Journal of Mormon History Vol. 32, No. 3, 2006

Journal of Mormon History

Volume 32 Issue 3 Article 1

2006

Follow this and additional works at: https://digitalcommons.usu.edu/mormonhistory

Part of the Religion Commons

Recommended Citation (2006) "Journal of Mormon History Vol. 32, No. 3, 2006," Journal of Mormon History: Vol. 32 : Iss. 3 , Article 1. Available at: https://digitalcommons.usu.edu/mormonhistory/vol32/iss3/1

This Full Issue is brought to you for free and open access by the Journals at DigitalCommons@USU. It has been accepted for inclusion in Journal of Mormon History by an authorized administrator of DigitalCommons@USU. For more information, please contact [email protected]. Journal of Mormon History Vol. 32, No. 3, 2006

Table of Contents CONTENTS

LETTERS

--Winter Quarters Correction, vii

--Mormon Scholars in the Humanities: Call for Papers, vii

ARTICLES

• --The Bickertonites: Schism and Reunion in a Restoration Church, 1880-1905 Gary R. Entz, 1

• --Mountain Meadows Survivor? A Mitochondrial DNA Examination Ugo A. Perego and Scott R. Woodward, 45

• --Rhetoric and Ritual: A Decade of Woman’s Exponent Death Poetry Kylie Nielson Turley, 54

• --“The Queen of Inventions”: The Sewing Machine Comes to Utah Audrey M. Godfrey, 82

• --“A Simple, Common-Sense Explanation”: Thomas F. O’Dea and the Book of Mormon Howard M. Bahr, 104

• --The Church Follows the Flag: U.S. Foreign Aid, Utah Universities, the LDS Church, and Iran, 1950–64 Jessie L. Embry, 141

• --Mormonism and Guerrillas in Bolivia David Clark Knowlton, 180

REVIEWS

--Duwayne R. Anderson, Farewell to Eden: Coming to Terms with Mormonism and Science Trent D. Stephens, 209

--William E. Evenson and Duane E. Jeffery, Mormonism and Evolution: The Authoritative Statements D. Jeffrey Meldrum, 213

--Kyle R. Walker, ed., United by Faith: The Joseph Sr. and Lucy Mack Smith Family Susan Easton Black, 218

--Devery S. An der son and Gary James Bergera, eds., Joseph Smith’s Quorum of the Anointed, 1842–1845: A Documentary History and Devery S. Anderson and Gary James Bergera, eds., The Nauvoo Endowment Companies, 1845–1846: A Documentary History Roger D. Launius, 220

--Donald R. Moorman with Gene A. Sessions, Camp Floyd and the Mormons: The Utah War William P. MacKinnon, 224

--Patricia Lyn Scott and Linda Thatcher, eds., Women in Utah History: Paradigm or Paradox? Linda Wilcox DeSimone, 232 --Debbie Palmer and Dave Perrin, Keep Sweet: Children of Polygamy; Jenny Jessop Larson, Brainwash to Hogwash: Escaping and Exposing Polygamy; and Kathleen Tracy, The Se cret Story of Polygamy Brian C. Hales, 236

--Susan Easton Black and Andrew C. Skinner, eds., Joseph: Exploring the Life and Ministry of the Prophet John C. Thomas, 244

--Edwin Brown Firmage and Rich ard Collin Mangrum, Zion in the Courts: A Legal History of the Church of Jesus Christ of Latter-day Saints, 1830–1900 John S. Dinger, 246

--John W. Welch, ed., The Worlds of Joseph Smith, A Bicentennial Conference at the Library of Congress Daniel P. Dwyer, 249

--John P. Hatch, ed., Danish Apostle: The Diaries of Anthon H. Lund, 1890–1921 Rich ard D. Ouellette, 251

--Carol Cornwall Madsen, An Advocate for Woman: The Public Life of Emmeline B. Wells, 1870–1920 Claudia L. Bushman, 259

--Anita Cosby Thompson, Stand As a Witness: The Biography of Ardeth Greene Kapp Cherry B. Silver, 264

--Vickie Cleverley Speek, “God Has Made Us a Kingdom”: James Strang and the Midwest Mormons Robin Scott Jensen, 268

BOOK NOTICE

--Rulon T. Burton, By My Own Hand: The Life Story of Rulon T. Burton and Rulon T. Bur on, Missionaries Two, 273

This full issue is available in Journal of Mormon History: https://digitalcommons.usu.edu/mormonhistory/vol32/iss3/ 1

JOUR NAL OF MOR MON HIS TORY

FALL 2006 COVER: Abstrac tion of the win dow trac ery, Salt Lake City Tenth Ward. De- sign by War ren Ar cher.

Arti cles appear ing in this journal are abstracted and in dexed in His tor i cal Ab stracts and Amer ica: His tory and Life, pub lished by ABC-CLIO, and in Re li - gion In dex One: Pe ri od i cals, pub lished by the Amer i can Theo log i cal Li brary As so ci a tion.

Af ter pub li ca tion herein, copy right re verts to au thors ex cept for re printed is sues. Cop ies of ar ti cles in this journal may be made for teach ing and re - search purposes free of charge and with out se curing per mis sion, as per mit - ted by Sec tions 107 and 108 of the United States Copy right Law. For all other purposes, permis sion must be ob tained from the au thor. The Mor- mon His tory As so ci a tion as sumes no re spon si bil ity for con tri bu tors’ state - ments of fact or opinion.

ii Staff of the Jour nal of Mor mon History

Ed i tor: Lavina Field ing An der son Ex ec u tive Com mit tee: Lavina Field ing An der son, Sherilyn Cox Bennion, G. Kevin Jones, Carol Cornwall Madsen, Kahlile B. Mehr, Pa tricia Lyn Scott, William W. Slaughter Edi to rial Staff: Beth Ander son, Robert Briggs, Barry C. Cleve land, Linda Wilcox DeSimone, John S. Dinger, John Hatch, Scarlett M. Lindsay, Linda Lindstrom, H. Michael Marquardt, Murphy S. Mathews, Ste phen R. Moss, Jerilyn Wakefield Ed i to rial Man ager: Pa tricia Lyn Scott In dexer: Mar jo rie New ton Busi ness Man ager: G. Kevin Jones Com pos i tor: Brent Corcoran De signer: Warren Ar cher

Board of Ed itors Polly Aird, Se at tle, Wash ing ton Douglas D. Al der, St. George, Utah Todd Compton, Mountain View, Cal ifor nia Paul M. Edwards, In de pend ence, Mis souri Ken Driggs, Decatur, Georgia B. Carmon Hardy, Or ange, Cal i for nia John C. Thomas, BYU—Idaho, Rexburg, Idaho

Mis sion State ment of the Mor mon His tory As so ci a tion The Mor mon His tory As so ci a tion is an in de pend ent or ga ni za tion ded i cated to the study and under stand ing of all aspects of Mormon history. We wel come all who are in terested in the Mormon past, irre sp ective of reli gious affil i a tion, aca demic trainin g, or world loca - tion. We promote our goals through schol arly research, confer ences, awards, and publi - ca tions. The Journal of Mormon History is published semi-annu ally by the Mormon History As - soci a tion, 581 S. 630 East, Orem, UT 84097, 1- 888-642-3678, {[email protected]}. It is distrib uted to members upon pay ment of annual dues: regu lar member ship: $35; joint/spouse mem ber ship: $45; emer i tus/re tired mem ber ship: $30; stu dent mem bership: $20; in sti tu tional mem ber ship: $45; sus tain ing mem ber ship: $100; pa tron mem bership: $250; do nor member ship: $500. For subscrip tions outside the United States, please add $10 for postage, in U.S. currency, VISA, or Mastercard. Single cop ies $20. Prices on back issues vary; contact Larry and Alene King, exec u tive direc tors, at the address above. The Journal of Mormon History ex ists to foster scholarly research and pub li ca tion in the field of Mormon history. Manuscripts deal ing with all aspects of Mormon history are wel come, in clud ing twen ti eth- and twenty-first-cen tury his tory, re gional and lo cal his tory, women’s his tory, and ethnic/mi nor i ties history. First con sider ation will be given to those that make a strong con tribu tion to knowledge through new in terpre ta tions and/or new infor ma tion. The Board of Edi tors will also con sider the paper’s gen eral inter est, accu - racy, level of inter p reta tion, and liter ary quality. The Journal does not usu ally con sider re- prints or si mul ta neous sub mis sions. Pa pers for consid er ation must be submit ted in trip li cate, typed and double-spaced throughout, includ ing all quota tions. Authors should follow the Chi cago Man ual of Style, 15th edition (see a recent edition of the Journal or style guide at www.mhahome.org) and be prepared to sub mit accepted manuscripts on com puter dis kette or CD, IBM-DOS for- mat preferred. Send manuscripts to the Jour nal of Mormon History, P.O. Box 581068, Salt Lake City, UT 84158-1068.

iii JOURNAL OF MORMON HISTORY VOLUME 32, NO. 3 FALL 2006

CON TENTS

LETTERS Win ter Quar ters Cor rec tion vii

Mormon Scholars in the Human i ties: Call for Papers vii

AR TI CLES The Bickertonites: Schism and Reunion in a Res to ra tion Church, 1880-1905 Gary R. Entz 1

Moun tain Mead ows Sur vi vor? A Mi to chon drial DNA Ex am i na tion Ugo A. Perego and Scott R. Woodward 45

Rheto ric and Rit ual: A De cade of Woman’s Ex po nent Death Po etry Kylie Nielson Turley 54

“The Queen of In ventions”: The Sew ing Ma chine Co mes to Utah Aud rey M. Godfrey 82

“A Simple, Common-Sense Expla nation”: Thomas F. O’Dea and the Book of Mormon Howard M. Bahr 104

The Church Fol lows the Flag: U.S. Foreign Aid, Utah Uni ver si ties, the LDS Church, and Iran, 1950–64 Jessie L. Embry 141

Mor mon ism and Guer ril las in Bolivia Da vid Clark Knowlton 180

RE VIEWS Duwayne R. Ander son, Farewell to Eden: Coming to Terms with Mormon ism and Science Trent D. Stephens 209

iv CONTENTS v

Wil liam E. Evenson and Duane E. Jeffery, Mor mon ism and Evo lu tion: The Au thor i ta tive State ments D. Jeffrey Meldrum 213

Kyle R. Walker, ed., United by Faith: The Jo seph Sr. and Lucy Mack Smith Fam ily Su san Easton Black 218

Devery S. An der son and Gary James Bergera, eds., Jo seph Smith’s Quo rum of the Anointed, 1842–1845: A Doc u men tary His tory and Devery S. An der son and Gary James Bergera, eds., The Nauvoo En dow ment Com pa nies, 1845–1846: A Doc u men tary History Roger D. Launius 220

Donald R. Moorman with Gene A. Sessions, Camp Floyd and the Mor mons: The Utah War Wil liam P. MacKinnon 224

Pa tricia Lyn Scott and Linda Thatcher, eds., Women in Utah His tory: Par adigm or Par adox? Linda Wilcox DeSimone 232

Debbie Palmer and Dave Perrin, Keep Sweet: Children of Polyg amy; Jenny Jessop Larson, Brainwash to Hogwash: Escap ing and Expos ing Po lyg amy; and Kathleen Tracy, The Se cret Story of Polygamy Brian C. Hales 236

Susan Easton Black and Andrew C. Skin ner, eds., Jo seph: Ex plor ing the Life and Minis try of the Prophet John C. Thomas 244

Edwin Brown Firmage and Rich ard Collin Mangrum, Zion in the Courts: A Le gal His tory of the Church of Je sus Christ of Lat ter-day Saints, 1830–1900 John S. Dinger 246

John W. Welch, ed., The Worlds of Jo seph Smith, A Bi cen ten nial Con fer ence at the Library of Con gress Daniel P. Dwyer 249

John P. Hatch, ed., Dan ish Apos tle: The Di a ries of Anthon H. Lund, 1890–1921 Rich ard D. Ouellette 251

Carol Cornwall Madsen, An Advo cate for Woman: The Public Life of Emmeline B. Wells, 1870–1920 Claudia L. Bushman 259 vi The Journal of Mor mon His tory

Anita Cosby Thomp son, Stand As a Wit ness: The Bi og ra phy of Ardeth Greene Kapp Cherry B. Silver 264

Vickie Cleverley Speek, “God Has Made Us a King dom”: James Strang and the Midwest Mor mons Robin Scott Jensen 268

BOOK NO TICE

Rulon T. Bur ton, By My Own Hand: The Life Story of Rulon T. Burton and Rulon T. Burton, Mis sion ar ies Two 273 LETTERS

Lyman Bushman will give the key - Winter Quarters Correc tion note ad dress. In Ed ward L. Kimball and Ken neth MSH in vites pa pers that cover a W. Godfrey’s “Law and Or der at wide range of prac ti cal, the o ret i cal, Win ter Quar ters,” 32, no. 1 (Spring and his tor i cal ques tions re gard ing 2006): 195, the num ber of prob lems the con nec tion be tween faith, in volv ing the stray pen are given as 0 teaching, and research , and that but should be 10; the to tal num ber draw on expe ri ences at a wide of prob lems should be 74 rather range of in sti tu tions of higher ed u - than 75. ca tion. We wish to provide a forum for hu man i ties schol ars that re flects An nounce ment: on the expe rience of Mormon re li - Mor mon Schol ars in the gious practice and its connec tion to Hu man i ties: Call for Pa pers hu man is tic schol ar ship, how the ex- Mor mon Schol ars in the Hu man i ties peri ence of Mormon scholars in the is ded i cated to pro mot ing in tel lec- hu man i ties re lates to his tor i cal and tual and colle gial exchange among con tem porary schol ars of other LDS hu man i ties schol ars in the faiths, and what pros pects ex ist for United States and abroad; foster ing the suc cess ful in te gra tion of faith sup port and mentoring for the pro - and schol ar ship. Pro posed top ics duc tion of su pe rior schol ar ship in all may include: hu man is tic dis ci plines; pro vid ing a 1. Schol ar ship: Is there a Mormon fo rum for ex change that ex plores foun da tion to hu man is tic in quiry? and strength ens LDS val ues, espe - What role does Mormon belief play cially as they relate to hu man is tic in - in the practice of scholar ship, espe - quiry; and assist ing mem bers in the cially about top ics far afield from suc cess ful in te gra tion of the in tel lec - Mor mon ex pe ri ence? What is the tual and spiri tual as pects of their Mor mon re spon si bil ity to ward sec- lives. u lar, cul tural, and in tel lec tual It will spon sor its first sym po sium knowl edge? How does one ap- from the Brigham Young Univer sity proach the life styles, be lief sys tems, Col lege of Hu man i ties, “Mor mon and val ues that hu man is tic schol ar - Be lief, Scholar ship, and the Hu man - ship an a lyzes when these con flict i ties,” on March 23–24, 2007, at BYU with those of the Mormon faith? to ex plore the re la tion ship be tween 2. Reli gious Human ism, Past and Mormon belief and the practice of Present: What exam ples from the hu man is tic schol ar ship. Rich ard past dem on strate the suc cess ful in -

vii viii The Journal of Mor mon His tory te gra tion of faith and scholar ship? Handley (George_Handley@byu. What exam ples from other reli gious edu) by De cem ber 15, 2006. In- and cul tural con texts to day pro vide clude a two-page CV. We also wel - in sight ful com par a tive con texts for come en tire panel pro pos als, work - the sympo sium’s themes? What val - shop ideas, or other proposed for- ues ought the human i ties es pouse in mats. All partic i pants must be light of Mormon belief? To what de- members of MSH ($10 annu ally) at gree is sec u lar hu man ism com pat i - the time of the sym po sium. ble with re li gious hu man ism? Where The or ga ni za tion will man age a must they part ways? mem ber website, which will pro - 3. Ped a gogy:What is the rela tion - vide a data base of members, their ship between schol arship and teach- schol arly in ter ests, and pro fes- ing? What role does Mormon belief sional lo ca tions; a venue for query - play in teaching mostly non-LDS stu - ing fel low schol ars how LDS views dents or mostly LDS stu dents? may op er ate in schol arly, ped a gog i - Which as pects of teaching are par tic- cal, and intel lec tual inqui rie s; infor - u larly chal leng ing and re ward ing? Is mal meetings at major profes sional there a Mor mon ped a gogy in the hu- con fer ences; a news let ter posted on man i ties? What are the ul ti mate website and printable in hard-copy aims of teach ing the human i ties and how do those aims relate to spiri tual to members; a mentoring program and in tel lec tual de vel op ment? for ju nior scholars; and confer ence 4. In tel lec tual and Pro fes sional De - spon sor ship. vel op ment:What road maps exist for MSH’s primary purpose is to fa- those pur su ing schol ar ship in the cil i tate con tact among LDS schol - hu man i ties? What ad vice can be ars in all hu man is tic dis ci plines, not given to fu ture Ph.D.s? How does to provide a special ized forum for one bal ance the ex pec ta tions of a hu - schol ar ship on Mor mon cul ture manis tic scholar with the expec ta - and history. LDS member ship is tions of an ac tive LDS Church mem - not re quired. Mem ber ship in for- ber? ma tion and addi tional MHS in for- Please sub mit pa per pro pos als ma tion is available at http://www. (no longer than one page) to George mormonscholars.org/. THE BICKERTONITES: SCHISM AND RE UNION IN A RES TO RA TION CHURCH, 1880–1905

Gary R. Entz

IN THEIR STUDY OF DIFFER ING Mor mon fact ions that have emerged since the death of Joseph Smith Jr., his tor ians Roger D. Launius and Linda Thatcher ar gue that “dissen t has been a sig nif ican t force in the church and a dy namic that has con tin ued througho ut the movemen t’s hist ory.”1* The dy namic of dissen t was par ticu larl y ap par ent in a small group of Mor mons known as the Church of Jesus Christ (Bickertonite). The fol low ers of Wil liam Bickerton were in troduced to Mor mon ism through Sid ney Rigdon’s Pennsyl - va nia church in 1845 but broke away in 1846 to form their own or ga ni za tion, first in Penn syl va nia and even tu ally in Kan sas. While Wil liam Bickerton’s church was born of dissen t and expe r i - enced disag ree ment througho ut its for mat ive years, it was aft er attempt ing to found a “stake of Zion” in Kansa s in 1875 that the Bickertonites ex pe ri enced their most se ri ous in ter nal re bel lion and came fully at odds with the Utah Church of Je sus Christ of Latt er-day Saints (LDS). What fol lows is not a compr e hensiv e his-

* GARY R. ENTZ {[email protected]} is an asso ci ate pro fessor of hist ory, McPherson Col lege, in McPherson, Kansa s. He is the aut hor of “Zion Val ley: The Mor mon Or i gins of St. John, Kan sas,” Kan sas His tory: A Jour nal of the Centr al Plains 24 (Sum mer 2001): 98–117; and “Rel i gion in Kan sas,” Kan sas Histor y: A Jour nal of the Centr al Plains 28 (Sum mer 2005): 120–45. 1Roger D. Launius and Linda Thatcher, Diff ering Vision s: Disse nters in Mor mon His tory (Ur bana: Uni versit y of Il li nois Press, 1994), 11.

1 2 The Journal of Mor mon His tory

Wil liam Bickerton, ca. 1903 (1815–1904), founder of the Church of Je sus Christ of Lat - ter Day Saints (Bickertonite). Courtesy Alex an der Robin son, presid ing el der, Church of Je- sus Christ (Bickertonite), St. John, Kansas.

tory of the Bickertonite Church. Rather it is a study of Wil liam Bickerton in Kansa s and the conf licts he faced within his own church and with the LDS Church. Born in 1815 to a working-cla ss Method ist fami ly in North- umberland, England, Wil liam Bickerton immi grated with his mother and sib lings in 1832 to the United States. Set tling in the area of Monongahela, Pennsyl va nia, Bickerton found work as a coal miner and even tua lly became a mine fore man. In April 1845, almos t a year aft er Jo seph Smith’s death, Bickerton and his wife, Doratha, went to hear the fol low ers of Sidney Rigdon preach in Limetown, Pennsyl va - nia. It was a life-alt er ing expe r ience for Bickerton, who came away from the meet ing con vinced that Rigdon “had the power of God.” Ac - cord ing to later acco unts, he was bapt ized by Elder John Frazier and became a member of Rigdon’s Church of Christ. It was a short-lived un ion be cause Bickerton dis agreed with Rigdon’s 1846 dec ision to relo cat e the church in Pennsyl va n ia’s Cumber land Valley near Greencastle. Feel ing “through the spirit that he was going wrong,” Bickerton sev ered his af fil i a tion with Rigdon.2** A small group of neophy tes coa lesced around Bickerton to

** 2Gary R. Entz, “Zion Val ley: The Mor mon Or i gins of St. John, Kan - sas,” Kan sas His tory 24 (Sum mer 2001): 100; J. S. Weeks, “A Lett er,” St. John GARY R. ENTZ/THE BICKERTONITES 3 study the Book of Mor mon, and in 1849 a con vert named Charles Brown pred icted that Bickerton “was to be a prophet to lead this peo - ple.” In 1851 Bickerton made a ten uo us af fil ia t ion with the Utah-based Church of Jesus Christ of Latt er-day Saints but stood firmly against pol yg amy. As a re sult he sev ered his con nect ion with the Utah Saints in 1852 aft er learn ing of Brigham Young’s pend ing ac- knowledg e ment of plur al mar riage. Aft er this point Bickerton expe r i - enced sev eral epipha n ies that conf irmed his call ing and he beg an ac- tively preaching from the Book of Mor mon. He learned of his of fic ial excom m un ica t ion from Elder Sam uel Wooley of the LDS Church in 1857, but it did not matt er to Bickerton or his fol low ers. In 1859 a re - ve lat ory expe r ience gave them con fir mat ion that God had “raised up ano ther like unto Jo seph . . . and now I have called forth my ser vant Wil liam Bickerton to lead forth my people. ” Wil liam Bickerton’s Church of Jesus Christ (Bickertonite) was for mally or gan ized in 1862 and incor por ated in 1865 at Pittsbur gh.3*** Almos t all member s of the Church dur ing its for mat ive years in Pennsyl va nia were English im mi - grants with whom Bickerton had worked in the mines or whom he had met through his preaching. To my knowledg e, none of his fol low - ers had been with Joseph Smith at Nauvoo. Bickerton in ter preted the beg inn ing of the Civil War as conf ir - mat ion that he was “liv ing in the gener at ion when the judge ments of God will be poured out as spo ken of by our Sav iour.” The group be - lieved in the rest or at ion of Isr ael and that “God will use man as his in- stru ments for its accom plish ments in these last days.” They also held that the “ab orig ines or Ind ians upon this con tinen t are a part of Is-

Sun, Au gust 4, 1887, 3, iden ti fied “El der Frazier” as hav ing per formed the bap tism. This was prob a bly John Frazier, one of Rigdon’s counc il ors. Rich- ard S. Van Wag oner, Sid ney Rigdon: A Por trait of Re li gious Ex cess (Salt Lake City: Sig na ture Books, 1994), 385. Bickerton’s first wife, Doratha, died in 1862 and he mar ried his sec ond wife, Charlo tte Hibbs, the next year. *** 3Gary R. Entz, “Zion Val ley: The Mor mon Or i gins of St. John, Kan - sas,” Kan sas His tory 24 (Sum mer 2001): 100–102; Wil liam Bickerton, “Test i - mony, June 1903,” 9, Church of Je sus Christ, St. John, Kansa s; “Rev ela tion of W. W. Wagoner , Decem ber 11, 1859,” in Wil liam Ba con, A Book of Recor d of the Rev e lation s given unto the Church of Je sus Christ of Lat ter day Saints (N.p.: Church of Je sus Christ, n.d.), 11. Im portant Bickertonite sites in western Penn syl va nia, ca. 1880s. Map by Gary R. Entz.

4 GARY R. ENTZ/THE BICKERTONITES 5 rael.”4****As such it was cruc ial to deliv er the re stored gospel embod ied in the Book of Mor mon to the Ind ian na tions; and in No vem ber 1861, an in ter pre tat ion of a messag e deliv ered through the gift of tongues re - vealed: “Thus saith the Lord I will pur ify my Church and my Ser vants shall go and preach the Gospel to the Ind ians of Amer ica.” This was a charge Bickerton took ser io usly, but the Civil War largely con fined the group’s early pros e ly tiz ing ef forts to Penn syl va nia and West Vir ginia.5+ Aft er the war ended, Bickerton renew ed his calls to embar k upon a mission to the Ind ian peo ples and, in April 1868, report ed a vision conf irm ing that “the time has come that sal va tion shall go to the Lamanites.”6++To ful fill this mission, Bickerton called one of his conv erts to accom pan y him, thirty-four-year-old Wil liam Cadman, who became impor tant in this con flict. Born in England in 1834, Cadman and his wife, Eliz abet h (sur name not known), immi grated to the United States in 1856. Cadman heard about Mor mon ism in a tav - ern con versa t ion, then heard Bickerton preach in the sum mer of 1859. The two men con tin ued meet ing, un til Cadman accept ed baptism in Decem ber 1859. With ano ther el der, Benjamin Meadowcroft, Bickerton and Cadman trav eled to Ind ian Ter rit ory in presen t-day Oklahoma in Sept em ber and spent a month meet ing with lead ers of the Cher ok ee Nat ion and min ist er ing to the Ind ian peo ples. The mission had mixed re sults. Cadman had embar ked upon the mission pre dict ing that the outcome “would be fruit less” and saw no rea son to alt er his opin ion. Bickerton, on the other hand, un derstood that this mission repr e sented only a first step and was commit - ted to con tin uing the mission. He joined this com mitmen t with the doctr ine of the gather ing and, in 1872, be gan urg ing his fol low ers to est ablish a Stake of Zion near Ind ian Ter rit ory.7+++ Bickerton took ano ther step to ward the Stake of Zion by or gan izing a com mitt ee to study the matt er. How ever, at this point in 1872,

**** 4Entz, “Zion Val ley,” 102; The En sign: or a Light to Lighten the Gentiles (Pitts burgh: Ferg u son and Co., 1863), 11–12; type script copy made by Bob Wat son, church hist o rian for the Church of Je sus Christ (Bickertonite), and given to Da vid Clark, who do nated the type script in No vem ber 1986 to the Commu n ity of Christ Libr ary-Archiv es. + 5Wil liam H. Cadman, A Histor y of the Church of Je sus Christ (Monongahela, Pa.: Church of Je sus Christ, 1945), 32. ++ 6Ibid., 50. +++ 7Ibid., 54, 64; Entz, “Zion Val ley,” 102–3. 6 The Journal of Mor mon His tory some members beg an to quest ion his rev ela t ions. George Barnes had been with the Bickertonites as early as 1851, had been recog nized as a prophet in the Church since 1863, and headed a con greg at ion in Coal Val ley, Pennsyl va nia. He became unea sy about Bickerton’s visions for an Ind ian mission and Stake of Zion in the West. Accor d ing to Cadman’s hist ory, Barnes arg ued that it was the “false rev ela t ions given to the church in its rise”—mean ing ear lier doubts about the va - lid ity of Bickerton’s rev ela t ions—“which had caused him to stumble. He con tended that our rev ela t ions were im per fect, and that we ought to hear the voice of God.”8++++Because Barnes had def ied church aut hor - ity and could not be recon c iled, Bickerton had no choice but to “sepa - rate from the Church” (ex comm un icat e) Barnes and his fol low ers. Barnes be came the leader of his own Mor mon sect and remained in- depend en t, but out of Bickerton’s sight, for the next ten years.9* In 1874 Bickerton had a rev ela t ory expe r ience showing him that the gather ing was to take place in Stafford County, Kan sas, near the bor ders of Ind ian Ter rit ory. Bickerton felt his vision conf irmed in late 1874 when, on a scout ing mission to west ern Kan sas, he drove a symbolic “stake of Zion” into the ground of his futur e colon y. He re - turned to Penn syl va nia and, over com ing op po si tion voices, or ga- nized a group of bet ween thirty-five and forty fami lies and led the col - ony that es tablished Zion Val ley, Kan sas, in April 1875.10**Ini tially the colon y suf fered tre mendo usly from the ele ments and from dissen t ing Saints who re mained be hind in Pennsyl va nia. Bickerton per sev ered, dissen t ers were purged, and the colon y became a success. How ever, while his fol low ers openly endor sed the doctr ine of the gather ing, many chose to re main behind in Pennsyl va nia. The re sult was a di - vided church with Zion Val ley be coming head quar ters of the west ern branch and West Elizabeth, Pennsylvania, becoming headquarters for

++++ 8Cadman, A Histor y of the Church of Je sus Christ, 66. Cadman ref ers to Barnes’s church as the “Rock Run Branch.” * 9Ibid. ** 10Al though exact mem bership fig ures are not known, Wil liam Bickerton is quoted in St. John County Cap ital, No vem ber 14, 1889, as saying that “five wag ons landed here April 3, 75 others came by RR oxen ar rived on the 17th May, each had two men and a yoke of oxen.” Appar ently a group of ten men came overland from Wil son County, Kan sas, in early April and made ar rangemen ts for the remain ing fami lies who ar rived via rail road con nec tion in Great Bend. Wil liam Cadman, leader of an im por tant Bickertonite schism in Kan sas.

7 8 The Journal of Mor mon His tory

Stafford County, Kan sas, where an im por tant Bickertonite col ony was es tab - lished at Zion Val ley, later renamed St. John. Map by Gary R. Entz. the eastern branch. Within a few years, Zion Val ley’s prosper ity attr acted enough other sett lers that it lost its iden tity as a reli gious colon y. In 1879 Zion Val ley reor gan ized as the secu lar town of St. John and won the batt le to become Stafford County’s seat. Bickerton had planned all along for Zion Val ley to be a base from which he could dispatch mission ar ies into Ind ian Ter rit ory and the sec ular izat ion of the town made lit tle dif fer ence to his goals. How ever, secu lar izing Zion Val ley was anath - ema to others. Wil liam Cadman, who presided over the east ern branch, was ada man t that the colon y “was the place of the gather ing; and that the Saints should gather to it, and none but the Saints, and GARY R. ENTZ/THE BICKERTONITES 9 that there should be no specu la t ion there, and that it was a spir itua l gath er ing and not a tem po ral gath er ing.”11***Wil liam Bickerton had over come op posi t ion and dissent before and gave little heed to Cadman’s strictures. As the year 1880 opened, Bickerton, who turned sixty-five that year, retur ned to his orig ina l mission and beg an mak ing ar range - ments to use the Church’s ann ual summer con fer ence as a launching point for send ing mission ar ies to Ind ian Ter rit ory. What he did not suspect was that his most dif ficult trial in the West had yet to begin. In the spring of 1880, Wil liam Bickerton, accom pa n ied by forty-two-year-old James Tay lor, a farmer, and Tay lor’s twenty- nine-year-old wife, Tryphena Single t on Taylor , spent three weeks visit ing the home of ev ery Saint in Stafford County, asking them to con - firm their com mitmen t to support God’s mission to the Lamanites. How ever, in April, plans for that mis sion hit an un expect ed snag when Taylor sud denly broke from Bickerton and accused the prophet, ei ther in a Church meet ing or in a sett ing in which Church mem bers rapidl y learned about it, of “causing a sepa r at ion in his fami ly,” mean ing that he suspect ed his wife and Bickerton of adul - tery.12****The ac cu sa tion re vived old fac tions and po lar ized Church mem ber ship. Bickerton was mor ti fied.

*** 11Entz, “Zion Val ley,” 103–17; Cadman, A His tory of the Church of Je sus Christ, 75. **** 12The Taylors, orig i nally from Ten nes see, had moved to Wil son County, Kan sas, near Par sons, and con verted to the Bickertonite Church in 1873 with sev eral other lo cal resi dents when John Stevenson, a Bickertonite mission ar y, demon strated the spir itua l gift of heal ing in the area. The Taylors, who had two daugh ters, were among the orig i nal 1875 Zion Val ley set tlers. Be tween 1875 and 1879, as Bickerton later reca lled, “Mrs. Taylor was taken very sick with lung fev er, so there seemed no chance of her liv ing and she gave up all hope. She bade her husband and all the brothers and sis - ters farew ell and told them what to do with the chil dren. I went to the edge of the creek and felt by the spirit of God that she would be healed. I came up to the house and found all stand ing around her bed. I asked her if she had faith in Christ, and she said yes; I took her by the hand and commanded her to arise and be made whole. She arose and went through the house glo ri fying God, and from that time was healed.” “Bickerton’s Let ter,” St. John County Cap i tal, No vem ber 14, 1889, 1. The orig i nal let ter used com mas througho ut inst ead of per iods. I have silen tly subst itut ed per iods. If 10 The Journal of Mor mon His tory

In 1875, as Zion Val ley was being founded, Eli Kenda ll, George Baker, and other Saints who even tua lly mig rated to Kansa s from the West Vir ginia branch of the church had ex pressed reser va tions about Bickerton’s prophe c ies for a west ern branch. Now in 1880 they be - lieved that their doubts were conf irmed and gave im me diat e cre - dence to Taylor ’s complain t. In early May, Kenda ll led a dis sent ing bloc that att empted to suspend Wil liam Bickerton from all priv i leges within the church. Bickerton pro tested that he was inno cen t and de- nied that Kenda ll had any aut hor ity to displace him from his leader - ship po sit ions. Accor d ingly, Bickerton along with Counsel ors Charles Brown and Art hur Bickerton, Wil liam’s brother, proceeded with business as usual and declar ed that the scheduled July con fer ence would take place as init ially planned.13+ Wil liam Cadman, who presided from Pennsyl va nia over the east ern branch of the church, had anno unced in April that he would att end the summer con fer ence in St. John. This was Cadman’s first trip to the west ern branch and the site of the for mer Zion Val ley col- ony. It may have been sheer hap penstance that his visit coin c ided with Taylor’s ac cu sa tions, but Cadman condoned the charges and sup - ported Kenda ll’s act ions in strip ping Bickerton of his of fice. In June Cadman dir ected Kenda ll’s fact ion to speak with Bickerton in an attempt to per suade the Church presi den t to repen t of his al leged sins. Kenda ll, accom pa n ied by Elder John McKewan, a forty-four-year-old farmer, orig ina lly from Ireland, and Elder Sam Campbel l, a forty-three-year-old farmer,14++fol lowed through with Cadman’s re - quest and met with Bickerton. How ever, Kenda ll and his col leagues

Tryphena Taylor was a true be liever, which she seems to have been, then she had rea son to be grateful and sol ic it ous to ward Wil liam Bickerton. That may have been enough to spark feel ings of jeal ousy from James Taylor . + 13Cadman, A Histor y of the Church of Je sus Christ, 77; Wil liam Bickerton, “Con fer ence,” St. John Ad vance, June 19, 1880, 2; “Con fer ence,” St. John Ad vance, June 26, 1880, 3; J. S. Weeks, “St. John, Kas., Aug. 13th, 1887,” St. John County Cap ital, Au gust 18, 1887, 4. No one ac cused Bickerton of any thing other than an adul ter ous af fair. There is no ev i dence sug gest ing that Bickerton, like Joseph Smith in Nauvoo, was com menc ing clan dest ine plu ral mar riage. How ever, if he were, it never ad vanced be yond this sin gle in ci dent. ++ 14Campbel l, along with Eli Kenda ll, had been a member of the Church’s West Vir ginia branch at Wheeling, where he was a coal miner. He GARY R. ENTZ/THE BICKERTONITES 11 had pre conceiv ed no tions of Bickerton’s guilt and were unwi ll ing to openly discuss the issue. Bickerton would not conf ess to what he held were false al leg at ions so Kenda ll’s group walked away with out reaching an ac cord. Aft er his en coun ter with Bickerton, Kenda ll proclaimed, “We, being of ficers of the church and appoin ted by the church to see them, we did so, and they are not rec onc iled.”15+++Nev er - theless, since the Saints who had mig rated to Kansa s from Pennsyl va - nia held a major ity of the member ship and con tin ued to support their president, Bickerton felt confident in proceeding with the July 4 conference as scheduled. Tay lor’s ac cu sa tions ef fec tively di vided the Church, which left Bickerton and Cadman to preside over ri val July con fer ences in St. John. Bickerton ig nored his adv ersar ies and used his assem bl y to ar - range for mission ar ies to depart for In dian Ter rit ory.16++++Cadman, on the other hand, made the disag reemen t the whole agenda for his confer ence, deno unced Bickerton, and assert ed his own presi denc y over the en tire Church. Up to this point, the accu sa t ions of adul tery had largely remained an in ter nal Church af fair; but to leg it imat e his own aut hor ity, Cadman issued a public no tice of the con tro versy’s full par - ticu lars. He charged that Bickerton had “willful ly and knowingl y walked in such a way as has brought a di vi sion in the fam ily of Brother James Taylor , also a dis grace upon the fam ily, also a re proach upon the church of Jesus Christ and a distur bance among the Saints.” St. John’s sec ular af fairs and focus on gain ing the county seat had seem- ingly taken pre ce dence over the spir itua l concer ns of the old Zion Val ley colon y, and this displea sed Cadman. He also ac cused Bickerton of “walking in such a way that you have put a hin drance in the way of the work of God in this place, and have caused some of the Saints to err and some to do things causing their sepa r at ion from the church.” Cadman’s chief concer n was the fact that most of the Kansa s Saints faithful ly stood behind their prophet de spite Cadman’s claims of hav ing “disr obed” Bickerton “of all pow ers and of fices of the Church of Jesus Christ” and excluded him from par tic ipa t ion in Church af fairs. How ever, because many of the Saints re fused to coun - and his wife, Ra chel, age thirty-eight, had a young son and daught er. +++ 15Eli Kenda ll, John McKewan, and Sam Campbel l, “St. John, June 22, 1880,” St. John Ad vance, June 26, 1880, 3. ++++ 16The mission ar ies Bickerton select ed to travel to In dian Ter rit ory included him self, Samuel Work, and Silas Busby. 12 The Journal of Mor mon His tory te nance the charges, Cadman called for a public meet ing in St. John at which both sides could air their griev ances.17* No one expr essed any con cern for Tryphena Taylor ’s version of events, and she appar ently left no re cord of it. From Bickerton’s perspec t ive, there was nothing to ask, while Cadman was in ter ested in litt le bey ond vali dat ing her husban d’s alle g at ions. Howev er, Cadman’s public con demna t ion of Bickerton incensed the Saints who re mained faithful to their prophet and enco ur aged them to rally in his sup port. Rober t Card well and Duncan Bell18**openly an- nounced, “We can test ify that we have known Wil liam Bickerton for a per iod of ten years. We have never known him to say an ill-beg ott en word to any lady and wher ever he went to preach the gospel he always found fa vor with the people, both men and women and aided the church accor d ingly.” These men felt that it was inap pr opr iat e and un seemly to pub li cize in ter nal church disput es. They con- demned Cadman for overst epping his aut hor ity but sim ult aneo usly wanted ev ery one to know that they main tained open minds and were will ing to list en to all opin ions: “We are not prepar ed to say which side is right,” the pair concluded, “but if there is a spark of hon esty left with eit her side the Lord will prosper them and bring them to the front.” Despit e their objec t iv ity, Cardw ell and Bell feared that, if Cadman had the temer ity to per sist in his goal of a public de bate, no one could pred ict where the div ision might end.19*** Ig nor ing these appea ls to let God dec ide the truth, Cadman proceeded with a pub lic in quiry. On July 15 loca l cit izens Wil liam R. Hoole and Frank Cox, who had no af fil i at ion with the Church,

* 17Wil liam Cadman Sr., “No tice,” St. John Ad vance, July 10, 1880, 3. ** 18Cardw ell, orig ina lly from Ireland, was a forty-two-year-old farmer who had been a coal miner be fore relo cat ing to Kan sas. A Bickertonite elder, he was mar ried to thirty-four-year-old Eliza Bickerton, Wil liam and Doratha Bickerton’s daugh ter, and the cou ple had three chil dren. The 1880 fed eral cen sus shows Wil liam as a boarder in the Card well home. Even without the fam ily connec tion, this would not be un usual, since Char lotte dis - liked Kansa s and came only for visit s, so Bickerton oft en lived with his con- greg ants. Duncan Bell, also an el der and a for mer coal miner, was a thirty-year-old farmer, orig ina lly from Scot land. He and his wife, Jane, age twenty-five, were the par ents of a son and a daugh ter. *** 19Rob ert Card well and Duncan Bell, “Ed. Ad vance,” St. John Ad vance, July 17, 1880, 3. GARY R. ENTZ/THE BICKERTONITES 13 agreed to pre side as chair man and sec re tary re spect ively at an inf or - mal inv est ig at ion. Cadman assumed the role of prose cu t or. Bickerton dis missed Cadman’s den unc ia t ions and re fused to att end lest his par tic i pa tion lend cred i bil ity to the pro ceed ings, al though a number of his sup port ers were presen t. Nev er theless, the “grave and ser io us charges that had been prefered [sic] against the head of the Mor mon church” cre ated a pub lic sen sat ion in St. John, and the inq uest went for ward as if in a true court of law. Cadman called twenty witnesses, all of whom were loca l resi den ts who lived near Bickerton’s home.20**** Aft er eight hours of quest ion ing, peo ple with Church af fil ia - tions were asked to re tire and the case was turned over to a jury of “dis in ter ested” cit i zens for de lib er a tion. The mem bers of this ad hoc jury spent thirty min utes consid er ing the charges bef ore reaching a ver dict. They dec ided: “we do not believ e that Wm. Bickerton and Mrs. James Taylor have been guilty of any crim ina l in timac y.” While this dec ision fa vored Bickerton, the jury added a reser va tion: “We do believ e that said Wil liam Bickerton has acted in such a manner as to cause a di vision of the fami ly of James Taylor , and dis turb the soc iet y in this neigh bor hood.” Al lowing a jury of out siders to dec ide an in ter - nal Church issue was indel icat e under any cir cumstances and certainly not part of of fic ial Church doctr ine. Despit e the split de cision, Wil liam Cadman found the pub lic dismissa l of the adul tery charges against Bickerton un ac cept able. He im me di ately re turned home to shore up his support in Pennsyl va nia; and at a late July con fer ence held in West Eliz a beth, Penn syl va nia, Cadman for mally sep a rated Bickerton and his fol low ers from the east ern branch of the church and den ied the aut hor ity of Bickerton’s July 4 conf er ence in St. John. Forty-four-year-old Eliz a beth Cadman there upon spoke in tongues saying, “Ver ily, ver ily, they are reject ed of me, saith the God of

**** 20Al though these pro ceed ings took a leg al form, it is not clear whether the witnesses tes ti fied un der oath. The Church’s dec la ra tion of “Faith and Doctr ines” claimed the right to “deal with its members . . . on dis- or derly conduct, or the vi o la tion of the com mand ments” but its rem ed ies were only excom mun ica tion and withdr awn fel lowship, not “life or limb,” prop erty, or “any physi cal pun ish ment.” The in quiry was stretching this def i ni tion by in clud ing non-mem bers as wit nesses, but oth er wise re mained within its own rules. 14 The Journal of Mor mon His tory

Heaven.”21+ While Cadman had been conduct ing his tri buna l in Pennsyl va - nia, Bickerton had been shor ing up his own support among the Saints in Kan sas with a conf er ence. Charles Brown22++ led the gather ing and in - formed the group that he “had known Wm. Bickerton for thirty years [and] had never heard any thing of an immor al char act er coming from him dur ing that per iod.” The Church presi den t, said Brown, had always beha ved as bef itt ing “the head of a Christ ian church, and we are sat isf ied that charges like these coming from such a source, must fall to the ground.” Brown compar ed Cadman’s att empt to disr obe Bickerton to the pun ishmen ts lev ied against Christ and asked rhet or ica lly: “Is it any wonder that leaders should be the vic tims of unwar ranted perse cu - tion in these latt er days, when we are to believ e strange things must happen. ” Dur ing the three-day Church con fer ence focused on the ac- cusa t ions, Bickerton called four witnesses who cor robo r ated his state - ment of in nocence against charges of adult ery. As to the den unc ia t ion that he had brought re proach upon the church, Bickerton re sponded that he “had lived in this lo cal ity for six years and . . . no one could be found to test ify of conduct re flect ing upon him. Such being the case, wherein could the church be dis graced[?]” The group agreed that, since compe t ent witnesses were lacking, only div ine rev e lat ion could prove or dis prove the al leg at ions. In this case, “the vote stood two for, and two against. The first two by a ma jor - ity with out any man if est at ion of the power of God, and the next two in his fa vor, the power of God came down and test if ied he was jus ti -

