PCR Tools 2Nd Edition PCR Tools 2Nd Edition | 2009

Novagen®

PCR Tools 2nd edition PCR Tools 2nd edition | 2009

Thermostable DNA Polymerases...... 4 Overview and Enzyme Selection Guide ...... 4 KOD Hot Start DNA Polymerase ...... 6 KOD Hot Start Master Mix...... 8 KOD Xtreme™ Hot Start DNA Polymerase...... 9 KOD XL DNA Polymerase ...... 11 KOD DNA Polymerase ...... 12 NovaTaq™ Hot Start DNA Polymerase ...... 13 NovaTaq Hot Start Master Mix Kit...... 13 NovaTaq DNA Polymerase ...... 14 NovaTaq PCR Master Mix ...... 14 Taq Antibody ...... 15 10 mM dNTP Mix ...... 15 Direct PCR from Blood...... 16 BloodDirect™ PCR Buffer Kits ...... 16 RT-PCR...... 18 One Step RT-PCR Master Mix Kit ...... 18 First Strand cDNA Synthesis Kit ...... 19 Cover and Inside Photography: Chris Bucher Photography, Dale Chihuly Sculpture located at Indiana University, Medical Sciences Building, Indiana, United States.

Prices and availability are subject to change. Copyright © 2009 EMD Chemicals Inc., an Mix Kit, and Taq Antibody. These products are manufactured by Toyobo and distributed affiliate of Merck KGaA, Darmstadt, Germany. All rights reserved. Each product is sold by EMD Chemicals, Inc. Patents related to these products include U.S. Patents 4,965,188, with a limited warranty which is provided with each purchase. Each product is intended 4,889,818, 5,079,352,5,075,216, 5,407,800, 5,322,770, 5,310,652, 5,436,149, 5,338,671, to be used for research purposes only. It is not to be used for drug or diagnostic purposes USSN 07/873, 897,USSN 08/384,490, and European Patent 592,035. nor is it intended for human use. EMD Chemicals products may not be resold, modified for resale, or used to manufacture commercial products without written approval of EMD KOD Hot Start DNA Polymerase, KOD XL DNA Polymerase, KOD Xtreme™ Hot Start DNA Chemicals. BacVector®, His•Tag®, HSV•Tag®, Novagen®, Pellet Paint®, Perfectly Blunt®, Polymerase, NovaTaq™ DNA Polymerase, NovaTaq Hot Start DNA Polymerase, One Step RT- and T7Select® are registered trademarks of EMD Chemicals Inc. in the United States and PCR Master Mix Kit. Use of these products is covered by one of more of the following U.S. in certain other jurisdictions. AccepTor™, BloodDirect™, Clonables™, CytoBuster™, D- Patents and corresponding patent claims outside the U.S.: 5,079,352, 5,618,711, 5,789,224, Tube™, GelMelt™, GigaSingles, HT96™, KOD Xtreme™, NovaTaq™, Perfect DNA™, pETBlue™, 6,127,155 and claims outside the U.S. corresponding to U.S. Patent 4,889,818. The S•Tag™, Singles™, SpinPrep™, Straight A’s™, Tuner™, Veggie™, and Zappers™ are trade- purchase of these products includes a limited, non-transferable immunity from suit under marks of EMD Chemicals Inc. ABI PRISM®, Big Dye®, and MicroAmp® are registered trade- the foregoing patent claims for using only this amount of product for the purchaser’s own marks of Applera Corporation. Cy5® is a registered trademark of GE Healthcare. Ex Taq™, internal research. No right under any other patent claim (such as the patented 5’ Nuclease LA Taq™, and PrimeSTAR® are trademarks of Takara Bio Inc. Herculase®, PfuTurbo®, and Process claims in U.S. Patents 5,210,015 and 5,487,972), no right to perform any patented PfuUltra® are registered trademarks of Stratagene. Platinum®, Pfx50™, and Quant-iT™ are method, and no right to perform commercial services of any kind, including without limi- trademarks of Invitrogen Corp. Norit® is a registered trademark of Norit N.V. Phusion™ is a tation reporting the results of purchaser’s activities for a fee or other commercial consid- trademark of Finnzymes Oy. PicoGreen® and SYBR® are registered trademarks of Molecular eration, is conveyed expressly, by implication, or by estoppel. This product is for research Probes, Inc. use only. Diagnostic uses under Roche patents require a separate license from Roche. Further information on purchasing licenses may be obtained by contacting the Director of Patent & Licensing Licensing, Applied Biosystems, 850 Lincoln Centre Drive, Foster City, California, 94404. AccepTor™ Vectors are covered under U.S. Patent 5,856,144 issued to EMD Chemicals Inc. for a vector, method, and kit for direct cloning of PCR products. Pellet Paint® Co-Precipitant is covered under U.S. Patent 7,144,713 and European Patent 0,853,680 issued to EMD Chemicals Inc. for a method for precipitating nucleic acid with D-Tube™ Dialyzers are covered under U.S. Patent 7,074,313, European Patent 1,285,257, a visible carrier. Australian Patent 2001,262,612, Canadian Patent 2,410,322, Indian Patent 201,731, and Israeli Patent 152,986 assigned to Gene Bio-Application Ltd. pETBlue™ Perfectly Blunt® Cloning Kits are licensed under U.S. Patent 5,693,489. For aca- demic or non-profit laboratories, a nondistribution agreement accompanies the products. KOD DNA Polymerase, KOD Hot Start DNA Polymerase, KOD XL DNA Polymerase, KOD Commercial laboratories must obtain a research-use license from Brookhaven Science Xtreme™ Hot Start DNA Polymerase, KOD Hot Start Master Mix, One Step RT-PCR Master Associates prior to purchase of the products. Novagen • PCR Tools

RESOURCE GUIDE...... 20 PCR Clean Up and Nucleic Acid Preparation...... 36 Clonables 2X Ligation Premix...... 49 SpinPrep™ PCR Clean-Up Kit ...... 36 NovaBlue Competent Cell Formats ...... 50 SpinPrep Gel DNA Kit ...... 37 NovaBlue GigaSingles™ Competent Cells ...... 50 Pellet Paint® Co-Precipitant ...... 38 NovaBlue Singles™ Competent Cells ...... 51 Pellet Paint NF Co-Precipitant ...... 39 NovaBlue T1R Singles Competent Cells ...... 51 Veggie™ NovaBlue Singles Competent Cells ...... 52 Molecular Size Markers...... 40 Zappers™ Electrocompetent Cells ...... 52 Perfect DNA™ Markers ...... 40 HT96™ NovaBlue Competent Cells ...... 53 Perfect DNA Ladders ...... 41 HT96 Isothermal Block ...... 53 PCR Markers ...... 41 Molecular Biology Essentials...... 54 PCR Cloning...... 42 Molecular Biology Reagents...... 54 Cloning Kits Overview...... 42 Molecular Biology Grade Buffers...... 55 AccepTor™ Vector Kits...... 44 Molecular Biology Enzymes...... 56 Perfectly Blunt® Cloning Kits ...... 46 D-Tube™ Dialyzers...... 58 Clonables™ Ligation/Transformation Kit...... 49 D-Tube Electroelution Accessory Kit...... 59

Resource Guide

Look for these 20 FAQ icons on the 22 Protocol Comparison 23 Comparing the Speed and Product Yield of 7 High product pages: Fidelity DNA Polymerases

S E D N 27 Reliable and Efficient PCR from Whole Blood and E F O C

I R Indicates that the enzyme

L Crude Tissue Lysates Using the KOD Xtreme™ Hot is licensed for PCR. Start DNA Polymerase System P C R 30 Reliable and Robust Real-time Amplification Using N T P d s NovaTaq™ Hot Start Master Mix Indicates that dNTPs

I N are included. 32 One Step Real-Time Amplification of mRNA Using C D L U D E the One Step RT-PCR Master Mix Kit 35 Detection of Shiga toxin-producing E. coli using ON THE W Find more information E B multiplex colony-direct PCR with KOD XL DNA on our website. www.novagen.com Polymerase

[email protected] 3 [email protected] Visit our website www.merckbio.com PCR • Thermostable DNA Polymerases

Thermostable DNA Polymerases Overview and Enzyme Selection Guide A complete selection of enzymes and kits for PCR

In the 25 years following the invention of PCR by Dr. Kary KOD Xtreme polymerase provides high accuracy, specificity, Mullis, PCR has evolved to become an integral laboratory and robust yield. tool. High quality thermostable polymerases are critical for consistent performance. We offer a complete selection of Not all applications require high-fidelity, high-performance high-quality Novagen enzymes and kits for a variety of PCR enzymes, but quality is still important. NovaTaq™ DNA applications. Polymerase is a high-purity, recombinant enzyme suitable for any application requiring premium quality Taq DNA Because low error rate is crucial, we feature ultra high- Polymerase. For increased specificity and convenience with fidelity KOD DNA Polymerase. This unique proofreading standard PCR, we offer NovaTaq Hot Start DNA Polymerase enzyme, isolated from the extreme thermophile Thermococcus and the Taq Antibody. NovaTaq Hot Start DNA Polymerase kodakaraensis KOD1, possesses superior processivity and is a chemically modified form of the enzyme that activates fidelity. This enables faster, more accurate PCR amplification when heated at 95°C for 10 minutes. The proprietary chemical than can be achieved with conventional enzymes, including modification utilized for NovaTaq Hot Start results in improved Pfu DNA Polymerase (Tagaki, 1997). KOD DNA Polymerase is low-copy target amplification, higher specificity, and higher also available in a hot start version for high specificity and yield. Taq Antibody is available as an alternative means of increased read length (Mizuguchi, 1999). KOD Hot Start DNA providing hot start capability to NovaTaq DNA Polymerase as Polymerase has been acknowledged in many peer-reviewed well as any other Taq DNA polymerase. Please refer to the publications as the ultra high-fidelity enzyme of choice. KOD table on the following page as a guide to select the appropriate XL DNA Polymerase, a blend of KOD DNA Polymerase and a enzyme for your application. mutant form of KOD that is deficient in 3´→5´ exonuclease activity (Nishioka, 2002), is designed for reliable amplification Our commitment to moving your research forward includes of crude samples, multiplex PCR, and incorporation of providing products that respect intellectual property law. All derivatized dNTPs. New to the KOD family is KOD Xtreme™ Novagen polymerases are licensed for PCR for research use. Hot Start DNA Polymerase, a high-fidelity “enzyme of last resort” for the most challenging targets. KOD Xtreme Hot References: Takagi, M., et al. 1997 Appl. Environ. Microbiol. 63,4504. Start DNA Polymerase is optimized for the amplification of Mizuguchi, H., et al. 1999. J. Biochem. (Tokyo) 126, 762. the most difficult targets, including GC-rich and long targets. Nishioka., et al. 2001 J. Biotechnol. 88, 141.

Enzyme KOD DNA Polymerase Pfu DNA Polymerase Taq DNA Polymerase Thermus aquaticus Species Thermococcus kodakaraensis Pyrococcus furiosus YT-1 Fidelity† 0.0035 0.0039 0.013 (mutation frequency) Elongation rate 106-138 25 61 (bases/second) Processivity >300 <20 not determined (nucleotide bases) † Fidelity was measured by the authors as mutation frequency in PCR products using a sensitive blue/white phenotypic assay with a 5.2-kb lacZ plasmid as template (Takagi 1997).

4 For more information or to place an order, Novagen • PCR Tools contact your local office (see back cover). Thermostable DNA Polymerases 5 6 9 11 13 14 14 12 Page

Y Y Y needs

are for Master Mix Available as

www.merckbio.com Thermostable DNA Polymerases DNA Thermostable • multiplex, Routine PCR Applications amplification amplification PCR PCR Cloning, cDNA Cloning, cDNA Crude samples, Crude samples, incorporation of derivatized dNTPs and GC-rich targets Hot start routine PCR Hot start routine PCR Long targets, difficult PCR Enzymes

       [email protected] [email protected] website our Visit Targets Difficult Diverse Research Our Success With

your PCR Ends blunt blunt blunt 3’-dA 3’-dA 3’-dA Product Priced Competitively and 3’-dA) Mixed (blunt Mixed enzymes offer the highest accuracy of commercially available proofreading DNA polymerases. Targets Difficult While many targets can be amplified with little optimization, certain target sequences (such as GC-rich sequences or long, complex targets) remain challenging. require a These high-performance enzyme targets optimized may for amplifications. difficult PCR Cloning We offer PCR cloning kits for ends amplicons (AccepTor™ Vector Kits) and that amplicons with blunt have ends 3´-dA Blunt® Kits). Please refer to the PCR Cloning section (Perfectly of this brochure (page 40) for more information.        Yield

       GC-rich Templates Best         Fidelity        Specificity Excellent  60 60 60 120 120 120 120 Rate (bases/s) Elongation Good <6  <21 <40 <30 PCR <5 kb <5 kb <5 kb Product Size (kb)

DNA Hot Start ™ DNA

Antibody Satisfactory KOD Xtreme™ Hot Start DNA Polymerase NovaTaq plus Polymerase Taq NovaTaq DNA Polymerase Polymerase KOD Hot Start DNA Polymerase KOD XL DNA NovaTaq Polymerase Polymerase KOD DNA  Enzyme PCR Enzyme Selection Guide Novagen • PCR Tools PCR • Novagen Rate Elongation experiment total the only not affects rate elongation Polymerase Fidelity product will be used Fidelity is critical when the amplification for applications such as direct sequencing or cloning. KOD PCR Enzyme Selection Guide Selection PCR Enzyme and kits for PCR selection of enzymes A complete Specificity restoring and temperature room at polymerase the Inactivating activity after initial denaturation can increase amplification specificity. The two most common strategies used to create heat-activatable forms of DNA modification polymerase Taq™ (Nova are Hot chemical antibody-mediated methods Start (KOD Hot Start DNA Polymerase, DNA Polymerase) KOD Xtreme™ Hot or Start DNA Polymerase, and NovaTaq DNA Antibody). plus Taq Polymerase time but also product yield and success a rate. faster Generally, fewer in products full-length of yield higher generate can enzyme amplification cycles. PCR • Thermostable DNA Polymerases

S E D N T P N TH N d s O E E F W

Thermostable DNA Polymerases O E C B

I R Page L I N 20 D www.novagen.com P C E KOD Hot Start DNA Polymerase C R L U D /KOD Heat-activatable form of KOD DNA Polymerase for increased specificity and convenient PCR setup

Features KOD Hot Start DNA Polymerase* is a premixed complex of • More accurate PCR in a shorter time high-fidelity KOD DNA Polymerase and two monoclonal • Highest accuracy, yield, and processivity of commercially antibodies that inhibit the DNA polymerase and 3’→5’ available proofreading DNA polymerases exonuclease activities at ambient temperatures (Mizuguchi • Amplifies genomic DNA templates up to 12 kb 1999). KOD Hot Start combines the high fidelity, fast • Amplifies plasmid and lambda DNA templates up to 21 kb • Eliminates mispriming and primer-dimer formation extension speed, and outstanding processivity of KOD with • Convenient ambient-temperature setup compatible with the high specificity of an antibody-mediated hot start. Non- automation specific amplification is reduced because mispriming events • Optimal KOD Hot Start Buffer for robust PCR performance during setup and initial temperature increase are avoided. with a wide range of targets In addition, primer degradation due to exonuclease activity Product Size Cat. No. Price during setup at ambient temperature is effectively inhibited. KOD Hot Start DNA 20 U 71086-5 KOD Hot Start DNA Polymerase generates blunt-ended DNA Polymerase 200 U 71086-3 o 1000 U 71086-4 products suitable for cloning with the Novagen® Perfectly Blunt® and LIC Vector Kits. The enzyme is compatible with Components 200 U or 5 × 200 U KOD Hot Start DNA Polymerase (1.0 U/ml) site-directed mutagenesis protocols. 1.2 ml or 5 × 1.2 ml 10X PCR Buffer for KOD Hot Start Unit definition: One unit is defined as the amount of DNA Polymerase

1 ml or 5 × 1 ml 25 mM MgSO4 enzyme that will catalyze the incorporation of 10 nmol dNTP 1 ml or 5 × 1 ml dNTP Mix (2 mM each) into acid-insoluble form in 30 min at 75°C, in a reaction Additional Information Available containing 20 mM Tris-HCl (pH 7.5 at 25°C), 8 mM MgCl2, KOD Hot Start DNA Polymerase User Protocol TB341 inNovations Nos. 17, 21, 25 7.5 mM DTT, 50 mg/ml BSA,150 µM each of dATP, dCTP, dGTP, dTTP (a mix of unlabeled and [3H]dTTP), and 150 µg/ ml activated calf thymus DNA. Source Recombinant Thermococcus kodakaraensis KOD1 DNA polymerase expressed References: in E. coli Mizuguchi, H., et al. 1999. J. Biochem. (Tokyo) 126, 762. Kitabayashi, M., et al. 2002. Biosci. Biotechnol. Biochem. 66, 2194. Concentration 1.0 U/ml Fujii, S., et al. 1999. J. Mol. Biol. 289, 835. Nicking activity None detected Amplification efficiency Functional PCR; inhibition of activity at 21˚C verified

* Manufactured by and distributed by EMD Chemicals. Not available from Merck Chemicals in Japan.

6 For more information or to place an order, Novagen • PCR Tools contact your local office (see back cover). Thermostable DNA Polymerases 7 www.merckbio.com Thermostable DNA Polymerases DNA Thermostable • PCR PCR 0 fidelity + 6. 5.1 [email protected] [email protected] website our Visit rpsL N/A q KOD yields more product in fewer cycles compared to KOD yields more product in fewer cycles compared other PCR enzymes (GSK 3α kinase synthase glycogen human of fragment 919-bp A cycling different 4 in enzymes 7 of one by amplified was 3α) the encompass which here), shown is A Profile Cycle (only protocols (5 samples PCR conditions. cycling recommended manufacturers’ 1.4% on analyzed and cycles 29 and 27, 25, 23, after taken were μl) reaction. the for used enzyme the indicate Lanes gels. agarose/TAE PicoGreen® (Note: above. table the in defined are profiles Cycling DNA HS PrimeSTAR® with increase yield a indicate results assay is intensity band reduced the 29; cycle to 27 cycle from Polymerase artifact.) gel a 23. page on Note Technical the see please article full the For 55°C 10 s 55°C 10 15 s 70°C 95°C 20 s 95°C 2 min Cycle Profile D Mutation frequency

ol. ol. ercentage of Mutants P Mutation Frequency (%) ol. ol. ol. kb ol. 0 1 lymerase. M: markers. 95°C 20 s 55°C 20 s 72°C 30 s ol. 95°C 2 min 72°C 3 min 0.25 0.1 0.1 12.3 Cycle Profile C AR® HS DNA P urbo®, PfuUltra®, and Ta 0.0 1.0 2.0 3.0 4.0 5.0 0.0 1.0 2.0 8.4 q Pfx50™ DNA P Phusion™ Hot Start DNA P PfuUltra® II Fusion HS DNA P PrimeST Sample PCR Markers KOD Hot Start DNA P KOD DNA P Platinum® Pfx DNA P PfuT Ta M urbo Genomic DNA amplification The human myosin heavy chain gene (8.4 kb) and human β-globin gene (12.3 kb) were amplified using KOD Hot Start DNA Po PfuUltra 4 5 6 7 Lane M 1 2 3 PfuT 94°C 15 s 52°C 20 s 68°C 60 s 94°C 2 min 68°C 5 min KOD Hot Start 7 Cycle Profile B 7 6 6 M

5 5 00% M M 51 53 164 354 4 4 Mutant 3 3 2 25 cycles 2 29 cycles 12 15 21 98°C 10 s 98°C 10 55°C 20 s 72°C 30 s 98°C 30 s 1 72°C 5 min 1 Cycle Profile A (plus final extension) 2, Fujii 1999). Colonies 000 Number of M otal 1200 M 7 T 5 49900 65900 7 7 6 6 5 Product Size (kb) 5 M M 4 4 3 3 23 cycles 27 cycles lymerase. M: markers. 2 2 DNA urbo 1 1 olymerase q P M 1 2 4 6 8 10 Lambda DNA amplification The indicated size fragments of lambda DNA were amplified using appropriate primers and KOD Hot Start DNA Po Ta KOD Hot Start PfuUltra PfuT M Mutation Frequency: (Number of mutant × 1 colonies/Number of total colonies) M Initial denaturation 29 cycles Final extension Mutation frequency comparison: KOD Hot Start, Mutation frequency comparison: assay (Kitabayashi 200 The fidelity of replication was measured as the mutation frequency in PCR products using a modified The fidelity of replication was measured as the mutation Continued KOD Hot Start DNA Polymerase Polymerase Start DNA KOD Hot Novagen • PCR Tools PCR • Novagen PCR • Thermostable DNA Polymerases

S E D N T P s N d TH E F ON E

Thermostable DNA Polymerases O W C

I E R B Page L I N 20 C D P C R L U D E www.novagen.com KOD Hot Start Master Mix /KOD Premixed 2X KOD Hot Start PCR components for convenience and reproducibility

Features KOD Hot Start Master Mix* is a ready-to-use 2X mixture • More accurate PCR in a shorter time optimized for convenient high-fidelity PCR. The mix contains • Highest accuracy, yield, and processivity of commercially KOD Hot Start DNA Polymerase, two monoclonal antibodies, available proofreading DNA polymerases ultrapure deoxynucleotides, and reaction buffer with MgSO . • Amplifies genomic DNA templates up to 12 kb 4 The Master Mix simplifies PCR set-up, offering time savings, • Amplifies plasmid and lambda DNA templates up to 21 kb consistency, and minimal risk of contamination. The mix is • Eliminates mispriming and primer-dimer formation • Convenient ambient-temperature setup compatible with ideal for use in high-throughput applications. This master automation mix quickly and accurately amplifies genomic and phage/ • Optimal KOD Hot Start Buffer for robust PCR performance plasmid DNA targets to 12 kb and 21 kb respectively. Simply with a wide range of targets add KOD Hot Start Master Mix to an equal volume of sample

Product Size Cat. No. Price containing DNA template and primers. The final diluted KOD Hot Start 100 rxn 71842-3 reaction contains 1 U KOD Hot Start DNA Polymerase per Master Mix 500 rxn 71842-4 50 µl reaction. The smaller size is sufficient for 100 x 50 µl Components reactions or 250 x 20 µl reactions. The larger size is adequate 2 × 1.25 ml or 10 × 1.25 ml KOD Hot Start Master Mix for 500 x 50 µl reactions or 1250 x 20 µl reactions. Additional Information Available KOD Hot Start Master Mix User Protocol TB506

1 2 3 4 5 6 7 8 9 10 Lane Template – Target - Size 1 PCR Markers 2  DNA – att region - 595 bp 3  DNA – att region - 595 bp 4 PCR Markers 5 cDNA plasmid – GSK 3 CD ORF – 919 bp 6 cDNA plasmid – GSK 3 CD ORF – 919 bp 7 PCR Markers 8 Uncut BacVector® 3000 DNA – Chitinase deletion region – 1.9 kb 9 Uncut BacVector 3000 DNA – Chitinase deletion region – 1.9 kb 10 Perfect DNA™ Markers, 0.5-12 kb

PCR products amplified using KOD Hot Start Master Mix The indicated DNA fragments were amplified using KOD Hot Start Master Mix in separate 50-µl or 20-µl reactions using cycling conditions indicated in the user protocol. Samples (5 µl) were analyzed by agarose gel electrophoresis (1.0% TAE) and stained with ethidium bromide.

* Manufactured by and distributed by EMD Chemicals. Not available from Merck Chemicals in Japan.

