allergens. Int Arch Allergy Immunol 128:264-70.

177. Schwartz, J. A., L. Buonocore, A. Roberts, A. Suguitan, Jr., D. Kobasa, G. Kobinger, H. Feldmann, K. Subbarao, and J. K. Rose. 2007. Vesicular stomatitis virus vectors expressing avian influenza H5 HA induce cross-neutralizing antibodies and long-term protection. Virology 366:166-73.

178. Seo, S. H., E. Hoffmann, and R. G. Webster. 2002. Lethal H5N1 influenza viruses escape host anti-viral cytokine responses. Nat Med 8:950-4.

179. Shen, S., G. Mahadevappa, H. L. Oh, B. Y. Wee, Y. W. Choi, L. A. Hwang, S. G. Lim, W. Hong, S. K. Lal, and Y. J. Tan. 2008. Comparing the antibody responses against recombinant hemagglutinin proteins of avian influenza A (H5N1) virus expressed in insect cells and bacteria. J Med Virol 80:1972-83.

180. Shi, H., X. F. Liu, X. Zhang, S. Chen, L. Sun, and J. Lu. 2007. Generation of an attenuated H5N1 avian influenza virus vaccine with all eight genes from avian viruses. Vaccine 25:7379-84.

181. Shi, L., D. F. Summers, Q. Peng, and J. M. Galarz. 1995. Influenza A virus RNA polymerase subunit PB2 is the endonuclease which cleaves host cell mRNA and functions only as the trimeric enzyme. Virology 208:38-47.

182. Shoji, Y., C. E. Farrance, H. Bi, M. Shamloul, B. Green, S. Manceva, A. Rhee, N. Ugulava, G. Roy, K. Musiychuk, J. A. Chichester, V. Mett, and V. Yusibov. 2009. Immunogenicity of hemagglutinin from A/Bar-headed Goose/Qinghai/1A/05 and A/Anhui/1/05 strains of H5N1 influenza viruses produced in Nicotiana benthamiana plants. Vaccine 27:3467-70.

48 183. Singh, N., A. Pandey, L. Jayashankar, and S. K. Mittal. 2008. Bovine adenoviral vector-based H5N1 influenza vaccine overcomes exceptionally high levels of pre-existing immunity against human adenovirus. Mol Ther 16:965-71.

184. Smeenk, C. A., and E. G. Brown. 1994. The influenza virus variant A/FM/1/47- MA possesses single amino acid replacements in the hemagglutinin, controlling virulence, and in the matrix protein, controlling virulence as well as growth. J Virol 68:530-4.

185. Solorzano, A., R. J. Webby, K. M. Lager, B. H. Janke, A. Garcia-Sastre, and J. A. Richt. 2005. Mutations in the NS1 protein of swine influenza virus impair anti- interferon activity and confer attenuation in pigs. J Virol 79:7535-43.

186. Solorzano, A., H. Zheng, E. Fodor, G. G. Brownlee, P. Palese, and A. Garcia- Sastre. 2000. Reduced levels of neuraminidase of influenza A viruses correlate with attenuated phenotypes in mice. J Gen Virol 81:737-42.

187. Song, H., G. R. Nieto, and D. R. Perez. 2007. A new generation of modified live- attenuated avian influenza viruses using a two-strategy combination as potential vaccine candidates. J Virol 81:9238-48.

188. Staudt, L. M., and W. Gerhard. 1983. Generation of antibody diversity in the immune response of BALB/c mice to influenza virus hemagglutinin. I. Significant variation in repertoire expression between individual mice. J Exp Med 157:687- 704.

189. Stech, J. 2008. Attenuated influenza A viruses with modified cleavage sites in hemagglutinin as live vaccines. Expert Rev Vaccines 7:739-43.

190. Steel, J., A. C. Lowen, L. Pena, M. Angel, A. Solorzano, R. Albrecht, D. R. Perez, A. Garcia-Sastre, and P. Palese. 2009. Live attenuated influenza viruses containing NS1 truncations as vaccine candidates against H5N1 highly pathogenic avian influenza. J Virol 83:1742-53.

191. Stone, H. D. 1987. Efficacy of avian influenza oil-emulsion vaccines in chickens of various ages. Avian Dis 31:483-90.

192. Suarez, D. L., and S. Schultz-Cherry. 2000. The effect of eukaryotic expression vectors and adjuvants on DNA vaccines in chickens using an avian influenza model. Avian Dis 44:861-8.

193. Subbarao, K., H. Chen, D. Swayne, L. Mingay, E. Fodor, G. Brownlee, X. Xu, X. Lu, J. Katz, N. Cox, and Y. Matsuoka. 2003. Evaluation of a genetically modified reassortant H5N1 influenza A virus vaccine candidate generated by plasmid-based reverse genetics. Virology 305:192-200.

194. Subbarao, K., A. Klimov, J. Katz, H. Regnery, W. Lim, H. Hall, M. Perdue, D. Swayne, C. Bender, J. Huang, M. Hemphill, T. Rowe, M. Shaw, X. Xu, K.

49 Fukuda, and N. Cox. 1998. Characterization of an avian influenza A (H5N1) virus isolated from a child with a fatal respiratory illness. Science 279:393-6.

195. Suguitan, A. L., Jr., J. McAuliffe, K. L. Mills, H. Jin, G. Duke, B. Lu, C. J. Luke, B. Murphy, D. E. Swayne, G. Kemble, and K. Subbarao. 2006. Live, attenuated influenza A H5N1 candidate vaccines provide broad cross-protection in mice and ferrets. PLoS Med 3:e360.

196. Swayne, D. E. 2009. Avian influenza vaccines and therapies for poultry. Comp Immunol Microbiol Infect Dis 32:351-63.

197. Swayne, D. E., J. R. Beck, and N. Kinney. 2000. Failure of a recombinant fowl poxvirus vaccine containing an avian influenza hemagglutinin gene to provide consistent protection against influenza in chickens preimmunized with a fowl pox vaccine. Avian Dis 44:132-7.

198. Swayne, D. E., M. Garcia, J. R. Beck, N. Kinney, and D. L. Suarez. 2000. Protection against diverse highly pathogenic H5 avian influenza viruses in chickens immunized with a recombinant fowlpox vaccine containing an H5 avian influenza hemagglutinin gene insert. Vaccine 18:1088-95.

199. Swayne, D. E., and D. Kapczynski. 2008. Strategies and challenges for eliciting immunity against avian influenza virus in birds. Immunol Rev 225:314-31.

200. Swayne, D. E., D. L. Suarez, S. Schultz-Cherry, T. M. Tumpey, D. J. King, T. Nakaya, P. Palese, and A. Garcia-Sastre. 2003. Recombinant paramyxovirus type 1-avian influenza-H7 virus as a vaccine for protection of chickens against influenza and Newcastle disease. Avian Dis 47:1047-50.

201. Swayne, D. E. a. D. A. H. 2003. Influenza, p. 135–160. In H. J. B. Y. M. Saif, A. M. Fadly, J. R. Glisson, L. R. McDougald, and D. E. Swayne (ed.), Diseases of poultry, 11th ed. Iowa State University Press, Ames, IA.

202. Talon, J., M. Salvatore, R. E. O'Neill, Y. Nakaya, H. Zheng, T. Muster, A. Garcia-Sastre, and P. Palese. 2000. Influenza A and B viruses expressing altered NS1 proteins: A vaccine approach. Proc Natl Acad Sci U S A 97:4309-14.

203. Taubenberger, J. K., A. H. Reid, R. M. Lourens, R. Wang, G. Jin, and T. G. Fanning. 2005. Characterization of the 1918 influenza virus polymerase genes. Nature 437:889-93.

204. Tompkins, S. M., Y. Lin, G. P. Leser, K. A. Kramer, D. L. Haas, E. W. Howerth, J. Xu, M. J. Kennett, R. K. Durbin, J. E. Durbin, R. Tripp, R. A. Lamb, and B. He. 2007. Recombinant parainfluenza virus 5 (PIV5) expressing the influenza A virus hemagglutinin provides immunity in mice to influenza A virus challenge. Virology 362:139-50.

50 205. Toro, H., D. C. Tang, D. L. Suarez, M. J. Sylte, J. Pfeiffer, and K. R. Van Kampen. 2007. Protective avian influenza in ovo vaccination with non-replicating human adenovirus vector. Vaccine 25:2886-91.

206. Treanor, J. J., G. M. Schiff, R. B. Couch, T. R. Cate, R. C. Brady, C. M. Hay, M. Wolff, D. She, and M. M. Cox. 2006. Dose-related safety and immunogenicity of a trivalent baculovirus-expressed influenza-virus hemagglutinin vaccine in elderly adults. J Infect Dis 193:1223-8.

207. Treanor, J. J., B. E. Wilkinson, F. Masseoud, J. Hu-Primmer, R. Battaglia, D. O'Brien, M. Wolff, G. Rabinovich, W. Blackwelder, and J. M. Katz. 2001. Safety and immunogenicity of a recombinant hemagglutinin vaccine for H5 influenza in humans. Vaccine 19:1732-7.

208. Ulmer, J. B., J. J. Donnelly, S. E. Parker, G. H. Rhodes, P. L. Felgner, V. J. Dwarki, S. H. Gromkowski, R. R. Deck, C. M. DeWitt, A. Friedman, and et al. 1993. Heterologous protection against influenza by injection of DNA encoding a viral protein. Science 259:1745-9.

209. Van Kampen, K. R., Z. Shi, P. Gao, J. Zhang, K. W. Foster, D. T. Chen, D. Marks, C. A. Elmets, and D. C. Tang. 2005. Safety and immunogenicity of adenovirus-vectored nasal and epicutaneous influenza vaccines in humans. Vaccine 23:1029-36.

210. Veits, J., D. Luschow, K. Kindermann, O. Werner, J. P. Teifke, T. C. Mettenleiter, and W. Fuchs. 2003. Deletion of the non-essential UL0 gene of infectious laryngotracheitis (ILT) virus leads to attenuation in chickens, and UL0 mutants expressing influenza virus haemagglutinin (H7) protect against ILT and fowl plague. J Gen Virol 84:3343-52.

211. Veits, J., D. Wiesner, W. Fuchs, B. Hoffmann, H. Granzow, E. Starick, E. Mundt, H. Schirrmeier, T. Mebatsion, T. C. Mettenleiter, and A. Romer- Oberdorfer. 2006. Newcastle disease virus expressing H5 hemagglutinin gene protects chickens against Newcastle disease and avian influenza. Proc Natl Acad Sci U S A 103:8197-202.

212. Wang, C., R. A. Lamb, and L. H. Pinto. 1994. Direct measurement of the influenza A virus M2 protein ion channel activity in mammalian cells. Virology 205:133-40.

213. Wang, W., and R. M. Krug. 1996. The RNA-binding and effector domains of the viral NS1 protein are conserved to different extents among influenza A and B viruses. Virology 223:41-50.

214. Wang, W., K. Riedel, P. Lynch, C. Y. Chien, G. T. Montelione, and R. M. Krug. 1999. RNA binding by the novel helical domain of the influenza virus NS1 protein requires its dimer structure and a small number of specific basic amino acids. RNA 5:195-205.

51 215. Watabe, S., K. Q. Xin, A. Ihata, L. J. Liu, A. Honsho, I. Aoki, K. Hamajima, B. Wahren, and K. Okuda. 2001. Protection against influenza virus challenge by topical application of influenza DNA vaccine. Vaccine 19:4434-44.

216. Watanabe, T., S. Watanabe, H. Kida, and Y. Kawaoka. 2002. Influenza A virus with defective M2 ion channel activity as a live vaccine. Virology 299:266-70.

217. Watanabe, T., S. Watanabe, J. H. Kim, M. Hatta, and Y. Kawaoka. 2008. Novel approach to the development of effective H5N1 influenza A virus vaccines: use of M2 cytoplasmic tail mutants. J Virol 82:2486-92.

218. Watanabe, T., S. Watanabe, G. Neumann, H. Kida, and Y. Kawaoka. 2002. Immunogenicity and protective efficacy of replication-incompetent influenza virus- like particles. J Virol 76:767-73.

219. Webby, R. J., D. R. Perez, J. S. Coleman, Y. Guan, J. H. Knight, E. A. Govorkova, L. R. McClain-Moss, J. S. Peiris, J. E. Rehg, E. I. Tuomanen, and R. G. Webster. 2004. Responsiveness to a pandemic alert: use of reverse genetics for rapid development of influenza vaccines. Lancet 363:1099-103.

220. Webster, R. G. 2004. Wet markets--a continuing source of severe acute respiratory syndrome and influenza? Lancet 363:234-6.

221. Webster, R. G., W. J. Bean, O. T. Gorman, T. M. Chambers, and Y. Kawaoka. 1992. Evolution and ecology of influenza A viruses. Microbiol Rev 56:152-79.

222. Webster, R. G., E. F. Fynan, J. C. Santoro, and H. Robinson. 1994. Protection of ferrets against influenza challenge with a DNA vaccine to the haemagglutinin. Vaccine 12:1495-8.

223. Webster, R. G., M. Yakhno, V. S. Hinshaw, W. J. Bean, and K. G. Murti. 1978. Intestinal influenza: replication and characterization of influenza viruses in ducks. Virology 84:268-78.

224. Wesley, R. D., M. Tang, and K. M. Lager. 2004. Protection of weaned pigs by vaccination with human adenovirus 5 recombinant viruses expressing the hemagglutinin and the nucleoprotein of H3N2 swine influenza virus. Vaccine 22:3427-34.

225. Wu, Q., L. Fang, X. Wu, B. Li, R. Luo, Z. Yu, M. Jin, H. Chen, and S. Xiao. 2009. A pseudotype baculovirus-mediated vaccine confers protective immunity against lethal challenge with H5N1 avian influenza virus in mice and chickens. Mol Immunol.

226. Yamanaka, K., N. Ogasawara, H. Yoshikawa, A. Ishihama, and K. Nagata. 1991. In vivo analysis of the promoter structure of the influenza virus RNA genome using a transfection system with an engineered RNA. Proc Natl Acad Sci U S A 88:5369-73.

52 227. Yen, H. L., J. R. Aldridge, A. C. Boon, N. A. Ilyushina, R. Salomon, D. J. Hulse-Post, H. Marjuki, J. Franks, D. A. Boltz, D. Bush, A. S. Lipatov, R. J. Webby, J. E. Rehg, and R. G. Webster. 2009. Changes in H5N1 influenza virus hemagglutinin receptor binding domain affect systemic spread. Proc Natl Acad Sci U S A 106:286-91.

228. Zhang, J., G. P. Leser, A. Pekosz, and R. A. Lamb. 2000. The cytoplasmic tails of the influenza virus spike glycoproteins are required for normal genome packaging. Virology 269:325-34.

229. Zheng, H., P. Palese, and A. Garcia-Sastre. 1996. Nonconserved nucleotides at the 3' and 5' ends of an influenza A virus RNA play an important role in viral RNA replication. Virology 217:242-51.

230. Zhu, Q., H. Yang, W. Chen, W. Cao, G. Zhong, P. Jiao, G. Deng, K. Yu, C. Yang, Z. Bu, Y. Kawaoka, and H. Chen. 2008. A naturally occurring deletion in its NS gene contributes to the attenuation of an H5N1 swine influenza virus in chickens. J Virol 82:220-8.

231. Zurcher, T., S. de la Luna, J. J. Sanz-Ezquerro, A. Nieto, and J. Ortin. 1996. Mutational analysis of the influenza virus A/Victoria/3/75 PA protein: studies of interaction with PB1 protein and identification of a dominant negative mutant. J Gen Virol 77 ( Pt 8):1745-9.

53 CHAPTER 2

CHARACTERIZATION OF INFLUENZA VIRUS VARIANTS WITH

DIFFERENT SIZES OF THE NON-STRUCTURAL (NS) GENES AND THEIR

POTENTIAL AS A LIVE INFLUENZA VACCINE IN POULTRY

2.1 ABSTRACT

From a stock of A/turkey/Oregon/71-delNS1 (H7N3) virus, which has a 10 nucleotide

deletion in the coding region of the NS1 gene, we found that several variants with

different sizes of NS genes could be produced by passaging the virus in 10- and 14-day-

old embryonating chicken eggs (ECE), but not in 7-day-old ECE or Vero cells. We were

able to rescue the reassortant virus that has different sizes of the NS genes and confirmed that those NS genes are genetically stable. By conducting in vivo studies in 2-week-old

chickens, we found two plaque purified variants which can be used as a potential live- attenuated vaccine (D-del pc3 and pc4). The variants were highly attenuated in chickens and did not transmit the virus from infected chickens to uninoculated cage mates. At the same time, the variants induced relatively high antibody titers which conferred good

protection against a high dose heterologous virus challenge. Our study indicates that

naturally selected NS1 deletion variants might be useful in the development of live

attenuated influenza vaccines in poultry. Furthermore, deletion in the NS1 protein can be

54 potentially useful as a negative marker for a DIVA (Differentiating Infected from

Vaccinated Animals) approach.

2.2 INTRODUCTION

Influenza A virus has eight RNA segments encoding at least ten proteins (25). Among

these proteins, most are structural proteins and are found in the virions. Although recently

identified PB1-F2 is a non-structural protein expressed by many influenza viruses (3), the

Nonstructural protein 1 (NS1) protein is the only known non-structural protein expressed

by all influenza viruses (14). The Nonstructural (NS) gene segment is the smallest in the influenza genome, typically 890 nucleotides (nt) in size and encodes for two different

proteins, NS1 and Nuclear export protein (NEP). The NEP coding sequence partially

overlaps the NS1 protein at the amino terminal end and the carboxy terminal end is a

result of alternative splicing of its mRNA. The NEP protein, previously known as NS2,

was thought to be a nonstructural protein, but it is present in small amounts in the virions

in association with the ribonucleoprotein (RNP) through interaction with the M1 protein

(25). In most viruses, the NS1 protein consists of 230 amino acids (aa) and the NEP

protein of 121 aa. The NS1 protein can be divided into two major domains which are the

N-terminal RNA binding domain and the remaining effector domain (15). This protein is

a multifunctional protein with regulatory effect on a variety of host cell functions

including suppression of innate immunity by preventing host cell mRNA processing (21),

blocking nuclear export of polyadenylated cellular transcripts (26, 28), and inhibiting

type I interferon (IFN) induction and/or production (5). In addition to its inhibitory role in

55 innate immunity, it was recently also shown that NS1 protein can inhibit adaptive

immunity by attenuating human dendritic cell (DC) maturation and the capacity of DCs

to induce T-cell responses (8).

Live attenuated virus vaccines have several distinct advantages over inactivated vaccines

such as triggering mucosal immune responses and inducing a cell-mediated immunity,

which may give vaccinees a more cross-protective and longer-lasting immunity (11, 20).

Furthermore, live-attenuated influenza virus vaccines can potentially be administered by

aerosol or water exposure, like Newcastle disease virus vaccines, which provides for cost

effective mass administration of the vaccine, and is a major advantage over current whole

virus adjuvanted killed vaccines which must be administered parenterally by needle

injection. Previous studies have shown that the blocking or reducing of the function of

the NS1 protein can effectively attenuate the virus, in large part because it allows the host

to generate a strong interferon response to which influenza viruses are intrinsically

sensitive. Thus, viruses producing defective NS1 proteins show highly attenuated

phenotypes both in vitro and in vivo, and might be useful as live attenuated vaccine candidate strains (27, 31, 37). It was also shown that viruses lacking the NS1 gene are potent stimulators of human DCs and therefore can be potent immunogens (8). In addition, since the NS1 protein is not incorporated into virions, alterations of this protein would not change the antigenicity of the influenza virion itself. Thus, the influenza virus

NS1 protein is an excellent target for attenuation by genetic manipulation.

A/turkey/Oregon/71 (TK/OR/71) (H7N3) virus, which is a low virulence strain isolated

from turkeys in 1971, exists as two genetically distinct stocks (34). One stock, named

TK/OR/71-SEPRL, is a low-passage stock of the field isolate that encodes a full-length

56 NS1 protein of 230 aa. The other stock, referred to a TK/OR/71-delNS1, has unknown passage history and has a 10 nt deletion in the middle of the NS gene which results in producing a truncated NS1 protein of 124 aa (23). The NEP protein open reading frames

(ORFs) are intact in both strains. TK/OR/71-delNS1 is a strong inducer of IFN with 20- fold difference compared to TK/OR/71-SEPRL (19). Clear differences in pathogenicity of these two viruses were observed in 1-day-old and 4-week-old chicken infection studies

(2). In the afore mentioned study, TK/OR/71-delNS1 was highly attenuated compared to

TK/OR/71-SEPRL and did not transmit efficiently from infected chickens to uninoculated cage mates, which showed the possibility of using the natural NS1 deletion variants, TK/OR/71-delNS1, as a potential live vaccine. However, we found that the NS gene of TK/OR/71-delNS1 was not genetically stable and variants with NS gene of different sizes and with different biological characteristics could be generated directly from this virus. This study describes the identification and characterization of these NS- deletion variants and the evaluation of individual NS variants as live influenza virus vaccine candidates.

2.3 MATERIALS AND MEHTODS

Viruses. The viruses used in this study were obtained from the repository of Southeast

Poultry Research Laboratory (SEPRL), Athens, Georgia. The passage history of the

TK/OR/71-delNS1 stock is unknown and we used the original Vero cell culture supernatant stock (originally kindly provided by Peter Palese, Mount Sinai School of

Medicine, NY) for the study. TK/OR/71-SEPRL and A/chicken/NJ/150383-7/02 (H7N2)

57 used in the challenge studies were passaged once in 10-day-old specific pathogen free

embryonating chicken eggs (ECE) to make working stocks of the virus.

TK/OR/71-delNS1 virus passage in Vero cells and 7-, 10-, and 14-day-old

embryonating eggs. The TK/OR/71-delNS1 stock was passaged 5 times in Vero cells

and ECE of different ages, respectively. Vero cells were maintained in Dulbecco’s

Modified Eagle’s Medium/Nutrient Mixture F-12 (Invitrogen, Carlsbad, CA)

supplemented with 10% fetal calf serum. The cells were seeded (approximately 106 cells/well) in six-well tissue culture plates the day before infection. The cells were infected with 1 to 1000 dilution of the virus from each passage and infectious supernatants were collected 2 days after infection. Virus propagation in the allantoic cavity of SPF ECEs was done as previously described (36).

RNA extraction and NS-gene specific RT-PCR, cloning and sequencing. Viral RNA was extracted with the RNeasy Mini kit (Qiagen, Valencia, CA) from infectious cell supernatants or allantoic fluids from ECE as previously described (33). Standard RT-PCR was carried out with the Qiagen one-step RT-PCR kit (Qiagen) with NS gene specific primers NS+1: 5’-AGCAAAAGCAGGGTGACAA- 3’ and NS-890: 5’-

AGTAGAAACAAGGGTGTT-3’. The PCR products were separated on an agarose gel by electrophoresis and amplicons were subsequently excised from the gel and extracted with Qiagen gel extraction kit (Qiagen). The purified PCR products were cloned into the

TOPO-TA vector following the manufacturer’s protocol (Invitrogen). Sequencing was performed with a 3730 automated sequencer (Perkin-Elmer, Waltham, MA) or ABI

PRISM 377 DNA sequencer at the SEPRL sequencing facility or Molecular and Cellular

Imaging Center at The Ohio State University.

58 Rescue of recombinant influenza viruses with NS genes of different sizes. Wild type and mutant NS genes were cloned into pHH21 vector between the promoter and terminator sequences of RNA polymerase I (17, 22). Plasmids expressing the remaining 7 influenza virus genes from influenza A/WSN/33 virus were kindly provided by Yoshihiro

Kawaoka, University of Wisconsin, WI. Other plasmids used in recombinant influenza virus rescue were described in our previous studies (16, 18). Recombinant viruses were generated by DNA transfection as previously described with minor modification (9, 22).

Briefly, 293T cells were transfected with 1 ug of each of the eight viral RNA genes expressing plasmids and four expression plasmids for the influenza virus proteins NP PA,

PB1, and PB2 with the use of Lipofectamine 2000 reagent (Invitrogen). Forty-eight hours after the transfection, the supernatants were collected and subsequently inoculated into

10-day-old ECE for virus propagation. At 72 hours post inoculation, allantoic fluids containing recombinant viruses were harvested and stored at – 70 °C for additional experiments. The identity of the NS gene was confirmed by sequencing.

Cloning of the influenza virus variants by plaque assay. To biologically purify influenza virus variants that have different NS genes from a mixed virus population, we conducted screening of progeny viruses that arose during passage in 10- and 14-day-old

ECE by plaque purification in chicken embryo fibroblast (CEF) cells followed by RT-

PCR and sequencing. RNA extraction, RT-PCR, and direct sequencing were done as described above.

Western blot analysis. Wells (in six-well plates) of confluent Vero, MDCK, and CEF cells were mock infected or infected at a multiplicity of infection (MOI) of 2 with wild type and NS variant viruses. At 8 and 12 hours post infection (p.i.), cells were lysed in

59 100 ul of radioimmunoprecipitation assay (RIPA) buffer (Santa Cruz Biotechnology,

Inc., Santa Cruz, CA) and 10% of the lysates were loaded on a 15% sodium dodecyl sulfate (SDS) polyacrylamide gel. Separated proteins were transferred to a membrane and subjected to Western blot analysis with rabbit polyclonal anti-NS1 and anti-NP antibodies (37). Goat anti-rabbit immunoglobulin G (IgG) (H+L) peroxidase antibody was used as a secondary antibody (Boehringer Mannheim, Germany). Western blots were developed with a chemiluminescent reagent (Dupont-NEN, Wilmington, DE).

Virus growth analysis in Vero and CEF cells. Vero cells were maintained as described above. Primary CEF cells were prepared from 10-day-old eggs (29). The cells were seeded (approximately 2×106 cells/well) in six-well tissue culture plates the day before

infection. The cells were then infected at 0.01 MOI. After one hour incubation, the

inoculum was removed and replaced with media with the addition of trypsin (0.05 and

0.35ug/ml for Vero and CEF cells, respectively). Cells were observed daily for cytopathic

effects (CPE). Aliquots of supernatants were removed at 24, 48, and 72 hours p.i. for

titration. RNA was extracted from 200 ul of supernatants using the RNeasy Mini kit

(Qiagen). One-tube real-time RT-PCR was performed using the Qiagen one-step RT-

PCR kit (Qiagen) in a 25ul reaction mixture containing probe specific for the matrix gene

(33). For quantitation, samples were run together with known amounts of control viral

RNA. Standard curves were generated with those control viral RNAs and the amount of

RNA in the samples was converted into EID50/ml by interpolation (17, 33).

In vivo pathogenesis and challenge-protection studies. The virulence of four plaque

purified variants was determined in 2-week-old SPF chickens (Charles River

Laboratories, Inc. Wilmington, MA). The pathogenicity of TK/OR/71-SEPRL and

60 TK/OR/71-delNS1 was previously described in detail (2). In these experiments, ten birds

6 were infected with 10 EID50/0.2ml of virus by intranasal inoculation. Four contact- control birds were introduced to the same cage with infected birds one day after infection.

Four infected birds were euthanized on 3 days p.i. to collect tissues for histopathology and immunohistochemistry (IHC). Collected tissues were fixed by submersion in 10% neutral buffered formalin, routinely processed, and embedded in paraffin. Sections were made at 5 um and were stained with hematoxylin and eosin (HE). A duplicate 4 um section was immunohistochemically stained by first microwaving the sections in Antigen

Retrieval Citra Solution (Biogenex, San Ramon, CA) for antigen exposure. A monoclonal antibody (P13C11) specific for a type A influenza virus nucleoprotein, developed at

SEPRL, was used as the primary antibody for a streptavidin-biotin-alkaline phosphatase complex-based IHC method as previously described (35).

Tracheal and cloacal swabs were collected from all the birds on 2 and 4 days p.i. (1 and 3 days post contact for sentinel control birds). Individual swabs were placed in 1.5 ml of sterile phosphate buffered saline (PBS) containing gentamycin (1mg per 100ml). RNA was extracted from the tracheal and cloacal swabs with RNeasy Mini kit (Qiagen). The virus was quantitated by real-time RT-PCR as described above. Birds were observed for two weeks for clinical signs and sera were collected at 2 week p.i. to check specific influenza virus antibody responses by the hemagglutinination inhibition (HI) test (36).

Two weeks after infection (at 4 weeks of age), the remaining 6 infected (or live vaccinated) and additional 6 uninfected (unvaccinated) control birds were challenged

6 with 10 EID50/0.2ml of heterologous H7N2 virus (A/CK/NJ/150383-7/02) by intranasal inoculation. We collected tracheal swabs at 3 and 5 days post challenge from both

61 vaccinated and unvaccinated challenged-control birds. Swab collection and titration were done as described above. Birds were observed for 10 days for clinical signs and sera were collected at the end of the experiment to check antibody responses by the HI test.

2.4 RESULTS

Identification of NS genes of different sizes after passaging the TK/OR/71-delNS1 virus in 10- and 14-day-old eggs. We conducted NS gene specific RT-PCR with RNA

extracted from delNS1 and SEPRL stocks of TK/OR/71 virus. In gel electrophoresis of the RT-PCR product, we observed a faint band which was smaller (approximately 700 bp) than the expected size (880 bp) of the NS gene from the delNS1 stock and not from the SEPRL stock (Fig. 2.1a). Based on previous studies that demonstrated increased IFN inducibility of both cultured chicken embryo cells and of intact ECE with increased age

(30), the delNS1 virus was passaged in ECE of different ages as well as in Vero cells which are constitutively defective in producing IFN (4). NS gene specific RT-PCR was done with RNA extracted from allantoic fluids or supernatants of each passage (Fig.

2.1b). We observed no or a slight increase in intensity of smaller-size bands when we

passaged the delNS1 virus in Vero cells (data not shown) and 7-day-old ECE,

respectively. In contrast, when we passaged the delNS1 virus in 10- and 14-day-old

ECEs, the appearance of different size smaller bands was more obvious and 14-day-old eggs generated smaller size bands in fewer passages than the 7- or 10-day-old eggs.