+ 21Frank Cox and W. R. Hoole, “Ed. Ad vance,” St. John Ad vance, July 24, 1880, 3; Cadman, A His tory of the Church of Je sus Christ, 78. Be lief in the New Test a ment spir i tual gifts was part of the Church’s dec la ra tion of “Faith and Doc trines,” and Cadman’s book is replete with ref er ences to var i ous Church mem bers speak ing in tongues. ++ 22Prob a bly Bickerton’s most loyal fol lower, in 1880 Brown, a for mer coal miner in Pennsyl va nia, was a fifty-seven-year-old Kansa s farmer. He and his wife, Jane, age fifty-one, had three sons and three daugh ters. Brown had joined Bickerton’s church in 1851 and served as Bickerton’s first coun - selor un til Brown’s death in 1887. (J. S. Weeks replaced him.) Brown made frequen t mis sion trips to In dian Ter ri tory and never quest ioned Bickerton’s au thor ity over the Church. GARY R. ENTZ/THE BICKERTONITES 15 fied.”23+++Because Bickerton and his counsel ors under st ood that they had receiv ed their “call ing into the church from God,” they refused to recog nize Cadman’s aut hor ity to disr obe them “of an ear nest labor in the field of christ ian ity for thirty-five years, upon such flimsy charges, and com ing from such ung odly Christ ians.” In con clud ing the delib - er a tions they at trib uted the in dict ment to “jeal ousy cor rod ing ev ery thought and blast ing all love’s par a dise.”24++++ Alt hough lo cal resi den ts in Kan sas had declar ed Wil liam Bickerton in nocen t of adult ery, their per cept ion of the distur bance among the Saints had be come a very real bur den. A disag ree ment that had started as a fam ily dis pute be tween James and Tryphena Tay- lor esca lated into a conf lict that po lar ized fam i lies and div ided the Church in Pennsyl va nia from that in Kansa s.25*Bickerton presided over the Zion Val ley Church in St. John, Kansa s, and a small fact ion of loyal support ers in Pennsyl va nia, while Cadman presided over the

+++ 23There was no “vote” in the con ven tional sense. Rather, it seems that Church mem bers would go into an in tense prayer group un til one or more mem bers be gan speak ing in tongues, which would be con sid ered a “vote” from God. Cadman’s book con tains many desc ript ions of simi lar meet ings. In this case, two peo ple spoke against Bickerton, but the group dec ided that the “power of God” had not been be stowed upon them (they had not truly receiv ed the gift of tongues) and their vote was rejected. The two speak ing in fa vor of Bickerton were deemed to have the le git i mate power of God, so their vote was ac cepted. Since no one else at the meet ing receiv ed the gift of tongues, no other “votes” were recor ded. ++++ 24“Wm. Bickerton’s An swer,” St. John Ad vance, July 24, 1880, 3. Bickerton’s refusa l to ac cept any out side judg ment upon him ac corded with his bel ief sys tem, and in this he was uncom pro mising. To ward the end of his life he wrote, “I do not bel ieve in sect ar ian in ter pret a tion. God’s way is per - fect.” Bickerton, “Test i mony, June 1903,” 5. * 25Wil liam Bickerton’s second wife, Char lotte, said nothing publ icly dur ing the con tro versy; but in Aug ust 1880 she sued Bickerton for di vorce (grounds not recor ded). The Bickertons may have had mar i tal prob lems pre dat ing the adul tery ac cu sa tion since Bickerton, “Tes ti mony, June 1903,” 12, stated that, when he orig i nally moved to Kan sas in 1875, he turned over the deed of the meet ing house in West Eliz a beth, Penn sylva nia, to the Church “so my wife could not take any ad van tage of the Church House.” James and Tryphena’s dis pute con tinued with no fur ther ref er ence to Bickerton, con clud ing in Tryphena’s scan dal ous 1882 civil di vorce of James (again, grounds not recor ded). Wil liam Bickerton v. Char lotte Bickerton, Case 16 The Journal of Mor mon His tory main body of the Church from West Eliza bet h, Pennsyl va nia, while main tain ing a small fact ion of loyal support ers in Kansa s. Since nei- ther side sought rec onc il ia t ion, the batt le focused on con trol of the meet ingho use in St. John. Cadman’s group sued in the Ninth Jud ic ial Dis trict Court for posses sion of the sanctu ar y. Bickerton support er Ja- cob Beitler, a fifty-seven-year-old farmer in St. John, who had advanced the Church a large share of the con struc tion costs, called in his loan in Aug ust 1880.26** A meag er har vest re sult ing from a drought dur ing the pre vio us sea son had left most of the Saints in debt. Neit her group had enough money to re tire the mortg age, so the court or dered the build ing sold at a sher iff’s auct ion on No vem ber 3, 1880. Beitler took persona l pos- session of the build ing at the auct ion and anno unced plans to move it to a Main Street loca t ion closer to the town’s cen tral square. Orig i - nally con structed in 1878, it was a simple wooden-frame struc ture mea sur ing 32x50 feet and 14 feet high. He moved it in early April 1881, but because he re tained a loy alty to Bickerton, Bickerton’s group con tin ued to worship there, even though it was now pri vately owned.27*** In April 1881 Bickerton held a pub lic con fer ence in St. John in which he lectur ed the townsf olk on his or gan iza t ion and how he be -

No. 22 (Aug ust 27, 1880), Stafford County, Ninth Ju di cial Distr ict Court, Civil Trial Docket, Vol. A, 1880–88, Libr ary and Ar chives Div i sion, Kan sas State Hist or i cal So ci ety, To peka. See also “Town and Coun try,” St. John Ad - vance, Decem ber 28, 1882, 3, which com ments on res i dents at tend ing the di vorce pro ceed ings for their en ter tain ment value. The court gave cust ody of the two Tay lor chil dren to Tryphena’s brother, Adolphus Sin gle ton. ** 26Beitler, a Ger man immi g rant, and his wife, Catherine Weinbright Beitler, had two sons and three daugh ters. For mer mem bers of the Church of the Breth ren, they had sett led in Wil son County, Kan sas, near the town of Parsons and had, like the Taylors, joined the Bickertonite Church in 1873 aft er mission ar y John Stevenson demon str ated the gift of heal ing. The Beitlers moved to the Zion Val ley col ony in 1877 and remained loyal to Bickerton through out all the con tro versies. Ja cob Beitler was one of the col - ony’s few ex pe ri enced farm ers. *** 27Jacob Beitler v. The Church of Je sus Christ, Case No. 20, Aug ust 27, 1880; The Church of Je sus Christ v. Jacob Beitler and James Jenkins, Case No. 28, Au gust 26, 1880; both in Stafford County, Ninth Ju di cial Distr ict Court, Civil Trial Docket, Vol. A, 1880–88, Kan sas State HIst or i cal So ci ety Ar - chives. See also L. Web ster Miles, “Sher iff’s Sale,” St. John Ad vance, Oc to ber GARY R. ENTZ/THE BICKERTONITES 17 lieved Brigham Young’s apost asy had led to his own call ing. Accor d - ing to the St. John Advance’ s report, Bickerton pointed out to St. John’s rapidl y growing non-Mor mon popu la t ion that his Saints reject ed polyg amy and had no con nec tion to the Utah Mor mons or their prac - tices. His fol low ers did “not att empt to force their reli gion on any person,” main tained the respect of their fel low resi den ts, and suf fered no un to ward per se cu tion for their be liefs. “Their re li gion,” com mented ed it or Wil liam R. Hoole, who knew Bickerton well and was friendly to ward him, “alt hough some what sing ular , is their own by right and is not in ter fered with by the comm un ity. They alwa ys ext end a cor dial inv it at ion to all classes to att end their meet ings and are very cour te - ous in their treatmen t of strang ers.”28**** While Bickerton thus cemen ted cor dial re lat ions with his non-Mor mon neigh bors, he could not boast of a sim i lar har mony in his deal ings with Cadman’s fol low ers. He would have pref erred to re - store har mony among all the Saints, but such a de sire was un at tain - able as long as neit her side would ack nowledg e the leg it imac y of the other’s church. Ac cord ingly, both sides worked against each other. While Wil liam and Ar thur Bickerton re turned to Pennsyl va nia “to gather tog ether the Latt er Day Saints” in that re gion, Wil liam Cadman came out to St. John to accom plish the same end.29+ Al though Cadman trav eled to Kan sas for the pur pose of hold - ing a conf er ence and so lid if ying his own support, his ar rival accom - plished litt le bey ond stir ring up smolder ing host il it ies. In June 1881, the Ninth Jud ic ial Dis trict Court conf irmed the sale of the church build ing to Jacob Beitler, and Cadman’s fact ion respond ed by appea l -

8, 1880, 3; “Town and Coun try,” ibid., No vem ber 19, 1880, 3; “Town and Coun try,” ibid., April 8, 1881, 3; Wil liam Bickerton, “No tice,” St. John Ad - vance, April 22, 1881, 3. **** 28“The An nual Con fer ence of the Church of Je sus Christ,” St. John Ad - vance, May 6, 1881, 2; Wil liam R. Hoole, Ed i to rial, ibid., Au gust 26, 1881, 2. Hoole, then thirty-five, was a lead ing cit izen of St. John, a prom inen t land- owner, and the town’s futur e mayor (elected 1885). He was not a Bickertonite and may have been a Method ist like the ma jor ity of St. John’s pop u la tion. + 29Wil liam Bickerton, “To All Whom It May Con cern,” St. John Ad - vance, May 6, 1881. Ar thur Bickerton remained in the East; and while he con tin ued to sup port his brother’s min istr y, he soon dropped out of Church af fairs. 18 The Journal of Mor mon His tory ing the dec ision. The case plod ded along for a year, and the con tin - ued bick er ing disg raced both sides in the eyes of the loca l pop ulace. “We presume,” edi t ori a lized Hoole in the Ad vance on No vem ber 25, 1881, “these people are Christ ians [sic], and ‘by their works ye shall know them.’ We think they should sett le this matt er by compr omise of some kind, and not drag any more of their privat e scanda ls bef ore the pub lic.”30++In June 1882 the court dismissed the appea l and or - dered both sides to split the court costs. Fed up with the leg al wran- gling, Beitler in Aug ust sold the Zion Val ley Church and lot to Eli jah and Frank Swartz,31+++who anno unced plans to conv ert the sanc tu ary into a hardwar e store. The brothers re locat ed the build ing to a lot on the town square. The for mer church lot became a lumber stor age area un til the Swartz brothers beg an the con struc tion of a house on the site a few months later.32++++ St. John, the town that had emerged from the reli gious col ony of Zion Val ley, was now a com mun ity witho ut a church. “Are we spir itu - ally di gress ing? It looks that way,” bemoaned the loca l press. “A church was the first build ing ever erected here, but the rush of business has neces si tated its conv ersion into a business house. Let us not in our eag er ness for this world’s gains, for get the im por tance of our

++ 30“Town and Coun try,” St. John Ad vance, No vem ber 25, 1881, 3. See also “Town and Coun try,” ibid., Au gust 19, 1881, 3. +++ 31The Swartz brothers had moved to St. John from Ohio in the early 1880s. Busi ness men who sold lum ber and hard ware, they had no af fil i a tion with ei ther Bickerton or Cadman. Ac cord ing to the 1880 cen sus, Frank was thirty-two, but Eli jah does not ap pear in that cen sus. ++++ 32“Town and Coun try,” St. John Ad vance, Au gust 4, 1882, 3; “Town and Coun try,” ibid., Sep tem ber 21, 1882, 3; “Town and Coun try,” ibid., Sep tem - ber 28, 1882, 3; “Town and Coun try,” ibid., No vem ber 30, 1882, 2; Ja cob Beitler v. The Church of Je sus Christ, Case No. 28, June 14, 1881; The Church of Je sus Christ v. Jacob Beitler and James Jenkins, Case No. 28, Decem ber 14, 1881; The Church of Je sus Christ v. Jacob Beitler, Charles Brown, and Jo seph Astin, Case No. 89, Decem ber 15, 1881; all three in Stafford County, Ninth Ju di cial Distr ict Court, Trial Docket, Vol. A, 1880–88, Kansa s State Hist or i - cal So ci ety Ar chives. Dur ing Cadman’s July conf er ence, Eli Kend all was pro moted from presi dent of the west ern branch to first counselor un der Cadman, George Kend all replaced Eli as presi dent of the west ern branch, and Cadman was sust ained as Church presi dent. Cadman, A Histor y of the Church of Je sus Christ, 85. GARY R. ENTZ/THE BICKERTONITES 19 spir itua l welfar e.” Per haps feel ing a bit guilty, the Swartz brothers volun teered twenty-five dol lars to any re li gious or ga ni za tion will ing to construct a house of worship in St. John, but neit her fact ion of Saints stepped for ward to claim the money and rebui ld its church.33* Both the Bickerton and Cadman fact ions con tin ued hold ing meet ings in the town hall or in pri vate homes and heeded Hoole’s admon it ion to keep their dis agree ments out of the pub lic eye. Cadman, who now al leged that the Church had aban doned plans for an Ind ian Mission as early as 1869, re turned to St. John for conf er ences in 1884 and again in 1886, but he and his Kansa s fol low ers took pains to at- tract no att en tion. Bickerton’s Saints were more act ive and issued inv i - tat ions for the gen eral pub lic to par tic ipat e in their meet ings. They also worked to dif fer en tiat e themsel ves from the LDS Church in Salt Lake City. For ex ample, in 1885 an ed it or ia l ist made the face tious re - mark that all Lat ter-day Saints were pol yg amist s. Elder J. S. Weeks, who had succeeded Ar thur Bickerton as Wil liam Bickerton’s second counselor , promptly wrote a lett er to the ed it or anno unc ing that there was a clear dist inct ion be tween the Bickertonites and others who pro- fessed to fol low the teachings of Joseph Smith. The Utah “Mor mons are not in any sense of the word en tit led to the name of Saints, for they have apos tat ized from the true gos pel of Jesus Christ, and adopted in its stead the Gospel of B. Young, Joseph Smith was not the aut hor of po lyg amy.”34** Despit e the split within the Bickertonite Church and the growing con cern that they might be asso c iat ed with the LDS Church, Bickerton’s fol low ers remained commit t ed to the pri mary mission that brought them to Kansa s in the first place, min ist er ing to the Lamanites. Accom pa n ied by Silas Busby and Sam uel Work, Bickerton led the 1880 mission to Ind ian Ter rit ory. The task had a cat har tic ef -

* 33“A Church,” St. John Ad vance, No vem ber 2, 1882, 3. ** 34J. S. Weeks, “Ed i tor Ad vance,” St. John Ad vance, May 14, 1885, 3; “A Home War Cloud,” ibid., May 7, 1885, 2; “The Utah Prob lem,” ibid., May 14, 1885, 2. J. S. Weeks came from the RLDS Church and joined the Bickertonites some time in 1882. Ac cord ing to Al ex an der Rob in son, Weeks may have been as so ci ated with Jo seph Smith’s church in Nauvoo. Al exan - der Rob in son, in ter viewed by Gary R. Entz, St. John, Kan sas, April 6, 1998, tape recor d ing in my posses sion, transc ript in Marriott Libr ary Spec ial Col - lec tions, Univ ersit y of Utah, Salt Lake City, and Kansa s State His tor ica l So - ci ety Ar chives. 20 The Journal of Mor mon His tory fect on Bickerton, who rejoiced in a modest success. “They were very preju d iced when I first beg an teaching the Book of Mor mon,” Bickerton rem in isced, “but by the time I had fin ished with my dis- course, they were very kind, as the Lord had worked upon them in his own way.” While the number of con verts within Ind ian Ter rit ory was never very large, Bickerton main tained his conv ict ion that the mission was God’s will. He wrote, “I never felt more in the power than while preaching the gospel of Christ in that coun try.”35***Busby mar - ried an Ind ian woman and con tin ued the Bickertonite mis sion to the Cher ok ee Nat ion from his home on Cott onw ood Creek near Caney in Montg omer y County. Bickerton and Work, how ever, re turned to Stafford County and car ried on their labors from St. John.36**** Life for the Bickertonites had sett led down con sider ably. How - ever, the same did not hold true for the Pennsyl va nia Saints because, in 1885, an old con tender for their loy alt ies reen tered their lives. In 1885 John E. Baxendall and Charles Price, both of whom had joined George Barnes when he sepa r ated from Bickerton’s church in 1873, became conv inced of the div in ity of the Doctr ine and Cov enan ts and con tacted LDS Presi den t John Taylor in Salt Lake City asking for more inf or mat ion. Taylor for warded the req uest to the presi den t of the Northw est ern States Mission, Wil liam Moroni Palmer.37+Palmer in turn dispatched El ders Vict or Emanuel Bean and Wil liam W. Allen, mission a ries in Ind iana, to Coal Valley , Pennsyl va n ia, to meet with members of Barnes’s sect. Barnes welcomed the mission ar ies and enlight ened them on the hist ory of the Church of Jesus Christ, in - clud ing the var io us schisms that had taken place since the Church’s founding.

*** 35Bickerton, “Test i mony, June 1903,” 5–6. Since the Bickerton and Cadman branches were reun ited by 1903, I in ter pret this statemen t as Bickerton’s reminder to the Cadman group that he had been do ing God’s work while they had been wran gling over lead ership. **** 36Bickerton be came the pro pri etor of the City Ho tel in St. John. In ad - dit ion to his Church dut ies, which included a mission to New Mex ico, he spent the next few years build ing up his busi ness. Samuel Work assist ed in man ag ing the ho tel. St. John Ad vance, May 3, 1883, 3; “Town and Coun try,” ibid., Aug ust 30, 1883, 3; “Town and Coun try,” ibid., Janu ar y 3, 1884, 3. + 37Palmer, then thirty-nine, had been born in Iowa in 1846 and had three wives: Mary Ann Mellor, Christ ina Helen Larson, and Mary Ann Mills. GARY R. ENTZ/THE BICKERTONITES 21

This his tory clearly in ter ested Bean and Allen because, af ter min ist er ing to Barnes’s small group, they made a point of visit ing both the Bickerton and Cadman fact ions. Art hur and Thomas Bickerton, Wil liam’s brothers, will ingly met with the mission ar ies and, accor d ing to Bean, inf ormed them that they “were very much opposed to po lyg amy and said that if it were not for that princ iple they would gladly be one with us.”38++Plu ral mar riage re mained a sig nif i - cant point of con ten tion, and Bean spec if ica lly noted that Bickerton’s son and Eliz abet h Cadman both re fused to coun te nance their presence because of it. As the two elders pre pared to depart, Ar thur Bickerton in formed Bean that “the Cadman branch the Sunday before spoke in very bitt er terms against us and de nounced the Utah peo ple.”39+++ The den unc ia t ion had lit tle impact on Bean and Allen’s pri - mary mission, and the pair succeeded in conv inc ing George Barnes’s sect to af fil iat e with the LDS Church. More im por tant, how ever, through their dis cussions they learned of the Zion Val ley col ony in Kansa s and the adul tery ac cu sa tions that had caused the split be - tween Bickerton and Cadman. The mission ar ies for warded this inf or - mat ion to Palmer; and aft er ana lyzing their re port, Palmer joined Bean in 1886 on a second visit to Pennsyl va nia. Tog ether they min is- tered to Barnes’s sect; and on May 18, 1886, Palmer bapt ized Barnes and, two days later, or dained him an elder in the New England, Penn- syl va nia, Branch.40++++ The news of sev eral con ten tious splin ter fact ions in Kansa s in - trigued Palmer, which led him in No vem ber to make a brief visit to St. John. “Many Bickertonites live at this place,” Palmer re corded in his diar y, “and I was to see what could be done among them.” While he made lit tle headwa y in a per sonal meet ing with Bickerton, Palmer dis-

++ 38Vic tor Emanuel Bean, Jour nals, 1884–89, Vol. 4:4, Ar chives, Fam ily and Church His tory Depar t ment, Church of Je sus Christ of Lat ter-day Saints, Salt Lake City (hereaf t er LDS Church Ar chives). See also ibid., 3:90–107 (1885); Eli Kend all, “The Other Side,” St. John Weekly News, July 19, 1889, 2. Bean, age twenty-one in 1885, was from Rich field, Utah. His com pan ion, Wil liam Allen, was thirty-one and from Nephi, Utah. +++ 39Bean, Jour nal, 4:13. ++++ 40Wil liam Moroni Palmer, Diar y, 1880–87, Vol. 2, May 23–30, 1886, LDS Church Ar chives; Bean, Jour nal, 4:12 (1886). New Eng land was a small set tle ment within walk ing dist ance of the town of Coal Val ley. 22 The Journal of Mor mon His tory cov ered that the on going ri valry bet ween Bickerton and Cadman left many of their fol low ers disi l lusioned. He was in ter ested in con vert ing the lot of them but recog nized that those who fol lowed Cadman would be likely to arouse the ire of the en tire comm un ity. Palmer also under st ood that a mission to the Kan sas Bickertonites would take time because this “group of prof essed saints are so scatt ered that it would be im possi ble to get them stirred up and to get them all to meet in side of a week or 10 days.” Since he had but a few days till his train ticket expir ed, Palmer resig ned himself to desc ribing the situ a t ion in a long report to the other wise un iden tif ied “Pres. Mor gan” (possi bl y John H. Mor gan, who was then a mem ber of the First Coun cil of the Sev enty). Palmer urged that “2 expe r ienced Elders be sent there at once to stir them up.”41* Bickerton paid lit tle heed to the long-term im pli cat ions of Palmer’s short visit. Inst ead he con tin ued focus ing on the Ind ian Mis- sion and, in 1886, asked the James Miskin fami ly to under take the next mission to Ind ian Ter rit ory. At a Christma s cele brat ion in the Miskin home, Bickerton re joiced over their success in deliv er ing God’s “glo rio us messag e to the fallen sons and daught ers of Adams race.”42** Palmer made good on his pledge to “stir up” the Saints, and Bickerton’s 1886 Christma s cele brat ion was his last peace ful one. In 1887 LDS Church presi den t John Taylor dir ected Palmer to add

* 41Palmer, Diar y, No vem ber 25, 1886. Morg an (1842–94) had been pres i dent of the Souther n States Mis sion. The First Coun cil of the Sev enty then had pri mary re spon si bil ity for call ing mis sion ar ies. ** 42J. S. Weeks, “St. John, Kan sas, Decem ber 27, 1886,” St. John Sun, De - cem ber 30, 1886, 3. The Miskin fam ily depar ted for In dian Ter ri tory in late April 1887. Wide Awake, “Sand Hill Farm,” St. John Ad vance, May 5, 1887, 1; Ar thur R. Miskin and Amelia L. Moore Miskin, “Notes on Our Early Life,” n.d., type script, 4, LDS Church Ar chives. The Miskins, Eng lish im mi grants from Guern sey Is land, moved to Kan sas in 1874 so James could work as a sur veyor for the newly org a niz ing Stafford County. They had one of five es- tab lished home steads when Bickerton founded Zion Val ley in 1875 and were his first con verts in Stafford County. In 1886, James was forty-two and Amelia was thirty-nine. Their fourth child was born while they were on their mission. GARY R. ENTZ/THE BICKERTONITES 23

Kansa s to the Northw est ern States Mission; 43***and in June, Palmer dispatched D. E. Har ris and J. O. Swenson to start prose ly tizing among the Bickerton and Cadman sects in St. John. The ar rival of the two elders pro voked an imme diat e and neg at ive re sponse. Bickerton re port edly adv ised “all his members not to let the Salt Lake Mor mons, as the LDS Mission ar ies were called by the Bickertonites, in their homes.”44****Bickerton’s second counselor , J. S. Weeks, was aware that “many hon est people shun us as they would the ‘Upas tree’ or the ‘black plague,’ for fear that we are part of the same church, which has so long been conspic u o us because of their belief in and pract ice of po lyg amy.” He theref ore wanted ev ery one in St. John to under stand that the Church of Jesus Christ “and the Utah Mor mons are an tip o des in Theo log i cal be lief.” Weeks quoted Ja cob 2:27 from the Book of Mor mon (a stiff de nun ci a tion of pol yg - amy) and the mar riage ser vice used dur ing Joseph Smith’s life time as doctr inal proof against plur al mar riage. Hav ing made clear his org an iza t ion’s oppo si t ion to this funda men t al LDS belief, Weeks stated that “we stand for orig ina l Mor mon ism and want none of Brigham’s addendums.”45+ Palmer re turned to St. John in July and joined the LDS mission - ar ies in preaching at a loca l schoolho use known as Blake’s Hall. Their ser mons at tracted re spect able crowds, and the lo cal aud ience found them to be “smooth and pleas ant talk ers.” How ever, the St. John Ad- vance report er scoffed at their ef forts and recor ded, “As to their suc - cess in the shape of new conv erts, we have not learned of any thing worth men tion ing.”46++How ever, Palmer’s imme diat e goal was not the gener al pub lic. His objec t ive was to con vert for mer Zion Val ley colo -

*** 43A more exact date is not avail able, but it had to have been be fore John Taylor’s death on July 25, 1887. **** 44Wil liam B. Astin, “Syn op sis of the Life of Jo seph Astin,” n.d., type - script, 2, LDS Church Ar chives. See also Palmer, Diar y, July 12, 1887. + 45J. S. Weeks, “A Let ter,” St. John County Cap ital, June 24, 1887, 4. Weeks quoted the mar riage ser vice as fol lows: “You both mu tu ally agree to be each others [sic] com pan ion, husband and wife, obser v ing the leg al rights belong ing to this cond it ion; that is, keeping yoursel ves wholly for each other and from all others, dur ing your lives.” See also J. S. Weeks, “St. John, Kan sas, June the 21, 1887,” St. John Sun, June 23, 1887, 3. The LDS mission in St. John was soon added to the Ind ian Ter rit ory Mission. ++ 46St. John Ad vance, July 19, 1887, 3. 24 The Journal of Mor mon His tory nists who alr eady were conv ersan t with the Book of Mor mon. Mem- bers of Bickerton’s fact ion remained fiercely loyal to their prophet, but members of Cadman’s sect had lost their focus and primar y rea - son for being in the West af ter Cadman had aban doned the In dian Mission. Palmer was a guest in Eli Kenda ll’s home dur ing his visit to St. John; and on July 14, 1887, he escort ed Eli and George Kenda ll, along with sev eral other members of Cadman’s sect, to Ratt lesnak e Creek and bapt ized them into the LDS Church.47+++The Kendalls had been leaders of Cadman’s west ern branch, and losing them repr e - sented a serious blow that forced Cadman to make another visit to Kansas. The presence of the Utah elders put both Bickerton’s and Cadman’s fact ions on the def ensiv e, but their ind iv idua l respons es re - flected the or gan iza t ional strength of the two Bickertonite sects in Kansa s. In June 1887 John Wil liams is sued a bana l state ment giv ing the posi t ion of Cadman’s church in Kansa s. Wil liams did not make a doctr inal ar gumen t; inst ead he faulted Bickerton for the at trit ion of mem bers to the LDS Church. His logic came from the belief that Bickerton had no aut hor ity to repr esen t himself as a reli gious leader because the church “had law fully expel led” him “for dis or derly con - duct.”48++++ In con trast, J. S. Weeks emerged as an ef fect ive spokesman for Bickerton’s group. He disr eg arded Wil liams’s charges and used the Church’s 1887 sum mer con fer ence in St. John as a platf orm to delin - eate the dif fer ences bet ween Bickerton’s or gan iza t ion and the Utah Mor mons. Weeks insist ed that Bickerton’s Church of Jesus Christ rather than the Utah LDS Church was the true in her it or of the church or gan ized in 1830 “by Joseph Smith, the Mar tyr.” When Smith and his brother were killed, many Saints who “had not lived as near God as they ought and theref ore were not compe t ent judges in Spir itua l things as well as many other careless ones, who were not properl y in- formed in church or der, fol lowed the leader ship of Brigham Young.” Weeks believ ed that the emer gence of pol yg amy proved that the

+++ 47Palmer, Diar y, July 12–14, 1887. ++++ 48J. D. Wil liams, “A Let ter,” St. John County Cap ital, June 30, 1887, 4. Wil liams, age forty-three, came from Ohio and was bapt ized into Bicker- ton’s Church in 1873 when he made a trip through Ohio. He set tled in Bick- erton’s Zion Val ley col ony in 1877 but af ter 1880 split from Bickerton and joined Cadman’s fac tion of the Church. GARY R. ENTZ/THE BICKERTONITES 25

Saints had erred in fol lowing Young and pointed out that “the world knows the result” of this per nic ious pract ice. Sidney Rigdon “had the only aut hor ity of presi denc y that was in exis t ence at that time, but be - cause he stood in the way of those wicked men who were det er mined to get con trol of the church, in or der that they might grat ify the lusts of the f lesh,” they drove him out. Weeks desc ribed Rigdon’s Pitts- burgh min istr y, Bickerton’s call ing as Joseph Smith’s succes sor , and the relo ca t ion of the Church head quar ters to Zion Val ley. His only ref - er ence to Cadman was an ack nowledg men t that “in ter nal dissen - sions, which were brought about by men who were not sta ble in doctrine, and who have since fallen away from the church,” adv ersely af - fected the or gan iza t ion’s prog ress. How ever, Weeks was pleased to report that as “of late the Lord has man if ested to us that the time to fa - vor Zion had come and that he would build us up.”49* While Bickerton’s fol low ers felt secur e enough in their posi t ion to face the LDS mission ar ies dir ectly, Cadman’s support ers did not. Cadman re sented Bickerton’s te nac ity in Kansa s. Cadman’s ong oing smear campaig n against the man he had “disr obed” was disc red it ing the or ig in of his own or gan iza t ion and pro vid ing the Mor mon elders with ad di tional arg u ments to lure away Cadman’s own Church mem - bers. Through a lett er pub lished in the lo cal St. John newspa pers Cadman renew ed the old adult ery charges against Bickerton and chal lenged Weeks, “If you can success ful ly def end his conduct, you have only ano ther to def end, which is the Devil. When you get both ac- complished I will give you a writt en recom men da t ion to old Belzibub [sic] that the sur render po sit ion is on you.” Cadman dismissed Weeks’s con ten tion that pol yg amy had been one of Young’s inv en - tions and adopted the stance of the Reor gan ized Church of Jesus Christ of Lat ter Day Saints (RLDS) that Smith had aut hor ized it but, “prono unced it a cursed doc trine, bef ore he died. They admit fairly and squarely that he gave the rev e lat ion, but aft er wards re pented and declar ed it was of the Devil.” Con tin uing his ti rade, Cadman ques- tioned Rigdon’s claims to succeed Smith and ac cused: The “facts are that Sydney [sic] Rigdon sank as far in re li gious fanat ic ism as any other man that ever lived, and asso c iat ing his name with your [Bickerton’s] bad conduct don’t help you one bit.” Cadman re mained

* 49J. S. Weeks, “A Let ter,” St. John Sun, Au gust 4, 1887, 3; J. S. Weeks, “A Let ter,” St. John County Cap ital, July 28, 1887, 4; J. S. Weeks, “A Let ter,” St. John Ad vance, Au gust 10, 1887, 3. 26 The Journal of Mor mon His tory fixat ed upon the adul tery accu sa t ions and al leged that Bickerton was a phi lander er who had dis avowed plu ral mar riage and the LDS Church in 1852 be cause “po lyg amy, bad as it is, places some re straints on sexu a l ity, there fore it did not meet with” his ap proba t ion.50** Bickerton re acted to Cadman’s dia tr ibe by fil ing a li bel suit against him in civil court but did not att empt to answ er the his tor ica l and doc trinal ar gumen ts. In con trast, Weeks felt compel led to pen a full re butt al to the ind ictmen t. Weeks knew that his church presi den t rarely ack nowledg ed those whom he believ ed had apos tat ized and quest ioned why Cadman should be so bit ter, when “neit her Wm. Bickerton or his associares [sic] have made any pub lic at tack eit her di - rectly or ind ir ectly on Mr. Cadman or his asso c iat es.” He repr i - manded Cadman for his exces siv e vexa t ion over Bickerton’s Church, “for if we are not of God we will fall, and if so be that we are of God your sar casm and rail ing will only bring con dem na tion on your own head.” In respons e to the resur rected adult ery charges, Weeks proclaimed, “many good men from righ teous Able [sic] down to Wm. Bickerton have been lied about and had their char act ers black ened by such men as you, and you can de pend upon it that I will stand by them as far as my strength and knowledge may ex tend in all good things.”51*** Weeks dismissed Cadman’s accu sa t ion that Smith had in troduced plu ral mar riage into the faith and drew on his RLDS ac quain - tances to support his posi t ion. “I have seen and conv ersed with scores of men and women, who were in timat e with Joseph Smith, who pos i tively deny that Joseph . . . taught, aut hor ized, or in any way sanct ioned eit her spir itua l wifery or pol yg amy.” He assert ed that it was Cadman’s inse cu r ity in his own posi t ion that led Cadman to quest ion Rigdon’s aut hor ity to bapt ize Bickerton. Since “you have bef ouled Jo seph Smith and Sidney Rigdon,” Weeks admon ished, “and made sport of Bickerton’s call ing and or di nat ion . . . will you be kind enough to tell the pub lic where you got your au thor ity, (if you have any?).” This was Weeks’s strong est ar gumen t against

** 50Wil liam Cadman Sr., and James Taylor , “An Answ er,” St. John Sun, Au gust 11, 1887; Wil liam Cadman Sr., “An An swer,” St. John County Cap ital, Au gust 11, 1887, 4. *** 51J. S. Weeks, “St. John, Kas., Aug. 13th, 1887,” St. John County Cap ital, Au gust 18, 1887, 4. Bickerton also filed suit against James Taylor and the newspa pers for pub lish ing Cadman’s li bel ous let ter. Both suits were ei ther withdr awn or dismissed. GARY R. ENTZ/THE BICKERTONITES 27

Cadman be cause Cadman had been “bap tized in 1859 under the au - thor ity of Wil liam Bickerton” and had receiv ed all his “or dinances under the same au thor ity.” He knew that Cadman had ad min is- tered the sac ramen t to Bickerton in the past and quoted 3 Nephi 18:28 to coun ter Cadman’s asser tion that Bickerton was unw or thy to remain within the church. Weeks scornful ly remar ked that, when Cadman had done this, he was ig no rant ei ther “of your duty or of Bickerton’s true char act er.” Other wise, Weeks con cluded, Cadman “was negli gent in duty, or Bickerton was not what you repr esen t him to have been.”52**** The LDS mis sionar ies in St. John said nothing througho ut this exchang e and re mained on the sidelines while the two fac tions tore at each other. Even tua lly the combat ants re al ized that vent ing their feel - ings openly did lit tle to enhance their repu t at ion within the town, so the pub lic side of the debat e quiet ed down aft er Aug ust. Cadman all but conceded the Kan sas branch of the Church to his ri vals and with- drew to his Pennsyl va nia stronghol d, while Bickerton dis patched Weeks to spend the win ter min ist er ing in In dian Ter rit ory. The wran- gling be tween the two fac tions quiet ed with Cadman’s depar ture, which al lowed the LDS Church to step in and fill the void. In 1888 El- der Heber Bennion of Taylorsville, Utah, joined the mission in St. John;53+ and with his ar rival, LDS pros e ly tiz ing ac tiv i ties es ca lated consid er ably. Bennion de liv ered a ser ies of dis courses at the Stafford County court house on the “schisms among the Latt er Day Saints” and issued inv it at ions to the fol low ers of both Wil liam Bickerton and Wil - liam Cadman to debat e the topic. Appar ently Bickerton and a few of his dev o tees accept ed Bennion’s chal lenge, because the report er for the County Cap i tal remar ked, “An exc it ing con tro versy took place at the court house last Satur day even ing, bet ween the Lat ter Day Saints of this com mun ity, and a Mor mon El der from Utah.” No jour nal ist re -

**** 52Ibid. 3 Nephi 18:28 reads: “And now behold, this is the command - ment which I give unto you, that ye shall not suf fer any one knowingly to par - take of my f lesh and blood un wor thily, when ye shall ad min ist er it.” + 53Heber Bennion (1858–1932) was thirty when he joined the mis sion in St. John. His fa ther, John Bennion, was a sheep rancher north of Taylorsville, Utah, and Heber would even tu ally become bishop of Taylorsville Ward. 28 The Journal of Mor mon His tory

Stafford County’s first courthouse at St. John, its streets at this mo ment a sea of prai rie mud. In ad dition to the court cases in volv ing Bickertonites, the build ing was also the site for their preach ing ser vices. Cour tesy Kan sas State His tor i cal Soci ety. corded the exchang e or whether eit her side in the debat e prevai led.54++ However, Bennion’s most significant successes came through private meetings rather than public forums. One of the first prose lytes Bennion added to the ranks was Jo- seph Astin, Bickerton’s for mer Church sec re tary and a mem ber of

++ 54“Home News,” St. John County Cap ital, April 13, 1888, 4; see also Heber Bennion, St. John Ad vance, March 29, 1888, 3. One year af ter the de - bate, Eli Kenda ll, who had an axe to grind with Bickerton, gave a one-sided in ter pret a tion of the exchange. He reca lled, “Mr. Bickerton was very vi o - lent in his den unc ia tion of Elder Bennion, the latt er desc ribed him as lit er - ally foam ing at the mouth and at one time he thought he in tended on mak - ing an assault on him, but he man aged to sat isfy himself with a vol ley of im- preca tions. Yet his own admis sions in answ er to El der Bennion’s pointed ques tions proved the lat ter’s po si tion to be cor rect and the meet ing re - sulted in good, as a few were soon added to the church.” Kend all, “The Other Side,” 2. GARY R. ENTZ/THE BICKERTONITES 29

Cadman’s fact ion. In the spring of 1888, the sixty-two-year-old Astin’s health was fail ing. He was pre par ing to meet with some fel low members from Cadman’s Church when Bennion called at his home. At her husband ’s re quest, Mar tha Astin re luct antly usher ed Bennion into Jo- seph’s bedr oom, then re turned to the kitchen and the seething churchmen. “Upon Mother’s re turn,” rec ol lected her son Wil liam, “the teachers imme diat ely arose and said, ‘Well, the Devil has gott en into this house, so we must leave,’ then left witho ut fur ther dela y.” At the con clusion of Bennion’s meet ing with Astin, Mar tha re turned to her husband ’s sickbed where, “much to her sur prise she found Fat her overjo yed and delight ed with his visit with Brother Bennion. ‘They have the truth, that’s what I’ve been looking for,’ he exclaimed. ” Astin conv erted just bef ore his death in 1889. His fami ly fol lowed him into the Church and in 1893 moved to Salt Lake City.55+++ Bickerton’s fol low ers tended to be less suscep t ible to the mis- sionar ies’ line of rea son ing, but a few found the LDS mes sage appea l - ing and conv erted. When James and Amelia Miskin left for the In dian Ter rit ory in 1887, they had ev ery in ten tion of making their mission a per manen t one. They rented a farm from Silas Busby about seven miles south of Caney, Kan sas, on Cot ton wood Creek and looked for - ward to es tablish ing their new home. How ever, by the spring of 1888, ma laria had swept through the fami ly, leav ing one child and Amelia’s fat her dead. Ad dit ional hardship came when herds of Texas catt le passing near the bor der inf ected the Miskins’ live stock with splenic fe - ver. Disi l lusioned with the outcome of their mission, the fam ily sold their re main ing catt le and limped back to St. John. Their ar rival coin - cided with Bennion’s in tensi f ica t ion of the LDS mis sion within the town, and Amelia re called, “As soon as we were able, we went to hear them.” Aft er att end ing sev eral meet ings, James Miskin inv ited an El- der Gunn to come hear one of his own ser vices. Gunn accept ed; and aft er hear ing Miskin preach on the rest or at ion of the gospel, he sat and quest ioned the loca l Saint. Gunn used many of the arg u ments Cadman had pub lished against Bickerton and asked Miskin if, as his ser mon said, God would never take the work on this earth away, then “where was your church from the time Sidney Rigdon died to when Wil liam Bickerton started his? And where was the church from the time the prophet [Joseph Smith] died to the time Sidney Rigdon

+++ 55Astin, “Syn op sis of the Life of Jo seph Astin,” 3. 30 The Journal of Mor mon His tory started his church?”56++++ Miskin had joined the Bickertonites in 1875 af ter the found ing of the Zion Val ley colon y. He had no first hand knowledg e of the Church’s beg inn ings or Bickerton’s early car eer in Pennsyl va nia. Un- able to give Gunn a re sponse, he was deeply disturb ed by the gaps Gunn highlight ed. Aft er con sider ing the issue, Miskin inf ormed his wife that he was “conv inced the Salt Lake Elders . . . belon g to the right church, and I am going to the foun tainhead. ” Miskin was also weary of all of the back bit ing and dis appoin tmen t. He told Amelia: “The rea son we have so much con fusion and splits and bitt er feel ings . . . is because this is just a side show.” Amelia ex er cised more caut ion, warn ing her husband not to rush his dec ision. “We claim to be the church, and so do the Josephites, and there may be others. I don’t see much dif fer ence in preaching. We all believ e in the rest or at ion of the gospel and that Joseph Smith was a prophet of God.” James, how ever, re mained sat isf ied with his dec ision. Amelia, who was still mourn ing the loss of her child and fat her in Ind ian Ter rit ory, joined him when she learned of “the doc trine of bapt ism for the dead. Then I too was ready for bapt ism. I felt this church had more light.” The Miskin family re ceived bapt ism dur ing the spring and summer of 1889, and in the fall James and Amelia Miskin moved to Utah.57* The LDS mission ar ies in St. John con tin ued hold ing reg ular meet ings and became a source of en ter tainmen t and amusemen t for the comm un ity. Lo cal report ers com mented on the abil ity of the able and elo q uent speak ers to draw large crowds, but they also jested that the Mor mon pre sen ta tions were, “grow ing in pop u lar ity much faster than the people who att end them.”58**Wil liam Bickerton found no humor in the LDS presence and grew inc reasingl y con cerned over the inr oads they were making. He knew that those un fami l iar with his church discer ned lit tle dif fer ence bet ween himself and the Utah mis - sionar ies. Theref ore, in the summer of 1889, Bickerton dec ided to assist his neighbor s in making the dist inct ion. In a ser ies of newspa per ar ticles, Bickerton of fered a primer for people cur io us about what the two churches believ ed and where they dif fered. Unlik e those who at- tacked him in the press, Bickerton did not resort to the role of char ac-

++++ 56Miskin and Miskin, “Notes on Our Early Life,” 5–6. * 57Ibid., 6. ** 58“Lo cal, Per sonal, and Oth er wise,” Stafford County Rustler , May 30, 1889, 7; see also “Lo cal, Persona l, and Other wise,” ibid., May 23, 1889, 7. GARY R. ENTZ/THE BICKERTONITES 31 ter assa ssin or scanda lmon g er to make his point. Nev er theless, he be - lieved that the mission ar ies were less than forthcom ing about their beliefs and cited passag es from the Doctr ine and Cov enan ts, Charles W. Penrose’s 1884 ad dress on the “Ar ticle of Blood Atonemen t,” and ar ti cles pub lished in the Mil len nial Star (a pub li cat ion of the Brit ish Mission) , to “show their doc trines from their own standar d books.”59*** Bickerton iden tif ied three princ ipa l points of con ten tion with the Utah church. The first was plur al mar riage, and he cited what he in ter preted as over a dozen con trad ic tory passag es from Doc trine and Cov e nants 132. Once he had highlight ed the textua l incon sis t en- cies, Bickerton expr essed his be lief that po lyg amy merely pander ed to the flesh and that there was nothing spir i tual about it. “It has made slaves of its dupes, and cowar ds of its lead ing adv ocat es.” He fur ther charged that pol yg amy “is not only of suspi c ious or i gin, but has been fos tered in sec ret and shielded in falsehoo d.” Bickerton believ ed that the doctr ine gave no chance of sal va tion to any woman who reject ed it, a dic tum that broke “the law of God and man.” Pol yg a mous mar - riage, he fina lly con demned, “turns home into a hell and heaven into a harem. If these things re flect the char act er of God and his works, we are at a loss to know how we shall ever iden tify the devil and his inst i - tu tions.”60**** The second doc trine to which he took excep t ion was blood atonemen t. Cit ing Penrose’s 1884 pam phlet as his source, Bickerton quoted Brigham Young: “There are sins which men com mit for which they can not re ceive for give ness in this world or in that which is to come, and if they had their eyes open to see their true cond it ion, they would be per fectly will ing to have their blood spilt on the ground.” Bickerton select ed sev eral other in flamma t ory excer pts from the pamphlet, but the point he stressed was that the doctr ine of blood atonemen t was “nothing less than mur der, and ought to be re jected by all honest peo ple.” He insist ed that “there is no place bet ween the lids of the Bi ble, where man is jus tif ied in shed ding his blood for the re -

