DOCSLIB.ORG

The Introduction of Xenopus Laevis Into Developmental Biology: of Empire, Pregnancy Testing and Ribosomal Genes

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Introduction of Xenopus Laevis Into Developmental Biology: of Empire, Pregnancy Testing and Ribosomal Genes Int. J. Dev. Biol. 44: 43-50 (2000) EGF, epithelium and Xenopus in developmental biology 43 The introduction of Xenopus laevis into developmental biology: of empire, pregnancy testing and ribosomal genes JOHN B. GURDON1* and NICK HOPWOOD2 1Wellcome CRC Institute and 2Department of History and Philosophy of Science, University of Cambridge, Cambridge, United Kingdom Introduction Spemann in the 1930s, even Joseph Needham and colleagues’ biochemical analysis of the organizer used newts (Haraway, The ever greater concentration of biomedical research on fewer 1976). Only during and after World War II did Xenopus begin its and fewer species is a striking general feature of the postwar era. In rise to dominance. But developmental biologists in Europe and developmental biology, the South African clawed frog Xenopus North America did not choose an African frog after a detached and laevis is, with Drosophila, the mouse, the chick, C. elegans and the comprehensive survey of world fauna. It turns out that the intro- zebrafish, one of only half-a-dozen ‘model’ organisms used for the duction of Xenopus into developmental biology laboratories was vast majority of research. How did a species which occurs naturally more fortuitous, and is more interesting. Its eventual embryologi- only in Southern and Central Africa rise to such international promi- cal exploitation was made possible by specific histories of empire nence? Developmental biologists routinely answer this question by and of endocrinology which happen to have centred to a substan- listing the main reasons currently assembled for using Xenopus: tial extent in Britain; demand was ensured by a reorientation of ease of maintenance of a wholly aquatic vertebrate in the laboratory; embryology towards biochemical methods. Here we trace the exceptional resistance to disease; a life cycle that among Amphibia scientific domestication of the South African clawed frog, focusing is relatively short; large numbers and size of eggs suitable for especially on how, between the 1930s and the early 1960s, it was microsurgery; and above all its year-round reproductive response to introduced into European and North American laboratories, where commercial hormone preparations compared to the limited breeding not only developmental biologists but also converts from bio- seasons of other amphibians (Kay and Peng, 1991; Tinsley and chemistry took it up. Kobel, 1996). Another kind of answer is historical, and this is what we offer here. Natural history, anatomy and laboratory culture From the 1880s and the early work of Wilhelm Roux and others in Germany, experimental embryologists favoured Amphibia Xenopus laevis was first described by a French naturalist at the (Beetschen, 1996; Nieuwkoop, 1996), but they used the local beginning of the nineteenth century; at the turn of the twentieth a European and North American species, initially mostly of the frog British zoologist first reported culturing its embryos in the labora- Rana (Maienschein, 1991). By the early twentieth century urode- tory. European men of science took advantage of imperial explo- les were preferred; Hans Spemann (Hamburger, 1988; Fäßler, ration to define and domesticate this exotic species. They were 1997) experimented mainly on species of the newt Triton (now interested primarily in its natural history and in comparing the Triturus) and Ross Harrison on the axolotl Amblystoma. Following distinctive anatomy to that of other Amphibia. *Address for reprints: Wellcome CRC Institute, University of Cambridge, Tennis Court Road, Cambridge CB2 1QR, United Kingdom. FAX: 44 1223 334185. e-mail: [email protected] 0214-6282/2000/$20.00 © UBC Press Printed in Spain www.lg.ehu.es/ijdb 44 J.B. Gurdon and N. Hopwood François Marie Daudin’s Histoire naturelle des rainettes, des grenouilles, et des crapauds (‘Natural History of Tree-frogs, Frogs and Toads’; 1802/03) contained the briefest description of what he called Bufo laevis, or ‘Crapaud lisse’ (‘smooth toad’). Based on a single preserved specimen of unknown provenance in the Mu- seum of Natural History in Paris, his drawing (Fig. 1) is just sufficient for a modern zoologist to recognise it as Xenopus from the lateral line system and dorsal eyes. But, analysing a specimen from South Africa, the Museum’s great comparative anatomist, Georges Cuvier (1829, p. 107), was critical of Daudin’s efforts, not least his failure to show claws, and pointedly renamed the animal Dactylethra (or ‘finger thing’), a translation of Cuvier’s ‘dé à coudre’ (thimble). In the following decades, research on the taxonomy and anatomy of what appeared neither a typical frog nor a typical toad continued sporadically in the scientific centres of empire, especially London’s museums and zoo, as and when specimens were received from Africa. Albert Günther (1858), an assistant at the British