By cloning and subsequent sequencing, we were able to identify more than 20 different

NS genes of different sizes and the schematic diagram of those NS genes is shown in

62 figure 2.2a. These NS genes were named as double-deletion (D-del) genes because they

were derived from the stock that already had a 10 nt deletion. Most of the D-del NS genes

sequenced have a large deletion in the middle of the NS gene. Among different NS genes,

nine D-del NS genes are missing the NEP 3’ splicing site due to a large deletion in the

middle of the NS gene. D-del pc3 NS gene has two separate regions of deletion because,

in addition to one deleted region which is exactly the same as that of delNS1, it has

another 14 nucleotide deletion upstream of the original parental deletion. A schematic

diagram of predicted NS1 proteins based on NS gene sequence is shown in figure 2.2b.

All the NS1 proteins retain an intact or partial double-stranded RNA binding domain, and

some of them lost their entire effector domain while others retained a portion of the

effector domain.

Rescue of reassortant viruses that have different size NS genes. We introduced the

different size NS genes one by one in the backbone of a control influenza virus using 12

plasmid-based reverse genetics. We were able to rescue recombinant infectious viruses

that have all the different sizes of the NS genes except D-del 5 and 16 genes and all D-del

NS genes (D-del 4, 7, 8, 10-15) that lost the splicing site and part of the coding region of the NEP gene. Once the viruses were rescued, we passaged those recombinants in 10- day-old eggs to test if their NS genes are genetically stable. Mutant NS genes were genetically stable with the exception of the recombinant virus that had its NS gene derived from the original delNS1 virus. With this virus, we observed a pattern similar to that seen when we passaged the parental delNS1 virus in which the emergence of different size of deleted NS genes was obvious after a few passages (data not shown).

Thus, it appears that most D-del NS genes are competent at least in the in vitro system we

63 used as far as the NEP ORF is intact and they were directly derived from an unstable NS gene of original delNS1 virus.

Biological purification and characterization of the NS1 deletion variants. We were able to plaque purify the five variants (D-del pc1, pc2, pc3, pc4, and pc5) and the schematic diagram of their respective NS genes and NS1 proteins is shown in Figure 2.2.

We passaged these in ovo selected variants at least 5 times in 10-day-old eggs and confirmed that those NS genes are stable and do not produce additional variants. By conducting Western blot analysis, we confirmed the expression of the truncated NS1 protein by the variants. We were able to detect more NS1 protein expression from infected Vero cells (Fig. 2.3) than from MDCK or CEF cells (data not shown). Even in

Vero cells, we were not able to detect NS1 protein of D-del pc1 and pc3 variants while we were able to detect large amounts of NP protein expressed from all the strains including D-del pc1 and pc3 variants. This indicates that the truncated NS1 viruses display major differences in their ability to express their mutant NS1 proteins, with high levels of expression for D-del pc2 and pc5 viruses, followed by delNS1 parent and D-del pc4 viruses (low levels) and finally by D-del pc1 and pc3 viruses (undetectable by

Western blot).

The replication efficiency of the biologically purified NS variants was evaluated in Vero and CEF cells. The titers of all variants and original delNS1 viruses were comparable to that of the wild type SEPRL virus at all time points analyzed. All variants tested reached

6 7 their highest titers (10 -10 EID50/ml) at 48 hours p.i. in Vero cells. All variants also replicated equally well and were comparable with the SEPRL and delNS1 virus in CEF

7 cells reaching peak titers (approximately 10 EID50/ml) by 24 hours p.i. (data not shown).

64 In vivo pathogenicity, replication, and transmission studies of selected NS variants.

We tested 4 biologically purified D-del NS variants (D-del pc1 – pc4) in birds. The variants tested replicated poorly in 2-week-old SPF birds and only small amounts of virus were detected mainly at 2 days p.i. from a few infected birds (Table 2.1). All variants did

not transmit the virus to contact control cage mates (determined by virus isolation and

antibody response) and induced no clinical signs or histopathological lesions. We were

not able to detect any viral antigen from any of the tissues examined including the trachea

by immunohistochemical staining. It is clear contrast with the wild type SEPRL virus which express full length NS protein and showed efficient virus replication, virulence, and transmission to contact control birds in different ages of chickens (2). Two variants,

D-del pc3 and D-del pc4, were of particular interest because they replicated poorly in infected birds, but induced relatively high antibody titers at 2 week p.i.. As shown in

Table 2.1, only one out of 10 D-del pc3 variant infected birds shed low amounts of virus at 2 days p.i.. From D-del pc4 infected birds, low amounts of virus in 3 birds at 2 days p.i. and 1 bird at 4 days p.i., respectively, was detected from tracheal swabs.

Protective efficacy of potential live vaccines after challenge with heterologous strain

of the same HA subtype. Since low pathogenic avian influenza viruses seldom produces

clinical signs in experimental conditions, protection efficacy was measured by the

amount of virus shedding at 3 and 5 days post challenge. In this protection study with a

6 high dose heterologous virus challenge (10 EID50/0.2ml), live virus vaccination with D-

del pc3 and D-del pc4 was highly effective by significantly reducing the amount of

challenge virus shedding (Table 2.2). Although D-del pc1 and D-del pc2 vaccinated birds

showed a certain level of protection, most birds still shed relatively large amount of the

65 virus. The protection rate was correlated with the level of HI antibody titer measured at 2 week post vaccination and 10 days post challenge (Table 2.1&2.2). All challenge-control birds shed high amounts of virus both at 3 and 5 days post challenge (Table 2.2).

2.5 DISCUSSION

The NS1 protein of influenza A virus is dispensable in certain conditions, as a recombinant virus lacking the entire NS1 coding region has been generated and shown to grow in IFN-deficient Vero cells (10). However, the same virus could not replicate efficiently in IFN competent cells. In our study, we were able to rescue infectious viruses by reverse genetics that contained different D-del NS genes, except D-del 5 and 16 genes, as long as they retained the NEP splicing site. We could not rescue the reassortants that had one of nine D-del NS genes which lost the splicing site for NEP protein translation and part of the NEP coding sequence (Fig. 2.2b). NEP (or NS2) protein is an essential structural protein for virus replication and our results partly support the model of NS gene evolution proposed by Winter et al. (38). In this model, the NS1 protein originally occupied the entire vRNA, but a second shorter mRNA encoding NEP was produced resulting from mutations which generated a splice site in the NS1 mRNA. At the same time, the NEP protein became more critical for the function of the virus than the carboxyl-terminal part of the NS1 protein, which was then progressively lost.

In our extensive trial, we were able to biologically clone five NS1 mutant virus variants

(D-del pc1 – pc5) by plaque purification in CEF cells, and confirmed that the NS genes of those variants were genetically stable. It is likely that those NS genes had selective

66 advantages in CEF cells compared to other NS genes in terms of replication and plaque

forming efficiency. However, the selected variants express similar or more truncated NS1

protein compared to the NS1 protein of delNS1. In addition, none of the variants that

retained the partial 3’end effector domain were selected (Fig. 2.2b). Furthermore, the D-

del pc1, which among the 5 variants has the largest deletion in its NS gene and thus

expresses together with the D-del pc3 variant, the smaller NS1 proteins of the 5 variants,

was the most predominant variant observed in our cloning and plaque purification study

(data not shown). Thus, the size of the NS1 protein and selection efficiency did not

correlate. It is possible that the dimerization function of the effector domain is sequence

specific and that the newly introduced sequences at the 3’ end of each NS1 protein due to

deletion or frameshift influences the stability of the RNA binding domain and thus the

function of the NS1 protein. The five biologically purified variants encode NS1 proteins

of 86 (pc3), 90 (pc1), 93 (pc4), 125 (pc2) and 132 (pc5) amino acids, respectively.

Although we were able to confirm the NS1 expression of some of those D-del variants by

Western blot analysis, NS1 expressions from D-del pc1 and pc3 were not detected. In our

growth curve study in Vero and CEF cells, all variants replicated comparably well and

thus the replication efficiency does not appear to be a factor for NS1 detection from

infected cells. It should be noted that the polyclonal NS1 antibody used in the Western

blots was raised against a recombinant truncated NS1 protein of 73 amino acids, which

are present in all six recombinant NS1 truncated viruses analyzed in these studies. Thus,

it is also possible that the deletion in the 3’ carboxyl terminal region may have affected

the three dimensional structure of the 5’ RNA binding domain recognized by the antibody we used. The reason for the different levels of NS1 expression among the

67 different NS1 truncated viruses remains unclear, but similar observations with other NS1

truncated viruses were previously reported (31).

In a study with NS1 truncated, mouse-adapted human influenza viruses, the length of the

NS1 protein correlated with the level of the attenuation of these viruses: the shorter the

NS1 protein, the less virulent the virus (37). However, in studies with NS1 truncated

equine and swine influenza viruses, the degree of attenuation did not strictly correlate

with the length of the NS1 protein (27, 31). In our study with avian influenza virus, we

also found that degree of attenuation did not correlate with the length of NS1 protein. It is

possible that different levels of attenuation of NS variants in different species may result

from a different role of NS1 protein in different species. However, all these studies have

been performed with a discreet number of NS1 variants from different viral strains. In

addition, as shown by the X-ray crystal structure (1), the three-dimensional structure of the NS1 effector domain involves multiple interactions between amino acids that are far apart on the linear map of the NS1 protein effector domain. Thus, more investigations are required to determine the influence of the length in conjunction with the three- dimensional structure of the NS1 protein on its function and stability.

The NS1 protein of influenza A virus has several advantages as a target to attenuate influenza virus in developing a live attenuated vaccine. However, there is also a concern that a live attenuated vaccine strain may mutate and revert to the virulent wild type.

Truncation of the NS1 protein renders irreversible attenuation of influenza A virus and has been shown to be a valuable tool for safe influenza vaccine development (5, 6, 24).

Our in vivo study shows that all the selected variants (D-del pc1- pc4) are highly attenuated in chickens and despite the compensatory adaptations, none of the variants

68 regain the original virulence of wild type SEPRL virus that express intact NS1 protein

(2). Among the variants, D-del pc3 and pc4 viruses showed the most promising characteristics as a vaccine candidate strain. These variants replicated poorly in infected birds without transmitting the virus to contact control cage mates and produced no clinical signs or histopathological lesions. At the same time, the variants induced relatively high antibody titer at 2 week p.i. (Table 2.1). In a protection study with a high dose heterologous virus challenge, the live-attenuated variants vaccination was highly effective by reducing the amount of challenge virus shedding (Table 2.2). Therefore, these NS deletion variants can be excellent master strains for live attenuated vaccine development. Additional introductions of mutations, such as changes that can convert the virus to a temperature sensitive phenotype (12, 32), or introducing immunostimulatory genes (7, 13) in the deleted region of the NS gene may provide additional safety features.

In summary, we demonstrated that diverse NS genes of different sizes could be generated directly from the parental TK/OR/71-delNS1 strain. In addition, our in vitro and in vivo studies with selected isolates show that our naturally selected NS1 deletion variants might be useful in the development of a live influenza virus vaccines in their current state or with further modifications by reverse genetics. Furthermore, deletion in the NS1 protein can be potentially useful as a negative marker for a DIVA (Differentiating Infected from

Vaccinated Animals) approach.

2.6 ACKNOWLEDGEMENTS

The authors would like to thank Suzanne Deblois, Megan Strother, Keumsuk Hong,

Somanathan Pillai, and Richard Cadagan for technical assistance with this work. This

69 work was supported in part by the USDA-ARS Specific Cooperative Agreement and

USDA, CSREES AICAP grant (to CWL), and by NIAID grants R01 Ai46954 and U01

AI070469 (to AG-S).

2.7 REFERENCES

1. Bornholdt, Z. A., and B. V. Prasad. 2006. X-ray structure of influenza virus NS1 effector domain. Nat Struct Mol Biol 13:559-60.

2. Cauthen, A. N., D. E. Swayne, M. J. Sekellick, P. I. Marcus, and D. L. Suarez. 2007. Amelioration of influenza virus pathogenesis in chickens attributed to the enhanced interferon-inducing capacity of a virus with a truncated NS1 gene. J Virol 81:1838-47.

3. Chen, W., P. A. Calvo, D. Malide, J. Gibbs, U. Schubert, I. Bacik, S. Basta, R. O'Neill, J. Schickli, P. Palese, P. Henklein, J. R. Bennink, and J. W. Yewdell. 2001. A novel influenza A virus mitochondrial protein that induces cell death. Nat Med 7:1306-12.

4. Diaz, M. O., S. Ziemin, M. M. Le Beau, P. Pitha, S. D. Smith, R. R. Chilcote, and J. D. Rowley. 1988. Homozygous deletion of the alpha- and beta 1-interferon genes in human leukemia and derived cell lines. Proc Natl Acad Sci U S A 85:5259-63.

5. Donelan, N. R., C. F. Basler, and A. Garcia-Sastre. 2003. A recombinant influenza A virus expressing an RNA-binding-defective NS1 protein induces high levels of beta interferon and is attenuated in mice. J Virol 77:13257-66.

6. Egorov, A., S. Brandt, S. Sereinig, J. Romanova, B. Ferko, D. Katinger, A. Grassauer, G. Alexandrova, H. Katinger, and T. Muster. 1998. Transfectant influenza A viruses with long deletions in the NS1 protein grow efficiently in Vero cells. J Virol 72:6437-41.

7. Ferko, B., C. Kittel, J. Romanova, S. Sereinig, H. Katinger, and A. Egorov. 2006. Live attenuated influenza virus expressing human interleukin-2 reveals increased immunogenic potential in young and aged hosts. J Virol 80:11621-7.

8. Fernandez-Sesma, A., S. Marukian, B. J. Ebersole, D. Kaminski, M. S. Park, T. Yuen, S. C. Sealfon, A. Garcia-Sastre, and T. M. Moran. 2006. Influenza virus evades innate and adaptive immunity via the NS1 protein. J Virol 80:6295- 304.

70 9. Fodor, E., L. Devenish, O. G. Engelhardt, P. Palese, G. G. Brownlee, and A. Garcia-Sastre. 1999. Rescue of influenza A virus from recombinant DNA. J Virol 73:9679-82.

10. Garcia-Sastre, A., A. Egorov, D. Matassov, S. Brandt, D. E. Levy, J. E. Durbin, P. Palese, and T. Muster. 1998. Influenza A virus lacking the NS1 gene replicates in interferon-deficient systems. Virology 252:324-30.

11. Gorse, G. J., M. J. Campbell, E. E. Otto, D. C. Powers, G. W. Chambers, and F. K. Newman. 1995. Increased anti-influenza A virus cytotoxic T cell activity following vaccination of the chronically ill elderly with live attenuated or inactivated influenza virus vaccine. J Infect Dis 172:1-10.

12. Jin, H., H. Zhou, B. Lu, and G. Kemble. 2004. Imparting temperature sensitivity and attenuation in ferrets to A/Puerto Rico/8/34 influenza virus by transferring the genetic signature for temperature sensitivity from cold-adapted A/Ann Arbor/6/60. J Virol 78:995-8.

13. Kittel, C., B. Ferko, M. Kurz, R. Voglauer, S. Sereinig, J. Romanova, G. Stiegler, H. Katinger, and A. Egorov. 2005. Generation of an influenza A virus vector expressing biologically active human interleukin-2 from the NS gene segment. J Virol 79:10672-7.

14. Krug, R. M., and P. R. Etkind. 1973. Cytoplasmic and nuclear virus-specific proteins in influenza virus-infected MDCK cells. Virology 56:334-48.

15. Krug, R. M., W. Yuan, D. L. Noah, and A. G. Latham. 2003. Intracellular warfare between human influenza viruses and human cells: the roles of the viral NS1 protein. Virology 309:181-9.

16. Lee, C. W., Y. J. Lee, D. A. Senne, and D. L. Suarez. 2006. Pathogenic potential of North American H7N2 avian influenza virus: a mutagenesis study using reverse genetics. Virology 353:388-95.

17. Lee, C. W., D. A. Senne, and D. L. Suarez. 2004. Generation of reassortant influenza vaccines by reverse genetics that allows utilization of a DIVA (Differentiating Infected from Vaccinated Animals) strategy for the control of avian influenza. Vaccine 22:3175-81.

18. Lee, C. W., D. E. Swayne, J. A. Linares, D. A. Senne, and D. L. Suarez. 2005. H5N2 avian influenza outbreak in Texas in 2004: the first highly pathogenic strain in the United States in 20 years? J Virol 79:11412-21.

19. Marcus, P. I., J. M. Rojek, and M. J. Sekellick. 2005. Interferon induction and/or production and its suppression by influenza A viruses. J Virol 79:2880-90.

20. Nelson, K. M., B. R. Schram, M. W. McGregor, A. S. Sheoran, C. W. Olsen, and D. P. Lunn. 1998. Local and systemic isotype-specific antibody responses to

71 equine influenza virus infection versus conventional vaccination. Vaccine 16:1306-13.

21. Nemeroff, M. E., S. M. Barabino, Y. Li, W. Keller, and R. M. Krug. 1998. Influenza virus NS1 protein interacts with the cellular 30 kDa subunit of CPSF and inhibits 3'end formation of cellular pre-mRNAs. Mol Cell 1:991-1000.

22. Neumann, G., T. Watanabe, H. Ito, S. Watanabe, H. Goto, P. Gao, M. Hughes, D. R. Perez, R. Donis, E. Hoffmann, G. Hobom, and Y. Kawaoka. 1999. Generation of influenza A viruses entirely from cloned cDNAs. Proc Natl Acad Sci U S A 96:9345-50.

23. Norton, G. P., T. Tanaka, K. Tobita, S. Nakada, D. A. Buonagurio, D. Greenspan, M. Krystal, and P. Palese. 1987. Infectious influenza A and B virus variants with long carboxyl terminal deletions in the NS1 polypeptides. Virology 156:204-13.

24. Palese, P., T. Muster, H. Zheng, R. O'Neill, and A. Garcia-Sastre. 1999. Learning from our foes: a novel vaccine concept for influenza virus. Arch Virol Suppl 15:131-8.

25. Palese, P., and M. L. Shaw. 2007. Orthomyxoviridae: The viruses and their replication, p. 1647-1689. In D. M. Knipe and P. M. Howley (ed.), Fields Virology, 5th ed. Lippincott Williams & Wilkins, Philadelphia.

26. Qiu, Y., and R. M. Krug. 1994. The influenza virus NS1 protein is a poly(A)- binding protein that inhibits nuclear export of mRNAs containing poly(A). J Virol 68:2425-32.

27. Quinlivan, M., D. Zamarin, A. Garcia-Sastre, A. Cullinane, T. Chambers, and P. Palese. 2005. Attenuation of equine influenza viruses through truncations of the NS1 protein. J Virol 79:8431-9.

28. Satterly, N., P. L. Tsai, J. van Deursen, D. R. Nussenzveig, Y. Wang, P. A. Faria, A. Levay, D. E. Levy, and B. M. Fontoura. 2007. Influenza virus targets the mRNA export machinery and the nuclear pore complex. Proc Natl Acad Sci U S A 104:1853-8.

29. Schat, K. A., and H. G. Purchase. 1998. Cell-Culture Methods, p. 223-234. In D. E. Swayne (ed.), A Laboratory Manual for the Isolation and Identification of Avian Pathogens. American Association of Avian Pathologists, Kennett Square, PA.

30. Sekellick, M. J., W. J. Biggers, and P. I. Marcus. 1990. Development of the interferon system. I. In chicken cells development in ovo continues on time in vitro. In Vitro Cell Dev Biol 26:997-1003.

72 31. Solorzano, A., R. J. Webby, K. M. Lager, B. H. Janke, A. Garcia-Sastre, and J. A. Richt. 2005. Mutations in the NS1 protein of swine influenza virus impair anti-interferon activity and confer attenuation in pigs. J Virol 79:7535-43.

32. Song, H., G. R. Nieto, and D. R. Perez. 2007. A new generation of modified live-attenuated avian influenza viruses using a two-strategy combination as potential vaccine candidates. J Virol 81:9238-48.

33. Spackman, E., D. A. Senne, T. J. Myers, L. L. Bulaga, L. P. Garber, M. L. Perdue, K. Lohman, L. T. Daum, and D. L. Suarez. 2002. Development of a real-time reverse transcriptase PCR assay for type A influenza virus and the avian H5 and H7 hemagglutinin subtypes. J Clin Microbiol 40:3256-60.

34. Suarez, D. L., and M. L. Perdue. 1998. Multiple alignment comparison of the non-structural genes of influenza A viruses. Virus Res 54:59-69.

35. Swayne, D. E. 1997. Pathobiology of H5N2 Mexican avian influenza virus infections of chickens. Vet Pathol 34:557-67.

36. Swayne, D. E., Senne, D.A., and Beard, C.W. 1998. Avian influenza, p. 150- 155. In D. E. Swayne (ed.), A Laboratory Manual for the Isolation and Identification of Avian Pathogens American Association of Avian Pathologists, Kennett Square, PA.

37. Talon, J., M. Salvatore, R. E. O'Neill, Y. Nakaya, H. Zheng, T. Muster, A. Garcia-Sastre, and P. Palese. 2000. Influenza A and B viruses expressing altered NS1 proteins: A vaccine approach. Proc Natl Acad Sci U S A 97:4309-14.

38. Winter, G., S. Fields, M. J. Gait, and G. G. Brownlee. 1981. The use of synthetic oligodeoxynucleotide primers in cloning and sequencing segment of 8 influenza virus (A/PR/8/34). Nucleic Acids Res 9:237-45.

Infected birds Uninoculated cage mates

Group Virus Isolation HI titer Virus Isolation HI titer

2 DPIa 4 DPI (2 week PIa ) 2 DPI 2 DPI (2 week PI )

D-del pc1 7/10b (2.0+0.4)c 2/10 (2.3+1.2) 30+19 0/4 0/4 0

D-del pc2 1/10 (2.4) 0/10 16+0d 0/4 0/4 0

D-del pc3 1/10 (2.9) 0/10 50+41 0/4 0/4 0

D-del pc4 3/10 (2.6+0.6) 1/10 (2.0) 202+85 0/4 0/4 0

Table 2.1. Pathogenicity and transmission of D-del NS variants in 2-week-old SPF chickens a DPI: Days post-infection b Number of birds positive / number tested. c Virus titer is expressed as log10 median egg infective doses per milliliter. d Only one bird showed measurable antibody titer.

Virus Isolation Average HI titer Group 3 DPCa 5 DPC (10 DPC)

D-del pc1 3/6b (3.2+0.5)c 5/6 (2.6+0.3) 133

D-del pc2 6/6 (3.8+1.4) 6/6 (3.2+0.9) 106

D-del pc3 2/6 (3.2+0.7) 0/6 2901

D-del pc4 1/6 (3.2+0.0) 1/6 (1.8) 1562

Unvaccinated 6/6 (4.7+0.7) 6/6 (3.3+0.5) 166 Control

6 Table 2.2. Protection of D-del NS variants infected birds after challenge with 10 EID50 of heterologous H7N2 virus a DPC: Days post-challenge b Number of birds positive / number tested. c Virus titer is expressed as log10 median egg infective doses per milliliter.

Figure 2.1. Identification of NS genes of different sizes after passaging the TK/OR/71- delNS1 virus in embryonating chicken eggs (ECEs) of different ages. NS gene specific

RT-PCR was conducted with RNAs extracted from original stock (a) and passaged (b) viruses and the amplification products were separated on a 1.5% agarose gel by electrophoresis. Number of passages are indicated on the top.

Figure 2.2. Schematic diagram of the NS genes (a) and predicted NS1 protein (b) that were identified by cloning and subsequent sequencing. Black (thick) line: same nt or aa sequence compared to wild type virus; dash line: deleted nt or aa sequence; Arrow (in figure a): NEP splicing site; Asterisk (in D-del 10 gene): premature stop codon. The carboxyl end of some of the NS1 proteins contains amino acid residues different from wild type (in gray color) due to a frame shift in the open reading frame.

77 delNS1 pc1 D-del pc2 D-del pc3 D-del pc4 D-del pc5 D-del delNS1 pc1 D-del pc2 D-del pc3 D-del pc4 D-del pc5 D-del SEPRL SEPRL 1234567 1234567 NP NP

NS1 25.9 25.9 NS1 19.4 19.4 14.8 Truncated 14.8 Truncated NS1 NS1

8 hr p.i. 12 hr p.i.

Figure 2.3. Western blot analysis of the NS1 protein. Vero cells were infected with wild type TK/OR/71 and derivative viruses for the indicated time points at an MOI of 2. Cell extracts were probed with an antibody against the NS1 or NP protein as described in the

Materials and Methods.

78 CHAPTER 3

DEVELOPING LIVE ATTENUATED AVIAN INFLUENZA VIURS IN OVO

VACCINES FOR POULTRY

3.1 ABSTRACT

Live attenuated vaccines can mimic natural infection and induce humoral and cellular immune response. However, possibility of reassortment between vaccine viruses and field isolates, and mutations from low pathogenic to highly pathogenic viruses prevented using live attenuated strains as poultry vaccines. In ovo vaccination using live attenuated strains that can undergo limited replication cycles would be a better option, because they can be used for mass vaccination without spreading or reassorting with other viruses. Our previous study demonstrated that two influenza A NS variant viruses are more attenuated and immunogenic than other variants in chickens, making them potential live vaccine candidates. In this study, we tested whether those NS variants could be used as in ovo vaccines alone or in combination with temperature sensitive (ts) mutations. In addition, we also tested the effect of different HA subtypes on in ovo vaccination of NS variants.

Our results demonstrated that NS variants alone or in combination with ts mutations were not attenuated enough to be used for in ovo vaccination. We also observed variable effects of different HA subtypes in the same NS deletion variant backbone on

79 hatchability. However, even with substitution of HA subtypes, NS variants inoculated eggs still had lower hatchability compared to mock control group, indicating that the high virulence of NS variant backbone strain in eggs might have affected the results.

3.2 INTRODUCTION

Avian influenza is continuously threatening the poultry industry and human health. It is urgent to develop effective strategies to prevent and control avian influenza to decrease the possibility of human infection and economic losses to poultry industry. Vaccination is one of the effective strategies used to control avian influenza. There are commercially available inactivated and live recombinant vaccines (1, 2). However, inactivated vaccines only induce humoral immune response, and need to be delivered to birds by parenteral route. Although they can be surrogate viruses inducing immune response like a live attenuated virus vaccine, fowl-pox virus vectored HA vaccines will not give uniform immunization to birds which are previously vaccinated or infected with fowl pox viruses

(3). A live attenuated vaccine can elicit both humoral and cellular immune responses, and also can be used for mass vaccination in the poultry industry. However, concerns of possibility of reassortment between vaccine and field viruses as well as mutations of vaccine strains from low pathogenic to highly pathogenic viruses in the case of H5 and

H7 subtypes prevent recommending live attenuated virus strains as poultry vaccines.

Under this condition, live attenuated in ovo vaccines will be a better option for avian influenza viruses, as they have advantages of mass vaccination and elicit earlier immunity. There are commercial in ovo vaccines available for Marek’s disease virus,

infectious bursal disease virus, etc. (4), however, live attenuated avian influenza in ovo

vaccines are still under development.

Several different methods can be used to attenuate influenza A viruses for developing

live attenuated influenza vaccines including modification of HA cleavage site (5), M2

mutants (6), NS variants (7, 8), and temperature sensitive (ts) mutants (9). The ts mutation strategy was originally developed with A/Ann Arbor/6/60 (H2N2) strain by

serially passaging this virus in primary chick kidney cells or embryonated chicken eggs

(ECE) at successively lower temperatures (10) and the attenuated strain is being used in

licensed human live influenza vaccine (11). Several studies have reported the generation

of H5N1 (12), H6N1 (13), H7N3 (14), and H9N2 (15) subtype vaccine viruses using the

internal gene backbone of attenuated A/Ann Arbor/6/60 strain, which can provide

efficacious protection against wild type virus challenge in mice and ferrets. In addition,

among 11 specified amino acid mutations in this attenuated strain (9), only five mutations

introduced into PB2, PB1, and NP were sufficient to impart ts and attenuation phenotype

in ferrets to A/Puerto Rico/8/34 (H1N1) (16). Recently, those five ts mutations together

with HA tag introduced in PB1 were used to attenuate A/Guinea Fowl/Hong

Kong/WF10/99 (H9N2) avian influenza virus for vaccine development, and this live

attenuated virus strain was used as a backbone to attenuate H1N1, H5N1, and H7N2

subtype viruses which can effectively protect mice or birds against influenza (17, 18).

Moreover, using this backbone, the live attenuated H5N1 provided effective protection

when administered in ovo (18). However, the suitability of this attenuated strain as an in

ovo vaccine, especially regarding hatchability of vaccinated eggs, has not been fully

addressed. In the present study, we tested whether NS variants alone or together with ts

mutations could be used as in ovo vaccines, and whether different HA subtypes in the NS variant backbone have the same effect on in ovo vaccination.

3.3 MATERIALS AND METHODS

Viruses and Cells. Viruses included in this study are the A/TK/OR/71-SEPRL (H7N3) with a full-length NS gene; A/TK/OR/71-D-del pc1 to 5 with partially deleted NS genes

(8); A/Mute Swan/MI/451072-2/06 (H5N1) (19); A/TK/OH/313053/04 (H3N2) (20). All cell lines, 293-T (human kidney cells), Madin-Darby canine kidney (MDCK), and chicken embryo fibroblasts (CEF) cells, were grown and maintained in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum, and 1%

Gentamicin. Cells were incubated at 37°C with 5% CO2.