*** 59Wil liam Bickerton, “Saints vs. Mor mons: Salt Lake Mor mon ism as Viewed by a Lat ter Day Saint,” St. John Weekly News, June 7, 1889, 2. Bickerton’s “Saints vs. Mor mons” compr ised a ser ies of four ar ti cles that ap- peared over a four-week per iod on June 14, 21, 28, 1889. A fifth, con clud ing ar ti cle, “The Dif fer ence,” ap peared on July 12, 1889, 2. **** 60Bickerton, “Saints vs. Mor mons,” St. John Weekly News, June 14, 1889, 2. 32 The Journal of Mor mon His tory mis sion of his sins, and giv ing him any tit le to the Kingdom of God here aft er.” His third point of con ten tion was Brigham Young’s Adam-God doctr ine, con tro versia l even among the Mor mons. Bickerton paraph rased Ex odus 20:3, “Thou shalt have no other God besides me,” and dismissed this tenet as simple “idola tr y, and needs no com ment.”61+ The remain der of Bickerton’s dis course highlight ed Joseph Smith’s disco v ery of the Book of Mor mon, Sid ney Rigdon’s or dina - tion as Smith’s succes sor , and his own or gan iza t ion’s beliefs. How - ever, the key theme he con tin ua lly stressed was his belief that the Utah mis sion ar ies were in ten tion ally mis lead ing their pros e lytes by with- hold ing inf or mat ion. “We have no desir e to in ter fere with the char ac- ter of men,” Bickerton proclaimed, “but are only deal ing with princ i- ple. And the pub lic is left to judge whether they are moral or Christ-like.” He conf iden tly stated that any one who cared to quest ion him was at lib erty to view the rele van t books and pamphlet s to draw their own inf er ences. Bickerton wanted to make it clear that the LDS mission ar ies in St. John pro vided only the ba sic out line of their faith, rev eal ing the more con tro versia l tenet s only aft er a conv ert had made the jour ney to Utah Ter rit ory. He consid er ed this pract ice decep t ive and an nounced: “We have here treated with only a part of their gospel which is taught in Salt Lake City, Utah. They preach here what they call the first princ iples of the gospel, but as they tell you, you will have to go to Utah to know it ALL.”62++ Bickerton’s expos i t ory treat ise drew Heber Bennion’s respons e. In what was possi bl y a move to goad fur ther fact ional inf ight ing, Bennion asked for mer Zion Val ley colo n ist Eli Kenda ll to pen the LDS rebut t al. Kenda ll, how ever, was not well-versed in doctr inal issues. Rather than debat e Bickerton, Kenda ll chose inst ead to slander Sid ney Rigdon’s char ac ter and, by as so ci a tion, Bickerton’s in teg rity. Kenda ll beg an well enough in pro vid ing the LDS in ter pret at ion of how Church au thor ity had shifted from Jo seph Smith to the Quo rum

+ 61Ibid. See also Charles W. Penrose, Blood Atoneme nt, as Taught by Lead ing Elders of the Church of Je sus Christ of Lat ter-day Saints (Salt Lake City: Ju ven ile In struc tor Of fice, 1884). The Brigham Young statemen t is from a dis course, Sep tem ber 21, 1856, Jour nal of Dis courses, 26 vols. (Lon don and Liv er pool: LDS Book sell ers De pot, 1855–86), 4:53. ++ 62Bickerton, “Saints vs. Mor mons,” St. John Weekly News, June 14, 1889, 2. GARY R. ENTZ/THE BICKERTONITES 33 of the Twelve Apos tles at Nauvoo and quoted Smith as saying, “There is no First Presi denc y over the twelve.” Had he con tin ued with this rea soned line of ar gumen t Kenda ll could have cast ser io us doubts on Bickerton’s spir itua l lin eage. But inst ead of det ail ing the spir itua l pro- gression of the LDS Church, Kenda ll slipped into char act er assa ssi na - tion, claiming that Rigdon “was a well known adul terer when he was sev ered from the Church in 1845.” While pro vid ing no ev idence for his claims, Kenda ll went on to give a fairly accu r ate timeline of Bickerton’s conv ersion un der Rigdon and even tual for mat ion of the Bickertonite Church. Nev er theless, Kenda ll felt compel led to embel - lish his version of events with mislead ing commen tary to disc redit Bickerton’s or ga ni za tion. Bickerton stated on nu mer ous oc ca sions that he had brok en with Rigdon because Smith’s for mer first counselor had gone wrong in the spirit, but Kenda ll shamelessl y assert ed that the break had occur red because of Rigdon’s dishon or able conduct. It became so bad, said Kenda ll, “and his loose immo r al ity so man if est, that he [Bickerton] dissol ved all connec t ion with him and stood by him self.”63+++ Kenda ll con tin ued with a full exam i na t ion of Bickerton’s church from its earli est years though the found ing of Zion Val ley and the town of St. John. How ever, the point he pressed througho ut was that in the eyes of the LDS Church, an apos tate had conv erted Bickerton, and Bickerton was at fault for not recog nizing the her esy. “The small- est grain of rea son or con sist ency should have taught them that if the church had gone astray” aft er Jo seph Smith’s death “they themsel ves were equally des titut e of” div ine aut hor ity, “witho ut which it is sheer blas phemy to min is ter the gos pel or di nances.” Kend all an nounced that Bickerton had lost his chance for un ion with the Utah church in 1857 when Elder Sam uel Wooley passed through Pennsyl va nia. Though “he had acted hast ily in reject ing a prin ciple he had never fully ex am ined or un der stood,” Bickerton “had am ple op por tu nity to repen t, and recon sider his ill-adv ised course.” Inst ead, bemoaned Kenda ll, “he hardened his heart and chose the oppo sit e road.”64++++ Bickerton was quick to respond and promptly pointed out that his ear lier disco urse had il lus trated the doctr inal dif fer ences between his church and the Latt er-day Saints of Utah, while Kenda ll “did not answ er a sin gle point.” He “only tried to vil ify my char act er

+++ 63Kend all, “The Other Side,” 2. ++++ 64Ibid. 34 The Journal of Mor mon His tory and to make me the targ et to jus tify themsel ves.” Bickerton ig nored the bulk of Kenda ll’s polemic and restrict ed his answ er to cor rect ing the lat ter’s in con sis ten cies. Sid ney Rigdon, Bickerton ex plained, was any thing but an adult erer and worked to expose the doctr ines of polyg amy and mar riage for eter nity. “Rigdon, hav ing two daught ers that they wanted to make spir itua l wives, which he opposed. . . . [T]hat was why Brigham Young and his con feder acy reject ed him which the hist ory of the Brigham Young church will bear us out in.” Bickerton dis missed Kenda ll’s asser tion that he had had the chance to avoid excom m un ica t ion from the LDS Church dur ing Elder Wooley’s 1857 visit to Pennsyl va nia and proclaimed that the scriptures along with the Holy Ghost “taught him to oppose Brigham Young in his accursed doc trines which was published in 1852 at Washing t on, DC.” He charged that the LDS mis sionar ies were lying to accom plish their own cor rupt ends by making him “the spec ial ob - ject of their calum n ies” and appea led to the people of St. John to search their hearts for the truth. “I only ask the people of Stafford Co., as you have been acq uainted with me these many years, is this my char act er ist ic or not? And as all of our meet ings are open to the pub - lic, we leave you to judge.”65* Heber Bennion, hav ing complet ed his mission, retur ned to Salt Lake City in July 1889, and with out his mo tivat ing presence Kenda ll retr eated to the sidelines. Bickerton, how ever, was not fin ished; and beg inn ing in Aug ust he took steps to preempt any furt her in vect ives by compos ing his most ex haus tive test imo n ial to date. In a ser ies of eleven lett ers that appear ed through the remain der of the year, Bickerton gave an ecu men ica l his tory of his church that det ailed his as so ci a tion with Sid ney Rigdon, the or ga ni za tional growth of the Church of Jesus Christ (Bickertonite), and a chron icle of Zion Val ley. It pro vided a ready ref er ence for any one want ing to check the ver ac ity of accu sa t ions against Bickerton or the Church and ended the con tro - versy bet ween the var io us rest or at ion churches in St. John. “People ask why we are so few,” Bickerton com mented to ward the end of his treat ise. “Because they have never known the dif fer ence bet ween Salt Lake Mor mons and Latterday [sic] Saints, and we have to bear the re - proach. . . . Many make cov enan ts and break them, we know that this is

* 65Wil liam Bickerton, St. John Weekly News, Au gust 16, 1889, 2. GARY R. ENTZ/THE BICKERTONITES 35

LDS mem bers and mis sion ar ies clus ter out side the meet ing house on the day it was ded i cated in 1895, on the same site that the Bickertonites had dedi cated several years ear lier. Cour tesy Church Ar chives, Church of Je sus Christ of Lat - ter-day Saints. the church of Christ as it was thirty years ago.”66** The fact ional fight ing ceased with the pub li cat ion of Bickerton’s expos i t ory lett er; and with the excep t ion of Cadman’s declin ing branch, both churches sett led into a peace ful co exis t ence in St. John. Eli Kenda ll left Kansa s in March 1890 for Provo, Utah, and enough others fol lowed that S. A. D. Glasscock, a for mer mem - ber of Cadman’s fact ion, could write back to boast of “the St. John

** 66St. John Ad vance, July 12, 1889, 4; “Bickerton’s Let ter,” St. John County Cap i tal, No vem ber 21, 1889, 1. Un der the ti tle of “Bickerton’s Let - ter,” the en tire text ran in weekly in stall ments in St. John County Cap ital in 1889: Aug ust 15, p. 4 (ti tle on only this in stall ment “Mr. Ed i tor, Sir”), Au - gust 22, p. 4; Aug ust 29, p. 4; Sept em ber 5, p. 4; Sep tem ber 12, p. 4; Oct o ber 3, p. 4; Oct o ber 10, p. 4; Oct o ber 17, p. 4; No vem ber 14, p. 1; No vem ber 21, p. 1; and No vem ber 28, p. 1. 36 The Journal of Mor mon His tory colon y in Salt Lake City.”67***Over the next few years, a small but steady stream of mig rants depart ed for Utah, but not ev ery one wanted to abandon their Kansa s homes. Enough LDS conv erts re - mained that, in 1895, the Mor mons pur chased a lot on the cor ner of Fifth and Ex change Streets in St. John, which was unr emar kable ex - cept for the fact that it was the site of Bickerton’s orig ina l Zion Val - ley church and the loca t ion that his fol low ers believ ed had been ded - icat ed to the Lord in 1874 when Bickerton had driven a symbolic “stake of Zion” into the ground. Wil liam Astin, the son of Jo seph Astin and an LDS conv ert from the Bickertonites, claimed that, in the early 1880s it was his fat her and George Baker who “felt impressed to ded icat e the plot to the Lord” aft er they had joined Cadman in breaking from Bickerton. They very well may have done so, but the lo cat ion’s sym bolic im por tance clearly came from Bickerton’s ear lier con se cra tion.68**** In the spring of 1895, the Latt er-day Saints pur chased an exist - ing build ing from the United Breth ren and moved it across town to their newly acq uired lot. They spent the summer re furbish ing the struc ture to the point where unnamed lo cal commen tat ors obser ved, it became a place “for worship second to none in the city.”69+Ed ward Stevenson of the First Counc il of the Sev enty in Salt Lake City, Presi - dent Andr ew Kimball of the LDS Ind ian Ter ri tory Mission, and many other dig ni tar ies came to St. John for the ded i cat ion cer e mon ies in Sep tem ber. Kimball and other el ders gave re li gious ad dresses, while a choir composed of both Saints and Gen tiles alike pro vided an inspi r a- tional di version for the townsf olk. In the days fol lowing the ser vices the visit ing dig ni tar ies played a game of baseba ll with the St. John Nine and deliv ered lectur es to area farm ers on proper methods of ir - ri gat ion. The Mor mons made a strong impr ession on lo cal re port ers, who re marked that “the Elders and others presen t conduct ed them- selves in a highly gen tlemanl y manner , and all were cour te ously and

*** 67S. A. D. Glasscock, St. John Ad vance, May 1, 1890, 4; see also “Lo cal Graphics,” St. John Weekly News, March 28, 1890, 5. **** 68Astin, “Syn op sis of the Life of Jo seph Astin,” 2; see also “Lo cal News,” St. John Weekly News, Sep tem ber 25, 1890, 5; “Lo cal News,” ibid., Jan- u ary 15, 1891, 5. + 69“The Mor mons,” St. John County Cap ital, Sep tem ber 13, 1895, 4. See also ibid., June 28, 1895, 4. GARY R. ENTZ/THE BICKERTONITES 37 pleasan tly treated by our cit izens. ”70++The ex tended ded i ca tion program was part of Kimball’s over all strat egy of expand ing the Ind ian Ter rit ory Mission, and St. John’s popu la t ion of Saints pro vided him with a ready-made foot hold.71+++ Elder Sam uel Kirkman pre sided over the St. John LDS unit dur - ing Kimball’s ten ure in the area, and the use of en ter tainmen t to pros- e ly tize within the town con tin ued througho ut the per iod. In No vem - ber the Latt er-day Saints insta lled an or gan in their church and be gan holding regu lar music rec ita ls. Howev er, the musi ca l highlight came in Decem ber when the famed Salt Lake City per former Philip Margetts came to town for a vio lin concert. He at tracted an appr e cia- tive crowd, but the cli max came over Christma s when loca l resi den ts were inv ited to share hol ida y fest iv it ies in a church build ing gaily dec- or ated with col or ful Chinese lan terns. The townsf olk pre sumed that the rat iona le behind the lav ish musi ca l and visua l pag eants were for public rela t ions purposes. Commen t at ors in the St. John County Cap i - tal remar ked that the Mor mon elders were “hust lers and seem fami l - iar with ev ery thing that tickles the pub lic palat e.”72++++Nev er the less, no one of fered any ser io us ob ject ions. In 1897 Wil liam T. Jack succeeded Kimball as presi den t of the In dian Ter rit ory Mission, and Mor mon exper tise in ir rig at ion, when com bined with the welcome per for - mances, remained sig nif ican t tools of per sua sion that long out lasted the debat es with Bickerton.73* Aft er 1890 the Latt er-day Saints largely ceased their public crit i -

++ 70“The Mor mons,” St. John County Cap ital, Sep tem ber 13, 1895, 4. +++ 71Rich ard L. Jensen, “An drew Kimball and the In dian Ter ri tory Mis- sion,” Task Pa pers in LDS Histor y, No. 30 (Salt Lake City: LDS Hist or ica l De- part ment, 1979), 19–20. ++++ 72St. John County Cap ital, Decem ber 27, 1895, 4; see also these ar ti cles in the Cap i tal, No vem ber 8, 1895, 4; Decem ber 6, 1895, 4; “Pro gram,” De - cem ber 13, 1895, 4; Decem ber 20, 1895, 4. * 73Jensen, “Andr ew Kimball and the Ind ian Ter rit ory Mission, 21. For repor ts of LDS ac tiv i ties in St. John dur ing this pe riod, see also these ar ti - cles in the St. John County Cap ital: Janu ary 17, 1896, 4; Jan u ary 24, 1896, 4; “At the Rink,” July 3, 1896, 4; July 24, 1896, 4; Decem ber 18, 1896, 4; “Christma s at the Churches,” Janu ary 1, 1897, 4; Jan u ary 17, 1897, 4; Feb ru - ary 19, 1897, 4; Feb ru ary 26, 1897, 4; March 5, 1897, 4; April 30, 1897, 4; May 21, 1897, 4; June 25, 1897, 4. The Lat ter-day Saints also turned Utah Pi - o neer Day on July 24 into a lo cal fest i val, which may have made St. John the 38 The Journal of Mor mon His tory cism of Bickerton; and except for a thinly disg uised 1892 sa tir ica l dia - tribe en tit led “Them Old Times,” no more att acks ap peared against the elderl y, re spected prophet. Bickerton like wise paid litt le att en tion to Mor mon ac tiv i ties, though he re mained un re lent ing in his op po sition to the LDS Church. He re sumed his work of min ist er ing to the Lamanites; and dur ing the 1890s, he and his fol low ers made re peated visit s to Ind ian Ter rit ory. In 1890 Bickerton sold his in ter est in the City Ho tel and left for his third trip to the ter rit ory. He was back in St. John in the spring of 1891, but many Saints were focused on their ag - ri cul tural in ter ests and had be come ab sorbed by Pop u list Party ac tiv i - ties by that time. Few churches of any denom i na t ion had much of an im pact, but an ecu men ica l move ment was afoot. Though it went mostly unno ticed, the few re main ing members of Wil liam Cadman’s Kansa s branch who had thus far re sisted LDS en treat ies were again at- tend ing worship ser vices with Wil liam Bickerton.74** Cadman was well aware that his inf luence over the west ern branch of the Church had been wan ing since 1887, but now he was in dang er of losing what remained of his fol low ers in St. John. Mov ing to renew their sense of pur pose, Cadman declar ed in a conf er ence held in Pennsyl va nia in Jan uar y 1894 that it was the will of God to resur rect the Ind ian Mission that, in his view, the Church had abandoned in 1869. Under his dir ect ion, the Pennsyl va nia Saints resol ved to “consider the Ind ian Ter rit ory Mission as bind ing on the Church at this time as ever at any time prev io us.”75***Cadman ig nored the exis t ence of Zion Val ley, and Bickerton’s un in ter rupted ef forts on the Oklahoma res er va tions, so his proc la ma tion had lit tle im me di ate im pact in St. John. His Kan sas mem bers con tin ued meet ing with Bickerton, which in 1896 in spired him to in ter pret a dream to mean that the St. John only town in Kan sas to cel ebr ate this Mor mon hol i day. “Utah Pi o neer Day,” St. John County Cap ital, July 23, 1897, 4. ** 74E. M. Benton, “Them Old Times: A Bit of Lo cal Fic tion That Is Not Wholly Fic ti tious,” St. John Weekly News, May 27, 1892, 4; St. John County Cap - i tal, Sep tem ber 25, 1890, 4; “Lo cal News,” St. John Weekly News, Sep tem ber 18, 1890, 5. Bickerton’s Saints were not alone in turn ing to Pop u lism. Many ru ral Kan sans in the 1890s felt that rel i gion had failed them and be gan turn ing to Pop u list pol i tics as a sec u lar al ter na tive to or ga nized re li gion. See Gary R. Entz, “Re li gion in Kan sas,” Kan sas His tory 28 (Sum mer 2005): 138. *** 75Cadman, Histor y of the Church of Je sus Christ, 91. GARY R. ENTZ/THE BICKERTONITES 39 branch of the church was like a piece of rott en wood in the founda t ion of an other wise sound house.76**** Bickerton paid no heed to Cadman’s prono uncemen ts, and in 1895 Bickerton’s Saints be gan is su ing in vi ta tions to in ter ested cit i - zens to att end their meet ings in the court house. Here the Church mem bers of fered to “show up the au thor ity and dif fer ence bet ween the Lat ter Day Saints church of Stafford county and the Utah church.” They be gan call ing themsel ves “Stafford County Saints” to stress their loca l ties and to dif fer en tiat e their Church both from the “Utah Mor mons” and “Monongahela Saints” who still fol lowed Cadman. Nev er the less, de spite the es tab lish ment of a per ma nent Utah LDS branch in town, Bickerton remained fixat ed on the In - dian Mission. He retur ned to the ter rit ory in late 1895 for an eight-month stay and rejoiced in bring ing in some “few honest souls.” How ever, he blamed Mor mon ef forts in Oklahoma Ter rit ory for slowing his work. Bickerton lamen ted that “some have been almost persuaded to come out and do God’s will but the stigma seems to be that ‘We are connect ed with the Utah Mor mons,’ but we are labor ing hard to break down the preju d ice and there is good inf luence working. ”77+ Despit e his complain ts of preju d ice, Bickerton in 1897 and 1898 made two ad dit ional trips to Oklahoma Ter rit ory. His great est suc - cess, though, came in St. John, where his Church or gan iza t ion con tin - ued to grow in strength. His fol low ers had been witho ut a per manen t house of worship since the 1882 loss of the Zion Val ley meet ingho use; but once they had re gained some of their old vigor, many expr essed a desir e for some thing more substan tial than a public meet ing room in the court house. Alt hough their orig ina l site was gone and they lacked the funds to buy it back from the LDS Church, Bickerton’s Saints could still gather enough re sources for a small struc ture that would mark them as per manen t among the town’s churches. In 1899, the Bickertonites obt ained a lot on West Second Street and erected a small frame build ing to serve as their per manen t church build ing in St. John. Their new church was plain and built with out the fan fare

**** 76Ibid., 92–93. + 77St. John County Cap ital, Sep tem ber 27, 1895, 4; Sol Van Lieu, ibid., Oc to ber 18, 1895, 4; Sol Van Lieu, ibid., Oct o ber 25, 1895, 4; Wil liam Bickerton, “From the Ind ian Ter rit ory,” St. John County Cap ital, July 17, 1896, 4. 40 The Journal of Mor mon His tory

The Bickerton meet ing house, erected in 1899 on West 2nd Street in St. John. W. H. Cadman, A History of the Church of Jesus Christ (Monongahela, Pa.: Church of Jesus Christ, 1945), 96. that had ac com pa nied the new LDS build ing, but its ap pear ance served as a re minder of Bickerton’s un yield ing persis t ence in Kan- sas.78++ In 1898 Bickerton’s brother, Ar thur, became a member of Cadman’s church in West Eliza bet h, Pennsyl va nia, and the old wounds that had fest ered among the Bickertonites for almos t two decades slowly healed. Ar thur Bickerton had exper imen ted with mem- bership in the RLDS Church in Misso uri but abandoned it, remar k-

++ 78St. John County Cap ital, May 7, 1897, 4; St. John County Cap ital, Feb ru- ary 18, 1898, 4; Stafford County Histor y, 1870–1890 (Stafford, Kans.: Stafford County His tor i cal and Ge ne a log i cal So ci ety, 1990), 99. GARY R. ENTZ/THE BICKERTONITES 41 ing, “They have a form of Godli ness but not the power.” His retur n raised the quest ion of bring ing for mer members back into the fold, an is sue that in cluded striv ing for rec on cil i a tion with Wil liam Bickerton in Kansa s. While trying to expand his church’s Ind ian Mis- sion in Oct ober 1900, Cadman made a per sonal visit to St. John and Bickerton. The visit brought no reso lu t ion to their dif fer ences, and Cadman depart ed, consid er ing Bickerton “as yet stand ing aloof from the Church.” Nev er theless, he remained open to a reun if ica t ion be - tween the east ern and west ern branches and, in 1902, sent Elder Alex - ander Cherry to St. John to meet with Bickerton and his fol low ers.79+++ Ar thur Bickerton died in 1902, and feel ings of his own mor tal ity may have led the eighty-seven-year-old Wil liam Bickerton to seek an ac- cord with Cherry. He did not want a div ided church to be his leg acy. In No vem ber 1902, Bickerton and Cherry reached an agree ment that made the two branches one again.80++++ Under this ar rangemen t, Cadman became presi den t over the en tire Church; and from his under stand ing, Bickerton was being re - admit t ed to the Church as an elder af ter twenty-two years as an apos- tate. Bickerton had a dif fer ing con cept ion. He saw himself as ret ir ing with no break in the con tin uit y of his Church ser vice. While never men tion ing the old adul tery charges, he con sid ered re uni fi ca tion of the two branches as an admis sion that Cadman had been mist aken in his ear lier zeal. Bickerton made this perspec t ive per fectly clear in July 1903 when he sub mitt ed his fina l writt en test imon y to the ann ual con - fer ence in Pennsyl va nia. In ru mi nat ing over his life’s work for the Church and in Ind ian Ter rit ory, Bickerton wrote, “Don’t think I am trying to throw any ref lect ions on any one. . . . I am only trying to give you all a brief sketch of my own expe r ience with God, feel ing the blessing in do ing so, not knowing whether or not it will be accept able to all.” Despit e his disclaimer , Bickerton un derscor ed that “ev ery

+++ 79Al ex an der Cherry was a sig nif i cant fig ure in Cadman’s Penn syl va- nia branch. He be came a mem ber of the Quo rum of the Twelve when the Cadman branch recon sti tuted that body in 1904, and it was Cherry who, in Janu ar y 1906, succeeded Wil liam Cadman as presi dent of the Church of Je - sus Christ (Bickertonite) aft er the deaths of both Bickerton and Cadman in 1905. In 1902, Cherry, an im mi grant from Scot land, was forty-five and a coal miner. He and his wife, Amy, age forty-nine, had three sons and a daugh ter. ++++ 80Cadman, A Histor y of the Church of Je sus Christ, 94–97. 42 The Journal of Mor mon His tory church has a his tory of its own, and I was the org a nizer of this church.” He believ ed that he had struggled against the odds throughout his life and had done his “best for the work of God, and with God’s help, I will so con tinue in the futur e.” Bickerton’s test imo n ial had the desir ed shock ef fect. It disturb ed the Pennsyl va nia elders because Bickerton presen ted his per sonal life story as an unbr ok en his tory of the Church with no ack nowledg men t of any sepa r at ion from Cadman. Nev er theless, no one wanted to reopen any freshly healed wounds, so aft er discuss ing the matt er, the elders endor sed his test i - mony “as far as he was a member in good stand ing in the Church.”81* In Jan uar y 1905, Bickerton, one of St. John’s “oldest and most highly re spected cit i zens,” cel e brated his nine ti eth birth day. He used the oppor tun ity to ad dress the resi den ts of the town he had founded, re mind ing them once again that his Saints were not Utah Mor mons. We “are Stafford County Saints, who have come here from Pennsyl va nia, West Vir ginia, Ohio, and East ern Kan sas.” Bickerton wanted ev ery one to know that he and his fol low ers “loved the peo ple of Kan sas and es pe cially those of St. John as they have never in ter fered with our view of Christ ian ity.” The win ter of 1904–05 was a memo r able one for Bickerton since Christma s, New Year’s Day, and his birthda y all fell on the Sab bath, which he took as a sign of God’s or der in the world. He re assert ed his belief in the Book of Mor mon but was clearly tired of the struggle and re marked, “I feel like Job that the balance of my life [sic] I will wait un til my change comes. I have no enem y that I know of, and only pity the poor souls that do not believ e in Christ ian ity.”82** Bickerton did not have long to wait. On a frigid Febr uar y eve - ning the elderl y man took a heat ing stone from the stove and placed it on his bed to keep his feet warm while he slept. The rock was too hot for the bed ding, and a cin der that had smolder ed all night erupted into a blaze early in the morn ing. The city volun teer fire depart ment quickly react ed to the alarm and ex ting uished the f lames bef ore the house suf fered any sig nif ican t damag e. Bickerton sur vived with min i - mal inju r ies, but the St. John Weekly News obser ved that “the shock was

* 81Bickerton, “Test i mony, June 1903,” 13–14; Cadman, A His tory of the Church of Je sus Christ, 99. ** 82Wil liam Bickerton, “Elder Bickerton Writes,” St. John Weekly News, Janu ary 20, 1905, 1. GARY R. ENTZ/THE BICKERTONITES 43

Stand ing next to Wil liam Bickerton’s grave stone in the St. John Cem etery is this mod ern me mo rial, iden ti fy ing Bickerton as “suc ces sor to Jo seph Smith.” Photo by Gary Entz, July 2006. almos t too much for him and that he is in a very fee ble cond it ion.”83*** Indeed, the trauma proved too great for the aged prophet, and within a week “Uncle Billie Bickerton” was dead. As the en tire town mourned the loss of the old pio neer , Bickerton took one fina l stab at his ad ver sar ies. In an tic i pa tion of his pass ing, he had pre se lected the lamen tat ion of Job to serve as the text of his funer al ser mon. Job 19 expr essed Bickerton’s feel ings of betr ayal and abandon men t dur ing the years he had been at odds with Cadman and the Utah LDS Church. A se lec tion from Job 19:4–10 reads: And be it in deed that I have erred, mine error remaineth with my - self. If indeed ye will mag nify your selves against me, and plead against me my re proach: Know now that God hath overthrown me, and hath com passed me with his net. Be hold, I cry out of wrong, but I am not heard: I cry aloud, but there is no judgement. He hath fenced up my way that I cannot pass, and he hath set

*** 83“A Small Blaze,” St. John Weekly News, Feb ru ary 17, 1905, 1. 44 The Journal of Mor mon His tory

darkness in my paths. He hath stripped me of my glory, and taken the crown from my head. He hath de stroyed me on ev ery side, and I am gone: and mine hope hath he re moved like a tree. At the same time, how ever, verse 25 re af firmed his faith that “my re deemer liveth, and that he shall stand at the lat ter day upon the earth.”84**** Wil liam Bickerton’s death marked the end of an era for the Church of Jesus Christ (Bickertonite). In No vem ber 1905 Wil liam Cadman fol lowed Bickerton to the grave, and a new gener at ion assumed lead ership of the Church. The Church Bickerton founded con - tin ues to bear his name and has remained his great est leg acy, but Cadman had a fina l vict ory in his long batt le with Bickerton. In 1945 Wil liam H. Cadman, the son of Wil liam Cadman and of fi cial hist o- rian of the Church, agreed with his fa ther’s view of Church his tory and wrote Wil liam Bickerton and the west ern branch in St. John out of much of the Church’s chron icles. The re sult has been that the mem ory of Bickerton has become ob scured within his own church. In Cadman’s Histor y of the Church of Jesu s Christ, Bickerton ap pears as the found ing prophet but his lifework in Kansa s and Ind ian Ter rit ory after the 1880 adult ery al leg at ion is ig nored en tirely. The memor y of Bickerton became as Job 19:14, which was read at his funer al: “My kinsf olk have failed, and my familiar friends have forgotten me.”

**** 84“A Pi o neer Gone,” St. John Weekly News, Feb ru ary 24, 1905, 5; “Wm. Bickerton,” St. John County Cap ital, Feb ru ary 23, 1905, 1. Wil liam Bickerton was sur vived by five chil dren: Eliza Cardw ell, Angelina Grant, Jose phine Hearn, James Bickerton, and Alma Bickerton. MOUN TAIN MEADOWS SURVI VOR ? A MI TO CHON DRIAL DNA EX AM I NA TION

Ugo A. Perego and Scott R. Woodward *

ON SEPTEMBER 11, 1857, A BAND of In dians, joined by lo cal resi - dents from southern Utah, att acked a party of appr oxi mately 140 men, women, and childr en in the val ley of Moun tain Meado ws, near Cedar City. The vict ims of the trag edy were part of the Baker-Fancher wagon train, a group of em ig rants on their way from Arkan sas to Cal i for nia. Only a small number of young chil - dren sur vived the assault, and were given to neigh bor ing Mor - mon fam i lies to care for. In 1859, gov ernmen t of fic ials inv est ig at - ing the inc iden t gather ed all the sur viv ing childr en who could be iden tif ied and retur ned them to rela t ives in the east. The mass mur der that took place at Moun tain Meado ws is known as the Moun tain Meado ws Massa c re and has been the focus of numer ous publi cat ions, each one att empt ing to bring new light to an event whose det ails are likely to re main ob fuscat ed. Because many of the orig ina l jour nals and lett ers have been destr oyed or lost, var io us anec dotes have re placed first-hand writt en acco unts. One of the mys- ter ies em bed ded in this epi sode is the ex act number of childr en who were spared dur ing the att ack. Early acco unts re ported the fig ure to

* UGO A. PEREGO {[email protected]} is Dir ect or of Oper at ions and SCOTT R. WOODWARD {[email protected]} is Chief Sci en tific Of fi cer and Princ ipa l Inv est ig at or at the Sorenson Molec u l ar Gene a logy Founda t ion {www.smgf.org}. Ad dress quer ies to Ugo Perego at the Foun da tion, 2511 South West Tem ple, Salt Lake City, Utah 84115, phone (801) 428–1050.

45 46 The Journal of Mor mon His tory be sev en teen, based on the to tal number of childr en even tua lly re - turned to rela t ives in Ar kansa s.1**Other versions state that eigh teen or more childr en sur vived the massa c re,2***im plying that some of the fam - i lies who receiv ed the childr en hid them when civil aut hor it ies made att empts to reclaim them. Fami ly his tor ian Anna Jean Backus has re - ported that a young blond girl, pur port edly the young est child of Al- exan der Fancher and Eliza Ingram Fancher, was given into the care of Philip Klingensmith and his wife, Betsy Catt le Klingensmith.3****They named her Priscilla and said she was born March 20, 1855, two and a half years bef ore the massa c re. Accor d ing to these acco unts, Priscilla grew up as a Klingensmith and mar ried John Urie, on No vem ber 24, 1873. The couple lived in Cedar City most of their lives.4+ This ar ticle desc ribes a type of DNA test ing uti lized to rev eal the bi o log i cal ma ter nal par ent age of Priscilla Klingensmith Urie. DNA samples were obt ained from one of Priscilla’s descen dan ts and from two ad dit ional mat er nally linked lin eages in an att empt to recon struct genet ic data that would conf irm or ex clude Betsy Cat tle Klingen- smith as Priscilla’s birth mother.

** 1Wil liam Bishop, Mor moni sm Unveiled; or the Life and Con fes sions of the Late Mor mon Bishop, John D. Lee, 1887, as cited in Will Bagley, Blood of the Proph ets: Brigham Young and the Massa cr e at Moun tain Mead ows (Nor man: Uni versit y of Oklahoma Press, 2004), 154. Bagley lists the sur viv ing chil - dren on 159, 388–89. See also Charles W. Penrose, The Moun tain Mead ows Mas sa cre (1884; rpt. Roy, Utah: Eborn Books, 2000), 12. Ac cord ing to Rich - ard E. Turley Jr., “Recen t Moun tain Meado ws Publ ica t ions: A Sampl ing,” Jour nal of Mor mon Histor y 32, no. 2 (Sum mer 2006): 220–21, points out that the Eborn version is repr inted from the 1899 edi tion, not the 1884 (first) edit ion, but that the dif fer ences are “minor copying ed it ing.” *** 2Sally Denton, Amer i can Mas sa cre: The Trag edy at Moun tain Mead ows, Sep tem ber 1857 (New York: Al fred A. Knopf, 2003), 139, 151, 196. Turley, “Recen t Mount ain Meado ws Publ ica t ions,” 215–16, lists numer o us “factua l er rors and shal low resear ch,” but does not spec if ica lly iden tify er rors in the sur vi vor list. **** 3Anna Jean Backus, Through Bonds of Love: In the Shad ows of the Moun - tain Mead ows Mas sa cre (Orem, Utah: Self-pub lished, 1998), 21. + 4Juanita Brooks, The Moun tain Mead ows Mas sa cre, 2d ed. (1950; rpt., Nor man: Uni versit y of Oklahoma Press, 1987), 101–5; Anna Jean Backus, Moun tain Mead ows Wit ness: The Life and Times of Bishop Philip Klingensmith (Spo kane, Wash.: Ar thur H. Clark Com pany, 1995), 15–21, 141, 144. PEREGO AND WOODWARD/MOUNTAIN MEADOWS DNA 47

Fig ure 1. Cell di a gram.

MITOCHONDRIAL DNA TESTING AND FAMILY HISTORY The use of DNA to success ful ly re construct genet ic inf or mat ion for gene a log i ca l and hist ori ca l purposes 5++ has been demon str ated prev io usly with three al leged childr en of Joseph Smith Jr. born to his plu ral wives.6+++ The DNA test used in the Smith case uti lized Y chro- mosome mark ers, which are found only in males and are helpful in studying strict pat er nal lin eages. How ever, a smaller segmen t of DNA found out side the nucleus of cells in organelles called mit ochon dria (see Fig ure 1), can also be used for test ing fami l ial rela t ionships. Each cell has hundr eds of mit ochon dria and each mito- chondrion con tains mul ti ple cop ies of mi to chon drial DNA

++ 5Ugo A. Perego, Ann Turner, Jayne E. Ekins, and Scott R. Wood ward, “The Sci ence of Mo lec u lar Ge ne al ogy,” Na tional Ge ne a log i cal So ci ety Quar - terly 93 (De cem ber 2005): 245–59. +++ 6Ugo A. Perego, Natalie M. Myres, and Scott R. Wood ward, “Re con - struct ing the Y-Chro mo some of Jo seph Smith: Ge ne a log i cal Ap pli ca tions,” Jour nal of Mor mon Histor y 31 (Fall 2005): 42–60. The con clu sion in all three exam ples (Moroni L. Pratt, Zebulon Jacob, and Orrison Smith) was that it was highly un likely that Jo seph Smith was their fa ther. 48 The Journal of Mor mon His tory

Fig ure 2. Mi to chon - 16024 16365 73 340 576 drial DNA mole cule HVR1 HVR2 with con trol re gion. CONTROL REGION (D-loop)

16,569 bp

(mtDNA). MtDNA is a cir cular genome and con tains 16,569 chemi ca l bases called nucleo tides. (See Fig ure 2.) Compar ed to the three bil - lion nucleo tides found in the nu clear genome, the mtDNA genome is quite small. In a seg ment of mtDNA called “con trol reg ion,” random changes, called mut at ions, may occur in each new gener at ion. (See Table 1.) Over the years, these mut at ions accu m ulat e and creat e unique mtDNA prof iles, called haplotypes, which are char act er ist ic of spe cific an ces tral or i gins and mi gra tion pat terns. Mu ta tions in the con trol reg ion are harm less because they are not responsible for any life-sustaining activity. The con trol reg ion com prises 1,121 bases, which con tains two segmen ts known as hypervariable reg ion I (HVR1) and hy pervari - able reg ion II (HVR2) that are trad it iona lly used for matching pur - poses. For simplic ity, mtDNA seq uences are compar ed to an in dustr y standar d called the Cambridge Ref er ence Se quence (CRS) and only dif fer ences in the seq uence are report ed.7++++MtDNA haplotypes with ident ica l muta t ions may ind icat e a common ances tr al and

++++ 7For the com plete CRS sequence, see Human Mi to chon drial DNA PEREGO AND WOODWARD/MOUNTAIN MEADOWS DNA 49

TABLE 1 EXAMPLE OF TWO DNA SEQUENCES WITH MUTATION AT BASE POSITION 7

Ref er ence Se quence: TAGCCGATACGACGATACGGACTAGACGTACACCCATCGTTACG

Com par i son Se quence: TAGCCGTTACGACGATACGGACTAGACGTACACCCATCGTTACG geographical origin. While Y chromo some test ing as pre sented in the Joseph Smith study is traceable ex clusiv ely along the pat er nal lin eage (from fat her to son),8* mtDNA fol lows the mat er nal line. Both males and fema les carry mtDNA in their cells; how ever, childr en inher it it from their mothers only. In ad dit ion, mtDNA does not recom bine and, with the excep t ion of small random mut at ions, is passed essen tially un- changed from one gener at ion to the next. This type of genet ic test ing be came pop u lar for ge ne a log i cal pur poses af ter it was used to iden - tify the remains of Czar Nich ola s Romanov’s wife and chil dren.9** Later, the same test was used to dispr ove the iden tity of Anna Ander - son Manahan, who claimed to be Nicho la s’s daught er Anastasia.10*** Using techn iques simi lar to the Romanov study, we em ployed ge netic test ing to re solve the bi o log i cal par ent age of Priscilla Klingensmith Urie, the pur ported eight eenth sur viv ing child of the massa c re at Mountain Meadows.

THE CASE STUDY CANDIDATE Ac cord ing to Anna Jean Backus, spec ific ev idence that Priscilla was a Klingensmith by birth is lack ing. First, her birth cer tif icat e was

Re vised Cam bridge Ref er ence Se quence, up dated Au gust 25, 2006, http://www.mitomap.org/mitoseq.html (ac cessed Oc to ber 2, 2006). * 8Perego, Myres, and Wood ward, “Recon struct ing the Y-Chro mo - some of Joseph Smith.” ** 9Pet er Gill et al., “Iden ti fi ca tion of the Remains of the Romanov Fam - ily by DNA Analy sis,” Na ture Ge net ics 6 (Feb ru ary 1994): 130–35. *** 10Pet er Gill et al., “Est ab lish ing the Iden tity of Anna An derson Mana - han,” Na ture Ge net ics 9 (Janu ary 1995): 9–10. 50 The Journal of Mor mon His tory never found; and second, she does not appear in the Utah Ter rit ory census re turns of 1856.11****Backus theref ore concludes that, af ter the massa c re, Philip Klingensmith took the child in, gave her a new birth- day (March 20, 1855), and re named her Priscilla.12+ Priscilla’s al leged mother, Betsy Cat tle, was born Sep tem ber 9, 1835, in Foleshill, Warwickshire, England and mar ried Philip Klingensmith on May 30, 1854, in Ce dar City.13++ In ad dit ion to Priscilla, Betsy had four childr en, all youn ger than Pricilla: Mary Al - ice, born on March 19, 1857, Betsy Ann, born on July 9, 1859, Mar ga - ret Jane, born on March 5, 1863, and Wil liam Cat tle, born on April 16, 1865. To con firm Betsy Cat tle’s mtDNA haplotype, we iden tif ied and tested a descen dan t of her daught er, Betsy Ann, and of her sis ter Mary, Priscilla’s alleged aunt.

COMPARING MtDNA HAPLOTYPES Priscilla’s mtDNA seq uence was inf erred by col lect ing a bio log i - cal sample from one of her liv ing descen dan ts through an unbr ok en mother-daught er lin eage. (See M1 in Fig ure 3.)14+++To de ter mine the mtDNA seq uence of Betsy Catt le, we gener ated two ad dit ional mtDNA haplotypes from samples col lected through descen dan ts of Priscilla’s al leged sist er, Betsy Ann Klingensmith, who was born two years af ter the massa c re, and also from Betsy Cat tle’s sis ter, Mary Cat - tle Bladen, and whose bio log ica l rela t ionships to mother Betsy Cat tle were unquestioned. (See M2 and M3 in Figure 3.) Bi o log i cal sam ples were gath ered us ing a mouth wash rinse pro- cedur e and DNA was extr acted from the cel lular ma ter ial using the Gentra Syst ems’ Puregene® DNA Pu ri fi ca tion Kit pro to col (http:// www.gentra.com/pdf/400128-000.pdf). MtDNA se quences were gen er ated by Sorenson Genomics Lab o ra to ries (http://www. SorensonGenomics.com) using ABI 3700 aut omat ed genet ic ana lyz- ers and seq uenced using Gene Codes’ Sequencher® soft ware (Gene

**** 11Backus, Moun tain Mead ows Wit ness, 144. + 12Backus, Through Bonds of Love, 54. ++ 13Backus, Moun tain Mead ows Wit ness, 85. +++ 14Names of par tic ipan ts in this study have been with held to pro tect their pri vacy. PEREGO AND WOODWARD/MOUNTAIN MEADOWS DNA 51

Philip Klingensmith Betsy Cattle Mary Cattle

Priscilla (born 1855) Betsy Ann (born 1859)

M3 M1

Fig ure 3. Pedi gree showing the mater nall y linked lin eages of Priscilla, Betsy Ann, and Mary Cat tle.