Museum, refined the classification of this tongueless anuran; his superior, Keeper of Zoology John Edward Gray (1864), published the first description and figure of a larva, based on fixed specimens sent via Liverpool from Lagos, Nigeria. William Kitchen Parker, Hunterian professor of comparative anatomy at the Royal College of Sur- geons and a man ‘once known to speak for four hours continuously on the lower jawbone of the raven without saying anything that was other than valuable’ (Prosser, 1895-96, p. 292), used larvae from the same bottle as Gray to include Dactylethra in two truly massive Fig. 2. The first published pictures of Xenopus laevis larvae and descriptions of the development of the batrachian skull (Parker, embryos. (A) Tadpole of Dactylethra (subsequently Xenopus laevis), from 1876, 1881). By studying lower vertebrates he amassed evidence Gray (1864). (B-E) A.K. Maxwell’s drawings of eggs and embryos of against Richard Owen’s vertebral theory of the skull and in favour Xenopus laevis, from Bles (1905). (B) Unfertilized egg; (C) mid-blastula; (D) of the views of his friend and Owen’s arch-enemy T.H. Huxley. In neurula; (E) feeding tadpole. Reproduced by permission of the Syndics of a note from the South African Cape, J.M. Leslie (1890) gave the Cambridge University Library. earliest account of the breeding habits in swamps and ponds of what he called Xenopus laevis, a name proposed by Wagler Evers Beddard, prosector of the Zoological Society of London, (1827), and one which has stuck (see Deuchar, 1975). Leslie noted reported (1894) the natural spawning in the Gardens of the Society that the natural spawning season in South Africa is spring (August). of some animals newly arrived from Zanzibar. This first account of Around this time living specimens began to be imported, and Frank Xenopus breeding outside Africa showed drawings of larvae of 5 mm and up (Fig. 2A). Meanwhile, in the hands of the German zoologist Ernst Haeckel and the Cambridge morphologist Francis Maitland Balfour, Darwin’s theory of evolution had greatly stimulated comparative embryol- ogy, not least of colonial fauna (MacLeod, 1994). A couple of years after Beddard, Edward J. Bles, a zoologist formerly of Owens College in Manchester and then in Cambridge, began an extended study of Xenopus development. Obtaining four adults from a dealer in 1896, he maintained them for two years on a diet of earthworms and strips of liver, and then arranged a space in a corner of the tropical lily tank in the Cambridge University Botanic Garden (Bles, 1901). In February 1899 he achieved a natural spawning, at a temperature of 22-24°C, and noted the black nuptial pads on the forearms of the males. In 1905, now an assistant (i.e. lecturer) in the Department of Zoology at Glasgow University, Bles published a fine article, which not only contains A.K. Maxwell’s exquisitely drawn figures from the unfertilised egg right through to the late feeding larva (Fig. 2B-E), but also meticulously describes condi- tions for the ovulation, fertilisation and rearing of Xenopus in the Fig. 1. The first published picture of Bufo laevis, from Daudin (1802/03). laboratory. Bles kept the animals in a bell-jar over a Bunsen burner The species was eventually re-named Xenopus laevis. Reproduced by (Fig. 3), a set-up designed by John Samuel Budgett, a ‘Balfour permission of the Syndics of Cambridge University Library. Student’ at Cambridge (Shipley, 1907; MacLeod, 1994). Bles EGF, epithelium and Xenopus in developmental biology 45 brought the Xenopus to 22°C several days before coupling, and changed the water just before egg-laying. He found that it helped to allow them to hibernate before attempting to induce egg-laying; apparently, the same female lived for a decade and spawned spontaneously for at least three consecutive years. Endocrinology and the Xenopus pregnancy test During the early twentieth century, Xenopus continued to be imported occasionally for research, and increasingly also for hobby aquaria in Europe. At first it was only among the scientific colonists in South Africa that Xenopus was bound up in a more general shift from comparative work, which might require only a few museum specimens, to anatomical and, increasingly, physiological studies which demanded large numbers of animals of the same species (Clarke, 1987). In South Africa the ‘Plathander’, ‘Platanna’, or ‘Platie’ as Xenopus was known for short, was a readily available substitute for that ‘old martyr of science’, the frog (Holmes, 1993). Xenopus was used both as a ‘type’ animal in school and university teaching, and by the 1920s also in physiological research (Dreyer, 1913, p. 341; Zwarenstein et al., 1946, Preface and pp. 2-5; Deuchar, 1975, p. 2). But only from the 1930s did it become a Fig. 3. The ‘Tropical Aquarium’ devised by J.S. Budgett and used by E.J. Bles (1905) to obtain spawning of Xenopus laevis. A bell-jar of 20 inches regular inhabitant of European and North American laboratories. diameter is supported on a tripod in contact with a galvanised iron tank The establishment of laboratory colonies of Xenopus outside heated by a Zeiss micro-burner.