Construction of transcription plasmids and rescue of ressortant viruses. RNAs from each virus used in this study were extracted with the RNeasy mini kit (Qiagen, Valencia,

CA) from infected allantoic fluid. Seven genes (PB2, PB1, PA, HA, NP, NA, and M) of

A/TK/OR/71-SEPRL, and HA genes of A/Mute Swan/MI/451072-2/06 as well as

A/TK/OH/313053/04 were cloned into pHH21 transcriptional vector between the promoter and terminator sequences of RNA polymerase I. The transcription plasmids that contain the NS genes of A/TK/OR/71-SEPRL, A/TK/OR/71-D-del pc3, and

A/TK/OR/71-D-del pc4 were previously prepared (8). The ts mutations were introduced into PB2 (N265S) and PB1 (K391E, E581G, A661T) genes of A/TK/OR/71-SEPRL by site-directed mutagenesis using a commercially available kit (Stratagene, La Jolla, CA) as described previously (18). Four expression plasmids (pCAGGS-WSN-NP, pcDNA774-

PB1, pcDNA762-PB2, and pcDNA787-PA) were kindly provided by Dr. Yoshihiro

Kawaoka at the University of Wisconsin (21). Recombinant viruses were generated by

reverse genetics as described previously (21). The recovery of recombinant viruses was verified by sequencing. NS variants with different HA subtypes derived their HA genes from H5 or H3 HA and the remaining seven genes from A/TK/OR/71-D-del pc3 or D-del

pc4.

Evaluation of ts phenotype properties of the reassortant viruses in vitro. The titers of

reassortant viruses rTK/OR/71-SEPRL, rTK/OR/71-D-del pc3, rTK/OR/71-D-del pc4 as

well as their corresponding viruses with ts mutations (rTK/OR/71-SEPRL-ts,

rTK/OR/71-D-del pc3-ts, rTK/OR/71-D-del pc4-ts) were determined by plaque assay

using CEF. Viral growth was analyzed in CEF and MDCK at 37°C and 41°C,

respectively, to check if rTK/OR/71-SEPRL-ts, rTK/OR/71-D-del pc3-ts, and

rTK/OR/71-D-del pc4-ts had ts phenotype. Cells were infected with each virus at an MOI

of 0.001. Cell supernatants were collected at 24, 48, and 72h post infection for virus

titration (log10EID50/ml) by real time RT-PCR (22, 23).

Hatchability of in ovo vaccinated eggs with different viruses. Two vaccine doses (101

2 and 10 EID50/0.1 ml) of A/TK/OR/71-D-del pc1-5 or phosphate-buffered saline (PBS) were used to vaccinate 18-day-old chicken embryos obtained from SPAFAS, Inc

(Norwich, CT). The hatching rates were determined. In two other separate studies, the

2 10 EID50/0.1 ml of viruses with or without ts mutations (rTK/OR/71-SEPRL,

rTK/OR/71-D-del pc3, rTK/OR/71-D-del pc4, rTK/OR/71-SEPRL-ts, rTK/OR/71-D-del

pc3-ts, rTK/OR/71-D-del pc4-ts), NS variants with different HA subtypes or PBS were also used to vaccinate the 18-day-old chicken embryos to monitor the hatchability.

3.4 RESULTS AND DISCUSSION

Our previous study demonstrated that A/TK/OR/71-D-del pc3 and A/TK/OR/71-D-del

pc4 were more attenuated and immunogenic than other NS variants in chickens, making

them potential live vaccine candidates (8). To evaluate potential application of NS gene

deletion variants in in ovo vaccination, different NS variants (A/TK/OR/71-D-del pc1-5)

we previously identified (8) were used to inoculate 17-day-old ECEs. All NS variants

2.5 4.6 replicated 1 or 2 log level lower (10 – 10 EID50/ml) than the wild-type viruses in the

lung collected at 3 days post inoculation (data not shown). However, when the same NS

variants were tested in 17 and 18-day-old ECEs, hatchability of NS variant groups was significantly lower than that of PBS control group, especially for 102/0.1ml vaccine dose

(Table 3.1), indicating that viruses with NS deletion strategy alone were not attenuated enough in ECE, and there is a need for further attenuation of these NS variants.

To further attenuate the viruses, ts mutations were introduced into a wild type

A/TK/OR/71-SEPRL (H7N3) and two NS variant (A/TK/OR/71-D-del pc3 and D-del pc4) strains by site-directed mutagenesis and ts mutants were generated by reverse genetics. These viruses (rTK/OR/71-SEPRL-ts, rTK/OR/71-D-del pc3-ts, and rTK/OR/71-D-del pc4-ts) showed ts phenotype in vitro which was more evident in CEF cells than in MDCK cells (Fig.3.1). The ts mutants exhibited ts phenotype in CEF at

41°C, with their titers being reduced by at least 1.1 log10EID50/ml compared to those at

37°C, whereas titer differences of their parental viruses between 41°C and 37°C were only less than 0.6 log10EID50/ml (except 72 hours post infection for rTK/OR/71-D-del

pc3) (Fig.3.1a). However, compared to titer reduction (0.3-2.4 log10EID50/ml) of their corresponding parent viruses at 41°C, these ts mutants showed weak ts phenotype in

MDCK cells (0.3-2.6 log10EID50/ml) (Fig. 3.1b). It should be noted that even the parent

viruses had variable titer reduction at 41°C in MDCK cells indicating mammalian

MDCK cells are more sensitive to 41°C than chicken CEF cells. This result is different

from that of a recent study of avian influenza virus (A/Guinea Fowl/Hong

Kong/WF10/99 (H9N2)) with those ts mutations which demonstrated that the ts phenotype was more evident in MDCK cells than in chicken embryo kidney cells (18).

These contrasting results indicate that cellular factors could affect the effect of ts phenotye in these viruses as well as the strain specificity. The ts mutations were also introduced into three H3N2 subtype viruses (wild type A/TK/OH/313053/04 and two NS variants). In contrast to H7N3 subtype ts mutants, only wild type H3N2 ts mutant exhibited similar ts phenotype pattern in vitro while the ts mutations did not affect

phenotype of two H3N2 NS variants at all (data not shown). This result again indicates

that ts mutations might not be universally effective on attenuating different influenza

virus strains, due to the strain specificity of influenza virus.

In in ovo study using 18-day-old eggs, eggs inoculated with ts mutants showed equal or

lower hatchability than that of those inoculated with corresponding parental viruses

indicating ts mutations did not help wild type virus decrease its virulence and also did not

work together with NS deletion to further attenuate avian influenza virus (Table 3.2).

Overall, although our and other studies demonstrated that avian influenza viruses with ts

mutations showed ts phenotype in vitro, ts mutations strategy alone does not attenuate

avian influenza viruses in ovo (Table 3.2) and also in vivo (18). It is also reasonable to

assume that the ts mutations strategy could have limitations in attenuation of avian

influenza viruses, or at least be strain or subtype specific. Although they can combine

with HA tag in PB1 to attenuate viruses (18), it is also possible that ts mutations can not

work synergistically with NS deletion to attenuate viruses, as demonstrated in our in vitro

study with H3N2 subtype strain. Human temperature sensitive and attenuated A/Ann

Arbor/6/60 virus has been used to generate vaccine strains for several different subtype

(H5N1, H6N1, H7N3, and H9N2) which were shown to be attenuated and efficacious

against wild type virus challenge in mice and ferrets (12-15). Different attenuation effects

of the same ts mutations on human and avian influenza viruses could be due to

differences in host body temperatures. In general, ts mutants show more evident ts

phenotype at higher temperature (41°C) than intermediate temperature (37 - 39°C) (18).

In our study, in ovo vaccinated eggs were kept at 37.8°C and although introducing ts

mutations might have attenuated the virus to a certain level, the level of attenuation

appears to be not sufficient enough to improve the hatchability.

To determine the effect of different HA subtypes on in ovo vaccination of NS variants, we first determined that A/Mute Swan/MI/451072-2/06 (H5N1) gave highest hatchability among five H5 subtype strains tested, and A/TK/OH/313053/04 (H3N2) was not lethal to eggs (data not shown). Using HA genes of those two strains, NS variants with H5 or H3 subtypes (rH5-TK/OR/71-D-del pc3, rH5-TK/OR/71-D-del pc4, rH3-TK/OR/71-D-del pc3, and rH3-TK/OR/71-D-del pc4) were then generated by reverse genetics. When we tested these reassortants and control wild type viruses (A/Mute Swan/MI/451072-2/06 and A/TK/OH/313053/04) for in ovo vaccination, eggs inoculated with NS variants with

H3 HA had a higher hatchability than that infected with NS variants with H5 HA (Table

3.3). It could be that strain specificity or incompatibility between H5 HA and N3 NA

results in lower hatchability in H5 subtype reassortant inoculated eggs. Even with H3 HA

substitution, eggs inoculated with NS variants still showed lower hatchability than that

PBS control group. In this study, NS gene deletion alone, or in combination with either

the ts mutations or HA substitutions did not attenuate H7N3 wild type virus enough for in ovo vaccination. Thus, it is quite possible that H7N3 wild type strain is refractory to attenuation.

Taken together, our study demonstrated that ts mutations could not combine with NS deletion to further attenuate avian influenza viruses for in ovo vaccination. In addition, although switching the HA subtype could increase hatchability of in ovo vaccinated eggs, additional efforts should be made to develop further attenuated strains to be used as in ovo vaccines.

3.5 ACKNOWLEDGMENTS

We would like to thank Megan Strother for technical assistance with this work. This work was supported in part by the USDA-ARS Specific Cooperative Agreement and

USDA, CSREES AI-CAP grant.

3.6 REFERENCES

1. Bublot, M., N. Pritchard, J. S. Cruz, T. R. Mickle, P. Selleck, and D. E. Swayne Efficacy of a fowlpox-vectored avian influenza H5 vaccine against Asian H5N1 highly pathogenic avian influenza virus challenge. Avian Dis 51:498-500. 2007.

2. Middleton, D., J. Bingham, P. Selleck, S. Lowther, L. Gleeson, P. Lehrbach, S. Robinson, J. Rodenberg, M. Kumar, and M. Andrew Efficacy of inactivated vaccines against H5N1 avian influenza infection in ducks. Virology 359:66-71. 2007.

3. Swayne, D. E., J. R. Beck, and N. Kinney Failure of a recombinant fowl poxvirus vaccine containing an avian influenza hemagglutinin gene to provide consistent protection against influenza in chickens preimmunized with a fowl pox vaccine. Avian Dis 44:132-137. 2000.

4. Ricks, C. A., A. Avakian, T. Bryan, R. Gildersleeve, E. Haddad, R. Ilich, S. King, L. Murray, P. Phelps, R. Poston, C. Whitfill, and C. Williams In ovo vaccination technology. Adv Vet Med 41:495-515. 1999.

5. Stech, J. Attenuated influenza A viruses with modified cleavage sites in hemagglutinin as live vaccines. Expert Rev Vaccines 7:739-743. 2008.

6. Watanabe, T., S. Watanabe, J. H. Kim, M. Hatta, and Y. Kawaoka Novel approach to the development of effective H5N1 influenza A virus vaccines: use of M2 cytoplasmic tail mutants. J Virol 82:2486-2492. 2008.

7. Talon, J., M. Salvatore, R. E. O'Neill, Y. Nakaya, H. Zheng, T. Muster, A. Garcia-Sastre, and P. Palese Influenza A and B viruses expressing altered NS1 proteins: A vaccine approach. Proc Natl Acad Sci U S A 97:4309-4314. 2000.

8. Wang, L., D. L. Suarez, M. Pantin-Jackwood, M. Mibayashi, A. Garcia-Sastre, Y. M. Saif, and C. W. Lee Characterization of influenza virus variants with different sizes of the non-structural (NS) genes and their potential as a live influenza vaccine in poultry. Vaccine 26:3580-3586. 2008.

9. Cox, N. J., F. Kitame, A. P. Kendal, H. F. Maassab, and C. Naeve Identification of sequence changes in the cold-adapted, live attenuated influenza vaccine strain, A/Ann Arbor/6/60 (H2N2). Virology 167:554-567. 1988.

10. Maassab, H. F. Adaptation and growth characteristics of influenza virus at 25 degrees c. Nature 213:612-614. 1967.

11. Belshe, R. B. Current status of live attenuated influenza virus vaccine in the US. Virus Res 103:177-185. 2004.

12. Li, S., C. Liu, A. Klimov, K. Subbarao, M. L. Perdue, D. Mo, Y. Ji, L. Woods, S. Hietala, and M. Bryant Recombinant influenza A virus vaccines for the pathogenic human A/Hong Kong/97 (H5N1) viruses. J Infect Dis 179:1132-1138. 1999.

13. Chen, Z., C. Santos, A. Aspelund, L. Gillim-Ross, H. Jin, G. Kemble, and K. Subbarao Evaluation of live attenuated influenza a virus h6 vaccines in mice and ferrets. J Virol 83:65-72. 2009.

14. Joseph, T., J. McAuliffe, B. Lu, L. Vogel, D. Swayne, H. Jin, G. Kemble, and K. Subbarao A live attenuated cold-adapted influenza A H7N3 virus vaccine provides protection against homologous and heterologous H7 viruses in mice and ferrets. Virology 378:123-132. 2008. 88

15. Chen, H., Y. Matsuoka, D. Swayne, Q. Chen, N. J. Cox, B. R. Murphy, and K. Subbarao Generation and characterization of a cold-adapted influenza A H9N2 reassortant as a live pandemic influenza virus vaccine candidate. Vaccine 21:4430-4436. 2003.

16. Jin, H., H. Zhou, B. Lu, and G. Kemble Imparting temperature sensitivity and attenuation in ferrets to A/Puerto Rico/8/34 influenza virus by transferring the genetic signature for temperature sensitivity from cold-adapted A/Ann Arbor/6/60. J Virol 78:995-998. 2004.

17. Hickman, D., M. J. Hossain, H. Song, Y. Araya, A. Solorzano, and D. R. Perez An avian live attenuated master backbone for potential use in epidemic and pandemic influenza vaccines. J Gen Virol 89:2682-2690. 2008.

18. Song, H., G. R. Nieto, and D. R. Perez A new generation of modified live- attenuated avian influenza viruses using a two-strategy combination as potential vaccine candidates. J Virol 81:9238-9248. 2007.

19. Spackman, E., D. E. Swayne, D. L. Suarez, D. A. Senne, J. C. Pedersen, M. L. Killian, J. Pasick, K. Handel, S. P. Pillai, C. W. Lee, D. Stallknecht, R. Slemons, H. S. Ip, and T. Deliberto Characterization of low-pathogenicity H5N1 avian influenza viruses from North America. J Virol 81:11612-11619. 2007.

20. Tang, Y., C. W. Lee, Y. Zhang, D. A. Senne, R. Dearth, B. Byrum, D. R. Perez, D. L. Suarez, and Y. M. Saif Isolation and characterization of H3N2 influenza A virus from turkeys. Avian Dis 49:207-213. 2005.

21. Neumann, G., T. Watanabe, H. Ito, S. Watanabe, H. Goto, P. Gao, M. Hughes, D. R. Perez, R. Donis, E. Hoffmann, G. Hobom, and Y. Kawaoka Generation of influenza A viruses entirely from cloned cDNAs. Proc Natl Acad Sci U S A 96:9345-9350. 1999.

22. Lee, C. W., D. A. Senne, and D. L. Suarez Generation of reassortant influenza vaccines by reverse genetics that allows utilization of a DIVA (Differentiating Infected from Vaccinated Animals) strategy for the control of avian influenza. Vaccine 22:3175- 3181. 2004.

23. Spackman, E., D. A. Senne, T. J. Myers, L. L. Bulaga, L. P. Garber, M. L. Perdue, K. Lohman, L. T. Daum, and D. L. Suarez Development of a real-time reverse transcriptase PCR assay for type A influenza virus and the avian H5 and H7 hemagglutinin subtypes. J Clin Microbiol 40:3256-3260. 2002.

% hatchabilitya Group 1 2 10 EID50/0.1ml 10 EID50/0.1ml

TK/OR/71-SEPRL 68 37

TK/OR/71-D-del pc1 82 18

TK/OR/71-D-del pc2 91 55

TK/OR/71-D-del pc3 36 10

TK/OR/71-D-del pc4 68 31

TK/OR/71-D-del pc5 26 31

Table 3.1. Hatchability of eggs vaccinated with different NS deletion variants.

a: Percent hatchability compared to that of control PBS inoculated group

Group % hatchabilitya rTK/OR/71-SEPRL 50 rTK/OR/71-SEPRL -ts 50 rTK/OR/71-D-del pc3 55 rTK/OR/71-D-del pc3-ts 22 rTK/OR/71-D-del pc4 78 rTK/OR/71-D-del pc4-ts 44

2 Table 3.2. Hatchability of eggs vaccinated with 10 EID50/0.1ml of reassortant viruses with or without ts mutations. a: Percent hatchability compared to that of control PBS inoculated group

Group % hatchabilitya rH5-TK/OR/71-D-del pc3 32 rH5-TK/OR/71-D-del pc4 39

A/Mute Swan/MI/451072-2/06 64 rH3- TK/OR/71-D-del pc3 58 rH3-TK/OR/71-D-del pc4 64

A/TK/OH/313053/04 45

2 Table 3.3. Hatchability of eggs vaccinated with 10 EID50/0.1ml of H5 or H3 subtype NS deletion variants.

a: Percent hatchability compared to that of control PBS inoculated group

Figure 3.1. Comparative growth analysis of reassortant viruses with or without ts

mutations in CEF (A) and MDCK (B) cells at 37°C and 41°C, respectively. Cells were

infected by each of rTK/OR/71-SEPRL, rTK/OR/71-SEPRL-ts, rTK/OR/71-D-del pc3, rTK/OR/71-D-del pc3-ts, rTK/OR/71-D-del pc4, rTK/OR/71-D-del pc4-ts at an MOI of

0.001. Cell supernatants were collected at 24, 48, and 72 hours post infection for virus

titration (log10EID50/ml) by real time RT-PCR.

CHAPTER 4

SEQUENCING AND MUTATIONAL ANALYSIS OF THE NON-CODING

REGIONS (NCRS) OF INFLUENZA A VIRUS

4.1 ABSTRACT

The genome of influenza A virus consists of eight negative-stranded RNA segments which contain one or two coding regions flanked by the 3’ and 5’ non-coding regions

(NCRs). Despite the importance of NCRs in replication and pathogenesis of influenza virus, sequencing of influenza virus genome has mainly been focused on coding regions of the individual genes and very limited NCR sequences are available. In this study, we sequenced the NCRs of seven influenza A virus strains of different host origin and varying pathogenicity using two recently developed methods (de Wit et al., J. Virol.

Methods 139:85-89, 2007; Szymkowiak et al., J. Virol. Methods 107:15-20, 2003). In addition to sequence and length variation present in the segment specific NCRs among different influenza strains, we also observed sequence variations at the fourth nucleotide of 3’ NCR of polymerase genes. To evaluate the role of sequence change in the NCRs in protein expression, we introduced mutations at the NCRs of two polymerase gene

segments, PB1 and PA, and created the green fluorescent protein (GFP) reporter plasmids. By measuring the GFP expression level, we confirmed that single or two mutations introduced at the 3’ and 5’ NCRs of PB1 and PA gene could alter the protein expression levels of these genes. In addition, we further confirmed that mutations in NCR of PA alone or PA and PB1 combination affect virus replication by characterizing reverse genetically created virus with specific mutations in vitro. Our study reaffirms the importance of NCRs in influenza virus replication and further analysis of their roles will lead to better understanding of influenza pathogenesis and development of live attenuated vaccines.

4.2 INTRODUCTION

Influenza A virus is a segmented negative sense RNA virus belonging to the

Orthomyxoviridae family. The virus genome consists of eight RNA segments containing one or two open reading frames (ORF) flanked by the 5’ and 3’ short non-coding regions

(NCRs). Sequence analysis showed that the first 12 nucleotides (except the 4th nucleotide in M and NA genes) at the 3’ end and the first 13 nucleotides at the 5’ end of NCR are conserved among all viral RNA segments (7, 37, 40), which form the promoter responsible for transcription and replication (9). These sequences were proven to be involved in the viral polymerase binding (12), cap-snatching (23), transcription initiation

(8), and packaging (26, 44). A single nucleotide mutation in the conserved region of the

viral RNA promoter impairs influenza virus RNA transcription in vitro (8) and in vivo

(19). Lee and Seong (1998) further showed that the nature of the nucleotide at the fourth

position of the 3’ end of the NA viral RNA is involved in regulation of both transcription

and replication (21). However, the effect of the same change was less significant in a

recent study done by de Wit et al. (2004) (6).

In addition to conserved sequences, the segment specific non-coding sequences with

different lengths are located between the panhandle structure (15) and the start codon at the 3’ end and also between the poly (U) stretch and the stop codon at the 5’ end of viral genome, respectively. In a study by Zheng et al. (1996), deletion of both ends of NA segment specific NCR showed decreased NA-specific viral RNA in infected cells and attenuated phenotype in tissue culture (49). The critical role of segment specific parts of

NCR in viral replication was further confirmed by Ng et al. (2008) (32). In addition to

NA segment, the deletion of 3’ segment specific NCR reduced NS viral RNA incorporation into virions implying that those regions may regulate the influenza A virus viral RNA packaging (11).

Although several studies showed that both conserved and segment specific sequences of

NCRs play an important role in transcription and thus in replication cycle of influenza A virus, those studies were done with limited strains on specific genes (eg. M and NA) due to limited NCR sequence information. Despite the acknowledged importance, the NCR sequencing of influenza A virus has lagged behind compared to the coding region sequencing, due mainly to inherent technical difficulties of sequencing 5’ and 3’ ends of the gene. Although several methods to sequence the 5’ and 3’ RNA ends were developed

earlier (10, 24), more practical and rapid methods specific to sequencing the NCRs of

influenza viruses, which utilize a T4 RNA ligase based strategy, were developed recently

(5, 43). Both of the methods rely on the ligation of viral RNA as a first step by T4 RNA

ligase which can ligate any single stranded DNA or RNA molecule with 5’ phosphoryl

terminal residue and 3’ hydroxyl terminal residue. The difference in the two methods is

that two segment specific primers are used to amplify NCR of each segment in a single

PCR reaction in Szymkowiak’s method, whereas two sets of one segment specific primer plus an additional universal primer are utilized to amplify NCR of each segment in two separate PCR reactions in de Wit’s method. In de Wit’s method, the first 3 nucleotide sequence at both ends of each gene segment, where the universal primers bind, can not be determined.

In this study, we utilized these two different methods to sequence the NCRs of seven avian influenza (AI) viruses of different host origin and varying pathogenicity. In addition, based on those NCR sequences analyzed, we assessed the effect of specific sequence in the NCR of PB1 and PA segments on protein expression and virus replication.

4.3 MATERIALS AND METHODS

Viruses, RNAs, and cells. The virus strains used in this study are listed in Table 4.1.

Low pathogenic AI viruses were obtained from the repository of Food Animal Health

Research Program, Wooster, Ohio. Viral RNAs were extracted with the RNeasy Mini kit

(Qiagen, Valencia, CA) from infectious allantoic fluids using a modified protocol as

previously described (41). RNAs from highly pathogenic AI viruses were kindly

provided by Dr. David Suarez (Southeast Poultry Research Laboratory, Athens, Georgia)

which were prepared by the Trizol (Invitrogen, Carlsbad, CA) method.

Human embryonic kidney cells (293T), used in the transfection study, were maintained in

Dulbecco’s Modified Eagle Medium supplemented with 10% fetal calf serum and were

maintained at 37 °C in 5% CO2.

T4 RNA ligation and RT-PCR. We utilized two recently developed methods with minor

modification to run RNA ligation and then RT-PCR (5, 43). For RNA ligation, sixteen ul

of RNeasy Mini kit extracted RNA together with 2 ul of 10× T4 RNA ligase buffer, 40

units of T4 RNA ligase (New England BioLabs, Ipswich, MA) and 8 units of RNase

Inhibitor (Promega, Madison, WI) in a total volume of 20 ul reaction were incubated at

37 °C for an hour, followed by heat inactivation at 65 °C for 15 min.

Standard RT-PCR was carried out in 25 ul reaction with the Qiagen one-step RT-PCR kit

(Qiagen) using each gene segment specific primers (43) or one universal primer, 5’ (5’-

CCTGCTTTTGCTAGT-3’) or 3’ (5’-CCTTGTTTCTACTAGC- 3’), and one segment

specific 5’ or 3’ primer (5). The sequence of segment specific primers is available upon

request. The reaction was performed in a GeneAmp PCR System 2400 machine (Perkin

Elmer) at the following conditions: 30 min at 50 °C and 15 min at 95 °C for RT step,

subsequently 35 times of 45 s at 94 °C, 30 s at 50 °C, 1 min at 72 °C, followed by 10 min

at 72 °C for PCR step.

Direct sequencing / cloning and sequencing. The RT-PCR products were analyzed on a

1.5% agarose gel by electrophoresis and amplified products were subsequently excised from the gel and purified using the QIAquick Gel Extraction Kit (Qiagen). Depending on the concentration of the sample, gel purified products were either directly sequenced or cloned into the TOPO-TA vector according to manufacturer’s protocol (Invitrogen,

Carlsbad, CA), then sequenced. Sequencing was performed at the sequencing facility of the Ohio Agriculture Research and Development Center (OARDC) using the ABI Prism

3100 automated sequencing machine (Applied Biosystems, Foster City, CA). Sequence comparisons were conducted by using the Megalign program using the Clustal V alignment algorithm (DNASTAR, Madison, WI).

Construction of GFP reporter plasmids. For construction of PB1 or PA segment-based minigenomes, primers containing different 5’ and 3’ NCRs of PB1 or PA segment were used to amplify the green fluorescent protein (GFP) reporter genes (derived from pEGFP-

N1 (Clonetech, Palo Alto, CA)) in antisense orientation (Fig. 4.1). PCR fragments were cloned into the pHH21 vector (31) and flanked by the human RNA polymerase I promoter and the mouse RNA polymerase I terminator sequence in this vector. We created constructs that had different combinations of sequences at specific positions and many PB1 or PA NCR sequences created corresponded to sequence of the different virus strains (PB1-1: CK/Indo/03 or WS/Mon/05; PB1-2: TK/WI/68, TK/OR/71, and

TK/OH/04; PB1-3: Egret/HK/02; PB1-4: TK/IL/04; PA-1: TK/IL/04, TK/OH/04, and

Egret/HK/02; PA-3: TK/WI/68-pHH21; PA-4: CK/Indo/03; PA-6: WS/Mon/05; PA-2, 5,

7, and 8 do not correspond to sequences of viruses used in this study). Each reporter plasmid were transfected with four protein expression plasmids (pPR10-PR8-PB2, 99

pPR10-PR8-PB1, pPR10-PR8-PA, and pPR10-PR8-NP, kindly provided by Dr. Nadia

Naffakh, Institut Pasteur, France) (27) into eukaryotic cells, which leads to transcription

of the GFP reporter gene, followed by the expression of GFP.

Transfection and flow cytometric analysis. 93T cells were transfected with plasmids,

with the use of Lipofectamine 2000 (Invitrogen) according to the manufacturer’s

instructions. Briefly, Lipofectamine 2000 (2ul per 1 ug of DNA) diluted in 250 ul Opti-

MEM® I Reduced-Serum Medium (Invitrogen) was incubated at room temperature for 5

min, then mixed with four protein expression plasmids and one of the GFP reporter

plasmids (1 ug each) diluted in 250-ul Opti-MEM® I Reduced-Serum Medium for 20 min

at room temperature, and added into the cells.

Forty-eight hours post transfection, GFP expression level was first assessed by inverted fluorescent microscope. Then, cells were washed with phosphate-buffered saline (PBS), pelleted, and suspended in 500 ul of FACS buffer (0.09% sodium azide, 1 × DPBS, and

3% FBS). Data acquisition was performed on a flow cytometer (BD FACSCalibur, San

Jose, CA) and percent cells and intensity of fluorescence was analyzed using CellQuest software (Becton Dickinson, Heidelberg, Germany). The data in this study are average of four separate experiments results.

Construction of transcription plasmids and rescue of NCR mutant viruses. Eight genes of A/TK/WI/68 were cloned into pHH21 transcriptional vector between the promoter and terminator sequences of RNA polymerase I. For generation of NCR mutant viruses, primers containing mutated nucleotides were used to amplify PA or PB1 genes followed by construction of transcription plasmids. Recombinant viruses were generated

100

by reverse genetics as described previously (30) and are shown in Table 4.3. The recovery of recombinant viruses was verified by partial sequencing.

Replication analysis in CEF cells. Primary CEF cells were prepared from 10-day-old eggs and were seeded (approximately 2×106 cells/well) in six-well tissue culture plates

the day before infection. The cells were infected by each recombinant virus at 0.001

MOI. After one hour absorption, virus inoculum was removed and replaced with media

with the addition of trypsin (0.35ug/ml). Supernatants of 140ul were collected at 2, 12,

24, 36, 48, and 60 hours post inoculation and used to extract viral RNA using the Viral

RNA kit (Qiagen). One-tube real-time RT-PCR was performed using the Qiagen one-step

RT-PCR kit (Qiagen) in a 25ul reaction mixture containing probe specific for the matrix

gene (41). For quantitation, samples were run together with known amounts of control

viral RNAs. Standard curves were generated with those control viral RNAs and the

amount of RNA in the samples was converted into EID50/0.2ml by interpolation (20, 41).

Statistical analyses. To determine the significant differences of level of GFP expression

among experimental groups, one-way ANOVA was performed using percent

fluorescence of cells. P-values were set at 0.05 (P<0.05).

4. 4 RESULTS

Sequence results. We first applied Szymkowiak’s method to obtain the entire NCR

sequences. Among NCR sequences of seven influenza strains, 62.5% (70 of 112 NCRs) 101

were amplified by Szymkowiak’s method. The NCR sequences that could not be determined by Szymkowiak’s method were completed by de Wit’s method. The first 3 nucleotide sequence at both ends of each gene segment, where the universal primers bind, could not be determined using the latter method and are indicated as X in table 4.2.

The nucleotide sequences of cDNAs corresponding to the 3’ and 5’ NCRs of each of the eight segments of 7 isolates were determined and compared with the published sequences

(Table 4.2). NCR sequences obtained by Szymkowiak’s method showed that the first 3 nucleotides at 3’ and 5’ ends were conserved. Except the fourth nucleotide of 3’ NCR, the terminal 13 and 12 nucleotides of the 5’ and 3’ ends, respectively, were conserved in all eight vRNA gene segments (Table 4.2), which is consistent with previous studies (7,

37). However, it should be noted that we observed this fourth nucleotide variation in polymerase genes (PA and PB1) which have been thought to be invariably “G”.