Codes, Ann Arbor , Michi g an).15++++ MtDNA haplotypes repr esen t ing mut at ions from the CRS are summa r ized in Table 2. The three haplotypes inf erred for Priscilla Klingensmith, Betsy Ann Klingensmith, and Mary Cat tle Bladen show iden ti cal mut a tions in the con trol re gion: 16224 (C), 16311 (C), 16320 (T), 16519 (C), 73 (G), 146 (C), 152 (C), 263 (G), in di cat ing that the three women share a common mat er nal ances t or. The ge netic data gen er ated from this study, combined with available hist or ica l and gene a log i ca l sources, suppo rt a matrilineal rela t ionsh ip bet ween Priscilla Klingensmith Urie and Betsy Cattle Klingensmith. To evalu at e the fre quency of the ob served haplotype in the general pop ula t ion, we used this haplotype to query the on line Feder al Bu reau of In ves ti ga tion mtDNA da ta base, which con tains 4,839

++++ 15Wal ter Bär et al., “Guidel ines for Mit o chondr ial DNA Typing,” Vox Sanguinis 79 (2000): 121–25. 52 The Journal of Mor mon His tory

TABLE 2 MtDNA MUTATIONS FOR THE THREE INDIVIDUALS TESTED IN THIS CASE STUDY

HVR1 HVR2 16224 16311 16320 16519 73 146 152 263 CRS T T C T A T T A M1 C C T C G C C G M2 C C T C G C C G M3 C C T C G C C G mtDNA haplotypes.16*Because many recor ds in this dat aba se report only base po si tions 16,024 through 16,365, the mut a tions ob served at 16,519 and those in HVR2 for the ma ter nally re lated Cat tle haplotypes could not be compar ed. Consid er ing only mut at ions at 16,224, 16,311, and 16,320, the fre quency of match ing haplotypes in the FBI dat aba se is 0.2% (9 of 4,839 haplotypes). It is possi ble that the fre quency of match ing haplotypes would be less than 0.2% if longer sequences were available to compare. Com par i son for HVR1 and HVR2 to the Uni ver sity of Pavia mtDNA da ta base (10,667 se quences)17**yielded only four exact matches (0.04%), all from Iceland. A fifth sample, also from Iceland, matched the Cat tle haplotype with an ad dit ional mut at ion at base posi tion 150. Ad di tional com par i sons to the Sorenson Mo lec u lar Ge ne- al ogy Foun da tion mtDNA da ta base18***(4,092 se quences) and to the

* 16Keith L. Monson et al., “The mtDNA Pop u la tion Da ta base: An In te - grated Soft ware and Da ta base Re source for Fo ren sic Com par i son,” Fo ren sic Sci ence Com mu ni ca tions 4 (April 2002), elec tronic edi tion http://www. fbi.gov/hq/lab/fsc/backissu/april2002/miller1.htm (ac cessed May 4, 2006). ** 17We con sulted the mtDNA da ta base “Genetica Umana” of pub - lished and unpub l ished data be long ing to the labo ra tory of An to nio Torroni, pro fes sor of Hu man Ge net ics, De part ment of Ge net ics and Mi cro - bi ol ogy, Uni ver sity of Pavia, It aly. *** 18Sorenson Molec u l ar Gene a logy Founda t ion, “Sorenson MTDNA PEREGO AND WOODWARD/MOUNTAIN MEADOWS DNA 53

Hu man Mi to chon drial Ge nome Da ta base19****(1,624 se quences) pro - duced no exact matches, which fur ther sup ports the conclu sion that the haplotype is rare. The low fre quency of the haplotype shared by Priscilla Kligensmith, Betsy Ann Klingensmith, and Mary Catt le Bladen in available mtDNA dat aba ses strongly support s a close ge netic re lat ionship of the three women.20+

CONCLUSION Priscilla Klingensmith Urie has been recor ded as one of the sur - viv ing chil dren from the Moun tain Mead ows Mas sa cre fol low ing incon sis ten cies in the avail able ge ne a log i cal re cords. As a con se quence, the sugg est ion has been advanced that Philip Klingensmith and Betsy Catt le Klingensmith, who raised Priscilla as their daught er, might not have been Priscilla’s bio log ica l par ents. DNA test ing per formed on the mtDNA con trol reg ion of descen dan ts from Priscilla, her al leged young er sis ter Betsy Ann, and her al leged mat er nal aunt Mary Cat tle Bladen, rev ealed three iden tica l haplotypes. The matching mtDNA seq uences pro vide a strong in dica t ion of a com mon mat er nal ances - tor for the three lin eages, support ing the con clusion that Betsy Cattle Klingensmith was Priscilla’s biological mother. This method of test ing for fami l ial rela t ionships using the mtDNA con trol reg ion does have some lim it at ions, in clud ing in some cases a poor res olu tion.21++How ever, con trol-re gion haplotypes char ac- ter ized by a well-def ined mutational mo tif, such as that obser ved in this study, are clear in dica t ors of a shared matrilineal ances tr y. In this case study, the inf erred haplotype of Priscilla was found at low to zero freq uency in the available dat aba ses, thus making extr emely unlik ely that Priscilla Klingensmith and Betsy Catt le had a matrilineal link dif - fer ent from a direct mother/daughter relationship.

Dat a base,” http://www.smgf.org/mtdna/search.jspx (ac cessed July 31, 2006). **** 19Uppsala Univ ersity , “mtDB—Human Mit ochon dria l Genome Data - base,” http://www.genpat.uu.se/mtDB (ac cessed on March 27, 2006). + 20An to nio Torroni, email to Ugo Perego, May 10, 2006. ++ 21An to nio Torroni et al., “Har vest ing the Fruit of the Hu man mtDNA Tree,” Trends in Ge net ics 6 (June 2006): 339–45. RHET O RIC AND RIT UAL: A DE CADE OF WOMAN’S EX PO NENT DEATH PO ETRY

Kylie Nielson Turley

IN HER PI O NEER ING 1985 ar ticle sur veying the first ten years of poetry in the Woman’s Ex po nent (1872–82), Maureen Ursenbach Beecher concludes that, while “one might dispar age the poet ic skill” of the women po ets, the “con tent ought not to be dis - missed.”1*She ar gues that “the very act of compos ing verses was a statemen t of iden tity, an af fir mat ion of gen til ity, [and] of civ i lized wom an hood.”2**The act of com pos ing po etry spe cif i cally about death and dying—wh ether the death be actua l or met a- phoric—seems to encom pa ss other cul tural work as well. With Beecher’s study exist ing as a framew ork and point ing out death poetr y as a “sub cat e gory,” the first decade of Ex po nent death poems can be ana lyzed to under stand their pur pose and func- tion.3***As a type, death poems bring to light a group of women vac il lat ing be tween hope and de spair, search ing des per ately for

* KYLIE NIELSON TURLEY {[email protected]} is an instruc - tor of Honors writ ing at Brigham Young Univ ersit y, a member of the Board of the Asso c ia t ion for Mormon Let ters, and an ed it or of Segullah, an on line LDS women’s lit er ary jour nal. She presen ted a version of this pa per at the Asso ci a tion for Mor mon Lett ers ann ual con fer ence, March 5, 2005, in Salt Lake City. 1Maureen Ursenbach Beecher, “Po etry and Pri vate Lives: Newspa per Verse on the Mor mon Fron tier.” BYU Stud ies 25, no. 3 (1985): 58. ** 2Ibid., 59. *** 3I de cided to fo cus on one decade primar ily so I could make appr o pri - ate compar i sons with Beecher’s prev i ous study. Death rates did not drop

54 KYLIE NIELSON TURLEY/RHETORIC AND RITUAL 55 rec onc il ia t ion to a com mon trial, and at times doing so in ways dif fer ent from their male Lat ter-day Saint peers. LDS women were not doing any thing unique when they wrote death poetr y. Michael Wheeler, in Death and the Futur e Life in Victo r ian Lit er a ture and The ol ogy, points out that Vict or ians had an “obses siv e in - ter est in death,” lead ing to, among other things, “a remar kabl y high propor tion of the lyric poetr y of the per iod, par ticu larl y by women writ ers, ad dress[ing] the themes of death and dying. ”4**** Wheeler considers women’s death poetr y as much a part of the “Vic tor ian cult of death” as the elab or ate funer al lit urgy of the era. Though Mor mons, like Prot est ants, were not given to “pomp and extr av ag ant displa ys of mourn ing” as were many other Vict or ian reli gions, LDS his tor ian Da - vis Bitton concludes that these reli gious groups did not complet ely avoid rit ual, eit her.5+ The abundan t writ ing of death poetr y coin c ides with the con ven tional (typ i cally fem i nine) Vic to rian ap proach to death, while LDS funer al rites were more restr ained than those of many of their Amer ican peers. The need to recon c ile one’s self to death is clear, as far as the ninet eenth cen tury is con cerned. In her 1881 poem, “Ere Comes the Night,” Mor mon au thor Em ily Hill Woodmansee, sur vi vor of the di - sastr ous 1856 Willie handcart com pany, speaks of “Death’s shado ws” fall ing ev ery where “upon our right and left.”6++ Sta tis ti cally speak ing, she was right; one was almos t cer tain to have mult iple and in timat e deal ings with death dur ing the ninet eenth cen tury and not just dur - ing the rugg ed jour ney across the Great Plains. In their study, “Infan t Deaths in Utah, 1850–1939,” Lee L. Bean and his as so ci ates found dra mat i cally un til the turn of the cen tury, and death po etry con tinued in the Woman’s Ex po nent in a sim i lar fashion. Coin c i den tally, as noted later, LDS women be gan speak ing at fu ner als af ter 1900. **** 4Mi chael Wheeler, Death and the Fu ture Life in Vic to rian Liter atur e and The ol ogy (Cam bridge, Eng.: Cambr idge Uni versit y Press, 1990), 25. + 5Da vis Bitton, “Mor mon Funer al Ser mons in the Nine teenth Cen - tury,” in Mor mons, Scriptur e and the Ancie nt World, ed ited by Da vis Bitton (Provo, Utah: Foun da tion for An cient Resear ch and Mor mon Stud ies, 1998), 27. ++ 6Em ily Hill Woodmansee, “Ere Co mes the Night,” Woman’s Ex po nent 10 (De cem ber 1, 1881): 99. For bio graph i cal in for ma tion, see Orson F. Whitney , “Emi ly Hill Woodmansee,” Histor y of Utah, 5 vols. (Salt Lake City: George Q. Cannon & Sons, 1904), 4:593–94. 56 The Journal of Mor mon His tory that at least “40 per cent of women sur viv ing in an in tact mar riage to age forty-nine and beg inn ing childbear ing bef ore 1895–99 would lose at least one infan t.”7+++ Over a third of childr en born in Utah never reached adult hood, with childr en under twelve compr ising nearly two-thirds of to tal deaths in west ern Mor mon sett lemen ts.8++++Adults also faced ill ness, ac ci dents, and gen er ally un healthy con di tions, all com pli cated by lim ited med i cal care.9* A sim ple sur vey of the topics of the po etry support s Woodmansee’s feel ing that death was ubiq uit ous. Death is found in eulo g ist ic poems for real persons as well as in poems for fic tit ious persons and gener al poetr y about dying. Met aphoric death shows it self dur ing all sea sons of the year—unsurprisingly in po etry about win ter, yet also in po etry about April, June, and mid-summer .10** Death crops up in po ems os tensi bl y on topics rang ing from new brides to New Year’s Day, from instruc tions to girls on help ing their mothers to a birthda y poem for Emmeline B. Wells.11*** Of more than four hundr ed po ems pub lished dur ing the Woman’s Ex po nent’s first decade, at least sixty-seven deal with death. While some ref er rather vaguely to death through na ture symbol ism or imagistically as the “night” that ends suf fer ing, many ref er to the death of obv io usly real people: oblique ref er ences to the “deaths of loved ones” but also named persons, as in the case of Eliza R. Snow’s, “Sa cred to the Memor y, of Our Belo ved Sist er, Mrs. Matilda Casper .” Indeed so many eulo g ies and po ems me - mo ri al iz ing par tic u lar per sons were re ceived that Woman’s Ex po nent

+++ 7Lee L. Bean, Ken R. Smith, Geraldine P. Mineau, Alison Fra ser, and Diana Lane, “In fant Deaths in Utah, 1850-1939,” Utah Histor i cal Quarterl y 70, no. 2 (2002): 172. ++++ 8Lester E. Bush, Health and Med icine among the Lat ter-day Saints (New York: Cross roads Pub lish ing, 1993), 41–42. * 9Julie Paige Hemming Sav age, “‘Yet I Must Submit ’: Mor mon Women’s Perspec tives on Death and Dy ing 1847-1900” (M.A. thesis, Brig- ham Young Uni versit y, 1995), 2–7. ** 10In Woman’s Ex po nent: Lu Dal ton, “Win ter Winds,” 8 (Janu ary 15, 1880): 131; Lula, “April,” 2 (April 15, 1874): 174; Emile, “Ode to June,” 7 (1 July 1878): 17; Emile, “Mid sum mer,” 7 (July 15, 1878): 25. *** 11In Woman’s Ex po nent: Lu Dal ton, “A Bride,” 2 (Au gust 15, 1873): 42; Lula, “New Year’s Greet ing,” 2 (Janu ary 1, 1874): 118; Home spun [Susa Young Gates] “New Year’s Eve,” 10 (Janu ary 15, 1882): 123; Sist er Lu [L. M. G. Hewlings?] 4 (March 15, 1876): 153. KYLIE NIELSON TURLEY/RHETORIC AND RITUAL 57 ed it or Emmeline B. Wells apolo g ized to sub scribers in Aug ust 1893: “It is almos t impos si ble to keep up with the number sent in for publi - cat ion” and implor ed that they not be of fended if all the poems and eulo g ies did not appear in print.12**** When some one died, women had a role to play in the mourn ing and in ter ment process. Susannah Morrill, assis t ant prof essor of re li - gious stud ies at Lewis and Clark Col lege, labels Mor mon women as “med ia t ors of liminality,” lit er ally the “first and the last,” those who stood “ready to wel come new com ers into the world” and who also sent “depart ing mort als to a higher and hap pier eter nal life.”13+ In her thesis, “‘Yet I Must Submit ’: Mor mon Women’s Perspec t ives on Death and Dying 1847-1900,” Julie Hem ming Sav age de scribes the typi cal ninet eenth-cen tury part of death ritu a ls in which women were in- volved, spec if i cally in “sitt ing up with the decea sed, sewing sac red burial clothing, [the] wash ing and laying out of bod ies, and walking in fu neral pro ces sions.”14++ Despit e women’s in timat e deal ings with the physi ca l process of death, Sav age notes that they were “excluded [from] speaking at fu ner als and ded icat ing graves,” the two fi - nal—and more spir i tual—rit u als of death.15+++ LDS women were spect a- tor-mourners dur ing the pub lic fu ner als, in keeping with the reli gious and so cial mor es of the Vic tor ian time per iod, though Sav age found that women “freq uently recor ded the con tents of the fu neral ad - dresses [in jour nals], oft en commen t ing . . . that the talks, music, and com mu nity sup port were com fort ing.”16++++ Per haps it was a wish for more of this conso la t ion as well as the exam ple of other nine - teenth-cen tury women that prompted LDS women to write and pub - lish death poetr y, a pub lic performance of their “mediator of liminality” role and one that has not been addressed by LDS scholarly literature.

**** 12Emmeline B. Wells, “Items,” Woman’s Ex po nent 22 (Au gust 1, 1893): 16. + 13Susannah Morrill, “White Roses on the Floor of Heaven: Natur e and Flower Im ager y in Lat ter-day Saint Women’s Liter a ture, 1880–1920” (Ph.D. diss., Uni versit y of Chi cago, 2002), 186. ++ 14Sav age, “Mor mon Women’s Per spec tives,” 48. +++ 15Accor d ing to Sav age, Mor mon women did not beg in speaking at funer als un til the early 1900s. Ibid., 74–75. The ded i ca tion of graves is still per formed ex clu sively by male priest hood hold ers. ++++ 16Ibid., 75. 58 The Journal of Mor mon His tory

Schol ars may have over looked Ex po nent death poetr y because it is simpl y not “good,” at least, not accor d ing to con tem por ary lit er ary values. As Beecher notes in her ar ticle, the persis t ent “failur es of the poet’s craft” tend to “make holy things profane and sincer e sen ti - ments lu di crous, most no tice ably by the jar ring jux ta pos ing of a verse patt ern inap pr opr iat e to the thought of the poem.”17* The first published death poem, “Sac red to the Memor y, of Our Belo ved Sis ter, Mrs. Matilda Casper ,” appear ed in the second issue of the Woman’s Ex po nent on June 15, 1872, and is in dic at ive of the lows in craftsman - ship. In the poem, Eliza R. Snow eulogizes Mrs. Casper and invokes LDS doctrine:

She has paid the last debt due to natur e; She to earth has the cask et re signed, That the morn of the first resur rec tion May re store it from dross all re fined.18**

The rhythmic ana pes t ic trim eter with its end-stopped lines canno t help be com ing sing-songy and un bend ing, of ten im pos ing awk ward, inv erted phrasing. Moreo ver, Snow’s mixed met aphor s work poorly at best; af ter in tro duc ing met al lur gic im ag ery in the first stanza (“dross all ref ined”), Snow switches in the second stanza and describes Mrs. Cas per’s “Mem’ry” as a “garland,” inv oking conno ta- tions of greener y and wreaths. Snow then switches back, tell ing readers the “garland” is made of “in teg rity’s jew els,” not “earthly al loys,” no doubt confus ing readers with Mrs. Caspar’s in flexi ble, metal garland. Per haps mean ing could be forced from Snow’s stiff lines and rote phrases; one could in ter pret the rigid style as a ref lect ion of fu- neral et iq uette, a sort of symbolic “dressing up” for the somber occa - sion, though the in ter pret at ion req uires some stretching. It seems more likely that such for mulaic po ems grew from pio neer women’s att empts to patt ern prec isely death poetr y writt en elsewher e. As Beecher points out, “The [Utah] women were loath to alt er their pattern lest their in ven tive ness re veal a qual i ta tive dif fer ence be tween them and their east ern sist ers and they be forced to admit that the rough iso lat ion of the preced ing decades had toughened their senses

* 17Beecher, “Po etry and Pri vate Lives,” 57. ** 18E. R. S. [Eliza R. Snow], “Sa cred to the Mem ory of Our Be loved Sis - ter, Mrs. Matilda Cas per,” Woman’s Ex po nent 1 (June 15, 1872): 3. KYLIE NIELSON TURLEY/RHETORIC AND RITUAL 59 as it had red dened their faces.”19*** One could easi ly sift though this plethor a of poetr y, exco r iat ing all the ama t eur ish home spun po ems and searching for the few gems like Eliza R. Snow’s, “My Sist er, Leonora A. Morley.” But readers must ask whether such a search is en tirely appr opr iat e. In Ang els and Ab - sences: Child Deaths in the Nineteenth Centur y, Laurence Lerner uses the theo r ies of Paul Ricoeur to ar gue that “a text can move us in two ways. The first is by its semiotic proper ties: it may command our respons e because it is pow er fully writt en. The second is by our knowledg e that it has a real ref er ent, that [these mothers] rea lly did lose their children. We can, that is, be moved because we are sensi t ive to lit er atur e, or because we respect real suf fer ing.”20****Simpl y stated, it behoo ves readers to recog nize that a poet’s writ ing skills may not match the depth of her grief, yet that does not make the grief any less real. As Lerner ar gues, to demean death poetr y because it is poorly writt en is to treat actua l death as fict ion—some thing to be ana lyzed on the ba sis of rhyme and met er with out respect to human suf fer ing, a rather in - humane reac t ion. Readers ought to recog nize that these women po - ets are ref er ring to real deaths; death poet s’ search for comfort must be taken on their own terms and analyzed on that basis. Moreo ver, the prev a lence and per va siveness of death poetr y sug gest a broader cultur al funct ion. Adapt ing Jane Tompkins’s arg u - ments about nine teenth-cen tury sen ti men tal nov els to Ex po nent death poetr y sugg ests that these poems can be read as “polit ica l en ter - prise[s], half way bet ween ser mon and soc ial theor y,” as works that “both [cod ify] and [att empt] to mold the values” of their time and soci ety.21+ Thus, the quest ion to ask is not neces sar ily whether they are “good” poems accor d ing to mod ern lit er ary standar ds (most would concede that few are), but what religio-cultur al pur pose they serve in

*** 19Beecher, “Po etry and Pri vate Lives,” 59. **** 20Laurence Lerner, Angels and Abse nces: Child Deaths in the Nine teenth Centur y (Nashv ille, Tenn.: Vanderbilt Uni versit y Press, 1997), 21–22. + 21Jane Tompkins, “Sent imen t al Power: Un cle Tom’s Cabin and the Pol i - tics of Lit er ary Hist ory,” The New Fem ini st Crit ici sm: Es says on Women, Lit er a - ture and Theor y, ed ited by Elaine Showalter (New York: Pan theon Books, 1985): 84–85. Laurence Lerner, Angels and Ab sences, 183–88, dis cusses the def i ni tion of “sen ti men tal” and the ten dency to la bel women’s lit er a ture as such and then dismiss it as poor writ ing. Typi ca l def in it ions “speak of display ing—or de mand ing—more emo tion than the sit u a tion war rants” but 60 The Journal of Mor mon His tory helping the ninet eenth-cen tury LDS comm un ity, especially the female community, deal with death. Poetr y was consid er ed an espe c ially fitt ing venue for women’s “fem in ine” thoughts and na ture dur ing the ninet eenth cen tury, and, as Beecher sug gested, LDS women in Utah strug gled to prove that they, too, were as civ i lized and cultur ed as their East ern fema le coun ter parts; yet in her Sep tem ber 1876 death poem, “Given Not Lent,“ Mrs. E. B. Brown ing dif fer en tiat es herself as a poet from the typi ca l woman, quest ion ing, “Shall I speak like a poet, or run / Into weak, woman’s tears for relief ?”22++ Brown ing seems to ar gue that poetr y is a “spo ken” or public thing and thus that Mor mon women, in writ ing death poetr y, become somet hing other than strictly fem i - nine because they use words rather than “tears for relief. ” Their use of rhet or ic leads these poet s into an area typi ca lly presc ribed for LDS men: the pub lic ritua l of the funer al ser mon. There are pitfa lls in compar ing women’s po etry and male funer al disco urse: for in - stance, the compar ison may implic itly set up male disco urse as “stan dard,” and, hence, may pre suppose that women’s poetr y, when it dif fers, is an ab er ra tion—an un for tu nate as sump tion for gender and lit er atur e. More over, the compar ison is apt to high light gender dif fer ences in writ ing style and topic, which may or may not accu r ately ref lect actua l gender rela t ions during the ninet eenth centur y. Despit e these drawback s, the evalu a t ion is use ful. Putt ing Ex po- nent death poetr y side by side with Da vis Bitton’s find ings in “Mor - mon Funer al Ser mons in the Ninet eenth Cen tury” shows that women poet s oft en compar e with their male coun ter parts yet also added to and other wise adjus ted for their par ticu lar needs in Bitton’s three major ar eas of study: eu logy, the “gos pel of com fort” (com fort ing doc -

this is clearly an inap pro pri ate la bel for poetr y about actua l deaths. Lerner pref ers a def i ni tion that “con sider[s] the na ture of the emo tion aroused: a sad ness that has lost all un pleas ant ness and be come[s] a warm glow.” Even this rev ised def in it ion does not ade qu ately depict the death poetr y found in the Ex po nent; and, hence, I have not used “sen ti men tal liter a ture” to de - scribe these works. ++ 22Mrs. E. B. Brown ing, “Given Not Lent,” Woman’s Ex po nent 5 (Sep - tem ber 15, 1876): 57. KYLIE NIELSON TURLEY/RHETORIC AND RITUAL 61 trine), and scriptur al texts.23+++

Eu logy Bitton concludes that the “most char act er ist ic Mor mon vir tues” eulo g ized by funer al speak ers were “just and true,” two catch words con not ing “un wa ver ing com mit ment to the re stored gos pel.”24++++ LDS women’s death poetr y rarely uses those ex act phrases, though the under ly ing mes sage of faith ful ness was cer tainly a dom i nant theme. Thus, while Eliza R. Snow praises Har riet Gray as one who will dwell in the “mansions of the just” and while Lydia Alder pays trib ute to Sarepta M. Hey wood for being “true to the end,” most po ets con - tented themsel ves by focus ing on more ele men tary vir tues.25* Besides the two catch word char act er ist ics, Bitton notes that LDS funer al ser - mons—un like “ora tions in the clas si cal rhe tor i cal tra di tion”—also hon ored the dead for “rud imen tary vir tues,” praising them “for hav - ing been kind, truthful, unself ish, pat ient, and cheer ful; for hav ing been obed ien t, dut iful childr en; or for hav ing given self less ser vice as par ents.”26** The poet ic eulo g ies writt en by women praise simple re li gious qual it ies, yet, when a woman died, the poems consis t ently added her “useful ness” and her honor able ser vice as a wife and mother. In her March 1881 poem, “In Memoriam,” E. B. Fer guson [El len Brooke Fer gu son], doc tor, prin ci pal in sti ga tor of the Deseret Hos pi tal, and well-known po lit i cal el o cu tion ist, me mo ri al izes “F.A.C.’s” “busy hands” and “kindly deeds” as well as her “lov ing helpful ness,” not ing espe c ially how the decea sed wore the “royal crown of mother hood— / The key stone of the arch of earthly life.”27***Eliza R. Snow praised Leonora Snow Morley, Snow’s older bi olog i cal sist er, for her years “fill’d with use fulness,” not ing espe c ially how Morley “no bly filled”

+++ 23Bitton, “Mor mon Funer al Ser mons,” 27–50. ++++ 24Ibid., 29. * 25In Woman’s Ex po nent: Eliza R. Snow, “Part ing Lines,” 3 (No vem ber 1, 1874): 90, empha sis mine; Lydia D. Al der, “In Memoriam, on the Death of Sist er S. M. Hey wood,” 10 (De cem ber 15, 1881): 109. ** 26Bitton, “Mor mon Fu neral Ser mons,” 28. *** 27E. B. Ferg u son [El len Brooke Ferg u son], “In Memoriam,” Woman’s Ex po nent 9 (March 1, 1881): 147. See also Orson F. Whit ney, “El len Brooke Ferg uson,” His tory of Utah, 4:602–4. 62 The Journal of Mor mon His tory her role as “wife and mother.”28**** The anon ymo us au thor of “Mother’s Growing Old” remem bers a mother who walked the “path of daily duty,” filled “her hands with use ful labor ,” and made “home a happy place.”29+ While faith fulness, kindli ness, and other vir tues were men - tioned in funer al ser mons and in death po etry, being a mother and being “useful” are exa lted in LDS women’s death poetr y while male ser mons over whelmingl y focused on the vir tues of being “just and true.” In their focus, fema le poet s were giv ing voice to the ethic ex- pressed in prose by their “presidentess,” Eliza R. Snow, in 1877: “What is true greatness? In human char act er, useful ness const i tutes greatness. . . . In the est ima t ion of holy intelligences, the most useful char act er or person is the great est.”30++ By praising useful ness, po ets best owed “greatness” upon the daily dut ies their women friends and family members performed. Dur ing these ten years of death poetr y about other women, one poem, “Only a Por trait,” stands out because it does not name useful - ness or mother ing as eulo g ized vir tues. Per haps because the nar rat or is appar ently gazing at a por trait, the ob ject of the poem is praised for being “fair,” with her “blue eyes, so lov ing and kind / That ever look smil ing on me.” Though babies were oft en eulo g ized for physi ca l fea- tures, women rarely were in Ex po nent death poetr y. The nar rat or also praises the decea sed’s “beauty of the mind” and her “dear, tender heart” that could “soften ano ther’s distr ess. / And cover its own with a smile,” desc ript ions of vir tues that are more in line with typi ca l death poetr y. In the last stanza, the aut hor finally reveals the object of the eulogy:

In joy, hers the spirit of goodness and love; In sor row, of pat ience and rest; The fa vored of God and His ang el above, Was Emma—the dear est and best.31+++

The aut hor only uses ini tials (“O. F. W.”) and leaves “Emma” witho ut a

**** 28Eliza R. Snow, “My Sis ter, Leonora A. Morley,” Woman’s Ex po nent 1 (Au gust 1, 1872): 35. + 29“Mother’s Growing Old,” Woman’s Ex po nent 3 (July 15, 1874): 30. ++ 30Beecher, “Po etry and Pri vate Lives,” 123. +++ 31O. F. W. [Orson F. Whit ney?], “Only a Por trait,” Woman’s Ex po nent 7 KYLIE NIELSON TURLEY/RHETORIC AND RITUAL 63 sur name. Thus, readers can not be cer tain to whom the aut hor is re - fer ring, though it is plausi ble that the aut hor, likely Orson F. Whitney , son of Helen Mar Kimball Smith Whitney , was speaking of Emma Wells, Emmeline B. Wells’s twenty-four-year-old daught er who died April 8, 1878. Whitney , an ambi t ious poet in his own right, was a family friend and founder of the Wasatch Lit er ary Asso c ia t ion, which met in Emmeline’s home from 1874 to 1878.32++++ Whit ney’s au thor ship may explain why “Only a Por trait” seems somewhat ir reg ular in desc ribing the dead woman’s physi ca l featur es and in overloo king her stan dard “use ful ness.” These sty lis tic tac tics are un char ac ter is tic of eu lo gis tic fe male death poetr y, but a male friend-aut hor would not neces sar ily un der stand by un spo ken con ven tions.

The “Gos pel of Com fort” In his second ma jor area of study, comf ort ing the ber eaved, Bitton found that fu neral ser mons typi ca lly “look[ed] for ward in time” and “desc ribed the spirit world, resur rect ion, judgmen t, and even tual rewar d in one of the three deg rees of glory.”33* Women po ets also used this techn ique, find ing con sola t ion when they desc ribed, for ex ample, the “heav enly joy” that co mes in “God’s per fect day” or how “resur rect ion‘s power combines / Immor tal bod ies and immor - tal minds.”34** Many also relied on the “oft-repeat ed trope” desc ribed by Bitton of portr aying the decea sed “as reliev ed from suf fer ing.”35*** Most poet s did not, how ever, depict the spirit as going to a “spirit world” or a “par ad ise” bef ore being resur rected, a common facet of funer al ser mons.36****Em ily Hill Woodmansee speaks of “the worn body, in the quiet ground,” yet her desc ript ions of “the tranq uil rest, so sweet and sound” and the “blest obliv ion” that occurs “till ‘The Trum pet’s sound,’” sugg est that the soul as well as the body is

(No vem ber 1, 1878): 81. ++++ 32Rona ld W. Walker, “Growing Up in Early Utah: The Wasatch Lit er - ary As so ci a tion, 1874–1878," Sun stone 6 (No vem ber/De cem ber 1981): 44–51. * 33Bitton, “Mor mon Fu neral Ser mons,” 33. ** 34In Woman’s Ex po nent: Lu Dal ton, “My Two Chil dren,” 2 (May 1, 1874): 178; Eliza R. Snow, “Im mor tal ity,” 3 (June 1, 1874): 6. *** 35Bitton, “Mor mon Fu neral Ser mons,” 33. **** 36Ibid. 64 The Journal of Mor mon His tory sleep ing.37+ Some “rest” or “sleep ing” expr essions could be in ter - preted fig ur at ively. LDS Church Presi den t Da vid O. McKay, at the 1912 death of his two-and-a-half-year-old son Royle, recor ded, “‘He is not dead but sleepeth’ was never more appli cable to any soul, for he truly went to sleep. He did not die.”38++ Such imag ery speaks less of the sta tus of the immor tal soul and more to the “relief from suf fer ing” rhet or ic Bitton found in ser mons. Such an in ter pret at ion seems ap- propr iat e when, for ex ample, Brit ish con vert Agnes Armstrong, says that Brigham Young deser ves “sleep for the weary eyes” and “peace for the throbbing breast,” and that he has “earned [his] calm re- pose.”39+++ Readers are apt to con sider the dif ficult y of Young’s life, rather than the con sciousness of his spirit when read ing such lines. Aft er burying her husband and four of her seven childr en in St. Louis, Misso uri, bef ore coming west to Utah and working as a teacher for the rest of her life to support her remain ing childr en, Armstrong was likely con sider ing her own dif ficult life and her persona l need for re - lief from suf fer ing when she spoke of “peace” and “sleep for the weary eyes.”40++++ Yet many poet s speak of the “sleep” of the spirit quite liter ally, concur ring with Woodmansee’s no tion of “blest obliv ion.” Hannah Tapfield King, an early Brit ish con vert who bur ied six of her ten children bef ore they were adults, explains in “Song of the Weary,” that “we’ll look upon death as a sleep . . . / Till tri umphan t we rise from the grave.”41* In her death poem for “My Sis ter, Leonora A. Morley,” Eliza R. Snow states that while the body decom poses, the im mor tal spirit is left “to rest—to sleep / Un til the glo rio us resur rect ion morn,” clearly

+ 37Woodmansee, “Ere Co mes the Night,” 99. ++ 38Teach ings of the Pres ide nts of the Church: Da vid O. McKay (Salt Lake City: Church of Je sus Christ of Lat ter-day Saints, 2003), 62. Rel ief So ci - ety/Melchizedek Priest hood man ual for 2004. +++ 39Agnes Armstrong, “Trib ute to Presi dent Brigham Young,” Woman’s Ex po nent 6 (No vem ber 1, 1877): 107. ++++ 40Helen E. Armstrong, “Obit u ar ies,” Woman’s Ex po nent 25 (May 15, 1897): 151. * 41Hannah T. King, “Song of the Weary,” Woman’s Ex po nent 7 (June 1, 1878): 1. For biog raphi ca l in for ma tion and excer pts from King’s jour nal, see “‘My Jour nal’ by Hannah Tapfield King,’” in Cover ed Wagon Women, ed - ited by Ken neth L. Holmes (Glen dale, Ca lif.: Ar thur H. Clark Com pany, 1986), 183–88. KYLIE NIELSON TURLEY/RHETORIC AND RITUAL 65 depict ing a state of uncon sc iousness un til the spirit and body are re - united.42**Per haps these po ets sim ply mis un der stood their na scent theol ogy , though this seems unlik ely given the clear doctr ine in the Book of Mor mon as well as in early ser mons on the af ter life. It also seems un likely that high-ranking and faithful LDS women would, as a group, con sciously and subv ersiv ely alt er doc trine, re sult ing in an un-au thor i ta tive fe male be lief about the spirit world.43*** Ano ther consid er ation may be ev ery day pio neer life; is it possi - ble that fron tier exis t ence was so over whelming that women took the concept of “rest ing from sor row,” a common Vict or ian met aphor for death, and rhet or ica lly explor ed it in verse, welcom ing a time for their spir its and bod ies to lit er ally “sleep” rather than be vig or ously act ive in par ad ise? The no tion is not in line with standar d LDS doctr ine; as Mary Ann Meyers summa r izes in her theolog ica l study, “Gates Ajar: Death in Mor mon Thought and Pract ice,” even if the LDS people believed death brought re lief from suf fer ing, “clearly death was not a re - lease from striv ing.”44****Some Mor mon women wanted to believ e other wise, given the dif ficult y of their lives. In her 1872 poem, “Long - ings,” Mary Jane Mount Tanner cert ainly wished for a repr ieve when she desc ribed her life as, “All night! All dark! / so drear and sad!” Tan- ner writes that she is “Weary! Weary!” and wishes for a “heaven . . . full of rest.”45+ Women po ets used the doctr ine of resur rect ion and celes - tial glory as their male peers did: to comf ort the ber eaved. Per haps that same search for com fort and peace from the tri als of this life led them to an unor thodo x under stand ing of the spirit’s “sleeping” after death and before the resurrection. The LDS doctr ine of eter nal fami ly and eter nal friend ship was an other means of com fort found in fu neral ser mons, though by no

** 42Snow, “My Sis ter, Leonora A. Morley,” 35. *** 43Morrill, “White Roses on the Floor of Heaven,” 264, ar gues persua - sively that such “con tra dic tory strains, prac tices, and sub cul tures [ex ist] within any given rel ig ious comm un ity” and hast ens to add that, while “con - tra dic tory,” such doc trines are “par a dox i cally, not nec es sar ily or openly con flict ing.” **** 44Mary Ann Myers, “Gates Ajar: Death in Mor mon Thought and Prac tice,” in Death in Amer ica, ed ited by Da vid E. Stannard (Phil a del phia: Uni ver sity of Penn syl va nia Press, 1975), 123. + 45M. J. T. [Mary Jane Mount Tan ner], “Long ings,” Woman’s Ex po nent 1 (De cem ber 1, 1872): 98. 66 The Journal of Mor mon His tory means an orig i nal one. In Death and the Futur e Life in Vic tor ian Liter a - ture and Theol ogy , Michael Wheeler main tains that the “most char ac- ter ist ic Vict or ian ideas of heaven are of a place in which fam ily re - unions and ‘the recog nit ion of friends’ are to be achieved aft er death, and (more rad ica lly Roman tic) of a site in which lov ers are reun ited as cou ples.”46++ LDS women po ets also cel e brate eter nal re lat ionships. For ex ample, Eliza R. Snow’s poem to “My Sist er, Leonora A. Morley,” concludes with a fare well for the presen t time only: “Adieu my sis ter, we shall meet again, / And live on earth when Jesus Christ shall reign.”47+++ In her “Lines” writt en for Isabel Hami lt on, Mar gar et A. White expr esses concer n that “we be wor thy still to claim [Hami lt on’s baby] in eter nity”; and Lu [Lucinda Lee] Dalt on knows that alt hough “Death stole from my enc ir cling arms / My bright baby,” the child is hers and will “meet me with joy when my earth work is done, / To be mine while du ra tion rolls around.”48++++ Like the Mor mon funer al ser - mons stud ied by Da vis Bitton, the poems for women and childr en find con so la tion in “the con tin u a tion not merely of the in di vid ual soul but also of the fam ily unit be yond the grave.”49* Yet the po ems dis pro por tion ately find that com fort ing re la tionship cont inu a t ion in fema le-and-fema le and mother-and-child rela - tionships, rather than in eter nal mar riage. Even Emi ly B. Spencer’s tribut e to Brigham Young lists the mult itude of friends he will meet in heaven (Jo seph and Hyrum Smith, Heber C. Kimball, George A. Smith, Jedediah M. Grant, Wil lard Rich ards, and Da vid Patt en) rather than his wives. Only eleven of the sixty-seven death poems are clearly about the deaths of actua l men. Five of those poems pay hom - age to high-ranking lead ers50** and four are tribut es for rela t ives—two

++ 46Wheeler, Death and the Fu ture Life, 120–21. +++ 47Snow, “My Sis ter, Leonora A. Morley,” 35. ++++ 48In Woman’s Ex po nent: Marg a ret A. White, “Lines,” 1 (Oc to ber 15, 1872): 78; Lu Dal ton, “My Two Chil dren,” 2 (May 1, 1874): 178. * 49Bitton, “Mor mon Fu neral Ser mons,” 35. ** 50In Woman’s Ex po nent: Agnes S. Armstrong, “Trib ute of Re spect: To the Mem ory of Brother Jo seph W. Young,” 2 (Sep tem ber 1, 1873): 54; Em ily B. Spencer, “On the Death of Pres i dent Brigham Young,” 6 (Oc to ber 15, 1877): 13; Agnes S. Armstrong, “Trib ute to Pres i dent Brigham Young,” 6 (No vem ber 1, 1877): 81; Lula, “Pro fes sor Jo seph L. Barfoot Dead!” 10 (May KYLIE NIELSON TURLEY/RHETORIC AND RITUAL 67 for grand fa thers, one for a fa ther, and one for a brother.51*** Two po - ems may be about the deaths of hus bands, but both are so vague that the decea sed may actu a lly be some one else en tirely.52**** This ab sence of grief-stricken poems about husband s’ deaths is star tling. If numbers alone were to mea sure grief—and, cer tainly, they do not—then these women po ets were more moved by Brigham Young’s death than by the deaths of their husbands. One of the few times that a husband shows up in death poetr y dur ing the first ten years of the Ex po nent is in Hattie F. Bell’s “Post-Mor tem Love.” The first person nar rat or pleads with her husband to, “love me now, while I can know / All the sweet and tender feel ings / Which from real af fec tion flow.” She does not wish for him to “wait” un til she is “gone / And then chisol [sic] it in mar ble— / Warm love-words on ice-cold stone.” Unlik e the typi ca l poem, which as sumes a life af ter death with com pan ion able fam ily re la tion ships, Bell declar es that she will not be able to “hear” her husband ’s words

1, 1882): 179. The only poem dur ing this time pe riod about a non-LDS high-rank ing of fi cial is about the as sas si nated U.S. Presi dent James A. Gar - field and is ad dressed to his widow, Lucretia Budolph Gar field. See Lula, “Mrs. Gar field,” 10 (Oc to ber 1, 1881): 65. *** 51Grandfa t her poems in Woman’s Ex po nent: Mary D. Brind, “Wait ing for Mother,” 10 (Sep tem ber 1, 1881): 51; and Lula, “Aft er the Sad News,” 11 (June 15, 1882): 9. Fa ther poem: Hannah T. King, “A Trib ute,” 6 (Sep tem - ber 15, 1877): 59. Brother poem: L. M. Hewlings, “The Sad Mes sage,” Woman’s Ex po nent 9 (Janu ary 15, 1881): 12. **** 52E. A. Bennion [Est her Ann Birch Bennion], “Never Again,” Woman’s Ex po nent 10 (1 Oc to ber 1881): 67, may be about ei ther her hus - band or Brigham Young. Her de scrip tion of the decea sed “gather[ing] around thee thy lit tle ones” and her hope to “in herit a glo ri ous home” and “meet to be parted, O, never again!“ por trays a per sonal fami ly situ a t ion, yet her some what more for mal de scrip tion of a man who “teach[es] the pre - cious Gospel word” and gives “counsel” coupled with no men tion of the de- ceased as a hus band or of herself as a wife sug gests that the de ceased may be a leader whom she ad mires for his gos pel lead ership and fat her hood. The poem was writ ten No vem ber 22, 1877, and pub lished four years later. Es- ther Ann Bennion’s husband, John, died Au gust 29, 1877, Brigham Young on Sep tem ber 1, 1877. See also John Bennion, “Est her Ann and Me: An Es - say into Boundar ies,” Ann ual of the As so ci ation for Mor mon Let ters 2000: Pa - pers from the Ann ual Meet ing Feb ru ary 20, 1999, ed ited by Lavina Field ing An- derson (Salt Lake City: Asso ci a tion for Mor mon Let ters, 2000), 31–32. 68 The Journal of Mor mon His tory aft er death, since “there’ll be walls of earth bet ween us.” In her fina l stanza, Bell again views death as final:

I won’t need your kind car esses When grass grows o’er my face. I won’t crave your love and kisses In my last, low, rest ing-place. So if you do love any, If it’s but a lit tle bit, I’d rather know it now, while I Can, liv ing, own and trea sure it.53+

The jaunty ABCB rhyme scheme, the rigid pat-a-pan rhythm with its end-stopped lines, and the mis guided imag es deno ted by the fig ur a- tive lang uage (grass growing over one’s face) make the poem almos t darkly humor ous; how ever, it should likely be in ter preted as an un - skilled aut hor’s att empts to beg—in the most desper ate of terms—for her husband ’s att en tion. Iron ica lly, using her own death to overstat e her point causes the aut hor to re ject her theol ogy . To con vince her husband that he must love her now bef ore it is ev erla st ingly too late, the nar rat or of the poem assumes the posi t ion that there is no life or consc iousness aft er death—that she needs his love now bef ore they are perma nen tly sepa r ated by death. The husband in M. J. T [Mary Jane Mount Tanner] ’s “Retr ospec - tion” is much more att en tive and lov ing, yet in ter est ingly, this poem also re jects LDS doc trine. When the “good wife’s” son dies, she is dev - ast ated, even tua lly find ing comf ort in her husband , the man who has “shared her toil [and] the hopes and care of her weary lot.” Despit e the ef fects that “time and sick ness and wear ying care” have wreaked on her appear ance, this husband still loves his wife as “a youthful bride” and tells her that “she [is] far more fair / Than the dainty daugh ters of fash ion.”54++ In Tan ner’s poem, even the good and lov ing husband who comf orts his ber eaved wife will only “clasp her to his