8 For more information or to place an order, Novagen • PCR Tools contact your local office (see back cover). Thermostable DNA Polymerases 9

EB W E H

/KOD N O

www.novagen.com

s E P D

N L d C I N

R F O 150

D R

N P

C I L See Page 10 for additional data. 10 See Page www.merckbio.com Thermostable DNA Polymerases DNA Thermostable • DE UI

G 120 PCR PCR 20 )

Page

E -5

R R U E O S 90 polymerase - Taq 141.2 [email protected] [email protected] website our Visit polymerase 130.3 - LA Taq

Percentage of Mutants Percentage Mutation Frequency (%) Mutation Frequency (× 10 30 The KOD Xtreme™ Hot GC-rich or long of Start amplification the for system PCR optimized DNA Polymerase* kit KOD fidelity high is ultra an includes system The templates. DNA an to antibodies monoclonal two with complexed polymerase DNA formulated specially with along thermocycling, start hot permit and quickly Polymerase DNA Start Hot Xtreme KOD buffer. 2X accurately amplifies genomic and phage/plasmid DNA targets up to 24 and 40 kb, with up to 90% GC content. challenging DNA templates respectively. It successfully amplifies Polymerase, DNA Start Hot Xtreme KOD U 200 provides kit Each amplification 200 for sufficient dNTPs and buffer, optimized an products DNA blunt-ended produces polymerase The reactions. suitable for cloning with the Novagen® Perfectly Blunt® and Kits. LIC Vector s 13.1 - KOD Xtreme™ Hot Start DNA Polymerase P

T N

3.4 - KOD Hot Start d 00 TB507 Price No. 28 5 19 218 145 Mutated Cat. No. 71975-3 Number of Bases 102,708 145,753 144,535 167,343 Sequenced Size 200 U ‡ KOD Xtreme Hot Start DNA Polymerase 2X Xtreme Buffer dNTPs (2 mM each) and distributed by EMD Chemicals. Not available from Merck Chemicals in Japan. DNA Polymerase KOD Hot Start KOD Xtreme LA Taq Taq ‡ LA Taq is representative of polymerases mixes which ‡ LA Taq DNA polymerase and a proofreading are a blend of Taq Advan- LA DNA Polymerase, enzyme, such as AccuTaq™ LA tage polymerases, Expand PCR systems, and TaKaRa ™ polymerase Taq Optimized for the highest PCR success rate, even with the Optimized for the highest most difficult targets to 90% GC-content templates Efficiently amplifies up blends fidelity than Taq higher 10X up to 24 kb Amplifies genomic targets targets up to 40 kb Amplifies phage/plasmid from crude samples Efficiently amplifies DNA primer-dimer formation Eliminates mispriming and setup compatible with Convenient ambient-temperature automation KOD Xtreme™ Hot Start DNA Polymerase Additional Information Available User Protocol KOD Xtreme Hot Start DNA Polymerase Product Components 1 × 200 U 3 × 1.7 ml 2 × 1 ml inNovations Features: • • • • • • • • KOD system optimized for difficult targets optimized for difficult KOD system KOD Xtreme™ Hot Start DNA Polymerase Start DNA Hot KOD Xtreme™ Novagen • PCR Tools PCR • Novagen * Manufactured by PCR • Thermostable DNA Polymerases Thermostable DNA Polymerases KOD Xtreme™ Hot Start DNA Polymerase

Continued

M1 1234 5 6 M2 GC-rich target Amplification Lane Samples M1 1 kb DNA ladder The human IGF2R gene[NM_000876] contains a 5’ 1 Product of KOD Xtreme™ Hot Start DNA Polymerase region that is ~90% GC. The reactions contained 2 Product of Ex Taq™ polymerase cDNA derived from 50 ng HeLa cell total RNA. PCR 3 Product of LA Taq™ polymerase cycling parameters for KOD Xtreme were as follows: 4 Product of PrimeSTAR® polymerase with GC Buffer initial denaturation at 94°C for 2 min; 30 cycles at 5 Product of LA Taq polymerase with GC Buffer 1 98°C for 10 s, 68°C for 9 min. For polymerases from 6 Product of LA Taq polymerase with GC Buffer 2 other manufacturers, optimal cycling parameters as M2 l/HindIII DNA Markers recommended by each manufacturer were used.

M1 12 34 5 M2 Genomic DNA Amplification Lane Samples M1 1 kb DNA ladder The indicated targets were amplified from 200 ng 1 1.3 kb b-globin target human genomic DNA. PCR cycling parameters for 1.3 2 3.6 kb b-globin target to 8.5 kb targets: initial denaturation at 94°C for 2 3 8.5 kb b-globin target min; 30 cycles at 98°C for 10 s, 68°C for 1 min/kb. PCR 4 17.5 kb b-globin target cycling parameters for 17.5 and 25 kb targets: initial 5 24 kb tissue plasminogen activator target denaturation at 94°C for 2 min; 5 cycles at 98°C for M2 l /HindIII DNA Markers 10 s, 74°C for 1 min/kb; 5 cycles at 98°C for 10 s, 72°C for 1 min/kb; 5 cycles at 98°C for 10 s, 70°C for 1 min/kb; 20 cycles at 98°C for 10 s, 68°C for 1 min/kb.

1 2 3 44 55 M 6 7 Performance of KOD Xtreme Hot Start DNA Lane(s) Samples

Polymerase versus competitors' polymerases M 1 kb ladder � 1 Product of PfuTurbo® DNA Polymerase in amplification of genomic DNA 2 Product of Advantage 2 polymerase A 6273 bp region of the GAD67 target was amplified 3 Product of LA Taq Polymerase from 100 ng chick kidney genomic DNA. PCR cycling 4 Product of Expand Long Template system parameters for KOD Xtreme were as follows: initial 5 Product of Herculase® polymerase denaturation at 94°C for 2 min; 35 cycles at 98°C 6, 7 Products of KOD Xtreme for 10 s, 68°C for 7 min. For polymerases from Hot Start DNA Polymerase other manufacturers, optimal cycling parameters as recommended by each manufacturer were used.

These data were provided by a member of the Faculty of Medicine, Kyoto University.

10 For more information or to place an order, Novagen • PCR Tools contact your local office (see back cover). Thermostable DNA Polymerases

EB 11 W E H

/KOD N O

www.novagen.com

s E P D , 7.5 mM DTT,

T U 2

µg/ml activated

N L d C I N

O R F

D R

N P

C I L www.merckbio.com Thermostable DNA Polymerases DNA Thermostable • s P PCR PCR

T 20

H]dTTP), and 150 Page

N 3 d µM each of dATP, dCTP, dGTP, dTTP [email protected] [email protected] website our Visit 0-kb PCR fragment Sample 1-kb PCR fragment 2-kb PCR fragment 4-kb PCR fragment 6-kb PCR fragment 8-kb PCR fragment 1 12-kb PCR fragment 15-kb PCR fragment Lane 1 2 3 4 5 6 7 8 50 mg/ml BSA, 150 (a mix of unlabeled and [ References: 88, 141. J. Biotechnol. Nishioka, M., et al. 2002. . 13, 309. Bioconjugate Chem Sawai, H., et al. 2002. . 24, 2604. Chem. Commun Sawai, H., et al. 2001. KOD XL DNA Polymerase* is an DNA Polymerase and optimized a mutant form of blend KOD that is deficient of KOD in 3´→5´ exonuclease activity (Nishioka 2002). This enzyme complex long, of amplification reliable for designed is mixture targets with robust yield and high accuracy. It can used for incorporation of derivatized dNTPs in PCR amplicons also be generates Polymerase DNA XL KOD 2001). Sawai 2002, (Sawai a mixture of PCR products with blunt and 3´-dA overhangs, suitable for cloning with Kits. the AccepTor™, and LIC Vector Novagen® Perfectly Blunt®, Unit definition: One unit is defined as the amountof enzyme that will catalyze the incorporation of 10 nmol of dNTP into containing reaction a in 75˚C, at min 30 in form acid-insoluble 20 mM Tris-HCl (pH 7.5 at 25˚C), 8 mM MgCl calf thymus DNA. lymerase Price TB342 No. 17 q DNA Po Ta koda- KOD XL (wild type and Cat. No. 71087-3 71087-4 1 2 3 4 5 6 7 8 Thermococcus E. coli M 8 Size 250 U 7 exonuclease-deficient forms) 2.5 U/ml None detected None detected Functional PCR Recombinant karaensis KOD1 DNA polymerase expressed in 1250 U lymerase in a 50-µl reaction. M: markers. and distributed by EMD Chemicals. Not available from Merck Chemicals in Japan. KOD XL DNA Polymerase (2.5 U/ml) KOD XL DNA Polymerase KOD XL DNA Polymerase PCR Buffer for 10X dNTP Mix (2 mM each) aq T 1 2 3 4 5 6 erformance comparison Ideal for amplification of large DNA fragments from Ideal for amplification of purified DNA or crude samples up to 30 kb Amplifies DNA templates sequences Successfully amplifies GC-rich derivatized dNTPs Efficiently incorporates or 2.5 U KOD XL DNA Po P The indicated λ DNA fragments were amplified using 2.5 U Concentration Endonuclease Nicking activity Amplification efficiency Source KOD XL DNA Polymerase inNovations Additional Information Available User Protocol KOD XL DNA Polymerase Product Components 250 U or 5 × 250 U 1.2 ml or 5 × 1.2 ml 1 ml or 5 × 1 ml Features • • • • * Manufactured by High performance enzyme blend for long and accurate PCR for long and accurate enzyme blend High performance KOD XL DNA Polymerase DNA Polymerase KOD XL Novagen • PCR Tools PCR • Novagen PCR • Thermostable DNA Polymerases

S E D N T P N TH N d s O E E F W

Thermostable DNA Polymerases O E C

I B R Page L I N 20 D P C E www.novagen.com KOD DNA Polymerase C R L U D /KOD Pure recombinant high fidelity DNA polymerase fromThermococcus kodakaraensis KOD1

Features KOD DNA Polymerase* is a recombinant form of Thermococcus • More accurate PCR in a shorter time kodakaraensis KOD1 DNA polymerase (Nishioka 2001). KOD is • Higher fidelity thanPfu DNA polymerase—excellent for a high-fidelity thermostable polymerase that amplifies target cloning DNA up to 6 kb with superior accuracy and yield (Takagi 1997). • Greater yield—extension speed is 2X faster than Taq DNA The 3´→5´ exonuclease-dependent proofreading activity of polymerase and 5X faster than Pfu DNA polymerase • Higher processivity—sequential nucleotide polymerization the enzyme results in a lower mutation frequency than any is 10- to 15-fold greater than Pfu and Tli DNA other commercially available DNA polymerase. The elongation polymerases rate and processivity are 5 times and 10 to 15 times higher, • Does not result in truncated amplification products respectively, than for Pfu DNA polymerase, resulting in highly Product Size Cat. No. Price accurate products and robust yield in a short reaction time. KOD DNA Polymerase 250 U 71085-3 The enzyme generates blunt-ended PCR products suitable for cloning with the Novagen® Perfectly Blunt® and LIC Vector Components Kits. 250 U KOD DNA Polymerase (2.5 U/ml) Unit definition: One unit is definedT P as the amount of enzyme 1 ml 10X Buffer #1 for KOD DNA Polymerase (pH 8.0) d N s 1 ml 10X Buffer #2 for KOD DNA Polymerase (pH 8.8) that will catalyze the incorporation of 10 nmol of dNTP into 1 ml 25 mM MgCl 2 acid-insoluble form in 30 min at 75˚C, in a reaction containing 1 ml dNTP Mix (2 mM each) 20 mM Tris-HCl (pH 7.5 at 25˚C), 8 mM MgCl2, 7.5 mM DTT, Additional Information Available 50 mg/ml BSA, 150 µM each of dATP, dCTP, dGTP, dTTP KOD DNA Polymerase User Protocol TB320 3 inNovations No. 25 (a mix of unlabeled and [ H]dTTP) and150 µg/ml activated calf thymus DNA.

References: Source Recombinant Thermococcus kodakaraensis KOD1 Nishioka, M., et al. 2001. J. Biotechnol. 88, 141. DNA polymerase expressed in E. coli Takagi, M., et al. 1997. Appl. Environ. Microbiol. 63, 4504. Concentration 2.5 U/ml Purity > 90% homogeneous by SDS-PAGE 5' Exonuclease Less than 2% per unit of enzyme M 1 2 3 when incubated 1 h at 74˚C in a reaction with 5'-labeled l/ScaI bp Lane Sample M Perfect DNA™ Markers, 0.5–12 kbp digest 12,000 – 10,000 – 1 5.4-kb PCR product (lambda DNA) Nicking activity None detected 8000 – 2 2.0-kb PCR product (plasmid DNA) 6000 – Amplification efficiency Functional PCR 3 1.6-kb PCR product (human genomic DNA) 4000 – 3000 –

2000 – 1500 – PCR products amplified using KOD DNA Polymerase 1000 – DNA fragments from various templates were amplified using 2.5 U KOD DNA Polymerase in a 100-µl reaction. Samples were analyzed 500 – by agarose gel electrophoresis (1.2% TAE).

* Manufactured by and distributed by EMD Chemicals. Not available from Merck Chemicals in Japan.

12 For more information or to place an order, Novagen • PCR Tools contact your local office (see back cover). Thermostable DNA Polymerases

O R O R 13 F F for

D D 2

R R

E E

C C

S S

N P P

E E

C C I I L L D

. The Master s E

2 P D

T U

20 N L

Page d C I N . The final diluted 2 q Hot Start

20 Page g activated salmon sperm salmon activated µg www.merckbio.com q DNA polymerase Thermostable DNA Polymerases DNA Thermostable • PCR PCR DNA polymerase and can minimize olymerase Taq E). NA P 2-kb fragment amplifed using Company A chemically modified Ta Sample Markers 2-kb fragment amplified using NovaTa P]dCTP, and 12.5 and P]dCTP, Hot Start PCR products The indicated fragments were amplified under standard conditions for each enzyme and analyzed by agarose gel electrophoresis (1.2% TA [email protected] [email protected] website our Visit D 2 Lane M 1 32 concentration. Simply add the NovaTaq Hot 2+ DNA polymerase that is inactive at ambient 2 M [α- µM Taq 1 µl. The two NovaTaq Hot Start Master Mix Kit sizes y , 1 mM 2-mercaptoethanol, 0.2 mM dATP, dGTP, and 2 M bp 000 – 800 – 600 – 400 – 200 – 1 DNA in a volume of 50 µl. Mix simplifies the set-up for PCR resulting into addition In time savings, contamination. of risk minimal and consistency, MgCl and Water Grade PCR includes kit the Mix, Master the 2500 – 2000 – 1500 – optimizing Mg NovaTaq Hot Start Master Mix provides a ready-to-use mixture 2X of NovaTaq Hot Start DNA deoxynucleotides, and reaction buffer with MgCl Polymerase, ultrapure Hot Start DNA Polymerase is a chemically modified chemically a is Polymerase DNA Start Hot NovaTaq™ form of temperature. The enzyme provides improved specificity when compared to standard the generation of nonspecific amplification products,as primer-dimers and such misprimed products. The enzyme must be activated by heat treatment (10 min at 95˚C), after which thermal cycling can proceed. The products with 3´-dA overhangs, suitable enzyme for cloning with the generates PCR Kits. Blunt®, AccepTor™, and LIC Vector Novagen® Perfectly Unit definition: one unit is defined as the amount of enzyme that will catalyze the incorporation of 10 nmol of dNTP into containing reaction a in 72˚C, at min 30 in form acid-insoluble 25 mM TAPS (tris-[hydroxymethyl]-methyl-amino-propane- sulfonic acid, sodium salt), pH 9.3 at 25˚C, 50 mM KCl, 2 mM MgCl Start Master Mix to an equal volume containing DNA template, DNA containing volume equal an to Mix Master Start primers, and, if desired, additional MgCl dTTP, 0.1 dTTP, Hot Start DNA Polymerase Polymerase DNA Start Hot NovaTaq of U 1.25 contains reaction per 50 1000provide standardsufficient 50-µl components for 200 or amplification reactions.

E S Price Price TB460 TB460 71091-3 71091-4 Cat. No. Cat. No. 71676-3 71676-4 aquaticus DNA poly- E. coli Size Size 2 250 U Thermus 1,250 U 200 rxn 1000 rxn 1000 2 Hot Start Master Mix NovaTaq 25 mM MgCl PCR Grade Water 5 U/ml None detected None detected Functional PCR Recombinant merase expressed in Hot Start DNA Polymerase NovaTaq Hot Start Buffer NovaTaq 10X 25 mM MgCl ™ Hot Start Master Mix Kit ™ Hot Start DNA Polymerase Start DNA Polymerase ™ Hot Higher PCR specificity and yield Higher PCR specificity and amplification Improved low-copy target compatible with automation Ambient temperature setup amplification of up to 5 kb Target high-throughput PCR Ideal for quantitative and applications Taq Taq Concentration Endonuclease Exonuclease Amplification efficiency Source Product ™ Hot Start Master NovaTaq Mix Kit Components 4 × 1.25 ml or 20 × 1.25 ml 1 × 1.5 ml or 3 × 1.5 ml × 2 ml 3 × 2 ml or 11 Additional Information Available and Kits User Protocol Hot Start DNA Polymerase NovaTaq Additional Information Available Hot Start DNA Polymerase NovaTaq and Kits User Protocol Product Components 250 U or 5 × 250 U 1.5 ml or 5 × 1.5 ml 1.5 ml or 5 × 1.5 ml ™ Hot Start DNA NovaTaq Polymerase Features • • • • • Premixed 2X “hot start” PCR components for convenience and reproducibilit Nova DNA polymerase DNA polymerase Taq form of recombinant chemically modified Heat-activatable, Nova Novagen • PCR Tools PCR • Novagen PCR • Thermostable DNA Polymerases

S E D N E F

Thermostable DNA Polymerases O C

I R Page L 20 NovaTaq™ DNA Polymerase P C R

Ultrapure recombinant enzyme for dependable PCR amplification

Product Size Cat. No. Price NovaTaq™ DNA Polymerase is a premium quality NovaTaq™ DNA Polymerase 100 U 71003-3 recombinant form of Thermus aquaticus DNA polymerase. 500 U 71003-4 2500 U 71003-5 This thermostable enzyme is suitable for a wide range of PCR applications. To ensure the highest purity and Components 100 U, 500 U, or 5 × 500 U NovaTaq DNA Polymerase reproducible perfomance, each preparation is extensively 1 × 1.5 ml, 2 × 1.5 ml, or 7 × 1.5 ml 10X NovaTaq Buffer with MgCl 2 tested in a variety of quality control assays. NovaTaq DNA 1 × 1.5 ml, 2 × 1.5 ml, or 7 × 1.5 m 10X NovaTaq Buffer without MgCl 2 Polymerase has 5´→3’ exonuclease activity and lacks 1 × 1.5 ml, 2 × 1.5 ml, or 7 × 1.5 ml 25 mM MgCl2 3’→5’ exonuclease activity. The enzyme generates PCR products Additional Information Available NovaTaq DNA Polymerase and Kits User Protocol TB309 with 3’-dA overhangs, suitable for cloning with the Novagen® Perfectly Blunt®, AccepTor™, and LIC Vector Kits. Each kit also

Source Recombinant Thermus aquaticus DNA includes optimized 10X NovaTaq Buffer with 15 mM MgCl2 polymerase expressed in E. coli for routine amplification conditions, plus separate vials of 10X Concentration 5 U/ml NovaTaq Buffer without MgCl2 and 25 mM MgCl2 to enable Purity >95% homogenous by SDS-PAGE convenient optimization of Mg2+ concentration. Endonuclease None detected Unit definition: one unit is defined as the amount of enzyme RNase None detected Amplification efficiency Functional PCR that will catalyze the incorporation of 10 nmol dNTP into acid- insoluble form in 30 min at 74˚C, in a reaction containing 25 mM TAPS (tris-[hydroxymethyl]-methyl-amino-propane- sulfonic acid, sodium salt), pH 9.3 at 25˚C, 50 mM KCl, 2 mM bp M 1 2 3 4 5 M MgCl2, 1 mM 2-mercaptoethanol, 0.2 mM dATP, dGTP, and 12,000 – 32 8000 – dTTP, 0.1 µM [α- P]dCTP, and activated salmon sperm DNA. 6000 – 4000 – 3000 – 2000 – 1500 – Lane Sample PCR products amplified using 1000 – M Perfect DNA™ Markers, 0.5–12 kb 1 0.5-kb PCR product NovaTaq DNA Polymerase 2 1.0-kb PCR product DNA fragments 0.5 to 7.35 kb in size were 3 2.0-kb PCR product 500 – amplified using 2.5 U NovaTaq DNA Polymerase in 4 4.8-kb PCR product separate 100-ml reactions. Products were analyzed 5 7.35-kb PCR product by agarose gel electrophoresis (1.2% TAE).

T S E D N P s N d E F O C

I R Page L I 20 N C D P NovaTaq™ PCR Master Mix L U D E C R

Premixed 2X PCR reaction components for convenience and reproducibility

Product Size Cat. No. Price The NovaTaq PCR Master Mix is a ready-to-use 2X mixture NovaTaq™ PCR 200 rxn 71007-3 of NovaTaq DNA Polymerase, ultrapure deoxynucleotides, Master Mix and reaction buffer without MgCl2. The Master Mix simplifies the assembly of PCRs and offers advantages of time savings, Components 4 × 1.25 ml 2X NovaTaq PCR Master Mix consistency, and minimal risk of contamination. Simply add 1.5 ml 25 mM MgCl Solution 2 the NovaTaq PCR Master Mix to an equal volume containing 3 × 2 ml PCR Grade Water the required amount of MgCl2, DNA template, and primers, Additional Information Available and the reaction is ready for thermal cycling. The final diluted NovaTaq DNA Polymerase and Kits Protocol TB309 reaction contains 2.5 U of NovaTaq DNA Polymerase per 100 ml. Sufficient components are included for 200 standard 50-ml (or 100 × 100-ml) amplification reactions.

14 For more information or to place an order, Novagen • PCR Tools contact your local office (see back cover). Thermostable DNA Polymerases ml 15 Taq www.merckbio.com Thermostable DNA Polymerases DNA Thermostable • ml) NovaTaq DNA Polymerase, PCR PCR l) of antibody inhibits > 95% of 5 U of U 5 of 95% > inhibits antibody of ml) [email protected] [email protected] website our Visit Taq DNA Polymerase, it provides an antibody- Antibody* is a mouse monoclonal antibody that inhibits that antibody monoclonal mouse a is Antibody* Taq The 10 mM a at salts) (monosodium dTTP and dNTP dGTP, dCTP, dATP, Mix ultrapure is a ready-to-use preparation concentration of mM 10 each in sterile deionized water at pH of qualified is and DNase and RNase of free is Mix dNTP The 7.0. for any application that requires pure deoxynucleotides, such as PCR, cDNA synthesis, and fill-in reactions. The Taq DNA polymerase activity at ambient temperatures. When mixed with mediated hot start that enhances the reaction during specificity,effective is Inhibition sensitivity, PCR. of convenience and assembly at ambient temperature, and is completely reversed when thermal cycling begins, with no other recombinant and native both inhibits antibody The effect conditions. on PCR Taq DNA polymerase activities, including Polymerase. ™ NovaTaq DNA (1 microgram One DNA polymerase at 40˚C. For convenience, simply mix 100 Taq Antibody with 500 U (100 with proceed and temperature, room at minutes 5 for incubate prepared freshly be can complex polymerase:antibody The PCR. later use. for each experiment or stored at –20˚C for Price Price TB322 Cat. No. 71088-3 Cat. No. 71004-3 Size 100 µl 100 Size 0.2 ml and distributed by EMD Chemicals. Not available from Merck Chemicals in Japan. and distributed by EMD Chemicals. Not available Antibody (1 mg/ml) Taq PCR Buffer 10X Higher PCR specificity and yield Higher PCR specificity and amplification Improved low-copy target compatible Ambient temperature setup with automation Product Antibody Taq Product Components ml 100 1.3 ml Additional Information Available Antibody User Protocol Taq 10mM dNTP Mix 10mM Antibody Antibody Features • • • * Manufactured by Qualified for enzymatic DNA synthesis 10 mM dNTP Mix 10 DNA polymerase into a hot start enzyme into a hot start DNA polymerase Taq Converts unmodified Taq Novagen • PCR Tools PCR • Novagen PCR • Direct PCR from Blood Direct PCR from Blood Direct PCR from Blood BloodDirect™ PCR Buffer Kits PCR amplification directly from human or mouse blood

Features BloodDirect™ PCR Buffer Kits are novel buffers that • Enables direct PCR amplification from neutralize DNA polymerase inhibitors present in human or anticoagulant-treated blood mouse blood. This eliminates all sample pretreatment steps • Ideal for genotyping and genetic screening experiments, and allows direct PCR amplification from as little as 0.5 µl of including routine transgenic mouse genotyping blood treated with any commonly used anticoagulant. • No DNA extraction required • Compatible with fresh, stored, and dried blood samples • Minimizes risk of sample cross-contamination Blood samples and other biological fluids contain a variety • Requires as little as 0.5 ml human or mouse blood of Taq DNA polymerase inhibitors such as polysaccharides, proteins, lipids and their conjugates, hemoglobin, and heparin. Product Size Cat. No. Price BloodDirect™ PCR Buffer Kit, 50 rxn 71342-3 Sequestration of these substances from the DNA template is Human 250 rxn 71342-4 necessary prior to PCR amplification. BloodDirect PCR buffers BloodDirect™ PCR Buffer Kit, 50 rxn 71343-3 Mouse 250 rxn 71343-4 neutralize charge-bearing inhibitory substances that might bind to DNA polymerase or template DNA. This ensures Components successful PCR amplification directly from blood. Cat. No. 71342 200 ml or 1 ml 5X BloodDirect Buffer 1 200 ml or 1 ml 5X BloodDirect Buffer A, Human Each BloodDirect PCR Buffer Kit includes two components: Cat. No. 71343 5X BloodDirect Buffer 1 and either 5X BloodDirect Buffer A m 200 l or 1 ml 5X BloodDirect Buffer 1 in the human kit or 5X BloodDirect Buffer B in the mouse 200 ml or 1 ml 5X BloodDirect Buffer B, Mouse kit. These buffers are added to the PCR mixture in place of Additional Information Available 10X PCR buffer. Anticoagulant-treated blood sample (1 µl BloodDirect PCR Buffer Kit User Protocol TB404 inNovations No. 18 per 50-ml mixture, 0.5 ml per 20-ml mixture) is added as the final component.