Previously, variation was observed only in NA and M genes and it is a first report to show the sequence variation at this position of polymerase genes to our knowledge.

NCR sequences of polymerase segments were relatively conserved. Nucleotide variations only in three and two positions at the 3’ and 5’ NCR of PB2, respectively, were present

(Table 4.2). Human isolates have “T” and “A” instead of “A” and “T” in selected avian isolates at position 17 and 26 of the 3’ and 5’ end, respectively. In the PB1 NCR, two variable positions, one each at the 3’ and 5’ regions, were observed. At 5’ NCR of PB1, all highly pathogenic H5N1 viruses had nucleotide “G” at the 24th position while other isolates had “A”. Nucleotide variations at three and four positions were observed at 3’ and 5’ NCRs of PA gene, respectively.

102

Due to sequence variations, subtype specific primers were designed and used to amplify

the NCRs of different subtypes of the HA (H3, H5, H7) and NA (N1, N2, N3, N9) genes.

HA NCRs differed in length in the range of 21-29 nucleotides at the 3’ NCR and 27-44 nucleotides at the 5’ NCR. Among the NCR sequences of H5 subtype viruses, 3’ and 5’

NCR sequences of H5N9 subtype viruses (TK/WI/68, TK/Ontario/66) had 3-and 4- nucleotide differences from other H5 subtype viruses. Compared to turkey H3 viruses, human H3 isolates have two nucleotide variations at 3’ NCR and longer length of 5’

NCR. Different NA subtypes also had different length of NCR ranging from 18-20 nucleotides at the 3’ NCR and 25-37 nucleotides at the 5’ NCR. Even in the same N2 subtype, there were also different lengths of 5’ NCR and two nucleotide variations between turkey and human origin H3N2 viruses. It should be mentioned that WSN/33

H1N1 virus has 19 nt at the 3’ NCR of NA which is different from 20 nt observed in other strains. The WSN/33 strain also had “G” at the 4th position of 3’ NCR while other strains had “A” (14).

In the 3’ NCR of NP segment, there were ten positions which had nucleotide variations.

At the 5’ NCR of NP segment, recent swine-lineage H3N2 viruses isolated from turkeys had “GG” or “AG” in the 22nd and 23rd position which is different from “GA” in other

subtype viruses.

Compared to other genes, NCRs of M segment showed relatively higher homology and

no sequence variations at 5’ NCRs of different strains. At 3’ NCR, we only observed

variations at 2 positions.

103

NS genes are divided into two subtypes or alleles: A and B (25, 42). Based on conserved sequence of NS allele A and B, we designed two sets of NS allele specific primers. In

NCRs of NS gene, one and two nucleotide variations were observed at 3’ and 5’ NCRs, respectively.

Reporter gene expression. To investigate whether the NCR sequence affects the expression of reporter gene, we constructed GFP reporter plasmids that contain different

NCR sequences as shown in Figure 4.1. The GFP expression in 293T cells was assessed by inverted fluorescent microscope and FACS analysis at 48-hours after transfection. In

FACS analysis, we observed a single narrow peak at 101 log intensity among different constructs which indicates similar level of GFP expression per cell. Among GFP reporter plasmids containing PB1 NCR sequences, pHH21-PB1-3, which has the same NCR sequence as that of Egret/HK/02 virus, showed the highest percentage of cells expressing

GFP, followed by PB1-1 (has sequence of CK/Indonesia/03 or WS/Mongolia/05 viruses) and PB1-2 (has sequence of TK/WI/68, TK/OR/71, or TK/OH/04 viruses). Although the difference in percent GFP expression produced by these 3 plasmids was obvious under the fluorescent microscope and FACS analysis, the difference was not statistically significant. The PB1-4, which contained NCR sequence of the TK/IL/04 strain, expressed significantly less fluorescence and the expression was not detectable under the microscope (Fig. 4.2A). Among GFP reporter plasmids containing PA NCR sequences, pHH21- PA-6, which has the WS/Mongolia/05 NCR sequence, expressed the highest

GFP level (Fig. 4.2B). All the pHH21-PA plasmids expressed relatively high levels of

GFP ranging from 37.8% to 50.5%. The PA-2, which has NCR sequence that does not correspond to any of the viruses used in this study, expressed the lowest level of GFP 104

(37.8%). We also observed that the 24th nucleotide change in the 5’ NCR of PB1 from A

(PB1-2 or PB1-4) to G (PB1-1 or PB1-3) or the twentieth nucleotide change in the 3’

NCR of PA from C (PA-1, PA-4, PA-2, or PA-7) to T (PA-3, PA5, PA-6, or PA-8)

increased the protein expression level.

Replication analysis. Growth properties of recombinant viruses, WI-WT, WI-PA 3’ 4th

A, WI-PA,PB1 3’ 4th A, WI-PA 3' 20th C 5' 41th C,55th G, and WI-PA 3’ 11th T, 5’ 12th A were analyzed on CEF cells. Confluent CEF cells were infected at a MOI of 0.001 and viruses present in the media were titrated by real time RT-PCR (Fig. 4.3). Viruses reach peak titers 48-60 h after infection. Recombinant viruses with 4th A at PA or PA and PB1

segments replicated better than wild type virus, while WI- PA 3' 20th C 5' 41th C,55th G with 3 nucleotide differences from wild type virus had decreased replication. Based on previous studies (3), we created WI-PA 3’ 11th T, 5’ 12th A which has mutations in virus

promoter as a control. Our results showed that promoter mutations in PA decreased virus

replication compared to wild type virus.

4.5 DISCUSSION

In this study, we first applied the Szymkowiak’s method to get the entire NCR sequences.

However, this method has more chance to amplify the frayed RNA as noticed previously

(43). During ligation, T4 RNA ligase not only ligates intact RNA segments, but also

ligates RNA segments with frayed terminal ends. Therefore, this method cannot eliminate

105

amplifying the ligated RNA with frayed terminal ends and we observed artificial deletions in the 5’ or 3’ ends at the connection site of RNA. The most common deletion was observed at the 5’ end of segments, ranging from 5 to 43 nucleotides in our study, whereas the first nucleotide deletion in the 3’ end of the gene segments was most common in a previous study (43). Although this method has lower efficiency compared to de Wit’s method, we were able to obtain full length NCR sequences from 62.5% of the

NCR sequences we tried to amplify.

For those NCR sequences that we failed to determine by Szymkowiak’s method, we used de Wit’s method to complete the sequencing. Using the universal primers, only intact ligated RNA and concatemers can be used as PCR template in this method. Therefore, this method has a high efficiency, but requires more ligated RNA templates to run two separate PCR reactions per segment. In addition, the first three nucleotides at the 5’ and

3’ ends, where the universal primer binds, cannot be determined. However, we observed no sequence difference in those 3 nucleotides among NCR sequences of seven influenza virus strains determined by the Szymkowiak’s method indicating that these nucleotides are highly conserved (Table 4.2). Therefore, data from this and previous studies (7) support that de Wit’s method could be used for rapid sequencing of NCRs of influenza A viruses.

The complete NCR sequences of seven AI virus strains used in our study were compared with those of other influenza A virus strains from published papers. We confirmed that

12 nucleotides at the 3’ termini (except the fourth nucleotide) and 13 nucleotides at the 5’ termini were common to all segments examined. Within these conserved sequences, a

106

unique natural variation (U or C) at 4th position of the 3’ end is observed in NA and M

segments in previous studies (7, 37). With limited sequencing data available, researchers

believe that the polymerase segments (PB2, PB1 and PA) invariably carry a C nucleotide at this position (C4) (21, 23, 32, 34). However, we observed that sequence variations, G or A (plus sense), were also present at 4th position of the polymerase genes (Table 4.2). In

general, universal primers containing G at this position in polymerase genes are being

used for PCR amplification when rescuing influenza A viruses using reverse genetics

(46) and it is possible that those reverse genetically generated viruses without sequence

confirmation may behave differently from wild type viruses due to sequence difference in

NCR.

All highly pathogenic H5N1 subtype viruses had nucleotide “G” while other isolates had

“A” at the 24th position of 5’ NCR of PB1 (Table 4.2), and even in H5 subtype isolates,

H5N9 viruses (TK/WI/68, TK/Ontario/66) had 4 and 3 nucleotides different from other

H5N1 subtype viruses at the 5’ and 3’ NCR, respectively (Table 4.2). In addition to

sequence variation, we observed that different subtypes have different NCR lengths in the

HA and NA segments. These differences could contribute to varying virulence and/or

host specificity.

To analyze the effect of PA and PB1 NCR sequence on protein expression, GFP reporter

plasmids were constructed. Our results demonstrated that the fourth nucleotide change of

PB1 or PA 3’ NCR from G (PB1-1, PA-1, PA-2 or PA-3) to A (PB-3, PA-4, PA-7 or PA-

5) increased the protein expression levels, which is consistent with the previous result on

the NA segment (21) where this change causes a large structural change in the promoter

107

(23). However, we also observed a contradicting result in both PB1 and PA segments

with same G (PB1-2 or PA-6) to A (PB1-4 or PA-8) change. It is possible that down

regulation we observed may result from influence of promoter secondary structure due to

nucleotide changes in both the 5’ and 3’ NCR sequences. However, no reporter

expression with PB1-4, that has the NCRs of TK/IL/04, is a striking result and hard to

explain. We speculate the down regulation may result from incompatible interaction

between polymerase complex (PR/8/34) and NCR sequences (TK/IL/04) used in our

study because the wild type TK/IL/04 virus strain replicates well both in MDCK cells and infected birds (48). It is possible to obtain different results if homologous expression plasmids with each NCR sequence of viruses are used due to unknown host range determinant within the NCRs. In the same context, it is also possible that the use of different species origin of cell line other than human kidney origin 293T cells could have

affected the reporter expression.

Many studies have demonstrated that the amino acids in different genes are responsible

for influenza virus pathogenicity (4, 13, 29, 38, 47). Two of the H5N1 viruses used in our

study (Egret/HK/02 and CK/Indonesia/03) demonstrate different pathogenicity in ducks,

Egret/HK/02 is highly virulent in ducks whereas CK/Indonesia/03 is less pathogenic,

although both of them are highly pathogenic in chickens and quail (35). Previously,

amino acid changes at position 515 of the PA gene and 436 of the PB1 gene were shown

to be associated with high lethality in ducks (16). However, until now the role of NCR

sequences in virus pathogenicity has received very limited attention. In our study, we

observed different levels of GFP expression between reporter plasmids containing PB1

and PA NCR of Egret/HK/02 and CK/Indonesia/03. This kind of regulation of protein 108

expression might be critical for Egret/HK/02 strain to utilize the host cells’ resources effectively, which could provide another explanation for its high virulence in ducks.

However, the difference in GFP expression among different constructs was small and

those specific nucleotide changes in the NCR may not affect the biological characteristics

of the virus in vivo as we observed in vitro. It is also possible that the effect of PA or PB1

NCR on protein expression in influenza viruses might be counteracted by other viral

genes.

To further investigate the role of those sequence variations in NCR in virus replication

cycle and whether differences in in vitro protein expression levels correlate with virus

replication characteristics, we reverse genetically generated several viruses with

mutations in NCRs using A/TK/WI/68 (H5N9) strain. We first assessed effect of variations in PA or PA and PB1 NCRs on virus replication in vitro. The 4th nucleotide

change of 3’ NCR in PA alone or PA and PB1 from G to A increased virus replication

(Fig. 4.3). In a previous study, the same mutation in NA segment of A/WSN/33 (H1N1)

has similar effect on virus replication (21).The effect of nucleotide change at this position

on virus replication could be due to a change in virus promoter structure as demonstrated

in NA segments (22). Compared to wild type virus, three nucleotide changes in segment

specific region of PA NCR also decreased virus replication (Fig. 4.3). To our knowledge,

this is the first report that nucleotide changes at those positions affect virus replication.

Previous studies showed that mutations (nucleotide changes, insertion, or deletion) in NA

segment specific NCR affect virus replications (2, 49), but the mechanism or the role of

segment specific region of NCR in virus replication is still unknown. One possible

explanation is that mutations in NCR segment specific regions may affect virus promoter 109

structure stability, which is recognized by polymerases. In addition, in case of mutations

in NCRs of PA segment, GFP reporter protein expression levels were positively

correlated with virus replication characteristics. Nucleotide changes in PA segment that

resulted in higher GFP expression levels also showed increase in virus replication (Table

4.3). In this study, recombinant virus WI-PA 3’ 11th T, 5’ 12th A which has mutations in

PA promoter at both sides was generated as a control virus to check whether mutations in

NCR affect virus replication, based on previous studies (3). Our data showed that mutations in PA promoter decreased virus replication, and the maximum titer of mutant virus is 0.6 log lower than that of wild type virus. By contrast, Catchpole et al. showed that a transfectant virus with same mutations in PA promoter achieved similar virus titers to wild type A/WSN/33 virus, while the titer of virus with mutations in NS promoter was

3 log lower (3). These differences between our and previous studies could result from that effect of mutations in promoter on virus replication is strain or subtype specific.

Further in vivo characterization is necessary to assess the potential of introducing specific mutation in the NCR described above in development of live attenuated vaccines.

In conclusion, we successfully applied two different methods for NCR amplification and sequencing of influenza viruses of different origin and pathogenicity.

To our knowledge, this is the most extensive NCR sequence study of influenza A viruses.

Our sequence analysis confirmed that 12 nucleotides at the 3’ termini (except the fourth nucleotide) and 13 nucleotides at the 5’ termini were common to all segments examined.

In addition to NA and M segments, sequence variations (C or U) of NCRs were also present at the 4th position of 3’ NCR in the polymerase genes. We also found that reporter

110

protein expression and virus replication could be regulated by nucleotide changes within

the NCR, which could be associated with virus pathogenicity and host specificity.

4.6 ACKNOWLEDGEMENTS

The authors would like to thank Megan Strother, Keumsuk Hong, and Suzanne Deblois

for technical assistance with this work. Thanks are also extended to Drs. David Suarez

and Nadia Naffakh for providing RNAs and expression plasmids for the study.

4.7 REFERENCES

1. Bentley, D. R., and G. G. Brownlee. 1982. Sequence of the N2 neuraminidase from influenza virus A/NT/60/68. Nucleic Acids Res 10:5033-42.

2. Bergmann, M., and T. Muster. 1996. Mutations in the nonconserved noncoding sequences of the influenza A virus segments affect viral vRNA formation. Virus Res 44:23-31.

3. Catchpole, A. P., L. J. Mingay, E. Fodor, and G. G. Brownlee. 2003. Alternative base pairs attenuate influenza A virus when introduced into the duplex region of the conserved viral RNA promoter of either the NS or the PA gene. J Gen Virol 84:507-15.

4. Conenello, G. M., D. Zamarin, L. A. Perrone, T. Tumpey, and P. Palese. 2007. A single mutation in the PB1-F2 of H5N1 (HK/97) and 1918 influenza A viruses contributes to increased virulence. PLoS Pathog 3:1414-21.

5. de Wit, E., T. M. Bestebroer, M. I. Spronken, G. F. Rimmelzwaan, A. D. Osterhaus, and R. A. Fouchier. 2007. Rapid sequencing of the non-coding regions of influenza A virus. J Virol Methods 139:85-9.

6. de Wit, E., M. I. Spronken, T. M. Bestebroer, G. F. Rimmelzwaan, A. D. Osterhaus, and R. A. Fouchier. 2004. Efficient generation and growth of influenza virus A/PR/8/34 from eight cDNA fragments. Virus Res 103:155-61.

111

7. Desselberger, U., V. R. Racaniello, J. J. Zazra, and P. Palese. 1980. The 3' and 5'-terminal sequences of influenza A, B and C virus RNA segments are highly conserved and show partial inverted complementarity. Gene 8:315-28.

8. Fodor, E., D. C. Pritlove, and G. G. Brownlee. 1995. Characterization of the RNA-fork model of virion RNA in the initiation of transcription in influenza A virus. J Virol 69:4012-9.

9. Fodor, E., D. C. Pritlove, and G. G. Brownlee. 1994. The influenza virus panhandle is involved in the initiation of transcription. J Virol 68:4092-6.

10. Frohman, M. A., M. K. Dush, and G. R. Martin. 1988. Rapid production of full-length cDNAs from rare transcripts: amplification using a single gene- specific oligonucleotide primer. Proc Natl Acad Sci U S A 85:8998-9002.

11. Fujii, K., Y. Fujii, T. Noda, Y. Muramoto, T. Watanabe, A. Takada, H. Goto, T. Horimoto, and Y. Kawaoka. 2005. Importance of both the coding and the segment-specific noncoding regions of the influenza A virus NS segment for its efficient incorporation into virions. J Virol 79:3766-74.

12. Hagen, M., T. D. Chung, J. A. Butcher, and M. Krystal. 1994. Recombinant influenza virus polymerase: requirement of both 5' and 3' viral ends for endonuclease activity. J Virol 68:1509-15.

13. Hatta, M., P. Gao, P. Halfmann, and Y. Kawaoka. 2001. Molecular basis for high virulence of Hong Kong H5N1 influenza A viruses. Science 293:1840-2.

14. Hiti, A. L., and D. P. Nayak. 1982. Complete nucleotide sequence of the neuraminidase gene of human influenza virus A/WSN/33. J Virol 41:730-4.

15. Hsu, M. T., J. D. Parvin, S. Gupta, M. Krystal, and P. Palese. 1987. Genomic RNAs of influenza viruses are held in a circular conformation in virions and in infected cells by a terminal panhandle. Proc Natl Acad Sci U S A 84:8140-4.

16. Hulse-Post, D. J., J. Franks, K. Boyd, R. Salomon, E. Hoffmann, H. L. Yen, R. J. Webby, D. Walker, T. D. Nguyen, and R. G. Webster. 2007. Molecular changes in the polymerase genes (PA and PB1) associated with high pathogenicity of H5N1 influenza virus in mallard ducks. J Virol 81:8515-24.

17. Jones, K. L., J. A. Huddleston, and G. G. Brownlee. 1983. The sequence of RNA segment 1 of influenza virus A/NT/60/68 and its comparison with the corresponding segment of strains A/PR/8/34 and A/WSN/33. Nucleic Acids Res 11:1555-66.

18. Kaptein, J. S., and D. P. Nayak. 1982. Complete nucleotide sequence of the polymerase 3 gene of human influenza virus A/WSN/33. J Virol 42:55-63.

112

19. Kim, H. J., E. Fodor, G. G. Brownlee, and B. L. Seong. 1997. Mutational analysis of the RNA-fork model of the influenza A virus vRNA promoter in vivo. J Gen Virol 78 ( Pt 2):353-7.

20. Lee, C. W., D. A. Senne, and D. L. Suarez. 2004. Generation of reassortant influenza vaccines by reverse genetics that allows utilization of a DIVA (Differentiating Infected from Vaccinated Animals) strategy for the control of avian influenza. Vaccine 22:3175-81.

21. Lee, K. H., and B. L. Seong. 1998. The position 4 nucleotide at the 3' end of the influenza virus neuraminidase vRNA is involved in temporal regulation of transcription and replication of neuraminidase RNAs and affects the repertoire of influenza virus surface antigens. J Gen Virol 79 ( Pt 8):1923-34.

22. Lee, M. K., S. H. Bae, C. J. Park, H. K. Cheong, C. Cheong, and B. S. Choi. 2003. A single-nucleotide natural variation (U4 to C4) in an influenza A virus promoter exhibits a large structural change: implications for differential viral RNA synthesis by RNA-dependent RNA polymerase. Nucleic Acids Res 31:1216-23.

23. Lee, M. T., K. Klumpp, P. Digard, and L. Tiley. 2003. Activation of influenza virus RNA polymerase by the 5' and 3' terminal duplex of genomic RNA. Nucleic Acids Res 31:1624-32.

24. Liu, X., and M. A. Gorovsky. 1993. Mapping the 5' and 3' ends of Tetrahymena thermophila mRNAs using RNA ligase mediated amplification of cDNA ends (RLM-RACE). Nucleic Acids Res 21:4954-60.

25. Ludwig, S., U. Schultz, J. Mandler, W. M. Fitch, and C. Scholtissek. 1991. Phylogenetic relationship of the nonstructural (NS) genes of influenza A viruses. Virology 183:566-77.

26. Luytjes, W., M. Krystal, M. Enami, J. D. Parvin, and P. Palese. 1989. Amplification, expression, and packaging of foreign gene by influenza virus. Cell 59:1107-13.

27. Massin, P., P. Rodrigues, M. Marasescu, S. van der Werf, and N. Naffakh. 2005. Cloning of the chicken RNA polymerase I promoter and use for reverse genetics of influenza A viruses in avian cells. J Virol 79:13811-6.

28. Naeve, C. W., and R. G. Webster. 1983. Sequence of the hemagglutinin gene from influenza virus A/Seal/Mass/1/80. Virology 129:298-308.

29. Neumann, G., and Y. Kawaoka. 2006. Host range restriction and pathogenicity in the context of influenza pandemic. Emerg Infect Dis 12:881-6.

113

30. Neumann, G., T. Watanabe, H. Ito, S. Watanabe, H. Goto, P. Gao, M. Hughes, D. R. Perez, R. Donis, E. Hoffmann, G. Hobom, and Y. Kawaoka. 1999. Generation of influenza A viruses entirely from cloned cDNAs. Proc Natl Acad Sci U S A 96:9345-50.

31. Neumann, G., A. Zobel, and G. Hobom. 1994. RNA polymerase I-mediated expression of influenza viral RNA molecules. Virology 202:477-9.

32. Ng, S. S., O. T. Li, T. K. Cheung, J. S. Malik Peiris, and L. L. Poon. 2008. Heterologous influenza vRNA segments with identical non-coding sequences stimulate viral RNA replication in trans. Virol J 5:2.

33. Odagiri, T., and K. Tobita. 1990. Nucleotide sequence of the PA gene of influenza A/WSN/33(H1N1). Nucleic Acids Res 18:654.

34. Palese, P., Shaw, M.L. 2007. Orthomyxoviridae: the viruses and their replication, p. 1647-1689. In D. M. Knipe, Howley, P.M. (ed.), Fields Virology, 5th ed. Lippincott Williams and Wilkins, Philadelphia, PA.

35. Pantin-Jackwood, M. J., D. L. Suarez, E. Spackman, and D. E. Swayne. 2007. Age at infection affects the pathogenicity of Asian highly pathogenic avian influenza H5N1 viruses in ducks. Virus Res 130:151-61.

36. Philpott, M., C. Hioe, M. Sheerar, and V. S. Hinshaw. 1990. Hemagglutinin mutations related to attenuation and altered cell tropism of a virulent avian influenza A virus. J Virol 64:2941-7.

37. Robertson, J. S. 1979. 5' and 3' terminal nucleotide sequences of the RNA genome segments of influenza virus. Nucleic Acids Res 6:3745-57.

38. Seo, S. H., E. Hoffmann, and R. G. Webster. 2002. Lethal H5N1 influenza viruses escape host anti-viral cytokine responses. Nat Med 8:950-4.

39. Sivasubramanian, N., and D. P. Nayak. 1982. Sequence analysis of the polymerase 1 gene and the secondary structure prediction of polymerase 1 protein of human influenza virus A/WSN/33. J Virol 44:321-9.

40. Skehel, J. J., and A. J. Hay. 1978. Nucleotide sequences at the 5' termini of influenza virus RNAs and their transcripts. Nucleic Acids Res 5:1207-19.

41. Spackman, E., D. A. Senne, T. J. Myers, L. L. Bulaga, L. P. Garber, M. L. Perdue, K. Lohman, L. T. Daum, and D. L. Suarez. 2002. Development of a real-time reverse transcriptase PCR assay for type A influenza virus and the avian H5 and H7 hemagglutinin subtypes. J Clin Microbiol 40:3256-60.

42. Suarez, D. L., and M. L. Perdue. 1998. Multiple alignment comparison of the non-structural genes of influenza A viruses. Virus Res 54:59-69. 114

43. Szymkowiak, C., W. S. Kwan, Q. Su, T. J. Toner, A. R. Shaw, and R. Youil. 2003. Rapid method for the characterization of 3' and 5' UTRs of influenza viruses. J Virol Methods 107:15-20.

44. Tchatalbachev, S., R. Flick, and G. Hobom. 2001. The packaging signal of influenza viral RNA molecules. RNA 7:979-89.

45. Verhoeyen, M., R. Fang, W. M. Jou, R. Devos, D. Huylebroeck, E. Saman, and W. Fiers. 1980. Antigenic drift between the haemagglutinin of the Hong Kong influenza strains A/Aichi/2/68 and A/Victoria/3/75. Nature 286:771-6.

46. Wang, S., Q. Liu, J. Pu, Y. Li, L. Keleta, Y. W. Hu, J. Liu, and E. G. Brown. 2008. Simplified recombinational approach for influenza A virus reverse genetics. J Virol Methods 151:74-8.

47. Wasilenko, J. L., C. W. Lee, L. Sarmento, E. Spackman, D. R. Kapczynski, D. L. Suarez, and M. J. Pantin-Jackwood. 2008. NP, PB1, and PB2 viral genes contribute to altered replication of H5N1 avian influenza viruses in chickens. J Virol 82:4544-53.

48. Yassine, H. M., M. Q. Al-Natour, C. W. Lee, and Y. M. Saif. 2007. Interspecies and intraspecies transmission of triple reassortant H3N2 influenza A viruses. Virol J 4:129.

49. Zheng, H., P. Palese, and A. Garcia-Sastre. 1996. Nonconserved nucleotides at the 3' and 5' ends of an influenza A virus RNA play an important role in viral RNA replication. Virology 217:242-51.

115

Virus strain Abbreviation Subtype Pathotype*

A/Turkey/Wisconsin/68 TK/WI/68 H5N9 LPAI

A/Turkey/Oregon/71 TK/OR/71 H7N3 LPAI

A/Turkey/Illinois/04 TK/IL/04 H3N2 LPAI

A/Turkey/Ohio/313053/04 TK/OH/04 H3N2 LPAI

A/Egret/Hong Kong/757.2/02 Egret/HK/02 H5N1 HPAI

A/Chicken/Indonesia/7/03 CK/Indo/03 H5N1 HPAI

A/Whooper swan/Mongolia/244/05 WS/Mon/05 H5N1 HPAI

Table 4.1. Influenza A virus strains used in this study

* LPAI: low pathogenic avian influenza; HPAI: highly pathogenic avian influenza

116

Table 4.2. Sequence comparison of the 3’ and 5’ NCR of each gene segment.

NCR Sequences of Egret/HK/02, CK/Indonesia/03, WS/Mongolia/05, TK/IL/04,

TK/OH/04, TK/OR/71, TK/WI/68 are shown in bold font and compared to the published

sequences-A/WSN/33: PB2 (18), PB1 (39), PA (33), N1 (14); A/FPV/Rostock/34: PB2,

PB1, PA, NP, M, NS (37); A/TK/Turkey/05 and A/Bilthoven/68: PB2, PB1, PA, HA,

NA, M, NS (5); Seal/Mass/80: H7 (28); A/NT/60/68: PB2 (17) N2 (1); A/TK/Ontario/66:

H5 (36); A/Aichi/2/68: H3 (45). Sequences are shown in message sense 5’ to 3’.

Majority line, consensus sequences; dot, the same nucleotide as in the Majority line; X, undetermined sequences; N, unavailable sequences; R, A or G.