+ 53Hattie F. Bell, “Post-Mor tem Love,” Woman’s Ex po nent 4 (De cem ber 1, 1874): 99. ++ 54These lines may be an oblique crit i cism of LDS husbands who marry young plu ral wives, al though Tan ner ar dently def ended the prac tice as a “sac red princ iple” in publ ic (while private ly desc rib ing it as a “sev ere KYLIE NIELSON TURLEY/RHETORIC AND RITUAL 69 heart / And hold her there un til death should part,”55+++ a sur prising bit of “Gen tile” rhet or ic from a faithful LDS fe male poet. Per haps the only eter nal mar riage desc ribed in this de cade of death poetr y comes in Hannah T. King’s “Tribut e” to her fat her. The poet imag ines that her fat her will “rise and stand among [the Saint’s] ranks” in heaven with “she, who was the part ner of his life / . . . His endow’d, / His chaste, and most obed ien t wife.”56++++ Yet King’s eter nal fami ly and her doctr ine are on shaky ground; her pur pose in writ ing is to “twine [her fa ther’s] honor’d name / Among the Saints of lat ter days” be cause she “know[s] / His place is with them,” even though he never joined the church, nor, for that matt er, did King’s husband, farmer Thomas Owen King. Though Thomas accom pa n ied Hannah to Utah in 1853, lived there un til his death on No vem ber 16, 1875, and never disco ur - aged Hannah in her Church endea v ors, he was not bapt ized dur ing his life time, and she had her self sealed to Brigham Young as his last plu ral wife.57* The disr eg ard for LDS doctr ine con cern ing eter nal husband-wife rela t ionships seems sur prising given that M. Guy Bishop’s finding that the “em pha sis upon the celes t ial fami ly” was well est ablished by Joseph Smith’s death in 1844.58** One might specu lat e that the fe male aut hors simpl y were mim icking the poetry of their Amer ican coun ter parts witho ut re flect ing their own par tic ular be liefs; and, indeed, there is ev idence that the Woman’s Ex po nent lifted poetr y from nat ional works ev ery so oft en in an ex- trial to our human na ture”). “Mary Jane Mount to Mrs. H. H. Bancroft, from Provo, Utah,” Oc to ber 24, 1880, http://studen ts.cs.byu.edu/%7eheath/ fam ily/tan ner/a5198.htm (ac cessed July 27, 2005); Mary Jane Mount Tan - ner, “A Me mo rial,” http://stu dents.cs.byu.edu/%7eheath/fam ily/tan ner /a5478.htm (ac cessed July 27, 2005). See also Margery W. Ward, ed., A Frag - ment: The Au to bi og ra phy of Mary Jane Mount Tan ner (Salt Lake City: Tanner Trust Fund and Uni versit y of Utah Li brary, 1980). +++ 55M. J. T. [Mary Jane Mount Tan ner], “Retr o spec tion,” Woman’s Expo - nent 2 (March 15, 1874): 154. ++++ 56Hannah T[apfield]. King, “A Trib ute,” Woman’s Ex po nent 6 (Sep - tem ber 15, 1877): 59. * 57“‘My Jour nal’ by Hannah Tapfield King,’” in Cover ed Wagon Women, 183–88. ** 58M. Guy Bishop, “To Over come the ‘Last En emy’: Early Mor mon Per cep tions of Death,” BYU Stud ies 26, no. 3 (1986): 76. 70 The Journal of Mor mon His tory press att empt to ex em plify good craftsman ship. 59*** How ever, the death poetr y about women and childr en dur ing this same per iod consis t ently turns to the comf ort ing doctr ine of eter nal rela t ionships. Moreo ver, women po ets cer tainly knew the doctr ine of eter - nal mar riage. Eliza R. Snow’s “Immor tal ity,” teaches that “We’ll be our very selves . . . To enjo y life’s sweet asso c ia t ions, such / As par - ents, childr en, husband s, wives and friends.”60**** Given these women’s com plete faith in the immor tal ity of mother ing and fe - male friend ship and their under stand ing of eter nal mar riage, the dearth of immor tal husbands seems odd at best. Jill Mulvay Derr’s syn op sis of Carroll Smith-Rosenberg’s ground break ing anal y sis of re la tions among nine teenth-cen tury Amer i can women of fers an ex- plana t ion. Derr points out that “the soc iet y in which Mor mon ism dev eloped was ‘char act er ized in large part by rigid gender-r ole dif - fer en tia t ion within the fami ly and within so ciet y as a whole, lead ing to the emo tional seg reg at ion of women and men.’”61+ The lack of death poetr y about husband s sugg ests a coin c iden t lack of emo - tional in timac y with husband s, a possi ble conse q uence of pol yg - amy, ext ended mission ser vice, or strict Vic tor ian gender roles. Still, if “O. F. W.” is indeed Orson F. Whitney , then at least one man wrote a mov ing lit er ary trib ute for a decea sed woman, trying to ex- press his grief and reach out to comf ort others—mos tly women—in the accept ed “fem in ine” poet ic manner . Thus, these emo tional “sepa r ate spheres” were not unbridge able. In any case, the prepon der ance of poetr y about women and childr en sugg ests strong emo tional connectedness to friends and babies and, hence, great grief when they died. Eliza Snow’s, “My Sist er, Leonora A. Morley,” is one of the best po ems in this decade of poetry. The free verse, un-rhymed poem with dramat ica lly hang ing

*** 59See un ti tled headnote to James G. Clark, “Leona,“ Woman’s Expo - nent 10 (Au gust 15, 1881): 43: “Compe tent liter ary crit ics have pro nounced the fol lowing poem un sur passed by any other pro duc tion of its class in our lan guage. It is per fect in rhyme, beau ti ful in fig ure and ex pres sion.” See also Beecher, “Po etry and Pri vate Lives,” 58. **** 60Eliza R. Snow, “Im mor tal ity,” Woman’s Ex po nent 3 (June 1, 1874): 6. + 61Jill Mulvay Derr, “‘Strength in Our Un ion’: The Mak ing of Mor mon Sis ter hood,” in Sisters in Spirit: Mor mon Women in Histor ical and Cul tural Per - spec tive, ed ited by Maureen Ursenbach Beecher and Lavina Field ing An der - son (Ur bana: Uni versit y of Il li nois Press, 1987), 155. KYLIE NIELSON TURLEY/RHETORIC AND RITUAL 71 lines, vivid fig ur at ive lang uage and emo tional depth, desc ribes the ang uish of losing a belo ved friend and older sist er. The first stanza explains Eliza’s rela t ionship with Leonora, claiming, “No holier sym - pa thy warms human breast / Than of lov ing sist er hood.” That Eliza R. Snow, mar ried to two prophet s, sist er to a third, and Relief Soc iet y gen eral pres i dent, finds her ho li est and most sym pa thetic re la tionship in “lov ing sis ter hood” is sig nif ican t. Eliza says that she and Leonora enjo yed the “sweet / Rec ipr oca t ion where each sen timen t / Found safe re posi tory—safe as heaven’s ar chives.” The soft “s” al lit er - at ion lulls the reader into secu r ity, as does the repe t it ion of “safe . . . safe.” Cer tainly the sis ters depended on each other. The Snow fami ly was close, yet Eliza Roxcy Snow Smith Young, Leonora Abi g ail Snow Leavit Morley, and Lorenzo Snow were the only Snow siblings to re - main in the LDS Church througho ut their lives, a god-fear ing, in ti - mate fami l ial trio that prompted Eliza’s biog rapher to compar e them to some of Christ’s most stal wart sup port ers: Mary, Mar tha, and Laz - a rus.62++ The reader of “My Sis ter, Leonora A. Morley” is set up to be star - tled by the first line of the second stanza, a jarringly short, end-stopped ex clama t ion, “But my sis ter’s gone!” As the death must have shocked Snow, she now uses short, choppy phras ing to jolt the reader: “I feared—I felt—I knew she soon would go.” Even when sen - tences lengthen and lines resume their hang ing style, the shock of death is not for gott en. Snow con tin ues her second stanza:

But when beside her bed I watch’d, and saw The last faint breath which fed the spring of life Ex haled, it seemed frail natur e’s tend’rest cord Was rent asunder , and a crushing sense Of loneli ness, like sol itude’s deep shade, In that un guarded momen t made me feel As though the lights of earth had all gone out, And left me deso lat e.63+++

Snow’s careful word choices help readers feel her dejec t ion. Line aft er line, word aft er word pulls readers down from the “safe” sist er hood

++ 62Maureen Ursenbach Beecher, Eliza and Her Sis ters (Salt Lake City: Aspen Books, 1991), 41–54, chap ter ti tled “Leonora, Eliza, and Lorenzo.” +++ 63Snow, “My Sis ter, Leonora A. Morley,” 35. 72 The Journal of Mor mon His tory framed by the first stanza. The words are vivid but not harsh or grat - ing: frail, rent, crush ing, loneli ness, sol i tude, deep, shade, deso late. Her final, short line, “and left me deso lat e,” graphi ca lly demon str ates Snow’s new isola t ion, echoing the four-word open ing line, “But my sist er’s gone!” Even when Snow re bounds in the third stanza, seek ing com fort from doc trine, she does not re turn to rote phrase ol ogy or to rigid rhyme and met er. Most of the stanza is one long sen tence. Though Snow knows that “the sac red cov enan ts which the Priest hood binds / On earth” promise life aft er death, the length of the sen tences makes the words seem plead ing rather than didac t ic. The sis ter hood bond is strikingl y strong. In their deva st at ion over losing their childr en, a few po ets took their emo tional con nect ion a step fur ther and claimed that the mother-child bond was the source of eter nal “sealed” rela t ionships. In “A Mother’s Resig nat ion,” Lu [Lucinda Lee] Dalt on first consid ers that “mother-love is strong / and deep laid as the ev erla st ing hills”; two years later she claims that “an ang el of God’s per fect day / Is mine, by the passion of mother hood won, / By love and fond memor y bound.”64++++ Like Dalt on, Mrs. E. B. Brown ing ar gues that women have a right to their childr en by virtue of mothering sacrifice:

. . . I appea l To all who bear babes—in the hour When the veil of the body we feel Rent round us—while tor ments rev eal The mother hood’s adv ent in power, And the babe cries!—has each of us known By apoca lypse / . . . the child is our own, Life of life, love of love, moan of moan, Through all changes, all times, ev ery where.65*

Why Mrs. E. B. Brown ing took up this ar gumen t is unk nown, though Lu Dalt on’s un happy mar riage as the fourth wife of the egal i tar ian but in tem per ate Charles Dalt on may explain her own poet ic stance. Aft er Charles died, priest hood leaders sugg ested Lu ob tain a can cel lat ion of seal ing and marry a more faithful man, yet she resist ed, con cerned

++++ 64In Woman’s Ex po nent: Dal ton, “A Mother’s Res ig na tion,” 1 (No vem - ber 15, 1872): 90; “My Two Chil dren,” 2 (May 1, 1874): 178. * 65Brown ing, “Given Not Lent,” 57. KYLIE NIELSON TURLEY/RHETORIC AND RITUAL 73 about her eter nal re lat ionship with her childr en. In a lett er to D[avid] H. Can non, Lu Dalt on explained , “My feel ings as a mother are far keener and deeper than my feel ings as a wife. I am the mother of six childr en; four are still liv ing and two are gone be fore; and I would not for feit my claim to them as their mother, for the sake of the best man in God’s kingdom. ”66** Dalt on even tua lly fol lowed the adv ice of her lead - ers and had her seal ing cancelled, despit e what must have been great emo tional and spir itua l tur moil. These Mor mon women po ets believed in priest hood seal ing power, yet they also searched for com fort within their own fema le expe r ience, claiming an eter nal bond with their childr en by vir tue of mother hood, sac rif ice, and love—a bond that would stand re gard less of a hus band’s be hav ior or Church sta tus. In searching for com fort, both male ser mons and fema le poetr y ad dress the par a dox i cal con cept of mourn ing, ac cept ing that tears are “natu r al” even while af firm ing that the “knowledg e of the gospel plan . . . should help the sur viv ors rea l ize that all is right.”67***Bitton relat es that fu neral speak ers at times declar ed, “Let us rejoice!” in timat ing that truly faithful Mor mons would find mourn ing some how im - proper.68****Mary Ann Myers con curs, stat ing that from LDS doctr inal disco urse “emerges . . . a kind of Pauline ad mon it ion that lam en tat ion is in ap pro pri ate for Saints.”69+Fe male poet s could also be harsh in their ind ictmen t of ang uish: Agnes Armstrong preaches witho ut reser va - tion that “All grief is self ish,” and the anon ymo us au thor of “The Loved and Lost” concurs, chast ising those who mourn the loss of loved ones: “And this we call a loss! O self ish sor row / Of self ish hearts! O we of lit tle faith.”70++Mar gar et A. White abruptly, even rudely, tells Isabel Hami lt on: “Sist er give thy baby up,” explain ing that there is no need to “mourn to lay him down / When he his work hath done.”71+++ Such—thank fully in fre quent—re marks were in sen si tive at best. They dem on strate a tact less bi nary op po si tion of faith/hap pi ness

** 66Lu Dal ton’s let ter quoted in Sheree Maxwell Bench, “‘Woman Arise!’ Po lit ica l Work in the Writ ings of Lu Dal ton” (M.A. thesis, Brigham Young Uni versit y, 2002), 74. *** 67Bitton, “Mor mon Fu neral Ser mons,” 39. **** 68Ibid. + 69Myers, “Gates Ajar,” 123. ++ 70Agnes Armstrong, “Trib ute to Pres i dent Brigham Young,” 107, and “The Loved and Lost,” 8 (Feb ru ary 1, 1880): 131. +++ 71Marg a ret A. White, “Lines,” Woman’s Ex po nent 1 (Oc to ber 15, 74 The Journal of Mor mon His tory versus apost asy/grief, which most women po ets rec og nize did not conf orm to the complex re al ity of rec onc il ing one self to death. Yet even these agg ressiv e att empts at con sola t ion cover an implic it as- sumpt ion and af fir mat ion of pain; women po ets who seem less than sym pa thetic ap par ently rec og nize a crush ing suf fer ing and try to solve the problem, albeit by spor ad ica lly re buk ing those who grieve and frequently glossing over death’s unpleasant aspects. The sprin kling of in sensi t ive poems seems to support other schol ars’ find ings of LDS death psychol ogy. In “To Over come the ‘Last Enem y’: Early Mor mon Per cept ions of Death,” M. Guy Bishop concludes that the “inner most thoughts [about death] of many early Mor mons may never be known. To expr ess any dissat isfac t ion, eit her verba lly or in writ ing, was deemed to be impr oper beha v ior and pos si- bly even sac ri le gious.”72++++ Su san Easton found a sim i lar trend in her “Suf fer ing and Death on the Plains of Iowa,” not ing that, in their jour - nals, the Saints “gener ally re mained objec t ive and even re tained a cau tious op ti mism.”73* How ever, these claims, and Bishop’s con ten - tion that “the lit er ary his tory of Mor mon ism displa ys a cul ture that was inc reasingl y recon c iled to death,” should be consid er ed in con - junct ion with the out spok en, pub licly ack nowledg ed grief that per - me ated much of the poetr y in the Ex po nent. Eliza R. Snow poignantly describes her pain:

I’ve had a taste of mor tal suf fer ing: I’ve seen my fel lows drink its cup fill’d to The brim and runn ing o’er, un til the pulse Of life was clogg’d in ev ery wheel—un til Natur e’s deep ag on ies, outweigh’d the love Of life, and yet the throbbing pulse beat on.74**

Snow’s recog nit ion that some tria ls are so bit ter and painful that they can “out weigh the love of life” is not rhet or ica l hyper bol e. For ex ample, the pseud on y mous au thor of “Trust in God” finds com fort in the “House of the Lord,” but only aft er con fessing the depth of her an- guish: “I felt that the grave was a ha ven / A refug e from grief and de - spair . . . / O how I wished I was there!”75***Many oth ers ac knowl edge the same despair in vaguer terms: Est her Ann Birch Bennion yearns for “one glimpse” of “the lit tle ones we bur ied long ago” but feels that if she were “per mitt ed to see them in their home of love and light, / With this dark world I might not be con tented.”76****Aft er compar ing death to sleep KYLIE NIELSON TURLEY/RHETORIC AND RITUAL 75 in her “Song of the Weary,” Hannah Tapfield King inv ites sleep/death: “Then come with thy wondr ous dreamland, / Yes, Morpheus, come quickly to me.”77++++Millicent, the aut hor of “Resig nat ion,” has seen the “clouds of this care-worn world” and their “shado ws creep over the soul” to the point where “the heart grows still with pain.”78*Whether in def in ite terms or in dist inct met aphor , some women were so pained by death that their own deaths seemed pref er able. Many other po ets did not neces sar ily wish to die; they simpl y lived in an ag on ized presen t. Con tem plat ing her life witho ut her loved one, A. E. T., possi bly Ann ie Turpin, explains:

The years go by, the years go by, I see them pass witho ut a sigh. . . . What now is all this world to me But taste less, dull mono t ony?79**

“Hope” (Sar ah Rus sell), the iron ica lly pseudo-named au thor of “To Magg ie,” feels much the same, dar ing the reader to “sing me one song where no an guish is found,” saying there is no such thing—“for if joy beg un, / It would turn to pain ere the song was done.” For her, death is “widely sown” and the “weary” will only find “rest” when “earth’s blood stained cross is exchang ed for a crown.”80*** Even Louisa (“Lula”) Greene Richar ds, aut hor of the rela t ively upbeat “To Ber eaved Moth- ers,” which reit er ates for fift een long stanza s that “we’ve but to wait” through this life and then find the “fair cherub forms at the bright gate,” sud denly bursts out in stanza six: “How long oh Lord! How long!” bef ore quiet ing her self, “But hush poor heart! / Thou would’st not quest ion Him.”81**** Grief-stricken pain is the founda t ional problem which death poetr y tries to resol ve, and po ets constan tly seek to al le- viat e that pain, vac il lat ing at times bet ween self-right eous doctr ine

++++ 77King, “Song of the Weary,” 1. * 78Millicent [Millicent Rus sell?], “Res ig na tion,” Woman’s Ex po nent 3 (March 15, 1875): 158. ** 79A. E. T. [An nie Turpin?], “Yearn ings,” Woman’s Ex po nent 3 (March 1, 1875): 150. *** 80Hope [Sa rah Rus sell], “To Mag gie,” Woman’s Ex po nent 3 (De cem - ber 15, 1874): 106. **** 81Lula [Louisa Greene Rich ards], “To Be reaved Mothers,” Woman’s Ex po nent 5 (April 1, 1877): 161. 76 The Journal of Mor mon His tory and doubt, res o lu tion and ex treme, all-con sum ing grief. Eliza R. Snow’s poem for her sis ter ex em pli fies the struggle and tries to find a ra tio nal rec on cil i a tion be tween the log i cal as sump tion that a true test imon y of life aft er death should stif le sor row and the emo tional dev ast at ion when a loved one dies. Aft er desc ribing her own pain at Leonora’s death, and then find ing some mea sure of con- sola t ion in doctr ine, Snow cuts her stanza into two sections with a dramatic turn:

but love accept s no subst itut e. When the fond mother lays her dar ling down In death’s cold, si lent sleep, though others may Be added to her arms, the va cancy Re mains un til the res ur rec tion shall Give back her child.82+

Strikingl y, Snow, who was childless, moves bey ond her imme diat e sit- ua t ion (death of a sist er) to ad dress ber eaved mothers. Witho ut re ject - ing her theol ogy or the comf ort ing doc trine of eter nal fami lies, Snow gives cre dence to the re al ity of grief, rec og nizing that some pains may not be healed in this life. She finds a gap bet ween faith and de spon- dency that al lows for sor row and mourn ing, rec og nizing that those emo tions may exist for the length of a woman’s life. In so doing, she reaches out and com forts those, who, like herself are strug gling to rec - onc ile themsel ves to death. The LDS women who wrote death poetr y seem, whether con- sciously like Snow or not, to be reaching out through their words in search of sup port and in an ef fort to pro vide com fort. In so do ing, they creat e a comm una l iden tity of faithful suf fer ers. Mary Ann Myers notes that, gener ally speak ing, “par taking in funer al rites give par tic ipan ts a renew ed sense of belon g ing to a so cial whole.” Aft er ex plain ing that fu ner als re veal the de ceased’s “so cial iden tity” within the comm un ity—be that “husband , fat her, friend, sold ier, civic, and reli gious leader”—Myers applies the con cepts to nineteenth-cen tury LDS cultur e: “The foremos t parts in the cat eg ory of par tic ipan ts who were not ber eaved kinsmen were taken by members of the church hier ar chy. It was cust omar y for a mem ber of the Melchizedek priest hood to speak at funer als. The deliv er ing of eulo -

+ 82Snow, “My Sis ter, Leonora A. Morley,” 35. KYLIE NIELSON TURLEY/RHETORIC AND RITUAL 77 gies seems to have been a com mon duty of elders; at the ob seq uies of the Mor mon elite, the main par tic ipan ts reg ularl y included the Presi den t, his two counsel ors, and members of the Quo rum of Twelve.”83++Typi ca l Mor mon funer als, as desc ribed by Myers, do not neces sar ily creat e the “soc ial iden tity” and feel ing of “soc ial whole” for LDS women that they did for men. Yet Myers’s desc ript ions ap - ply well to what women were doing for each other in the Ex po nent. When Mar gar et Ann Hill White died, the ward Re lief Soc iet y presi - dent, Eliz abet h Hill, and ward Re lief So ciet y sec re tary, Frances H. Hanson, composed a eulogy for publi cat ion in the Woman’s Expo - nent, im plic itly clar i fy ing Mar ga ret White’s faith ful ness and sta tus within her realm of LDS women.84+++Sarepta M. Hey wood’s “so cial iden tity” is clar i fied not only by the amount of space given her in the Ex po nent (a six-stanza poem, a seven-stanza poem, and nearly a full-col umn eulogy ) but also by ward Relief Soc iet y presi den t Marinda Hyde’s asser tion that she and Hey wood “have worked side by side in per form ing the many labor s and dis charg ing the high re - spon si bil i ties which de volved upon us, with out a dis cor dant feel ing. . . . [Hey wood] has been a true friend and a wise [ward Relief Soc iet y first] counselor .”85++++ Yet even while clar if ying soc ial iden tity—sis ter, mother, daugh ter, friend, reli gious leader—these pub lished poems al lowed women to mourn and seek comf ort as a comm una l group. Women per sona lly respond ed to deaths which impact ed them and did so in a public, published for um—inv it ing others to share their bur den and en join ing others to keep the faith in spite of the pain brought by death.

Fu neral Texts The scriptur es that women cite in their po etry furt her form an iden tity of God-fear ing mourners. Like funer al ser mons, death poetry was apt to use key words and phrases from scriptur es witho ut ref -

++ 83Myers, “Gates Ajar,” 128. +++ 84Eliza beth Hill and Frances H. Hanson, “Mar ga ret A. H. White,” Woman’s Ex po nent 25 (May 15, 1897): 151. ++++ 85Marinda Hyde, Un tit led eulogy for Sarepta M. Hey wood, Woman’s Ex po nent 10 (De cem ber 15, 1881): 109; Lydia D. Al der, “In Memoriam: On the Death of Sis ter S. M. Hey wood,” and Emi ly Hill Woodmansee, both in “Truly a Mother and a Friend Has Fallen,” Woman’s Ex po nent 10 (De cem ber 15, 1881): 109. 78 The Journal of Mor mon His tory er ences. For Bitton, this sig nif ies “the ease with which the early preachers moved into and out of sac red texts,” and the same ease is clearly man if est by fema le poet s.86* That women knew the appr opr i - ate scriptur al funer al texts is ob vio us from Marinda Hyde’s eulogy for Sarepta M. Hey wood. Framed bet ween two po ems hon or ing Hey - wood, Hyde concludes: “Of Sis ter Hey wood it may well be said, ‘Blessed are the dead who die in the Lord.’ She had ‘fought the good fight, she had kept the faith,’ and had secur ed the blessed priv i lege of ‘coming forth in the morn ing of the first resur rec tion, crowned with glory, immor t alit y and eterna l lives.’”87**In just two sen tences, Hyde manag es to emplo y three of Bitton’s most com mon scriptur al ref er - ences typi ca lly used as “funer al texts.”88*** Of Bitton’s list of twelve ref er ences, women po ets were most likely to ref er to 1 Cor in thians 15:55 (“O death, where is thy sting? O grave, where is thy vict ory?) and Job 1:21 (“The Lord gave, and the Lord hath taken away; blessed be the name of the Lord”). Most used the scrip tures as a standar d, but E. B. Brown ing arg ues a new—and comf ort ing—in ter pret at ion of Job 1:21. When a ber eaved mother ex- presses the typi ca lly misq uoted belief that “God lent him [her child] and takes him,” Brown ing vehe men tly disag rees, stat ing “God’s gener ous in giv ing, say I,— / And the thing which He gives, I deny / That He ever can take back again. / He gives what He gives.”89**** Re fus ing the common in ter pre tat ion that God has “taken back” a child from a mother, Brown ing con tends that God “lends not; but gives to the end, / As he loves to the end,” an idea that women who lost children must have found encouraging. The few scriptur es used by death poet s that are not on Bitton’s list of standar d funer al texts speak volumes about the depth of these women’s sor row. A number of poems re fer to the “cup,” appar ently an al lu sion to Matt hew 26:39 (Mark 14:36, Luke 22:42) when Christ

* 86Bitton, “Mor mon Fu neral Ser mons,” 41. ** 87Marinda Hyde, Un ti tled eu logy, 109. *** 88Bitton finds that twelve “scrip tural pas sages occur red with enough reg ular ity to be con sider ed stan dard within the funer al preaching tra di - tion”: 2 Samuel 3:38; Job 1:21; Job 19:25–26; Mat thew 25:21; Luke 2:29–30; John 11:25–26; 1 Co rin thi ans 15:19, 22, 55; 2 Timo thy 4:7; Rev ela tion 6:9, 7:9, 14:13, 20:12. The ser mons also use the “frame work” from Alma 40–42 and Doc trine and Cov enan ts 76, 88, 132, 42:46. **** 89Brown ing, “Given Not Lent,” 57. KYLIE NIELSON TURLEY/RHETORIC AND RITUAL 79 prays, “O my Fat her, if it be possi ble, let this cup pass from me: nev er - theless not as I will, but as thou wilt.” In “The Hand of God,” L. L. (Louisa “Lula” Greene Richar ds, first ed it or of the Woman’s Ex po nent) tells a ber eaved mother: “I can sympa t hize deeply with you . . . I have tasted, though lightly, of life’s bitt er cup.” Even though Lula was, at the time the poem was writt en, an unmar ried prof essiona l woman, she is sympa t hetic, rec og nizing that her friend is “wounded and rack’d, bowing low to the sod.” Still, the aut hor pleads with her friend to con - tinue to “ack nowledg e the kind Hand of God.”90+Sim i larly, the pseud- on ymo us “Hope” (Sar ah Russel l) theo r izes: “There’s a poison drop in the pur est cup, / That earth born mor tals are doomed to sup.” She also tells her friends that “how e’er so bitt er may seem the cup” we should con tinue to “bend our own, wild will” to God’s.”91++The women seem to be conced ing, per haps more frankly than the typi ca l funer al ser mon, that life is full of suf fer ing and dif ficult y. Like Christ, the women recog nize the bitt er ness of the “cup” God has given them before expr essing sub mission to His will. Ano ther scriptur e used by fe male poet s that likely did not find its way into fu neral ser mons is Matt hew 2:18: “In Rama was there a voice heard, lamen tat ion, and weeping, and great mourn ing, Rachel weeping for her chil dren, and would not be comf orted, because they are not.” In “To Belo ved Mothers,” Lula Greene Richar ds ref er ences the “Rachel” who “would not be comf orted nor find re lief, / Her chil - dren slain, she wept that they were not.” If any readers missed the ob- vio us compar ison, Lula then equates Rachel with bereaved LDS women:

A wail ing voice is heard in Deseret, The babes are stricken and the mothers mourn; Their hearts are pained, their cheeks and eyes are wet, For those who’re not; which they have fondly borne.92+++

Though the rest of the poem expr esses the comf ort to be found in doctr ine, Lula does not chast ise women for their sor row. On the con -

+ 90L. L. [Louisa (“Lula”) Greene Rich ards], “The Hand of God,” Woman’s Ex po nent 1 (Sep tem ber 15, 1872): 59. ++ 91Hope [Sa rah E. Rus sell], “Life,” Woman’s Ex po nent 2 (De cem ber 15, 1873): 110. +++ 92Lula, “To Be reaved Mothers,” 161. 80 The Journal of Mor mon His tory trary, she jus tif ies their grief: “What though we weep! God gave us tears to shed, / When hearts o’er bur dened burst from calm con trol,” and then com pares the ber eaved mothers ’ ag ony to Christ who “wept and groaned in an guish of His soul.” In the short four and a half years since her 1872 “The Hand of God,” Lula Greene Richar ds had had persona l expe r ience with the pain she was desc ribing. Sym pat hetic to her friend’s pain in 1872, Lula had mar ried and lost two infan t daugh - ters in the in ter ven ing years.93++++ She resig ned as ed it or of the Woman’s Ex po nent in 1877 aft er the death of her second baby. Lula and others sought con so la tion in scrip ture, find ing jus ti fi ca tion not only for hope but also for their deep and abid ing grief. That they used scrip- ture easi ly in po etry speaks to their belief in God, his words, his will and his plan; these women po ets were faithful. Yet faith did not cancel out a pain that was, for them, compa r able to Christ’s “bitt er cup” of ag ony in Geth sema ne.

CONCLUSION One scholar has concluded that “death it self was, for the Saints, a minor event” and one that was simpl y a “log ica l step in the ind iv id- ual’s march to god hood.”94* While that propo si t ion may be true doc- trina lly, it is dif ficult to support in light of LDS women’s nine - teenth-cen tury daily life as desc ribed in death poetr y. From their use of scriptur e to their wish to die, Mormondom’s nine teenth-cen tury women po ets expr essed great pain when loved ones died. Es pec ially when deal ing with the emo tiona lly chal leng ing deaths of friends or childr en, women wrote with a reg ular ity and var iet y that should demon strate the hist or i cal sig nif i cance of and emo tional trauma caused by death. Though they played publicly ack nowledg ed roles in the be- reavemen t process, the women also en acted their “med ia t or of liminality” role by writ ing death poetr y. In a com muna l act of shar ing and sym pat hizing, women eulo g ized those who had passed on and consoled those left behind, imi t at ing the themes and topics of Vict o- rian death poetr y and LDS fu neral ser mons, yet per me at ing the writ - ing with LDS women’s insight, expe r ience, and style. Writ ing their grief and publish ing their pain was both a self-heal ing tac tic and an

++++ 93Sherilyn Cox Bennion, Equal to the Occa sion: Women Edi tors of the Nine teenth-Cen tury West (Las Veg as: Uni versit y of Ne vada Press, 1990): 74–78. * 94Myers, “Gates Ajar,” 133. KYLIE NIELSON TURLEY/RHETORIC AND RITUAL 81 em pat hetic re sponse to other women. They expr essed their feel ings and sought for conso la t ion, found com fort in doctr ine and cre ated doctr ine for com fort, stretched out to ward others and pled for help from others. Lula Greene Richards explains why she wrote about death in “To Bereaved Mothers”:

Let me these humble, sa cred tribut es weave, O’er lit tle ones so loved, so early gone! It comf orts mine, and other hearts that grieve, May gather cour age as they struggle on.95**

While she writes to comf ort herself and to “gather cour age,” Lula also wrote for “other hearts that grieve,” for her sis ter-suf fer ers. In “Mrs. Gar field,” Lula again evokes the sis ter hood of suf fer ing, tell ing Mrs. Gar field that “ev ery wife and mother . . . / Feels her own heart bleed with thine!”96*** Hannah T. King con curs, saying when “we feel that NO TO-MORR OW / Has the power to bring relief,” there is a “law di - vine” that has “power the wounds of grief to heal.”97**** That law is “sym- pat hy”—an empa t hetic feel ing and call ing to which women re - sponded again and again by writ ing death poetr y.

** 95Lula, “To Be reaved Mothers,” 161. *** 96Lula, “Mrs. Gar field,” 65. **** 97Hannah T[apfield]. King, “Sym pat hy,” Woman’s Ex po nent 3 (April 1, 1875): 166; em pha sis hers. “THE QUEEN OF IN VEN TIONS”: THE SEWIN G MA CHINE CO MES TO UTAH

Audrey M. Godfrey

IN 1855 IOWA’S DAVENPORT GAZETTE declar ed that a new inv en tion, the treadle sewing machine, was “to the fron tier woman what the McCormick reaper was to the fron tier farmer,” and an early mag - azine, Godey’s Lady’s Book, called it “The Queen of In ven tions.” Besides re liev ing women of “hundr eds of hours of hand-stitch - ing,” the machine al lowed them “to make more compli cated fashions” and enabled daugh ters to “take over much of the fami ly sewing at an earlier age.”1* The possi bi l it ies seemed endless as Amer i - can women fore saw them selves con struct ing drap er ies, table clo ths, and other househol d items, as well as produc ing ship sails, grain sacks, and sturdy work clothing for their hus bands and sons. They also imag ined re duc ing the time consumed in sewing tucks and ruf fles on their dresses. Time would pro vide the an-

* AUDREY M. GODFREY {[email protected]} is an in de pend ent hist o - rian in Lo gan, Utah. She is the ed it or of Writing in the Wagon: Lucretia Wightman’s 1895 Travel Jour nal from Pima, Ar izona, to Payson, Utah (pub li ca - tion pend ing). She and her hus band, Ken neth, are cur rently writ ing a his - tory of the Church Ed u ca tional Syst em. 1Dav en port Ga zette, June 14, 1855, quoted in Glenda Riley, “‘Not Gain - fully Emplo yed’: Women on the Iowa Fron tier, 1833–1870,” Pacif ic Histor i - cal Rev iew 49, no. 2 (May 1980): 255; “The Queen of In ven tions,” Godey’s Lady’s Book 61 (July 1860): 77; see also Laurie Carlson, The Queen of In ven - tions: How the Sew ing Machine Changed the World (Brookfield, Conn.: Millbrook Press, 2003), 12.

82 AUDREY M. GODFREY/THE SEW ING MACHINE IN UTAH 83 swers to the myr iad problems enco un tered in a busy woman’s day. Though a few sewing machines came by ox team across the plains to Utah, sales of the “Queen of In ven tions” in the ter rit ory awaited the ar rival of the railr oad, which pro vided quicker transport to the area. At that point, af ter 1869, a greater var i ety and sup ply of sewing machines were available, and it was possi ble for more women to enjo y the luxur y of machine stitching. This lux ury af fected Utah’s comm un it ies in div erse ways. For ex am ple, the ter ri tory’s econ omy ben e fit ted from the new pro fession of sew ing-ma chine sales per son. These in di vid u als were fre - quently hired on a part-time ba sis, so it pro vided income to those witho ut full time or year-round jobs. Pur chasing the inv en tion also in troduced women to the pract ice of in stallmen t buy ing alr eady known to men. When used machines became available for sale, some buy ers bar tered to make the down paymen t and paid the balance later, inc reasing the movemen t of goods and money. Such purchases wor ried Brigham Young, who gener ally disap pr oved of buying on time and who also feared that ind iv idua l clothing produc t ion would super sede col lect ive sewing ef forts meant to unite the women of the Church. The Relief Soc iet y’s work meet ings, which sewed clothing for the poor, and quilt ing bees were well est ablished in stitu - tions, in ad dit ion to commer cial ven tures. How ever, the growing impor tance of the machine to Utah’s women showed an inde pend ence among those who were other wise obed ien t to their leaders ’ dir ec - tives. This ar ticle discusses the dev elop men t of the sew ing machine and the in troduc t ion of mecha n ized sewing to Utah women, the im - pact it had on the econom y of the ter rit ory, the censur e it drew from LDS aut hori t ies, the methods by which manu fac tu rers ent iced women to buy, and the inno va tive ways women found of paying for the machine.

THE DEVELOPMENT OF THE SEW ING MACHINE The first sewing machines were dev eloped for use in embr oider - ing fab rics. As early as 1790, Thomas Saint, a Brit ish cab inet mak er, pat ented a dev ice for making foot wear and included in the pat ent a machine for stitching on fabr ics. In Amer ica the appa r atus was part of the early Indus trial Rev olu t ion prior to the Civil War, crafted by men who consid er ed themsel ves ar tisans, not just inv en tors. Hist o- rian Page Smith writes that bet ween 1826 and 1860 this coun try’s in- 84 The Journal of Mor mon His tory ven tors mod if ied and per fected tools that were marked by their “great aes thetic po tency” with painted sur faces, desig ns, and gold let- ter ing. Thus, along with new technol ogy, early sewing machines fea- tured beauti ful ly deco r ated surfaces and careful ly modeled cabi net s and iron work.2** This per iod of the nat ion’s hist ory was the per fect time for the in tro duc tion of such tech nol ogy. Amer i cans ea gerly sought la bor-sav - ing dev ices, inc reased output, and more income. Smith recor ds, “It was n’t that Amer i cans dis liked work. It was rather that they wished to min imize it; to make it as unla bori ous as possi ble. ”3*** Amer i can sew ing ma chine in ven tors de vel oped nu mer ous tech nol o gies to please these busy people, desig n ing their own models, chang ing the way the machines worked (such as needle placemen t and dir ec tion of sewing), and tink er ing with parts, appear ance, and size. In the beg inn ing the machine was ba sica lly a hand-pow ered needle, sew ing one stitch at a time, but the in ven tors vied with each other to produce the first in ter- lock ing con tin uo us stitch. Elias Howe (1819–67), an inv en tor from Boston, is usua lly rec og nized as the first to pat ent this featur e in Amer ica in 1846, alt hough it was a pro tracted per fect ing of product s and ef forts to build on others ’ inv en tions and he did not start produc - ing it un til the 1860s. In the mean time, his brother Amasa won an award at the Lon don In ter nat ional Ex hibi t ion for his own excel lent sewing machines. The two compet ed un til, in 1867 with both of them dead, Elias’s sons-in-law took over the business, placed a brass meda l - lion featur ing Elias’s por trait on their machine, and adv er tised it as the “origi na l” Howe.4**** Isaac Merritt Singer pat ented an impr ovemen t on one of Howe’s earlier models by add ing a foot treadle, a rec ipr ocat ing shutt le, and an adjus t able tension. By 1856 Singer of fered an af fordable ma chine cost ing $125 for five dol lars down and the rest in monthly insta ll-

** 2“Sew ing Ma chines,” John son’s New Univer sal Cyclopaedia: Sci entif ic and Pop ular Trea sury of Use ful Knowledge (New York: A. J. Johnson & Son, 1877), 205; Page Smith, The Nation Comes of Age: A Peo ple’s Histor y of the Ante-Bellum Years (New York: McGraw-Hill Book, 1981), 4:809–10. *** 3Smith, The Na tion Co mes of Age, 824. **** 4Grace Rog ers Cooper , The In ventio n of the Sew ing Ma chine (Washing - ton, D.C.: Smith so nian In sti tu tion, 1968), 91. AUDREY M. GODFREY/THE SEW ING MACHINE IN UTAH 85

This Singer sew ing ma chine has a push, rather than a pull, wheel. Its beau ti - fully painted design and gold let tering typ ify the work of early ar ti sans of technol ogy. Ameri can West Heri tage Center, Wellsville, Utah. ments with in ter est.5+ Other early compa n ies compet ed with Singer, each add ing impr ovemen ts to set their machines apart from the rest. Some of these were the Do mest ic Sewing Machine Com pany, which supplied Sears, Roebuck , and Co. in the mid-1910s; and the Domes t ic Sewing Machine Com pany, which became a sub sid iary of the White Sew ing Ma chine Company. 6++ Ano ther brand, Grover-Baker’s sewing machines, were a “lit tle larger than a cof fee mill and a trif le higher than a milk ing stool.”7+++ Some models looked like toys, while others could be placed on ta ble tops, and still others had self-stand ing in tricat e wood cases. Beaut iful

+ 5Rob ert Nylen, Cu ra tor of His tory, “Singer’s Sew ing Ma chine, Ne - vada State Mu seum News let ter 26 (Sep tem ber/Oc to ber, 1998): 5. ++ 6http://www.sewusa.com/Pic_Pages/whitepicpage.htm (ac cessed Feb ru ary 22, 2003). +++ 7Joanna L. Stratton, Pio neer Women: Voices from the Kan sas Fron tier (New York: Simon & Schuster, 1981), 214. 86 The Journal of Mor mon His tory

This Singer has an iron trea dle and scrollwork. Amer i can West Her i tage Cen - ter. scrolled and desig ned iron work support ed the machines, and treadles featur ed intricate motifs. Power for some came from push ing or pull ing a small wheel that moved the needle up and down or from side to side. Others were pow - ered by a foot treadle that spun a large wheel att ached to a smaller wheel by a band that ro tated it. Man ufac tur ers also creat ed carved cabi net s to hold the machine, and carved wooden boxes enca sed the at tach ments for ruf fling, pleat ing, but ton hol ing, and hemming.

EARLY UTAH PURCHASES Toda y, many house holds across Utah have early models, while muse ums displa y some of the oldest. For in stance, a downstairs room in the Salt Lake Daugh ters of the Utah Pi oneers Mu seum featur es at least a dozen. One model is Sar ah Ann Pea Rich’s 1863 machine, made by the Flor ence Sewing Machine Com pany. A very early desig n, it has two arms, a nicely shaped treadle made to hold the feet in place with straps, and a fine cabi net to enclose the ma chine. Ann ie Taylor Dee, wife of Thomas D. Dee of Ogden, claimed to own the first orig i - AUDREY M. GODFREY/THE SEW ING MACHINE IN UTAH 87

This early ma chine is a Wheeler–Wil son model with a hand-pow ered wheel. Cour tesy Lo gan DUP Museum. nal Utah ma chine, brought by her fa ther, John Taylor , for her mother, Sar ah Faulk ner Taylor . The first sewing machine in Henefer, Utah, was a Wheeler and Wil son model that Jo seph and Prudence Edge - worth pur chased in Salt Lake City in 1871.8++++ The Daught ers of Utah Pi oneers Museum in Lo gan, Utah, dis- plays “one of the first” machines brought into Utah by railr oad, a Singer that had been pat ented in 1855. Kather ine Irvine pur chased it in 1870 and used it to sew burial clothing for a loca l under taker. An 1892 Wheeler and Wilson model in the mil li nery shop at the Amer i - can West Her it age Cen ter in Wellsville, Utah, is un usual in that the small wheel must be pushed away from the op er a tor by hand to start

++++ 8Notes pro vided to Aud rey Godfrey by the Daugh ters of the Utah Pi o - neers Museum staff in Salt Lake City on the con di tion and de scrip tion of the ma chines at the time they were do nated. An nie Taylor Dee, “Mem o ries of a Pi o neer,” n.p., n.d., pho to copy of type script, Stew art Li brary, Weber State Univ ersit y, Ogden, Utah, 25; Fann ie J. Richins and Maxine R. Wright, comps., Henefer, Our Valle y Home (Salt Lake City: Utah Print ing Compan y, n.d.), 132. The 1902 Sears cat a logue fea tured this full-page il lus tra tion, while the tightly packed copy pointed out such fea tures as its drop leaf, seven draw ers, its “beau ti- ful rich carv ing and heavy em boss ing,” its cab inet of “quar tered oak” with a sep a rate box cov er ing, and ball-bear ing mech a nism for trans fer ring power from the trea dle to the wheel. This model sold for the bar gain price of $13.85.