Load more

Recommended publications
  • L. Lacey Knowles
    Curriculum Vitae L. Lacey Knowles Department of Ecology and Evolutionary Biology E-mail: [email protected] Museum of Zoology, University of Michigan Orcid ID: 0000-0002-6567-4853 Ann Arbor, MI 48109-1079 POSITIONS 2015-present, Robert B. Payne Collegiate Professor, Department of Ecology and Evolutionary Biology, Curator of Insects, Museum of Zoology, University of Michigan 2012-2015, Professor, Department of Ecology and Evolutionary Biology, Curator of Insects, Museum of Zoology, University of Michigan 2008-2012, Associate Professor, Department of Ecology and Evolutionary Biology, Curator of Insects, Museum of Zoology, University of Michigan 2003-2008, Assistant Professor, Department of Ecology and Evolutionary Biology, Curator of Insects, Museum of Zoology, University of Michigan ACADEMIC APPOINTMENTS: Science Communication Fellow, Museum of Natural History, University of Michigan Member, Center for statistical Genetics, University of Michigan NIH Training Program in Genome Sciences, University of Michigan EDUCATION 2001-2002 NIH Postdoctoral Fellowship (PERT: Postdoctoral Excellence in Research and Teaching) awarded through the Center for Insect Science at the University of Arizona 1999-2001 Postdoctoral Fellowship from the National Science Foundation Research Training Group in the Analysis of Biological Diversification at the University of Arizona 1999 Ph.D., Ecology and Evolution, State University of New York at Stony Brook Dissertation title: Genealogical portraits of Pleistocene speciation and diversity patterns in montane grasshoppers 1993 M.S., Zoology, University of South Florida. Thesis title: Effects of habitat structure on community assemblages of epifaunal macroinvertebrates in seagrass systems. 1989 B.S., cum laude with honors in Marine Biology, University of North Carolina, Wilmington RESEARCH INTERESTS Speciation and processes that promote divergence Phylogenomics and statistical phylogeography Evolutionary consequences of climate change HONORS AND AWARDS *Fulbright U.S.