117

PB2 Strain 3’ NCR 5’ NCR 1 6 11 16 21 26 31 26 21 16 11 6 1 Majority AGCGAAAGCAGGTCAAATATATTCAAT TGTCGAATTGTTTAAAAACGACCTTGTTTCTACT Egret/HK/02 ...... CK/Indonesia/03 ...... WS/Mongolia/05 ...... TK/IL/04 ...... TK/OH/04 ...... TK/OR/71 XXX...... XXX TK/WI/68 XXX...... XXX A/WSN/33 ...... T...... A...... A/Bilthoven/68 XXX...... T...... C NNNN....A...... XXX A/NT/60/68 ...A...... T...... C ...T....A...... A/FPV/Rostock/34 ...... A/TK/Turkey/05 XXX...... NNNN...... XXX PB1 1 6 11 16 21 41 36 31 26 21 16 11 6 1 Majority AGCGAAAGCAGGCAAACCATTTGA TGAATTTAGCTTGTCCTTCATGAAAAAATGCCTTGTTTCTACT Egret/HK/02 ...A...... G...... CK/Indonesia/03 XXX...... G...... XXX WS/Mongolia/05 XXX...... G...... XXX TK/IL/04 ...A...... TK/OH/04 ...... XXX TK/OR/71 ...... TK/WI/68 ...... A/WSN/33 ...... A/FPV/Rostock/34 ...... A/TK/Turkey/05 XXX...... NNNNNNNNNNNNN...... G...... XXX A/Bilthoven/68 XXX...... NNNNNNNNNNNNN...... XXX

PA 1 6 11 16 21 56 51 46 41 36 31 26 21 16 11 6 1 Majority AGCGAAAGCAGGTACTGATTCAAA TTGTGGCAATGCTACTATTTGCTATCCATACTGTCCAAAAAAGTACCTTGTTTCTACT Egret/HK/02 ...... C...... CK/Indonesia/03 XXXA...... C...... XXX WS/Mongolia/05 ...... G...... C...... TK/IL/04 ...... C...... TK/OH/04 ...... C...... TK/OR/71 ...... C...... T...... TK/WI/68 ...... A/WSN/33 ...... A/FPV/Rostock/34 ...... C...... A/TK/Turkey/05 XXXA...... NNNNNNNNNNNNNNNNNNNNNNNNNNNN...... XXX A/Bilthoven/68 XXXA...... G.. NNNNNNNNNNNNNNNNNNNNNNNNNNNN...... XXX

H3 1 6 11 16 21 26 31 26 21 16 11 6 1 Majority AGCAAAAGCAGGGGATATTTCTATTAACC GTGGTGCATTAATTAAAAACACCCTTGTTTCTACT TK/IL/04 ...... TK/OH/04 ...... XXX A/Bilthoven/68 XXX...... A...... T. NNNNNTT.G...... XXX A/Aichi/2/68 XXXXXXXXXXXXXX...A...... T. GTGTATT.XXXXXXXXXXXXXXXXXXXXXXXXXXX H5 1 6 11 16 21 26 41 36 31 26 21 16 11 6 1 Majority AGCAAAAGCAGGGGTTCAATCTGTCAAA ATTTGTGAGTTCAGATTGTAGTTAAAAACACCCTTGTTTCTACT Egret/HK/02 ...... CK/Indonesia/03 XXX...... XXX WS/Mongolia/05 XXX...... XXX TK/WI/68 ...... CT.....A..... GA...... T..A...... A/TK/Turkey/05 XXX...... XXX A/TK/Ontario/66 XXXXXXXXXXXX...CT.....A..... GA...... T..A...... XXXXXXXXXXXXX

H7 1 6 11 16 21 26 21 16 11 6 1 Majority AGCAAAAGCAGGGGATACAAA TTTGAGAAAAACACCCTTGTTTCTACT TK/OR/71 XXX...... XXX Seal/Mass/80 XXXXXXXXXXXX...... XXXXXXXXXXXXX

Table 4.2. Continued 118

Table 4.2. Continued NP 1 6 11 16 21 26 31 36 41 21 16 11 6 1 Majority AGCAAAAGCAGGGTAGATAATCACTCACTGAGTGACATCAACATC AGAAAAATACCCTTGTTTCTACT Egret/HK/02 XXX...... G...... CK/Indonesia/03 XXX...... C...... XXX WS/Mongolia/05 XXX...... C...... TK/IL/04 ...... A...... GGAGC. G...... TK/OH/04 ...... A...... G.AGC. GA...... TK/OR/71 ...... C...... TK/WI/68 ...... C...... C...... A/FPV/Rostock/34 ...... T...... G.R..C.T...... A/TK/Turkey/05 XXX...... C.NNNNNNNNNNNNNNN ...... XXX A/Bilthoven/68 XXX...... NNNNNNNNNNNNNNN G...... XXX

N1 1 6 11 16 26 21 16 11 6 1 Majority AGCAAAAGCAGGAGTTCAAA TTTGTTCAAAAAACTCCTTGTTTCTACT Egret/HK/02 XXX...... CK/Indonesia/03 XXX...... XXX WS/Mongolia/05 XXX...... XXX A/WSN/33 ...G...... T...... A/TK/Turkey/05 XXX...... XXX

N2 1 6 11 16 36 31 26 21 16 11 6 1 Majority AGCAAAAGCAGGAGTAAAG GGCTTTCGCAATTTTAGAAAAAACTCCTTGTTTCTACT TK/IL/04 ...... C...... TK/OH/04 ...... A/Bilthoven/68 XXX...... G..A NNNNNNNNA.T...AGA...... XXX A/NT/60/68 XXXXXXXXXXXX...G..A .CT..CGCA.T...AGA...... XXXXXXXXXXXXX N3 1 6 11 16 21 16 11 6 1 Majority AGCAAAAGCAGGTGCGAG CAGAAAAAAGCACCTTGTTTCTACT TK/OR/71 ...... N9 1 6 11 16 26 21 16 11 6 1 Majority AGCAAAAGCAGGGTCAAG GATACAGAAAAAAGACCCTTGTTTCTACT TK/WI/68 XXX...... XXX

M 1 6 11 16 21 16 11 6 1 Majority AGCAAAAGCAGGTAGATGTTGAAAG AAAACTACCTTGTTTCTACT Egret/HK/02 XXX...... CK/Indonesia/03 XXX...... XXX WS/Mongolia/05 ...... TK/IL/04 ...... T...... TK/OH/04 ...... T...... TK/OR/71 ...... A...... XXX TK/WI/68 ...... A...... A/FPV/Rostock/34 ...... A..T...... A/TK/Turkey/05 XXX...... A...... XXX A/Bilthoven/68 XXX...... A...... XXX NS 1 6 11 16 21 26 26 21 16 11 6 1 Majority AGCAAAAGCAGGGTGACAAAAACATA TGATAAAAAACACCCTTGTTTCTACT Egret/HK/02 XXX...... A...... XXX CK/Indonesia/03 XXX...... XXX WS/Mongolia/05 XXX...... G...... XXX TK/IL/04 ...... G...... XXX TK/OH/04 ...... T...... XXX TK/OR/71 ...... AC...... XXX TK/WI/68 ...... AC...... A/FPV/Rostock/34 ...... A/TK/Turkey/05 XXX...... XXX A/Bilthoven/68 XXX...... G...... XXX

119

Recombinant Virus Same NCR sequences with those of following reporter plasmids*

WI-WT PA-3 PB1-2

WI-PA 3’ 4thA PA-5 PB1-2

WI-PA,PB1 3’ 4th A PA-5 PB1-4

WI-PA 3' 20thC 5' 41thC,55thG PA-2 PB1-2

WI-PA 3’ 11th T, 5’ 12th A NA** PB1-2

Table 4.3. Recombinant viruses generated by reverse genetics that contain specific NCR sequence changes in PA and PB1 segments.

*: Refer to Figure 4.1.

**: not available

120

pol I promoter NCR GFP NCR pol I terminator

PB1 or PA NCR PB1 or PA NCR (5’ end of viral RNA) (3’ end of viral RNA)

B. Plasmid Name

PB1-1 AGTAGAAACAAGGCATTTTTTCACGAAGGACAAGCTAAATTCA TCAAATGGTTTGCCTGCTTTCGCT

PB1-2 AGTAGAAACAAGGCATTTTTTCATGAAGGACAAGCTAAATTCA TCAAATGGTTTGCCTGCTTTCGCT

PB1-3 AGTAGAAACAAGGCATTTTTTCACGAAGGACAAGCTAAATTCA TCAAATGGTTTGCCTGCTTTTGCT

PB1-4 AGTAGAAACAAGGCATTTTTTCATGAAGGACAAGCTAAATTCA TCAAATGGTTTGCCTGCTTTTGCT

PA-1 AGTAGAAACAAGGTACTTTTTTGGACAGTATGGATAGCAAATAGTAGCATTGCCACAA TTTGGATCAGTACCTGCTTTCGCT

PA-2 AGTAGAAACAAGGTACTTTTTTGGACAGTATGGATAGCAAGTAGTAGCATTGCCCCAA TTTGGATCAGTACCTGCTTTCGCT

PA-3 AGTAGAAACAAGGTACTTTTTTGGACAGTATGGATAGCAAATAGTAGCATTGCCACAA TTTGAATCAGTACCTGCTTTCGCT

PA-4 AGTAGAAACAAGGTACTTTTTTGGACAGTATGGATAGCAAATAGTAGCATTGCCACAA TTTGGATCAGTACCTGCTTTTGCT

PA-5 AGTAGAAACAAGGTACTTTTTTGGACAGTATGGATAGCAAATAGTAGCATTGCCACAA TTTGAATCAGTACCTGCTTTTGCT

PA-6 AGTAGAAACAAGGTACTTTTTTGGACAGTATGGATAGCAAGTAGTAGCATTGCCCCAA TTTGAATCAGTACCTGCTTTCGCT

PA-7 AGTAGAAACAAGGTACTTTTTTGGACAGTATGGATAGCAAGTAGTAGCATTGCCCCAA TTTGGATCAGTACCTGCTTTTGCT

PA-8 AGTAGAAACAAGGTACTTTTTTGGACAGTATGGATAGCAAGTAGTAGCATTGCCCCAA TTTGAATCAGTACCTGCTTTTGCT

Figure 4.1. Schematic diagram of GFP reporter plasmid construct and plasmids containing different sequences in NCRs. (A) Schematic representation of the reporter plasmid with a pol I-transcription unit containing the non-coding region sequence of the

PB1 or PA segment and the cDNA encoding GFP in antisense orientation. (B) Plasmids containing different sequences (in bold character) from 5’ to 3’ in negative sense in the

PB1 or PA NCR. Refer to Material and Methods for detailed sequence information.

121

continued

Figure 4.2. Effect of PB1 (A) or PA (B) NCR sequences on reporter gene expression.

GFP expression in 293T cells was measured after 48h co-transfection of PB1 or PA NCR specific GFP reporter plasmids and four protein expression plasmids. Pictures from fluorescent microscopes are shown in upper panel. The graph in the bottom shows the percent cells expressing GFP determined by FACS (* indicates < 0.05).

122

Figure 4.2. continued

123

Figure 4.3. Growth curves of recombinant viruses on CEF cells.

Confluent CEF cells were infected with each recombinant virus at an m.o.i. of 0.001. At the indicated time-points, viruses present in the media were titrated by real time RT-PCR.

124

CHAPTER 5

DEVELOPMENT OF DIVA (DIFFERENTIATION OF INFECTED FROM

VACCINATED ANIMALS) VACCINES FOR THE CONTROL OF TRIPLE

REASSORTANT H3N2 INFLUENZA IN TURKEYS

5.1 ABSTRACT

Since 2003, triple reassortant (TR) swine H3N2 virus that contains gene segments from human, avian and swine origins have been detected in the U.S. turkey populations. The outbreak that occurred even involved birds that were vaccinated with the currently available swine- and avian- origin vaccines. Antigenically, all turkey isolates are closely related to each other. However, the turkey isolates show little or no antigenic cross- reactivity with the avian origin or swine origin vaccine strains that are currently being used. These results call for re-evaluation of currently available vaccines being used in turkey flocks and development of more effective DIVA (differentiation of infected from vaccinated animals) vaccines. In this study, we selected one of the recent strains,

A/turkey/OH/313053/04 (H3N2), that showed broad cross reactivity with other recent turkey H3N2 isolates. We created NA- and NS-based DIVA vaccine strains using a traditional reassortment method and protective efficacy of those vaccines was determined

125

in two-week-old and eighty-week-old breeder turkeys. The reassortant DIVA vaccines

significantly reduced challenge virus shedding in the oviduct of breeder turkeys as well

as trachea and cloaca of both young and old breeder turkeys. Thus, we expect that proper vaccination can effectively prevent egg production drop and potential viral contamination of eggs in infected turkeys. In combination with DIVA serological test, we expect the

newly developed vaccines will be useful for the control of TR H3N2 influenza in turkeys.

5.2 INTRODUCTION

Influenza A viruses are segmented, single stranded, negative sense RNA viruses which

belong to orthomyxoviridae family. Due to segmented characteristics, it is possible that

reassortment can occur in cells infected by two or more influenza viruses. This dramatic

change in virus genotype is called genetic shift which is different from genetic drift

caused by minor changes in the genome (18). In 1998, triple reassortant (TR) H3N2

viruses with their genes from human (PB1, HA, NA), swine (NP, M, NS), and avian

(PB2, PA) viruses were first isolated from swine populations (27), supporting the

hypothesis that pigs can serve as a mixing vessel for influenza virus and a potential

source for a human pandemic strain. In 2003, Choi et al. reported the first isolation of TR

H3N2 from turkeys in two geographically distant farms in the U.S. (6). Based on further

antigenic and genetic analysis, it was speculated that not only interspecies transmission

from swine to turkeys but also intraspecies transmission among turkeys could occur (6),

which was validated by a recent study (25). Since 2003, TR H3N2 virus infection in

126

turkeys has been reported in several farms in the U.S. and Canada (15, 22), raising

concerns about control of this virus infection.

It is well acknowledged that biosecurity is the first line of defense to protect birds from

any pathogen. However, biosecurity alone sometimes is not enough to stop the spread of

avian influenza virus (7). To compliment the prevention and control effort against avian

influenza, vaccines including inactivated and fowlpox virus vectored HA commercial

vaccines have been used in sporadic outbreaks of low pathogenic avian influenza in the

U.S.(8). Vaccine can increase resistance of poultry to virus infection, protect poultry

against death and morbidity, and reduce virus shedding and egg-production losses.

Inactivated vaccines allowing differentiation of infected from vaccinated animals (DIVA)

programs, together with strict biosecurity and a serological surveillance, have been

successfully used to control H7N1 and H7N3 outbreak in Italy (3). For the control of

turkey H3N2 avian influenza, commercial inactivated monovalent DIVA vaccine, made

with A/duck/Minnesota/79 (H3N4) strain, is available However, the vaccine strain shows

poor antigenic reactivity against field isolates and this commercial vaccine could not

provide turkey breeder hens effective protection against recent TR H3N2 isolate

challenge (10). Thus, there is a need for update of vaccine seed strains and development

of more effective vaccine.

Several strategies have been applied to develop inactivated vaccines which can comply

with a DIVA program. Heterologous NA strategy is based on the rationale that the same

HA of vaccine strain with field viruses provides protection to immunized birds, while

different NA of field viruses with vaccine strain which can be used to differentiate infected from vaccinated birds (3, 4). However, this strategy can not be used in certain

127

countries or regions where many subtypes of avian influenza are circulating in field at the

same time. To overcome this problem, vaccine strains with a rare NA have been

generated by classical reassortment or reverse genetics methods (1, 12, 13). A DIVA

program based on antibody response against NS1 protein has been tested in horse and

poultry (16, 23, 26). Since NS1 protein is a non-structural protein, anti-NS1 antibodies

can be detected only in the serum samples of infected animals and not in the vaccinated

animals by serological tests (2, 11, 16). Experimentally, this approach failed with

commercial inactivated vaccines in chickens (23). It was speculated that commercial

inactivated vaccines are contaminated with small amounts of residual NS1 protein due to

partial purification after amplification in eggs, and thus vaccinated chickens will have

antibodies against NS1 protein. By diluting serum before serological test, this strategy

could tell infected from vaccinated birds experimentally (23). This DIVA strategy still lack reported evidence of efficacy from field trials. Recently, immunodominant 5B19

epitope of the S2 glycoprotein of murine hepatitis virus inserted into NA or tetanus

toxoid as exogenous markers were used in vaccines for serological differentiation

between vaccinated and infected chickens (9, 14). The main drawback of both new

marker vaccines is inability to differentiate vaccinated and subsequently infected birds

from vaccinated birds.

In the present study, we selected a recent turkey TR H3N2 isolate which shows broad

cross reactivity with other recent turkey H3N2 subtype viruses, and utilized heterologous

NA and NS1 protein strategies to generate DIVA vaccines. Vaccine efficacy was

evaluated in both two-week old and 80-week-old breeder turkeys.

128

5.3 MATERIALS AND MEHTODS

Viruses. The virus strains used in this study, A/turkey/OH/313053/04 (H3N2),

A/duck/LA/B174/86 (H8N4), and A/turkey/OR/71-Ddel-pc4 (H7N3) were obtained from

the repository of Food Animal Health Research Program, Wooster, Ohio and were

passaged once in 10-day-old specific pathogen free (SPF) embryonated chicken eggs

(ECE) to make working stocks of the viruses.

Reassortant virus isolation and identification. The two parental viruses, one from

A/turkey/OH/313053/04 and another either from A/duck/LA/B174/86 or

A/turkey/OR/71-Ddel-pc4, were mixed in a proportion of 1:1 and inoculated into the

allantoic cavity of 10-day-old SPF ECE. Three days post inoculation, allantoic fluids

were harvested and used to infect MDCK cells for plaque assay to purify reassortant

viruses. Individual plaque was picked and resuspended into 0.5 ml sterile phosphate

buffered saline (PBS) followed by inoculation into two ECEs for amplification. Viral

RNA was extracted with the RNeasy Mini kit (Qiagen, Valencia, CA) from allantoic

fluids as previously described (19). Standard RT-PCR was first carried out with the

Qiagen one-step RT-PCR kit (Qiagen) with H3 HA and N4 NA or NS specific primers

followed by direct sequencing. After desired reassortant viruses were identified, their

remaining genes were then amplified and sequenced. The sequence of segment specific

primers is available upon request. Sequencing was performed with ABI PRISM 377

DNA sequencer at Molecular and Cellular Imaging Center at Ohio Agricultural Research

and Development Center, Wooster, Ohio.

Vaccination and challenge studies in young and breeder turkeys.

129

Vaccination studies were undertaken in four groups of two-week-old turkeys (six birds/group), including three vaccine groups and one non-vaccination control group.

Infectious allantoic fluids containing wild type A/turkey/OH/313053/04, and reassortant

DIVA vaccine strains, rH3N4 and rH3N3-Ddel-pc4, were inactivated by 0.1% β- propiolactone. Montanide™ ISA-70 VG adjuvant (Seppic, France) were mixed with inactivated viruses in a proportion of 2.3:1 and administered into turkeys subcutaneously

(0.5ml/turkey). Two weeks post vaccination, sera were collected to test specific influenza virus antibody responses by the hemagglutinination inhibition (HI) test (20), followed by

6 challenge with 10 EID50/0.2ml of wild type A/turkey/OH/313053/04 by intranasal inoculation. At 2 and 5 days post challenge, tracheal and cloacal swabs from all four groups were collected. Individual swab was placed into 1.5 ml of PBS containing gentamycin (1mg per 100ml). RNA was extracted from the tracheal and cloacal swabs with Viral RNA kit (Qiagen). The virus was quantitated by real-time RT-PCR as described previously (13, 19). Birds were observed for 14 days for clinical signs and sera were collected at the end of the experiment to check antibody responses by the HI test.

Similar vaccination and challenge study was also done in four groups of 8 eighty-week- old breeder turkeys per group. Vaccination and challenge protocols are same as described above. At 2 and 4 days post challenge, tracheal and cloacal swabs were collected for virus isolation. At 7 days post challenge, 2 birds from each group were bled for sera and were euthanized. Tissues (trachea, lungs, kidney, spleen, portions of small and large intestine and four different parts of the oviduct) were collected and preserved in 10% neutral buffered formalin for histopathology. Infundibulum, magnum, isthmus and uterus

130

(1 gram each) of oviduct were also collected separately for virus titration. At 14 days post

challenge, sera were collected from remaining birds to check antibody responses.

Tissues fixed in 10% neutral buffered formalin were embedded in paraffin. Sections were made at 5 μm and stained with hematoxylin and eosin (HE) as previously described (17).

In terms of the extent of different tissue lesion, we scored normal tissue as “-”, mild lesions as “+”, moderate lesions as “++”, severe lesion as “+++”.

Statistical analyses. To determine the significant differences of virus shedding in trachea and cloaca of young and breeder turkeys between vaccinated and non-vaccinated control groups, non-parametric Mann-Whitney test was performed using shedding virus titers. P- values were set at 0.05 (P<0.05).

5.4 RESULTS

Screening reassortant viruses. Infectious allantoic fluids from eggs co-inoculated with

A/turkey/OH/313053/04 (H3N2) and either one of A/duck/LA/B174/86 (H8N4) or

A/turkey/OR/71-Ddel-pc4 (H7N3) were extensively screened by plaque purification followed by segment specific RT-PCR. All eight gene segment of several plaque purified viruses that had HA gene from A/turkey/OH/313053/04 and NA or NS gene from other two viruses were sequenced and two DIVA vaccine strains, rH3N4 and rH3N3-Ddel pc4, were selected. Reassortant rH3N4 virus has HA, NP, and M genes from

A/turkey/OH/313053/04, and remaining genes from A/duck/LA/B174/86. Reassortant rH3N3-Ddel-pc4 virus has HA and PB2 genes from A/turkey/OH/313053/04, and remaining genes from A/turkey/OR/71-Ddel-pc4. In addition, reassortant rH3N4 and 131

7.3 8.3 rH3N3-Ddel-pc4 viruses replicated well in ECE and their titers (10 and 10 EID50/ml,

7.7 respectively) were comparable to that of A/turkey/OH/313053/04 (10 EID50/ml).

Vaccine efficacy in two-week-old turkeys after challenge. Two weeks after a single

vaccination, the rH3N4 and rH3N3-Ddel-pc4 elicited similar antibody immune responses

against HA protein as the A/turkey/OH/313053/04 vaccine (Table 5.1). Since our

previous studies showed that young turkeys infected with TR H3N2 virus did not present apparent clinical symptoms (unpublished data), the efficacy of the vaccine was compared in terms of preventing virus replication in the trachea and cloaca and results are summarized in Table 5.1. In the N4- and NS-based DIVA vaccine group, over 50% of the birds were shedding virus in trachea and cloaca at both 2 and 5 day-post-challenge

(DPC). Compared to the non-vaccinated control group, vaccination with rH3N4 significantly reduced virus shedding in trachea at 2DPC, and vaccination with rH3N3-

Ddel-pc4 significantly prevented virus shedding in trachea at 2 and 5 DPC. Similar protection was also observed in A/turkey/OH/313053/04 vaccine group and amount of virus shedding in trachea at 2 and 5 DPC was significantly lower than that of non- vaccinated control group. (Table 5.1).

Vaccine efficacy in breeder turkeys after challenge.

Both DIVA vaccines also induced similar HA antibody immune responses to the

A/turkey/OH/313053/04 vaccine after a single immunization (Table 5.2). Since TR H3N2 virus infections have been associated with drastic declines in egg production in breeder turkeys (17, 22), we wanted to determine if vaccination can effectively reduce the virus shedding in the oviduct of infected turkeys and thus reduce the egg production drop. We quantitated the amount of virus shedding in the oviduct of birds, in addition to virus titers

132

in the trachea and cloaca. In the vaccine groups, similar to young turkeys, over 50% of

the breeder turkeys shed viruses in the trachea and cloaca. Vaccination with rH3N4 and rH3N3-Ddel-pc4 significantly reduced virus shedding in the cloaca at 4DPC compared to non-vaccinated control group. In additon, compared to the non-vaccinated challenge control group, immunization with A/turkey/OH/313053/04 and DIVA vaccines significantly reduced challenge virus shedding in four parts of the oviduct, as there were no or very low amount of virus in vaccinated birds while a large amount of the viruses were detected in non-vaccinated control birds (Table 5.2). In the non-vaccinated control group, there were large amount of virus shedding in the oviduct compared to that in the trachea and cloaca, underscoring the effect of virus infection on decreased egg production in breeder turkeys observed in the field.

Histopathologic examination of trachea, lungs, spleen, and kidney collected at 7 days post challenge showed no difference in these organs among vaccinated and non- vaccinated groups (Table 5.3). Lesions consisted of mild hyperplasia of tracheal epithelium with mild infiltration of lymphocytes and heterophils, mild congestion and peribronchial lymphohistiocytic infiltration in lungs, mild lymphoid atrophy in spleen, and mild to severe tubule necrosis and associated lymphocytic interstitial nephritis.

However, lesions in the intestine and especially in the oviduct were more severe in non-

vaccinated group than three vaccine groups (Table 5.3), which include mild to moderate

infiltration of lymphocytes present mostly in the jejunum of small intestine, moderate to

severe lymphocytic infiltration in large intestines, and mild to moderate degeneration of

the oviduct epithelial cells and generalized glandular atrophy as well as cysts present in the glands especially in the uterus.

133

5.5 DISCUSSION

Since 1998, TR H3N2 has been successfully established in the swine population. As

influenza interspecies transmission between swine and turkeys previously occurred,

turkey producers started immunizing turkey breeders with autogenous killed swine TR

H3N2 virus vaccines or a A/duck/Minnesota/79 (H3N4) DIVA vaccine commercially

available. However, since 2003, several TR H3N2 outbreaks have been reported not only

from unvaccinated but also from vaccinated turkey flocks. Subsequent genetic and

antigenic studies demonstrated that despite higher percentage of genetic similarity

between them, turkey viruses were antigenically poorly related to the swine-origin

vaccine virus. In addition, both poor antigenic reactivity and lower genetic similarity were observed between turkey isolate and commercial H3N4 duck vaccine strain, which were proved by a recent protection-challenge study (10). Together, field and experimental evidence of currently available vaccines indicates an urgent need for an update of the vaccine strain and development of effective DIVA vaccines to control

turkey H3N2. Therefore, in the present study, we chose A/turkey/OH/313053/04 (H3N2)

which showed broad cross reactivity with other recent TR H3N2 turkey isolates, and

developed NA-based or NS1-based DIVA vaccines.

Two DIVA vaccine strains, rH3N4 and rH3N3-Ddel-pc4, were generated based on

heterologous NA and NS1 protein strategies, respectively. To reduce possibility of the same NA of field virus with heterologous NA-based DIVA vaccine strain, we chose a

134

rare N4 and created NA-based vaccine strain rH3N4 which has not been identified from commercial poultry. The NS1-based DIVA vaccine strain, rH3N3-Ddel-pc4, encodes a truncated NS1 protein (24). Our previous study demonstrated that the amount of NS1 proteins in cells infected with A/turkey/OR/71-Ddel-pc4 was much less than that of wild type virus (24). Therefore, incorporation of NS1 truncation into NS1-based DIVA vaccine strain (rH3N3-Ddel-pc4) would drastically decrease possibility of NS1 protein contamination in the vaccine strain, even if little residual NS1 protein contamination of vaccine strain occurs due to insufficient purification (23).

In vivo evaluation of DIVA vaccine efficacy was carried out in two-week-old and eighty- week-old breeder turkeys. At two weeks post vaccination, a single immunization induced good HI antibody titers in turkeys (Table 5.1 and 5.2). Overall, immunization with rH3N4 and rH3N3-Ddel-pc4 induced similar protection in turkeys regardless of ages to that of A/turkey/OH/313053/04, indicating heterologous NA did not affect vaccine efficacy. In young turkeys, compared to non-vaccinated challenge control groups, the rH3N4 vaccine significantly reduced virus shedding in trachea at 2DPC and rH3N3-

Ddel-pc4 and A/turkey/OH/313053/04 vaccines significantly prevented virus shedding in trachea at 2 and 5 DPC (Table 5.1). In breeder turkeys, rH3N4 and rH3N3-Ddel-pc4 vaccines significantly reduced virus shedding in cloaca at 4 DPC (Table 5.2). Although vaccines could reduce virus shedding in trachea and cloaca, most of vaccinated birds regardless of ages still shed challenge viruses in trachea and cloaca at both time points.

6 One possible reason could be a high challenge dose (10 EID50/0.2ml) used in our study.

Capua et al. demonstrated that challenge dose is important when determining vaccine

2 protection rates (5). In the aforementioned study, three challenge doses (10 EID50,

135

4 6 4 10 EID50, 10 EID50) were tested, and only 10 EID50 challenge dose was useful to check

6 inactivated vaccine efficacy. However, even with high challenge dose (10 EID50), TR

H3N2 viruses replicated to relatively low titers in trachea and cloaca of non-vaccinated

control groups regardless of ages (Table 5.1 and 5.2), demonstrating that trachea and cloaca could be not suitable organs to determine vaccine efficacy. This result was in consistent with previous studies (17, 25). In contrast, we found high titers of challenge viruses in all different parts of the oviduct in the non-vaccinated control group (Table

5.2). In our protection-challenge study with breeder turkeys, vaccination with rH3N4 and

rH3N3-Ddel-pc4 significantly prevented virus shedding in the oviduct while birds in non- vaccinated challenge control group shed large amount of viruses, which emphasizes the effect of virus infection on decreased egg production.

Histopathology results also supported the vaccine’s ability to reduce virus shedding in the oviduct, as less severe lesions were observed in the oviduct of vaccinated birds compared to non-vaccinated birds (Table 5.3). Thus, our study gave more support to the idea that testing of turkey vaccine efficacy for H3N2 should target the oviduct instead of the trachea and cloaca for virus isolation and histopathology, as suggested in our previous study (17). In this study, we used eighty-week-old breeder turkeys, and these older breeder turkeys were almost at the end of their egg production. Although we were not able to assess egg production as a measure of vaccine protection, virus shedding data and histopathology in the oviduct between vaccinated and non-vaccinated groups indicated that immunization with both NA-based and NS1-based DIVA vaccines could reduce egg production drop.

136

A practical DIVA strategy should have an accompanying serological test that is capable of high-throughput serological monitoring. Indirect immunofluorescent antibody test

(iFAT) was successfully applied to detect the specific anti-N1 antibodies of the field virus in Italy (4). The drawbacks of this test are that it is time-consuming, laborious and subjective in interpretation of the results, which limits its widespread application in different situations. Recently, micro NA inhibition (micro-NI) or ELISA (enzyme-linked immunosorbent assay) has been developed for a NA-based DIVA program (12, 21). Both tests are rapid, sensitive and more objective as they rely on the optical detection of a colorimetric signal. Currently, micro-NI, N2-ELSIA, NS1-ELISA and multiplexed fluorescence microsphere immunoassay (FMIA) are being utilized to detect antibody against NA and NS1 by our collaborators. In combination with these DIVA serological tests, we expect the newly developed vaccines will be useful for the control of TR H3N2 influenza in turkeys.

5.6 ACKNOWLEDGEMENTS

We would like to thank Megan Strother and Keumsuk Hong for technical assistance with this work. Thanks are also extended to Dr. Mary J. Pantin-Jackwood for histopathology.

5.7 REFERENCES

1. Beato, M. S., M. Rigoni, A. Milani, and I. Capua. 2007. Generation of avian influenza reassortant viruses of the H7N5 subtype as potential vaccine candidates to be used in the framework of a "DIVA" vaccination strategy. Avian Dis 51:479- 80.

137

2. Birch-Machin, I., A. Rowan, J. Pick, J. Mumford, and M. Binns. 1997. Expression of the nonstructural protein NS1 of equine influenza A virus: detection of anti-NS1 antibody in post infection equine sera. J Virol Methods 65:255-63.

3. Capua, I., and S. Marangon. 2007. The use of vaccination to combat multiple introductions of Notifiable Avian Influenza viruses of the H5 and H7 subtypes between 2000 and 2006 in Italy. Vaccine 25:4987-95.

4. Capua, I., C. Terregino, G. Cattoli, F. Mutinelli, and J. F. Rodriguez. 2003. Development of a DIVA (Differentiating Infected from Vaccinated Animals) strategy using a vaccine containing a heterologous neuraminidase for the control of avian influenza. Avian Pathol 32:47-55.

5. Capua, I., C. Terregino, G. Cattoli, and A. Toffan. 2004. Increased resistance of vaccinated turkeys to experimental infection with an H7N3 low-pathogenicity avian influenza virus. Avian Pathol 33:158-63.

6. Choi, Y. K., J. H. Lee, G. Erickson, S. M. Goyal, H. S. Joo, R. G. Webster, and R. J. Webby. 2004. H3N2 influenza virus transmission from swine to turkeys, United States. Emerg Infect Dis 10:2156-60.