88 AUDREY M. GODFREY/THE SEW ING MACHINE IN UTAH 89 the sewing, rather than to ward her.9* Even be fore the rail road’s ar rival, op por tu ni ties to pur chase a ma chine were avail able through com mer cial es tab lish ments. Godbe and Mitch ell, a drug and sundr y business, ran an adv er tisemen t in the Deseret News in Decem ber 1867 stat ing that it had the “Super la t ive” Wilcox and Gibbs sewing machines. A full-col umn adv er tisemen t in the No vem ber 16, 1870, Deseret News touted the Flor ence Sewing Ma- chine. Even ZCMI, the pur veyor of home-man ufac tur ed items of - fered Singer machines soon af ter railr oads brought goods to Utah.10** The Woman’s Ex po nent ran this adv er tisemen t in 1880: “Have you seen the new Vic tor sewing machine? If not you should do so at once and exam ine the New ideas in Sewing Machine Construc tion. The New Ma chine is ele gant in appear ance and admi rable in oper a- tion, runs witho ut noise and confu sion, alt hough the rate of speed is very high. Its self sett ing and self thread ing shutt le, and absence of springs and cogs, renders it both simple and dur able. Be sure to see it, for its gener al advan tages will make you its friend.”11*** Freder ick A. Neuberger of Log an, who sold pianos and or gans as well as sewing machines, adv er tised in the Woman’s Ex po nent and in the 1904 Log an Polk Di rec tory: “The White Sew ing Machine is King. Oldest Re li able Sewing machine House. The Only machine expert in Norther n Utah. 20 years expe r ience. Rent, re pair and sell machines. Extr as for all Machines. ”12**** While Neuberger called the White the “King,” John Daynes, in 1882, stayed with the “queen” desig nat ion. His ad quer ied, “Have you Seen it! The New Queen.” Then, in nicely laid-out prose he de clared, “The only Sewing Machine made which has Shutt le, Take-up and Ten-

* 9Notes de scrib ing the ma chine in the Lo gan DUP Mu seum. Con ver- sat ion with Lorraine Bowen, Pro gram Coor dina t or at the Amer ican West Her i tage Cen ter, in Wellsville, Utah, Janu ary 5, 2006. ** 10Wilcox and Gibbs adv er tisemen t, Deseret News, Decem ber 7, 1867, 3; Flor ence sew ing ma chine ad ver tise ment, Deseret News, Janu ary 3, 1870, 4; Mar tha Sonntag Bradley, “Zions Co op er a tive Mer can tile In sti tu tion,” Utah His tory En cy clo pe dia, ed ited by Allan Kent Powell (Salt Lake City: Uni versit y of Utah Press, 1994), 652. *** 11Adv er tisemen t for the Vict or Sewing Machine Compan y, O. H. Riggs, Agent in Salt Lake City, Woman’s Ex po nent, Au gust 1, 1880, 40. **** 12Lo gan City and Cache County Di rec tory (Salt Lake City: R. L. Polk, & Co., 1904). 90 The Journal of Mor mon His tory sions. En tirely Self Thread ing . . . Easy Run ning . . . The ‘Queen’ also makes the most per fect lock-Stitch . . . larg est Arm Space . . . Most Styl - ish fur ni ture, and Hand som est Plat ing and Or na men ta tion in the Mar ket. It Sews Any thing! It Beats Any thing! It Pleases Ev erybod y!” Then Daynes, the “sole agent for Utah,” anno unced his need for agents “in ev ery part of the ter rit ory.”13+ By 1888 Cache Val ley had a Singer sewing machine sales of fice locat ed above Britzelli & Bessler tai lors.14++

P URCHASING A MACHINE The women of Utah called the machine a wonder ful in ven tion and scoured their asset s to buy eit her new or used ones, oft en paying for them in in stallmen ts. For in stance, Minnie Petersen Brown sold three pigs and some fryer chick ens while her husband was working out of state; by these means, she raised a $25 down paymen t on a sec - ond-hand sewing ma chine, pur chased from Mrs. Long, a widow. Minnie even tua lly paid $75 for the ma chine. To raise ad dit ional money, she sewed and sold her work, as well as veg e tables from her gar den. She said, “I must not for get, when George came home he was so pleased with what I had done he gave me $10.00 to wards the ma - chine.”15+++ Ano ther in dus trio us seamstr ess, Rhoda Smith Allred, born in Ogden in 1859 to Dan iel and Eliza bet h Smith, helped her mother make buck skin gloves by hand to get their first machine. 16++++ It was not only the women who were agree able to paying for a

+ 13Ad ver tise ment, Salt Lake Her ald, Janu ary 7, 1882. In the 1880 cen - sus, John, age forty-nine, is listed as a musi cian. He founded Daynes Mu sic Com pany in 1862. ++ 14Ad ver tise ment for the tai lors, Lo gan Utah Jour nal, De cem ber 1, 1888, 3. +++ 15“Give Us This Day Our Daily Bread,” Trea sures of Pi o neer His tory, com piled by Kate B. Carter, 6 vols. (Salt Lake City: Daught ers of Utah Pi o - neers, 1952–57), 4:323. This bio graph i cal sketch has no iden ti fied au thor and does not give Minnie’s time per iod or lo ca tion. ++++ 16“The Leather In dustr y,” An En dur ing Leg acy (Salt Lake City: Daugh- ters of the Utah Pi o neers, 1985), 8:257. Though the price of a used ma chine might have been $75, Brigham Young stated in 1875 that new ones sold for $100–125. Brigham Young, Au gust 31, 1875, Jour nal of Dis courses, 26 vols. (Lon don and Liv er pool: LDS Book sell ers Depo t, 1854–86), 18:75. In 1882, Rob ert Pringle, agent for the “New Vic tor No. 4" ma chine, ad ver tised a AUDREY M. GODFREY/THE SEW ING MACHINE IN UTAH 91 machine in in stallmen ts. At least one husband was will ing to help his wife buy on credit. While Orson Pratt was in New York in 1867, he wrote to his wife Mary Ann Merrill Pratt, “I think I can get Credit from Godbe & Mitch ell for a sewing machine for you, pro vid ing that you can make the machine pay for it self in the course of a year or so. Are you will ing to try one on those terms?”17*

SEW ING WITH THE MACHINE It didn’ t take long for women to fit the appa r atus into their prov - ince of work—usu ally their home—where their childr en and asso c iat es obser ved them. The new in ven tion was indeed memo r able. Julia Stewart of Cache Val ley saw her first sewing machine at age ten, and it made such a deep impr ession that eighty-two years later she still re - mem bered: “Ev ery woman in town went to see it and was charmed be - cause it could sew so fast.”18** War ren Gould Child of Stringtown (Riverdale, Utah), watched his fat her sew cott on bed-ticking bags to hold the fami ly grain on a “hand power sewing machine, turned by a crank, and screwed to a ta ble like a sausag e grinder.” Emi ly Ann Saunders Winn de scribed the first sewing machine in Nephi, Utah, as sim i lar to a toy. It was pow ered by hand. Some of the hand-run ma - chines featur ed empty wooden thread spools or some type of home- made knob att ached to the wheel to make for easier turn ing.19*** Fami ly coop er at ion not only helped pur chase the machines but helped run them. Wil liam Ar thur Cox, a farmer and logg er in price for new ma chines of $50. Ad ver tise ment, The Utah Jour nal, Oc to ber 20, 1882, 4. * 17Orson Pratt, Lett er to Mary Ann Pratt, July 2, 1867, Orson Pratt Lett ers, Ar chives, Church of Je sus Christ of Latt er-day Saints, Salt Lake City. My thanks to Ardis E. Parshall for bring ing this let ter to my at ten tion. ** 18“Ex cerpts from the Di ary of Julia H. Stewar t,” Heart Throbs of the West, 9:405. *** 19War ren Gould Child, “Trail of an Itch ing Foot,” Our Pi o neer Her i- tage, com piled by Kate B. Carter, 20 vols (Salt Lake City: Daught ers of Utah Pi o neers, 1958–77), 10:105. Gould was one of few men who used a ma - chine. Sewing bri dles, sad dles, and har nesses was usua lly done by hand, ac - cord ing to Cache Val ley har ness maker Marla Brindley Trowbridge, in ter - viewed by tele phone, March 30, 2004. “Fashions As I Remem ber Them,” 8:22. Zelma Christiansen Golden, “The First Mil li nery and Dressmak ing Shop in Nephi,” Trea sures of Pi o neer His tory, 1:72. 92 The Journal of Mor mon His tory

Sanpete County, whose wife, Christ ina, usu ally sewed at night af ter the childr en were in bed, dut iful ly sat behind the sew ing machine, hold ing a lamp so that it would shine on her work. Futur e LDS Church presi den t Heber J. Grant re called that, af ter his fat her’s death, his mother earned an income by tak ing in boarders and sewing for others. He said he sat on the floor many eve nings and “pumped the sewing machine treadle to re lieve his weary mother.”20**** Mary Johanson Parson, a sur vi vor of the Mar tin hand cart com - pany, lost both legs belo w the knee to frostbit e. At age four teen she pur chased a sewing machine on time. Despit e her dis abil ity, Mary oper ated the machine on her own, and many of her neighbor s ad- mired her in ge nu ity and in dus try. One anon y mous ob server com- mented, “It would seem almos t impos si ble for her to tread a machine with her knees, yet this was what she did. She wore pads on her knees for soles, or shoes. Many people who knew her keen ambi t ion to support herself gave her a great deal of sewing and paid her lib er - ally.”21+ Marg ar et Boak Browne, a dress maker in Span ish Fork, Utah, in the 1860s who possessed ar tist ic abil ity with a nee dle, dec ided to use her talen ts to ob tain income for her fam ily. At first she sewed by hand, and of ten sat up most of the night to fin ish dresses and hats for her cust omers. Accor d ing to a DUP bio graphi ca l sketch, she pur chased a sewing machine about 1870 and “it was quite an event. . . . It was the first in town and the first many people had ever seen,” and sewing tucks and trim mings was less long and te dious aft er that.22++ Though the sewing machine saved time and ef fort, some claimed that it enco ur aged women to spend too many hours bent over their work, taking a toll on their health. Mary Fuller Frizzel from Salt Lake City, who was preg nant, died sud denly on Feb ru ary 28, 1873. Her mother blamed it on Mary’s exces siv e labor , tak ing in much work in ad dit ion to her own sewing. Mary was an excel lent seamstr ess, par - ticu larl y well-known for her long, white, baby dresses. Her persona l clothing featur ed tucks, em broider y, and bias insert s, all req uir ing ex-

**** 20Kate C. Snow, “Fashions As I Remem ber Them,” Heart Throbs of the West, com piled by Kate B. Carter, 12 vols. (Salt Lake City: Daught ers of Utah Pi o neers, 1939–51), 8:18; Ron ald W. Walker, “Heber J. Grant,” En cy clo pe dia of Mor mon ism,, 4 vols. (New York: Macmillan Pub lish ing, 1992), 2:564. + 21“The Mar tin Handcart Com pany,” Trea sures of Pi o neer His tory, 6:53. ++ 22Eliza bet h Sterling, “The Dressmak er,” Our Pi o neer Her i tage, 12:46. AUDREY M. GODFREY/THE SEW ING MACHINE IN UTAH 93

This chart shows dress pat terns styles for the late 1800s. Amer i can West Her i - tage Cen ter, Wellsville, Utah. act ing and care ful sew ing.23+++ Ano ther com plaint was that sew ing machines were dif ficult to oper ate, which was cer tainly true of the ear li est models. The owner of a Wheeler and Wilson machine said it “made a noise like a threshing ma chine and ran almost as hard.”24++++ Ann ie Taylor Dee reca lled that, when her fa ther first pur chased a sewing machine, it was called a manu fac tur ing ma chine. “It was all iron and hard to run; but at that it was a great sav ing of time.”25* The ad dit ion of treadles beg inn ing in the 1850s made oper at ing them easier because the sewer’s hands were free to guide the mat e rial; how ever, early Utah ma chines were mostly hand op er ated, ac cord ing to the an ec dotal de scrip tions

+++ 23Elvira Hemenway, Let ter to Dear Daugh ter Anna, July 25, 1873, Heart Throbs of the West, 10:191. ++++ 24Golden, “The First Mil liner y and Dressmak ing Shop in Nephi,” 1:72. * 25An nie Tay lor Dee, “Mem o ries,” 25. 94 The Journal of Mor mon His tory quoted in this ar ticle. 26**

C EN SURE FROM BRIGHAM YOUNG Presi den t Brigham Young’s speeches ind icat ed his reluc t ance to see women move from hand-sewing to the use of a machine. His counsel from the pulpit enco ur aged their in dus try but feared that the expense of the machines would impact the econom y of the ter rit ory. As early as 1867 in a dis course about “How the Sis ters Can Help to Build Up the Kingdom,” he warned mothers to teach their daught ers to make their clothing “when they have cloth to make up, inst ead of hir - ing help into the house and gett ing all the sewing machines that are ped dled off in the United States, why do not they sit down and make it up themsel ves. This would be far more econom i ca l.”27*** Part of his concer n stemmed from money being sent out of the ter rit ory rather than kept within. Aft er the railr oad ar rived in 1869, he warned the Saints to “cease to build up the mer chant who sends your money out of the Ter rit ory for fine clothes in the East.” Though at this time he was not speaking of sewing machines, it dem onstr ates his well-known wari ness about import s and his call for a “retr enchmen t” to simpler home-pro duced goods.28**** Also in 1869 at a meet ing of the fe male Re lief Soc iet y in Salt Lake City’s Fift eenth Ward, he again sugg ested col lect ive sewing and told the sist ers there was no harm in making men’s clothes for profit, but that they ought to do it in col lect ive groups of “six or eight women.” Ac cord ing to Leonar d Arrington, such prono uncemen ts re - sulted from Church leaders ’ fear that the coming of the railr oad would produce a money ed class among the Saints which would “rend the soc ial fab ric and destr oy cohe sion and unity.”29+ In 1875, Young, concer ned that the Saints were spend ing too much “time and money for nothing,” used the sewing machine as an

** 26Riley, “‘Not Gain fully Emplo yed,’” 256. *** 27Brigham Young, April 6, 1867, Jour nal of Discourses , 26 vols. (Lon - don and Liv er pool: LDS Book sell ers Depo t, 1854–86), 11:350–51. **** 28Quoted in Leon ard J. Arrington, Great Ba sin Kingdom: An Economi c Histor y of the Lat ter-day Saints (Cam bridge, Mass.: Har vard Uni versit y Press, 1958), 252. + 29Brigham Young, quoted in sect ion on the Rel ief Soc iet y, “Adv ice from the Pres i dent,” Our Pi o neer Her i tage, 14:82; Arrington, Great Ba sin King dom, 295. AUDREY M. GODFREY/THE SEW ING MACHINE IN UTAH 95 exam ple. “A sewing machine that costs twenty-two dol lars to man u- factur e, we pay one hundr ed and twenty-five dol lars for; . . . for one that costs six teen dol lars, we pay one hundr ed. And then, when a man gets his wife a sewing machine she will spend from five to fif- teen dol lars worth of time in making a dress. This is wast ing time.”30++ It is not clear how Young der ived his prices nor if he had consid er ed how much time making the dress by hand would have taken. Per haps he should have visit ed the clothing fact or ies of Orderville and witnessed that very lit tle time was being wasted in this col lect ive ef fort. Working in the fact or ies built in 1882 were women such as Su san Heaton, Mary E. Box, Mary El len Clay ton, Susan Fackrell, and Mary Ann Ingram White, who spent long hours cutt ing cloth or sewing at their machines. White espe c ially found the work dif ficult. “For ten hours or more each day she cut out . . . men’s clothing through sev eral thick nesses of the heavy cloth” un til her arm ached so much she couldn’ t sleep at night. Long hours working the treadle caused her feet to swell. Because she was only five feet three inches tall, her legs troubled her because she had to stretch to reach the treadle. A relative recalled, At first much of her work was done in her own room, and she liked that. It was not al to gether to the lik ing of the lead ers of the Order, but she had a sew ing ma chine that was pre cious to her and she re - fused to have it moved to the common room or to allow anyone else to use it. Days when she was not cutting in the big room she worked in her own house and hard ened her heart to her husband, John’s, cha grin.31+++ In spite of Young’s speeches, I found no exam ples of women who declined to pur chase or acq uire a sewing machine if they could, or who expr essed guilt about using it, re gardless of Pres i dent Young’s stric tures. By the time of his death in 1877, the Church was headed into its storm iest decade of conf lict with the feder al gov ernmen t over pol yg amy, and the topic of sewing machines does not seem to have been picked up by any other Gen eral Aut hor ity, except for Erastus Snow.

++ 30Brigham Young, Au gust 31, 1875, Jour nal of Discourses , 18:75. +++ 31“They Were Tried,” An En dur ing Leg acy, 12 vols. (Salt Lake City: Daugh ters of Utah Pi o neers, 1978–89), 9:347. 96 The Journal of Mor mon His tory

THE EMERGENCE OF MACHINE PEDDLERS Apos tle Erastus Snow crit ic ized, not the sewing machine, but its salesmen. On June 3, 1877, in Provo, Utah, he preached a ser mon against them, saying they “rav aged our coun try, impos ing themsel ves upon ev ery simple t on in the land and forc ing their goods upon him. Tens of thousands of dol lars are lying idle in houses” where the machines sat un used. Snow used alarm ist lang uage: “I was told that Sanpete County owed for sewing machines alone from $40,000 to $50,000 and . . . in Cache Val ley $40,000 would not clear the in debted - ness.32++++ The neg at ive view of sewing machine agents supplied an epi t het for Judge Wil liam Worm er Drummond, appoin ted to the ter rit or ial bench in 1855 but who was dislik ed so thor oughly by Utah cit izens that he fled from Utah in May 1856. A ho tel clerk, asked what Drummond’s voca t ion was, answ ered face t iously, “He’s not very well known here; I think he is a sew ing machine agent.”33* Sur prisingl y, this crit ic ism, which may be relat ed to the gener - ally shady repu t at ion of the trav el ing salesman or “drummer ,” cast i - gated many act ive and well-known Lat ter-day Saints. For in stance, Orson Fer guson Whitney , son of Hor ace Whitney and Helen Mar Kimball Whit ney and a grand son of Heber C. Kimball, proba bly sold machines as his first paid emplo ymen t in 1874 at age ninet een. He later became bishop of Salt Lake’s Eight eenth Ward, a his tor ian, and an apost le. Hyrum Har ri son Goddard of Salt Lake City, the first gen - eral sec re tary of the church’s Young Men’s Mutua l Impr ove ment As- so ci a tion, op er ated a sew ing ma chine busi ness. Be fore be com ing a sewing machine agent in the 1870s, John Prodger Wright of East Millcreek in the Salt Lake Val ley taught school, acted as a trustee for the distr ict schools, kept bees, was a tai lor, and sold White sewing machines. When John was away sell ing machines, his wife, Isabella War - dell Wright, com pleted sewing jobs for ZCMI—over alls, jumpers, and burial and tem ple clothes.34** Litt le money cir culat ed in Utah bef ore the railr oad’s com ple- tion in 1869. Some spec ie came from passing immi grants who

++++ 32Erastus Snow, June 3, 1877, Jour nal of Dis courses, 19:183. * 33Quoted in B. H. Rob erts, A Com pre hen sive Histor y of the Church of Je - sus Christ of Lat ter-day Saints, 6 vols. (Salt Lake City: Deseret Book, 1930), 4:207. ** 34For Whit ney, see Frank Esshom, Pi o neers and Prom i nent Men of Utah AUDREY M. GODFREY/THE SEW ING MACHINE IN UTAH 97 bought grain, stock, and gar den produce to replen ish their supplies be fore con tin u ing on to Cal i for nia and the North west. The mil i tary and stage lines also con tribut ed to the state’s cur rency.35*** One hist o- rian noted that “many farm ers, while possess ing propert y worth hundr eds and even thou sands of dol lars, were oft en witho ut a dol lar of actua l money.”36**** And of course, many farm ing fami lies were far from be ing worth “thou sands of dol lars.” An un named Cache Val ley farmwife in 1876 con trasted her sit u a tion (un re al is ti cally) with those of “our sis ters in the large cit ies whose husband s are mer - chants or clerks, etc., that re ceive very large sala r ies, . . . Our husbands that fol low farm ing, raise a lit tle wheat, po tat oes, etc. etc., and if we did not use econom y, we should never be able to sus tain our fami lies. ”37+ The con tin ual stream of Mor mon immi grants into Utah Ter rit ory un til the end of the ninet eenth cen tury exac er bat ed the prob lems of over pop u la tion and un der em ploy ment, de spite “missions” to sett le and farm land on the outer lim its of the ter rit ory. Utah’s indus tr ies and manu fac tu ring ent erpr ises grew more slowly than the pop u la tion un til World War II.38++ Thus, the possi bil ity of creat ing a job for oneself as a sewing machine agent was an appea l - ing one, though un usual for women.

THE SALES PITCH Each sew ing machine agent dev eloped his persona l strat eg ies of deal ing with the day-to-day chal lenges of sales: find ing a mar ket, de- velop ing a pitch, and find ing a way to col lect money owed by cus tomers. Some sewing machine agents in Utah came up with quite inno va - tive solutions.

(Salt Lake City: Pi o neer Book Pub lish ing, 1913), 1243; for Goddard, see ibid., 892. For Wright, see Isabella Zenger Christensen, “Faithful All His Days,” Our Pi o neer Her i tage, 2:301. *** 35Hubert Howe Bancroft, Histor y of Utah: 1540–1886 (1889; rpt., Las Ve gas: Ne vada Pub li ca tions, 1982), 578, 759–60. **** 36No ble Warrum, ed., Utah since State hood, 4 vols. (Chi cago: S. J. Clarke Pub lish ing, 1919), 1:272. + 37Woman’s Ex po nent 5 (Au gust 15, 1976): 46–47, quoted in Carol Cornwall Madsen, “A Sur vey of the Life of Cache Val ley Women in 1890” (1979), Spe cial Col lec tions, Merrill-Cazier Li brary, Utah State Uni versit y, Lo gan. ++ 38Arrington, Great Ba sin King dom, 354–55. 98 The Journal of Mor mon His tory

Dur ing the 1860s, for in stance, James Sherlock Cantwell of Smithf ield in Cache Val ley taught school, tai lored, and clerked. He also served the comm un ity as postma st er and labor ed for others. Then came an other car eer change. In 1872 he recor ded in his jour nal, “Dur ing the last four months I have taken agenc ies for the fol lowing ar ticles Secombs Sewing machines, Dr. A Kings Mother Nobles [sic] Syrup; and L C Kenned ys Golden Wonder . I am doing very well.” He canva ssed for buy ers, taking the time to instruct prospec t ive cust omers in how to use the sew ing machine. Aft er mak ing the sale, he sent his cus tomers ’ money or ders to his supplier “through the Ogden city PO.” He thought the var iet y in his work kept him in good health.39+++ Lucretia Wightman of Payson, an excep t ion to male ped dlers, sold both Singer and Wheeler and Wilson sew ing machines in about a twenty-five-mile rad ius. Her buggy was ar ranged to hold two sewing machines, and she wore out three bugg ies dur ing her car eer. Insta ll- ment paymen ts were so poor that, in about 1885, she thought up an inno va tive method to col lect from those in debted to her. She dec ided to build a ho tel and let those who owed money pay in eit her mat er ial or labor to balance their acco unts. The construc tion lasted five or six years, but in the end Lucretia owned “one of the best and larg est build ings in the county”—the Ho tel Wightman—all paid for in full and ready to give her a sta ble in come.40++++ Alt hough he sold sewing machines in a dif fer ent era, Ar thur Ruben of Murray, Utah, de scribes his work in the 1920s, sugg est ing the proces s used by those who sold prod ucts door to door. Ar thur took his work very ser io usly and had his sales pitch and demon str a- tions down to a sci ence. His daught er, Vio let Ruben Walker, reca lled that her fat her ref erred to his demon str at ions as “showing-up ” a machine, and his sales presen tat ion followed this pattern:

1. Life can hold lit tle mean ing to the fam ily who does not own a ma chine. 2. The time to buy is now be cause the op por tu ni ties are at their best.

+++ 39Blair R. Holmes, ed., “The Jour nal of James Sherlock Cantwell,” 1973, pho to copy of typesc ript in my posses sion. ++++ 40Dr. Roy Wightman, “His tory of Lucretia Jane Pepper Wightman,” n.p., n.d., type script; “Bi og ra phy of Lucretia Jane Wightman,” n.p., n.d., typesc ript. Lucretia’s de scen dants pro vided me with pho to cop ies of these his to ries. AUDREY M. GODFREY/THE SEW ING MACHINE IN UTAH 99

3. The payments are so small that they are practi cally negli gible and will not be missed. 4. Anyone can learn to sew. 5. I will be glad to “show-up” the ma chine without any obli ga- tion.41*

Ruben would then demon str ate the sewing machine. He care - fully remo ved the canva s cover and showed how the head moved up and down in the cabi net. He empha sized the fol lowing points reg ard - ing the machine: it had ball bear ings, a per fect stitch, was easy to clean, could sew any mat er ial from crepe de chene to leather, and with the included att achmen ts one could make any thing. He then whipped up a doll’s bonnet with great ease using the ruf fler, the tucker, and the binder. How could any one resist such a presen tat ion?42**

S EW ING MACHINE TRADING CARDS Be sides typ i cal ad ver tise ments in pub li ca tions such as newspa pers, mer chants and man u fac tur ers took some in ter est ing ap- proaches to catch the pub lic eye. Somet imes they were aided by news pa per ed i tors who in tro duced their prod ucts in ed i to ri als. Somet imes stores car rying the machines handed out broadside ad- ver tisemen ts. Beg inn ing in the 1870s, a new sales method became a big success nat ionwide. Salespeo ple and the businesses they repre sented be gan to of fer hu mor ous or dec o ra tive trad ing cards ad- ver tising their product s. Col lect ing them was a pop ular past ime, and rec ipi en ts pasted them in albums and used them to deco r ate their homes. For ex am ple, the War bur ton fam ily of Tooele, Utah, pasted the beau ti fully il lus trated cards in dec o ra tive albums.43***Others framed them and hung them on their walls. In ad - dit ion to roman tic scenes, these col or ful cards featur ed var io us machine models and praised their ca pabi l it ies. Usua lly the mer - chant’s ad dress appear ed in black print. A rare stereopticon imag e

* 41Vi o let Ruben Walker, “A Rev iew of the Sew ing Ma chine Busi ness and Ar thur Ruben, Sr., 1859–1928,” n.d., type script, Utah State Hist or i cal So ciet y Libr ary, Salt Lake City. ** 42Ibid. *** 43“Al bums of the Warbur ton Fam ily,” Trea sures of Pi o neer His tory, 6:144; D. A. Brumleve, “19th Cen tury Sew ing Ma chine Trade Cards,” http://www.ismacs.net/ar ti cles/cardsart.html (ac cessed Feb ru ary 23, 2004). 100 The Journal of Mor mon His tory

This Singer trading card con cen trates on the fea tures of this por ta ble model in a car ry ing case, hand-op erated by turn ing the wheel on the right, with “dou - ble-thread lock-stitch” and “vibrat ing shut tle.” Cour tesy DeLoy and Rodell Johnson, Logan, Utah. of a woman sitt ing at her sewing machine shows that this method to draw cus tomers may also have been used.44**** In 1893, the Singer Sewing Machine Com pany produced a boxed set of cards to commem or ate the Chicag o World Colom bian Expo si t ion. The cards featur ed women in folk cos tumes of var io us coun tries using Singer machines. For the 1901 Pan-Amer ican Ex- posi t ion, Singer pub lished a booklet en tit led “All Over the World” fea tur ing beau ti fully de picted Vic to rian scenes that in cluded women at sewing machines. Other Singer cards showed Amer ican song birds and other at trac tive pic tures with ad ver tis ing copy printed on the rev erse side.45+

THE LEGACY OF THE SEW ING MACHINE Over the years, in no va tive mar ket ing and the finan c ial ease of

**** 44Pho to copy in my pos session; prov enance of the imag e unk nown. + 45“The Vir tues of the Vic to rian Sewing Ma chine,” www.sewitgoes. net/victc/victsmtcintro.html (ac cessed Janu ar y 16, 2006.) AUDREY M. GODFREY/THE SEW ING MACHINE IN UTAH 101

This Singer trading card sug gests ease of op era tion by the at trac tively dressed and well-groomed woman. The iron orna mental work and treadle are typi cal fea tures. pur chasing a sew ing machine made what was orig ina lly an object of luxur y into an accept ed neces sit y. As the machines impr oved, so did the lives of many seamstr esses and tai lors who could produce more ar - ticles of clothing with reg ulat ed and even seam stitches and with tucks, ruf fles, gathers, and butt onhol es. Mend ing was quickly accom - plished with machine att achmen ts. Not only was the appa r atus valued for its funct ion, but it beau tif ied homes with its deco r at ive iron scroll support s and treadles and colorfully painted flowers on the machine heads. With the in troduc t ion of the sewing machine to Utah, ind iv idu - als with litt le income became en tre pre neurs whose sales of the dev ice bene fitt ed the state’s econom y and their own finances. The sewing machine also had a posi t ive ef fect on the busi nesses that added it to their in ven tor ies and to the pub li cat ions that found inc reased advertising markets as a result. In spite of Brigham Young’s con cern about the re duct ion of women’s unity and Erastus Snow’s griev ance against “ped dlers,” women in Utah welcomed the inv en tion, and insta llmen t pur chases of the de vice became an accept ed part of consum ers ’ lives. In the en- 102 The Journal of Mor mon His tory

This Singer trading card ad vertises a 1900 draw ing book being used by the three chil dren clus tered around the closed ma chine. Mea sur ing ap prox i mately 5½x3", the book con tains black and white line-draw ings of var i ous Singer mod els topped with tracing paper upon which the chil dren could “draw” the sew ing ma chine.

suing years, Mor mon women have reg arded the sewing machine as a neces sar y tool in clothing their fami lies and in doing good work. In both the first and second World Wars, Church women banded to- gether like other women’s groups to sew for those in the armed forces and for fami lies in Eu rope who had lost many of their belong ings. Desig nat ing these project s as welfar e work, the sis ters produced clothing, bedding, and household linens. Dur ing other times of stress, sewing machines whirred in busy har mony as the women sewed for good causes. For in stance, dur ing the 1930s Great Depr ession, the Relief Soc iet y in St. George started a cott age indus try to make burial clothing. They also repair ed used ap- parel and fur nished machines for a sewing cen ter where mothers could come and remodel clothing with the help of expe r ienced seam- stresses.46++ To day’s Re lief So ci ety en rich ment pro gram in cludes women

++ 46Jill Mulvay Derr, Janath Rus sell Can non, and Maureen Ursenbach AUDREY M. GODFREY/THE SEW ING MACHINE IN UTAH 103

This dress was sewn on a ma chine in the early 1900s. Ameri can West Heri tage Center, Wellsville, Utah.

working alone or tog ether on human it ar ian project s inv olved in sewing items such as quilts, clothing, and stuffed toys. Brigham Young’s view of their use of the sewing machine surely would have been posi - tive. Presi den t Gordon B. Hinckley has enco ur aged the sis ters of the Church, both young and old, to use the fam ily sewing machine to produce more modest clothing for them selves. At the March 27, 2004, Young Women’s broadca st, he said: “I some times wish ev ery girl had access to a sew ing machine and train ing in how to use it. She could make her own attr act ive clothing. . . . I do not hesi t ate to say that you can be attr act ive witho ut being immod es t.”47+++ Even in an age of cheap, im ported clothing, the “Queen of In ven tions” and the sewing skills it fac il it ates have remained part of the lives of Utah’s Mormon women.

Beecher, Women of Cov e nant: The Story of the Re lief Soci ety (Salt Lake City: Deseret Book, 1992), 293. +++ 47Discourses of Pres ide nt Gordon B. Hinckley, 2 vols. (Salt Lake City: Church of Je sus Christ of Lat ter-day Saints, 2005), 2:274. “A SIMPLE , COM MON-SENSE EX PLA NA TION”: THOMAS F. O’DEA AND THE BOOK OF MORMON

Howard M. Bahr

LATE 1957 MUST HAVE BEEN a heady time for Thomas F. O’Dea. His book, The Mor mons, was sell ing well, the posi t ive re views beg in- ning to pile up. In De cem ber, Alex an der Morin, manag ing ed it or of the Univ ersit y of Chicag o Press, wrote that “the book is mov ing along steadily, even if not at a re markabl y fast pace,” and pre - dicted that “of course, it is dest ined to become the standar d ref er - ence on the sub ject, and there fore will con tinue to sell, even though we hoped for rather more of an imme diat e im pact on the public. ” He penned a hasty post script, “I have just seen the lat est Sat ur day Re view, where we appear promi nen tly & warmly. Al leluia!!!”1* It was a hard-won “Al leluia. ” O’Dea’s enco un ter with Mor mon - ism had beg un eight years bef ore. A new gradu at e studen t in Har vard

* HOWARD M. BAHR {[email protected]} is a pro fessor of so ci ol ogy at Brigham Young Uni versit y. ACKNOWLEDGEMENTS: Spe cial thanks are due to Da vid J. Whittaker, cur a tor of nine teenth-cen tury Mor mon and West ern manusc ripts, L. Tom Perry Spe cial Col lec tions, Har old B. Lee Li - brary, Brigham Young Univ ersit y, for more than a decade of help and en- cour agemen t in my use of the Thomas F. O’Dea Pa pers. John M. Murphy, cu ra tor of twen ti eth-cen tury manu scripts at Perry Spe cial Col lec tions, also pro vided valu able as sis tance. “Book of Mor mon,” fol low ing the Jour nal’s style, is not ital i cized except in quo ta tions. How ever, O’Dea under l ined the tit le incon sis t ently in his vari o us works. 1Al exan der J. Morin, Let ter to Thomas F. O’Dea, Decem ber 28,

104 HOWARD M. BAHR/THOMAS F. O’DEA 105

Univ ersit y’s Depart ment of Soc ial Rela t ions, he spent the summer of 1949 doing li brary resear ch on the Mor mons for the univ ersit y’s Compar at ive Study of Values in Five Cultur es Project. 2** Project leaders, pleased with the result ing report, published it that fall as a project work ing pa per.3*** The Com par at ive Values Project was a study of five ethn ic com- mun it ies (Mor mons, Hispan ics, Zuni, Na vajo, and Texan home stead- ers) peaceful ly coex ist ing in the Amer ican Southw est, in the vic in ity of the Mor mon vil lage of Ramah, New Mexico. Early in 1950, O’Dea was select ed as the project ’s Mor mon spec ial ist, respon si ble for an ethnographic acco unt of Mor mon so ciet y and cultur e as lived by the Ramah vil lag ers. The fieldw ork included six weeks in Salt Lake City in the summer of 1950, fol lowed by five months’ resi dence in Ramah. O’Dea’s doct oral thesis, “Mor mon Values” (1953), com bined a rew orking and ex tension of the 1949 report with find ings from his

1957, Thomas F. O’Dea Papers, Box 3, fd. 25, L. Tom Perry Spe cial Col lec - tions, Har old B. Lee Libr ary, Brigham Young Uni versit y; hereaf t er cited as O’Dea Papers. ** 2The Val ues Pro ject, a long range multidisciplinary pro ject funded by grants from the Rockefeller Foun da tion to Har vard Uni versit y 1949–55, was di rected by Clyde Kluckhohn, Talcott Parsons, and J. O. Brew. For its hist ory and main find ings, see Evon Z. Vogt and Ethel M. Al bert, eds., Peo ple of Rimrock: A Study of Values in Five Cultur es (Cambr idge, Mass.: Har vard Uni versit y Press, 1966), and Wil low Rob erts Pow ers, “The Har vard Five Cul tures Val ues Study and Post War An thro pol ogy” (Ph.D. diss., Uni versit y of New Mex ico, 1997). *** 3Thomas F. O’Dea, A Study of Mor mon Values, Com par a tive Study of Val ues Working Papers, No. 2 (Cam bridge, Mass.: Har vard Uni versit y Lab - o ra tory of So cial Re la tions, 1949). The mim eo graphed re port, based largely on LDS sources, ran to 120 sin gle-spaced pages, plus an anno tated bib li og ra phy. It con tained ten chap ters: “His tor i cal Back ground,” “Sources of Doc trine of the Church of Je sus Christ of Lat ter-day Saints,” “Mor mon Theol ogy: The Na ture of the Uni verse and Man’s Place within It,” “Mor mon Epis te mol ogy,” “The Work, Health, Rec re ation, and Ed u ca tion Com plex,” “The ‘Res to ra tion’ As pects of Mor mon ism,” “Mor mon ism and the Fam ily,” “Mor mon ism and Gov ern ment: Civil and Ec cle si as ti cal,” “Mor mon ism and Economic Act iv ity,” and “The Mor mon Value Sys tem: Summar y and Ar eas of Conf lict.” 106 The Journal of Mor mon His tory field work.4**** In the fol lowing years, O’Dea pub lished sev eral ar ticles based in his Mor mon vil lage resear ch and worked to fashion the disser ta tion into a book.5+ Even tua lly he dec ided that the vil lage ethnog - raphy belong ed in a sepa r ate manusc ript. The more gener al mat er ial, on the hist ory, inst itu t ions, and values of Mor mon ism, was rew orked, pol ished, and publ ished as The Mor mons. The Sat ur day Re view piece, by west ern his tor ian Dale Mor gan, called The Mor mons “per haps the most sag ac ious book about the ‘pe - culiar people’ yet writt en, a wholly thoughtful cul tural and so cial in- ven tory.”6++ Later re views in scholarl y jour nals, almos t unif ormly posi - tive, cast the book as the best of its genre. In the Amer i can So cio log i cal Re view, Kimball Young wrote, “This rela t ively brief book is the best ac-

**** 4Thomas F. O’Dea, “Mor mon Val ues: The Sig nif icance of a Rel ig ious Out look for So cial Ac tion” (Ph.D. diss., Har vard Uni ver sity, 1953). Ac cord - ing to O’Dea’s sum mary, “It be gins with a study of Mor mon theol ogy and hist ory, based on libr ary resear ch, in which I have tried to spell out the main as pects of the Mor mon out look, trace their in f lu ence on the set tle ment and in sti tu tion build ing of the Mor mons, and show the ef fects of these expe ri - ences and these in sti tu tions, once built, back upon the Mor mon val ues them selves. This ac counts for two sec tions of the thesis, one on the theol ogy and one on the hist ory of the movemen t. The third sec tion of the thesis is a com mun ity study.” O’Dea, Let ter to Everett C. Hughes, Sep tem ber 30, 1952, 2, O’Dea Pa pers, Box 2, fd. 7. + 5O’Dea frankly as sessed his dis ser ta tion shortly aft er he was awarded the Ph.D.: “I be lieve that it will even tu ally be publ ished, but the fur ther dis - cus sions on that must await the fall. My own judg ment on the thesis is not one of over whelm ing en thu si asm. Un der proper di rec tion—un der real di - rect ion which I still requ ired at that time but did not have—I could have done much better. But it is not a fool ish work and it does show some gen u - ine under stand ing. It con tains prob lems which I and soc iol ogy as consti - tuted to date canno t solve. But it does not la bor to hide them. Parts of it are rea lly good and there is a large mea sure of luck among the fact ors mak ing that so.” O’Dea, Lett er to Everett C. Hughes, July 14, 1953, O’Dea Pa pers, Box 2, fd. 7. ++ 6Dale L. Morg an, “The ‘Pecu liar Peo ple,’” Sat ur day Re view, Decem - ber 28, 1957, 9. Walker, Whittaker, and Allen char ac ter ize Morg an as among “Mor mon ism’s straying in tel lec tu als” of the first half of the twentieth cen tury. In a ca reer mostly out side for mal uni versit y ap point ments, Mor gan ed ited or authored more than forty books. At this point, he had been rev iewing west ern hist ory and fic tion for Sat ur day Re view for more HOWARD M. BAHR/THOMAS F. O’DEA 107 count and in ter pret at ion of Mor mon ism at hand,” add ing that O’Dea had “han dled his ma te ri als with ad mi ra ble ob jec tiv ity.”7+++ In the Amer i - can Jour nal of So ci ol ogy, Low ry Nelson said it was “the best gener al sociolog ica l anal ysis of Mor mon ism yet made.” O’Dea had shown “re - markable sen sit iv ity to the subt let ies of mean ing more oft en implic it than expl icit,” and “as an ‘out sider’” had done “a superb job of descrip tion and anal y sis.”8++++ Phi los o pher Ster ling McMurrin, writ ing in the Utah His tor i cal Quar terly, said O’Dea’s book was “easi ly the best gener al statemen t yet published on the Mor mons.”9* Some rev iew ers singled out O’Dea’s treatmen t of the Book of Mor mon for spec ial men tion. Leland Creer said The Mor mons was “bril liantly writ ten” and that its treatmen t of the Book of Mor mon was an instance of O’Dea’s “pen etr at ing anal ysis of the Mor mon prophet.”10**For McMurrin, O’Dea’s po si tion on the Book of Mor mon ex em pli fied the “fine balance and restr ained assess men ts that char - ac ter ize his conclusions”: In con trast to many au thors who describe Jo seph Smith in terms of than a decade. Rona ld W. Walker, Da vid J. Whittaker, and James B. Allen, Mor mon His tory (Ur bana: Uni versit y of Il li nois Press, 2001), 48–49. +++ 7Kimball Young, “[Rev iew of] The Mor mons,” Amer i can So cio log i cal Re - view 23 (Feb ruar y 1958): 104. Young, an em i nent so cial psy chol o gist at Northw est ern Uni versit y and the only Mor mon to serve as presi dent of the Amer i can So cio log i cal As so ci a tion (1945), was a grand son of Brigham Young. He had recen tly publ ished a cri tique of Mor mon po lyg amy, Isn’t One Wife Enough? (New York: Henry Holt, 1954). ++++ 8Low ry Nel son, “[Re view of] The Mor mons,” Amer i can Jour nal of So ci ology 63 (May 1957–58):673. Pro fes sor of so ci ol ogy at the Uni versit y of Min - neso ta, Nel son was aut hor of The Mor mon Villag e: A Patter n and Techniqu e of Land Set tle ment (Salt Lake City: Uni versit y of Utah Press, 1952). * 9Sterl ing M. McMurrin, “[Rev iew of] The Mor mons,” Utah His tor i cal Quar terly 26 (April 1958): 183. McMurrin was pro fessor of phi los o phy at the Uni versit y of Utah and one of O’Dea’s hosts dur ing his Salt Lake City field - work. A wide-rang ing, multidisciplinary in tel lec tual, McMurrin later served the Univ ersit y of Utah as Dean of the Gradu at e School and Aca demic Vice Pres i dent. Dur ing the Ken nedy ad min is tra tion he was ap pointed U.S. Com- mis sioner of Ed u ca tion. ** 10Leland H. Creer, “[Rev iew of] The Mor mons,” Jour nal of Amer i can His tory 44 (March 1958):737. Creer was pro fessor of hist ory at the Uni versity of Utah. 108 The Journal of Mor mon His tory

medi cal and abnor mal psychol ogy, O’Dea treats him as a normal person func tion ing in a somewhat unusual en vi ron ment. He as sumes un - criti call y Joseph Smith’s author ship of the Book of Mormon and pro- ceeds with an inter est ing anal ysis of the reli gious and moral ideas of that book as a re flec tion of the thought, at ti tude, and life of the prophet’s own world. In con trast to the not un com mon dis missal of the Book of Mormon as a worthless and boring il lit erate concoc tion, O’Dea is found say ing that “in some of the scenes of prophecy and preach ing the Book of Mormon reaches some thing like great ness in por tray ing the ten sion of hope, the in ner soar ing of the spirit, of the com mon man who em braced revival Christian ity.” 11*** Alt hough the Church made no of fic ial, pub lic crit ique, the Uni - versit y of Chicag o Press had made ar range ments to reach the LDS mar ket by adv er tising the book in the Im prove ment Era. The adv er tise- ment did not appear , and the paymen t was retur ned to the adv er tising agency. The agency “pro tested vig or ously” and receiv ed the fol lowing expla na t ion from Verl F. Scott, business manag er for the Im prove ment Era:

The book, while it ap peared to be ex tremely well writ ten, in our opin ion had parts in it that were in extremely poor taste. One of these sections had to do with detail ing the rites and ordi nances which take place in the Mor mon tem ples. These par tic u lar things are of a sa cred na ture to mem bers of the Mormon Church and are not something to be taken lightly nor to be broadcast in books. There are quite a goodly number of other things in the book which would also make it seem rather in con gruous to us to con tem plate ad vertis ing that book to the Mor mon peo ple. The main objec tion was the one mentioned above, and we certainly have no ill feel ings to ward the au thor at all, but felt it would not be par tic u - larly suit able to ad vertise in our mag a zine be cause of the things I have mentioned. I am sure Pres i dent Da vid O. McKay has not sent any kind of en - dorse ment of the book to the pub lish ers, al though I be lieve they re- quested statements from him as well as from us.12****

I believ e that Church leaders and believ ing Mor mons could also have expr essed disma y at O’Dea’s treatmen t of the Book of Mor mon,

*** 11McMurrin, “[Rev iew of] The Mor mons,” 184. **** 12Quoted in Al exan der Morin, Let ter to O’Dea, De cem ber 28, 1957, 1, O’Dea Papers, Box 3, fd. 25. HOWARD M. BAHR/THOMAS F. O’DEA 109 which appears in Chap ter 2. Much of O’Dea’s The Mor mons had had two pre vi ous in car na tions as schol arly pub li ca tion, first as a work ing paper of the Com par at ive Study of Values project, then as his doc - toral the sis. But O’Dea’s chap ter on the Book of Mor mon was new, hav ing no coun ter part in eit her O’Dea’s 1949 working paper or the 1953 disser tat ion. Alt hough the reader was not alerted to this fact, it was not among those chapt ers that, accor d ing to The Mor mons’ preface, had been read in ear lier draft by the late Apos tle John A. Widtsoe.13+ And unlik e the treatmen t of transcen dence in Mor mon hist ory in those earlier works, Chapt er 2 of The Mor mons did what O’Dea him self had caut ioned against in the pract ice of the so ciolog i - cal study of re li gion, namely tak ing an “objec t ive” posi t ion on the truth or falsit y of a spir itua l claim, as this essa y will est ablish. This ob - ser va tion acq uires mean ing, given O’Dea’s ef forts to seek crit iques of his work from Lat ter-day Saints, and his well-ar tic ulat ed position about the limitations of scientific inquiry as applied to religion.