    [Show full text]
  • Disease and Clinical Signs Poster
    African Clawed Frog Xenopus laevis Diseases and Clinical Signs in Photographs Therese Jones-Green University Biomedical Services Abstract Reported clinical signs associated with ill health and Clinical signs found between 2016 to 2018 Many diseases of Xenopus laevis frogs have been described in the • Opened in 2005, the biofacility can hold up to 900 female and 240 disease Clinical signs found between 2016 to 2018 male frogs in a Marine Biotech (now serviced by MBK Installations Ltd.) • 80 recirculating aquatic system. • Buoyancy problems 70 bridge this gap using photographs taken of frogs with clinical signs. The system monitors parameters such as: temperature, pH, • • Changes in activity e.g. lethargy or easily startled. My aims are: conductivity, and Total Gas Pressure. 60 • Unusual amount of skin shedding. 2018 • To share my experiences, via images, to help improve the welfare and • Frogs are maintained on mains fed water with a 20% water exchange. 50 ases • Weight loss, or failure to feed correctly. c husbandry of this species. • 2017 • Coelomic (body cavity) distention. 40 • To stimulate a dialogue which results in further sharing of ideas and 2016 Whole body bloat. 30 information. • Frogs are held under a 12 hour light/dark cycle. • Number of • Each tank has a PVC enrichment tube (30cm x 10cm), with smoothed • Fungal strands/tufts. 20 Introduction cut edges. • Sores or tremors at extremities (forearms and toes). 10 Between January 2016 and October 2018, cases of ill health and disease • Frogs are fed three times a week with a commercial trout pellet. • Redness or red spots. 0 Oedema Red leg Red leg (bad Red leg Gas bubble Sores on forearm Opaque cornea Skeletal Growth (cartilage Scar Cabletie Missing claws Eggbound in a colony of Xenopus laevis frogs housed by the University Biological hormone) (nematodes) disease deformity under skin) • The focus of the research undertaken in the biofacility is embryonic and • Excessive slime/mucous production or not enough (dry dull skin).
    [Show full text]
  • Table S1. Nakharuthai and Srisapoome (2020)
    Primer name Nucleotide sequence (5’→3’) Purpose CXC-1F New TGAACCCTGAGCTGAAGGCCGTGA Real-time PCR CXC-1R New TGAAGGTCTGATGAGTTTGTCGTC Real-time PCR CXC-1R CCTTCAGCTCAGGGTTCAAGC Genomic PCR CXC-2F New GCTTGAACCCCGAGCTGAAAAACG Real-time PCR CXC-2R New GTTCAGAGGTCGTATGAGGTGCTT Real-time PCR CXC-2F CAAGCAGGACAACAGTGTCTGTGT 3’RACE CXC-2AR GTTGCATGATTTGGATGCTGGGTAG 5’RACE CXC-1FSB AACATATGTCTCCCAGGCCCAACTCAAAC Southern blot CXC-1RSB CTCGAGTTATTTTGCACTGATGTGCAA Southern blot CXC1Exon1F CAAAGTGTTTCTGCTCCTGG Genomic PCR On-CXC1FOverEx CATATGCAACTCAAACAAGCAGGACAACAGT Overexpression On-CXC1ROverEx CTCGAGTTTTGCACTGATGTGCAATTTCAA Overexpression On-CXC2FOverEx CATATGCAACTCAAACAAGCAGGACAACAGT Overexpression On-CXC2ROverEx CTCGAGCATGGCAGCTGTGGAGGGTTCCAC Overexpression β-actinrealtimeF ACAGGATGCAGAAGGAGATCACAG Real-time PCR β-actinrealtimeR GTACTCCTGCTTGCTGATCCACAT Real-time PCR M13F AAAACGACGGCCAG Nucleotide sequencing M13R AACAGCTATGACCATG Nucleotide sequencing UPM-long (0.4 µM) CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT RACE PCR UPM-short (2 µM) CTAATAC GACTCACTATA GGGC RACE PCR Table S1. Nakharuthai and Srisapoome (2020) On-CXC1 Nucleotide (%) Amino acid (%) On-CXC2 Nucleotide (%) Amino acid (%) Versus identity identity similarity Versus identity identity Similarity Teleost fish 1. Rock bream, Oplegnathus fasciatus (AB703273) 64.5 49.1 68.1 O. fasciatus 70.7 57.7 75.4 2. Mandarin fish, Siniperca chuatsi (AAY79282) 63.2 48.1 68.9 S. chuatsi 70.5 54.0 78.8 3. Atlantic halibut, Hippoglossus hippoglossus (ACY54778) 52.0 39.3 51.1 H. hippoglossus 64.5 46.3 63.9 4. Common carp IL-8, Cyprinus carpio (ABE47600) 44.9 19.1 34.1 C. carpio 49.4 21.9 42.6 5. Rainbow trout IL-8, Oncorhynchus mykiss (CAC33585) 44.0 21.3 36.3 O. mykiss 47.3 23.7 44.4 6. Japanese flounder IL-8, Paralichthys olivaceus (AAL05442) 48.4 25.4 45.9 P.