7. Halvorson, D. A. 2002. The control of H5 or H7 mildly pathogenic avian influenza: a role for inactivated vaccine. Avian Pathol 31:5-12.

8. Halvorson, D. A., D. Karunakaran, A. S. Abraham, J. A. Newman, V. Sivanandan, and P. E. Poss. 1987. Efficacy of vaccine in the control of avian influenza, p. 264-270. In E. B. C. Beard C.W. (ed.), Proceddings of the Second International Symposium on Avian influenza. U.S. Animal Health Association, Richmond, Virginia.

9. James, C. M., Y. Y. Foong, J. P. Mansfield, S. G. Fenwick, and T. M. Ellis. 2007. Use of tetanus toxoid as a differentiating infected from vaccinated animals (DIVA) strategy for sero-surveillance of avian influenza virus vaccination in poultry. Vaccine 25:5892-901.

10. Kapczynski, D. R., E. Gonder, K. Liljebjelke, R. Lippert, D. Petkov, and B. Tilley. 2009. Vaccine-induced protection from egg production losses in commercial turkey breeder hens following experimental challenge with a triple- reassortant H3N2 avian influenza virus. Avian Dis 53:7-15.

11. Krug, R. M., and P. R. Etkind. 1973. Cytoplasmic and nuclear virus-specific proteins in influenza virus-infected MDCK cells. Virology 56:334-48.

12. Kwon, J. S., M. C. Kim, O. M. Jeong, H. M. Kang, C. S. Song, J. H. Kwon, and Y. J. Lee. 2009. Novel use of a N2-specific enzyme-linked immunosorbent

138

assay for differentiation of infected from vaccinated animals (DIVA)-based identification of avian influenza. Vaccine 27:3189-94.

13. Lee, C. W., D. A. Senne, and D. L. Suarez. 2004. Generation of reassortant influenza vaccines by reverse genetics that allows utilization of a DIVA (Differentiating Infected from Vaccinated Animals) strategy for the control of avian influenza. Vaccine 22:3175-81.

14. Li, C., J. Ping, B. Jing, G. Deng, Y. Jiang, Y. Li, G. Tian, K. Yu, Z. Bu, and H. Chen. 2008. H5N1 influenza marker vaccine for serological differentiation between vaccinated and infected chickens. Biochem Biophys Res Commun 372:293-7.

15. Olsen, C. W., A. I. Karasin, S. Carman, Y. Li, N. Bastien, D. Ojkic, D. Alves, G. Charbonneau, B. M. Henning, D. E. Low, L. Burton, and G. Broukhanski. 2006. Triple reassortant H3N2 influenza A viruses, Canada, 2005. Emerg Infect Dis 12:1132-5.

16. Ozaki, H., T. Sugiura, S. Sugita, H. Imagawa, and H. Kida. 2001. Detection of antibodies to the nonstructural protein (NS1) of influenza A virus allows distinction between vaccinated and infected horses. Vet Microbiol 82:111-9.

17. Pillai, S. P., M. Pantin-Jackwood, S. J. Jadhao, D. L. Suarez, L. Wang, H. M. Yassine, Y. M. Saif, and C. W. Lee. 2009. Pathobiology of triple reassortant H3N2 influenza viruses in breeder turkeys and its potential implication for vaccine studies in turkeys. Vaccine 27:819-24.

18. Shaw, M. L., and P. Palese. 2007. Orthomyxoviridae: The viruses and their replication, p. 1647–1689. In P. H. DM Knipe (ed.), Fields Virology. Lippincott Williams & Wilkins, Philadelpha,PA.

19. Spackman, E., D. A. Senne, T. J. Myers, L. L. Bulaga, L. P. Garber, M. L. Perdue, K. Lohman, L. T. Daum, and D. L. Suarez. 2002. Development of a real-time reverse transcriptase PCR assay for type A influenza virus and the avian H5 and H7 hemagglutinin subtypes. J Clin Microbiol 40:3256-60.

20. Swayne, D. E., Senne, D.A., and Beard, C.W. 1998. Avian influenza, p. 150- 155. In D. E. Swayne (ed.), A Laboratory Manual for the Isolation and Identification of Avian Pathogens American Association of Avian Pathologists, Kennett Square, PA.

21. Sylte, M. J., B. Hubby, and D. L. Suarez. 2007. Influenza neuraminidase antibodies provide partial protection for chickens against high pathogenic avian influenza infection. Vaccine 25:3763-72.

139

22. Tang, Y., C. W. Lee, Y. Zhang, D. A. Senne, R. Dearth, B. Byrum, D. R. Perez, D. L. Suarez, and Y. M. Saif. 2005. Isolation and characterization of H3N2 influenza A virus from turkeys. Avian Dis 49:207-13.

23. Tumpey, T. M., R. Alvarez, D. E. Swayne, and D. L. Suarez. 2005. Diagnostic approach for differentiating infected from vaccinated poultry on the basis of antibodies to NS1, the nonstructural protein of influenza A virus. J Clin Microbiol 43:676-83.

24. Wang, L., D. L. Suarez, M. Pantin-Jackwood, M. Mibayashi, A. Garcia- Sastre, Y. M. Saif, and C. W. Lee. 2008. Characterization of influenza virus variants with different sizes of the non-structural (NS) genes and their potential as a live influenza vaccine in poultry. Vaccine 26:3580-6.

25. Yassine, H. M., M. Q. Al-Natour, C. W. Lee, and Y. M. Saif. 2007. Interspecies and intraspecies transmission of triple reassortant H3N2 influenza A viruses. Virol J 4:129.

26. Zhao, S., M. Jin, H. Li, Y. Tan, G. Wang, R. Zhang, and H. Chen. 2005. Detection of antibodies to the nonstructural protein (NS1) of avian influenza viruses allows distinction between vaccinated and infected chickens. Avian Dis 49:488-93.

27. Zhou, N. N., D. A. Senne, J. S. Landgraf, S. L. Swenson, G. Erickson, K. Rossow, L. Liu, K. Yoon, S. Krauss, and R. G. Webster. 1999. Genetic reassortment of avian, swine, and human influenza A viruses in American pigs. J Virol 73:8851-6.

140

Post- Virus Isolation Average HI Group vaccination a titer (14 DPC) HI titer 2 DPCb 5 DPC

c d Tracheal 3/6 (0.9+0.7) * 2/6 (0.6+0.3) * A/turkey/OH/313053/04 8.83+0.41 7.50+0.55 Cloacal 2/6 (1.5+0.1) 5/6 (1.3+0.3)

Tracheal 5/6 (1.3+0.4) * 6/6 (1.6+0.6) rH3N4 9.17+0.41 6.50+0.55 Cloacal 6/6 (1.5+0.5) 3/6 (1.3+0.7)

Tracheal 5/6 (1.2+0.7) * 5/6(0.8+0.5) * rH3N3-Ddel-pc4 10.17+0.75 7.50+0.84 Cloacal 4/6 (1.6+0.3) 3/6 (0.8+0.2)

Tracheal 6/6 (2.2+0.8) 6/6 (2.2+1) Unvaccinated Control < 2 10.17+1.72 Cloacal 5/6 (1.1+0.4) 5/6 (2.3+1)

Table 5.1. Protection of young turkeys vaccinated with inactivated DIVA vaccines after

6 challenge with 10 EID50/ 0.2ml of A/turkey/OH/313053/04. a The HI titer is expressed as the log2 reciprocal of the endpoint in a twofold dilution of sera b DPC: Days post-challenge c Number of birds positive / number tested. d Virus titer is expressed as log10 EID50/ml + standard deviation. * indicates P< 0.05

141

Post- Virus Isolation Average Group vaccination b HI titer HI titera 2 DPC 4 DPC 7 DPC (14 DPC)

c d Tracheal 6/8 (1.6+0.2) 7/8 (1.9+0.4)

Cloacal 6/8 (2.0+0.5) 8/8 (1.7+0.3) A/turkey/OH/ 6.25+1.28 8.00+1.10 313053/04 Infundibulum 0 Magnum 0 Isthmus 1.1(1/2) Uterus 0

Tracheal 7/8 (1.7+0.4) 6/8 (1.5+0.2)

Cloacal 7/8 (1.8+0.2) 2/8 (1.8+0.5) * 0 H3N4 Infundibulum 6.38+2.07 7.75+2.05 Magnum 0 Isthmus 0 Uterus 0 Tracheal 4/8 (1.6+0.8) 7/8(1.6+0.4) Cloacal 6/8 (1.2+0.2) 7/8 (1.4+0.4) * H3N3-D-del Infundibulum 0 pc4 7.25+1.28 Magnum 0 7.63+2.07 Isthmus 0 Uterus 0 Tracheal 7/8 (1.8+0.5) 5/8 (1.7+0.4) Cloacal 7/8 (1.6+0.5) 8/8 (2.5+1.2) Unvaccinated < 2 Infundibulum 3.8(1/2) Control 8.40+2.61 Magnum 2.5+0.2(2/2) Isthmus 3.9(1/2) Uterus 2.6+1.9(2/2)

Table 5.2. Protection of breeder turkeys vaccinated with inactivated DIVA vaccines after

6 challenge with 10 EID50/0.2ml of A/turkey/OH/313053/04 a The HI titer is expressed as the log2 reciprocal of the endpoint in a twofold dilution of sera. b DPC: Days post-challenge c Number of birds positive / number tested. d Virus titer is expressed as log10 mean EID50/ml or EID50/g of oviduct tissues+ standard deviation. * indicates P< 0.05

142

Tissue A/turkey/OH/313053/04 rH3N4 rH3N3-Ddel-pc4 Unvaccinated Control Trachea -,+ +,++ -,- +,++ Lungs +,+ +, + +, + +, ++ Spleen +,+ +,+ +,+ +,+ Kidney -,++ +++,++ +++, NA ++, +++ Small intestine -, - +, ++ -, ++ -, ++ Large intestine +,+ +, ++ +,++ ++, ++ Infundibulum -, NA +,+ -,+ +, +++ Magnum -,+ -, NA -,+ +, ++ Isthmus -,+ -, - -,+ +, ++ Uterus -,+ +, ++ +,+ +++, +

Table 5.3. Result of histopathologic lesion in different tissues from breeder turkeys at 7 day-post-challenge. NA = not available, - = normal, + = mild lesions, ++ = moderated lesions, +++ = severe lesions

143

BIBLIOGRAPHY

1. Albo, C., A. Valencia, and A. Portela. 1995. Identification of an RNA binding region within the N-terminal third of the influenza A virus nucleoprotein. J Virol 69:3799-806.

2. Ali, A., R. T. Avalos, E. Ponimaskin, and D. P. Nayak. 2000. Influenza virus assembly: effect of influenza virus glycoproteins on the membrane association of M1 protein. J Virol 74:8709-19.

7. Bean, W. J., M. Schell, J. Katz, Y. Kawaoka, C. Naeve, O. Gorman, and R. G. Webster. 1992. Evolution of the H3 influenza virus hemagglutinin from human and nonhuman hosts. J Virol 66:1129-38.

8. Beare, A. S., and R. G. Webster. 1991. Replication of avian influenza viruses in humans. Arch Virol 119:37-42.

9. Beato, M. S., M. Rigoni, A. Milani, and I. Capua. 2007. Generation of avian influenza reassortant viruses of the H7N5 subtype as potential vaccine candidates to be used in the framework of a "DIVA" vaccination strategy. Avian Dis 51:479-80.

144

10. Beaton, A. R., and R. M. Krug. 1986. Transcription antitermination during influenza viral template RNA synthesis requires the nucleocapsid protein and the absence of a 5' capped end. Proc Natl Acad Sci U S A 83:6282-6.

11. Belshe, R. B. 2004. Current status of live attenuated influenza virus vaccine in the US. Virus Res 103:177-85.

12. Bentley, D. R., and G. G. Brownlee. 1982. Sequence of the N2 neuraminidase from influenza virus A/NT/60/68. Nucleic Acids Res 10:5033-42.

13. Bergmann, M., A. Garcia-Sastre, E. Carnero, H. Pehamberger, K. Wolff, P. Palese, and T. Muster. 2000. Influenza virus NS1 protein counteracts PKR- mediated inhibition of replication. J Virol 74:6203-6.

14. Bergmann, M., and T. Muster. 1996. Mutations in the nonconserved noncoding sequences of the influenza A virus segments affect viral vRNA formation. Virus Res 44:23-31.

15. Birch-Machin, I., A. Rowan, J. Pick, J. Mumford, and M. Binns. 1997. Expression of the nonstructural protein NS1 of equine influenza A virus: detection of anti-NS1 antibody in post infection equine sera. J Virol Methods 65:255-63.

16. Boni, M. F., J. R. Gog, V. Andreasen, and M. W. Feldman. 2006. Epidemic dynamics and antigenic evolution in a single season of influenza A. Proc Biol Sci 273:1307-16.

17. Bornholdt, Z. A., and B. V. Prasad. 2006. X-ray structure of influenza virus NS1 effector domain. Nat Struct Mol Biol 13:559-60.

18. Braam, J., I. Ulmanen, and R. M. Krug. 1983. Molecular model of a eucaryotic transcription complex: functions and movements of influenza P proteins during capped RNA-primed transcription. Cell 34:609-18.

19. Bright, R. A., D. M. Carter, C. J. Crevar, F. R. Toapanta, J. D. Steckbeck, K. S. Cole, N. M. Kumar, P. Pushko, G. Smith, T. M. Tumpey, and T. M. Ross. 2008. Cross-clade protective immune responses to influenza viruses with H5N1 HA and NA elicited by an influenza virus-like particle. PLoS ONE 3:e1501.

20. Bright, R. A., D. M. Carter, S. Daniluk, F. R. Toapanta, A. Ahmad, V. Gavrilov, M. Massare, P. Pushko, N. Mytle, T. Rowe, G. Smith, and T. M. Ross. 2007. Influenza virus-like particles elicit broader immune responses than whole virion inactivated influenza virus or recombinant hemagglutinin. Vaccine 25:3871-8.

21. Brownlee, G. G., and J. L. Sharps. 2002. The RNA polymerase of influenza a virus is stabilized by interaction with its viral RNA promoter. J Virol 76:7103-13.

145

22. Bublot, M., N. Pritchard, J. S. Cruz, T. R. Mickle, P. Selleck, and D. E. Swayne. 2007. Efficacy of a fowlpox-vectored avian influenza H5 vaccine against Asian H5N1 highly pathogenic avian influenza virus challenge. Avian Dis 51:498- 500.

23. Bui, M., G. Whittaker, and A. Helenius. 1996. Effect of M1 protein and low pH on nuclear transport of influenza virus ribonucleoproteins. J Virol 70:8391-401.

24. Capua, I., and S. Marangon. 2007. The use of vaccination to combat multiple introductions of Notifiable Avian Influenza viruses of the H5 and H7 subtypes between 2000 and 2006 in Italy. Vaccine 25:4987-95.

25. Capua, I., C. Terregino, G. Cattoli, F. Mutinelli, and J. F. Rodriguez. 2003. Development of a DIVA (Differentiating Infected from Vaccinated Animals) strategy using a vaccine containing a heterologous neuraminidase for the control of avian influenza. Avian Pathol 32:47-55.

26. Capua, I., C. Terregino, G. Cattoli, and A. Toffan. 2004. Increased resistance of vaccinated turkeys to experimental infection with an H7N3 low-pathogenicity avian influenza virus. Avian Pathol 33:158-63.

27. Castrucci, M. R., and Y. Kawaoka. 1993. Biologic importance of neuraminidase stalk length in influenza A virus. J Virol 67:759-64.

28. Catchpole, A. P., L. J. Mingay, E. Fodor, and G. G. Brownlee. 2003. Alternative base pairs attenuate influenza A virus when introduced into the duplex region of the conserved viral RNA promoter of either the NS or the PA gene. J Gen Virol 84:507-15.

29. Cauthen, A. N., D. E. Swayne, M. J. Sekellick, P. I. Marcus, and D. L. Suarez. 2007. Amelioration of influenza virus pathogenesis in chickens attributed to the enhanced interferon-inducing capacity of a virus with a truncated NS1 gene. J Virol 81:1838-47.

30. Chambers, T. M., M. Quinlivan, T. Sturgill, A. Cullinane, D. W. Horohov, D. Zamarin, S. Arkins, A. Garcia-Sastre, and P. Palese. 2009. Influenza A viruses with truncated NS1 as modified live virus vaccines: pilot studies of safety and efficacy in horses. Equine Vet J 41:87-92.

31. Chen, H., Y. Matsuoka, D. Swayne, Q. Chen, N. J. Cox, B. R. Murphy, and K. Subbarao. 2003. Generation and characterization of a cold-adapted influenza A H9N2 reassortant as a live pandemic influenza virus vaccine candidate. Vaccine 21:4430-6.

32. Chen, W., P. A. Calvo, D. Malide, J. Gibbs, U. Schubert, I. Bacik, S. Basta, R. O'Neill, J. Schickli, P. Palese, P. Henklein, J. R. Bennink, and J. W. Yewdell.

146

2001. A novel influenza A virus mitochondrial protein that induces cell death. Nat Med 7:1306-12.

33. Chen, Z., C. Santos, A. Aspelund, L. Gillim-Ross, H. Jin, G. Kemble, and K. Subbarao. 2009. Evaluation of live attenuated influenza a virus h6 vaccines in mice and ferrets. J Virol 83:65-72.

34. Chengalvala, M. V., B. M. Bhat, R. Bhat, M. D. Lubeck, S. Mizutani, A. R. Davis, and P. P. Hung. 1994. Immunogenicity of high expression adenovirus- hepatitis B virus recombinant vaccines in dogs. J Gen Virol 75 ( Pt 1):125-31.

35. Choi, Y. K., J. H. Lee, G. Erickson, S. M. Goyal, H. S. Joo, R. G. Webster, and R. J. Webby. 2004. H3N2 influenza virus transmission from swine to turkeys, United States. Emerg Infect Dis 10:2156-60.

36. Claas, E. C., A. D. Osterhaus, R. van Beek, J. C. De Jong, G. F. Rimmelzwaan, D. A. Senne, S. Krauss, K. F. Shortridge, and R. G. Webster. 1998. Human influenza A H5N1 virus related to a highly pathogenic avian influenza virus. Lancet 351:472-7.

37. Conenello, G. M., D. Zamarin, L. A. Perrone, T. Tumpey, and P. Palese. 2007. A single mutation in the PB1-F2 of H5N1 (HK/97) and 1918 influenza A viruses contributes to increased virulence. PLoS Pathog 3:1414-21.

38. Connor, R. J., Y. Kawaoka, R. G. Webster, and J. C. Paulson. 1994. Receptor specificity in human, avian, and equine H2 and H3 influenza virus isolates. Virology 205:17-23.

39. Cox, M. M., and J. R. Hollister. 2009. FluBlok, a next generation influenza vaccine manufactured in insect cells. Biologicals 37:182-9.

40. Cox, N. J., F. Kitame, A. P. Kendal, H. F. Maassab, and C. Naeve. 1988. Identification of sequence changes in the cold-adapted, live attenuated influenza vaccine strain, A/Ann Arbor/6/60 (H2N2). Virology 167:554-67.

41. Crawford, J., B. Wilkinson, A. Vosnesensky, G. Smith, M. Garcia, H. Stone, and M. L. Perdue. 1999. Baculovirus-derived hemagglutinin vaccines protect against lethal influenza infections by avian H5 and H7 subtypes. Vaccine 17:2265- 74.

42. Crevar, C. J., and T. M. Ross. 2008. Elicitation of protective immune responses using a bivalent H5N1 VLP vaccine. Virol J 5:131.

43. de Wit, E., T. M. Bestebroer, M. I. Spronken, G. F. Rimmelzwaan, A. D. Osterhaus, and R. A. Fouchier. 2007. Rapid sequencing of the non-coding regions of influenza A virus. J Virol Methods 139:85-9.

147

44. de Wit, E., M. I. Spronken, T. M. Bestebroer, G. F. Rimmelzwaan, A. D. Osterhaus, and R. A. Fouchier. 2004. Efficient generation and growth of influenza virus A/PR/8/34 from eight cDNA fragments. Virus Res 103:155-61.

45. Deroo, T., W. M. Jou, and W. Fiers. 1996. Recombinant neuraminidase vaccine protects against lethal influenza. Vaccine 14:561-9.

46. Desselberger, U., V. R. Racaniello, J. J. Zazra, and P. Palese. 1980. The 3' and 5'-terminal sequences of influenza A, B and C virus RNA segments are highly conserved and show partial inverted complementarity. Gene 8:315-28.

47. Dhama, K., M. Mahendran, P. K. Gupta, and A. Rai. 2008. DNA vaccines and their applications in veterinary practice: current perspectives. Vet Res Commun 32:341-56.

48. Diaz, M. O., S. Ziemin, M. M. Le Beau, P. Pitha, S. D. Smith, R. R. Chilcote, and J. D. Rowley. 1988. Homozygous deletion of the alpha- and beta 1-interferon genes in human leukemia and derived cell lines. Proc Natl Acad Sci U S A 85:5259-63.

49. Donelan, N. R., C. F. Basler, and A. Garcia-Sastre. 2003. A recombinant influenza A virus expressing an RNA-binding-defective NS1 protein induces high levels of beta interferon and is attenuated in mice. J Virol 77:13257-66.

50. Egorov, A., S. Brandt, S. Sereinig, J. Romanova, B. Ferko, D. Katinger, A. Grassauer, G. Alexandrova, H. Katinger, and T. Muster. 1998. Transfectant influenza A viruses with long deletions in the NS1 protein grow efficiently in Vero cells. J Virol 72:6437-41.

51. Els, M. C., G. M. Air, K. G. Murti, R. G. Webster, and W. G. Laver. 1985. An 18-amino acid deletion in an influenza neuraminidase. Virology 142:241-7.

52. Falcon, A. M., A. Fernandez-Sesma, Y. Nakaya, T. M. Moran, J. Ortin, and A. Garcia-Sastre. 2005. Attenuation and immunogenicity in mice of temperature- sensitive influenza viruses expressing truncated NS1 proteins. J Gen Virol 86:2817- 21.

53. Falcon, A. M., R. M. Marion, T. Zurcher, P. Gomez, A. Portela, A. Nieto, and J. Ortin. 2004. Defective RNA replication and late gene expression in temperature- sensitive influenza viruses expressing deleted forms of the NS1 protein. J Virol 78:3880-8.

54. Ferko, B., C. Kittel, J. Romanova, S. Sereinig, H. Katinger, and A. Egorov. 2006. Live attenuated influenza virus expressing human interleukin-2 reveals increased immunogenic potential in young and aged hosts. J Virol 80:11621-7.

148

55. Ferko, B., J. Stasakova, J. Romanova, C. Kittel, S. Sereinig, H. Katinger, and A. Egorov. 2004. Immunogenicity and protection efficacy of replication-deficient influenza A viruses with altered NS1 genes. J Virol 78:13037-45.

56. Fernandez-Sesma, A., S. Marukian, B. J. Ebersole, D. Kaminski, M. S. Park, T. Yuen, S. C. Sealfon, A. Garcia-Sastre, and T. M. Moran. 2006. Influenza virus evades innate and adaptive immunity via the NS1 protein. J Virol 80:6295- 304.

57. Flick, R., G. Neumann, E. Hoffmann, E. Neumeier, and G. Hobom. 1996. Promoter elements in the influenza vRNA terminal structure. RNA 2:1046-57.

58. Fodor, E., L. Devenish, O. G. Engelhardt, P. Palese, G. G. Brownlee, and A. Garcia-Sastre. 1999. Rescue of influenza A virus from recombinant DNA. J Virol 73:9679-82.

59. Fodor, E., P. Palese, G. G. Brownlee, and A. Garcia-Sastre. 1998. Attenuation of influenza A virus mRNA levels by promoter mutations. J Virol 72:6283-90.

60. Fodor, E., D. C. Pritlove, and G. G. Brownlee. 1995. Characterization of the RNA-fork model of virion RNA in the initiation of transcription in influenza A virus. J Virol 69:4012-9.

61. Fodor, E., D. C. Pritlove, and G. G. Brownlee. 1994. The influenza virus panhandle is involved in the initiation of transcription. J Virol 68:4092-6.

62. Fouchier, R. A., V. Munster, A. Wallensten, T. M. Bestebroer, S. Herfst, D. Smith, G. F. Rimmelzwaan, B. Olsen, and A. D. Osterhaus. 2005. Characterization of a novel influenza A virus hemagglutinin subtype (H16) obtained from black-headed gulls. J Virol 79:2814-22.

63. Frohman, M. A., M. K. Dush, and G. R. Martin. 1988. Rapid production of full- length cDNAs from rare transcripts: amplification using a single gene-specific oligonucleotide primer. Proc Natl Acad Sci U S A 85:8998-9002.

64. Fujii, K., Y. Fujii, T. Noda, Y. Muramoto, T. Watanabe, A. Takada, H. Goto, T. Horimoto, and Y. Kawaoka. 2005. Importance of both the coding and the segment-specific noncoding regions of the influenza A virus NS segment for its efficient incorporation into virions. J Virol 79:3766-74.

65. Fynan, E. F., R. G. Webster, D. H. Fuller, J. R. Haynes, J. C. Santoro, and H. L. Robinson. 1993. DNA vaccines: protective immunizations by parenteral, mucosal, and gene-gun inoculations. Proc Natl Acad Sci U S A 90:11478-82.

66. Galarza, J. M., T. Latham, and A. Cupo. 2005. Virus-like particle (VLP) vaccine conferred complete protection against a lethal influenza virus challenge. Viral Immunol 18:244-51. 149

67. Gamblin, S. J., L. F. Haire, R. J. Russell, D. J. Stevens, B. Xiao, Y. Ha, N. Vasisht, D. A. Steinhauer, R. S. Daniels, A. Elliot, D. C. Wiley, and J. J. Skehel. 2004. The structure and receptor binding properties of the 1918 influenza hemagglutinin. Science 303:1838-42.

68. Gao, W., A. C. Soloff, X. Lu, A. Montecalvo, D. C. Nguyen, Y. Matsuoka, P. D. Robbins, D. E. Swayne, R. O. Donis, J. M. Katz, S. M. Barratt-Boyes, and A. Gambotto. 2006. Protection of mice and poultry from lethal H5N1 avian influenza virus through adenovirus-based immunization. J Virol 80:1959-64.

69. Garcia-Sastre, A., A. Egorov, D. Matassov, S. Brandt, D. E. Levy, J. E. Durbin, P. Palese, and T. Muster. 1998. Influenza A virus lacking the NS1 gene replicates in interferon-deficient systems. Virology 252:324-30.

70. Ge, J., G. Deng, Z. Wen, G. Tian, Y. Wang, J. Shi, X. Wang, Y. Li, S. Hu, Y. Jiang, C. Yang, K. Yu, Z. Bu, and H. Chen. 2007. Newcastle disease virus-based live attenuated vaccine completely protects chickens and mice from lethal challenge of homologous and heterologous H5N1 avian influenza viruses. J Virol 81:150-8.

71. Gomez-Puertas, P., C. Albo, E. Perez-Pastrana, A. Vivo, and A. Portela. 2000. Influenza virus matrix protein is the major driving force in virus budding. J Virol 74:11538-47.

72. Gomez-Puertas, P., I. Mena, M. Castillo, A. Vivo, E. Perez-Pastrana, and A. Portela. 1999. Efficient formation of influenza virus-like particles: dependence on the expression levels of viral proteins. J Gen Virol 80 ( Pt 7):1635-45.

73. Gorse, G. J., M. J. Campbell, E. E. Otto, D. C. Powers, G. W. Chambers, and F. K. Newman. 1995. Increased anti-influenza A virus cytotoxic T cell activity following vaccination of the chronically ill elderly with live attenuated or inactivated influenza virus vaccine. J Infect Dis 172:1-10.

74. Graham, F. L., J. Smiley, W. C. Russell, and R. Nairn. 1977. Characteristics of a human cell line transformed by DNA from human adenovirus type 5. J Gen Virol 36:59-74.

75. Hagen, M., T. D. Chung, J. A. Butcher, and M. Krystal. 1994. Recombinant influenza virus polymerase: requirement of both 5' and 3' viral ends for endonuclease activity. J Virol 68:1509-15.

76. Hale, B. G., W. S. Barclay, R. E. Randall, and R. J. Russell. 2008. Structure of an avian influenza A virus NS1 protein effector domain. Virology 378:1-5.

77. Halvorson, D. A. 2002. The control of H5 or H7 mildly pathogenic avian influenza: a role for inactivated vaccine. Avian Pathol 31:5-12.

150

78. Halvorson, D. A. 1998. The strengths and weaknesses of vaccines as a control tool., p. 223-227, In: Proceedings of the Fourth International Symposium on Avian Influenza. U.S. Animal Health Association, Athens, Georgia.

79. Halvorson, D. A., D. Karunakaran, A. S. Abraham, J. A. Newman, V. Sivanandan, and P. E. Poss. 1987. Efficacy of vaccine in the control of avian influenza, p. 264-270. In E. B. C. Beard C.W. (ed.), Proceddings of the Second International Symposium on Avian influenza. U.S. Animal Health Association, Richmond, Virginia.

80. Hatta, M., P. Gao, P. Halfmann, and Y. Kawaoka. 2001. Molecular basis for high virulence of Hong Kong H5N1 influenza A viruses. Science 293:1840-2.

81. Herlocher, M. L., H. F. Maassab, and R. G. Webster. 1993. Molecular and biological changes in the cold-adapted "master strain" A/AA/6/60 (H2N2) influenza virus. Proc Natl Acad Sci U S A 90:6032-6.

82. Hickman, D., M. J. Hossain, H. Song, Y. Araya, A. Solorzano, and D. R. Perez. 2008. An avian live attenuated master backbone for potential use in epidemic and pandemic influenza vaccines. J Gen Virol 89:2682-90.

83. Hinshaw, V. S., R. G. Webster, W. J. Bean, and G. Sriram. 1980. The ecology of influenza viruses in ducks and analysis of influenza viruses with monoclonal antibodies. Comp Immunol Microbiol Infect Dis 3:155-64.