SEEKING MORMON FEEDBACK AND THE LIMITS OF SCIENCE In his preface to The Mor mons, O’Dea conceded, “When my wife and I went to live among the Mor mons in 1950, we were tender feet indeed.”14++ Per haps that was so where O’Dea’s persona l expe r ience with Mor mons was concer ned, but it surely was not with re spect to aca - demic knowledg e of Mor mon ism. O’Dea had spent much of the pre - ced ing year do ing li brary re search, pre par ing A Study of Mor mon Val- ues. Part of the Har vard Values Project strat egy for fac il i tat ing O’Dea’s access to key LDS inf or mants was to distr ibut e A Study of Mor - mon Val ues in advance of his ar rival, and among his stated rea sons for visit ing Salt Lake City was to receiv e mean ingful crit ic ism of the work from Mor mons. O’Dea had mailed copies to the Church His tor ian’s of fice, then un der the dir ect ion of Church His tor ian Joseph Field ing Smith and receiv ed an ack nowledg men t from Earl C. Olsen, then an em ployee in the his tor ian’s of fice. O’Dea brought sev eral copies along; and some had been distr ibut ed by Irving Tell ing, a fel low Har - vard stu dent and Values Project resear cher whose dis ser tat ion on the

+ 13Thomas F. O’Dea, The Mor mons (Chicag o: Univ ersit y of Chicag o Press, 1957), viii. ++ 14Ibid., vii. 110 The Journal of Mor mon His tory early his tory of Ramah and McK inley County, New Mexico, had ne- cessi t ated consult ing LDS hist or ica l sources in Salt Lake City.15+++ When, early in their visit to Salt Lake City, O’Dea and his wife, Geor gia, met Wil liam Mulder and other Univ ersit y of Utah gradu at e stu dents,16++++Mulder was pleased to inf orm O’Dea that “about twenty- five people” had read Mulder’s copy of O’Dea’s report and “all ind i - cated that it was fa vor ably receiv ed.” Among those who read the re - port was soc i olo g ist Low ry Nelson, whom the studen ts quoted as de - clar ing: “Eit her this fel low is a Mor mon who knows Mor mon ism, or this is a re markable job of sensi tiv ity to a cul ture.”17* O’Dea’s preface thanked Apos tle John A. Widtsoe for hav ing read “an early draft of some of these chap ters.” In fact, Widtsoe had done a great deal more than simpl y read and commen t. Impr essed by O’Dea’s work, he wrote a lett er that O’Dea proudly att ached to the front of his copy of the 1949 re port, thereby assur ing instan t re spect and rapport with faith ful Mor mons who exam ined it. Widtsoe’s let- ter, on the of fic ial lett er head of the Counc il of the Twelve, ad dressed to William Mulder, read:

August 11, 1950 Dear Pro fessor: Is that the right term to use? I did not have the op por tu nity of an other visit with the O’Days [sic]. I have read the manu script. It is one of the best things I have ever read on the sub ject. He knows his lit era ture. The pecu liar thing is, the work was done with out be ing on the field at any time. Will you get that mes sage to him? Cordiall y yours, John A. Widtsoe

+++ 15Irving Tell ing, “New Mexico Fron tiers: A So cial Hist ory of the Gal - lup Area, 1881–1901” (Ph.D. diss., Har vard Uni versit y, 1952). ++++ 16Wil liam Mulder was an in struc tor at the Uni versit y of Utah, then fin ishing his doct oral thesis for a Har vard deg ree. He had a long and fruit - ful ca reer as pro fessor of Eng lish and Amer i can stud ies at the Uni versit y of Utah. Per haps his best-known work is Home ward to Zion: The Mor mon Mig ra- tion from Scand ina via (Min ne ap o lis: Uni ver sity of Min ne sota Press, 1957). * 17O’Dea, “Meet ing Ar ranged by Hoyt An der son with Two Mor mon Grad uat e Stu dents,” July 14, 1950, 1, O’Dea Papers, Box 5, fd. 7. Hoyt An - der son was em ployed as a full-time re search as so ci ate and “in ves ti ga tor” at the Uni versit y of Utah (1949–53). He worked on sev eral de fense-related pro jects funded by the fed eral gov ern ment. HOWARD M. BAHR/THOMAS F. O’DEA 111

The lett er was signed, “Uncle John.”18** (Mulder was mar ried to Widtsoe’s niece.) O’Dea in ter viewed Widtsoe twice, one on July 29, 1950, when O’Dea left a copy of the report with him, and ano ther on Aug ust 17, the day bef ore the O’Deas headed south for New Mexico. Accor d ing to O’Dea’s notes, Widtsoe “said there were two or three places where he would have changed the ter mi nol ogy if he were writ ing it himself, but that even in these places it was all right as it stood. I told him that [I] tried to be scrupu lo usly fair. He said that I was, that I just said what the Mor mons believ e and did not inject any of my own no tions into it. He said he was very pleased with it.”19*** A Study of Mor mon Values did not aspir e to be a thor ough his tory or so ci ol ogy of Mor mon ism. Rather, it drew mostly upon LDS sources in an ef fort to por tray the Mor mons as they saw themsel ves. Mor mon readers praised the report ’s conclud ing parag raph, which sum ma rized the standar ds of fair ness that O’Dea had tried to main - tain in writ ing about a peo ple and religion not his own: Throughout a value study of this kind, I have tried at all times to pres - ent my ma terial in a man ner respect ful to the be liefs and val ues of 1,000,000 of my fellow Amer i cans. This respect for val ues and be liefs need in no way conflict with the orien ta tions of social sci ence. Whether one be lieves that val ues are revealed by God or that they are human cre ations (or both) they re main the ori ent ing mech a nisms which give meaning to human life and which are held with a consid er - able degree of emo tional at tach ment. As such they de serve the respect of the stu dent. As the so cial sci en tist him self acts on the ba sis of a high eval u a tion of knowl edge, his own at tach ment to this value should make him sen si tive to the be liefs and feel ings of oth ers, and thus aid him in meeting any situ a tion in which a fact-finding and criti - cal ap proach should seem to con flict with a re spect for the sa cred. Both the stu dent and the mem ber of the Lat ter-day Saint church must believe in the final anal ysis that knowledge cannot conflict with other im por tant val ues when weighed in any ul ti mate scales. Respect, then, is al ways appro pri ate and in a study of reli gious values it is imper a tive. Such at least has been the ideal ori en ta tion of the writer of this report.

** 18John A. Widtsoe, Let ter to Wil liam Mulder, Au gust 11, 1950, O’Dea Papers, Box 3, fd. 37. *** 19Thomas F. O’Dea, “Talk with Apos tle John A. Widtsoe,” Au gust 17, 1950, O’Dea Papers, Box 5, fd. 8. 112 The Journal of Mor mon His tory

It is hoped that his behav ior in the preced ing pages bears some recog - niz able re la tion to it.20**** This disar m ing parag raph was not mere windo w dressing. O’Dea truly had tried to fol low its pre cepts, and he succeeded to the ext ent that the re port pleased ev ery one—from apost le to secu lar liberal gradu at e studen ts. At times he had used words like “al leged” or “pur ported” to ind icat e his own uncer tainty about the transcen den t events of Mor mon hist ory, yet not offend believing readers. Lowell Bennion at the Univ ersit y of Utah In stitut e of Re li gion was among those who said O’Dea had succeeded in his att empt to por tray sac red events fairly. Ac cord ing to O’Dea’s notes, Dr. Bennion spoke in terms of very high praise of my manuscript on the study of Mor mon val ues, which he had on his desk, and said he had read it yester day for the second time. He asked me if I had had an acquain tance with Mor monism before and if I had been to Utah before. I said that I had done the thing al most en tirely from li brary sources, that I had talked to a few Mor mons at the Cam bridge branch, but that I had never be fore been to Utah. He said he thought it was re- markable, that it was the best thing he had ever seen by a non-Mor- mon, and that most Mormons would n’t have done as well. He said that he espe cially liked my last paragraph where I stated my po si tion on the study of val ues. I said that I thought that so cial sci ence had to take such a posi tion and he replied that he was in com plete agree- ment.21+ Shortly aft er the O’Deas were first in troduced at the Univ ersit y of Utah Depart ment of An thropol ogy , they were inv ited to a “pri vate sem inar ,” where they might meet some of the people O’Dea had been adv ised to in ter view. This semi nar was a session of the “Swear ing El- ders,” a group of facult y and grad u ate studen ts, mostly from the Uni - versit y of Utah, who met weekly to con sider issues of in ter est to LDS in tel lec tu als who found or tho doxy prob lem atic.22++ The O’Deas at- tended four meet ings dur ing their Salt Lake City sojo urn. O’Dea was

**** 20O’Dea, A Study of Mor mon Values, 120. + 21O’Dea, “In ter view with Dr. Lowell L. Bennion,” July 15, 1950, 1, O’Dea Pa pers, Box 5, fd. 7. ++ 22Ster ling McMurrin reca lled: “We weren’t a tame bunch.” The sem i - nar met reg u larly from 1948 un til the mid-1950s “to dis cuss rel i gious is sues with in vited guests who had made spe cial stud ies or writ ten books of in ter - HOWARD M. BAHR/THOMAS F. O’DEA 113 com fort able with these Mor mon in tel lec tu als, feel ing him self among sen si tive, lib eral peo ple like him self.23+++ At the July 20 meet ing, he ac - cepted an inv it at ion to ad dress the group at the next week’s meet ing. est to us, usu ally but not al ways relat ing to Mor mon ism.” McMurrin char ac - ter ized it as “al ways an ex cel lent af fair for those who wanted to talk freely and list en to others who spoke freely.” Sterl ing M. McMurrin and L. Jackson New ell, Mat ters of Con science: Con ver sation s with Sterling M. McMurrin on Phi- los o phy, Ed u ca tion, and Re li gion (Salt Lake City: Sig na ture Books, 1996), 181-82. Her bert Larsen ini ti ated the group, but respon si bil ity for mak ing ar rangemen ts and sched ul ing speak ers soon passed to Wil liam Mulder and Ster ling McMurrin. See Will Bagley, “‘Swear ing El ders’ Left Leg acy of Lively Debat e among Mormon Int ellec tu a ls,” Salt Lake Tribune , De cem ber 1, 2002, B-2; Thomas A. Blakely, “The Swear ing El ders: The First Gener a - tion of Mod ern Mor mon In tel lec tu als,” Sun stone 10 (Janu ary 1986): 8–13; James W. Ure, Leav ing the Fold: Can did Con ver sa tions with In ac tive Mor mons (Salt Lake City: Sig na ture Books, 1999), 38–39; and Brigham D. Madsen, “Sterl ing M. McMurrin: A Her e tic but Not an Apost ate,” in Mor mon Mav er - icks: Es says on Disse nt ers, ed ited by John Sillito and Susan Staker (Salt Lake City: Sig na ture Books, 2002), 293–94. +++ 23In the preface to The Mor mons, O’Dea iden tif ies his own stance as an at tempt “to com bine in tel lec tual ob jec tiv ity with in tel li gent hu man sym- pat hy.” His chapt er on “Sources of Strain and Conf lict” in the Church iden - ti fies “the lib eral Mor mon in tel lec tual” as one who is “un able to accept an or thodo x lit eral theol ogy which for most of their fel low churchmen is the ba sis of all the other cher ished val ues” (vii, 240). O’Dea’s field notes iden - tify such lib eral Mor mons as “very sensi t ive,” “sensi t ive and in tel lig ent,” or “sin cere and trou bled,” in con trast to the more or tho dox, “rel a tively un - think ing” ma jor ity. See O’Dea, “Meet ing Ar ranged by Hoyt An derson,” 1–2, and “In ter view with Dean Har old W. Bentley,” July 13, 1950, 5, O’Dea Papers, Box 5, fd. 7. O’Dea was com fort able with the Mor mon in tel lec tu als who found ort hodo xy problem at ic because, as a Catho l ic int ellec tua l, he oc cu pied much the same po si tion in his own rel i gious tra di tion. In the late 1960s, he made many of the same kind of non-or thodo x crit ic isms of insti - tut ional Cat hol ic ism that members of the “pri vate semi nar” had of fered against Mor mon ism. He saw the Sec ond Vat ican Counc il as Cat hol ic ism’s ef fort to make “a more ade qu ate confr on tat ion with the world” and a “second great att empt by Christ ian ity to face moder nity and adjust it self to the chal lenge of to day’s cond it ions.” He called for “very bold and far-reaching changes” whereby “the cen tral tran scen dent mes sage of Christ ian ity must now find rad ica lly new expr ession. ” O’Dea, Cath o lic Cri sis (Boston: Beacon 114 The Journal of Mor mon His tory

“As these people have been very open with me, I felt that I could not refuse an inv it at ion to lay my cards on the table bef ore them, so I accepted.”24++++ He beg an his pre sen tat ion this way: “Since my ar rival in Salt Lake City some three weeks ago, I had been treated not only with cour tesy, but with kind ness and gener osit y, . . . to a deg ree which in the old army phrase may be said to be far ‘above and be yond the call of duty.’ I expr essed my appr e cia t ion for this and said that the least I could do in re turn was to presen t the complet e acco unt of my plans and my ap proach to their ful fill ment.”25* As part of his in troduc t ion, O’Dea empha sized the value-free qual ity of soc ial sci ence, and talked of the “‘science vis-a-vis the non-empir ica l aspect s of the univ erse,’ hold ing that sci ence could not at pres ent, and proba bl y never would be able to, struc ture ad e quately this impor tant area.” He continued: In the past, when sci ence has at tempted this task be yond its qual i fi ca - tions, it had to sur repti tiously bring in non-em pir i cal pos tu lates clothed in the guise of scien tific jargon. This I called . . . “scient ism.” I said that I felt that such an ap proach was dan gerous to val ues, as it placed the scien tist in the po sition of advo cat ing a rival reli gion to the one he was pre sum ably ob jec tively study ing. . . . I said that such a scientistic ap proach was a threat not only to val ues, which should be data to the so cial sci ences, but also to sci ence it self, as it put sci ence in the po si tion of mak ing at tacks upon an ex is ten tial and value struc tur- ing of the universe, which a compar a tive study of soci eties had revealed as neces sary to man, while at the same time remain ing in fact in ad equate to struc ture this area it self. . . . To be more con crete, I said, if I come to you in the name of sci ence, tram pling upon your most cherished val ues, some one among you will in vite me to leave, es cort - ing me through the door with a kick in the seat of the pants, and if I am a good so ci ol o gist I should have been able to predict it—to have al - most called the time.26** For O’Dea, this po sit ion on the lim its of sci ence in the face of re -

Press, 1968), 5, 154. ++++ 24O’Dea, “Pri vate Sem i nar of Grad u ate Stu dents and Pro fes sors,” July 20, 1950, 1, O’Dea Papers, Box 5, fd. 7. * 25O’Dea, “Meet ing of the Sem i nar of Mor mon Grad u ate Studen ts and Pro fes sors,” July 27, 1950, 1, O’Dea Papers, Box 5, fd. 7. ** 26Ibid., 3. HOWARD M. BAHR/THOMAS F. O’DEA 115 li gious belief was neit her tem por ary nor transi t ional. He stated it in the 1949 re port, re peated it in pre sen tat ions in 1950, and much later, in the conclud ing parag raph of The So ci ol ogy of Re li gion, re af firmed his con vict ion that “the soc iol ogy of reli gion does not concer n it self with the truth or worth of the supraempirical beliefs upon which reli - gion rests.”27*** Based on his well-es tab lished and well-ar tic u lated po si tions for deal ing with such re li gious quest ions, it would have been consis t ent for O’Dea to have pre sented the com ing forth of the Book of Mor mon as Mor mons viewed that event, making it clear that he was desc ribing their be lief and values. Thus, his dec ision to of fer a natu r al ist ic alt er - nat ive in Chapt er 2 of The Mor mons was at variance both with his pub - lic state ments on re spect for the spir itua l values of other groups and with his long-term posi t ion that the soc iol ogy of re li gion lacked the tools to assess the va lid ity of re li gious claims. For ex ample, in a 1958 lectur e en tit led, “Is an Objec t ive Study of Re li gion Possi ble?” he ques- tioned, “Since many re li gions claim a transcen den tal ele ment, does not objec t ive study with its assump t ions of natu r al causa t ion leave out pre cisely what is most impor tant? If God in ter venes in human af - fairs—is not such in ter ven tion be yond the crit e ria of an empir ica l sci - ence that assumes natu r al causa t ion as the suf fic ient answ er to all problems? I think that we must answ er yes.” Even so, he con tin ued, study ing the em pir i cal char ac ter is tics and so cial con di tions as so ci - ated with re li gious change was im por tant. And to say that some re li - gious processes were soc ially con dit ioned was not to say that they con - tained no ele ment of transcen dence: “Whether or not there is such an ele ment is a matt er for a pruden tial judgmen t that sur passes the crit e - ria of science. ”28**** O’Dea’s att empt to stake out an objec t ive posi t ion on the aut hor - ship of the Book of Mor mon is also sur prising because moder n ist so - ci ol ogy,29+ at least since Max Weber, has had an accept able way of brack et ing ques tions of tran scen dent ex pe ri ence that al lows an a lysts simpl y to label them and move on. What ever repr esen ts the inex pli ca-

*** 27Thomas F. O’Dea, The So ci ol ogy of Re li gion (Englewood Cliffs, N.J.: Prentice-Hall, 1966), 117. **** 28O’Dea, “Is an Ob jec tive Study of Rel i gion Pos si ble,” 1958, 4–5, O’Dea Papers, Box 9, fd. 23. + 29“Mod ern ist” here de notes a worldview grounded in the epist emol - ogy of em pir i cism, a mindset some times la beled nat u ral ism. Mod ern ism in 116 The Journal of Mor mon His tory ble or the inef fable can be ef fect ively encap su lat ed under the concept “charisma,” or its products. Of course O’Dea was fami l iar with the concept. Elsewher e in The Mor mons he applied it, both in the anal ysis of Mor mon his tory (e.g., the sec tion of “Con tainmen t of Char isma”) and in naming “ra- tiona l ity versus char isma” as one of the “ar eas of strain postu lat ed in the Mor mon value sys tem.”30++ In these con texts O’Dea’s use of the term al lowed him to bracket, or ig nore, prec isely what the “char isma” of Jo seph Smith con sisted of; what ever it was, it fit Weber’s concept of cha risma, de fined as “a cer tain qual ity of an in di vid ual per son al ity by vir tue of which he is set apart from or dinar y men and treated as en- dowed with su per nat u ral, su per hu man, or at least spe cif i cally ex cep- tional pow ers or qual it ies. These as such are not acces si ble to the or di - nary person but are reg arded as of di vine or ig in.”31+++ As an exam ple, when O’Dea desc ribed Jo seph Smith’s re act ions to al leged rev e lat ions re ceived by his asso c iat es, he wrote: “Joseph Smith, hav ing claimed char ismat ic gifts pre vio us to his found ing of a church, had almos t lim ited his own gift to that of mir acu lo us transla - tion as early as the spring of 1829.”32++++ O’Dea has, in that statemen t, as- signed “mir acu lo us transla t ion” to the cat eg ory of char isma. Here he is on safe so cio log i cal ground with out fur ther an a lyz ing cha risma. But in Chap ter 2 of The Mor mons, he proposed an alt er nat ive to the main theo r ies of the or ig in of the Book of Mor mon prev io usly of - this sense com bines an em pha sis on quan ti ta tive mea sure ment with reductionism and ra tio nal ism. See Huston Smith, “Bey ond the Moder n West ern Mind Set,” Teach ers Col lege Re cord 82, no. 3 (1981): 434–57. Mod - ern ist so cial science is commit t ed to the “sophic” out look, a “world view of hor i zon tal nat u ral ism, a mo nis tic metaphysic that con fines all re al i ties to the nat u ral or der.” H. Curtis Wright, “A Sophic and a Mantic Peo ple,” BYU Stud ies 31 (Sum mer 1991): 51. Wil liam Mulder aptly char ac ter ized the mod - ern ist out look in de scrip tion of the Swear ing El ders as marked by “a healthy skep ti cism about any thing that the Breth ren—early or late—utt ered, and the last resor t was al ways a sense of ra tio nal ity, the at tempt to be ra tio nal about ev ery thing.” See Blakely, “Swear ing El ders,” 11. ++ 30O’Dea, The Mor mons, 156–60, 241–42. +++ 31Max Weber, The The ory of So cial and Eco nomic Or ga ni za tion, trans - lated by A. M. Henderson and Talcott Parsons (Glencoe, Ill.: Free Press, 1947), 358–59. ++++ 32O’Dea, The Mor mons, 156–57. HOWARD M. BAHR/THOMAS F. O’DEA 117 fered by non-believ ing writ ers. Seeing neit her the “disea sed mind” nor the “stolen manusc ript” theor y as tena ble, he of fered a “simple common-sen se expla na t ion” that the book’s re view ers, some of whom were alr eady on re cord as not believ ing the lit eral truthfulness of Joseph Smith’s account, found satisfactory and even praiseworthy. The O’Dea Papers include his field notes of his first visit to Salt Lake City in 1950 and day-by-day re search notes on life in Ramah from Sep tem ber 1950 to Jan uar y 1951. Rele vant also are selec t ions from his cor re spondence and his hand-marked copy of the Book of Mor - mon from which he construct ed impr essiv e footno tes of the book’s key themes.33* I found nothing in these mat er ia ls to sugg est that O’Dea ever consid er ed ser io usly that the Book of Mor mon might be what Joseph Smith claimed it to be. Nor does there seem to be a paper trail clar if y- ing the dec ision to ig nore his own oft-stated posi t ion that so cial sci - ence can not as cer tain the va lid ity of tran scen dent ex pe ri ence. How - ever, there is rele van t con text in his notes about conv ersa t ions with Saints on the Book of Mor mon and pos si ble clues in his Book of Mor - mon mar gina lia. Sig nif ican t is McMurrin’s commen t that O’Dea “assumes unc rit ica lly” Joseph Smith’s aut hor ship of the Book of Mor - mon.34** This es say ex am ines in de tail that un crit i cal as sump tion, which O’Dea terms a “simple, common-sense explanation.”

CONVERSATIONS ON THE BOOK OF MORMON, 1949–50 O’Dea’s Study of Mor mon Val ues (1949) cov ered aspect s of Mor - mon hist ory, pract ice, and belief that he consid er ed rele van t to the

* 33Major Book of Mor mon themes that O’Dea doc umen ted in long lists, ref er enced by chap ter and verse, in cluded the link age of righ teous ness and pros per ity, the “cen tral mes sage” of repen tance, the doc trine of free will, judgmen t accor d ing to works, the avail abil ity of mercy and grace and the uni versa l Atone ment, the pres ence of proph ecy, obe di ence to the com - mandmen ts, earth life as a pro ba tionar y state, the impor tance of per sev er - ance, the ne ces sity of knowl edge for ac count abil ity, the plain ness of the gos - pel, Amer ica as a prom ised land, the desir abil ity of democ racy, the per ils of mon ar chy, the evil of op pres sive tax a tion, anti-law yer sen ti ment, the ob li ga - tion of the clergy to work, the exis t ence of a great and abom i na ble church, the doc trine of the gather ing, and anti-se cret so ci ety sen ti ment. O’Dea, The Mor mons, 267–69. ** 34McMurrin, “[Rev iew of] The Mor mons,” 184. 118 The Journal of Mor mon His tory

Mor mon value sys tem. The report ’s first parag raph, explic itly neutral, under scor es the Book of Mor mon’s cen tral ity in early LDS history. O’Dea writes that Joseph Smith “publi shed his transla t ion of the Book of Mor mon which he claimed to have re ceived in an appa r it ion from the ang el Moroni, eng raved upon plates of gold. This book, pur - port ing to be the re cord of the an cient inhab it ants of the New World, became tog ether with the Bible, the scriptur es of the new Church. Moreo ver, the new reli g ion claimed cont inu o us cont empo r ary reve la - tion from God.”35*** Later, O’Dea brief ly ref ers to the Book of Mor mon as part of the LDS scriptur al canon, char act er izing it as “an al leged re - cord disco v ered by Joseph Smith through div ine assis t ance and trans- lated by the ‘gift and power of God,’ pur port ing to be sac red writ ings of the an cient inhab it ants of the Amer ican con tinen t. It is consid er ed by the Mor mons ‘a recor d of God’s deal ing with some Hebr ew inhab - it ants of the West ern hemispher e.’”36****He hardly men tions the book in the remain der of the report, save for an occa sional ci tat ion as a source of Mor mon doctr ine or a rea son for the Church’s in ter est in the Amer ican Ind ian. Througho ut the report, O’Dea is scrupu lo usly neutr al, ind icat ing neit her belief nor disbe lief when he ref ers to LDS ac counts of an gelic min is tra tions or rev e la tions. In a note pre ced ing the bib li og raphy , he explained that his objec t ive was to under stand Mor mon values from the Mor mon point of view. Theref ore “it was most appr opr iat e that Mor mon sources should be used ext ensiv ely,” but not exclu siv ely.37+ Al though the in ter ven ing field work ex panded his fa mil iar ity with Mor mon at ti tudes about the Book of Mor mon, as well as ar gu - ments for and against its aut hen tic ity, O’Dea main tained the same neutr al ity of presen tat ion in his 1953 doct oral thesis. In its conclud - ing chap ter, he wrote, “Mor mon ism is clearly Amer ican,” and con tin - ued, “The strands which en ter into its for mat ion are oft en the same as those which en ter into the dev elop men t of the Amer ican comm un ity as [a] whole and of other sub-comm un it ies within it.”38++ Even the or- thodo x Mor mon reader is unlik ely to take issue with that gener al ization. It may fol low for O’Dea that those “strands” in clude the cir cum-

*** 35O’Dea, Study of Mor mon Values, 1. **** 36Ibid., 12. + 37Ibid., 121. ++ 38O’Dea, “Mor mon Val ues: The Sig nif i cance of a Rel i gious Out look for Soc ial Act ion,” 510. HOWARD M. BAHR/THOMAS F. O’DEA 119 stances and in fluences that produced the Book of Mor mon; but to the believ ing reader, to say that Mor mon ism is Amer ican is not an attack on the Book of Mor mon. The book plays lit tle part in the rest of the disser tat ion, ex cept as it appears occa siona lly in notes on vil lage life as the sub ject of conv ersa t ions or talks and lessons at church. O’Dea does not coun ter or even ana lyze Jo seph Smith’s acco unt of the book’s coming forth, and the reader fin ishes the disser tat ion impressed that O’Dea has continued to be neutral and circumspect in his conclusions. Ex cept for a de tailed sum mary of the Book of Mor mon, the O’Dea Papers seem to con tain no pre-publi cat ions drafts of O’Dea’s 1957 chap ter on the book. Per haps the best we can do is to assess the kinds of input he recor ded in his field notes. The Book of Mor mon was not a major topic in most of O’Dea’s in ter views with Utah Mor - mons in 1950. Some times he asked about its rele vance to an in creased Church ef fort to missionize the Ind ians, and somet imes his inf or - mants would crit i cize or praise re cent in ter pre ta tions of ar chae o log i - cal find ings. He also notes that some mem bers of the “pri vate semi - nar” found, among problem at ic aspect s of Mor mon ism, Joseph Smith’s story of the origin of the Book of Mormon. In the course of O’Dea’s fieldw ork, he heard posi t ive test imon y on the Book of Mor mon from apost les, Church ad min is tra tors, ed u - cat ors, mission ar y guides on Tem ple Square, and members in Church meet ings, firesides, and persona l con versa t ions. He also heard neg a- tive tes ti mony from Mor mon in tel lec tu als who de scribed them selves as commit t ed to Mor mon values and cultur e, but not its theol ogy . He read the book careful ly enough to prepar e a det ailed summar y of its con tents and coded much of the book by topic, thus iden tif ying major themes and docu men t ing their loca t ion. How ever, there is lit tle ev i - dence that O’Dea read the Book of Mor mon an a lyt ica lly bef ore writ - ing Chapt er 2 of The Mor mons. His 1949 repor t and 1953 dis ser ta tion of fer lit tle ev idence that O’Dea engaged the book intellectually, either about its origins or its content. Moreo ver, in neit her the Salt Lake City nor the Ramah field notes does the Book of Mor mon fig ure as a cen tral topic. If one iden - tif ies brief and more sizable “men tions” by number of lines or para- graphs dev oted to discus sions of Book of Mor mon issues, the en tire body of field notes accu m ulat ed dur ing O’Dea’s six weeks in Salt Lake City yields only twenty-one brief ref er ences to or statemen ts about the Book of Mor mon, plus six “siz able” (roughly, a para graph or more) 120 The Journal of Mor mon His tory state ments. None of these re veal O’Dea’s re act ions to or feel ings about the Book of Mor mon; he sim ply re cords what was said or ob - served. The brief ref er ences in clude de scrip tions of ma te ri als dis- played or state ments made about the Book of Mor mon dur ing O’Dea’s visit s to Tem ple Square plus inf or mant statemen ts about the role of the Book of Mor mon in Mor mon hist ory, ar ti facts of an cient Amer ica as rele vant to Book of Mor mon peo ples, mission ar y work among the In di ans, and the Book of Mor mon as a ba sis for Mor mon theol ogy or mission ar y work. Three of the “siz able” state ments are his notes on test imo n ies by Tem ple Square tour guides; two are re ports of state ments on Church hist ory and the Book of Mor mon by BYU prof es sor of psy chol ogy M. Wilford Poulson; and the sixth re cords Lowell Bennion’s ex pla na tion of how the Book of Mormon supports a richer understanding of the mission of Christ. The field notes from O’Dea’s five months in Ramah con tain thirty-nine segmen ts on the Book of Mor mon, in clud ing four teen statemen ts a para graph or more in length, mostly sum ma ries of talks or lessons on Book of Mor mon topics at church meet ings. Typ ica lly the twenty-five briefer segmen ts also ref er to use of the Book of Mor - mon in LDS sett ings, occa siona lly as applied to mission ar y work among the nearby Zuni and Navajo. Combin ing both Salt Lake City and Ramah, there are twenty “sizable” acco unts in O’Dea’s field notes of conv ersa t ions or other en - coun ters inv olv ing the Book of Mor mon. The six I discuss here dif fer from the other four teen by being long er, tend ing to inv olve higher-sta - tus Mor mons, and, in three cases, of fer ing a rare glimpse of O’Dea’s persona l opin ions or impr essions, in con trast to his typi ca l neutr al re - cord ing of what was said and done. O’Dea’s notes on these six en - coun ters are rele van t for two rea sons: They rev eal the soc ial con texts in which O’Dea receiv ed inf or mat ion about the Book of Mor mon, and they also rev eal the kind of in for mat ion that he judged to be worth sett ing down. O’Dea “votes,” as it were, with his typew riter, and these epi sodes il lus trate some of his most sig nif ican t input on the Book of Mor mon. The first three are from Salt Lake City field notes, and the others from Ramah. “A Mem ber of the Elect” Bef ore beg inn ing for mal in ter views in Salt Lake City, the O’Deas spent a few days ori ent ing themsel ves. They re corded “general impr essions of Salt Lake City,” rang ing from depic t ions of down - town, Tem ple Square, and the State Capitol through “ev idences of HOWARD M. BAHR/THOMAS F. O’DEA 121 the presence and impor tance of the LDS Church,” the qual ity of the newspa pers, and the availabi l ity of cig ar ettes and li quor. On Tuesda y July 11, they visit ed Tem ple Square and joined three guided tours at different points in the tour. Pre sumabl y each of the tours treated the Book of Mor mon at some length. How ever, O’Dea’s notes men tion it only in connec t ion with their second tour, guided by a woman “hov er ing indef in itely around 60, small, with a de cisiv e walk, firmly corseted, and with a clubwoman’s man ner.” She spoke, he said, with a cer tain ad mix ture of at ti tudes rem i nis cent of the D.A.R. and Christian Sci en tists. It was a kind of “sweet ness and light” man ner. . . . One got the im pression from her re marks, that to her, pride in Utah, the tra di tions of its found ers and the ac com plish ments of its sons . . . was in tertwined with a faith in the right ness of Mor mon rev e- la tion. There was about this com bined at ti tude on her part a cer tain smug ness, but also an ex pression of real feel ing. She re ferred to early Mormon events and rel ics the way a D.A.R. member might re fer to the chair of Betsy Ross. The impor tance of America as a chosen land in Mormon think ing was evi dent in her remarks. She told in part the story of the Book of Mormon, of the two im mi gra tions of the Jews to this con ti nent . . . and of the degen era tion of their cul ture and the darken ing of their skins, con sequent upon their fall from vir tue. She spoke of the dis cov ery of Co lum bus as guided by the Holy Spirit. She spoke of Ja cob re ferring to Amer ica as the prom ised land, and two or three times re ferred to America as a land of lib erty. One felt that like Thoreau she thought she had been “born in the most esti ma ble place in all the earth and in the nick of time.” One got the feel ing that Amer ica was won derful, that Salt Lake City was its cen ter of virtue, and that the Mormons were the soul of this virtue. Moreover, it ap peared that she felt quite fortu nate to be a mem ber of the elect, and felt a certain pity for her Gen tile au di tors la - bor ing in dark ness. She pointed out, how ever, that the church was open to all, and warned that a fall from grace could lead to the degen er - a tion of our cul ture, as it did in the case of the early in hab it ants of the Amer i can hemi sphere.39+++ Lowell Bennion Among the Utah aca dem ics who discussed the Book of Mor - mon with O’Dea were Lowell Bennion and M. Wilford Poulson. Bennion had used O’Dea’s report as a ba sis for fireside discus sions

+++ 39O’Dea, Un ti tled field notes, July 11, 1950, 3, O’Dea Papers, Box 5, fd. 7. 122 The Journal of Mor mon His tory with his In stitut e of Reli gion studen ts, and had some gener al feedback on Mor mon theol ogy , spec if ica lly the cen tral ity of Christ, which he thought O’Dea had not empha sized suf fic iently. Bennion linked Christ ian belief and pract ice to the teachings of the Book of Mormon. He told O’Dea: The foun da tion of Mor mon faith was faith in Christ, and . . . in his [Bennion’s] work he was trying to ori ent this to an ac cep tance of Christ’s val ues. He said, “You hear much about our be ing a prac ti cal peo ple, etc.” but . . . the Mor mons should work to ward be ing known as a peo ple who un derstand Christ. He said that he thinks that Mor - mon theo log i cal con tent will be a great help in the fu ture toward mak - ing them the fin est Christians. He said his own reli gion was func - tional, that he thought of it in terms of ac tive par tic i pa tion in the re li - gious life. He said, for ex ample, look at the Mormon teach ing on baptism. He asked, what is baptism to the aver age Christian, and an - swered that it was a rite by which we get rid of origi nal sin. He said that for many Saints it was just a mat ter of forgive ness of sins and ac cep - tance into the church. He then said that he was n’t trying to preach to us, but that he would like to read us a state ment on bap tism in the Book of Mormon, in which one of the leaders addresses a group of people who are about to be bap tised. He read from Mosiah, Chap ter 18, where the leader pointed out that the re cep tion of bap tism meant will ing ness to bear each other’s bur dens, and that it was a cove nant with the Lord, that he may pour out his Spirit more abun dantly in their lives. He said the ol ogy and ordi nances in the Mormon Church pointed up to man as sum ing his part. He said, “Let me put it this way. Every thing in our reli gion takes us in as partic i pants.” He said it enabled peo ple to help oth ers and to help them selves, and that this goes back to the ol ogy, to the doc trines of the co-eter nity and freedom of man.40++++

M. Wilford Poulson In con trast to Bennion’s use of the Book of Mor mon to sup port the cen tral ity of Christ in LDS the ology was the posi t ion of M. Wilford Poulson, of Brigham Young Uni ver sity’s Psychol ogy De part - ment. Poulson “didn’ t put much stock in the theol ogy him self, but . . .

++++ 40O’Dea,, “In ter view with Dr. Lowell L. Bennion,” July 25, 1950, 4, O’Dea Pa pers, Box 5, fd. 7. HOWARD M. BAHR/THOMAS F. O’DEA 123 he thought a lot of the Mor mon values were good.”41* He was something of an aut hor ity on early LDS docu men ts, hav ing visit ed upstat e New York in 1929–32 when “some old people were still alive who re - mem bered things of in ter est to him.” Poulson’s skept ic ism about LDS the ology in cluded Jo seph Smith’s story of the coming forth of the Book of Mormon. He cited a con versa t ion he had had with Wallace Minor , an el- derly res i dent of the Pal myra area, who told him, that when he was a lit tle boy, Mar tin Har ris had come back to town and “had shown him the place where he and Joseph Smith had dug for bur ied trea sure.” Poulson con tin ued, “We deny this, but I believ e Wallace Minor . He had one foot in the grave when he told me this.” Poulson added that Mi nor re mem bered that “Mart in Har ris said that the site of this digging was much more sac red than ‘Mor mon hill,’ as there were many more heav enly man if est at ions there. . . . [and] that Mar tin Har ris felt that the plates had orig ina lly been there. He said that Mart in Har ris told him that they orig ina lly beg an to dig nearer the town, where they had so much trouble from spir its that they had to sac rif ice a black sheep.”42** Poulson also praised the work of Walt er Prince, who had done “a psy cho log i cal study of the Book of Mor mon and had tried to show what inf luences were act ing upon Joseph Smith as he inv ented proper names.”43***Joseph Smith had used many names be ginn ing with “M” and end ing with “on” or “an.” This, Prince arg ued, re flected

* 41O’Dea, “Con versa tion with Pro fes sor M. W. Poulson,” July 21, 1950, 3, O’Dea Pa pers, Box 5, fd. 7. ** 42O’Dea, “Discus sion with Pro fessor M. W. Poulson,” July 29, 1950, 2–3. O’Dea Papers, Box 5, fd. 8. *** 43Ibid., 4. See Wal ter F. Prince, “Psy cho log i cal Tests for the Aut hor- ship of the Book of Mor mon,” Ameri can Journal of Psychol ogy 28 (July 1917): 378–89. Prince had a Ph.D. in ab nor mal psy chol ogy from Yale and was a leading figur e in mult iple person a lit y and psychi ca l resear ch. Poulson con - sider ed him a friend, hav ing cor responded with him and visit ed him at his Boston of fice. Among Prince’s books were The Psy chic in the House (Boston: Boston So ci ety for Psy chic Resear ch, 1926), Noted Wit nesses for Psy chic Oc cur - rences: Inci de nts and Biog raphi cal Data, with Occa sional Comme nts (Boston: Boston So ci ety for Psy chic Resear ch, 1928; rpt. New Hyde Park, N.Y.: Uni - versit y Books, 1963; rpt. New York: Arno Press, 1975), and The En chanted Bound ary: Be ing a Sur vey of Nega tive Re ac tions to Claims of Psy chic Phe nome na, 124 The Journal of Mor mon His tory the anti-Masonic exc ite ment of the late 1820s in the area, for “A man named Mor gan had been kidnapped into Canada as a re sult of giv ing away Masonic se crets and was never again heard from. . . . The name Mor gan was a by word in the area at the time.” Poulson himself had ex- amined the lo cal news papers of the per iod and found that the name “Mor gan” appear ed many times in some issues. “Prince’s hypo the sis was that Jo seph Smith would be uncon sc iously inf luenced by names he had heard asso c iat ed with a strong emo tional impact. He [Poulson] said that he himself did not believ e these things at first but came to believ e them because he had to.” Poulson told O’Dea that Prince had been puz zled by the “Corianton” type of name; Poulson believ ed that it der ived from James Fenimore Coo per, whose her oine in the Last of the Mohicans was named Cora.44**** O’Dea found the Mor gan epi sode rele van t, not so much as the source of proper names as the or ig in of Joseph Smith’s appar ent fasc i - nat ion in the Book of Mor mon with sec ret combi na t ions.45+ Later, when O’Dea coded repet it ive themes in the Book of Mor mon, ref er - ences to Gadiantons or sec ret soc iet ies prompted the mar ginal notes “Mor gan,” or “Ma sonry.” The Wallace Minor story of sheep sac rif ice, witho ut attr i but ion, found its way into O’Dea’s sketch of Jo seph Smith’s early hist ory and the “nec romanc y” phase of O’Dea’s ex pla - na tion of the or i gin of the Book of Mor mon.46++ At the Aug ust 3 meet ing of the semi nar , Poulson talked about his in ter pre ta tions of the his tor i cal ma te rial on early Mor mon ism from the stand point of psy chology . He arg ued that Joseph Smith was better edu cat ed and had access to more books than is gener ally thought, for “the Church had [mist ak enly] presen ted these things as if they happened in a vacuum.” He said he knew of the li brary which was cir culated in Jo seph Smith’s town, which if Joseph had not read himself, at least his neighbors had

1820–1920 (Boston: Boston So ci ety for Psy chic Resear ch, 1930). **** 44O’Dea, “Discus sion with Pro fessor M. W. Poulson,” July 29, 1950, 4. + 45Fawn McKay Brodie makes the same point in No Man Knows My His - tory: The Life of Joseph Smith, the Mor mon Prophet, 2d ed. (New York: Al fred A. Knopf, 1971; rpt. New York: Vin tage Books, 1995), 63–66. This may be one of the in stances rev iewer Dale Morg an ref erred to in his com ment that O’Dea was “more deeply indebted [to Brodie] than the notes to his open ing chap ters would make one think.” Morg an, “‘Pecu liar Peo ple,’” 9. ++ 46O’Dea, The Mor mons, 5–6, 24. HOWARD M. BAHR/THOMAS F. O’DEA 125

read . . . . He said that Jo seph Smith could write better than many of his [Poulson’s] col lege stu dents, and that he [Jo seph Smith] knew quite a bit. He said that he [Poulson] had bought a num ber of old books, some of which he believed had been owned by Jo seph Smith. He said he could smell Jo seph Smith on one of them.47+++ Poulson quoted Walt er Prince as saying, “Now, Poulson, you point out to me one pas sage from the Book of Mor mon that has any liter ary merit, that was not cribbed from the Bible. ” Poulson had visited the Sac red Grove and “was conv inced that that was not the sac red grove, but that the way it af fected him was that he got down on his knees.”48++++ Mat thew Cow ley One of O’Dea’s most ext ensiv e expo sur es to the messag e and mean ing of the Book of Mor mon was the ded i cat ion of an LDS meet - ingho use for the Na vajo branch near Ramah, New Mex ico, in Oc to- ber, 1950. Apost le Matt hew Cowley was the vis it ing aut hor ity. The O’Deas att ended not only the ded i cat ion of the chapel but also a morn ing mission ar y meet ing in Zuni and a meet ing at the Ramah Ward chapel that eve ning. Elder Cowley spoke at each meet ing. At Zuni he bore test i mony to the Book of Mor mon, com ment ing on ar - cheo l ogi ca l disco ver ies and the voyage of Thor Heyerdahl: “These dis cov er ies, he said, merely prove that what the Book of Mor mon says is not impos si ble. He then said that he believ ed the Book of Mor mon not because it was scien tif ica lly proven, but because it was rev ealed by Jo- seph Smith whom he believ ed to be a prophet of the Liv ing God. He said that faith was in ter nal, but that test imo n ies were strengthened by these ex ter nal ev i dences.”49* Later that day, at the meet ing for the ded ica t ion, as usual, talks pre ceded the ded ica t ory prayer. O’Dea desc ribed this meet ing in his disser tat ion, and I quote from that, rather than the field notes, because in the disser tat ion O’Dea al lows himself some evaluative commen tary on the speeches while, in the field notes, he gives no in dica - tion of his reaction.