BloodDirect Kits can be used in genotyping and genetic screening experiments with fresh blood samples, with samples stored at –20°C for up to four years, and with archived dried blood samples stored on filter paper or specimen collection cards. BloodDirect PCR Buffer Kit for mouse blood is ideal for routine transgenic mouse genotyping. The simple protocol dramatically reduces the risk of cross-contamination and sample mishandling.

BloodDirect Kits are compatible with commercially available Taq DNA polymerases, except for chemically-modified hot start DNA polymerases. To perform hot start PCR with BloodDirect PCR Buffer Kits, use any antibody-mediated hot start DNA polymerase, for example, NovaTaq™ DNA Polymerase plus Taq Antibody.

16 For more information or to place an order, Novagen • PCR Tools contact your local office (see back cover). Direct PCR from Blood 17 M 4 ml 4 ml 1 ml 20 ml 0.1 ml 0.5 ml to 20 ml 40 cycles 0.125 m 0.125 mM Final Volume 1 ml 4 ml 10 ml 10 10 ml 10 50 ml 0.25 ml 0.5 mM 0.5 mM to 50 ml Direct PCR from Blood from PCR Direct • PCR PCR www.merckbio.com † † Preheating at 80˚ C for 15 min is recommended when fresh fresh when recommended is min 15 for C 80˚ at Preheating blood (collected on the same day as PCR amplification) is used. Final concentration 3’-primer DNA polymerase (5 U/ml) Taq PCR-grade water Anticoagulant-treated blood Cycling Conditions 94˚C, 4.5 min* 94˚C, 30 s Annealing temperature, 1 min 72˚C, 1 min 72˚C, 7 min Treatment 5X BloodDirect Buffer 1 * * † Typical PCR setup and cycling conditions Typical 5X BloodDirect Buffer A (or B) dNTP mixture (2.5 mM each) 5’-primer [email protected] [email protected] website our Visit 1 bp 1 bp 13 bp ← 408 bp ← 280 bp ← 2 ← 52 ← 52 rget 19 M 19 M E) and -treated human blood; lymerase using the TA HLA DPB1 q™ DNA Po aTa anel A shows the results from 1-ml samples 12 13 14 15 16 17 18 12 13 14 15 16 17 18 11 11 protein S AE) and ethidium bromide staining. Lane 1: 1 µl ED

anel B shows the results from 200-800 ng of each DNA purified from the tails of the same -globin β olymerase. For heparinized blood samples, the cycling conditions listed in the table above olymerase. For heparinized blood samples, the cycling conditions listed in the table

q DNA P M 1 2 3 4 N M 1 2 3 4 N M 1 2 3 4 N M M 1 2 3 4 N M 1 2 3 4 M 1 2 3 4 N Purified DNA samples M 1 2 3 4 5 6 7 8 9 10 ypical PCR setup and cycling conditions) were used with annealing at 55˚C; for purified DNA samples, the ypical PCR setup and cycling conditions) were used with annealing at 55˚C; for purified DNA M 1 2 3 4 5 6 7 8 9 10 Lane 2: blood dried in PCR tube; Lane 3: blood absorbed on filter paper (4-mm diameter); Lane 4: purified DNA paper (4-mm diameter); Lane Lane 2: blood dried in PCR tube; Lane 3: blood absorbed on filter equivalent to 1 µl blood; Lane N: negative control; Lane M: markers. cycling conditions listed in the table (PCR setup and cycling conditions) with annealing at 55°C. Ta with annealing at 55°C. cycling conditions listed in the table (PCR setup and cycling conditions) µl) of the total reaction volume was analyzed sequences included β-globin, protein S, and HLA DPB1. PCR samples(5 by agarose gel electrophoresis (2.5% T Comparison of direct PCR using fresh, dried, and purified DNA samples from human blood Comparison of direct PCR using performed with BloodDirect buffers and Nov PCR amplifications (50 µl) were A. Heparinized blood samples B. Screening for transgenic mice by BloodDirect PCR analysis buffers and PCR analysis to detect the lck promoter-human D4-GD1 transgene was performed using BloodDirect NovaTa (T conditions were modified (30 cycles and a 30-s annealing at 55˚C). P of heparinized blood; P 19 mice. A total reaction volume of 5 ml was analyzed by agarose gel electrophoresis (2.5% TA ethidium bromide staining. Lane M: markers. Continued BloodDirect™ PCR Buffer Kits Buffer Kits PCR BloodDirect™ Novagen • PCR Tools PCR • Novagen

Direct PCR from Blood PCR • RT - PCR RT - PCR

Page One Step RT-PCR Master Mix Kit 20

Convenient one-enzyme, hot start master mix system for RT-PCR

Features and Benefits: The One Step RT-PCR Master Mix Kit* allows rapid, sensitive • Robust one-step, one-enzyme master mix system for easy analysis of gene expression from tissues and cells. One Step reaction assembly RT-PCR Master Mix Kit can replace methods for detecting • Eliminates the risk of cross contamination associated with and quantifying gene expression such as Northern blots, two-step RT-PCR protocols • High-temperature (60°C) for reverse transcription in situ hybridization, dot blots, S nuclease assays and enhances read-through of RNA secondary structure conventional two step RT-PCR. The kit utilizes recombinant • Ideal for gene expression studies Thermus thermophilus (rTth) DNA Polymerase, which acts • Compatible with real-time RT-PCR as both a thermostable RNA‑dependent DNA polymerase • Optimized buffer conditions and antibody-mediated hot and a DNA‑dependent DNA polymerase. The rTth DNA start for increased sensitivity • Rapid enzyme activation step (30 s) avoids damage of Polymerase is provided in a 2X master mix with an antibody template RNA for antibody-mediated hot start, optimized buffer, and ultrapure deoxynucleotides. Antibody-mediated hot start Product Size Cat. No. Price One Step RT-PCR 50 rxn 71978-3 enhances specificity of both reverse transcription and PCR. Master Mix Kit The kit enables cDNA synthesis from input RNA followed by PCR amplification of the cDNA in a single reaction, with Components no additional hands-on requirement for buffer changes or 2 × 625 ml 2X One Step RT-PCR Master Mix

1 × 200 ml 50 mM Mn(OAc)2 adding reagents. Typically, detection of a specific transcript 1 × 1.1 ml RNase Free Water 1 × 50 ml Primer F (10 pmol/ ml) requires only 2 hours. 1 × 50 ml Primer R (10 pmol/ ml) 1 × 50 ml Positive Control RNA (5 × 108 copies/ml) We recommend using either two gene-specific primers or oligo Additional Information Available One Step RT-PCR Master Mix Kit User Protocol TB508 (dT) and one gene-specific 5´-primer with the kit. Although rTth adds 3´ dA overhangs, it is generally not recommended for PCR product cloning because the rTth error rate is higher than standard Taq DNA Polymerase. This kit is ideal for the rapid screening of gene expression.

* Manufactured by and distributed by EMD Chemicals. Not available from Merck Chemicals in Japan.

18 For more information or to place an order, Novagen • PCR Tools contact your local office (see back cover). RT - PCR 19 RT - PCR - RT • PCR PCR www.merckbio.com ml) of the first strand cDNA : oligo (dT). [email protected] [email protected] website our Visit The First Strand cDNA Synthesis preparation of Kit high-quality is first strand designed cDNA for from cellular RNA templates. the The kit contains Reverse MMLV Transcriptase for superior yields of full-length cDNA. Both oligo(dT) random hexamer primers and are included for a choice of general specific user-supplied to alternatives as and strategies priming primers. A small volume (1-2 reaction can be used in PCR amplification Use this Polymerase. kit in conjunction withwith the Straight A’s™ KOD DNA mRNA Isolation System and appropriate amplify rare coding regions. PCR reagents to RH: random hexamers, dT Price , where appropriate) and amplification. First strand primers Cat. No. 69001-3 69896-3 Size 20 µg 40 rxn

PCR of first strand cDNA synthesis with various The positive control RNA was subjected to first strand cDNA Control Primer (and primer combinations followed by addition of the 5'-sense antisense Control Primer are indicated. AS: antisense Control Primer,

RH AS + dT + AS

MMLV Reverse Transcriptase MMLV 5X First Strand Buffer mM DTT 100 mM dNTP Mix 10 Oligo(dT) Primer Random Hexamer Primers Nuclease-free Water 3’ AS Control Primer, Positive 5’ S Control Primer, Positive dT

AS + RH + AS

AS M Product Components 4000 U 200 ml ml 100 50 ml 20 mg mg 10 1.5 ml pmol 100 pmol 100 First Strand cDNA Synthesis Kit Oligo(dT) primer First Strand cDNA Synthesis Kit Synthesis Kit cDNA First Strand for RT-PCR of templates Reliable preparation Novagen • PCR Tools PCR • Novagen G E U • C I PCR Resource Guide R D U E

S E R FAQ Thermostable DNA Polymerases Resource Guide

What is the difference between NovaTaq™ and d. KOD Xtreme – 3´ to 5´ exonuclease proofreading activity KOD polymerases? e. NovaTaq – lacks 3´ to 5´ exonuclease proofreading activity f. NovaTaq Hot Start – lacks 3´ to 5´ exonuclease proofreading NovaTaq DNA Polymerase is a premium quality recombinant activity form of Thermus aquaticus DNA polymerase. The enzyme possesses 5´ to 3´ DNA polymerase activity and lacks 3´ to 5´ exonuclease activity (proofreading). The preparation is What types of ends do the various Novagen >95% pure and lacks RNase and endonuclease activities. polymerases leave on PCR amplification NovaTaq DNA Polymerase generates PCR products with 3´- products? dA overhangs. Generally, proofreading polymerases that possess 3´ to 5´ exonuclease activity will remove the 3´-dA overhangs whereas KOD is a recombinant form of Thermococcus kodakaraensis non-proofreading polymerases will not. KOD1 DNA Polymerase. The enzyme's 3´ to 5´ exonuclease- a. KOD – blunt ends dependent proofreading activity results in an extremely b. KOD Hot Start – blunt ends low mutation frequency. The extension speed of KOD is 2X c. KOD XL – mixture of blunt ends and 3´-dA overhangs faster than Taq, enabling shorter reaction times. KOD DNA d. KOD Xtreme – blunt ends polymerase produces blunt-ended DNA products. e. NovaTaq – 3´-dA overhangs f. NovaTaq Hot Start – 3´-dA overhangs Why should I use KOD DNA polymerases? KOD DNA Polymerase is an ultra high fidelity thermostable What does “hot start” mean and what are the DNA polymerase and a number of independent studies have advantages? verified the extreme high fidelity of KOD DNA Polymerase While it is most convenient to set up PCR reactions at compared to other thermophilic polymerases (Takagi 1997, ambient temperature, this can lead to mispriming events that Nishioka 2001, Rual 2004, Wu 2006). In addition to a result in non-specific amplification products. In addition, the low mutation frequency, the fast extension rate and high exonuclease activity possessed by proofreading enzymes, such processivity of KOD result in higher yields of full-length as KOD, can lead to primer degradation. “Hot start” means product in fewer reaction cycles. Combined, these make KOD that the polymerase is not active until cycling temperatures DNA polymerases the PCR enzyme of choice when speed and are increased to activate the polymerase. This eliminates the fidelity matter. mispriming and primer degradation concerns described above, Nishioka, M. et al. 2001. J. Biotech. 88, 141. resulting in greater specificity and increased target yield. In Rual, J-F. et al. 2004. Genome Res. 14, 2128. Takagi, M. et al. 997 Appl. Environ. Microbiol. 63, 4509. addition, “hot start” enzymes offer convenience of the room- Wu, G. et al. 2006. J. Biotechnol. 124, 496. temperature reaction set-up.

Are the Novagen® polymerases “proofreading”? How does the hot start work with Novagen What type of proofreading mechanism do polymerases? NovaTaq and KOD polymerases use? KOD Hot Start is a premixed complex of KOD DNA Polymerase KOD, KOD Hot Start, and KOD Xtreme™ polymerases all and two monoclonal antibodies. The antibodies inhibit possess 3´ to 5´ exonuclease proofreading activity, making the 3´ to 5´ exonuclease and DNA polymerase activities at them ideal for applications where fidelity is essential, such as ambient temperatures, providing high template specificity by PCR from reverse transcription reactions and cloning. KOD XL preventing primer degradation and mispriming during reation is a mixture of traditional KOD and its exonuclease-deficient set-up. mutant. NovaTaq polymerase does not have proofreading activity. NovaTaq Hot Start is a chemically modified form ofTaq DNA a. KOD – 3´ to 5´ exonuclease proofreading activity Polymerase that is inactive at room temperature. The enzyme b. KOD Hot Start – 3´ to 5´ exonuclease proofreading activity must be activated by heat treatment (10 minutes at 95˚C), c. KOD XL – mixture of KOD (with exonuclease proofreading after which thermal cycling can proceed. activity) and its exonuclease-deficient mutant.

20 For more information or to place an order, Novagen • PCR Tools contact your local office (see back cover). DE UI

G Thermostable DNA Polymerases Resource Guide

R R U E O S

4 21 FAQ concentration Resource Guide Resource • 2+ PCR PCR concentration can be 2+ www.merckbio.com concentration. Adjusting the final MgSO final the Adjusting concentration. 2+ [email protected] [email protected] website our Visit reduced in 0.25 mM increments. If the smearing is below the below is smearing the If increments. mM 0.25 in reduced target size, we would recommend increasing the extension time by 5 s/kb and/or increasing the Mg in 0.25 mM increments. Smearing can also sometimes reduced be by reducing the amount of template DNA added to the reaction. If not using a hot start enzyme, smearing can be caused by should Reactions set-up. reaction during activity exonuclease be set up on ice to avoid degredation. concentration from 1.5 to 2.25 mM in 0.25 mM increments should be tried when suboptimal results are targets obtained over 3000 bp. Also, the addition of DMSO to 2-10% for v/v final concentration may reduce secondary structure of the template DNA and increase yield. The 2X Xtreme Buffer supplied with KOD Xtreme polymerase has been optimized for long targets. The addition of DMSO or other additives is polymerase. generally not needed when using KOD Xtreme 10-25 s/kb. s/kb. 10-25 times. extension short or long too by caused be can Smearing If the smear is above the target size, extension time can be reduced by 5 s/kb and/or the Mg I see smearing of my PCR products after I see smearing of my PCR products is causing cycling when using KOD. What this and how can I get rid of it? Because KOD has higher processivity and times, faster reaction it is important to adjust extension times to Are there any special recommendations for Are there any special long targets? using KOD with In addition to trying one of our polymerases specialized for to beneficial often is it Xtreme), KOD or XL (KOD targets long Mg final the adjust With other KOD polymerases, the final concentration may decrease template secondary 2-10% addition of DMSO to structure and increase yield. Final DMSO concentrations of less than 5% v/v have no effect on fidelity. The effect of DMSO above 5% v/v on enzyme fidelityhas not yet been determined. KOD Xtreme Hot Start DNA Polymerases has been specifically been has Polymerases DNA Start Hot Xtreme KOD formulated for difficult targets, including GC-rich targets. Additions, such as DMSO or other additives, are generally not needed. Nucleic Acids Res. 34, 5007 Deigendesch, N. et al. 2006 Nucleic Acids Mol. Biol. Evol. 24, 2504. A. et al. 2007 Konno, Res. 35, 2944. Nucleic Acids Liang, J. et al. 2007 Are there any special using KOD with GC-rich targets? recommendations for Can I use KOD DNA polymerases for site- Can I use KOD DNA polymerases directed mutagenesis? KOD DNA polymerases are an ideal choice for site-directed mutagenesis protocols. These polymerases possess high fidelity, providing ultra- a reduced chance of unintentional changes. This high fidelity combined with high processivity and fast extension rate, allow for efficient amplification of plasmids over 10 kb with only the desired mutation. Below are selected citations of KOD Hot Start used for site-directed mutagenesis. What is the difference between KOD XL and KOD XL the difference between What is DNA Polymerases? ™ Hot Start KOD Xtreme KOD XL is designed for accurate and rapid amplification of complex, GC-rich, and long (up to 30 kb) target DNA. KOD XL is an optimized mixture of KOD DNA Polymerase and a mutant form of KOD that is deficient in 3´ to 5´ exonuclease resulting activity, in increased efficiency and betteryield of polymerase KOD of variation only the is XL KOD targets. long known to work in reactions for incorporation of modified dNTPs. KOD Xtreme™ Hot Start is an optimized the amplification PCR of system long for or GC-rich DNA templates. The system includes an ultra high fidelity KODPolymerase DNA complexed with two monoclonal antibodies to permit hot start thermocycling, along with amplifies accurately and quickly Xtreme KOD specially buffer. Xtreme formulated 2X kbp, 40 and 24 to up targets DNA phage/plasmid and genomic challenging amplifies successfully Xtreme KOD respectively. fidelity Relative content. GC 90% to up with templates DNA is higher than that of KOD XL. Novagen • PCR Tools PCR • Novagen G E U • C I PCR Resource Guide R D U E

S E R Protocol Comparison Thermostable DNA Polymerases Resource Guide

KOD Hot Start KOD Xtreme™ Phusion™ PfuUltra® II Hot Start Hot Start Fusion HS Company Merck Chemicals Merck Chemicals NEB/Finnzymes Stratagene Target Size genomic up to 12 kb genomic up to 24 kb genomic up to 7.5 kb genomic up to 19 kb phage/plasmid phage/plasmid (use 5U/rxn for genomic > 6 kb) up to 21 kb up to 40 kb vector up to 20 kbp Fidelity 50-fold higher than Taq 11-fold higher than Taq 52-fold higher than Taq 20-fold higher than Taq Ends blunt blunt blunt blunt Other target info For targets up to 90% GC Enzyme/50 µl rxn 1 U/rxn 1 U/rxn 1 U/rxn 1 µl/rxn Activate 95˚C for 2 min 94˚C for 2 min 98˚C for 30 s 95˚C for 2 min Denature 95˚C for 20 s 98˚C for 10 s 98˚C for 30 s 95˚C for 20 s Anneal Lowest Tm for 10 s Lowest Tm for 30 s Tm + 3 for 30 s Lowest Tm-5 for 20 s Extend 70˚C for 68˚C for 72˚C for 72˚C for 2 min, 5 sec 5 min 1 min, 15 s 1 min, 15 s Final Extension time n/a n/a 72˚C for 10 min 72˚C for 3 min # of cycles 25 30 30 30 Reaction time for a 1 h, 10 min 2 h, 51 min 1 h, 8 min 1 h, 3 min 5 kb target amplified from plasmid

PfuTurbo® PfuUltra Herculase® Platinum® Hot Start Hot Start Hot Start Pfx Company Stratagene Stratagene Stratagene Invitrogen Target Size genomic up to 19 kb genomic up to 6 kb genomic up to 37 kb up to 12 kb phage up to 20 kb (use 5 U/rxn for genomic > vector up to 48 kb 6kbp) vector up to 17 kb Fidelity 6-fold higher than Taq 18-fold higher than Taq 3-fold higher than Taq 26-fold higher than Taq Ends blunt blunt mixed blunt Other target info For GC rich, long, and challenging targets Enzyme/50 µl rxn 2.5-5 U/rxn 2.5-5 U/rxn 2.5-5 U/rxn 1-2.5 U/rxn Activate 95˚C for 2 min 95˚C for 2 min 95˚C for 2 min 94˚C for 2 min Denature 95˚C for 30 s 98˚C for 30 s 98˚C for 30 s 94˚C for 15 s Anneal Lowest Tm-5 for 30 s Lowest Tm-5 for 30 s Lowest Tm-5 for 30 s 55˚C for 30 s Extend 72˚C for 5 min 72˚C for 10 min 10 cycles: 72˚C for 5 min 68˚C for 5 min 20 cycles; 72˚C for 5 min + 10 s/cycle Final Extension time 72˚C for 5 min 72˚C for 10 min 72˚C for 10 min n/a # of cycles 30 30 30 30 Reaction time for a 3 h, 12 min 3 h, 12 min 3 h, 43 min 2 h, 53 min 5 kb target amplified from plasmid

22 For more information or to place an order, Novagen • PCR Tools contact your local office (see back cover). DE UI

G Thermostable DNA Polymerases Resource Guide

R R U E O S

23 † 4 1 3 3 2 2 1

Resource Guide Resource • Cycling profile Continues on page 24 PCR PCR www.merckbio.com 0.5 U 0.5 0.5 U 0.5 0.5 U 0.5 2.5 U 2.5 U 0.5 0.625 U 0.625 l (U not given) not (U ml Polymerase*/ l reaction 25-ml 0.5 ml were tested to determine an Technical Notes Technical Reaction volume Reaction volumes of 50, 25, 20, 10 and optimum volume for consistent results (data PCR not shown). Both 50- and 25-ml reactions gave consistent results, and the 25-ml volume was used for the remaining experiments. Template A 919-bp fragment of human GSK3a (glycogen synthase kinase 3a) catalytic Open an in GC-content, 54% ORF, domain Biosystems cDNA plasmid (MHS1010- 7507851, GeneBank BC027984) selected as the DNA template. was Primers/reagents Primers used were (35-mer HPLC sense) purified: -3´ TTTCCCAAGAAGTGGCTTACAC 5´-GACGACGACAAGA (41-mer and antisense) ACATCGCAGTTCATCAAAGA CCGGTCTTA 5´-GAGGAGAAGC AG-3´. the shows 1 Bases Table ORF. the to homologous shown in ion bold are components polymerase. used for each 5 5 5 5 5 5 5 [email protected] [email protected] website our Visit (ng) Template/ l reaction 25-ml 0.3 0.3 0.2 0.3 0.3 0.3 0.5 [Primer] M each) (mM 0.2 0.2 0.2 0.3 0.3 0.2 0.25 [dNTP] (mM each) (mM † See Table 2 for cycling parameters cycling for 2 Table See † 2.0 1.0 1.2 1.5 Materials and Methods Thermocycler DNA amplification was performed on MJ Research PTC-200 that had recently been calibrated by the thermocyclers manufacturer. Reactions were going to be done in tube strips, always using the same polymerase in the same location on each strip. To ensure no bias due to the location of the reaction in the strip or in the thermocycler, test reactions were performed using KOD Hot Start DNA Polymerase, and reaction yields measured. Yields were found comparable for all to tube locations be and wells tested (data not shown). and two monoclonal exonuclease 5´ 3´→ antibodies. the inhibit antibodies The and DNA 1999), (Mizuguchi temperatures polymerase ambient activities at providing high template specificity by preventing primer degradation mispriming events during reaction set- and up. This report evaluates the speed and product yield of KOD Hot Start Polymerase DNA in an optimized buffer reaction and compares the 6 enzyme other to commercially available fidelity thermophilic DNA polymerases. high (mM) ] in reaction in ] 2+