84. Hinshaw, V. S., R. G. Webster, C. W. Naeve, and B. R. Murphy. 1983. Altered tissue tropism of human-avian reassortant influenza viruses. Virology 128:260-3.

85. Hiti, A. L., and D. P. Nayak. 1982. Complete nucleotide sequence of the neuraminidase gene of human influenza virus A/WSN/33. J Virol 41:730-4.

86. Hoelscher, M. A., S. Garg, D. S. Bangari, J. A. Belser, X. Lu, I. Stephenson, R. A. Bright, J. M. Katz, S. K. Mittal, and S. Sambhara. 2006. Development of adenoviral-vector-based pandemic influenza vaccine against antigenically distinct human H5N1 strains in mice. Lancet 367:475-81.

87. Horimoto, T., K. Nakayama, S. P. Smeekens, and Y. Kawaoka. 1994. Proprotein-processing endoproteases PC6 and furin both activate hemagglutinin of virulent avian influenza viruses. J Virol 68:6074-8.

88. Hsu, M. T., J. D. Parvin, S. Gupta, M. Krystal, and P. Palese. 1987. Genomic RNAs of influenza viruses are held in a circular conformation in virions and in infected cells by a terminal panhandle. Proc Natl Acad Sci U S A 84:8140-4.

89. Huang, Z., S. Elankumaran, A. S. Yunus, and S. K. Samal. 2004. A recombinant Newcastle disease virus (NDV) expressing VP2 protein of infectious bursal disease virus (IBDV) protects against NDV and IBDV. J Virol 78:10054-63. 151

90. Hulse-Post, D. J., J. Franks, K. Boyd, R. Salomon, E. Hoffmann, H. L. Yen, R. J. Webby, D. Walker, T. D. Nguyen, and R. G. Webster. 2007. Molecular changes in the polymerase genes (PA and PB1) associated with high pathogenicity of H5N1 influenza virus in mallard ducks. J Virol 81:8515-24.

91. Ito, T., O. T. Gorman, Y. Kawaoka, W. J. Bean, and R. G. Webster. 1991. Evolutionary analysis of the influenza A virus M gene with comparison of the M1 and M2 proteins. J Virol 65:5491-8.

92. Iwatsuki-Horimoto, K., T. Horimoto, T. Noda, M. Kiso, J. Maeda, S. Watanabe, Y. Muramoto, K. Fujii, and Y. Kawaoka. 2006. The cytoplasmic tail of the influenza A virus M2 protein plays a role in viral assembly. J Virol 80:5233- 40.

93. James, C. M., Y. Y. Foong, J. P. Mansfield, S. G. Fenwick, and T. M. Ellis. 2007. Use of tetanus toxoid as a differentiating infected from vaccinated animals (DIVA) strategy for sero-surveillance of avian influenza virus vaccination in poultry. Vaccine 25:5892-901.

94. Jia, N., S. J. de Vlas, Y. X. Liu, J. S. Zhang, L. Zhan, R. L. Dang, Y. H. Ma, X. J. Wang, T. Liu, G. P. Yang, Q. L. Wen, J. H. Richardus, S. Lu, and W. C. Cao. 2009. Serological reports of human infections of H7 and H9 avian influenza viruses in northern China. J Clin Virol 44:225-9.

95. Jiang, Y., K. Yu, H. Zhang, P. Zhang, C. Li, G. Tian, Y. Li, X. Wang, J. Ge, Z. Bu, and H. Chen. 2007. Enhanced protective efficacy of H5 subtype avian influenza DNA vaccine with codon optimized HA gene in a pCAGGS plasmid vector. Antiviral Res 75:234-41.

96. Jin, H., B. Lu, H. Zhou, C. Ma, J. Zhao, C. F. Yang, G. Kemble, and H. Greenberg. 2003. Multiple amino acid residues confer temperature sensitivity to human influenza virus vaccine strains (FluMist) derived from cold-adapted A/Ann Arbor/6/60. Virology 306:18-24.

97. Jin, H., H. Zhou, B. Lu, and G. Kemble. 2004. Imparting temperature sensitivity and attenuation in ferrets to A/Puerto Rico/8/34 influenza virus by transferring the genetic signature for temperature sensitivity from cold-adapted A/Ann Arbor/6/60. J Virol 78:995-8.

98. Johansson, B. E. 1999. Immunization with influenza A virus hemagglutinin and neuraminidase produced in recombinant baculovirus results in a balanced and broadened immune response superior to conventional vaccine. Vaccine 17:2073-80.

99. Johnson, D. C., G. Ghosh-Choudhury, J. R. Smiley, L. Fallis, and F. L. Graham. 1988. Abundant expression of herpes simplex virus glycoprotein gB using an adenovirus vector. Virology 164:1-14.

152

100. Jones, K. L., J. A. Huddleston, and G. G. Brownlee. 1983. The sequence of RNA segment 1 of influenza virus A/NT/60/68 and its comparison with the corresponding segment of strains A/PR/8/34 and A/WSN/33. Nucleic Acids Res 11:1555-66.

101. Joseph, T., J. McAuliffe, B. Lu, L. Vogel, D. Swayne, H. Jin, G. Kemble, and K. Subbarao. 2008. A live attenuated cold-adapted influenza A H7N3 virus vaccine provides protection against homologous and heterologous H7 viruses in mice and ferrets. Virology 378:123-32.

102. Kahn, J. S., A. Roberts, C. Weibel, L. Buonocore, and J. K. Rose. 2001. Replication-competent or attenuated, nonpropagating vesicular stomatitis viruses expressing respiratory syncytial virus (RSV) antigens protect mice against RSV challenge. J Virol 75:11079-87.

103. Kalhoro, N. H., J. Veits, S. Rautenschlein, and G. Zimmer. 2009. A recombinant vesicular stomatitis virus replicon vaccine protects chickens from highly pathogenic avian influenza virus (H7N1). Vaccine 27:1174-83.

104. Kang, S. M., J. M. Song, F. S. Quan, and R. W. Compans. 2009. Influenza vaccines based on virus-like particles. Virus Res.

105. Kapczynski, D. R., E. Gonder, K. Liljebjelke, R. Lippert, D. Petkov, and B. Tilley. 2009. Vaccine-induced protection from egg production losses in commercial turkey breeder hens following experimental challenge with a triple-reassortant H3N2 avian influenza virus. Avian Dis 53:7-15.

106. Kaptein, J. S., and D. P. Nayak. 1982. Complete nucleotide sequence of the polymerase 3 gene of human influenza virus A/WSN/33. J Virol 42:55-63.

107. Kawaoka, Y., S. Krauss, and R. G. Webster. 1989. Avian-to-human transmission of the PB1 gene of influenza A viruses in the 1957 and 1968 pandemics. J Virol 63:4603-8.

108. Kendal, A. P. 1997. Cold-adapted live attenuated influenza vaccines developed in Russia: can they contribute to meeting the needs for influenza control in other countries? Eur J Epidemiol 13:591-609.

109. Kida, H., T. Ito, J. Yasuda, Y. Shimizu, C. Itakura, K. F. Shortridge, Y. Kawaoka, and R. G. Webster. 1994. Potential for transmission of avian influenza viruses to pigs. J Gen Virol 75 ( Pt 9):2183-8.

110. Kida, H., R. G. Webster, and R. Yanagawa. 1983. Inhibition of virus-induced hemolysis with monoclonal antibodies to different antigenic areas on the hemagglutinin molecule of A/seal/Massachusetts/1/80 (H7N7) influenza virus. Arch Virol 76:91-9.

153

111. Kim, H. J., E. Fodor, G. G. Brownlee, and B. L. Seong. 1997. Mutational analysis of the RNA-fork model of the influenza A virus vRNA promoter in vivo. J Gen Virol 78 ( Pt 2):353-7.

112. Kittel, C., B. Ferko, M. Kurz, R. Voglauer, S. Sereinig, J. Romanova, G. Stiegler, H. Katinger, and A. Egorov. 2005. Generation of an influenza A virus vector expressing biologically active human interleukin-2 from the NS gene segment. J Virol 79:10672-7.

113. Klenk, H. D., R. Rott, M. Orlich, and J. Blodorn. 1975. Activation of influenza A viruses by trypsin treatment. Virology 68:426-39.

114. Kochs, G., A. Garcia-Sastre, and L. Martinez-Sobrido. 2007. Multiple anti- interferon actions of the influenza A virus NS1 protein. J Virol 81:7011-21.

115. Kodihalli, S., J. R. Haynes, H. L. Robinson, and R. G. Webster. 1997. Cross- protection among lethal H5N2 influenza viruses induced by DNA vaccine to the hemagglutinin. J Virol 71:3391-6.

116. Kreijtz, J. H., Y. Suezer, G. de Mutsert, J. M. van den Brand, G. van Amerongen, B. S. Schnierle, T. Kuiken, R. A. Fouchier, J. Lower, A. D. Osterhaus, G. Sutter, and G. F. Rimmelzwaan. 2009. Recombinant modified vaccinia virus Ankara expressing the hemagglutinin gene confers protection against homologous and heterologous H5N1 influenza virus infections in macaques. J Infect Dis 199:405-13.

117. Kreijtz, J. H., Y. Suezer, G. van Amerongen, G. de Mutsert, B. S. Schnierle, J. M. Wood, T. Kuiken, R. A. Fouchier, J. Lower, A. D. Osterhaus, G. Sutter, and G. F. Rimmelzwaan. 2007. Recombinant modified vaccinia virus Ankara- based vaccine induces protective immunity in mice against infection with influenza virus H5N1. J Infect Dis 195:1598-606.

118. Kretzschmar, E., L. Buonocore, M. J. Schnell, and J. K. Rose. 1997. High- efficiency incorporation of functional influenza virus glycoproteins into recombinant vesicular stomatitis viruses. J Virol 71:5982-9.

119. Krug, R. M., and P. R. Etkind. 1973. Cytoplasmic and nuclear virus-specific proteins in influenza virus-infected MDCK cells. Virology 56:334-48.

120. Krug, R. M., W. Yuan, D. L. Noah, and A. G. Latham. 2003. Intracellular warfare between human influenza viruses and human cells: the roles of the viral NS1 protein. Virology 309:181-9.

121. Kwon, J. S., M. C. Kim, O. M. Jeong, H. M. Kang, C. S. Song, J. H. Kwon, and Y. J. Lee. 2009. Novel use of a N2-specific enzyme-linked immunosorbent assay for differentiation of infected from vaccinated animals (DIVA)-based identification of avian influenza. Vaccine 27:3189-94. 154

122. Lamb, R. A., P. W. Choppin, R. M. Chanock, and C. J. Lai. 1980. Mapping of the two overlapping genes for polypeptides NS1 and NS2 on RNA segment 8 of influenza virus genome. Proc Natl Acad Sci U S A 77:1857-61.

123. Lamb, R. A., Krug, R.M. 2001. Orthomyxoviridae: the viruses and their replication, p. 1487–1531. In D. M. Knipe, Howley, P.M. (ed.), Fields Virology, vol. fourth ed. Lippinncott Williams & Wilkins, Philadelphia, PA.

124. Lamb, R. A., S. L. Zebedee, and C. D. Richardson. 1985. Influenza virus M2 protein is an integral membrane protein expressed on the infected-cell surface. Cell 40:627-33.

125. Larsen, D. L., N. Dybdahl-Sissoko, M. W. McGregor, R. Drape, V. Neumann, W. F. Swain, D. P. Lunn, and C. W. Olsen. 1998. Coadministration of DNA encoding interleukin-6 and hemagglutinin confers protection from influenza virus challenge in mice. J Virol 72:1704-8.

126. Larsen, D. L., and C. W. Olsen. 2002. Effects of DNA dose, route of vaccination, and coadministration of porcine interleukin-6 DNA on results of DNA vaccination against influenza virus infection in pigs. Am J Vet Res 63:653-9.

127. Latham, T., and J. M. Galarza. 2001. Formation of wild-type and chimeric influenza virus-like particles following simultaneous expression of only four structural proteins. J Virol 75:6154-65.

128. Lazarowitz, S. G., and P. W. Choppin. 1975. Enhancement of the infectivity of influenza A and B viruses by proteolytic cleavage of the hemagglutinin polypeptide. Virology 68:440-54.

129. Leahy, M. B., D. C. Pritlove, L. L. Poon, and G. G. Brownlee. 2001. Mutagenic analysis of the 5' arm of the influenza A virus virion RNA promoter defines the sequence requirements for endonuclease activity. J Virol 75:134-42.

130. Lee, C. W., Y. J. Lee, D. A. Senne, and D. L. Suarez. 2006. Pathogenic potential of North American H7N2 avian influenza virus: a mutagenesis study using reverse genetics. Virology 353:388-95.

131. Lee, C. W., D. A. Senne, and D. L. Suarez. 2006. Development and application of reference antisera against 15 hemagglutinin subtypes of influenza virus by DNA vaccination of chickens. Clin Vaccine Immunol 13:395-402.

132. Lee, C. W., D. A. Senne, and D. L. Suarez. 2004. Generation of reassortant influenza vaccines by reverse genetics that allows utilization of a DIVA (Differentiating Infected from Vaccinated Animals) strategy for the control of avian influenza. Vaccine 22:3175-81.

155

133. Lee, C. W., D. E. Swayne, J. A. Linares, D. A. Senne, and D. L. Suarez. 2005. H5N2 avian influenza outbreak in Texas in 2004: the first highly pathogenic strain in the United States in 20 years? J Virol 79:11412-21.

134. Lee, J. S., H. S. Kim, and S. H. Seo. 2008. Genetic characterization and protective immunity of cold-adapted attenuated avian H9N2 influenza vaccine. Vaccine 26:6569-76.

135. Lee, K. H., and B. L. Seong. 1998. The position 4 nucleotide at the 3' end of the influenza virus neuraminidase vRNA is involved in temporal regulation of transcription and replication of neuraminidase RNAs and affects the repertoire of influenza virus surface antigens. J Gen Virol 79 ( Pt 8):1923-34.

136. Lee, M. K., S. H. Bae, C. J. Park, H. K. Cheong, C. Cheong, and B. S. Choi. 2003. A single-nucleotide natural variation (U4 to C4) in an influenza A virus promoter exhibits a large structural change: implications for differential viral RNA synthesis by RNA-dependent RNA polymerase. Nucleic Acids Res 31:1216-23.

137. Lee, M. T., K. Klumpp, P. Digard, and L. Tiley. 2003. Activation of influenza virus RNA polymerase by the 5' and 3' terminal duplex of genomic RNA. Nucleic Acids Res 31:1624-32.

138. Li, C., J. Ping, B. Jing, G. Deng, Y. Jiang, Y. Li, G. Tian, K. Yu, Z. Bu, and H. Chen. 2008. H5N1 influenza marker vaccine for serological differentiation between vaccinated and infected chickens. Biochem Biophys Res Commun 372:293-7.

139. Li, M. L., P. Rao, and R. M. Krug. 2001. The active sites of the influenza cap- dependent endonuclease are on different polymerase subunits. Embo J 20:2078-86.

140. Li, S., C. Liu, A. Klimov, K. Subbarao, M. L. Perdue, D. Mo, Y. Ji, L. Woods, S. Hietala, and M. Bryant. 1999. Recombinant influenza A virus vaccines for the pathogenic human A/Hong Kong/97 (H5N1) viruses. J Infect Dis 179:1132-8.

141. Li, X., and P. Palese. 1992. Mutational analysis of the promoter required for influenza virus virion RNA synthesis. J Virol 66:4331-8.

142. Lin, Y. J., M. C. Deng, S. H. Wu, Y. L. Chen, H. C. Cheng, C. Y. Chang, M. S. Lee, M. S. Chien, and C. C. Huang. 2008. Baculovirus-derived hemagglutinin vaccine protects chickens from lethal homologous virus H5N1 challenge. J Vet Med Sci 70:1147-52.

143. Lipatov, A. S., S. Andreansky, R. J. Webby, D. J. Hulse, J. E. Rehg, S. Krauss, D. R. Perez, P. C. Doherty, R. G. Webster, and M. Y. Sangster. 2005. Pathogenesis of Hong Kong H5N1 influenza virus NS gene reassortants in mice: the role of cytokines and B- and T-cell responses. J Gen Virol 86:1121-30.

156

144. Liu, T., and Z. Ye. 2005. Attenuating mutations of the matrix gene of influenza A/WSN/33 virus. J Virol 79:1918-23.

145. Liu, X., and M. A. Gorovsky. 1993. Mapping the 5' and 3' ends of Tetrahymena thermophila mRNAs using RNA ligase mediated amplification of cDNA ends (RLM-RACE). Nucleic Acids Res 21:4954-60.

146. Long, J. X., D. X. Peng, Y. L. Liu, Y. T. Wu, and X. F. Liu. 2008. Virulence of H5N1 avian influenza virus enhanced by a 15-nucleotide deletion in the viral nonstructural gene. Virus Genes 36:471-8.

147. Lu, Y., X. Y. Qian, and R. M. Krug. 1994. The influenza virus NS1 protein: a novel inhibitor of pre-mRNA splicing. Genes Dev 8:1817-28.

148. Lubeck, M. D., R. J. Natuk, M. Chengalvala, P. K. Chanda, K. K. Murthy, S. Murthy, S. Mizutani, S. G. Lee, M. S. Wade, B. M. Bhat, and et al. 1994. Immunogenicity of recombinant adenovirus-human immunodeficiency virus vaccines in chimpanzees following intranasal administration. AIDS Res Hum Retroviruses 10:1443-9.

149. Ludwig, S., U. Schultz, J. Mandler, W. M. Fitch, and C. Scholtissek. 1991. Phylogenetic relationship of the nonstructural (NS) genes of influenza A viruses. Virology 183:566-77.

150. Luo, G., M. Bergmann, A. Garcia-Sastre, and P. Palese. 1992. Mechanism of attenuation of a chimeric influenza A/B transfectant virus. J Virol 66:4679-85.

151. Luo, G., J. Chung, and P. Palese. 1993. Alterations of the stalk of the influenza virus neuraminidase: deletions and insertions. Virus Res 29:141-53.

152. Luo, G. X., W. Luytjes, M. Enami, and P. Palese. 1991. The polyadenylation signal of influenza virus RNA involves a stretch of uridines followed by the RNA duplex of the panhandle structure. J Virol 65:2861-7.

153. Lupiani, B., and S. M. Reddy. 2009. The history of avian influenza. Comp Immunol Microbiol Infect Dis 32:311-23.

154. Luschow, D., O. Werner, T. C. Mettenleiter, and W. Fuchs. 2001. Protection of chickens from lethal avian influenza A virus infection by live-virus vaccination with infectious laryngotracheitis virus recombinants expressing the hemagglutinin (H5) gene. Vaccine 19:4249-59.

155. Luytjes, W., M. Krystal, M. Enami, J. D. Parvin, and P. Palese. 1989. Amplification, expression, and packaging of foreign gene by influenza virus. Cell 59:1107-13.

157

156. Maassab, H. F. 1967. Adaptation and growth characteristics of influenza virus at 25 degrees c. Nature 213:612-4.

157. Maassab, H. F., and D. C. DeBorde. 1985. Development and characterization of cold-adapted viruses for use as live virus vaccines. Vaccine 3:355-69.

158. Mahmood, K., R. A. Bright, N. Mytle, D. M. Carter, C. J. Crevar, J. E. Achenbach, P. M. Heaton, T. M. Tumpey, and T. M. Ross. 2008. H5N1 VLP vaccine induced protection in ferrets against lethal challenge with highly pathogenic H5N1 influenza viruses. Vaccine 26:5393-9.

159. Marcus, P. I., J. M. Rojek, and M. J. Sekellick. 2005. Interferon induction and/or production and its suppression by influenza A viruses. J Virol 79:2880-90.

160. Massin, P., P. Rodrigues, M. Marasescu, S. van der Werf, and N. Naffakh. 2005. Cloning of the chicken RNA polymerase I promoter and use for reverse genetics of influenza A viruses in avian cells. J Virol 79:13811-6.

161. Matassov, D., A. Cupo, and J. M. Galarza. 2007. A novel intranasal virus-like particle (VLP) vaccine designed to protect against the pandemic 1918 influenza A virus (H1N1). Viral Immunol 20:441-52.

162. Matrosovich, M., A. Tuzikov, N. Bovin, A. Gambaryan, A. Klimov, M. R. Castrucci, I. Donatelli, and Y. Kawaoka. 2000. Early alterations of the receptor- binding properties of H1, H2, and H3 avian influenza virus hemagglutinins after their introduction into mammals. J Virol 74:8502-12.

163. Matrosovich, M., N. Zhou, Y. Kawaoka, and R. Webster. 1999. The surface glycoproteins of H5 influenza viruses isolated from humans, chickens, and wild aquatic birds have distinguishable properties. J Virol 73:1146-55.

164. Mayr, A., and K. Danner. 1978. Vaccination against pox diseases under immunosuppressive conditions. Dev Biol Stand 41:225-34.

165. Mayrhofer, J., S. Coulibaly, A. Hessel, G. W. Holzer, M. Schwendinger, P. Bruhl, M. Gerencer, B. A. Crowe, S. Shuo, W. Hong, Y. J. Tan, B. Dietrich, N. Sabarth, H. Savidis-Dacho, O. Kistner, P. N. Barrett, and F. G. Falkner. 2009. Nonreplicating vaccinia virus vectors expressing the H5 influenza virus hemagglutinin produced in modified Vero cells induce robust protection. J Virol 83:5192-203.

166. McCown, M. F., and A. Pekosz. 2006. Distinct domains of the influenza a virus M2 protein cytoplasmic tail mediate binding to the M1 protein and facilitate infectious virus production. J Virol 80:8178-89.

158

167. McCown, M. F., and A. Pekosz. 2005. The influenza A virus M2 cytoplasmic tail is required for infectious virus production and efficient genome packaging. J Virol 79:3595-605.

168. McGeoch, D., P. Fellner, and C. Newton. 1976. Influenza virus genome consists of eight distinct RNA species. Proc Natl Acad Sci U S A 73:3045-9.

169. Middleton, D., J. Bingham, P. Selleck, S. Lowther, L. Gleeson, P. Lehrbach, S. Robinson, J. Rodenberg, M. Kumar, and M. Andrew. 2007. Efficacy of inactivated vaccines against H5N1 avian influenza infection in ducks. Virology 359:66-71.

170. Mills, J., V. Chanock, and R. M. Chanock. 1971. Temperature-sensitive mutants of influenza virus. I. Behavior in tissue culture and in experimental animals. J Infect Dis 123:145-57.

171. Min, J. Y., and R. M. Krug. 2006. The primary function of RNA binding by the influenza A virus NS1 protein in infected cells: Inhibiting the 2'-5' oligo (A) synthetase/RNase L pathway. Proc Natl Acad Sci U S A 103:7100-5.

172. Mounier-Jack, S., R. Jas, and R. Coker. 2007. Progress and shortcomings in European national strategic plans for pandemic influenza. Bull World Health Organ 85:923-9.

173. Mounts, A. W., H. Kwong, H. S. Izurieta, Y. Ho, T. Au, M. Lee, C. Buxton Bridges, S. W. Williams, K. H. Mak, J. M. Katz, W. W. Thompson, N. J. Cox, and K. Fukuda. 1999. Case-control study of risk factors for avian influenza A (H5N1) disease, Hong Kong, 1997. J Infect Dis 180:505-8.

174. Murphy, B. R., and K. Coelingh. 2002. Principles underlying the development and use of live attenuated cold-adapted influenza A and B virus vaccines. Viral Immunol 15:295-323.

175. Muster, T., E. K. Subbarao, M. Enami, B. R. Murphy, and P. Palese. 1991. An influenza A virus containing influenza B virus 5' and 3' noncoding regions on the neuraminidase gene is attenuated in mice. Proc Natl Acad Sci U S A 88:5177-81.

176. Naeve, C. W., and R. G. Webster. 1983. Sequence of the hemagglutinin gene from influenza virus A/Seal/Mass/1/80. Virology 129:298-308.

177. Nakaya, T., J. Cros, M. S. Park, Y. Nakaya, H. Zheng, A. Sagrera, E. Villar, A. Garcia-Sastre, and P. Palese. 2001. Recombinant Newcastle disease virus as a vaccine vector. J Virol 75:11868-73.

178. Nelson, K. M., B. R. Schram, M. W. McGregor, A. S. Sheoran, C. W. Olsen, and D. P. Lunn. 1998. Local and systemic isotype-specific antibody responses to

159

equine influenza virus infection versus conventional vaccination. Vaccine 16:1306- 13.

179. Nemeroff, M. E., S. M. Barabino, Y. Li, W. Keller, and R. M. Krug. 1998. Influenza virus NS1 protein interacts with the cellular 30 kDa subunit of CPSF and inhibits 3'end formation of cellular pre-mRNAs. Mol Cell 1:991-1000.

180. Neumann, G., and Y. Kawaoka. 2006. Host range restriction and pathogenicity in the context of influenza pandemic. Emerg Infect Dis 12:881-6.

181. Neumann, G., T. Watanabe, H. Ito, S. Watanabe, H. Goto, P. Gao, M. Hughes, D. R. Perez, R. Donis, E. Hoffmann, G. Hobom, and Y. Kawaoka. 1999. Generation of influenza A viruses entirely from cloned cDNAs. Proc Natl Acad Sci U S A 96:9345-50.

182. Neumann, G., T. Watanabe, and Y. Kawaoka. 2000. Plasmid-driven formation of influenza virus-like particles. J Virol 74:547-51.

183. Neumann, G., M. A. Whitt, and Y. Kawaoka. 2002. A decade after the generation of a negative-sense RNA virus from cloned cDNA - what have we learned? J Gen Virol 83:2635-62.

184. Neumann, G., A. Zobel, and G. Hobom. 1994. RNA polymerase I-mediated expression of influenza viral RNA molecules. Virology 202:477-9.

185. Ng, S. S., O. T. Li, T. K. Cheung, J. S. Malik Peiris, and L. L. Poon. 2008. Heterologous influenza vRNA segments with identical non-coding sequences stimulate viral RNA replication in trans. Virol J 5:2.

186. Norton, G. P., T. Tanaka, K. Tobita, S. Nakada, D. A. Buonagurio, D. Greenspan, M. Krystal, and P. Palese. 1987. Infectious influenza A and B virus variants with long carboxyl terminal deletions in the NS1 polypeptides. Virology 156:204-13.

187. Noton, S. L., M. Simpson-Holley, E. Medcalf, H. M. Wise, E. C. Hutchinson, J. W. McCauley, and P. Digard. 2009. Studies of an influenza A virus temperature- sensitive mutant identify a late role for NP in the formation of infectious virions. J Virol 83:562-71.

188. O'Neill, R. E., R. Jaskunas, G. Blobel, P. Palese, and J. Moroianu. 1995. Nuclear import of influenza virus RNA can be mediated by viral nucleoprotein and transport factors required for protein import. J Biol Chem 270:22701-4.

189. O'Neill, R. E., J. Talon, and P. Palese. 1998. The influenza virus NEP (NS2 protein) mediates the nuclear export of viral ribonucleoproteins. Embo J 17:288-96.

160

190. Odagiri, T., and K. Tobita. 1990. Nucleotide sequence of the PA gene of influenza A/WSN/33(H1N1). Nucleic Acids Res 18:654.

191. Olitsky, A. B. S. a. P. K. 1938. Influence of host factors on neuroinvasiveness of vesicular stomatitis virus. J. Exp. Med. 67:201-227.

192. Olsen, C. W., A. I. Karasin, S. Carman, Y. Li, N. Bastien, D. Ojkic, D. Alves, G. Charbonneau, B. M. Henning, D. E. Low, L. Burton, and G. Broukhanski. 2006. Triple reassortant H3N2 influenza A viruses, Canada, 2005. Emerg Infect Dis 12:1132-5.

193. Olsen, C. W., M. W. McGregor, N. Dybdahl-Sissoko, B. R. Schram, K. M. Nelson, D. P. Lunn, M. D. Macklin, W. F. Swain, and V. S. Hinshaw. 1997. Immunogenicity and efficacy of baculovirus-expressed and DNA-based equine influenza virus hemagglutinin vaccines in mice. Vaccine 15:1149-56.

194. Operschall, E., J. Pavlovic, M. Nawrath, and K. Molling. 2000. Mechanism of protection against influenza A virus by DNA vaccine encoding the hemagglutinin gene. Intervirology 43:322-30.

195. Ozaki, H., T. Sugiura, S. Sugita, H. Imagawa, and H. Kida. 2001. Detection of antibodies to the nonstructural protein (NS1) of influenza A virus allows distinction between vaccinated and infected horses. Vet Microbiol 82:111-9.

196. Palese, P., T. Muster, H. Zheng, R. O'Neill, and A. Garcia-Sastre. 1999. Learning from our foes: a novel vaccine concept for influenza virus. Arch Virol Suppl 15:131-8.

197. Palese, P., and M. L. Shaw. 2007. Orthomyxoviridae: The viruses and their replication, p. 1647-1689. In D. M. Knipe and P. M. Howley (ed.), Fields Virology, 5th ed. Lippincott Williams & Wilkins, Philadelphia.

198. Palese, P., Shaw, M.L. 2007. Orthomyxoviridae: the viruses and their replication, p. 1647-1689. In D. M. Knipe, Howley, P.M. (ed.), Fields Virology, 5th ed. Lippincott Williams and Wilkins, Philadelphia, PA.

199. Palese, P., K. Tobita, M. Ueda, and R. W. Compans. 1974. Characterization of temperature sensitive influenza virus mutants defective in neuraminidase. Virology 61:397-410.

200. Pantin-Jackwood, M. J., D. L. Suarez, E. Spackman, and D. E. Swayne. 2007. Age at infection affects the pathogenicity of Asian highly pathogenic avian influenza H5N1 viruses in ducks. Virus Res 130:151-61.

201. Pappas, C., P. V. Aguilar, C. F. Basler, A. Solorzano, H. Zeng, L. A. Perrone, P. Palese, A. Garcia-Sastre, J. M. Katz, and T. M. Tumpey. 2008. Single gene

161

reassortants identify a critical role for PB1, HA, and NA in the high virulence of the 1918 pandemic influenza virus. Proc Natl Acad Sci U S A 105:3064-9.