    [Show full text]
  • Network Access to the Genome and Biology of Caenorhabditis Elegans
    82–86 Nucleic Acids Research, 2001, Vol. 29, No. 1 © 2001 Oxford University Press WormBase: network access to the genome and biology of Caenorhabditis elegans Lincoln Stein*, Paul Sternberg1, Richard Durbin2, Jean Thierry-Mieg3 and John Spieth4 Cold Spring Harbor Laboratory, 1 Bungtown Road, Cold Spring Harbor, NY 11724, USA, 1Howard Hughes Medical Institute and California Institute of Technology, Pasadena, CA, USA, 2The Sanger Centre, Hinxton, UK, 3National Center for Biotechnology Information, Bethesda, MD, USA and 4Genome Sequencing Center, Washington University, St Louis, MO, USA Received September 18, 2000; Accepted October 4, 2000 ABSTRACT and a page that shows the locus in the context of the physical map. WormBase (http://www.wormbase.org) is a web-based WormBase uses HTML linking to represent the relationships resource for the Caenorhabditis elegans genome and between objects. For example, a segment of genomic sequence its biology. It builds upon the existing ACeDB data- object is linked with the several predicted gene objects base of the C.elegans genome by providing data contained within it, and each predicted gene is linked to its curation services, a significantly expanded range of conceptual protein translation. subject areas and a user-friendly front end. The major components of the resource are described below. The C.elegans genome DESCRIPTION WormBase contains the ‘essentially complete’ genome of Caenorhabditis elegans (informally known as ‘the worm’) is a C.elegans, which now stands at 99.3 Mb of finished DNA small, soil-dwelling nematode that is widely used as a model interrupted by approximately 25 small gaps. In addition, the system for studies of metazoan biology (1).
    [Show full text]
  • Lower Organisms As Alternatives for Toxicity Testing in Rodents with a Focus on Ceanorhabditis Elegans and the Zebrafish (Danio Rerio)
    Report 340720003/2009 L.T.M. van der Ven Lower organisms as alternatives for toxicity testing in rodents With a focus on Ceanorhabditis elegans and the zebrafish (Danio rerio) RIVM report 340720003/2009 Lower organisms as alternatives for toxicity testing in rodents With a focus on Caenorhabditis elegans and the zebrafish (Danio rerio) L.T.M. van der Ven Contact: L.T.M. van der Ven Laboratory for Health Protection Research [email protected] This investigation has been performed by order and for the account of the Ministry of Health, Welfare and Sport, within the framework of V/340720 Alternatives for animal testing RIVM, P.O. Box 1, 3720 BA Bilthoven, the Netherlands Tel +31 30 274 91 11 www.rivm.nl © RIVM 2009 Parts of this publication may be reproduced, provided acknowledgement is given to the 'National Institute for Public Health and the Environment', along with the title and year of publication. RIVM report 340720003 2 Abstract Lower organisms as alternatives for toxicity testing in rodents With a focus on Caenorhabiditis elegans and the zebrafish (Danio rerio) The nematode C. elegans and the zebrafish embryo are promising alternative test models for assessment of toxic effects in rodents. Tests with these lower organisms may have a good predictive power for effects in humans and are thus complementary to tests with in vitro models (cell cultures). However, all described tests need further validation. This is the outcome of a literature survey, commissioned by the ministry of Health, Welfare and Sport of the Netherlands. The survey is part of the policy to reduce, refine and replace animal testing (3R policy).