1.5 1.5 1.0 [Mg added in 1X buffer 1X in added in buffer in in buffer in in buffer in in buffer in Pfu DNA

1X 1X 1X 1X 1X 1X 1X Buffer Pfx Pfu enzyme (Takagi 1997). KOD Pfx50™ Hot Start Hot Platinum® KOD Hot Start Hot KOD PrimeSTAR® HS PrimeSTAR® DNA Polymerase DNA II Fusion II PfuUltra® Phusion™ Hot Start Hot Phusion™ manufacturer. by recommended as used units, defined *Manufacturer Novagen • PCR Tools PCR • Novagen Table 1. Reaction components and cycling profile for each DNA polymerase based on manufacturers’ recommendations manufacturers’ on based polymerase DNA each for profile cycling and components Reaction 1. Table Since the Polymerase preliminary studies, significant KOD has work been DNA done to buffer optimize and cycling parameters. Another the PCR improvement is KOD Hot Start Polymerase, DNA which complex is of a KOD premixed DNA Polymerase Introduction Thermococcus kodakaraensis KOD1), (strain previously thought Pyrococcus to sp., is be a hyperthermophilic a archaea isolated from a solfataric hot spring on Kodakara (Atomi 2004). In preliminary studies to Island, Japan polymerase, DNA KOD1 the characterize researchers found that had fidelity the comparable enzyme to high cloning, for DNA amplifying When fidelity DNApolymerases, such as KOD polymerase, are recommended. If the enzyme is also fast and can generate fewer product, full-length of yields high amplification cycles are required and the probability of obtaining error-free clones is greatly increased. Keith Yaeger and Keith Fourrier - EMD Chemicals - Novagen - Madison, WI Madison, - Novagen - Chemicals EMD - Fourrier Keith and Yaeger Keith polymerase, but with an extension rate (referred to as speed) 5 and times processivity 10 to higher 15 times higher than the Comparing the Speed and Product Yield of 7 High Fidelity Fidelity High 7 of Yield Product and Speed the Comparing DNA Polymerases Polymerases DNA G E U • C I PCR Resource Guide R D U E

S E R Technical Notes Thermostable DNA Polymerases Resource Guide Table 2. Cycling profiles used Cycling profiles Cycle Profile 1 Cycle Profile 2 Cycle Profile 3 Cycle Profile 4 All 7 enzymes were tested in 4 different Initial denaturation 98°C 30 s 94°C 2 min 95°C 2 min 95°C 2 min cycling protocols, which encompass the 98°C 10 s 94°C 15 s 95°C 20 s 95°C 20 s manufacturers’ recommended cycling 29 cycles 55°C 20 s 52°C 20 s 55°C 20 s 55°C 10 s conditions (Table 2). 72°C 30 s 68°C 60 s 72°C 30 s 70°C 15 s Final extension 72°C 5 min 68°C 5 min 72°C 3 min N/A Results and Discussion Different Cycling Profiles A. 23 cycles 25 cycles Multiple reaction strips were prepared M 1 2 3 4 M 5 6 7 M 1 2 3 4 M 5 6 7 Lane DNA Polymerase using master mixes for each polymerase. M PCR Markers After 19, 21, 23, 25, 27, and 29 cycles, 1 KOD Hot Start 2 KOD reaction strips were removed and placed 3 Platinum® Pfx m 4 Pfx50™ on ice. Samples (5 l) from cycles 23, 5 Phusion™ Hot Start 25, 27, and 29 were assayed on 1.4% 6 PfuUltra® II Fusion HS 7 PrimeSTAR® HS agarose/TAE gels containing ethidium bromide (Figure 1). Yield concentrations were determined on diluted samples from 19, 21, 23, 25, 27, and 29 cycles using a M 1 2 3 4 M 5 6 7 M 1 2 3 4 M 5 6 7 Quant-iT™ PicoGreen® ds DNA Assay Kit 27 cycles 29 cycles (Invitrogen) and a FLUOstar plate reader (plus final extension) (BMG LABTECH). B. 23 cycles 25 cycles C . 23 cycles 25 cycles M 1 2 3 4 M 5 6 7 M 1 2 3 4 M 5 6 7 M 1 2 3 4 M 5 6 7 M 1 2 3 4 M 5 6 7 New primers and enzyme kits were obtained and all experiments were repeated to verify initial results and trends. Results with the new reagents were comparable to the initial experiments (data not shown). Yields generated by each enzyme at 19, 21, 23, 25, 27, and 29 cycles were plotted for each protocol. Not all enzymes gave their best yield using the manufacturer’s

M 1 2 3 4 M 5 6 7 M 1 2 3 4 M 5 6 7 M 1 2 3 4 M 5 6 7 M 1 2 3 4 M 5 6 7 recommended cycling conditions, so the 27 cycles 29 cycles 27 cycles 29 cycles best yields for each enzyme, from any (plus final extension) (plus final extension) cycling protocol, were compared (Figure 2). D. 23 cycles 25 cycles For cloning purposes, fewer reaction cycles M 1 2 3 4 M 5 6 7 M 1 2 3 4 M 5 6 7 increase the potential for error-free clones. Figure 1. PCR results from 7 high fidelity thermophilic DNA polymerases using 4 Cycles 19-25 have been shaded green on different cycling profiles the graph to emphasize the reaction yields PCR samples were removed after 23, 25, 27, and 29 cycles and 5 ml were assayed on 1.4% agarose/TAE gels. Lanes indicate the enzyme used for the reaction. Cycling profiles are defined in Table 2. (A) cycling profile 1 (Note: PicoGreen results indicate a yield increase with PrimeStar HS DNA Pol. from cycle 27 to cycle 29; the reduced band intensity here is a gel loading artifact), (B) cycling profile 2, (C) cycling profile 3, (D) cycling profile 4. M 1 2 3 4 M 5 6 7 M 1 2 3 4 M 5 6 7 27 cycles 29 cycles

24 For more information or to place an order, Novagen • PCR Tools contact your local office (see back cover). DE UI

G Thermostable DNA Polymerases Resource Guide

R R U E O S 25 R® HS (1) ml ® II Fusion HS (2) a KOD Hot Start (1) KOD (1) Platinum® Pfx (2) Pfx50™ (2) Phusion™ Hot Start (3) PfuUltr PrimeSTA Resource Guide Resource •

PCR PCR Continues on page 26 AR HS olymerase 29 DNA P PCR Markers KOD Hot Start KOD Platinum Pfx Pfx50 Phusion Hot Start PfuUltra II Fusion HS PrimeST www.merckbio.com 27 Lane M 1 2 3 4 5 6 7 Figure 3. PCR results from 7 high 7 from results PCR 3. Figure 2-step a using enzymes fidelity profile cycling 27, 25, 23, after removed were samples PCR 5 and protocol 2-step a of cycles 29 and Lanes gels. agarose/TAE 1.4% on assayed were for used enzyme the indicate reaction. the Technical Notes Technical 7 7 25 6 6 5 5 M M [email protected] [email protected] website our Visit 4 4 23 Cycle number 3 3 29 cycles 2 2 25 cycles 1 1 M M 21 7 7 6 6 5 5 19 M M 4 4 3 3 27 cycles 2 2 23 cycles

4.00 3.50 3.00 2.50 2.00 1.50 1.00 0.50 0.00

1 1

µ µ l reaction) l g/25- (

M Amplicon yield Amplicon M Figure 2. Best yield for each high fidelity thermophilic enzyme thermophilic fidelity high each for yield Best 2. Figure cycling 4 all for cycles 29 and 27, 25, 23, 21, 19, after analysis PicoGreen by determined were Yields The graphed. was profile, cycling any from enzyme, each for data yield best The 2). (Table profiles highlights area shaded green The parentheses. in identified is yields best the gave that profile cycling cloning. for preferable be would which 19-25, cycles in yields from any cycling profile cycling any from l eluate was used for PCR. Primers were: Primers PCR. for used was eluate l m l TE (10 mM Tris-HCl, 0.1 mM EDTA) and and EDTA) mM 0.1 Tris-HCl, mM (10 TE l 2-Step PCR Longer primers (generally can ≥23 increase bases) PCR specificityto and, higher due annealing temperatures, be can used in time-saving profiles. 2-step KOD Hot Start cycling Polymerase DNA and the other 6 high were fidelity enzymes tested (initial denaturation in at 95°C for 2 a min, and 29 cycles of 95°C for 20 2-step s, 68°C for enzymes all not that shows 3 Figure s). 40 protocol functioned well with this 2-step protocol (lanes with little or not product). enzymes, Other including the 2 KOD enzymes, generated high yields comparable to the 3-step protocols shown in Figure 1. KOD application - screening plaques Testing the ability of KOD Hot Start DNA Polymerase to amplify a variety of DNA 2-step a in used was enzyme the templates, from clones random screen to profile cycling the Human T7Select® Brain cDNA Library 100 in eluted were Plaques 70637). No. (Cat. m 5 sense primer 5´-ACT TCC AAG CGG ACC AGA TTA TCG C-3´ and antisense primer 5´-AAC CCC TCA AGA CCC AGG-3´. GTT Reactions were TAG cycled with an initial denaturation at 95°C for 2 min, and 25 of cycles 95°C for 20 s, 68°C for 25 s. Of the 50 clones screened, KOD successfully amplified 49 inserts (Figure 4). Amplicons ranged in size from ~250-1800 bp. from these earlier cycles. KOD Hot Start DNA Start Hot KOD cycles. earlier these from in yields high gave consistently Polymerase cycles 19-25 for all 4 profiles tested.(data not shown) Novagen • PCR Tools PCR • Novagen G E U • C I PCR Resource Guide R D U E

S E R Technical Notes Thermostable DNA Polymerases Resource Guide

KOD DNA polymerase (pol) fidelity independent assays is the consistent high in PCR has been assayed by different fidelity of KOD DNA pol. methods. Initial studies by Takagi et al. (1997) measured the mutation frequency Conclusion in amplicons after 30 PCR cycles using a A number of independent studies have plasmid template containing the lacZ gene. verified the extremely high fidelity of KOD By comparing the number of white and DNA Polymerase. In addition to a low light blue colonies (mutant) to the total mutation frequency, the fast extension rate number of colonies (including blue, intact and high processivity of the KOD enzyme lacZ colonies), they determined mutation result in high yields of full-length product rates of 2.8% for KOD DNA pol, 3.6% for in fewer reaction cycles. Combined, these Pfu DNA pol, and 48.0% for Taq DNA pol. attributes have made KOD Hot Start DNA Using the same blue/white assay method, Polymerase the PCR enzyme of choice for but with 25 cycles, Nishioka et al. (2001) many routine and high throughput cloning found mutation frequencies of 0.79% for and structural proteomics studies. ■ KOD DNA pol and 28.1% for Taq DNA pol. References Atomi, H. et al. 2004. Archaea 1, 263. Rual et al. (2004) directly sequenced ~70,000 Mizuguchi, H. et al. 1999. J. Biochem. (Tokyo) 126, 762. bases and determined a misincorporation Nishioka, M. et al. 2001. J. Biotech. 88, 141. rate of 1 in 35,000 nucleotides for KOD Pienaar, E. et al. 2006. Comp. Biol. Chem. 30, 102. DNA pol compared to 1 in 2,000 nucleotides Rual, J-F. et al. 2004. Genome Res. 14, 2128. Takagi, M. et al. 1997. Appl. Environ. Microbiol. 63, 4509. for Platinum® Taq DNA Polymerase High Tindall, K.R. and Kunkel, T.A. 1988. Biochemistry 27, 6008. Fidelity in amplicons generated after 20 cycles of PCR. Discrepancies in mutation rates can be due to the different assay methods, as well as to thermal degradation of DNA at high temperatures, which is not related to enzyme function (Tindall 1988, Pienaar 2006). What stands out in these

Lane Sample M1 Perfect DNA™ Markers, 0.5-12 kbp M2 PCR Markers

Figure 4. Results from KOD Hot Start amplification of T7Select Human cDNA Library clones PCR was performed as stated in the text; 5 ml of each 25-ml reaction were assayed on a 1.4% agarose/TAE gel. KOD Hot Start successfully amplified 49 of 50 clones with amplicons ranging from ~250-1800 bp.

26 For more information or to place an order, Novagen • PCR Tools contact your local office (see back cover). DE UI

G Thermostable DNA Polymerases Resource Guide

R R U E O S

- 27 Taq Resource Guide Resource • Continues on page 28 PCR PCR -proofreading enzyme enzyme -proofreading Taq www.merckbio.com Technical Notes Technical (tomato, (tomato, tobacco, and rice) under the same cycling and reaction conditions with excellent yield. In contrast, two the competitor high-efficiency proofreading enzyme blends failed the from product to PCR detectable any yield same tissue lysates, yielding PCR product only when purified genomic DNA was Xtreme KOD the Hence, template. as used Hot System is Start DNA an Polymerase efficient and reliable PCR system that the obviates need for of the purification target genomic DNA from plant tissues, cycling or reaction of optimization the or conditions for different types of and tissue sample, time, saving thereby lysates, purification DNA and reagents PCR of cost systems. Figure 3 performance of illustrates the KOD Xtreme the Start Hot DNA superior PCR genotyping using Polymerase crude mouse tail System tissue lysates compared to in a competitor’s high-efficiency blends commonly used for this purpose. The competitor’s PCR systems did not amplify the larger sequence, transgenic and amplified target the wild-type sequence with mostly moderate to low efficiency. In contrast, the KOD Xtreme Hot Start DNA efficiently Polymerase and system homozygous reliably target wild-type, heterozygous as well as transgenic, amplified homozygous yield. genomic DNA with excellent [email protected] [email protected] website our Visit -globin -globin gene β rbcL gene from l of whole blood (Figure 1B), thus thus 1B), (Figure blood whole of l µ kb fragment of the kb fragment of the thermocycling, thereby thermocycling, ensuring high priming specificity and inhibition of primer degradation during setup at ambient temperature. 2X buffer formulated 2. A specifically which in combination with optimized reaction conditions, facilitates amplification of the GC-rich, long, and otherwise problematic target sequences (Yaeger, DNA 2008), as well as amplification from difficult samples such as whole blood or crude tissue lysates. l) of whole blood, with superior yield from from different sample sizes (1, 2, or 4 µ and reliability compared PCR This commercial systems. reliability with DNA with maintained were other yield high and templates up to 8.5 kb under the same reaction and cycling conditions, from 2 only eliminating the usual need for optimization when further targeting larger DNA starting of amounts different or sequences sample material. Figure 2 features the of amplification a 1.3 The tissues. plant different of lysates crude KOD Xtreme Hot Start DNA Polymerase System fragment gene facilitated target the of amplification the tissue different two of lysates crude from successful types (leaf and grain) of plants different Results in 1A, KOD Figure Xtreme As illustrated polymerase successfully amplified1.3 a exonuclease activities at ’ 5  1. 1. The ultra high fidelity KOD DNA polymerase in complex neutralizing with monoclonal two antibodies that inhibit the DNA polymerase and the 3’ ambient ambient temperature. This complex allows for antibody-mediated hot start Currently, Currently, efficient and reliable systems require the of prior purification PCR target DNA templates from samples of cost of burdens the to addition In interest. purification DNA the in invested time and procedures, this approach a necessitates which material, of sample amount larger in many cases is scarce. Furthermore, the of amplification GC-richDNA templates time consuming extensive often requires optimization. The KOD Xtreme Hot Start DNA Polymerase System rate, exploits extension fast fidelity, the high inherent from polymerase DNA of processivity and Thermococcus kodakaraensis (KOD DNA permits that combination a in polymerase) hot start PCR and the amplification of difficult DNA targets, and PCR from whole facilitates blood or crude tissue minimal with achieved all is This lysates. optimization. The system includes: Among Among the persistent existing PCR systems are sample scarcity, challenges of time and cost efficiency, and the reliable such targets problematic of amplification our to addition latest The DNA. GC-rich as Hot Xtreme™ KOD the offering, system PCR Start DNA Polymerase System, addresses high maintaining still while issues, these rate. reaction fast and accuracy Lysates Using the KOD Xtreme™ Hot Start DNA Polymerase System System Polymerase DNA Start Hot Xtreme™ KOD the Using Lysates Introduction Reliable and Efficient PCR from Whole Blood and Crude Tissue Crude and Blood Whole from PCR Efficient and Reliable Novagen • PCR Tools PCR • Novagen G E U • C I PCR Resource Guide R D U E

S E R Technical Notes Thermostable DNA Polymerases Resource Guide Summary The KOD Xtreme™ Hot Start DNA and templates that are up to 90% GC- technical assistance in providing data and/or rich, with much enhanced yields and samples. We would also like to acknowledge Polymerase System has been optimized the EMD Chemicals technical service scientists to provide the highest success rate even blunt ended DNA products suitable for and others for their assistance in preparing this with the most challenging DNA targets cloning. To the end user, such superior note. and sample types. It is superior for the performance is achieved with minimal References amplification of target DNA from whole manipulation and significant cost, time, Yaeger, K., et al. 2008 inNovations 28, 15. blood or crude lysates of different types and sample savings. of tissues. This is in addition to offering Acknowledgements: We would like to thank fast reaction rates, high fidelity, and high Akio Sugiyama, Toyobo Co., Ltd and Yuji Arai, efficiency amplification of long targets National Cardiovascular Center, Japan for their

Figure 1: Performance of the KOD Xtreme Hot Start DNA Polymerase System in Amplification from Whole Blood Samples

Figure 1A Figure 1B KOD Xtreme PfuTurbo® Ex Taq™ HS LA Taq™ HS Taq KOD Xtreme M 1 2 3 M 1 2 3 M 1 2 3 M 1 2 3 M 1 2 3 M M1 1 2 3 M2

A. Reactions (50 µl each) were set up to amplify a 1.3 kb region of the β-globin gene from 1, 2 or 4 µl of untreated whole blood (lanes numbered 1, 2, and 3, respectively). B. PCR reactions were set up to amplify a 1.3 kb region, a 3.6 kb region, or an 8.5 kb region of the β-globin gene (lanes 1, 2, and 3, respectively) from 2 µl of untreated whole blood. For both A and B, PCR cycling parameters for KOD Xtreme were as follows: initial denaturation at 94°C for 2 min; 30 cycles at 98°C for 10 s, 68°C for 1 min/kbp. For polymerases from other manufacturers, optimal cycling parameters as recommended by each manufacturer were used. M and M1: 1 kbp Ladder; M2: λ/Hind III Marker.

Primers: <β-globin 1.3 kb> Primer F: 5’-TTAGGCCTTAGCGGGCTTAGAC-3’ Primer R: 5’-CCAGGATTTTTGATGGGACACG-3’

<β-globin 3.6 kb> Primer F: 5’-GGTGTTCCCTTGATGTAGCACA-3’ Primer R: 5’-ACATGTATTTGCATGGAAAACAACTC-3’

<β-globin 8.5 kb> Primer F: 5’-TGATAGGCACTGACTCTCTGTCCCTTGGGCTGTTT-3’ Primer R: 5’-ACATGATTAGCAAAAGGGCCTAGCTTGGACTCAGA-3

28 For more information or to place an order, Novagen • PCR Tools contact your local office (see back cover). DE UI

G Thermostable DNA Polymerases Resource Guide

R R U E O S 29 Resource Guide Resource • PCR PCR s www.merckbio.com obacco leaf omato leaf Samples Tg/Tg Tg/W W/W 1 kbp Ladder Rice leaf Purified rice leaf DNA T Rice grain Samples T 1 kbp Ladder lymerase System Technical Notes Technical Po Lane M 1 2 3 3 4 5 2 Lane M 1 [email protected] [email protected] website our Visit 5 3 4 ype or transgenic gene, respectively, from the indicated mouse ype or transgenic gene, respectively, OH for 10 minutes at 95°C, neutralized with one-tenth volume of OH for 10 Xtreme were as follows: initial denaturation at 94°C for t 98°C for 10 s, 68°C for 3 min. For polymerases from other t 98°C for 10 . Tg: transgenic; W: wild-type. 2 3 q™ HS q™ HS LA Ta LA Ta 2 1 1 M M gene from each of the indicated crude plant tissue lysates. All tissues (~ 3 x 3 rbcL gene from each of the indicated il Tissue Lysates Using KOD Xtreme Hot Start DNA 5 3 lymerase System in Amplification from Crude Lysates of Different Plant Tissue Lysates of Different Plant in Amplification from Crude lymerase System q™ HS Po 4 Ex Ta 2 3 q™ HS 2 Ex Ta 1 1 M M 5 ransgenic Mice by PCR from Mouse Ta 3 4 2 3 KOD Xtreme rformance of the KOD Xtreme™ Hot Start DNA KOD Xtreme™ Hot Start DNA rformance of the KOD Xtreme 2

1 5’-AGGCCTGACAGTAGCTCAG-3’ 5’-AGGCCTGACAGTAGCTCAG-3’ 5’-TGGACGTGAGCTTCAGCAC-3’ 5’-TGGACGTGAGCTTCAGCAC-3’ 5’-AAGCTGCGGCTAGTTCAGGACTCCA-3’ (Rice) 5’-AAGCTGCGGCTAGTTCAGGACTCCA-3’ 5’-ATGTCACCACAAACAGAAACTAAAGC-3’ (Rice) 5’-ATGTCACCACAAACAGAAACTAAAGC-3’ 5’-AAGCAGCAGCTAGTTCCGGGCTCCA-3’ (Tomato & Tobacco)） (Tomato 5’-AAGCAGCAGCTAGTTCCGGGCTCCA-3’ 5’-ATGTCACCACAAACAGAGACTAAAGC-3’ (Tomato & Tobacco) (Tomato 5’-ATGTCACCACAAACAGAGACTAAAGC-3’ R: F: R2: F2: R1: F1: 1

Figure 3*: Genotyping of T * The mouse tail samples were provided by Dr. Yugi Arai, National Cardiovascular Center, Japan. Arai, National Cardiovascular Center, Yugi * The mouse tail samples were provided by Dr.

Primers: Reactions (50 µl each) were set up to amplify a 1.5 kbp region or a 3.1 kbp region of the wild-t tail tissue lysates. Tissue fragments (~ 3 mm-long tail piece each) were extracted in 50 mM Na used in the corresponding amplification reaction. PCR cycling pH 8.0, spun at 12,000 rpm for 5 min, and 1 µl of each of the clarified extracts was 1 M Tris-HCl, parameters for KOD Xtreme were as follows: initial denaturation at 94°C for 2 min; 30 cycles a manufacturers, optimal cycling parameters as recommended by each manufacturer were used

l each) were set up to amplify a 1.3 kb region of the Reactions (50 µl each) were set up to amplify and 1 ul of each of the mM EDTA, (pH 9.5), 1 M KCl, 10 mM Tris-HCl 95°C in 100 minutes at grain) were extracted for 10 mm piece of leaf or one rice PCR cycling parameters for KOD extracts was used in the corresponding amplification reaction.