202. Park, M. S., J. Steel, A. Garcia-Sastre, D. Swayne, and P. Palese. 2006. Engineered viral vaccine constructs with dual specificity: avian influenza and Newcastle disease. Proc Natl Acad Sci U S A 103:8203-8.

203. Pavlova, S. P., J. Veits, G. M. Keil, T. C. Mettenleiter, and W. Fuchs. 2009. Protection of chickens against H5N1 highly pathogenic avian influenza virus infection by live vaccination with infectious laryngotracheitis virus recombinants expressing H5 hemagglutinin and N1 neuraminidase. Vaccine 27:773-85.

204. Peeters, B. P., Y. K. Gruijthuijsen, O. S. de Leeuw, and A. L. Gielkens. 2000. Genome replication of Newcastle disease virus: involvement of the rule-of-six. Arch Virol 145:1829-45.

205. Philpott, M., C. Hioe, M. Sheerar, and V. S. Hinshaw. 1990. Hemagglutinin mutations related to attenuation and altered cell tropism of a virulent avian influenza A virus. J Virol 64:2941-7.

206. Pillai, S. P., M. Pantin-Jackwood, S. J. Jadhao, D. L. Suarez, L. Wang, H. M. Yassine, Y. M. Saif, and C. W. Lee. 2009. Pathobiology of triple reassortant H3N2 influenza viruses in breeder turkeys and its potential implication for vaccine studies in turkeys. Vaccine 27:819-24.

207. Pinto, L. H., L. J. Holsinger, and R. A. Lamb. 1992. Influenza virus M2 protein has ion channel activity. Cell 69:517-28.

208. Plotch, S. J., M. Bouloy, I. Ulmanen, and R. M. Krug. 1981. A unique cap(m7GpppXm)-dependent influenza virion endonuclease cleaves capped RNAs to generate the primers that initiate viral RNA transcription. Cell 23:847-58.

209. Pons, M. W., I. T. Schulze, G. K. Hirst, and R. Hauser. 1969. Isolation and characterization of the ribonucleoprotein of influenza virus. Virology 39:250-9.

210. Price, R. J. 1982. Avian influenza in the United States (1964-1980), p. 178-179, In: Porceedings of the First International Symposium on Avian influenza. Carter Composition corporation, Richmond, USA.

211. Pritlove, D. C., L. L. Poon, L. J. Devenish, M. B. Leahy, and G. G. Brownlee. 1999. A hairpin loop at the 5' end of influenza A virus virion RNA is required for synthesis of poly(A)+ mRNA in vitro. J Virol 73:2109-14.

212. Pushko, P., T. M. Tumpey, F. Bu, J. Knell, R. Robinson, and G. Smith. 2005. Influenza virus-like particles comprised of the HA, NA, and M1 proteins of H9N2 influenza virus induce protective immune responses in BALB/c mice. Vaccine 23:5751-9. 162

213. Qiao, C. L., K. Z. Yu, Y. P. Jiang, Y. Q. Jia, G. B. Tian, M. Liu, G. H. Deng, X. R. Wang, Q. W. Meng, and X. Y. Tang. 2003. Protection of chickens against highly lethal H5N1 and H7N1 avian influenza viruses with a recombinant fowlpox virus co-expressing H5 haemagglutinin and N1 neuraminidase genes. Avian Pathol 32:25-32.

214. Qiu, Y., and R. M. Krug. 1994. The influenza virus NS1 protein is a poly(A)- binding protein that inhibits nuclear export of mRNAs containing poly(A). J Virol 68:2425-32.

215. Quan, F. S., C. Huang, R. W. Compans, and S. M. Kang. 2007. Virus-like particle vaccine induces protective immunity against homologous and heterologous strains of influenza virus. J Virol 81:3514-24.

216. Quan, F. S., D. Steinhauer, C. Huang, T. M. Ross, R. W. Compans, and S. M. Kang. 2008. A bivalent influenza VLP vaccine confers complete inhibition of virus replication in lungs. Vaccine 26:3352-61.

217. Quinlivan, M., D. Zamarin, A. Garcia-Sastre, A. Cullinane, T. Chambers, and P. Palese. 2005. Attenuation of equine influenza viruses through truncations of the NS1 protein. J Virol 79:8431-9.

218. Richardson, J. C., and R. K. Akkina. 1991. NS2 protein of influenza virus is found in purified virus and phosphorylated in infected cells. Arch Virol 116:69-80.

219. Richt, J. A., P. Lekcharoensuk, K. M. Lager, A. L. Vincent, C. M. Loiacono, B. H. Janke, W. H. Wu, K. J. Yoon, R. J. Webby, A. Solorzano, and A. Garcia- Sastre. 2006. Vaccination of pigs against swine influenza viruses by using an NS1- truncated modified live-virus vaccine. J Virol 80:11009-18.

220. Ricks, C. A., A. Avakian, T. Bryan, R. Gildersleeve, E. Haddad, R. Ilich, S. King, L. Murray, P. Phelps, R. Poston, C. Whitfill, and C. Williams. 1999. In ovo vaccination technology. Adv Vet Med 41:495-515.

221. Roberts, A., L. Buonocore, R. Price, J. Forman, and J. K. Rose. 1999. Attenuated vesicular stomatitis viruses as vaccine vectors. J Virol 73:3723-32.

222. Roberts, A., E. Kretzschmar, A. S. Perkins, J. Forman, R. Price, L. Buonocore, Y. Kawaoka, and J. K. Rose. 1998. Vaccination with a recombinant vesicular stomatitis virus expressing an influenza virus hemagglutinin provides complete protection from influenza virus challenge. J Virol 72:4704-11.

223. Robertson, J. S. 1979. 5' and 3' terminal nucleotide sequences of the RNA genome segments of influenza virus. Nucleic Acids Res 6:3745-57.

163

224. Robinson, H. L., L. A. Hunt, and R. G. Webster. 1993. Protection against a lethal influenza virus challenge by immunization with a haemagglutinin-expressing plasmid DNA. Vaccine 11:957-60.

225. Roche, B., C. Lebarbenchon, M. Gauthier-Clerc, C. M. Chang, F. Thomas, F. Renaud, S. van der Werf, and J. F. Guegan. 2009. Water-borne transmission drives avian influenza dynamics in wild birds: The case of the 2005-2006 epidemics in the Camargue area. Infect Genet Evol.

226. Rogers, G. N., and J. C. Paulson. 1983. Receptor determinants of human and animal influenza virus isolates: differences in receptor specificity of the H3 hemagglutinin based on species of origin. Virology 127:361-73.

227. Rohm, C., N. Zhou, J. Suss, J. Mackenzie, and R. G. Webster. 1996. Characterization of a novel influenza hemagglutinin, H15: criteria for determination of influenza A subtypes. Virology 217:508-16.

228. Romer-Oberdorfer, A., J. Veits, D. Helferich, and T. C. Mettenleiter. 2008. Level of protection of chickens against highly pathogenic H5 avian influenza virus with Newcastle disease virus based live attenuated vector vaccine depends on homology of H5 sequence between vaccine and challenge virus. Vaccine 26:2307- 13.

229. Roush, S. W., and T. V. Murphy. 2007. Historical comparisons of morbidity and mortality for vaccine-preventable diseases in the United States. JAMA 298:2155- 63.

230. Ruigrok, R. W., A. Barge, P. Durrer, J. Brunner, K. Ma, and G. R. Whittaker. 2000. Membrane interaction of influenza virus M1 protein. Virology 267:289-98.

231. Sailaja, G., I. Skountzou, F. S. Quan, R. W. Compans, and S. M. Kang. 2007. Human immunodeficiency virus-like particles activate multiple types of immune cells. Virology 362:331-41.

232. Sakaguchi, T., G. P. Leser, and R. A. Lamb. 1996. The ion channel activity of the influenza virus M2 protein affects transport through the Golgi apparatus. J Cell Biol 133:733-47.

233. Sanz-Ezquerro, J. J., S. de la Luna, J. Ortin, and A. Nieto. 1995. Individual expression of influenza virus PA protein induces degradation of coexpressed proteins. J Virol 69:2420-6.

234. Satterly, N., P. L. Tsai, J. van Deursen, D. R. Nussenzveig, Y. Wang, P. A. Faria, A. Levay, D. E. Levy, and B. M. Fontoura. 2007. Influenza virus targets the mRNA export machinery and the nuclear pore complex. Proc Natl Acad Sci U S A 104:1853-8.

164

235. Schafer, J. R., Y. Kawaoka, W. J. Bean, J. Suss, D. Senne, and R. G. Webster. 1993. Origin of the pandemic 1957 H2 influenza A virus and the persistence of its possible progenitors in the avian reservoir. Virology 194:781-8.

236. Schat, K. A., and H. G. Purchase. 1998. Cell-Culture Methods, p. 223-234. In D. E. Swayne (ed.), A Laboratory Manual for the Isolation and Identification of Avian Pathogens. American Association of Avian Pathologists, Kennett Square, PA.

237. Schmidt, M., and D. R. Hoffman. 2002. Expression systems for production of recombinant allergens. Int Arch Allergy Immunol 128:264-70.

238. Schwartz, J. A., L. Buonocore, A. Roberts, A. Suguitan, Jr., D. Kobasa, G. Kobinger, H. Feldmann, K. Subbarao, and J. K. Rose. 2007. Vesicular stomatitis virus vectors expressing avian influenza H5 HA induce cross-neutralizing antibodies and long-term protection. Virology 366:166-73.

239. Sekellick, M. J., W. J. Biggers, and P. I. Marcus. 1990. Development of the interferon system. I. In chicken cells development in ovo continues on time in vitro. In Vitro Cell Dev Biol 26:997-1003.

240. Seo, S. H., E. Hoffmann, and R. G. Webster. 2002. Lethal H5N1 influenza viruses escape host anti-viral cytokine responses. Nat Med 8:950-4.

241. Shaw, M. L., and P. Palese. 2007. Orthomyxoviridae: The viruses and their replication, p. 1647–1689. In P. H. DM Knipe (ed.), Fields Virology. Lippincott Williams & Wilkins, Philadelpha,PA.

242. Shen, S., G. Mahadevappa, H. L. Oh, B. Y. Wee, Y. W. Choi, L. A. Hwang, S. G. Lim, W. Hong, S. K. Lal, and Y. J. Tan. 2008. Comparing the antibody responses against recombinant hemagglutinin proteins of avian influenza A (H5N1) virus expressed in insect cells and bacteria. J Med Virol 80:1972-83.

243. Shi, H., X. F. Liu, X. Zhang, S. Chen, L. Sun, and J. Lu. 2007. Generation of an attenuated H5N1 avian influenza virus vaccine with all eight genes from avian viruses. Vaccine 25:7379-84.

244. Shi, L., D. F. Summers, Q. Peng, and J. M. Galarz. 1995. Influenza A virus RNA polymerase subunit PB2 is the endonuclease which cleaves host cell mRNA and functions only as the trimeric enzyme. Virology 208:38-47.

245. Shoji, Y., C. E. Farrance, H. Bi, M. Shamloul, B. Green, S. Manceva, A. Rhee, N. Ugulava, G. Roy, K. Musiychuk, J. A. Chichester, V. Mett, and V. Yusibov. 2009. Immunogenicity of hemagglutinin from A/Bar-headed Goose/Qinghai/1A/05 and A/Anhui/1/05 strains of H5N1 influenza viruses produced in Nicotiana benthamiana plants. Vaccine 27:3467-70.

165

246. Singh, N., A. Pandey, L. Jayashankar, and S. K. Mittal. 2008. Bovine adenoviral vector-based H5N1 influenza vaccine overcomes exceptionally high levels of pre-existing immunity against human adenovirus. Mol Ther 16:965-71.

247. Sivasubramanian, N., and D. P. Nayak. 1982. Sequence analysis of the polymerase 1 gene and the secondary structure prediction of polymerase 1 protein of human influenza virus A/WSN/33. J Virol 44:321-9.

248. Skehel, J. J., and A. J. Hay. 1978. Nucleotide sequences at the 5' termini of influenza virus RNAs and their transcripts. Nucleic Acids Res 5:1207-19.

249. Smeenk, C. A., and E. G. Brown. 1994. The influenza virus variant A/FM/1/47- MA possesses single amino acid replacements in the hemagglutinin, controlling virulence, and in the matrix protein, controlling virulence as well as growth. J Virol 68:530-4.

250. Solorzano, A., R. J. Webby, K. M. Lager, B. H. Janke, A. Garcia-Sastre, and J. A. Richt. 2005. Mutations in the NS1 protein of swine influenza virus impair anti- interferon activity and confer attenuation in pigs. J Virol 79:7535-43.

251. Solorzano, A., H. Zheng, E. Fodor, G. G. Brownlee, P. Palese, and A. Garcia- Sastre. 2000. Reduced levels of neuraminidase of influenza A viruses correlate with attenuated phenotypes in mice. J Gen Virol 81:737-42.

252. Song, H., G. R. Nieto, and D. R. Perez. 2007. A new generation of modified live- attenuated avian influenza viruses using a two-strategy combination as potential vaccine candidates. J Virol 81:9238-48.

253. Spackman, E., D. A. Senne, T. J. Myers, L. L. Bulaga, L. P. Garber, M. L. Perdue, K. Lohman, L. T. Daum, and D. L. Suarez. 2002. Development of a real-time reverse transcriptase PCR assay for type A influenza virus and the avian H5 and H7 hemagglutinin subtypes. J Clin Microbiol 40:3256-60.

254. Spackman, E., D. E. Swayne, D. L. Suarez, D. A. Senne, J. C. Pedersen, M. L. Killian, J. Pasick, K. Handel, S. P. Pillai, C. W. Lee, D. Stallknecht, R. Slemons, H. S. Ip, and T. Deliberto. 2007. Characterization of low-pathogenicity H5N1 avian influenza viruses from North America. J Virol 81:11612-9.

255. Staudt, L. M., and W. Gerhard. 1983. Generation of antibody diversity in the immune response of BALB/c mice to influenza virus hemagglutinin. I. Significant variation in repertoire expression between individual mice. J Exp Med 157:687- 704.

256. Stech, J. 2008. Attenuated influenza A viruses with modified cleavage sites in hemagglutinin as live vaccines. Expert Rev Vaccines 7:739-43.

166

257. Steel, J., A. C. Lowen, L. Pena, M. Angel, A. Solorzano, R. Albrecht, D. R. Perez, A. Garcia-Sastre, and P. Palese. 2009. Live attenuated influenza viruses containing NS1 truncations as vaccine candidates against H5N1 highly pathogenic avian influenza. J Virol 83:1742-53.

258. Stone, H. D. 1987. Efficacy of avian influenza oil-emulsion vaccines in chickens of various ages. Avian Dis 31:483-90.

259. Suarez, D. L., and M. L. Perdue. 1998. Multiple alignment comparison of the non-structural genes of influenza A viruses. Virus Res 54:59-69.

260. Suarez, D. L., and S. Schultz-Cherry. 2000. The effect of eukaryotic expression vectors and adjuvants on DNA vaccines in chickens using an avian influenza model. Avian Dis 44:861-8.

261. Subbarao, K., H. Chen, D. Swayne, L. Mingay, E. Fodor, G. Brownlee, X. Xu, X. Lu, J. Katz, N. Cox, and Y. Matsuoka. 2003. Evaluation of a genetically modified reassortant H5N1 influenza A virus vaccine candidate generated by plasmid-based reverse genetics. Virology 305:192-200.

262. Subbarao, K., A. Klimov, J. Katz, H. Regnery, W. Lim, H. Hall, M. Perdue, D. Swayne, C. Bender, J. Huang, M. Hemphill, T. Rowe, M. Shaw, X. Xu, K. Fukuda, and N. Cox. 1998. Characterization of an avian influenza A (H5N1) virus isolated from a child with a fatal respiratory illness. Science 279:393-6.

263. Suguitan, A. L., Jr., J. McAuliffe, K. L. Mills, H. Jin, G. Duke, B. Lu, C. J. Luke, B. Murphy, D. E. Swayne, G. Kemble, and K. Subbarao. 2006. Live, attenuated influenza A H5N1 candidate vaccines provide broad cross-protection in mice and ferrets. PLoS Med 3:e360.

264. Swayne, D. E. 2009. Avian influenza vaccines and therapies for poultry. Comp Immunol Microbiol Infect Dis 32:351-63.

265. Swayne, D. E. 1997. Pathobiology of H5N2 Mexican avian influenza virus infections of chickens. Vet Pathol 34:557-67.

266. Swayne, D. E., J. R. Beck, and N. Kinney. 2000. Failure of a recombinant fowl poxvirus vaccine containing an avian influenza hemagglutinin gene to provide consistent protection against influenza in chickens preimmunized with a fowl pox vaccine. Avian Dis 44:132-7.

267. Swayne, D. E., M. Garcia, J. R. Beck, N. Kinney, and D. L. Suarez. 2000. Protection against diverse highly pathogenic H5 avian influenza viruses in chickens immunized with a recombinant fowlpox vaccine containing an H5 avian influenza hemagglutinin gene insert. Vaccine 18:1088-95.

167

268. Swayne, D. E., and D. Kapczynski. 2008. Strategies and challenges for eliciting immunity against avian influenza virus in birds. Immunol Rev 225:314-31.

269. Swayne, D. E., Senne, D.A., and Beard, C.W. 1998. Avian influenza, p. 150-155. In D. E. Swayne (ed.), A Laboratory Manual for the Isolation and Identification of Avian Pathogens American Association of Avian Pathologists, Kennett Square, PA.

270. Swayne, D. E., D. L. Suarez, S. Schultz-Cherry, T. M. Tumpey, D. J. King, T. Nakaya, P. Palese, and A. Garcia-Sastre. 2003. Recombinant paramyxovirus type 1-avian influenza-H7 virus as a vaccine for protection of chickens against influenza and Newcastle disease. Avian Dis 47:1047-50.

271. Swayne, D. E. a. D. A. H. 2003. Influenza, p. 135–160. In H. J. B. Y. M. Saif, A. M. Fadly, J. R. Glisson, L. R. McDougald, and D. E. Swayne (ed.), Diseases of poultry, 11th ed. Iowa State University Press, Ames, IA.

272. Sylte, M. J., B. Hubby, and D. L. Suarez. 2007. Influenza neuraminidase antibodies provide partial protection for chickens against high pathogenic avian influenza infection. Vaccine 25:3763-72.

273. Szymkowiak, C., W. S. Kwan, Q. Su, T. J. Toner, A. R. Shaw, and R. Youil. 2003. Rapid method for the characterization of 3' and 5' UTRs of influenza viruses. J Virol Methods 107:15-20.

274. Talon, J., M. Salvatore, R. E. O'Neill, Y. Nakaya, H. Zheng, T. Muster, A. Garcia-Sastre, and P. Palese. 2000. Influenza A and B viruses expressing altered NS1 proteins: A vaccine approach. Proc Natl Acad Sci U S A 97:4309-14.

275. Tang, Y., C. W. Lee, Y. Zhang, D. A. Senne, R. Dearth, B. Byrum, D. R. Perez, D. L. Suarez, and Y. M. Saif. 2005. Isolation and characterization of H3N2 influenza A virus from turkeys. Avian Dis 49:207-13.

276. Taubenberger, J. K., A. H. Reid, R. M. Lourens, R. Wang, G. Jin, and T. G. Fanning. 2005. Characterization of the 1918 influenza virus polymerase genes. Nature 437:889-93.

277. Tchatalbachev, S., R. Flick, and G. Hobom. 2001. The packaging signal of influenza viral RNA molecules. RNA 7:979-89.

278. Tompkins, S. M., Y. Lin, G. P. Leser, K. A. Kramer, D. L. Haas, E. W. Howerth, J. Xu, M. J. Kennett, R. K. Durbin, J. E. Durbin, R. Tripp, R. A. Lamb, and B. He. 2007. Recombinant parainfluenza virus 5 (PIV5) expressing the influenza A virus hemagglutinin provides immunity in mice to influenza A virus challenge. Virology 362:139-50.

168

279. Toro, H., D. C. Tang, D. L. Suarez, M. J. Sylte, J. Pfeiffer, and K. R. Van Kampen. 2007. Protective avian influenza in ovo vaccination with non-replicating human adenovirus vector. Vaccine 25:2886-91.

280. Treanor, J. J., G. M. Schiff, R. B. Couch, T. R. Cate, R. C. Brady, C. M. Hay, M. Wolff, D. She, and M. M. Cox. 2006. Dose-related safety and immunogenicity of a trivalent baculovirus-expressed influenza-virus hemagglutinin vaccine in elderly adults. J Infect Dis 193:1223-8.

281. Treanor, J. J., B. E. Wilkinson, F. Masseoud, J. Hu-Primmer, R. Battaglia, D. O'Brien, M. Wolff, G. Rabinovich, W. Blackwelder, and J. M. Katz. 2001. Safety and immunogenicity of a recombinant hemagglutinin vaccine for H5 influenza in humans. Vaccine 19:1732-7.

282. Tumpey, T. M., R. Alvarez, D. E. Swayne, and D. L. Suarez. 2005. Diagnostic approach for differentiating infected from vaccinated poultry on the basis of antibodies to NS1, the nonstructural protein of influenza A virus. J Clin Microbiol 43:676-83.

283. Ulmer, J. B., J. J. Donnelly, S. E. Parker, G. H. Rhodes, P. L. Felgner, V. J. Dwarki, S. H. Gromkowski, R. R. Deck, C. M. DeWitt, A. Friedman, and et al. 1993. Heterologous protection against influenza by injection of DNA encoding a viral protein. Science 259:1745-9.

284. Van Kampen, K. R., Z. Shi, P. Gao, J. Zhang, K. W. Foster, D. T. Chen, D. Marks, C. A. Elmets, and D. C. Tang. 2005. Safety and immunogenicity of adenovirus-vectored nasal and epicutaneous influenza vaccines in humans. Vaccine 23:1029-36.

285. Veits, J., D. Luschow, K. Kindermann, O. Werner, J. P. Teifke, T. C. Mettenleiter, and W. Fuchs. 2003. Deletion of the non-essential UL0 gene of infectious laryngotracheitis (ILT) virus leads to attenuation in chickens, and UL0 mutants expressing influenza virus haemagglutinin (H7) protect against ILT and fowl plague. J Gen Virol 84:3343-52.

286. Veits, J., D. Wiesner, W. Fuchs, B. Hoffmann, H. Granzow, E. Starick, E. Mundt, H. Schirrmeier, T. Mebatsion, T. C. Mettenleiter, and A. Romer- Oberdorfer. 2006. Newcastle disease virus expressing H5 hemagglutinin gene protects chickens against Newcastle disease and avian influenza. Proc Natl Acad Sci U S A 103:8197-202.

287. Verhoeyen, M., R. Fang, W. M. Jou, R. Devos, D. Huylebroeck, E. Saman, and W. Fiers. 1980. Antigenic drift between the haemagglutinin of the Hong Kong influenza strains A/Aichi/2/68 and A/Victoria/3/75. Nature 286:771-6.

169

288. Wang, C., R. A. Lamb, and L. H. Pinto. 1994. Direct measurement of the influenza A virus M2 protein ion channel activity in mammalian cells. Virology 205:133-40.

289. Wang, L., D. L. Suarez, M. Pantin-Jackwood, M. Mibayashi, A. Garcia-Sastre, Y. M. Saif, and C. W. Lee. 2008. Characterization of influenza virus variants with different sizes of the non-structural (NS) genes and their potential as a live influenza vaccine in poultry. Vaccine 26:3580-6.

290. Wang, S., Q. Liu, J. Pu, Y. Li, L. Keleta, Y. W. Hu, J. Liu, and E. G. Brown. 2008. Simplified recombinational approach for influenza A virus reverse genetics. J Virol Methods 151:74-8.

291. Wang, W., and R. M. Krug. 1996. The RNA-binding and effector domains of the viral NS1 protein are conserved to different extents among influenza A and B viruses. Virology 223:41-50.

292. Wang, W., K. Riedel, P. Lynch, C. Y. Chien, G. T. Montelione, and R. M. Krug. 1999. RNA binding by the novel helical domain of the influenza virus NS1 protein requires its dimer structure and a small number of specific basic amino acids. RNA 5:195-205.

293. Wasilenko, J. L., C. W. Lee, L. Sarmento, E. Spackman, D. R. Kapczynski, D. L. Suarez, and M. J. Pantin-Jackwood. 2008. NP, PB1, and PB2 viral genes contribute to altered replication of H5N1 avian influenza viruses in chickens. J Virol 82:4544-53.

294. Watabe, S., K. Q. Xin, A. Ihata, L. J. Liu, A. Honsho, I. Aoki, K. Hamajima, B. Wahren, and K. Okuda. 2001. Protection against influenza virus challenge by topical application of influenza DNA vaccine. Vaccine 19:4434-44.

295. Watanabe, T., S. Watanabe, H. Kida, and Y. Kawaoka. 2002. Influenza A virus with defective M2 ion channel activity as a live vaccine. Virology 299:266-70.

296. Watanabe, T., S. Watanabe, J. H. Kim, M. Hatta, and Y. Kawaoka. 2008. Novel approach to the development of effective H5N1 influenza A virus vaccines: use of M2 cytoplasmic tail mutants. J Virol 82:2486-92.

297. Watanabe, T., S. Watanabe, G. Neumann, H. Kida, and Y. Kawaoka. 2002. Immunogenicity and protective efficacy of replication-incompetent influenza virus- like particles. J Virol 76:767-73.

298. Webby, R. J., D. R. Perez, J. S. Coleman, Y. Guan, J. H. Knight, E. A. Govorkova, L. R. McClain-Moss, J. S. Peiris, J. E. Rehg, E. I. Tuomanen, and R. G. Webster. 2004. Responsiveness to a pandemic alert: use of reverse genetics for rapid development of influenza vaccines. Lancet 363:1099-103.

170

299. Webster, R. G. 2004. Wet markets--a continuing source of severe acute respiratory syndrome and influenza? Lancet 363:234-6.

300. Webster, R. G., W. J. Bean, O. T. Gorman, T. M. Chambers, and Y. Kawaoka. 1992. Evolution and ecology of influenza A viruses. Microbiol Rev 56:152-79.

301. Webster, R. G., E. F. Fynan, J. C. Santoro, and H. Robinson. 1994. Protection of ferrets against influenza challenge with a DNA vaccine to the haemagglutinin. Vaccine 12:1495-8.

302. Webster, R. G., M. Yakhno, V. S. Hinshaw, W. J. Bean, and K. G. Murti. 1978. Intestinal influenza: replication and characterization of influenza viruses in ducks. Virology 84:268-78.

303. Wesley, R. D., M. Tang, and K. M. Lager. 2004. Protection of weaned pigs by vaccination with human adenovirus 5 recombinant viruses expressing the hemagglutinin and the nucleoprotein of H3N2 swine influenza virus. Vaccine 22:3427-34.

304. Winter, G., S. Fields, M. J. Gait, and G. G. Brownlee. 1981. The use of synthetic oligodeoxynucleotide primers in cloning and sequencing segment of 8 influenza virus (A/PR/8/34). Nucleic Acids Res 9:237-45.

305. Wu, Q., L. Fang, X. Wu, B. Li, R. Luo, Z. Yu, M. Jin, H. Chen, and S. Xiao. 2009. A pseudotype baculovirus-mediated vaccine confers protective immunity against lethal challenge with H5N1 avian influenza virus in mice and chickens. Mol Immunol.

306. Yamanaka, K., N. Ogasawara, H. Yoshikawa, A. Ishihama, and K. Nagata. 1991. In vivo analysis of the promoter structure of the influenza virus RNA genome using a transfection system with an engineered RNA. Proc Natl Acad Sci U S A 88:5369-73.

307. Yassine, H. M., M. Q. Al-Natour, C. W. Lee, and Y. M. Saif. 2007. Interspecies and intraspecies transmission of triple reassortant H3N2 influenza A viruses. Virol J 4:129.

308. Yen, H. L., J. R. Aldridge, A. C. Boon, N. A. Ilyushina, R. Salomon, D. J. Hulse-Post, H. Marjuki, J. Franks, D. A. Boltz, D. Bush, A. S. Lipatov, R. J. Webby, J. E. Rehg, and R. G. Webster. 2009. Changes in H5N1 influenza virus hemagglutinin receptor binding domain affect systemic spread. Proc Natl Acad Sci U S A 106:286-91.

309. Zhang, J., G. P. Leser, A. Pekosz, and R. A. Lamb. 2000. The cytoplasmic tails of the influenza virus spike glycoproteins are required for normal genome packaging. Virology 269:325-34.

171

310. Zhao, S., M. Jin, H. Li, Y. Tan, G. Wang, R. Zhang, and H. Chen. 2005. Detection of antibodies to the nonstructural protein (NS1) of avian influenza viruses allows distinction between vaccinated and infected chickens. Avian Dis 49:488-93.

311. Zheng, H., P. Palese, and A. Garcia-Sastre. 1996. Nonconserved nucleotides at the 3' and 5' ends of an influenza A virus RNA play an important role in viral RNA replication. Virology 217:242-51.

312. Zhou, N. N., D. A. Senne, J. S. Landgraf, S. L. Swenson, G. Erickson, K. Rossow, L. Liu, K. Yoon, S. Krauss, and R. G. Webster. 1999. Genetic reassortment of avian, swine, and human influenza A viruses in American pigs. J Virol 73:8851-6.

313. Zhu, Q., H. Yang, W. Chen, W. Cao, G. Zhong, P. Jiao, G. Deng, K. Yu, C. Yang, Z. Bu, Y. Kawaoka, and H. Chen. 2008. A naturally occurring deletion in its NS gene contributes to the attenuation of an H5N1 swine influenza virus in chickens. J Virol 82:220-8.

314. Zurcher, T., S. de la Luna, J. J. Sanz-Ezquerro, A. Nieto, and J. Ortin. 1996. Mutational analysis of the influenza virus A/Victoria/3/75 PA protein: studies of interaction with PB1 protein and identification of a dominant negative mutant. J Gen Virol 77 ( Pt 8):1745-9.

172