    [Show full text]
  • Patterns and Potential Mechanisms of Thermal Preference in E. Muscae-Infected Drosophila Melanogaster
    Western Washington University Western CEDAR WWU Honors Program Senior Projects WWU Graduate and Undergraduate Scholarship Spring 2020 Patterns and potential mechanisms of thermal preference in E. muscae-infected Drosophila melanogaster Aundrea Koger Western Washington University Carolyn Elya Ph.D. Harvard University Jamilla Akhund-Zade Ph.D. Harvard University Benjamin de Bivort Ph.D. Harvard University Follow this and additional works at: https://cedar.wwu.edu/wwu_honors Recommended Citation Koger, Aundrea; Elya, Carolyn Ph.D.; Akhund-Zade, Jamilla Ph.D.; and de Bivort, Benjamin Ph.D., "Patterns and potential mechanisms of thermal preference in E. muscae-infected Drosophila melanogaster" (2020). WWU Honors Program Senior Projects. 406. https://cedar.wwu.edu/wwu_honors/406 This Project is brought to you for free and open access by the WWU Graduate and Undergraduate Scholarship at Western CEDAR. It has been accepted for inclusion in WWU Honors Program Senior Projects by an authorized administrator of Western CEDAR. For more information, please contact [email protected]. Patterns and potential mechanisms of thermal preference in Entomophthora ​ muscae-infected Drosophila melanogaster ​ ​ 1 2 2 Aundrea Koger ,​ Carolyn Elya, Ph.D. ,​ Jamilla Akhund-Zade, Ph.D. ,​ and Benjamin de Bivort, ​ ​ ​ Ph.D.2 ​ 1 2 Honors​ Program, Western Washington University, Department​ of Organismic and ​ Evolutionary Biology, Harvard University Abstract Animals use various strategies to defend against pathogens. Behavioral fever, or fighting infection by moving to warm locations, is seen in many ectotherms. The behavior-manipulating fungal pathogen Entomophthora muscae infects numerous dipterans, including fruit flies and ​ ​ ​ ​ house flies, Musca domestica. House flies have been shown to exhibit robust behavioral fever ​ ​ early after exposure to E.
    [Show full text]
  • Helical Insertion of Peptidoglycan Produces Chiral Ordering of the Bacterial Cell Wall
    Helical insertion of peptidoglycan produces PNAS PLUS chiral ordering of the bacterial cell wall Siyuan Wanga,b, Leon Furchtgottc,d, Kerwyn Casey Huangd,1, and Joshua W. Shaevitza,e,1 aLewis-Sigler Institute for Integrative Genomics, Princeton University, Princeton, NJ 08544; bDepartment of Molecular Biology, Princeton University, Princeton, NJ 08544; cBiophysics Program, Harvard University, Cambridge, MA 02138; dDepartment of Bioengineering, Stanford University, Stanford, CA 94305; and eDepartment of Physics, Princeton University, Princeton, NJ 08854 AUTHOR SUMMARY Cells from all kingdoms of wall growth to demonstrate life face the task of that patterning of cell-wall constructing a specific, synthesis by left-handed mechanically robust three- MreB polymers leads to a dimensional (3D) cell shape right-handed chiral from molecular-scale organization of the glycan components. For many strands. This organization bacteria, maintaining a rigid, produces a left-handed rod-like shape facilitates a twisting of the cell body diverse range of behaviors during elongational growth. including swimming motility, We then confirm the detection of chemical existence of right-handed gradients, and nutrient access Fig. P1. Helical insertion of material into the bacterial cell wall (green) glycan organization in E. coli during elongational growth, guided by the protein MreB (yellow), leads and waste evacuation in by osmotically shocking biofilms. The static shape of to an emergent chiral order in the cell-wall network and twisting of the cell that can be visualized using surface-bound beads (red). surface-labeled cells and a bacterial cell is usually directly measuring the defined by the cell wall, a difference in stiffness macromolecular polymer network composed of glycan strands between the longitudinal and transverse directions.