2 min; 30 cycles at 98°C for 10 s, 68°C for 1.5 min. For polymerases from other manufacturers, optimal cycling parameters as recommended by each s, 68°C for 1.5 min. For polymerases from other manufacturers, 2 min; 30 cycles at 98°C for 10 manufacturer were used. Primers: Figure 2: Pe Novagen • PCR Tools PCR • Novagen G E U • C I PCR Resource Guide R D U E

S E R Technical Notes Thermostable DNA Polymerases Resource Guide Reliable and Robust Real-time Amplification Using NovaTaq™ Hot Start Master Mix Hope Schultz and Keith Yaeger - EMD Chemicals - Novagen - Madison, WI

Real-time PCR methods are used to Real-time PCR Amplification from cDNA detected using a HEX-labeled probe. determine the level of specific mRNA or with NovaTaq™ Hot Start Master Mix Figure 1, Panel A shows the amplification DNA sequences. These real-time methods Real-Time PCR was performed using curves for the real-time PCR and the may be used in a number of different a linearized plasmid containing the reproducibility of the amplification using application areas including analyzing glycogen synthase kinase 3 alpha NovaTaq Hot Start Master Mix Kit over gene expression, genotyping studies, and (GSK3α) cDNA. The stock DNA at 5 × 108 a range of template concentrations. In pathogen detection. We have demon- copies/µl was 10-fold serially diluted in figure 1, Panel B the cycle threshold (Ct) strated that NovaTaq™ Hot Start Master TE and reactions were run in triplicate. is plotted against DNA concentration. Mix can be used in real-time PCR The following parameters were used on This yielded a standard curve with a amplification of various templates to the Chromo4 Real-Time PCR Detection correlation of 1, showing that NovaTaq obtain reproducible results and robust System(Bio-Rad): initial denaturation at Hot Start Master Mix gave linear results amplification of low copy number 95°C for 10 minutes; followed by 94°C for 10 to 109 copies of the plasmid. genes. In this article, a comparison for 30 seconds, 54°C for 30 seconds, and of competitors’ PCR mixes indicates 72°C for 10 seconds for 45 cycles. The NovaTaq Hot Start Master Mix provides primer/probe mix was designed to target superior amplification and specificity. a 112 bp amplicon of GSK3α. DNA was

Figure 1. Linearized cDNA plasmid amplified using NovaTaq Hot Start Master Mix

Panel A Panel B

Real-Time PCR Amplification from Time PCR Detection System was: initial amplification curves (Figure 2, Panel A). Human Genomic DNA with NovaTaq Hot denaturation at 95°C for 10 minutes; Ct vs. DNA concentration (Figure 2, Panel Start Master Mix followed by 94°C for 30 seconds, 54°C B) yielded linear results for 0.01 to 100 ng Human Genomic DNA (Cat No. 69237) for 30 seconds, and 72°C for 10 seconds genomic DNA. Note that 0.001 ng would was serially diluted 10-fold in TE (10mM for 45 cycles. DNA was detected using correlate to about 0.3 copies of the target Tris, pH 8 from 50 ng/µl. The primer/ a HEX-labeled probe. All reactions were sequence and one of the three experiments probe mix was designed to target a 139 performed in triplicate. Amplification was performed in triplicate gave a signal while bp amplicon of GSK3α. The cycling seen down to a level of approximately 3 the other two were negative. profile using the Bio-Rad Chromo4 Real- copies per reaction as indicated by the

Panel A. Amplification curve Trace color 109 Copies 108 Copies 107 Copies Figure 2. 106 Copies 105 Copies 104 Copies Serially diluted human 103 Copies 102 Copies 101 Copies

genomic DNA amplified using NovaTaq Hot Start Master Mix

Panel A Panel B

30 For more information or to place an order, Novagen • PCR Tools contact your local office (see back cover). DE UI

G Thermostable DNA Polymerases Resource Guide

R R U E O S 31 Resource Guide Resource • PCR PCR www.merckbio.com Technical Notes Technical shown on the right. The melting analysis analysis The melting on the right. shown (curves shown on the with left) a was temperature done range at 99°C, acquiring each of A degree. single 60°C to peak in the melting curve demonstrates peaks Multiple reaction. ofthe specificity indicate that secondary products were also amplified. Mix has a higher amplification efficiency efficiency amplification higher a has Mix and than severalcompetitors’ specificity PCR mixes. [email protected] [email protected] website our Visit Hot Start Master Master Start Hot Polymerase Polymerase or detected was DNA qPCR manufacturer. mixes indicated from the using SYBR® Green dye. Each following reaction The triplicate. in performed was parameters were used with Rotorgene 6000: initial a denaturation at Corbett 10 for 95°C by followed min; 10 for 95°C s, 55°C for 15 s, and 72°C for 20 s for 40 cycles. The amplification curves are strand strand cDNA. The data obtained using this enzyme premix and allows are for the of analysis low copy reproducible NovaTaq genes. number bp bp

Hot Hot ™ ™ Hot Start -actin coding β Hot Start DNA Figure 6. – Red Hot Start DNA Polymerase NovaTaq Stratagene - Green shows superior am- Hot Start DNA Polymerase NovaTaq plification efficiency as indicated by the much higher fluorescence intensity. Hot Start DNA Polymerase – Red Hot Start DNA Polymerase NovaTaq Green Biosystems – KAPA demonstrates poor reaction Biosystems polymerase KAPA specificity as demonstrated by the multiple peaks in the melting curve. Figure 5. Figure 4. – Red Hot Start DNA Polymerase NovaTaq Qiagen - Green am- shows superior Polymerase Hot Start DNA NovaTaq plification efficiency as indicated by the much higher fluorescence intensity. Figure 3. – Red Hot Start DNA Polymerase NovaTaq Invitrogen – Green lower amplification effi- Invitrogen's polymerase shows ciency as indicated by the lower fluorescence intensity. Start Master Mix Kit may be used for real- for used be may Kit Mix Master Start time PCR of plasmid, genomic, and first Summary have demonstrated We that NovaTaq sequence was amplified from 15 ng/µl of cDNA using NovaTaq region of the mouse Master Master Mix in PCR quantitative versus PCR mixes. competitors' RNA Total was from isolated mouse 3T3 cells and cDNA was synthesized using MMLV reverse transcriptase. A 122 Performance Performance of NovaTaq Novagen • PCR Tools PCR • Novagen G E U • C I PCR Resource Guide R D U E

S E R Technical Notes Thermostable DNA Polymerases Resource Guide One Step Real-Time Amplification of mRNA Using the One Step RT-PCR Master Mix Kit Hope Schultz and Keith Yaeger - EMD Chemicals - Novagen - Madison, WI

Reverse transcription followed by thermophilus (rTth) DNA Polymerase, allowing for a sensitive detection of polymerase chain reaction (RT-PCR) which functions as both a thermostable RNA. One Step RT-PCR Master Mix allows amplification and detection of RNA–dependent DNA polymerase and a Kit is compatible with SYBR® Green, very low amounts of RNA. The technique DNA–dependent DNA polymerase. The providing fluorescent signal to detect is important for gene expression profiling anti-rTth antibody included in the mix the amplified region and melt analysis to and RNA virus detection. In addition to enhances the specificity of the reverse confirm homogeneity of product. In this using purified RNA as a template, RT- transcription by binding the polymerase article, the One Step RT-PCR Master Mix PCR kits may be used directly with crude and reducing mispriming during Kit was used to amplify mRNA directly lysates of mammalian cells, a technique reaction assembly. The high optimal from mammalian extracts. Duplex that can be used to compare mRNA temperature for polymerization by rTth RT-PCR using the same crude extract levels in different cells. polymerase in reverse transcription demonstrates that the One Step RT-PCR offers the advantage of increased success Master Mix can be used to analyze two The Novagen® brand One Step RT- by reducing secondary mRNA structure targets in a single reaction when probes PCR Master Mix Kit allows for mRNA and the single reaction set up reduces are used as the detection method. amplification in a single tube because chances of contaminating the samples it contains recombinant Thermus with exogenous DNA, RNA or nucleases

Real-Time PCR from CytoBuster™ Protein Extraction Reagent RT-PCR reactions that were done in Crude Lysate (Cat. No. 71009) to lyse cells and 40 units triplicate. The primers used targeted a To test the ability of the One Step RT-PCR RNase Inhibitor (Cat. No. 556881). An 99 bp amplicon from exon 3 to exon 4 of Master Mix Kit to amplify mRNA from addition of 50 μl of TE (10 mM Tris, pH cyclophilin B (PPIB, genomic accession HeLa cell lysates in a real-time reaction 8, 1mM EDTA) + 0.02% Triton X-100 NT_010194.16). using SYBR Green I for detection. was added to yield a lysate containing 5000 cell equivalents/μl. The lysate PCR was performed Chromo4 Real- HeLa cells (5X105 cells) were cultured was two-fold serially diluted in TE + Time PCR Detection System (Bio-Rad) in DMEM, pelleted, and stored at -70°C. 0.02% Triton X-100, and 2 μl of each and SYBR Green I was from Invitrogen. The cell pellet was treated with 50 μl of dilution was used as template in 50 μl Table 1 contains the cycling parameters.

Table 1

CYCLING STEP Time/temperature 1. Polymerase Activation 30 s at 90°C 2. Reverse Transcription 15 min at 60°C 3. Denaturation 30 s at 94°C 4. Denaturation 1 s at 95°C 5. Annealing 15 s at 50°C 6. Extension 5 s at 72°C Repeat Steps 4-6 for 40 cycles

32 For more information or to place an order, Novagen • PCR Tools contact your local office (see back cover). DE UI

G Thermostable DNA Polymerases Resource Guide

R R U E O S 33 Resource Guide Resource • PCR PCR Continues on page 34 www.merckbio.com Technical Notes Technical [email protected] [email protected] website our Visit Panel B: Melting Curve Panel

s e colors 625 Cells 313 Cells 156 Cells 78 Cells 39 Cell 20 Cells 10 Cells Control Template No Trac 10000 Cells 5000 Cells 2500 Cells 1250 Cells

Panel C: Ct vs. Cell Number Panel Figure 1. PPIB mRNA amplified from crude HeLa lysates Figure 1. PPIB mRNA amplified We observed excellent yield and observed reproducibility excellent as shown Panelin A).the Theamplification signals curves titrated (FigureWe 1, from 10,000 to 10 cells as shown by the standard curve with a correlation of 0.999 (Figure 1 Panel shows a single product was amplified. B) (Figure 1, Panel C). The melting curve Novagen • PCR Tools PCR • Novagen Panel A: Amplification Curve A: Amplification Panel G E U • C I PCR Resource Guide R D U E

S E R Technical Notes Thermostable DNA Polymerases Resource Guide Duplex Real-Time PCR with One-Step RT-PCR Master Mix The template used in the duplex RT- PCR experiment was the same HeLa cell preparation used in the SYBR® Green I experiments previously described. In the reactions, the primer Set I targeted a 99 bp amplicon spanning from exon 3 to exon 4 of PPIB. Primer Set II targeted an 112bp amplicon spanning from exon 4 to exon 5 of glycogen synthase kinase 3 alpha (GSK3α, genomic accession NC_000019). FAM Dye was used to detect PPIB and HEX dye was used to detect GSK3α. Reactions were performed in triplicate using the Chromo4 Real-Time PCR Detection System (Bio-Rad) with the cycling conditions described in Table 1. The plate was read after step 5 for these experiments. Figures 2 and 3 shows that PPIB and GSK3α are efficiently amplified in the same reaction and the signal titrates well from 5000 to 10 cells with a standard curve with a correlation coefficient of 0.997.

Figure 2: PPIB mRNA amplified from crude HeLa cell lysates using the One Step RT-PCR Master Mix Kit and FAM Dye.

Trace color 5000 Cells 2500 Cells 1250 Cells 625 Cells 313 Cells 156 Cells 78 Cells 39 Cells 20 Cells 10 Cells

Panel A: Amplification Curve Panel B: Ct vs. Cell Number

Figure 3: GSK3α mRNA amplified from crude Hela cell lysates using the One Step RT-PCR Master Mix Kit and HEX Dye.

Trace color 5000 Cells 2500 Cells 1250 Cells 625 Cells 313 Cells 156 Cells 78 Cells 39 Cells 20 Cells 10 Cells

Panel A: Amplification Curve Panel B: Ct vs. Cell Number

Summary Real time reverse transcription PCR is a powerful technique in functional proteomics. The Novagen® One Step RT-PCR Master Mix Kit provides results that are reproducible and robust.

34 For more information or to place an order, Novagen • PCR Tools contact your local office (see back cover). DE UI

G Thermostable DNA Polymerases Resource Guide

R R U E O S 35 eaeA, 2, Upload , in in IS1203v,

Resource Guide Resource • PCR PCR stx2, 384 bp for Rev. Rev. Microbiol. Clin. Sample ladder) (100-bp Markers strains STEC strain K-12 www.merckbio.com Figure 1. STEC identification by CD-PCR Eleven STEC strains and one K-12 strainused were for CD-PCR. analyzed Reaction by agarose productsgel stained with ethidium bromide. electrophoresis were and Lane M 1–11 12 , and 910 bp for bp 910 and hlyA, 87, 93–96. 87, Bioeng. Biosci. J. Technical Notes Technical stx1, 255 bp for By using KOD XL DNA Polymerase, Karmali, M. A. (1989) A. M. Karmali, 15–38. Clin. J. (1998) C. J. Paton, and W. A. Paton, 598–602. 36, Microbiol. K. Shinagawa, and Y., Kawamura, Y., Nishiya, M., (1999) (2001) S. Yamai, and R, Suzuki, T., Okitsu, newsletter). Japan Ltd., Co., (Toyobo 63 References 1. 2. 3. 4 534 bp for bp 534 ponents. PCR were at performed denaturation using initial conditions: the following 15 for 98°C of cycles 30 minutes, 5 for 94°C seconds, 60°C for 5 seconds, and 74°C for the of one-tenth PCR, the After seconds. 30 was solution reaction by analyzed agarose (2% gel TAE gel, electrophoresis Figure 1). a showed The of results the multiplex-PCR for clear each amplification target: 180 bp for STEC strains (Figure 1). Amplification of 11 strain K-12 control the from genes target the was negative. The results STEC for clearly effective is system demon- this that strated typing. PCR was completed in less than 1.5 hours, the to compared savings time significant a nearly 3.5 hours of the original spec- method, multiple when advantage great a and processing. quick require imens ← IS1203 ← hlyA ← eaeA ← stx2 ← stx1 [email protected] [email protected] website our Visit using multiplex using M 12 11 cfu 4 1X 2.5 U 2.5 10 0.2 mM 0.2 10 0.2 µM each µM 0.2 each µM 0.2 each µM 0.2 each µM 0.2 each µM 0.1 approximately 9 Concentration coli E. 8 7 6 1 5 4 3 2 1 Component PCR buffer for KOD XL KOD for buffer PCR mix dNTP primers (stx1-F + stx1-R) + (stx1-F primers stx1 stx2-R) + (stx2-F primers stx2 eaeA-R) + (eaeA-F primers eaeA hlyA-R) + (hlyA-F primers hlyA + (1203v-F primers IS1203v 1203v-R) cells Bacterial KOD XL DNA Polymerase DNA XL KOD M When using KOD XL DNA Polymerase, set up the PCR on ice. on PCR the up set Polymerase, DNA XL KOD using When Table 1. STEC PCR setup PCR STEC 1. Table 1 upon the original multiplex PCR assay. from colony bacterial a method, our With a food or fecal culture was used directly as the template. In addition, four target of presence the for examined were genes the IS1203v insertion sequence discov- ered in stx2 genes (3, 4) with IS1203v- need- time the reduce To primers. specific was polymerase DNA Taq PCR, the for ed replaced with the faster KOD XL DNA Multiplex CD-PCR Polymerase*. analysis for eleven STEC strains and one control Prefec- Kanagawa at isolated strain K-12 was 1999 and 1996 between Japan, ture, performed (Figure 1). Table 1 identifies com- PCR the of concentrations final the

stx1) stx2). hlyA, in crude E. coli (STEC), are known to pro- to known are coli E. eaeA and , and correlated genes correlated and stx2, stx1, In this study, we developed a rapid PCR is generally considered the most Novagen • PCR Tools PCR • Novagen duce a family of related toxins, referred to referred toxins, related of family a duce as Shiga toxin 1 (Stx1, encoded by Certain strains of strains Certain Okitsu, T., Suzuki, R., Yamai, H. Yamai, R., Suzuki, T., Okitsu, Japan Institute, Research Health Prefecture Kanagawa Department, Pathology Bacterial by encoded (Stx2, 2 toxin Shiga and Shiga toxin-producing DNA extracts from primary fecal tures. cul- typing system for STEC that improves Detection of Shiga toxin-producing toxin-producing Shiga of Detection that encode accessory STEC factors, such as virulence represented by serotype O157:H7, has a strong infectious capacity and - pathoge has bacterium this years, recent In nicity. been affecting an increasing number of victims, resulting in life-threatening ill- ness such as hemorrhagic colitis, hemo- lytic-uremic syndrome, and thrombotic thrombocytopenic purpura (1). The mor- STEC with associated mortality and bidity disease highlight the threat these organ- reason, this For health. public to pose isms and fast for demand increasing an is there vir- of detection the for methods efficient and samples fecal in STEC of strains ulent products. dairy and meat in food a if determining for means sensitive or fecal sample contains STEC. A multi- and Paton by developed method PCR plex Paton (2) enables simultaneous determi- of nation colony-direct PCR with KOD XL DNA Polymerase DNA XL KOD with PCR colony-direct PCR • PCR Clean Up and Nucleic Acid Precipitation PCR Clean Up and Nucleic Acid Precipitation SpinPrep™ PCR Clean-Up Kit

Rapid purification of PCR products

Product Size Cat. No. Price The SpinPrep™ PCR Clean-Up Kit is designed for rapid SpinPrep™ PCR 100 rxn 70976-3 purification of PCR-amplified DNA. The 10-minute procedure Clean-up Kit involves addition of binding buffer followed by adsorption Components 82 ml SpinPrep Bind Buffer of the DNA to a silica membrane in a spin column format. 27 ml SpinPrep Wash Buffer Following a wash step, DNA is eluted in low-salt buffer. This 10 ml SpinPrep Elute Buffer kit removes DNA polymerases, dNTPs, salts, and primers so 100 SpinPrep Filters 100 Receiver Tubes that they do not interfere with downstream applications such 100 SpinPrep Eluate Receiver Tubes as cloning, sequencing, or labeling. PCR products from 100 Additional Information Available bp to >12 kb can be cleaned up, with standard recoveries of SpinPrep PCR Clean-Up Kit User Protocol TB290 60–90%.

SpinPrep PCR Clean-Up Kit 1 2 3 4 bp Column binding capacity: up to 6 mg PCR sample volume: 100 µl/rxn 2000 – Typical recovery: 60-90% 1500 – 1000 – Size range: 100 bp to > 12,000 bp 750 – 500 – Time required: < 10 min 300 – 150 –

50 –

Primer removal with the SpinPrep PCR Clean-Up Kit

Lane Sample 1 PCR Markers 2 Crude PCR product 3 Purified PCR product 4 PCR Markers

36 For more information or to place an order, Novagen • PCR Tools contact your local office (see back cover).

PCR Clean Up and Nucleic Acid Precipitation 37

Gel analysis and quantification of DNA fragments isolated with the SpinPrep Gel DNA Kit Known amounts (2 mg) of four DNA fragments of the indicated sizes were run in separate lanes on a 1% agarose gel. Each band was excised and the DNA extracted from the gel using the SpinPrep Gel DNA Kit and standard protocol. Recoveries shown as percentages above were determined by absorbance at 260 nm. Samples (250 ng) of each recovered band were analyzed by agarose gel electrophoresis. Lane 1 contained a mixture of the starting DNAs. www.merckbio.com 000, 90% bp PCR Clean Up and Nucleic Acid Precipitation Acid Nucleic and Up Clean PCR • ← 12,000, 52% ← 8000, 50% ← 1 ← 150, 90% PCR PCR [email protected] [email protected] website our Visit 3 4 5 1 2 Gel analysis and quantification of DNA fragments isolated with the SpinPrep Gel DNA Kit Known amounts (2 mg) of four DNA fragments of the indicated sizes were run in separate lanes on a 1% agarose gel. Each band was excised and the DNA extracted from the gel using the SpinPrep Gel DNA Kit and standard protocol. Recoveries shown as percentages above were determined by absorbance at 260 nm. Samples (250 ng) of each recovered band were analyzed by agarose gel electrophoresis. Lane 1 contained a mixture of the starting DNAs. The SpinPrep™ Gel DNA Kit enables efficient extraction of DNA DNA of extraction efficient enables Kit DNA Gel SpinPrep™ The gels. agarose from size in bp >12,000 to bp 150 from fragments slice, gel the dissolve to Solution GelMelt™ uses procedure The followed by adsorption of the DNA to a silica membrane in a spin column format. After a wash step, the purified DNA is eluted in low-salt Each buffer. spin column can bind up to 20 is 50–90%. mg DNA. Routine recovery TB274 Price 000, 90% bp 50-90% < 30 min ← 12,000, 52% ← 8000, 50% ← 1 ← 150, 90% 150 mg/rxn up to 20 mg 150 bp to > 12kb Cat. No. 70852-3 Size 3 4 5 100 rxn 100 1 2 SpinPrep GelMelt™ Solution Buffer SpinPrep Wash SpinPrep Elute Buffer SpinPrep Filters Receiver Tubes SpinPrep Eluate Receiver Tubes No organic extraction or alcohol precipitation No organic extraction or preparation time < 30 minutes Total required No low melting point agarose Gel slice mass: recovery: Typical Size range: Time required: SpinPrep Gel Kit Column binding capacity: SpinPrep™ Gel DNA Kit Additional Information Available SpinPrep Gel DNA Kit User Protocol Components 5 × 24 ml Product 27 ml ml 10 100 100 100 Features • • • SpinPrep™ Gel DNA Kit Gel DNA SpinPrep™ from agarose gels extraction of DNA Rapid, efficient Novagen • PCR Tools PCR • Novagen PCR • PCR Clean Up and Nucleic Acid Precipitation

N THE O W PCR Clean Up and Nucleic Acid Precipitation E

www.novagen.com Pellet Paint® Co-Precipitant /PelletPaint

Rapid, quantitative precipitation of DNA and RNA; excellent for PCR clean-up

Feature Pellet Paint® Co-Precipitant is a visible dye-labeled carrier • Allows direct visualization and tracking of precipitated formulated specifically for use in alcohol precipitation of material nucleic acids (McCormick 1995, McCormick 1996). The

Product Size Cat. No. Price 2-minute precipitation uses just 2 ml per reaction and requires Pellet Paint® Co-Precipitant 125 rxn 69049-3 no low-temperature incubations or prolonged centrifugation. 1000 rxn 69049-4 Both RNA and DNA are efficiently precipitated even from Components dilute solutions (2 ng/ml). The pellet is easily located by 250 ml or 2 ml Pellet Paint Co-Precipitant its vivid pink color and 1 ml or 8 ml 3 M Sodium Acetate pH 5.2 can be easily followed Additional Information Available Pellet Paint Co-Precipitant User Protocol TB146 during washing steps, inNovations No. 4a, 5, 9, 12, 26 preventing losses during handling.

Comparison of different carriers Most PCR applications for precipitation of nucleic acids benefit from a clean-up Compatible with Pellet Paint glycogen tRNA step in which primers Pellet Paint pellet (2 ml) under UV and visible gel electrophoresis — and other reactants illumination PCR amplification ? — are removed and the target DNA is concentrated (Taggart DNA sequencing — restriction digestion 1998). Pellet Paint Co-Precipitant is ideal for this cleanup ligation ? because the procedure is rapid, primers < 50 nt in length transformation ? are efficiently removed, and the DNA is quantitatively cDNA synthesis ? recovered. Furthermore, it provides visual confirmation of kinase reactions — DNA resuspension. random priming ? — in vitro transcription ? Pellet Paint Co-Precipitant is compatible with most molecular in vitro translation RNase protection assay ? biology procedures and is free of contaminating nucleic acids phenol extraction and nucleolytic enzymes. Although it absorbs in the UV LiCl precipitation — range, accurate spectrophotometric measurements of DNA bacterial ? ? or RNA samples are possible; the absorbance ratio (provided electroporation with each package) can be used as a correction factor when PEG precipitation ? ? determining nucleic acid concentration (McCormick 1996). Recovery of various RNA and DNA Pellet Paint Co-Precipitant is compatible with automated Cy5® samples with Pellet Paint carrier sequencers. Pellet Paint NF Co-Precipitant is recommended Sample Incorp. cpm recovered for use with PE Applied Biosystems automated sequencers. RNA (100 nt, 0.2 ng/ml) 90% References: RNA (1000 nt, 0.2 ng/ml) 92% McCormick, M. 1995. inNovations 4a, 10. RNA (10,000 nt, 0.2 ng/ml) 89% McCormick, M. 1996. inNovations 5, 10. DNA (100-2000 bp, 4 pg/ml) 86% Taggart, E. W., et al. 1998. J. Clin. Microbiol. 36, 3408.

The indicated samples of 32P-labeled RNA and DNA were prepared using standard protocols for transcription and random priming, Pellet Paint Procedure respectively. Following the labeling reactions, incorporation was 1. Add 2 ml Pellet Paint or 1 ml Pellet Paint NF Co-Precipitant determined by DE81 filtration. Known amounts of incorporated plus 0.1 volume 3 M Sodium Acetate to sample and mix briefly. material (300,000 cpm) were precipitated in the presence of Pellet 2. Add 2 volumes ethanol (or 1 volume isopropanol) and briefly vortex. Paint. Samples without Pellet Paint Co-Precipitant resulted in a 5- to 3. Incubate at room temperature for 2 min. 50-fold reduction in recovery. 4. Spin sample for 5 min. 5. Discard supernatant. Wash and resuspend pellet.

38 For more information or to place an order, Novagen • PCR Tools contact your local office (see back cover). PCR Clean Up and Nucleic Acid Precipitation

EB 39 W E H

N O /PelletPaint www.novagen.com www.merckbio.com PCR Clean Up and Nucleic Acid Precipitation Acid Nucleic and Up Clean PCR • PCR PCR [email protected] [email protected] website our Visit cing applications

Pellet Pellet Paint® NF Co-Precipitant labeled is carrier a compatible nonfluorescent with dye- alcohol during Terminators BigDye of removal fluorescentrapid facilitates sequencing. It precipitation of cycle sequencing reaction sequencing reactions can be products. precipitated rapidly with 1 ml of Cycle The minutes. 10 of times centrifugation and reaction per carrier easily visualized carrier provides a simple confirmation that precipitation has occurred. Sequencing reaction products are efficiently pelleted and dye-labeled remain in the terminators during supernatant alcohol precipitation using the standard Applied Biosystems protocols. Resuspension precipitation of pelleted sequencing reaction checking by confirmed be can formamide deionized in products for dissolution of the NF Paint Pellet carrier. Co-Precipitant is Cycle Terminator BigDye PRISM® ABI the with compatible fully Sequencing Ready Reaction. To avoid extra sample handling, Pellet Paint NF Co-Precipitant can be added directly to reaction the mix, template DNA, crude PCR samples, or dilution buffer before the cycle sequencing reaction. Although Pellet spectrophotometric accurate range, UV the in absorbs NF Paint measurements of DNA or RNA absorbance ratio (provided samples with each package of are Pellet Paint possible; the NF) can be used as a nucleic acid concentration. Pellet Paint NF correction Co-Precipitant has factor when determining no detectable effect on the sequencing reaction or sequence accuracy. Pellet Paint NF Co-Precipitant is a useful substitute for the original Pellet Paint Co-Precipitant where fluorescent detection is used. in applications - TB268 Price No. 10, 26 No. 10, Cat. No. 70748-3 70748-4 Size 125 rxn 1000 rxn 1000 Pellet Paint NF Co-Precipitant Paint Pellet 3 M Sodium Acetate pH 5.2 Efficient and rapid precipitation of BigDye® cycle Efficient and rapid precipitation sequencing products terminators Efficient removal of dye of precipitated material Direct visualization and tracking reaction No effect on sequencing detection applications Compatible with fluorescent Cycle sequencing with Pellet Paint NF Paint Cycle sequencing with Pellet ng plasmid and 1.6 pmol primer in 100 NF (2 ml)* was combined with Paint Pellet Cycle Sequencing Reaction performed in 8-well Micro ml BigDye Terminator 10 Amp® reaction tubes. Following thermal cycling, reaction products were min at 3000 × g. purified by addition of isopropanol and centrifugation for 10 Samples were drained by inversion and the plate was spun at low force in an Suppression inverted position. The samples were resuspended in 20 ml Template data Sequence automated sequencer. Reagent and run on an ABI PRISM 310 NF Paint were identical to those obtained with a control reaction without Pellet (not shown). The read extended beyond 450 bases. * Note that the standard precipitation reaction uses 1 µl. Additional Information Available NF Co-Precipitant User Protocol Paint Pellet inNovations Pellet Paint® NF Co-Precipitant Paint® Pellet Product Components 125 ml or 1 ml 1 ml or 8 ml Features • • • • • Non-fluorescent visible nucleic acid co-precipitant for automated sequen co-precipitant for visible nucleic acid Non-fluorescent Pellet Paint® NF Co-Precipitant Co-Precipitant NF Paint® Pellet Novagen • PCR Tools PCR • Novagen PCR • Molecular Size Markers

N THE O W

Molecular Size Markers E

www.novagen.com Perfect DNA™ Markers /Markers

Convenient, easy-to-remember sizes

Features Perfect DNA™ Markers contain sets of DNA fragments • Available in three size ranges: with convenient, easy-to-remember sizes for agarose gel 0.05–10 kbp analysis. The markers have uniform band intensities except 0.1–12 kbp for the easily identifiable reference bands, which are useful 0.5–12 kbp for instant band identification. An extra vial of 6X DNA Gel • Includes 6X Loading Buffer Loading Buffer is included. Product Size Cat. No. Price Perfect DNA™ 100 lanes 70087-3 Perfect DNA Markers Markers, 0.1-12 kbp Perfect DNA™ 100 lanes 69002-3 0.1–12 kbp 0.5–12 kbp 0.05–10 kbp Markers, 0.05-12 kbp kbp kbp kbp 10 8 – 12 6 Perfect DNA™ 100 lanes 70540-3 – 10 – 12 – 10 4 Markers, 0.5-10 kbp – 8 3 – 6 – 8 – 2 – 4* – 6 Components – 1.5 Cat. No. 70087 – 3 – 4* – 1.4 500 ml Perfect DNA Markers, 0.1–12 kbp – 3 – 1 in 1X DNA Gel Loading Buffer – 2 – 0.75 1 ml 6X DNA Gel Loading Buffer – 1.5 – 2 Cat. No. 69002 – 1 – 1.5 – 0.5 500 ml Perfect DNA Markers 0.5-12 kbp – 0.4 in 1X DNA Gel Loading Buffer – 1 – 0.3 1 ml 6X DNA Gel Loading Buffer – 0.5* – 0.4 – 0.2 Cat. No. 70540 – 0.3 1 ml Perfect DNA Markers, 0.05–10 kbp – 0.2 – 0.1 – 0.1 – 0.5 in 1X DNA Gel Loading Buffer – 0.05 1 ml 6X DNA Gel Loading Buffer 1.5% TAE agarose gel* 0.8% TAE agarose gel* 2.0% TAE agarose gel

*higher-intensity reference band

40 For more information or to place an order, Novagen • PCR Tools contact your local office (see back cover). Molecular Size Markers

EB EB 41 W W E E H H

T T

N N

/Markers /Markers O O www.novagen.com www.novagen.com 00 bp AE agarose gel – 2000 – 1500 – 10 – 750 – 500 – 300 – 150 – 50 kbp – 10 – 8 – 6 – 5 – 4 – 3 – 2.5 – 2 – 1.5 – 1 – 0.5 AE agarose gel PCR Markers 1.5% T 0.8% T 1-kbp ladder Molecular Size Markers Size Molecular • PCR PCR www.merckbio.com 0 0 000 bp – 1 – 900 – 800 – 70 – 600 – 500 – 400 – 300 – 200 – 10 AE agarose gel 00-bp ladder 2.0% T 1 ml per lane produces 0 0 [email protected] [email protected] website our Visit 000 bp – 3000 – 2000 – 1 – 900 – 800 – 70 – 600 – 500 – 450 – 400 – 350 – 300 – 250 – 200 – 150 – 10 – 50 AE agarose gel erfect DNA Ladders P 50-bp ladder 2.0% T PCR Markers contain a mixture of eight defined DNA fragments ranging from 50 for intervals size convenient at bp 2000 to characterizing small DNA products. The markers are supplied ready-to-use in gel loading buffer containing two tracking dyes that do illumination of ethidium not bromide-stained interfere with bands. A UV separate vial of Buffer is 6X included. Each Loading vial of markers is enough for 50 lanes on TBE agarose or stained TAE with ethidium bromide. The recommended 5 bands of even intensity that are bright, sharp, and easy to photograph. The Perfect DNA™ Ladders contain sets of DNA fragments with fragments DNA of sets contain Ladders DNA™ Perfect The convenient, easy-to-remember sizes for agarose gel analysis. The markers have uniform band intensities and cover a wide range of DNA sizes. They are supplied in a convenient ready- to-load format containing dye and are ideal for routine use. and 70538-3 Nos. Cat. (for Buffer Loading 6X of vial extra An 70537-3) No Cat. (for Buffer Loading Gel DNA 6X or 70539-3) is included. Price Price Cat. No. 70538-3 70539-3 70537-3 Cat. No. 69278-3 Size Size 50 lanes 100 lanes 100 lanes 100 lanes 100 PCR Markers in 1X Loading Buffer 6X Loading Buffer Perfect DNA 50 bp Ladder in 1X Loading Buffer Perfect 6X Loading Buffer bp Ladder in 1X Loading Buffer DNA 100 Perfect 6X Loading Buffer in 1X DNA Gel Loading DNA 1kbp Ladder Perfect 6X DNA Gel Loading Buffer 50–3000 bp bp 100–1000 bp 500–10,000 Contains fragments from 50 to 2000 bp Includes 6X Loading Buffer Includes 6X loading buffer Available in three size ranges: Components 250 ml 1 ml Product Components Cat. No. 70538 1 ml 1 ml Cat. No. 70539 500 ml 1 ml Cat. No. 70537 500 ml Buffer 1 ml Product Perfect DNA™ 100 bp DNA™ 100 Perfect Ladder DNA™ 1 kbp Perfect Ladder Perfect DNA™ 50 bp Perfect Ladder PCR Markers, 50–2000 bp Features • • • Features • For accurate sizing of PCR products PCR Markers Evenly spaced DNA markers in ready-to-load format DNA markers in ready-to-load Evenly spaced Perfect DNA™ Ladders Ladders DNA™ Perfect Novagen • PCR Tools PCR • Novagen PCR • PCR Cloning PCR Cloning Cloning Kits Overview

Efficient, reliable reagents for cloning PCR products

We offer a variety of cloning kits for PCR and DNA overhanging ends are blunt-ended prior to cloning into fragments. AccepTor™ Vector Kits are designed for cloning the blunt-end, dephosphorylated vector. For demanding DNA fragments that have a single 3´-dA overhang, typically procedures, GigaSingles™ Cloning Kits contain extremely generated by non-proofreading, thermostable polymerases. high efficiency NovaBlue Competent Cells. The pSTBlue-1 Perfectly Blunt® Cloning Kits are designed for cloning DNA AccepTor Vector and pSTBlue Perfectly Blunt Vector are with any type of ends. DNA fragments or PCR products with both available as Giga Cloning Kits.

AccepTor Vector Cloning and Giga Cloning Kit Configurations pSTBlue-1 AccepTor Vector Introductory Kits AccepTor Vector Kits AccepTor Vector Giga Cloning Kits Kit Component 10 rxn 20 rxn 40 rxn 20 rxn 40 rxn 20 rxn 40 rxn AccepTor Vector 0.5 mg 2 × 0.5 mg 4 × 0.5 mg 2 × 0.5 mg 4 × 0.5 mg 2 × 0.5 mg 4 × 0.5 mg Positive Control Insert 10 ml 10 ml 10 ml 10 ml 10 ml 10 ml 10 ml Clonables 2X Ligation 55 ml 2 × 55 ml 4 × 55 ml 2 × 55 ml 4 × 55 ml Premix Nuclease-free Water 1.5 ml 1.5 ml 1.5 ml 1.5 ml 1.5 ml NovaBlue Singles Competent 11 × 50 ml 22 × 50 ml 44 × 50 ml 22 × 50 ml 44 × 50 ml Cells* SOC Medium† 2 (or 3) × 2 ml 4 (or 5) × 2 ml 7 (or 9) × 2 ml 4 × 2 ml 7 × 2 ml Test Plasmid 10 ml 10 ml 10 ml 10 ml 10 ml * The pETBlue™ AccepTor Vector Kits also contain Tuner™(DE3)pLacl Competent Cells (0.2 ml for 10 rxn, 2 × 0.2 ml for 20 rxn, and 4 × 0.2 ml for 40 rxn). The AccepTor Vector Giga Cloning Kits subsitute NovaBlue GigaSingles for NovaBlue Singles™ Competent Cells. † The pETBlue AccepTor Vector Kits contain extra SOC Medium, as indicated in parentheses.

Perfectly Blunt Cloning and Giga Cloning Kit Configurations pSTBlue-1 Perfectly Blunt Introductory Kits Perfectly Blunt Cloning Kits Blunt Vector Kits Giga Cloning Kits Kit Component 10 rxn 20 rxn 40 rxn 20 rxn 40 rxn 20 rxn 40 rxn Blunt Vector 0.5 mg 2 × 0.5 mg 4 × 0.5 mg 2 × 0.5 mg 4 × 0.5 mg 2 × 0.5 mg 4 × 0.5 mg Positive Control Insert 10 ml 10 ml 10 ml 10 ml 10 ml 10 ml 10 ml End Conversion Mix 100 ml 100 ml 2 × 100 ml 100 ml 2 × 100 ml 100 ml 2 × 100 ml T4 DNA Ligase 100 U 100 U 2 × 100 U 100 U 2 × 100 U Nuclease-free Water 1.5 ml 1.5 ml 1.5 ml 1.5 ml 1.5 ml NovaBlue Singles™ 11 × 50 ml 22 × 50 ml 44 × 50 ml 22 × 50 ml 44 × 50 ml Competent Cells* SOC Medium† 2 (or 3) × 2 ml 5 (or 6) × 2 ml 7 (or 9) × 2 ml 4 × 2 ml 7 × 2 ml Test Plasmid 10 ml 10 ml 10 ml 10 ml 10 ml * The pETBlue Perfectly Blunt Cloning Kits also contain Tuner(DE3)pLacl Competent Cells. The Perfectly Blunt Giga Cloning Kits subsitute NovaBlue GigaSingles for NovaBlue Singles Competent Cells. † The pETBlue Perfectly Blunt Vector Kits contain extra SOC Medium, as indicated in parentheses.

42 For more information or to place an order, Novagen • PCR Tools contact your local office (see back cover). PCR Cloning 43

PCR Cloning PCR • PCR PCR www.merckbio.com No fusion tags Insert provides start ATG codon Vector Features Vector Opposing SP6/T7 promoters Amp and Kan selection Dual EcoRI sites flank insert His•Tag® His•Tag® sequences Vector Features Vector Opposing SP6/T7 promoters Amp and Kan selection Dual EcoRI sites flank insert T7 promoter Amp or Kan selection Dual EcoRI sites flank insert T7 promoter NdeI/BamHI sites flank insert T7 promoter N-terminal S•Tag™ sequence Optimal Kozak translation initiation Xenopus globin 5'-UTR T7 promoter No fusion tag Insert provides start ATG codon T7 promoter Optional C-terminal HSV•Tag® and Vector provides Vector start ATG codon E. coli [email protected] [email protected] website our Visit Applications Archiving Subcloning Sequencing In vitro transcription Protein expression: T7-driven in vitro protein synthesis In vitro transcription/translation Sequencing Protein expression: T7lac-driven, tightly controlled, high-level expression in E. coli Applications Archiving Subcloning Sequencing In vitro transcription Protein expression: T7lac-driven, tightly controlled, high-level expression in Perfectly Blunt Cloning Perfectly or Vector Kit AccepTor Vector pSTBlue-1 pETBlue™-1 pSTBlue-1 pT7Blue-3 pT7Blue pT7Blue-2 pETBlue-1 pETBlue-2 † † Any DNA polymerase Blue/white screening > 95% recombinants Also compatible with restriction fragments Any ends (kit makes blunt ends) 20-minute end conversion 15-minute ligation 8-minute transformation Nonproofreading DNA polymerases Blue/white screening > 80% recombinants Single 3′- dA overhang 30-minute ligation 8-minute transformation Time to plating transformants is with ampicillin selection. For kanamycin selection, add 30 minutes. All times listed refer to kits using NovaBlue Singles™ which use NovaBlue Competent Cells. Giga kits, require one hour for GigaSingles™ Competent Cells, outgrowth. or™ Vector Kits AccepTor™ Vector • * † • • • Ends required: • compatibility: Polymerase Procedure time*: • • • Features: Perfectly Blunt® Cloning Kits Blunt® Perfectly • • • Ends required: • compatibility: Polymerase Procedure time*: • • Features: Continued Kits Overview Cloning Novagen • PCR Tools PCR • Novagen PCR • PCR Cloning PCR Cloning AccepTor™ Vector Kits Rapid, direct cloning with patented UA cloning technology

Features AccepTor™ Vector Cloning Kits are designed to simplify • Does not require restriction digestion or special primers cloning of PCR products with single 3´-dA nucleotide • Perform direct ligation of PCR product with vector overhangs, which are generated by non-proofreading • Compatible with polymerases that leave single 3´-dA thermostable DNA polymerases, such as KOD XL polymerase overhangs and native and recombinant Taq polymerases. The linearized • Blue/white screening with pSTBlue-1 or pETBlue™-1 vectors AccepTor Vector contains single 3´-dU DNA ends that are • Simple protocol takes as little as 40 min from PCR compatible with direct ligation of these products without product to plating transformants the need for intermediate reactions. The dU residues are converted to dT residues in vivo following transformation. In the AccepTor Vector Kits, vectors are supplied ready-to- ligate. Simply mix the vector with your PCR product, add Clonables™ 2X Ligation Premix, and transform into NovaBlue Singles™ Competent Cells.

Amplify target using AccepTor Vector Kits are available in an introductory Taq DNA or KOD XL 10-reaction size as well as 20- and 40-reaction configurations. polymerase. The linearized AccepTor Vectors are also available separately without the ligation and transformation components. See Giga Cloning Kits for information on the pSTBlue-1 AccepTor Vector Giga Kit with higher-efficiency competent cells.

A A LIGATE PCR product 15 min - 2 h AccepTor Vector 2X Ligation Premix

TRANSFORM NovaBlue Singles 8 min Competent Cells

PLATE SOC Medium 0 min incubation (Amp), 30 min incubation (Kan)

44 For more information or to place an order, Novagen • PCR Tools contact your local office (see back cover). PCR Cloning 45 E. coli. There PCR Cloning PCR • PCR PCR terminator T7 terminator

rrnB

n i

i I f

Sr www.merckbio.com r

I a Sm

I R E. coli, while providing the Eco t f e t

dU Z

dU c 3476 bp

Met...

a l pETBlue-1

AccepTor cloning site is located just downstream of

5'-ATGXXX... No restrictions c

a p l

7 m or Vector T A

[email protected] [email protected] website our Visit

o i r ccep or™ Vector kits. Each is carefully prepared carefully is Each kits. Vector AccepTor™ RBS (ribosome binding site). Amplification of the insert using sense using insert the of Amplification site). binding (ribosome RBS 10 a-complementation. The pSTBlue-1 vector is a general Primer design for expression of inserts in pETBlue-1 the T7 gene T7 the the between spacing optimal ensure will 5’-end the at ATG with beginning primers RBS and translation initiation sites for efficient protein synthesis in are no restrictions on the C-terminal (antisense) primers. Sense Primer: Antisense primer: pETBlue-1 is designed for the expression of unfused proteins from inserts start that have codon. an The ATG Two different vectors, as pSTBlue-1 available and pETBlue™-1, are and tested for optimal cloning efficiency and provides easy visualization of recombinants by blue/white screening using LacZ both promoters, SP6 and T7 opposed dual with vector purpose amp and kan resistance cassettes, and an array specifically of plasmid flanking a is vector pETBlue-1 The sites. restriction developed to enable high-level T7 RNA polymerase-driven expression of target genes in convenience of blue/white screening and high plasmid copy number. Initial cloning is performed in the non-expression host NovaBlue, and the recombinant plasmid is transformed into Tuner™(DE3)pLacI Competent Cells (included in kits) for protein expression. SP6

Price

TB248 TB249

Price I Eag

I t No

I Sac

I a novagen.com Ap

I O109 Eco

I X t Bs

I Pml

I A Cat. No. Rle 70199-3 71228-3 71228-4 70594-3 70595-3 70595-4 70596-3 70596-4

Cat. No. 70608-3 70598-3 70598-4 70599-3 70599-4 70597-3 I a Xb

I e Nh

I y St

II r

Av gin

i p I

Xho or

1 m Size A d III d n Hi f

c II c n 20 µg Hi 20 µg

10 rxn 10 20 rxn 40 rxn 20 rxn 40 rxn 20 rxn 40 rxn 10 rxn 10

20 rxn 40 rxn 20 rxn 40 rxn

I c Ac

I Sal

I R Eco

Size Z

l dU 1 bp 385

I R Eco pSTBlue-1

I H Bam

I B

Sna n

a I u Ml

i K r

I Pst o

I Sph

I Kpn T7 or™ Vector pETBlue™-1 AccepTor™ Vector (linearized vector) pETBlue™-1 DNA or™ Vector pETBlue™-1 AccepTor™ Vector Kit Introductory pETBlue™-1 Kit AccepTor™ Vector Components See table on page 42 for kit components. Additional Information Available Kits User Protocol AccepTor Vector pETBlue-1 Kits & DNA Product See table on page 42 for kit components. pETBlue System Manual Maps and Sequences Vector pSTBlue-1 Kits & DNA Product Introductory pSTBlue-1 Kit AccepTor™ Vector pSTBlue-1 AccepTor™ Vector Kit pSTBlue-1 AccepTor™ Vector Giga Kit pSTBlue-1 DNA Components or™ Vector pSTBlue-1 AccepTor™ Vector (linearized vector) Continued or™ Vector Kits Tor™ Vector Accep Novagen • PCR Tools PCR • Novagen PCR • PCR Cloning PCR Cloning Perfectly Blunt® Cloning Kits Efficient cloning of DNA amplified by any polymerase

Features With the Perfectly Blunt® Cloning Kits, DNA with any type • 7 different vectors available, including pETBlue™ of end can be cloned with high efficiency. DNA products expression vectors are treated in the end conversion reaction to produce • No restriction enzymes or special primers required blunt, phosphorylated ends, which are compatible with the • Compatible with inserts generated by any DNA polymerase, regardless of end type generated linearized, dephosphorylated blunt vector. • Blue/white screening • Simple protocol takes less than 1 h from PCR product to The Perfectly Blunt Cloning Kits are designed to simplify plating transformants cloning of DNA generated by PCR using any type of DNA Primer design for expression of inserts in pT7Blue-2 polymerase. This approach enables the use of high-fidelity Blunt Vector proofreading enzymes for amplification, which decreases the pT7Blue-2 is designed for T7 promoter-driven expression in reticulocyte probability of generating mutations in the target sequence. lysate or lac promoter-driven expression in E. coli of proteins fused In addition, under many conditions blunt cloning is more with an upstream, cleavable S•Tag™ sequence. The blunt cloning site (SmaI) is located just downstream from the enterokinase cleavage site efficient than T-cloning, probably because the efficiency coding sequence. For in-frame cloning of PCR products, the first base of single 3´-dA addition by Taq DNA polymerase varies of the 5’ (sense) primer is the last base of the CCN proline codon. N can be any base, however G and A form preferred codons in E. coli. There significantly depending on the sequence context of the DNA are no restrictions on the design of the C-terminal (antisense) primer. ends, and the number of PCR cycles performed (Novy 1996, Sense Primer: 5'-NXXX...* Clark 1998, Brownstein 1996, Magnuson, 1996, Hu 1993). Antisense primer: No restrictions

*where N = any base (completes Pro codon; G or A is recommended) and XXX = With the Perfectly Blunt cloning protocol, you can go the initial codon of the insert. from PCR product to plating transformants in less than Note: For additional information, please refer to User Protocol TB183 one hour with minimal hands-on time. The finished PCR product is converted to a blunt, phosphorylated DNA in a 15-minute reaction using premixed reagents. Following a 5-minute heat inactivation step, the treated Amplify target using insert is combined with the ready-to-use vector and any thermostable DNA polymerase.

pSTBlue-1 I I O109 O109 X T7 SP6 Kpn I Sph I Pst I Ml u I Sna B I Bam H I Eco R I Eco R I Sal I Ac c I Hi n c II Hi n d III Xho I Av r II St y I Nh e I Xba I Rl e A I Pml I Bs t Eco Apa I Sac I No t I Eag I