    [Show full text]
  • Germ-Line Gene Editing and Congressional Reaction in Context: Learning from Almost 50 Years of Congressional Reactions to Biomedical Breakthroughs
    Journal of Law and Health Volume 30 Issue 1 Article 2 7-1-2017 Germ-Line Gene Editing and Congressional Reaction in Context: Learning From Almost 50 Years of Congressional Reactions to Biomedical Breakthroughs Russell A. Spivak, J.D. Harvard Law School I. Glenn Cohen, J.D. Harvard Law School Eli Y. Adashi, M.D., M.S. Brown University Follow this and additional works at: https://engagedscholarship.csuohio.edu/jlh Part of the Bioethics and Medical Ethics Commons, Cells Commons, Genetic Processes Commons, Health Law and Policy Commons, Medical Genetics Commons, Medical Jurisprudence Commons, Science and Technology Law Commons, and the Tissues Commons How does access to this work benefit ou?y Let us know! Recommended Citation Russell A. Spivak, J.D.; I. Glenn Cohen, J.D.; and Eli Y. Adashi, M.D., M.S., Germ-Line Gene Editing and Congressional Reaction in Context: Learning From Almost 50 Years of Congressional Reactions to Biomedical Breakthroughs, 30 J.L. & Health 20 (2017) available at https://engagedscholarship.csuohio.edu/jlh/vol30/iss1/2 This Article is brought to you for free and open access by the Journals at EngagedScholarship@CSU. It has been accepted for inclusion in Journal of Law and Health by an authorized editor of EngagedScholarship@CSU. For more information, please contact [email protected]. GERM-LINE GENE EDITING AND CONGRESSIONAL REACTION IN CONTEXT: LEARNING FROM ALMOST 50 YEARS OF CONGRESSIONAL REACTIONS TO BIOMEDICAL BREAKTHROUGHS RUSSELL A. SPIVAK, J.D., HARVARD LAW SCHOOL, CLASS OF 2017 I. GLENN COHEN J.D., PROFESSOR OF LAW, HARVARD LAW SCHOOL, CO-DIRECTOR, PETRIE- FLOM CENTER FOR HEALTH LAW POLICY, BIOTECHNOLOGY, AND BIOETHICS, HARVARD UNIVERSITY, CAMBRIDGE, MA.
    [Show full text]
  • High Abundance of Invasive African Clawed Frog Xenopus Laevis in Chile: Challenges for Their Control and Updated Invasive Distribution
    Management of Biological Invasions (2019) Volume 10, Issue 2: 377–388 CORRECTED PROOF Research Article High abundance of invasive African clawed frog Xenopus laevis in Chile: challenges for their control and updated invasive distribution Marta Mora1, Daniel J. Pons2,3, Alexandra Peñafiel-Ricaurte2, Mario Alvarado-Rybak2, Saulo Lebuy2 and Claudio Soto-Azat2,* 1Vida Nativa NGO, Santiago, Chile 2Centro de Investigación para la Sustentabilidad & Programa de Doctorado en Medicina de la Conservación, Facultad de Ciencias de la Vida, Universidad Andres Bello, Republica 440, Santiago, Chile 3Facultad de Ciencias Exactas, Departamento de Matemáticas, Universidad Andres Bello, Santiago, Republica 470, Santiago, Chile Author e-mails: [email protected] (CSA), [email protected] (MM), [email protected] (DJP), [email protected] (APR), [email protected] (MAR), [email protected] (SL) *Corresponding author Citation: Mora M, Pons DJ, Peñafiel- Ricaurte A, Alvarado-Rybak M, Lebuy S, Abstract Soto-Azat C (2019) High abundance of invasive African clawed frog Xenopus Invasive African clawed frog Xenopus laevis (Daudin, 1802) are considered a major laevis in Chile: challenges for their control threat to aquatic environments. Beginning in the early 1970s, invasive populations and updated invasive distribution. have now been established throughout much of central Chile. Between September Management of Biological Invasions 10(2): and December 2015, we studied a population of X. laevis from a small pond in 377–388, https://doi.org/10.3391/mbi.2019. 10.2.11 Viña del Mar, where we estimated the population size and evaluated the use of hand nets as a method of control. First, by means of a non-linear extrapolation Received: 26 October 2018 model using the data from a single capture session of 200 min, a population size of Accepted: 7 March 2019 1,182 post-metamorphic frogs (range: 1,168–1,195 [quadratic error]) and a density Published: 16 May 2019 of 13.7 frogs/m2 (range: 13.6–13.9) of surface water were estimated.