A I A pT7Blue-3 I O109 O109 X T7 Apa I Sac I No t I Eag I A A Kpn I Sph I Pst I Ml u I Sna B I Bam H I Eco R I Eco R I Sal I Ac c I Hi n c II Hi n d III Xho I Av r II St y I Nh e I Xb a I Rl e A I Pml I Bs t Eco C PCR Product CONVERT ENDS lacZ 20 min P End Conversion Mix

ri o f1 o r i P g i LIGATE Blunt Vector n 15 min Ligase pSTBlue-1 pT7Blue-3 TRANSFORM NovaBlue Singles 8 min Competent Cells

p m K A PLATE SOC Medium an 0 min incubation (Amp), 30 min incubation (Kan)

46 For more information or to place an order, Novagen • PCR Tools contact your local office (see back cover). PCR Cloning 47 Price Price Price Price PCR Cloning PCR • Cat. No. 70191-3 70191-4 70188-3 70188-4 71229-3 71229-4 70199-3 70184-3 PCR PCR Cat. No. 70183-3 70189-3 70189-4 70174-3 70174-4 69967-3 Cat. No. 70186-3 70186-4 69141-3 70190-3 70190-4 Cat. No. 70075-3 70182-3 70182-4 70187-3 70187-4 70025-3 Size 10 rxn 10 20 rxn 40 rxn 20 rxn 40 rxn 20 µg Size Size Size 20 µg 20 µg 20 rxn 40 rxn 20 rxn 40 rxn 20 µg 10 rxn 10 20 rxn 40 rxn 20 rxn 40 rxn 20 rxn 40 rxn 10 rxn 10 20 rxn 40 rxn 20 rxn 40 rxn www.merckbio.com [email protected] [email protected] website our Visit Introductory pT7Blue Blunt® Cloning Perfectly Kit pT7Blue Perfectly Blunt® Cloning Kit pT7Blue Blunt Vector pT7Blue Blunt Vector (linearized) pT7Blue DNA (uncut) pT7Blue-2 Blunt (linearized) Vector pT7Blue-2 DNA (uncut) Components pT7Blue-2 Perfectly pT7Blue-2 Perfectly Blunt® Cloning Kit Components See table on page 42 for kit components. See table on page 42 for kit components. pT7Blue-2 Kits & DNA Product See table on page 42 for kit components.. pT7Blue Kits & DNA Product pSTBlue-1 Kits & DNA Product See table on page 42 for kit components. pT7Blue-3 Kits & DNA Product pSTBlue-1 Perfectly pSTBlue-1 Perfectly Blunt® Giga Cloning Kit pSTBlue-1 DNA Components Introductory pSTBlue-1 Perfectly Blunt® Cloning Kit pSTBlue-1 Perfectly Blunt® Cloning Kit pSTBlue-1 Blunt (linearized) Vector Introductory pT7Blue-3 Perfectly Blunt® Cloning Kit pT7Blue-3 Perfectly pT7Blue-3 Perfectly Blunt® Cloning Kit pT7Blue-3 Blunt (linearized) Vector pT7Blue-3 DNA (uncut) Components

I g Ea

I t No

I c Sa

I Apa

I X Bst

I Pml

I a Xb

I e Nh

II r Av

I o Xh

I II d n Hi

I Acc

c II c n Hi

I l Sa

V R o Ec

I R Eco in

orig

I R

, 700. , 700. Eco 1

SP6 f

I H Bam I c Sa

I B Sna I Kpn

I Mlu I Ava

I Pst I Sma

I R Bse I H Bam Z

c mp

a A l

I e Nd I A n Pi

I Spe okinase site

I Kpn Kpn pT7Blue pT7Blue-2

I a Xb

I c Ac enter

c II c n Hi

S•T

I l Sa I o Nc

. Each vector is available in a kit containing containing a in kit available is E. vector coli. Each I 8387 Sse I Msc

I Pst

i r

o I Sph

d III d n Hi transcription/translation, and protein in T7-driven vitro transcription/translation, globin UTR T7 T7 pT7Blue pT7Blue-2 Hu, G. 1993. DNA Cell Biol. 12, 763. References: 6, 7. R.E., et al. 1996. inNovations Novy, . 16, 9677. Res Clark, J.M. 1988. Nucleic Acids 20, 1004. Brownstein, J.M., et al. 1996. BioTechniques 21 BioTechniques et al. 1996. Magnuson, V.L., ligated in an optimized 8-minute 15-minute reaction. transformation An procedure exclusive NovaBlue using Singles™ Competent high Cells efficiency colonies generates that recombinant are easily visualized by blue/white screening. The Perfectly Blunt® PCR method products; is these not restriction kits limited are to using also cloning fragments, suitable the for available Vector same cDNA, cloning pT7Blue-3. and as pT7Blue-2, pT7Blue, protocols. pSTBlue-1, Perfectly pETBlue-2, Six or Blunt different Cloning choices include those designed for general cloning, sequencing, Kits: vectors sheared pETBlue™-1, are optimal DNA expression in 10, 20, or 40 reactions. sufficient reagents for “Vector only” kits are also available in 20- sizes without ligase and competent and cells. For highest-efficiency 40-reaction competent cells, use pSTBlue-1 Perfectly Blunt Giga Cloning Kit. Perfectly Blunt® Cloning Kits Cloning Blunt® Perfectly Continued Novagen • PCR Tools PCR • Novagen PCR • PCR Cloning PCR Cloning Perfectly Blunt® Cloning Kits Continued

pETBlue-1 Kits & DNA

pETBlue-1 I Product Size Cat. No. Price R Sm a I Sr f I Introductory 10 rxn 70633-3 Eco pETBlue™-1 Perfectly Blunt® Cloning Kit pETBlue-2 pETBlue™-1 Perfectly 20 rxn 70634-3 HSV•Tag His•Tag Blunt® Cloning Kit 40 rxn 70634-4 Nco I Sm a I Ecl 136 II Bam H I Eco R I Bsr G I Asc I Bss H II Sse 8387 I Pst I Sal I Aat II Kp n I Cla I Ml u I Nsp V Hi n d III Not I Eag I Pvu II Bst 1107 I Pml I Xho I Pac I pETBlue™-1 Blunt 20 rxn 70620-3 lacZ Vector (linearized) 40 rxn 70620-4 tet ac rrnB terminator 7l pETBlue™-1 DNA 20 µg 70608-3 T T7 terminator Components See table on page 42 for kit components.

r pETBlue-1 o pETBlue-2 pETBlue-2 Kits & DNA Product Size Cat. No. Price in Introductory 10 rxn 70635-3 A ig mp or pETBlue™-2 Perfectly f1 Blunt® Cloning Kit pETBlue™-2 Perfectly 20 rxn 70636-3 Blunt® Cloning Kit 40 rxn 70636-4 pETBlue™-2 Blunt 20 rxn 70621-3 Vector (linearized) 40 rxn 70621-4 Primer design for expression of inserts in pETBlue™-1 and pETBlue™-2 DNA 20 µg 70609-3 pETBlue-2 Blunt Vectors (uncut) pETBlue-1 is designed for the expression pETBlue-2 is designed for the expression Components of unfused proteins from inserts that have of proteins fused with C-terminal See table on page 42 for kit components. an ATG start codon. The blunt cloning site HSV•Tag® and His•Tag® sequences to is located just downstream from the T7 facilitate detection and purification. In Additional Information Available gene 10 RBS (ribosome binding site). addition, this vector encodes an ATG Perfectly Blunt Cloning Kits User Protocol TB183 Amplification of the insert using sense start codon 8 base pairs downstream of pETBlue System Manual TB249 primers beginning with ATG at the 5’- the T7 gene 10 RBS. The blunt cloning inNovations No. 6, 8 end will ensure optimal spacing between site is located such that the insert will Vector Maps and Sequences novagen.com the RBS and translation initiation sites specify the fourth amino acid following for efficient protein synthesis in E. coli. Met-Ala-Ile at the N-terminus of the There are no restrictions on the design of expressed protein. In order to achieve the C-terminal (antisense) primer. correct reading frame, the 5’-end of the insert (and the sense PCR primer) should Met... begin with the third base of the Ile/Met Sense Primer: 5'-ATGXXX... codon. To express a target protein fused Antisense primer: No restrictions with C-terminal HSV•Tag and His•Tag peptides, the antisense primer should begin with two bases in any combination except TA or CA, and specify an antisense codon beginning with the third base.

MetAlaIle....insert.....Ser Vector: ATGGCGATNXXX...... ATCC TACCGCTA...... YYYNNTAGG Sense Primer: 5'-NXXX...... If N = G, Met codon is generated instead of lle. Antisense primer: 5'-NNYYY..... If NN = CA or TA, stop codon is generated in sense strand.

48 For more information or to place an order, Novagen • PCR Tools contact your local office (see back cover). PCR Cloning 49 PCR Cloning PCR • PCR PCR www.merckbio.com [email protected] [email protected] website our Visit es The Clonables 2X T4 quality Ligation highest the of concentrations optimized containing Premix efficient for is needed cofactors and a stabilizer, buffer, ligase, single DNA solution ligation of any type of compatible DNA ends. The premix is tested for ligation of compatible 2- to 4-base on cohesive DNA found overhangs single-base and ends blunt as well as ends some PCR products. ligation Under most conditions excellent more overhangs, U/A or T/A With minutes. 15 only in occurs colonies can be obtained by incubating for up to two hours. Although maximal efficiencies are obtained using NovaBlue Singles Competent Cells, this reagent transformation is of any compatible type with of chemically competent cells. The high performance, minimal pipetting requirement, and single-addition format make the premix suitable for high- throughput applications. One vial of the 2X Ligation Premix contains enough reagent µl scale). ligation reactions (10- for 11 The Clonables™ Kit enables convenient, dependable, high- efficiency ligation and transformation ofDNA any compatible ends. The kit features a Premix, unique, containing universal Ligation ligase, buffer, supports ligation of any type of DNA cohesive or blunt ends and cofactors, which in a 15-minute reaction. Ligated DNA is transformed streamlined a use which Cells, Competent into Singles™ NovaBlue ampicillin-resistant for minutes 8 than less takes that protocol plasmids and 38 plasmids. minutes This kit for can be other without used end, DNA of type any with compatible is with and vectors antibiotic-resistant a variety of cloning altering the ends or desired cloning junctions. The Clonables Kit contains sufficient reagents11 to perform control a includes and reactions, transformation and ligation vector and insert mix to verify performance. No. 9 TB233 Price TB233 Price Cat. No. 70526-3 Cat. No. 70573-3 70573-4 Size Size 55 µl 2.5 ml 11 rxn 11 Clonables 2X Ligation Premix Control Clonables Positive Nuclease-free Water NovaBlue Singles Competent Cells SOC Medium Plasmid Test Rapid 15-min ligation, 8-min transformation with Rapid 15-min ligation, 8-min ampicillin selection decrease pipetting steps Premixed ligation components and increase reliability for cohesive ends, One reaction condition, optimized blunt ends single base overhangs, and eliminate need to aliquot, Single-use competent cells or waste partially used vials freeze/thaw, enzyme buffer, TE, restriction Compatible with PCR buffer, and End Conversion Mix Clonables™ 2X Ligation Premix Additional Information Available Clonables Kit User Protocol Product Additional Information Available Clonables Kit User Protocol inNovations Clonables™ Ligation/ Kit Transformation Product Components 55 ml ml 10 1.5 ml × 50 ml 11 2 × 2 ml ml 10 Features • • • • • Single solution for optimal ligation in 15 minutes Clonables™ 2X Ligation Premix Clonables™ 2X Ligation Simple, reproducible ligation and transformation—in as little as 23 minut transformation—in as ligation and Simple, reproducible Clonables™ Ligation/Transformation Kit Ligation/Transformation Clonables™ Novagen • PCR Tools PCR • Novagen PCR • PCR Cloning PCR Cloning NovaBlue Competent Cell Formats

High efficiency and convenient aliquot sizes for reduced cell waste

NovaBlue is a K-12 strain ideally suited as an initial cloning use tubes); HT96™ format (20-ml volume in a 96-well plate); host due to its high transformation efficiency, blue/white and a standard format (0.2-µl volume sufficient for ten screening capability (with appropriate plasmids), and recA transformations). For applications in which animal-derived and endA mutations, which result in high yields of high- products are prohibited, Veggie™ Singles are prepared with quality plasmid DNA. NovaBlue competent cells come in a animal-free reagents. Please refer to the table at right and the variety of formats including: Singles™ format (50-ml single- following pages for more information.

NovaBlue Competent Cells Transformation Efficiency* Reaction Size Application GigaSingles™ > 1.0 × 109 cfu/mg 50 ml High-efficiency cloning Singles > 1.5 × 108 cfu/mg 50 ml Routine cloning Veggie Singles > 1.5 × 108 cfu/mg 50 ml Applications requiring nonanimal-derived materials Routine cloning HT96 > 1.0 × 108 cfu/mg 96 × 20 ml High-throughput cloning Standard > 1.5 × 108 cfu/mg 20 ml Routine cloning * Measured as cfu/µg test plasmid NovaBlue Genotype: – + endA1 hsdR17(rK12 mK12 ) supE44 thi-1 recA1 gyrA96 relA1 lac F’[proA+B+ lacIqZM15::Tn10] (TetR)

N THE O W E

www.novagen.com NovaBlue GigaSingles™ Competent Cells /CompCells 109 efficiency in chemically competent cells

Features NovaBlue GigaSingles™ Competent Cells produce >1 × 109 • Guaranteed efficiency >1 × 109 cfu/µg colonies/µg plasmid DNA for cloning applications requiring • Ideal for high-efficiency cloning high-efficiency transformations. • Enables production of high-quality plasmid DNA • Easy-to-use Singles format • Prepared using an optimized chemical method

Product Size Cat. No. Price NovaBlue GigaSingles™ 11 rxn 71227-3 Competent Cells 22 rxn 71227-4

Components 11 × 50 ml or 22 × 50 ml Competent Cells 2 × 2 ml or 4 × 2 ml SOC Medium 10 ml Test Plasmid

50 For more information or to place an order, Novagen • PCR Tools contact your local office (see back cover). PCR Cloning

EB EB 51 W W E E H H

T T

N N

O O B /CompCells /CompCells + www.novagen.com www.novagen.com PCR Cloning PCR • PCR PCR www.merckbio.com strain has the same features as NovaBlue, ) supE44 thi-1 recA1 gyrA96 relA1 lac tonA F’[proA + R [email protected] [email protected] website our Visit ) R K12 m – recA, which result in high yields of high-quality ] (Tet K12 Genotype: R and ZM15::Tn10 endA q with the added benefit of being resistant to T1 and T5 phage. NovaBlue is a K-12 strain ideally suited as an initial cloning host because it has high transformation blue/white efficiency, mutations and plasmids), appropriate (with capability screening in plasmid DNA. lacI The NovaBlue T1 NovaBlue T1 NovaBlue Singles™ Competent Cells, like all Novagen® Singles Singles Novagen® all like Cells, Competent Singles™ NovaBlue Competent Cells, are designed for ultimate convenience and reliability in plasmid transformation. The cells are grown and Cells procedure. optimized an using competent chemically made are provided in 50-µl volumes to eliminate the need to freeze/thaw, aliquot, or waste partially used money, time, saves This vials. and ensures cell reliable performance. To use, simply thaw, add DNA, incubate fiveheat shock for minutes30 seconds, place on ice for two minutes, on ice, add SOC Medium, and plate directly (when selecting for ampicillin resistance) or after incubation at 37˚C for 30 minutes (when selecting for other antibiotic resistances). endA1 hsdR17 (r Price Price Cat. No. 70181-3 70181-4 69825-3 69825-4 Cat. No. 71318-3 71318-4 Size 11 rxn 11 0.4 ml 1.0 ml 22 rxn cfu/µg cfu/µg 8 8 Singles Competent Cells R Size Singles Competent Cells SOC Medium Plasmid Test Competent Cells Plasmid Test 11 rxn 11 22 rxn NovaBlue T1 SOC Medium Plasmid Test Singles™ Competent Cells Singles™ Competent Cells R Singles™ R Resistant to T1 and T5 phage Enables production of high-quality plasmid DNA Easy-to-use Singles format Prepared using an optimized chemical method Provided frozen as single-use tubes in Provided frozen as single-use or 22-reaction kits 11-reaction efficiency Reliably high transformation DNA preparation Enables high-quality plasmid directly in the supplied Rapid: perform transformation tube Guaranteed efficiency >1.5 × 10 Guaranteed efficiency >1.5 × Guaranteed efficiency >1.5 × 10 × Guaranteed efficiency >1.5 Components × 50 ml or 22 × 50 ml 11 Product Components Catalog No. 70181 × 50 ml or 22 × 50 ml 11 Product 2 × 2 ml or 4 × 2 ml µl 10 Catalog No. 69825 2 x 0.2 ml or 5 x 0.2 ml µl 10 10 ml 10 Competent Cells 2 × 2 ml or 4 × 2 ml NovaBlue T1 NovaBlue Competent Cells NovaBlue Singles™ Competent Cells NovaBlue Singles™ Competent • • • • • • • • • Features Features • NovaBlue T1 Resistant to T1 and T5 phage in less than 8 minutes in less than of E. coli high-efficiency transformation Cost-effective, NovaBlue Singles™ Competent Cells Competent Singles™ NovaBlue Novagen • PCR Tools PCR • Novagen PCR • PCR Cloning

M D ON THE A * W E

PCR Cloning B

* A

i m

a l- D e ri ve s F d Material www.novagen.com Veggie™ NovaBlue Singles™ Competent Cells R E E /CompCells

Certified animal-free chemically competent cells

Features Veggie™ NovaBlue Singles™ Competent Cells are appropriate • Guaranteed efficiency >1.5 × 108 cfu/µg for standard cloning applications when absence of animal- • Manufactured free of animal-derived media and derived components is essential. NovaBlue is a K-12 strain components ideally suited as an initial cloning host due to its high • Reproducible high-efficiency cloning transformation efficiency, blue/white screening capability • Enables production of high-quality plasmid DNA • Easy-to-use Singles format (with appropriate plasmids), and mutations in recA and endA, • Prepared using an optimized chemical method which result in excellent yields of high-quality plasmid DNA. Veggie NovaBlue Singles Competent Cells are supplied with an Product Size Cat. No. Price animal-free prepared SOC medium. Veggie™ NovaBlue Singles™ 11 rxn 71251-3 Competent Cells 22 rxn 71251-4 NovaBlue Genotype: – + Components endA1 hsdR17(rK12 mK12 ) supE44 thi-1 recA1 gyrA96 + + q R 11 × 50 ml or 22 × 50 ml Veggie NovaBlue Singles Competent Cells relA1 lac F’[proA B lacI ZM15::Tn10] (Tet ) 2 × 2 ml or 4 × 2 ml Veggie SOC Medium 10 µl Test Plasmid

N THE O W E

www.novagen.com Zappers™ Electrocompetent Cells /CompCells

1010 cloning efficiency in phage-resistant strains

Features NovaXG and NovaXGF´ Zappers™ Electrocompetent Cells • Conveniently packaged combine favorable genotypes with high-transformation • Guaranteed transformation efficiency of efficiency for the most demanding cloning applications. Both 10 >1 × 10 cfu/µg cell types have tonA mutations conferring resistance to T1 • Methylation restriction minus and T5 phage. NovaXG features deletion of genes involved in • Recombination and restriction minus restriction of methylated DNA [(mcrC–mrr)], and recA and • Resistant to T1 and T5 phage • Enables blue/white screening by α-complementation with endA mutations, which facilitate excellent yields of high-quality appropriate plasmids plasmid DNA. The lacZ w fragment is expressed constitutively from the genome of NovaXG and allows blue/white screening Product Size Cat. No. Price NovaXG Zappers™ Electrocompetent 10 rxn 71315-3 for recombinants by lacZ α-complementation. Cells 20 rxn 71315-4 NovaXGF’ Zappers™ 10 rxn 71317-3 Electrocompetent Cells 20 rxn 71317-4 NovaXGF´ cells have the same genotype as NovaXG, but harbor an F´ episome which confers tetracycline resistance and Components 5 × 50 ml or 10 × 50 ml NovaXG or XGF' Zappers allows infection by M13 for single strand DNA production. Electrocompetent Cells Because the F´ carries the lacIq repressor gene, addition of 10 ml Test Plasmid IPTG is required for blue/white screening of recombinants. In NovaXG Genotype: – the absence of IPTG, transcription of insert DNA from the lac F mcrA (mcrC-mrr) endA1 recA1 φ80dlacZM15 lacX74 araD139 (ara-leu)7697 galU galK rpsL nupG λ– tonA promoter is kept to a minimum.

NovaXGF’ Genotype: mcrA (mcrC-mrr) endA1 recA1 f80dlacZM15 Both NovaXG and NovaXGF´ strains are manufactured for lacX74 araD139 (ara-leu)7697 galU galK rpsL ultra-high transformation efficiency (>1 × 1010 cfu/µg) by nupG l tonA F’[lacIq Tn10] (TetR) electroporation. Ultra-high efficiency is especially important when working with limited amounts of DNA or when constructing raries. Cells are packaged at two reactions per tube to minimize waste.

52 For more information or to place an order, Novagen • PCR Tools contact your local office (see back cover). PCR Cloning

EB 53 W E H

N O /CompCells www.novagen.com PCR Cloning PCR • PCR PCR www.merckbio.com [email protected] [email protected] website our Visit throughput applications throughput The HT96 Isothermal Block is an anodized aluminum, solvent- aluminum, anodized an is Block Isothermal HT96 The resistant block specifically designed to hold one HT96 plate and to provide efficient thermalwithin the 96-well transferplate. Using an HT96 Isothermal Block for to samples held each temperature, samples can be rapidly transferred between the low-temperature and heat-shock steps in transformation protocols. Simply preincubate the anodized aluminum block at the desired temperature and place the HT96 Competent Cell plate in the block. The HT96 Isothermal Block is compatible with most 96-well PCR plates and robotic platforms. HT96™ NovaBlue Competent Cells 20-µl in predispensed are are cells The transformation. throughput designed for high- volumes in a sturdy 96-well polypropylene plate compatible with a variety of thermal cyclers and water baths. Wells are individually sealed and have raised or tips pipet rims standard with pierced be can Seals to contamination. prevent cross- removed for easier access. Strips of caps are also provided for reliable sealing during manipulation smaller and processing for storage. plate the Groups from of split easily be can wells 24 numbers of samples. Price Price 71195-3 Cat. No. 71011-3 71011-4 Cat. No. Size 1 ea Size cfu/mg 1 plate 8 4 plates HT96 NovaBlue Competent Cells SOC Medium Plasmid Test 8-Cap Strips Reagent Reservoirs High-throughput, 96-well format High-throughput, 96-well Guaranteed efficiency >1 × 10 × Guaranteed efficiency >1 Product 1 × 14 ml or 4 × 14 ml ml ml or 2 × 10 1 × 10 1 or 4 pkg 1 or 4 HT96™ NovaBlue Competent Cells HT96™ NovaBlue Competent Components 1 or 4 plates Product HT96™ Isothermal Block • Features • High-efficiency competent cells predispensed in a 96-well plate for high- predispensed in a 96-well competent cells High-efficiency HT96™ NovaBlue Competent Cells Competent NovaBlue HT96™ Efficient thermal transfer to samples in an HT96 plate Efficient thermal transfer to samples in an HT96™ Isothermal Block HT96™ Isothermal Block Novagen • PCR Tools PCR • Novagen PCR • Molecular Biology Essentials

N THE O W Molecular Biology Essentials E

www.calbiochem.com Molecular Biology Reagents /MolecularBiology

Product Size Cat. No. Price Ethidium Bromide Absorber Agarose, Type I, Molecular Biology 100 g 121853 Safely remove ethidium bromide Grade 500 g EDTA, 0.5 M, pH 8.0, Molecular 100 ml 324506 Gray-brown suspension. Developed specifically for the safe Biology Grade, DEPC-Treated and simple removal of ethidium bromide (EtBr) from aqueous EDTA, Disodium Salt, Dihydrate, 100 g 324503 staining solutions and running buffers used in nucleic acid Molecular Biology Grade 1 kg separation gels. Typical concentrations in these solutions are Ethidium Bromide 1 g 331564 0.5-10 mg/L. EtBr is bound and concentrated by the adsorber Ethidium Bromide Adsorber 1 ea 331569 column, allowing filtrate removal. Each column normally binds at least 300 mg of ethidium bromide from TAE or TBE Formaldehyde, Molecular Biology 250 ml 344198 Grade buffers. Residual capacity is easily visualized because the EtBr X-Gal Solution 3 ml 71077-3 appears as a dark red to black band on the column. As long as Sodium Chloride Tablets 1 ea 567442 this band has not reached the bottom of the column bed, the (10 tablets) concentration of dye is still below the column capacity. EC 214-984-6, RTECS SF7950000, CAS 1239-45-8. Merck Index: 14, 4731 Agarose, Type 1, Molecular Biology Grade For nucleic acid electrophoresis Formaldehyde, Molecular Biology Grade CH O Suitable for the preparation of gels for nucleic acid 2 electrophoresis. Gel strength: ≥1200 g/cm2. A solution of 37% by weight of formaldehyde gas in water, PROTECT FROM MOISTURE. Gelling range (1.5%): 36-39°C. with 10% methanol added to prevent polymerization. Useful Melting range: 87-89°C. EEO -mr: ≤0.10. Contaminants: as a preservative, stabilizer, and disinfectant. Sulfate: ≤0.15%; DNase, RNase, protease: none detected. Purity: ≥37% by acidometry. Contaminants: RNases: none EC 2327318, CAS 9012-36-6. detected. Heavy metals: 0.0002% (as Pb). RTECS LP8925000, CAS 50-00-0. Merck Index: 14, 4235. R: EDTA, 0.5M, pH 8.0, Molecular Biology Grade, 23/24/25-34-40-43; S: 26-36/37/39-45-51. DEPC-Treated Ethylenediaminetetraacetic Acid Trisodium Salt X-Gal Solution For blue/white screening Sterile-filtered solution of 0.5 M EDTA in 2H O treated with diethyl pyrocarbonate (DEPC). Suitable for use in molecular The β-galactosidase substrate X-Gal biology applications. (5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside) is a CAS 150-38-9. chromogenic stain for b-gal activity. It is commonly used to distinguish between recombinants and nonrecombinants EDTA, Disodium Salt, Dihydrate, by lacZ α-complementation with appropriate vectors and Molecular Biology Grade hosts. X-Gal Solution is provided as a convenient 40 mg/ml Ethylenediaminetetraacetic Acid, 2Na concentrate in DMSO (3 × 1-ml tubes), ready for dilution into culture medium or appropriate buffers. A chelating agent used to sequester divalent and trivalent metal ions. HYGROSCOPIC. Contaminants: DNases, proteases, Sodium Chloride Tablets (10 Tablets) RNases: none detected. Each tablet contains 9 g sodium chloride. Note: 1 each = 10 RTECS AH4410000, tablets. CAS 6381-92-6. Merck Index: 14, 3517 R: 22. RTECS VZ4725000, CAS 7647-14-5. Ethidium Bromide Nucleic acid stain Red to purple solid. PROTECT FROM LIGHT. Fluorescent dye that produces fluorescent intercalation complexes with DNA. Suitable for use in gel electrophoresis and DNA isolation procedures. Purity: 95% HPLC. EC 214-984-6, RTECS SF7950000, CAS 1239-45-8. Merck Index: 14, 4731

54 For more information or to place an order, Novagen • PCR Tools contact your local office (see back cover). Molecular Biology Essentials

EB 55 W E H

N O /MolecularBiology www.calbiochem.com Molecular Biology Essentials Biology Molecular • www.merckbio.com PCR PCR [email protected] [email protected] website our Visit TE Buffer, 100X, Molecular Biology Grade 100X, TE Buffer, A widely-used buffer for nucleic acids. This concentrated pH 8.0. mM EDTA, formulation is 1M Tris, 100 Molecular Biology Grade 10X, TBE Buffer, Buffer Tris-Borate-EDTA running bufferUsed in the preparation of agarose gels and as a better has TBE electrophoresis. acid nucleic nondenaturing for during buffer of recirculation so TAE, than capacity buffering recommended not is TBE necessary. not is electrophoresis extended Tris, 0.89 M M 0.89 is concentrate 10X The gels. preparative for pH 8.3. boric acid, 20 mM EDTA, Contaminants: DNase, RNase, protease: none detected. R: 36/37/38; S: 36/37/39 Tris Buffer, 100 mM, pH 7.4, Molecular Biology 100 Buffer, Tris Grade used biological buffer. mM solution, pH 7.4. Widely Sterile 100 applications. Contaminants: DNases, Suitable for DNA and RNA RNases: none detected. Merck Index: 14, 9772. RTECS TY2900000, CAS 77-86-1. R: 36/38; S: 26. Molecular Biology Grade 10X, Buffer, TAE Buffer Tris-Acetate-EDTA of agarose gels and as a running Used in the preparation TAE buffer for nondenaturing nucleic acid electrophoresis. With a lower is recommended over TBE for preparative gels. during buffering capacity than TBE, recirculation of buffer as 10X extended electrophoresis is recommended. Supplied pH 8.3. mM EDTA, solution containing 400 mM Tris acetate, 10

Price 648310 648314 648315 391340 574797 574793 574795 Cat. No. 1 l 1 L 1 L Size 25 g 500 g 250 g 2.5 kg 100 ml 100 ml 100 Tris Buffer, 1.0 M, pH 8.0, Buffer, Tris Molecular Biology Grade mM, pH 7.4, 100 Buffer, Tris Molecular Biology Grade Molecular Biology 10X, Buffer, TAE Grade Molecular Biology 100X, TE Buffer, Grade Molecular Biology 10X, TBE Buffer, Grade Tris Base, Molecular Biology Grade Tris Product HEPES, Free Acid, Molecular Biology Grade Tris Buffer, 1.0 M, pH 8.0, Molecular Biology Buffer, Tris Grade Sterile 1 M solution. Suitable for DNA and RNA applications. Tris Base, Molecular Biology Grade Tris tris(Hydroxymethyl)aminomethane pKa 8.1 at Widely used to prepare buffers for nucleic acids. ≥99% by 25°C. Useful in the pH range of 7.0-9.0. Purity: RNases, titration test (perchloric acid titration). Contaminants: (260 nm): DNases, proteases: none detected. Absorbance pKa 8.30 at ≤0.03; (280 nm): 0.02. Heavy metals: ≤0.0005%. 20°C. 9772. R: RTECS TY2900000, CAS 77-86-1. Merck Index: 14, 36/38; S: 26. Contaminants: DNases, RNases: none detected. RTECS TY2900000, CAS 77-86-1. R: 36/38; S: 26. HEPES, Free Acid, Molecular Biology Grade HEPES, Free Acid, Molecular Biology Grade ’-2-ethanesulfonic Acid N-2-Hydroxyethylpiperazine-N buffering A zwitterionic N-substituted aminosulfonic acid and cell agent suitable for use with proteins, nucleic acids, range. culture. pKa 7.48 at 25°C. Useful in the pH 6.8-8.2 Purity: Maintains buffering capacity at low temperatures. and RNase, DNase, Contaminants: assay. alkalimetric by ≥99% pKa 7.55. protease: none detected. Heavy metals: ≤0.0005%. , 4654. RTECS TL6809000, CAS 7365-45-9. Merck Index: 14 Molecular Biology Grade Buffers Biology Molecular Novagen • PCR Tools PCR • Novagen PCR • Molecular Biology Essentials

N THE O W Molecular Biology Essentials E

www.calbiochem.com Molecular Biology Enzymes /MolecularBiology

Product Size Cat. No. Price DNase I, RNase free and DNase I, ds Qualified DNase I, RNase free 1000 U 69182-3 For applications in which maintenance of RNA integrity is critical DNase I, ds Qualified 50 U 69164-3 Phosphatase, Alkaline, Calf 1000 U 524576 RNase-free DNase I digests either single- or double-stranded DNA, Intestine, Molecular Biology producing a mixture of mono- and oligonucleotides. Purified to be Grade free of RNase, this preparation is qualified for applications in which maintenance of RNA integrity is critical. The enzyme selectively degrades DNA in the presence of RNA and can be used to remove DNA template following in vitro transcription reactions. This enzyme is also useful in other applications such as DNase footprinting and nick translation. For applications requiring the use of DNase I for random double-stranded cleavage of DNA, use DNase I, ds Qualified.

This is a select list of our Unit definition: One unit will degrade molecular biology reagents. 1 µg DNA in 10 minutes at 37˚C. The reaction mixture (50 µl)

contains 80 mM HEPES pH 7.5, 10 mM NaCl, 5 mM MgCl2, 10 mM For a comprehensive listing, see the DTT, 1 µg plasmid DNA, and enzyme. Calbiochem catalog or visit Phosphatase, Alkaline, Calf Instestine, Molecular www.calbiochem.com/molecularbiology Biology Grade Dephosphorylation of nucleic acids Calf Intestine Alkaline Phosphatase catalyzes the hydrolysis of 5´-terminal phosphates of DNA, RNA, and deoxy- and ribonucleoside triphosphates (Moessner 1990). The enzyme will dephosphorylate vector DNA to prevent “empty vector” religation in cloning experiments, and remove 5´-phosphate groups in preparation for labeling with polynucleotide kinase. Specific activity is 2000 U/mg protein. No contaminating DNase or RNase are detected. Supplied

as a liquid in 25 mM Tris-HCl, 1 mM MgCl2, 100 μM ZnCl2, 50% glycerol, pH 7.6. pH optimum is 8.0–10.5, pI 5.7. EC 3.1.3.1, CAS 9001-78-9, M.W. 140,000. Unit definition: One unit is defined as the amount of enzyme that will hydrolyze 1.0 mmol of pNPP per minute at 37˚C, pH 9.8.

Reference: Moessner, E., et al. 1980. Hoppe-Seylers Z. Physiol. Chem. 361, 543.

56 For more information or to place an order, Novagen • PCR Tools contact your local office (see back cover). Molecular Biology Essentials

EB 57 W E H

N O /MolecularBiology www.calbiochem.com , 5 mM 2 P]ATP in 30 min. Unit P]ATP 32 Molecular Biology Essentials Biology Molecular • www.merckbio.com PCR PCR Moessner, E., et al. 1980. Hoppe-Seylers Z. E., et al. 1980. Moessner, Reference: P]ATP, and 0.5 mM 5´-OH polynucleotide end P]ATP, [email protected] [email protected] website our Visit 32 P from pyrophosphate into ATP as Norit®-absorbable material as P from pyrophosphate into ATP DTT, 0.1 mM [γ- DTT, concentration. in 20 minutes at 37˚C. 0.01 Weiss unit is the amount of enzyme Weiss in 20 minutes at 37˚C. 0.01 λ HindIII fragments required to ligate > 95% of 1 µg bacteriophage at 16˚C in 20 minutes. assay conditions: 40 mM Tris-HCl, pH 7.5, 10 mM MgCl assay conditions: 40 mM Tris-HCl, pH 7.5, 10 32 Kinase T4 Polynucleotide Qualified for the most stringent cloning conditions Kinase (PNK) catalyzes the transfer of the T4 Polynucleotide of single and double to the 5´-hydroxyl γ-phosphate from ATP PNK useful for 5´–end stranded DNA or RNA. This activity makes labeling of DNA or RNA molecules for hybridization probes or labeled primers for sequencing. The enzyme is also useful for preparing non-radioactive phosphorylated DNA for cloning or PCR primers. Novagen PNK has been rigorously tested for contaminating endonuclease, and ribonuclease activities. For exonuclease, and ATP Kinase Buffer convenience and reliable performance, 10X solution are provided with the enzyme. Unit definition: One unit is defined as the amount of enzyme required to catalyze the transfer of 1 nmol phosphate to the 5´-OH end of an oligonucleotide from [γ- Merck Index 13, 8286. RNase A Solution degradation of RNA Convenient solution for selective alternative to powdered RNase A Solution is a convenient purified preparation of bovine pancreatic RNase A. It is a highly for use in selective removal of RNA. It ribonuclease A suitable DNase I and is suitable for RNA has been pretreated to remove procedures. Supplied at a digestion in plasmid purification 50% 1 mM EDTA, mM Tris-HCl, mg/ml in 10 concentration of 10 glycerol, pH 7.5. T4 DNA Ligase Qualified for the most stringent cloning conditions bonds T4 DNA Ligase catalyzes the formation of phosphodiester 5´-phosphate groups of adjacent DNA and between 3´-hydroxyl configurations. and RNA nucleotides in blunt-end or cohesive-end in duplex molecules The enzyme joins RNA and DNA strands only Novagen® T4 and does not join single-stranded nucleic acids. cloning assay DNA Ligase is rigorously tested in a blue-white ends to any under conditions that maximize exposure of DNA for any ligation contaminating nucleases. The enzyme is qualified or cloning application. unit is defined as the one Weiss units/µl; Unit definition: 4 Weiss of 1 nmole amount of enzyme required to catalyze the exchange 543. Physiol. Chem. 361, mg) of Price 556746 Cat. No. 71049-3 71049-4 mmol (181 70856-3 70663-4 70663-5 69839-3 69839-4 69248-3 Size 1 ml 2 ml 10 ml 10 100 U 100 10 KU 10 500 U 250 U 50 KU 100 mg 100 500 mg Product T4 DNA Ligase Kinase T4 Polynucleotide RNase A Solution RNase A, Protease-Free, Highly RNase A, Protease-Free, Highly Pancreas Purified, Bovine Proteinase K, Lyophilized Proteinase K Solution, 600 mAU/ml tyrosine from casein per minute at pH 7.5 at 37˚C. Ribonuclease A, Protease-Free Dephosphorylation of nucleic acids Ribonuclease A, Protease-Free is a chromatographically purified, pyrimidine-specific endoribonuclease that acts on single-stranded RNA. Supplied lyophilized. enzyme of amount the as defined is unit One definition: Unit first-order a yield to RNA of hydrolysis the catalyze will that velocity constant equal to 1.0 at 25˚C, pH 5.0. Efficient removal of proteins from nucleic acid solutions Efficient removal of proteins from nucleic acid solutions protease Proteinase K is a highly active 28,904-Da serine isolated from the fungus Tritirachium album. The enzyme and denatured exhibits broad cleavage specificity on native of DNA and proteins and is widely used in the purification denaturants RNA. Its activity is increased in the presence of The such as SDS (1%) and elevated temperature (50–60˚C). µg/ml for recommended working concentration is 50–100 mg/ up to 2 protein removal and enzyme inactivation, and Lyophilized powder K, Proteinase The treatment. tissue for ml in water and can be prepared as a 20 mg/ml stock solution available as stored in aliquots at –20˚C. The enzyme is also mAU/ml) a ready-to-use concentrated stock solution (600 1 mg that is convenient for routine use in most applications. = Anson of Proteinase K is the equivalent of 30 mAU (AU DNase and unit). Proteinase K products are free of detectable RNase. Unit definition: One AU (AU = Anson unit) is the amount defined of as enzyme that liberates 1.0 Proteinase K Molecular Biology Enzymes Biology Molecular Novagen • PCR Tools PCR • Novagen PCR • Molecular Biology Essentials Molecular Biology Essentials D-Tube™ Dialyzers

Dialysis and electroelution from polyacrylamide or agarose gels

Features: The D-Tube™ Dialyzers can be used for dialysis and • Easy-to-handle dialyzers for buffer exchange and removal electroelution of proteins, RNA, DNA, and oligonucleotides of detergents and urea from polyacrylamide or agarose gels. The disposable, single- • One-step procedure that does not require syringes or any use tubes require no syringes, microcentrifuge, or laborious special equipment steps to manipulate small sample volumes. The sample is added • Typical volume recovery of sample in solution >97% • Free of Protease, RNAse, DNAse, and PCR products and removed using a standard laboratory pipette. Available • Ideal for electroelution of proteins, protein-DNA with molecular weight cutoffs (MWCO) from 3.5 to 14 kDa, the complexes, oligonucleotides, DNA, and RNA from D-Tube Dialyzers are designed in three volume capacities: mini polyacrylamide and agarose gels (10–250 µl), midi (50–800 µl), and maxi (500–3000 µl). The Product Size Cat. No. Price membrane is ultra-clean, EDTA-treated regenerated cellulose, D-Tube™ Dialyzer Mini, MWCO 1 kit 71504-3 sulfur- and heavy metal-free. Each kit contains 10 D-Tube 6-8 kDa b D-Tube™ Dialyzer Mini, MWCO 1 kit 71505-3 Dialyzers and one floating rack that can hold up to four D-Tube 12-14 kDa b Dialyzers in the exchange buffer. D-Tube™ Dialyzer Midi, MWCO 1 kit 71506-3 3.5 kDa b D-Tube™ Dialyzer Midi, MWCO 1 kit 71507-3 6-8 kDa b D-Tube™ Dialyzer Maxi, MWCO 1 kit 71508-3 3.5 kDa b D-Tube™ Dialyzer Maxi, MWCO 1 kit 71509-3 6-8 kDa b D-Tube™ Dialyzer Maxi, MWCO 1 kit 71510-3 12-14 kDa b Floating Rack, Mini 10 racks 71512-3 Floating Rack, Midi 10 racks 71513-3 Floating Rack, Maxi 10 racks 71514-3

Components Cat. No. 71504 – 71510 10 D-Tubes 1 Floating Rack

Additional Information Available D-Tube Dialyzer Mini, Midi, Maxi and D-Tube96 User Protocol TB422 inNovations Nos. 21, 27

D-Tube Dialyzer Size Volume MW Cutoff Mini 10 to 250 µl 6-8 kDa 10 to 250 µl 12-14 kDa Midi 50 to 800 µl 3.5 kDa 50 to 800 µl 6-8 kDa Maxi 100 to 3000 µl 3.5 kDa 100 to 3000 µl 6-8 kDa 100 to 3000 µl 12-14 KDa

58 For more information or to place an order, Novagen • PCR Tools contact your local office (see back cover). Molecular Biology Essentials 59 Molecular Biology Essentials Biology Molecular •

www.merckbio.com PCR PCR [email protected] [email protected] website our Visit ctroelution The combination of D-Tube™ Electroelution Dialyzers Accessory and Kit the provides extraction D-Tube a of unique any tool protein-DNA complex for protein, from non-denaturing and protein-protein denaturing complex, (SDS) or polyacrylamide gels less with than 2 60% hours. recovery Extracted proteins most yield are downstream compatible applications in mapping, with such peptide HPLC, as production, antibody MALDI-MS, for immunization animal and functional assays. In addition, D-Tube Dialyzers can be used for oligonucleotides, RNA, and DNA both extraction polyacrylamide from and agarose gels. of fragments DNA for and oligos 15-nt Efficientfor achieved is 90%) (> extraction provides, Kit Accessory Electroelution D-Tube The kb. 80 to up three D-Tube support trays, one for each size D-Tube which is compatible with most commercially available electrophoresis horizontal units and optimized reagents for protein and nucleic acid precipitation following electroelution. Price 71511-3 Cat. No. Size 1 kit MS Precipitation Buffer 20% TCA, 3 M NaAc, pH 5.2 Mini, Midi, Maxi Supporting Trays, For any questions on our PCR portfolio, on any questions For representative local sales contact your Support. or Technical Electroelution Accessory Kit Accessory Electroelution ™ Efficient extraction of protein, protein-DNA complexes, Efficient extraction of protein, RNA from 1D and 2D oligonucleotides, DNA, and polyacrylamide and agarose gels More than 60% protein recovery of oligonucleotides , RNA, and More than 90% recovery in size DNA from 15 nt to 80 kb variety of downstream Procedure compatible with functional assays, and applications including MALDI-MS, HPLC D-Tube™ Electroelution Electroelution D-Tube™ Accessory Kit 10 ml 10 2 × 1 ml 3 Components 1 ml Product Features: • • • • Optimized reagents for protein and nucleic acid precipitation following ele nucleic acid precipitation for protein and Optimized reagents D-Tube Novagen • PCR Tools PCR • Novagen Argentina Hong Kong Pakistan Merck Quimica Argentina S.A.I.C. Onwon Trading Limited Merck (Private) Limited Tel: +54 11 4546 8100 Tel: +852 2757 7569 Tel: +92 21 455 9210 Fax: +54 11 4546 7369 Fax: +852 2757 7211 Fax: +92 21 453 5294 E-mail: [email protected] E-mail: [email protected] E-mail: [email protected] www.merck.com.ar www.onwon.com.hk www.merck.com.pk

Australia India Peru Merck Pty. Limited Merck Specialities Private Limited Merck Peruana S.A. Tel: +61 3 9728 7600 Tel: +91 22 6660 9184 Tel: +51 1 6187 500 Fax: +61 3 9728 1351 Tel: +91 22 6660 9000 Fax: +51 1 4372 955 E-mail: [email protected] Fax: +91 22 2495 4590 E-mail: [email protected] www.merck.com.au Fax: +91 22 2495 0307 www.merck.com.pe E-mail: [email protected] Brazil www.merck.co.in Philippines Merck S.A. Merck Inc. Toll Free: 0800 21 9292 Indonesia Tel: +63 2 815 4067 Tel: +55 11 3346 8500 Pt. Merck Tbk. Tel: +63 2 815 4208 Fax: +55 11 3207 5040 Toll Free: 0800 140 1253 Fax: +63 2 815 4882 E-mail: [email protected] Tel: +62 21 841 3889 E-mail: [email protected] www.merck.com.br Fax: +62 21 841 5537 E-mail: [email protected] Singapore Imprint do Brasil Ltda. Merck Pte. Ltd. Tel: +55 19 3772 2900 Israel Customer Hotline: +65 6890 6660 Fax: +55 19 3273 5389 Mercury Scientific & Industrial Tel: +65 6890 6660 E-mail: [email protected] Products Ltd. Fax: +65 6890 6639 www.imprint-corp.com Tel: +972 3 938 7164 E-mail: [email protected] Fax: +972 3 938 7174 www.merck.com.sg Caribbean E-mail: [email protected] Merck, S.A. www.mercury-ltd.co.il South Africa See information under Central America Merck Laboratory Supplies Division Japan Tel: +27 11 345 9000 Central America Merck Ltd. National Contact No. 08600 63725 Merck, S.A. Guatemala Tel: +81 0120 189 390 Fax: +27 11 345 9251 Tel: +50 2 2410 2300 Fax: +81 0120 189 350 E-mail: [email protected] Fax: +50 2 2250 5193 E-mail: [email protected] E-mail: [email protected] www.merck.co.jp Taiwan www.merck.com.gt Merck Ltd. Korea Tel: +886 2 2742 2788 Chile Merck Limited Fax: +886 2 2742 2766 Merck S.A. Tel: +82 2 2185 3836 E-mail: [email protected] Tel: +56 2 3400 000 Tel: +82 2 2185 3840, 3842 www.merckbio.com.tw Fax: +56 2 3400 399 Fax: +82 2 2185 3870 E-mail: [email protected] E-mail: [email protected] Thailand www.merck.cl www.merck.co.kr Merck Ltd. Tel: +66 2 667 8333 China Malaysia Fax: +66 2 667 8338 Merck China Merck Sdn Bhd E-mail: [email protected] Tech Service: 400 820 8872 Tel: +6 03 7494 3688 www.merck.co.th Tel: +86 21 3222 4788 Fax: +6 03 7491 0850 Fax: +86 21 6247 9680 Fax: +6 03 7491 0860 Venezuela E-mail: [email protected] E-mail: [email protected] Merck S.A. www.merck-china.com www.merck.com.my Tel: +58 21 2235 1379 Fax: +58 21 2237 7632 Colombia Mexico E-mail: [email protected] Merck Colombia S.A. Control Técnico Y Representaciones www.merck.com.ve Tel: +57 1 425 4770 Monterrey, Nuevo, León Fax: +57 1 425 5407 Tel: +52 81 8158 0600 Vietnam E-mail: [email protected] Fax: +52 81 8373 2891 Merck Representative Office www.merck.com.co E-mail: [email protected] Tel: +84 8 932 0187 Fax: +84 8 526 0201 Ecuador Mexico City E-mail: [email protected] Merck C.A. Tel: +52 55 5208 5197 Tel: +593 2 298 1677 +52 55 5208 5198 10002722 Fax: +593 2 298 1644 +52 55 5208 8116 PCR Tools 2008 APLA E-mail: [email protected] Fax: +52 55 5203 6229 www.merck.com.ec New Zealand Guatemala Merck Limited Merck S.A. Toll Free: 0800 46 37 25 See information under Central America Tel: +64 06 356 7328 Fax: +64 06 356 7311 E-mail: [email protected] www.merck.co.nz