    [Show full text]
  • Model Organisms
    RESEARCH HIGHLIGHTS Nature Reviews Genetics | Published online 30 Aug 2017; doi:10.1038/nrg.2017.70 P. Morgan/Macmillan Publishers Limited Morgan/Macmillan P. its caste-specific RNA expression is conserved in other insect species with different social systems. In ants undergoing the worker–gamergate transition, high corazonin peptide levels promoted worker-specific behaviour and inhibited behaviours associated with progression to the MODEL ORGANISMS gamergate caste; as expected, short interfering RNA (siRNA) knockdown of the corazonin receptor (CrzR) gene New tools, new insights — had the opposite phenotypic effect. The researchers went on to identify the vitellogenin gene as a key regula- probing social behaviour in ants tory target of corazonin; its expres- sion is consistently downregulated Eusocial insects display complex strategy of Harpegnathos saltator to in response to increased corazonin social behaviours, but the underlying increase the number of reproducing levels, suggesting that corazonin and Until now, molecular mechanisms are largely ants to enable them to establish orco vitellogenin have opposing effects functional unknown. Now, a trio of papers in mutant lines. In the absence of a on caste identity. Consistent with genetic studies Cell decribe two genes (orco and queen, non-reproductive H. saltator this hypothesis, siRNA knockdown corazonin) that control social behav- workers can become ‘gamergates’, of vitellogenin gene expression pro- have not been iour in ants. Furthermore, two of which lay fertilized eggs. This caste moted worker-specific behaviours. possible in the studies describe the first mutant transition can be replicated in the lab Based on these observations, the ants lines in ants, which were generated by simply by isolating workers.
    [Show full text]
  • The Antennapedia Gene
    Downloaded from genesdev.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press Control elements of the P2 promoter of the Antennapedia gene Anne M. Boulet I and Matthew P. Scott Department of Molecular, Cellular, and Developmental Biology, University of Colorado, Boulder, Colorado, 80302 USA Antennapedia (Antp), a homeotic gene of Drosophila required for proper differentiation of the thorax of the fly, is expressed in complex spatial patterns during development. The gene is > 100 kb long and has two independently regulated promoters. To characterize cis-acting regulatory elements responsible for the expression pattern, fusions of the Antp promoter 2 cap site and upstream sequences to an Adh-lacZ gene were introduced into flies. A 10-kb sequence directs ~-galactosidase production in a pattern that closely resembles the endogenous P2 pattern. Transcription from the 10-kb fusions is regulated by three genes that regulate Antp transcription. Control elements, including a target of action of homeo-domain-containing proteins, were mapped by deleting parts of the 10-kb sequence. [Key Words: Homeotic; Antennapedia; Drosophila; promoter] Received July 19, 1988; revised version accepted October 18, 1988. The homeotic genes of Drosophila are required for the 1987; Mahaffey and Kaufman 1987; Martinez-Arias et specification of segmental identity during embryonic de- al. t987; Regulski et al. 1987). The complexity of ho- velopment and metamorphosis. Mutations in homeotic meotic mutant phenotypes and the elaborate spatial pat- genes lead to the transformation of one part of the em- terns in which the genes are expressed suggest that bryo or adult fly into another.
    [Show full text]
  • Balcomk41251.Pdf (558.9Kb)
    Copyright by Karen Suzanne Balcom 2005 The Dissertation Committee for Karen Suzanne Balcom Certifies that this is the approved version of the following dissertation: Discovery and Information Use Patterns of Nobel Laureates in Physiology or Medicine Committee: E. Glynn Harmon, Supervisor Julie Hallmark Billie Grace Herring James D. Legler Brooke E. Sheldon Discovery and Information Use Patterns of Nobel Laureates in Physiology or Medicine by Karen Suzanne Balcom, B.A., M.L.S. Dissertation Presented to the Faculty of the Graduate School of The University of Texas at Austin in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy The University of Texas at Austin August, 2005 Dedication I dedicate this dissertation to my first teachers: my father, George Sheldon Balcom, who passed away before this task was begun, and to my mother, Marian Dyer Balcom, who passed away before it was completed. I also dedicate it to my dissertation committee members: Drs. Billie Grace Herring, Brooke Sheldon, Julie Hallmark and to my supervisor, Dr. Glynn Harmon. They were all teachers, mentors, and friends who lifted me up when I was down. Acknowledgements I would first like to thank my committee: Julie Hallmark, Billie Grace Herring, Jim Legler, M.D., Brooke E. Sheldon, and Glynn Harmon for their encouragement, patience and support during the nine years that this investigation was a work in progress. I could not have had a better committee. They are my enduring friends and I hope I prove worthy of the faith they have always showed in me. I am grateful to Dr.
    [Show full text]