+++ 47O’Dea, “Pri vate Sem i nar of Grad u ate Stu dents and Pro fes sors,” Au - gust 3, 1950, 4, O’Dea Papers, Box 5, fd. 8. ++++ 48Ibid., 7. * 49O’Dea, “Resear ch Jour nal,” Oc to ber 17, 1950, 3, O’Dea Pa pers, Box 5, fd. 10. 126 The Journal of Mor mon His tory

Fi nally Apos tle Cow ley was in tro duced. (Let the brief sum mary of these speeches here mislead no one into thinking they were briefly deliv ered.) He spoke about the Indi ans as a chosen people and said that the typi cal In dian con ception of the hereaf ter as a place of activ ity not un like ac tivity in this world was closer to that revealed in mod ern scrip ture than that held for gen era tions by Chris tians. The In di ans, he said, were far more right than those who thought it con sisted of sit ting on a cloud and playing a harp.50**He then gave a long ded i ca tory prayer. In this he asked the Lord’s bless ings of each de tail of the build - ing, naming them ap parently for the Lord’s in forma tion. . . . It is ex tremely doubt ful how much of these speeches the In di ans un derstand. One would have to have some ac quain tance with the Book of Mormon to see the point of most of what was said, for the whole prob - lem of In dian con version is seen by the Saints in terms of that book. The In di ans are, of course, ig no rant of this sup posed his tor i cal background, ex cept in so far as they have heard of it from Mor mons. Any con gru ence be tween Book of Mormon ideol ogy and the culture of an In dian group is, there fore, quite ac ci den tal. Apos tle Cow ley’s de scrip tion of the In dian con cep tion of the hereaf ter ap peared to be based upon no tions of the Plains In di ans, perhaps received several times re moved from the source. At any rate it has lit tle re la tion ship to Na vaho be liefs. Yet so con - vinced are the Mormons of the truth of their mod ern scriptures that they appeal to the Indi ans with lengthy verbal izations which are in effect expanded ex ege sis upon them [the scrip tures]. One is tempted to say that such overconcern with the Book of Mormon gets in the way of a more un der stand ing ap proach to con tem po rary In dian cul tures.51*** Later that even ing, af ter a meet ing at the Ramah Ward, Apos tle Cowley . . . shook hands with us in a very friendly way. He said that we had en dur ance [for having at tended all three meet ings that day] and he urged us, if we were in Salt Lake City, to come to his of fice to see him . . . . I asked him if he would take a message back for me to Apos tle Widtsoe. He be came very in terested and asked me if I knew

** 50This ac count of Cowley’s speech may be a misattribution. In the field notes, O’Dea states that it was Presi dent Eu gene S. Flake of the South- west Mission who talked about the In dian view of the hereaf ter. O’Dea’s field notes on Cowley’s talk prior to the ded i ca tory prayer oc cupy just two sen tences: “Apost le Cowley paid trib ute to the lo cal peo ple for build ing this cha pel, and he urged the In di ans to make it their own. He spoke on mis sion - ary work and com pared his ex pe ri ences in the South Seas with the work among the In di ans.” O’Dea, “Resear ch Jour nal,” Oc to ber 17, 1950, 6. *** 51O’Dea, “Mor mon Val ues: The Sig nif i cance of a Rel i gious Out look for So cial Ac tion,” 352–53. HOWARD M. BAHR/THOMAS F. O’DEA 127

Apostle Widtsoe. I said I knew him, that he had helped me a great deal, and I had great regard and af fection for him. Apostle Cowley then said, “He knows that you’re here, doesn’t he?” I said that he did. He said, “I be lieve he spoke to me about you.” He said, “I remem ber your name.” He then took out his note book and made a note to give my regards to Apos tle Widtsoe.52**** Despit e this cor dial con versa t ion with Elder Cowley , O’Dea’s acco unt of the day’s speeches in his disser tat ion was more crit ica l than posi - tive.

Ramah Vil lag ers In line with Values Project norms on ethnographic note-taking, O’Dea’s field notes con tain few per sonal re act ions and beliefs. His re - cord of what he told Ramah Mor mons when asked about his be liefs is instruc tive, for it sugg ests he in tended to give the impr ession that he was unde c ided. An earlier Har vard re searcher had writt en that the best way to main tain rapport with lo cal Mor mons was to feign in ter est in their church.53+ O’Dea, of course, was int erest ed: Mormon life, beliefs, and values were his assig nmen t. When he was quest ioned about his re li gious beliefs, he stated that he was a Cath olic but also seemed to leave the impr es sion that he was undecided about Mormon theology. Somet imes O’Dea shared his Study of Mor mon Val ues with Ramah peo ple. On one such occa sion, he brought along the report to a soc ial visit. He and his host talked about it, the Mor mon read some selec t ions, and then asked O’Dea: “What do you find in the Church most dif ficult to believ e?” O’Dea responded: I said that I had been brought up in the east and knew practi cally noth - ing about Mor mons when I started that re search and that the idea of mod ern reve la tion was a new idea to me. [He] won dered if it had been plu ral mar riage. I said no, that I thought I un derstood the feel ing at

**** 52O’Dea, “Resear ch Jour nal,” Oc to ber 17, 1950, 11. + 53Val ues Pro ject resear cher Helen Faigin in Ramah wrote: “Per haps the best way to est ab lish good rap port in this comm un ity is to at tend Church and act in ter ested in their faith and be liefs. At least we have found this quite suc cess ful.” Faigin, June 13, 1950, 12, Ramah Resear ch Files, Lab - or at ory of An thropol ogy Ar chive, Santa Fe, New Mex ico. See also Helen Faigin, “Child Rear ing in the Rimrock Comm un ity with Spec ial Ref er ence to the Dev el op ment of Guilt” (Ph.D. diss., Har vard Uni versit y, 1952). 128 The Journal of Mor mon His tory

the time on the in tro duc tion of plu ral mar riage. I said that the idea of mod ern reve la tion, how ever, was something quite new. I said that af - ter I be gan to read the Mor mon scrip tures I was quite im pressed with them. . . . I said that the only things I knew of Mormon ism be fore I started this work were the names of Jo seph Smith and Brigham Young, po lyg amy, the trek to the west and the fact that saints had been perse cuted. I said that was about all all east erners knew. I said I had known some Mor mons from Salt Lake City in the army, and had liked them and one had shown me the Book of Mormon and that I read a few pages in it. But I did not think much about it at the time. I said it seemed a long way off and that New England ers were unbe liev - ably pro vincial and did not quite real ize what ex isted west of the Hud- son River.54++ Late in Oct ober , at a fare well dance for a Ramah man en ter ing the mil it ary, one of the lo cal Mor mons asked ano ther Har vard re - searcher, Da vid McAllester, what the re searchers thought of the Mor - mons. O’Dea watched the discus sion from a dist ance and reported:

Dave told me later that [the Mor mon] had asked him about the opinion of the Harvard people and his own opinion about the Book of Mormon ex plain ing the ori gin of the In dian. Dave gave an answer that he and I had ear lier agreed upon. He said that there were several theo ries and that the Book of Mormon the ory was cer tainly one of them. He said that he un derstood that Mor mons did not con sider the Book of Mormon merely a theory. He said that he real ized that when Jo seph Smith had first said there had been large cit ies on this con ti - nent that peo ple thought it was crazy, but that sub sequent archae o log - i cal re searches had shown that there were. He said he did n’t know him self but that the Book of Mormon the ory had some ev i dence. . . . [The Mor mon] then asked Dave what Geor gia and I were do ing in Ramah. Dave said that I was a so ciol o gist and histo rian and that I had written a his tory of the Mormons that the el ders in Salt Lake City were very pleased with. He said that I had spent some time in Salt Lake City and that I knew a num ber of Church lead ers person ally and that they thought well of me.55+++

Such statemen ts sugg est ing that O’Dea and other resear chers

++ 54O’Dea, “Resear ch Jour nal,” No vem ber 15, 1950, 3, O’Dea Pa pers, Box 5, fd. 11. +++ 55O’Dea, “Resear ch Jour nal,” Oc to ber 23, 1950, 4, O’Dea Pa pers, Box 5, fd. 10. HOWARD M. BAHR/THOMAS F. O’DEA 129 believ ed that “the Book of Mor mon theor y had some ev idence,” along with report s that inf luen tial Mor mon leaders knew O’Dea and thought well of him, and with the on going ev idence of the O’Deas’ en - thu si as tic par tic i pa tion in LDS Church meet ings and other ac tiv i ties, were suf fic ient to ensur e his con tin ued rapport with the villagers.

O’DEA’S MARKINGS IN HIS BOOK OF MORMON Ano ther source of in for mat ion on O’Dea’s beliefs about the Book of Mor mon is his mar gina lia and underlinings in his copy of the book,56++++ind icat ing passag es that he found impor tant for some rea son. Usua lly, it seems, he marked the topic cat eg or ies he wanted to men - tion in his Book of Mor mon chap ter. Sim i larly, most of the marg inal notes are cod ing cat e go ries (e.g., “bap tism,” “re pen tance,” “Atone- ment,” “plainness” of the gospel, “obed ience”) that he marked and summa r ized in footno tes to il lus trate the themes of the book. His statemen t that “the cen tral messag e of the book is repen tance” is supported by ref er ence to verses in eighty-seven chapt ers. His iden tif ica - tion of twenty-one other themes, sim i larly support ed by chap ter and verse, is ir refut able ev idence—o ver kill, one might argue—that he has read and analyzed the book. On the other hand, his markings are those of a coder, his foot- notes those of a concor dance-maker, rather than ev idence of a writer’s thoughtful en gage ment with a text. For in stance, O’Dea finds many more verses on re pen tance than on the Atonemen t; there fore, by his quan tit at ive count of impressionistically marked passag es, he concludes that re pen tance is the Book of Mor mon’s cen tral messag e. He did not, how ever, mark the preface, which plainly states that the book’s pur pose is “the conv inc ing of the Jew and Gen tile that JESUS is the CHRIST, the ETERNAL GOD, man if est ing himself unto all na- tions” (Book of Mormon title page). O’Dea’s mar ginal notes in 3 Nephi, which re cords Christ’s min - istr y in the New World and is there fore cen tral to the book, iden tify the theme of “re pen tance” twenty-four times, “bap tism” eight, “Ma - sonry” six, “gather ing of the Jews/Isr ael” five, “Lord’s Supper” two, “Lord’s Prayer” one, and “Atonemen t” one. The index to The Mor - mons also of fers ev idence of incom plet e themat ic cod ing. It con tains more en tries for Arminianism (4) and Danites (4) than for Second

++++ 56O’Dea Papers, Box 38, Item 2. 130 The Journal of Mor mon His tory

Coming (3), and there are none for “Atonemen t,” “Love,” “Christ,” “Je sus,” “Je ho vah,” “Re demp tion,” “Resurrection,” or “Savior.” Thus, O”Dea’s mar ginal notes and, to a deg ree, the index to The Mormon s, are rev eal ing in what they do not rev eal: in the notes that are not there, the absen t ev idence of in tel lectua l eng agemen t other than topic la bel ing. Still, one must in ter pret absences with cau tion. Per - haps the ar chived Book of Mor mon is not the copy O’Dea first read but rather one he read and marked spec if ica lly as a cod ing project, to pro vide support and ev idence of anal ysis for the new chapt er. And per haps someone else prepared the index. A few of O’Dea’s mar ginal notes sugg est an att itude, a stance about Joseph Smith and the Book of Mor mon alr eady in place when he marked this book. It shows up in his ready use of the name “Mor - gan,” or “Ma sonry” when sec ret combi na t ions are men tioned and in his label ing of “er rors.” On 2 Nephi 1:14, O’Dea noted, “Shake - speare;” Mosiah 25:15 gener ated “this is a typi ca l camp meet ing descrip tion”; 2 Nephi 33;6, Enos 2, Mosiah 5:3, and Alma 5:9, 7:19, 26:6–7, and 34:4–5 are all la beled with some vari ant of “re viv al ism” or “re vival meet ing”; Alma 30:15, 23, and 42–43, are la beled “Vil lage atheism, ninet eenth cen tury”; beside Alma 30:44 and Helaman 12:15 are jot ted “Co per ni cus” and “Co per ni can the ory”; Alma 48:10–11 and 54:13 prompted the no tat ion, “Amer ica the Beaut iful”; Alma 43:38 he iden tif ied as “dict at ing mist ake,” Helaman 2:14 as an “art i - fact of dic ta tion,” Alma 24:19 as “mis take?” and Mor mon 8:34–35 as “mist ake.” Fi nally, Alma 27:4 pro voked a “poor Joe,” and 3 Nephi 29:6 the note, “Woe to those who reject Joe.” This patt ern strongly sug- gests that O’Dea had alr eady est ablished mental categories and opinions before reading/marking this copy.

A “SIMPLE, COMMON-SENSE EXPLANATION” REVISITED O’Dea’s li brary re search conv inced him of the impr oba bi l ity of the or ies at trib ut ing au thor ship of the Book of Mor mon to some one other than Jo seph Smith.57* It also seemed unlik ely to him that Joseph Smith was psy cholog ica lly twisted in any way that might explain the Book of Mor mon. That left O’Dea two op tions: Smith was au thor of

* 57He took this po si tion in 1949, not ing that George B. Arbaugh’s Rev - e la tion in Mor mon ism “tends to suppor t the Spaulding-Rigdon theor y of the ori g in of the Book of Mor mon, a theor y which is uncon vinc ing to the presen t writer,” and main tained it thereaf t er. O’Dea, A Study of Mor mon Values, 122. HOWARD M. BAHR/THOMAS F. O’DEA 131 the book, or, as he claimed, its transla t or. O’Dea chose the first, and produced Chapt er 2 of The Mor mons in support of that position. From a book praised as “bril liantly writt en,” O’Dea’s statemen t of the “sim ple, com mon-sense ex pla na tion” is re mark ably con vo- luted. The single sen tence “expla na t ion” runs to eighty-four words: “There is a simple common-sens e expla na t ion [of the or ig in of the Book of Mor mon] which states that Josep h Smith was a nor mal per - son liv ing in an atmo spher e of reli gious exc itemen t that inf luenced his be hav ior as it had that of so many thou sands of others and, through a unique con com i tance of cir cum stances, in flu ences, and pres sures, led him from nec ro mancy into rev e la tion, from rev e la tion to prophec y, and from prophec y to leader ship of an impor tant re li - gious movemen t and to inv olvemen t in the bitt er and fat al in ter group conf licts that his inno va tions and success had called forth.”58** O’Dea calls this statemen t “by far the most likely and saf est” ex - pla na tion of the Book of Mor mon’s or i gins. Hav ing thus, from the standpoin t of the nonbelieving reader, sat isfac t or ily resol ved one of the burn ing quest ions in the his tory of Mor mon ism, his expla na t ion would seem to deser ve more att en tion than it has receiv ed in the half cen tury since The Mor mons was published. In fact, it de served more att en tion from its aut hor. One might expect O’Dea himself to elabo r ate this concept, furt her clari f ying the defi n it ions, assump t ions, and variables inv olved. Inst ead, the next parag raph moved on to a consid er ation of the book’s themes, thus leav ing the reader to in ter pret O’Dea’s ex plana t ion. A syst em atic re - duct ion and re state ment of this com plex verba l chain shows that it is composed of these statements: 1. Joseph Smith was a nor mal person. 2. He lived in an atmo spher e of reli gious exc itemen t. 3. Liv ing in an at mo sphere of re li gious ex cite ment in flu ences the be hav ior of a nor mal person. 4. Jo seph Smith was inf luenced, as many thousands of others had been. 5. Jo seph Smith was inf luenced uniquely, or as many thousands of others had not been. 6. He was inf luenced by a unique concom i t ance of cir cumstances, inf luences, and pressur es. 7. Some how (unspec if ied in O’Dea’s sen tence, but presum abl y

** 58O’Dea, The Mor mons, 24. 132 The Journal of Mor mon His tory as a conse q uence of the “unique concom i t ance”) Jo seph Smith ar - rived at necromancy. 8. The unique concom i t ance “led him” from nec romanc y to rev - e la tion. 9. The unique concom i t ance led him from rev e lat ion to prophecy. 10. The unique concom i t ance led him from prophec y to lead ership of an impor tant re li gious move ment. 11. The unique concom i t ance led him from leader ship to in- volve ment in bitt er and fat al in ter group con flicts. This pre lim inar y re duct ion of the key parag raph of O’Dea’s chapt er gener ates two problems: First, where is the depend en t vari - able, the Book of Mor mon? The parag raph sounds very learned, and per haps the book has indeed been explained . Still, a care ful re-read - ing con firms the appar ent ambi g uit y about which state ment, if any, in cor po rates the cre ation of the Book of Mor mon. Part of the problem is that the expla na t ion has gone too far—the “unique concom i - tance” seems to have explained the history of Mormonism up to 1844. Items 3 through 11 are state ments of process: Joseph Smith is “inf luenced” or “led.” Where in these state ments of in fluence does the Book of Mor mon be long? A possi ble opt ion is state ment 7, which inv okes nec romanc y. That word deno tes “magic in gener al, espe c ially that pract iced by a witch or sor cerer; witchc raft; conju r at ion,” or “the al leged art of div ina t ion through com mun ica t ion with the dead; the black art.” Earlier in the book, O’Dea de scribed Jo seph Smith as one who “seems to have appear ed to those who knew him as an agree able and lik able young man, some what of a ne’er-do-well,” who as a “dig - ger af ter trea sure” used a peep stone that he said helped him lo cate trea sure. Thus, O’Dea con tin ued, “nec ro mancy, mid night digging—in short, an inno cen t occult ism—seemed to occup y the youth. . . . Joseph later used his peep-stone in the transla t ion of his Book of Mor mon, so that even this act iv ity was a sort of prepa r at ion for his pro- phetic car eer.”59***It might also be ar gued that the visit of the ang el Moroni was nec romanc y under its definition which includes “communication with the dead.” Elsewher e, O’Dea seems to place the Book of Mor mon’s or ig ins later, in the “from nec romanc y to rev ela t ion” link of statemen t 8. O’Dea’s in troduc t ory chapt er con tains a brief acco unt of the First Vi-

*** 59Ibid., 5–6. HOWARD M. BAHR/THOMAS F. O’DEA 133 sion, fol lowed by the state ment: “It was in this way, so Joseph Smith main tained, that there beg an a ser ies of report ed rev ela t ions, which included the mi racu lo us disco v ery and transla t ion of a set of gold plates.”60****If we include the Book of Mor mon as part of that “ser ies of re ported rev e la tions,” de lete gen eral prop o si tions in fa vor of the spe- cific, and also delet e statemen ts that ref er to outcomes other than the Book of Mor mon, O’Dea’s causal chain can be reduced to the state - ment that Jo seph Smith, a nor mal person, lived in an atmo spher e of reli gious exc itemen t. That, and a unique concom i t ance of cir cumstances, inf luences, and pressur es, led him to necromancy, and thence to revelation (the Book of Mormon). A second problem with the “simple, com mon-sense expla na - tion” is the cen tral ity of the “unique concom i t ance.” Unique, of course, deno tes “exist ing as the only one or as the sole exam ple; single; sol i tary in type or char ac ter is tics.” Mod ern ist so cial sci ence is not in ter ested in the unique, but in pat terns that conf orm to laws or ten- denc ies. It is the natur e of uniqueness, by def in it ion, to be bey ond the pat tern; it rep re sents a se vere anom aly, a non-re pet i tive oc cur rence, a sol it ary instance. Yet in this case, that char act er ist ic which places an event be yond gen er al iza tion, its very sol i tary-in-type-ness, be comes a part of the expla na t ion. By that inclu sion, in the strict sense this “ex- plana t ion” has spilled bey ond the al lowable lim its of the term, for the unique is unreplicable, unpredictable, beyond trend. In the spirit of fur ther simpli fica t ion, let us subst itut e “mix” for “concom i t ance,” and the single term “inf luences” for the phrase “cir - cumstances, inf luences, and pressur es.” It can be ar gued that both cir cumstances and pressur es are, in the sense O’Dea used these terms, inf luences of one sort or ano ther. Also, reli gious exc itemen t may be consid er ed as a pressur e, cir cumstance, or inf luence. Fina lly, that Jo seph Smith was “nor mal” seems an unnec es sar y, compli cat ing assump t ion. Presum abl y here O’Dea meant to dist ing uish his simple ex pla na tion from those that at trib ute the Book of Mor mon to an un - balanced or patho log ica l mind. More im por tant, here O’Dea was, in good socio log i ca l trad it ion, reject ing the expla n at ions of “ment al state” or “black box” in fa vor of the soc ial env ir onmen t. Even so, the assump t ion of nor malcy, espe c ially in light of Jo seph Smith’s subsequent history, is too strong, and in this explanation it is unnecessary.

**** 60Ibid., 3. 134 The Journal of Mor mon His tory

It fol lows that O’Dea’s simple, com mon-sense expla na t ion can now be render ed thus: Joseph Smith, inf luenced by a unique mix of inf luences, was led to nec romanc y and rev ela t ion (the Book of Mor - mon). For O’Dea, the Book of Mor mon is explained by a unique mix of influences. The reader is unlik ely to be sat isf ied with an expla na t ion that concludes in “a unique mix of inf luences,” because that phrase is both opaque (Which inf luences? How did those “in fluences” become the book?) and non-inf or mat ive (How was the uni verse creat ed? A unique mix of inf luences). In explain ing ev ery thing, O’Dea’s simple, com mon-sense ex pla na tion of pro cesses ex plains noth ing. O’Dea may have rea l ized its weak ness, for he spends the rest of the chap ter iden tif ying inf luences that he presumed were presen t in the unique mix. These ba sic themes “in the air when Mor mon ism was born” include “the implic it men tal ity of the popu lar Prot est ant ism of the time” (a projec t ion of the his tory of sect ar ian Christ ian ity), the hopes and ex al ta tion of the re vival meet ing, “the ro man tic na tion al ism of the new repub lic,” the “popu lar no tions of Hebr aic gene sis” of the In- di ans, sec u lar op ti mism and pop u lar ex pec ta tions of prom ise for the com mon man, “dem o cratic sen ti ments,” the “ideal pro jec tion of left-wing Prot es tant ism” (good and evil eas ily dis cern ible, ec u men i cal as pi ra tions), the uto pi an ism of im mi grants, “pop u lar be liefs in the spe cial char ac ter of this con ti nent,” and the val ues, as pi ra tions, and in ter ests of Amer i can up state New York.61+ Un for tu nately, the processes whereby these inf luences are transm uted into the text of the Book of Mor mon—the linkag e bet ween ext er nal con dit ions and lit er - ary pro duc tion—re mains en tirely un spec i fied. In ad di tion, this ex pla- nat ion suf fers from the ecolog ica l fal lacy by which group char act er is- tics are assumed to influence individual behavior. It fails as an explanation because the connection between characteristics “in the air” and the pages of dictated text is never demonstrated. Still, O’Dea’s most ser i ous problem is not that his expla na t ion is incom plet e but that he states as cer tain ties what are, at best, frag ile hy poth e ses. These are hy po thet i cal links. Un able to dem on strate how any of the char act er ist ics “in the air” of 1820s Amer ica actu a lly took shape as the Book of Mor mon, he of fers with ap par ent as sur - ance such judgmen ts as these, support ing them with an “obv io usly” or “one suspect s” to def lect att en tion from the missing con nect ions:

+ 61O’Dea, The Mor mons, 24–26, 28–31. HOWARD M. BAHR/THOMAS F. O’DEA 135

Much can be seen in the Book of Mormon of the implicit mental ity of the pop ular Prot estant ism of the time. . . . It is ob vi ously an Amer ican work growing in the soil of Ameri can con cerns in terms of its basic plot and its enshrin ing of Amer ica as the promised land, as well as in the uncon cealed sec ular pa trio tism with which it refers to the United States. . . . The Book of Mormon verses are a descrip tion of the disci ples of Christ in the New World and are ob vi ously in imi ta tion of the bibli - cal texts. . . . The expec ta tions of the Nephites are those of nine - teenth-cen tury Amer i can Prot es tants rather than of bib li cal He brews. . . .Those who are saved are al ways saved in Christ, and the only dif fer - ence be tween what a Nephite prophet and a New York reviv al ist says is that the for mer usu ally adds “who will come” or “who is to come” af - ter the name of Christ. . . . There is one in stance when one suspects that the tension and ex cite ment of the revivalistic present tense ac tually got away from the au thor and that he hurried to regain him self and to keep from expos ing him self be fore his scribe.62++ In fact, O’Dea’s simple theor y of the or ig in of the Book of Mor - mon is implic it througho ut the chapt er. He does not need the myst if y- ing chain of el emen ts, the eighty-four-word sen tence, or the ob scure “con com i tance of cir cum stances, in flu ences, and pres sures” to frame his common-sens e expla na t ion. He might have said quite plainly: “Jo - seph Smith dict ated the Book of Mor mon from ideas that were ‘in the air’ at the time, but I can’t explain how he did it.” O’Dea’s clear est state ment of this work ing hy poth e sis—not an ex pla na tion—is stated in an endnote: “There seems very lit tle doubt toda y as to Joseph Smith’s au thor ship of the Book of Mor mon.”63+++ It is this “expla na t ion” that was sharply crit ic ized in the only neg - at ive rev iew of the book I have been able to find.64++++Ezra Geddes, a so - ci ol o gist trained at Cor nell Uni ver sity, was an as sis tant pro fes sor at

++ 62Ibid., 29, 32, 37, 39, 39–40, 40; em pha sis mine. The pas sage where O’Dea thinks the aut hor had to cover his slip from his scribe is Mosiah 16:6: “And now if Christ had not come into the world, speaking of things to come as though they had al ready come, there could have been no redemp tion.” +++ 63Ibid., 266. ++++ 64In all, I have found twenty-two rev iews, in clud ing eigh teen signed rev iews and four anon ymo us brief book notes. Some of these are more pos i - tive than others, and of ten, along with praise, ref er to a hist or ica l er ror or two, or to modes t shortcom ings. How ever, only the Geddes rev iew is sharply crit i cal. Leon ard J. Arrington, “Schol arly Stud ies of Mor mon ism in 136 The Journal of Mor mon His tory the Univ ersit y of New Mexico when he rev iewed O’Dea’s book for the New Mex ico His tor i cal Re view. In it, he quest ioned O’Dea’s standar ds of judgmen t on sev eral grounds, among them that “he is main tain ing that Joseph Smith from early in youth through out the ma ture years of his life per petr ated, taught and lived a lie. This accu sa t ion is a se rio us mat ter and re quires care ful doc u men ta tion,”65* which the book did not provide. I comm un icat ed with Geddes by telephon e and email in Febr u- ary 2006, asking about his neg at ive rev iew of O’Dea’s book almos t a half-cen tury ago, in con trast to the many very posi t ive rev iews. He the Twen ti eth Cen tury,” Dia log ue: A Jour nal of Mor mon Thought 1, no. 1 (Spring 1966): 22; Rob ert M. Barry, “[Rev iew of] The Mor mons,” Amer i can Cath o lic So cio log i cal Re view 18 (De cem ber 1957): 344; Charles S. Braden, “Mor mon ism Through the Years,” South west Re view 43 (Win ter 1958): 75–78; John Buettner-Janusch, “[Rev iew of] The Mor mons,” Amer i can An- thro pol o gist 60 (April 1958): 384–85; Creer, “[Rev iew of] The Mor mons”; LaMar T. Empey, “[Re view of] The Mor mons,” BYU Stud ies 1 (Win ter 1959): 69–71; W. J. E. “The Mor mon Trek—By Land and Sea,” San Franci sco Chroni - cle, No vem ber 10, 1957, 25; Aust in E. Fife, “[Rev iew of] The Mor mons,” Pa - cific His tor i cal Re view 27 (May 1958): 188–92; Winfred E. Gar ri son, “[Re - view of] The Mor mons,” Jour nal of Bi ble and Re lig ion 27 (Janu ary 1959): 262–63, and “[Re view of] The Mor mons,” Chris tian Cen tury 75 (March 1958): 343–44; Ezra Geddes, “[Rev iew of] The Mor mons,” New Mex ico His tor i cal Re - view 33 (April 1958): 156–60; Vin cent C. Hopkins, “[Rev iew of] The Mor - mons,” Thought: Fordham Univer sity Quar terly 33 (Spring 1958): 145–46; Don- ald F. Maclean, “[Re view of] The Mor mons,” Dalhousie Re view 38 (Sum mer 1958): 257, 259; McMurrin, “[Rev iew of] The Mor mons”; Mor gan, “Pe cu liar Peo ple”; Nel son, “[Re view of] The Mor mons”; S. A. W., “[Re view of] The Mor - mons,” Jour nal of Il li nois State His tor i cal So ci ety 50 (Win ter 1957): 431–32; Gustave Weigel, “[Rev iew of] The Mor mons,” Theo log i cal Stud ies 19, no. 4 (1958): 659–60; and Young, “The Mor mons.” Anon ymo us book notes, gener - ally only two or three para graphs long, also ap peared: “[Rev iew of] The Mor mons,” Daugh ters of Amer i can Rev o lu tion Mag a zine 91 (De cem ber 1957): 1377; “[Rev iew of] The Mor mons,” New Yorker 33 (De cem ber 7, 1957): 244; “[Re view of] The Mor mons,” Utah His tor i cal Quar terly 33 (Win ter 1965): 94–95. * 65Geddes, “[Rev iew of] The Mor mons,” 158. Geddes is a prac tic ing Lat ter-day Saint. Much of his later car eer was with the Sys tem Dev elop men t Cor po ra tion, the Amer i can Jus tice In sti tute, and the Tech nol ogy Ser vice Cor po ra tion. He re tired in 1986. HOWARD M. BAHR/THOMAS F. O’DEA 137 emailed on Febr uar y 18, 2006: “My re sponse has to be spec ula t ive since I have not read their re views nor do I know the unw ritt en as- sumpt ions in their minds when their re views were writt en.” The main dif fer ence, he said, was in the assump t ions from which the re view ers beg an. “One of my assump t ions was that Joseph Smith was, indeed, used by the Lord to pro vide inf or mat ion that was needed at that time and that the Lord works, not through in tel lec tua ls, but through people who are ‘nobod ies.’ I do not know that he has rev ealed much through so called in tel lectu a ls. Given my assump t ions . . . which are in op po si tion to O’Dea’s that Josep h Smith lived a hoax, I looked for weak nesses in O’Dea’s ar gumen ts. Why other re view ers did not find these weak nesses re veals that their assump t ions dif fered from mine.”66** Geddes’ sec ond crit ic ism might have been writt en by O’Dea him self: The so ci ol o gist as a sci en tist nec es sar ily dis tin guishes the superempirical from the empir i cal and con fines himself, except for de scrip tion, to em pir i cal mat ters which can be re pro duced through sci en tific pro ce dures and to gen er al iza tions there from. When con - fronted with such non-em pir i cal ques tions as when, how and to whom God gives rev ela tions, and even such mun dane non-em pir i cal ques - tions as what a dead man ac tually thought in con trast to what he com - mu ni cated to oth ers, the soci ol o gist ad mits that his tools of anal ysis are in ad e quate. In these ar eas the so ci ol o gist de scribes with out pass - ing judg ment. Dr. O’Dea, on the other hand, not only passes judg - ment con cerning these non-em pir i cal matters, but sets himself up as an au thority who presumes to ex plain the non-em pir i cal “truth” to the reader.67*** A pos si ble ex pla na tion of O’Dea’s vi o la tion of his own so cio log i - cal standar d may be his growing exper tise in Mor mon ism, re flected in his rec ommen da t ions on the neces sit y for trained theolo g ians to rescue an outdat ed Mormon theol ogy . Consid er ing “the Mormon en- coun ter with mod ern secu lar thought,” O’Dea wrote that “the church has, with few excep t ions, no theolog ica lly qual if ied leaders who can guide it in its enco un ter with sec ular thought. . . . In terms of the ology , the church is gov erned not only by laymen but also by ama t eurs.” Part

** 66Geddes, Santa Monica, email to Howard Bahr, Feb ru ary 18, 2006. *** 67Geddes, “[Rev iew of] The Mor mons,” 158. 138 The Journal of Mor mon His tory of the rea son that the Church faced “the threat of apos tasy on the part of its in tel lectu a ls,” he sugg ested, was the need for a lib er al izat ion of its fun da men tal ist the ol ogy. But the kind of rap proche ment nec es sary to bridge the di vide be tween fun da men tal ists and in tel lec tu als was not possi ble because the Church, “inv olv ing as it does the princ iple of lay leader ship, has not produced a spec ial ized corps of theolo g ians who would be prof ession a lly prepar ed to grapple with the problems in volved.”68**** That O’Dea’s out look had matur ed from his 1949 re port is also sugg ested in a sub tle but sig nif ican t shift. He had presen ted the re - port “in a manner respect ful to the beliefs and values” of the Saints and an ef fort to be “sen sit ive to the beliefs and feel ings of others. ” His de ci sions about The Mor mons, O’Dea said, were gov erned by “in tel li - gent sym pa thy,”69+ and for the mod ern ist so ci ol o gist, in tel li gence trumps sympa t hy. For the be liev ing reader, this may mean that the earlier respect and sen sit iv ity have become sympathetic but patronizing. Hav ing spent eight years studying the Mor mons, O’Dea may have felt he had ar rived at that deg ree of earned assur ance and under - stand ing of “his people” desc ribed so well by Brit ish an thropol o g ist E. E. Ev ans-Pritchar d: “It is almost impos si ble for a person who knows what he is look ing for and how to look for it, to be mist aken about the facts if he spends two years among a small and cul tur ally homo g e - neous people do ing nothing else but studying their way of life.”70++ The Mor mons were not a small popu la t ion; but with re spect to faith and doctr ine, they were fairly ho mog e neous. On the ba sis of fieldw ork at both their ur ban cen ter and rur al mar gin, and of fami l iar ity with the rele van t liter a tur e far bey ond that of most edu cat ed Mormons, O’Dea could claim a thor ough, atypical, and perhaps overconfident mastery of Mormonism. From the standpoin t of twenty-first-cen tury sensi t iv ity in the social sci ences to the in her ent lim i ta tions of any par tic u lar van tage point and (in an thro pol ogy par tic u larly) to the le git i macy of a worldview grounded in the expe r ience of the people, one is struck by how thor oughly in The Mor mons O’Dea assert s the etic view, the ext er -

**** 68O’Dea, The Mor mons, 230, 234. + 69Ibid., vii. ++ 70E. E. Ev ans-Prit chard, So cial An thro pol ogy (London: Tavistock, 1957), 83. HOWARD M. BAHR/THOMAS F. O’DEA 139 nal spec ial ist’s in ter pret at ion, over the emic, the view of the people. 71+++ In 1949, unsur e of him self and new to the cultur e, O’Dea was con strained, ten ta tive, def er en tial to the per cep tions of the peo ple he stud ied. Eight years later, trained and cer tif ied, sea soned by long er im mersion in Mor mon cul ture and his tory than many of his an thro- polog ica l col leagues in their preliterate tribes, he was in a po sit ion to under stand and gener al ize. In con trast to his earlier work, which explic itly sought the “nat ive” perspec t ive, O’Dea in The Mor mons be - came the in tel li gent but sym pat hetic expert, an “aut hor ity” whose job it was “to explain the non-empir ica l ‘truth’ to the reader.”72++++ That his “expla na t ion” of the Book of Mor mon suf fered from vagueness, did not sust ain the cer tain ties of his conclu sions, and cast Jo seph Smith as fraudu len t seems to have been overlooked or minimized by most reviewers. One wonders what might have been had O’Dea sought crit ica l re act ion to this chap ter from ort hodo x Mor mons, as he had earlier done with A Study of Mormon Values. There was lit tle crit ique of as- sumpt ions in the ed it or ial process; the anon ymo us re viewer of the manusc ript for the Univ ersit y of Chicag o Press noted that O’Dea’s view of the or ig ins of the Book of Mor mon agreed with his own.73* Per haps feedback from ort hodo x readers would have reminded O’Dea of his own standar d, published dur ing the same per iod that

+++ 71Rob ert Feleppa, “Emics, Etics, and Soc ial Ob ject iv ity,” Cur rent An - thro pol ogy 27 (June 1986): 243–55. ++++ 72Geddes, “[Rev iew of] The Mor mons,” 158. * 73Anon y mous, “Uni ver sity of Chi cago Press—Manu script Re port,” Janu ar y 24, 1956, 2, O’Dea Pa pers, Box 9, fd. 4. The rev iewer wrote: “It should be men tioned that I ap proach this manusc ript through the eye of an in di vid ual who has come out of a Mor mon back ground and who has read the ma jor stud ies deal ing with the hist ory of Mor mon ism and the so cial, eco nomic, po lit i cal, and psy cho log i cal as pects of Mor mon life.” The re- viewer found the manusc ript com prehen siv e, but too di verse and seem ing to att empt too much: “Thus, a crit ica l appr aisal of ‘Who wrote the Book of Mor mon?’ is rather remo te from a det ailed soc ial study of a con tempo r ary Mor mon vil lage.” Chap ter 2 “pro vides a de tailed analy sis of the Book of Mor mon. Cor rectly in my opin ion it em pha sizes that the book ref lects the exc ited rel i gious atmo sphere of the time and that its appea l to con verts was based on its concern with the quest ions and hopes about which lay people wor ried.” 140 The Journal of Mor mon His tory the manusc ript for The Mor mons was in prepa r at ion: “It is not the task of the soc i ol ogy of re li gion or the psy chol ogy and his tory of re li gion to pass judgmen t on the ul timat e truth of reli gious doctr ines.”74**Or per haps, as sect ions of his manusc ript beg an to take on the ironic tone char act er ist ic of Fawn McKay Brodie, he might have re mem - bered his own crit ic ism of Brodie and the biases he perceived in his project associates. Such att itudes were appar ently more troubling to him in 1949 than they would be eight years later. The bib li og raphy of the 1949 re - port included his rec ommen da t ions for other Values Project work ers. His an no ta tion on No Man Knows My Histor y is rev eal ing: “This biog - raphy of Joseph Smith was writt en by an ex-Mor mon, a mem ber of an impor tant Mor mon fam ily. Its publi cat ion caused quite a stir among the Saints. The presen t writer found it il lumi nat ing in many places. Yet because of the great desir e on the part of many of our work ers to reduce and expose reli gious prophet s, a desir e held on an almos t unverbalized level, one hesi t ates to recom mend it, as it might be grist to the reductionist mill. It cer tainly should be read tog ether with a Mor mon view of the prophet.”75*** There was no com par able warn ing to readers of The Mor mons. Inst ead, O’Dea’s “desir e,” espe c ially in the chap ter on the Book of Mor mon, now seemed much in line with that of his moder n ist peers.

** 74Thomas F. O’Dea, “The Soc iol ogy of Rel ig ion,” Amer i can Cath o lic So cio log i cal Re view 15 (June 1954): 88. *** 75O’Dea, Study of Mor mon Values, 124. THE CHURCH FOLLOWS THE FLAG: U.S. FOREIGN AID, UTAH UNI VER SI TIES, THE LDS CHURCH, AND IRAN, 1950–64

Jessie L. Embry

IN 1960 CLARK BALLARD, who dir ected a U.S.-funded con tract between Utah State Univ ersit y1* and the Ag ri cul tural Col lege in Karadj, Iran, asked my fat her, Bertis L. Embry, an eng ineer ing prof es sor at USU, “How would you like to take a trip around the world?” My par ents weighed the advan tages and dis advan tages of upr oot ing their five childr en, rang ing in age from six to sixt een. Ult imat ely, because my fat her believ ed that trav el ing was a valuable ed uca t ion, he agreed to accept a two-year assig nmen t. My life in Iran as a third and fourth grader was a pleas ant ad ven ture. Al- though I was sur rounded by a very dif fer ent cultur e, I was shel- tered by an Amer ican school and by LDS reli gious ser vices that pro vided im por tant el e ments of con ti nu ity. In 1998, I in ter viewed Helen Milligan about her years in North

* JESSIE L. EMBRY {[email protected]}Jessie Embry is the asso ci ate di rec tor of the Charles Redd Cen ter for West ern Stud ies at Brigham Young Uni versit y. She has writ ten seven books and more than a hundr ed ar ticles on Mor mon ism, Utah, Amer ican West, women, and oral his tory top ics. 1Utah State Ag ricul tur al Col lege became Utah State Univ ersit y in 1957. Since the name change does not af fect this pa per, I ref er to the uni versity by its cur rent name through out.

141 142 The Journal of Mor mon His tory

Log an, but she also in trigued me by desc ribing her fami ly’s two years in Iran in the early 1950s. Her husband , Cleve Milligan, had worked on the same con tract as my fat her. That connec t ion with my fami ly’s expe r iences sparked my in ter est. I resear ched furt her and learned about the strug gles that Utah tech ni cians from USU, Brigham Young Univ ersit y (BYU), and the Univ ersit y of Utah—nearly all of them Mor - mons—had with the Iran ian and Amer ican gov ernmen ts. I also saw the Utah con tracts in the broader Cold War sett ing. This ar ticle describes the lives of Utah Mor mons in a Muslim country during the 1950s and 1960s.

SOURCES To re search the con tracts, I visit ed the ar chives of the three uni - versi t ies. USU’s Specia l Collec t ions and Archiv es has ext ensiv e re - cords. The ann ual, quar terly, and end-of-tour re ports by the Utah techn ic ians pro vided valuable in sights. BYU’s L. Tom Perry Spec ial Col lect ions and Manusc ripts Div ision houses the papers of Dean A. Pe terson, a BYU emplo yee who super vised all the Utahns in the 1950s. The Univ ersit y of Utah Re cords Manag e ment also has papers.2** My fat her wrote weekly lett ers to his mother while we were in Iran. While these lett ers rarely discussed his work, they do pro vide some insight s about life in Iran. I conduct ed an oral his tory in ter view with my fat her, and Iran was one area of discus sion. While 1998 was a lit tle late to start the re search, I in ter viewed other techn ic ians and their wives about life in Iran. These in ter views do not include day-to-day rout ines, but they summa r ize sig nif ican t events and bene - fit from re flect ions on their work, given the changes in Iran with the

** 2Spe cial Col lec tions and Ar chives are housed in the Merrill-Cazier Li - brary at Utah State Univ ersit y (hereaf t er USU Spec ial Col lec tions). In 1998 when I be gan my resear ch, half of its Iran doc u ments were cat a logued and half were in pro cess. Since then Rob ert Parsons, the Univ ersit y Ar chiv ist, has com pleted the task. The L. Tom Perry Spe cial Col lec tions and Manu - scripts recor ds are in the Har old B. Lee Libr ary at Brigham Young Univ ersity, Provo, Utah (hereaf ter Perry Spe cial Col lec tions). The Uni versit y of Utah pa pers are at the Recor ds Manag emen t Div ision, Univ ersit y of Utah, Salt Lake City. While I do not cite papers from this third col lec tion, the re- cords were help ful. JESSIE L. EMBRY/UTAH UNIVERSITIES AND IRAN, 1950–64 143

Iran in 1954 show ing the lo ca tion of USU Point Four tech ni cians in the ostans. Iran and Utah State Uni ver sity (Lo gan: Utah State Uni versity, ca. 1963), 48.

1978–79 rev o lu tion.3*** I also visit ed the Nat ional Ar chives in Col lege Park, Maryland. In 1999 over two hundr ed boxes were decla ssi f ied but had not been

*** 3My fat her’s let ters are in my pos ses sion. The oral hist ory in ter views are part of the Charles Redd Cen ter for West ern Stud ies Oral His tory Pro - gram, Perry Spe cial Col lec tions. Un less other wise cited, all in ter views are in this col lec tion. I con ducted sixt een in ter views with USU and BYU techn i - cians. I did not find any Univ ersit y of Utah person nel to in ter view. 144 The Journal of Mor mon His tory cat a logued. Find ing inf or mat ion about the role of the Utah univ ersi - ties was dif ficult, but I did find some important papers. This paper focuses on the views of the Mor mon Church and the Utah techn ic ians. Two Iran ians also re flected on their coun try’s views of U.S. Point Four prog rams. USU en gineer ing studen t Malek Monsour Esfardiaz con cluded, “Techn ica l Assis t ance to Iran was at the most oppor tune time. It was a time that consc iousness was stir - ring and feuda l ism was beg inn ing to crumble un der the weight of a new na tion al ism.” I don’t know how much at tend ing USU in f lu enced his ideas. Jahangir Amuzegar, published a book on U.S. assis t ance to Iran. How ever, Ira ni ans re fused to co op er ate, so his re search was based on Amer icans ’ fina l report s.4****

B EGINNING THE MORMON CONNECTION In 1912 John A. Widstoe, USU’s pres i dent, who had a doct or ate in chemis tr y and spe cial ized in soil re search, met Mirza Ali Gholi Khan, Iran’s Con sul Gen eral, at an ir ri ga tion con fer ence in Canada. A friend ship dev eloped, and in 1915 Widstoe inv ited Khan to speak at a USU bac ca laur e ate ser vice. As a re sult, Iran i ans be gan studying ag ri cul tural and ir ri gat ion methods at USU. By 1951, 150 for mer USU studen ts were working for the Iran ian gov ernmen t. For ex ample, Mo hammed Ameen Khan Sepehri, aft er his stud ies at USU, became presi den t of the Karadj Ag ricul tur al Col lege. Seyed Jafar Khan, also a USU alumnus, be came an ad vi sor in an i mal hus bandry to the Shah Reza Pahlevi.5+ The close connec t ion that Widstoe es tablished with Iran ian gov - ernmen t leaders and stu dents sur vived a complet e change of gov ern-

**** 4Malek Monsour Esfardiaz, “The Ag ri cul tural Phase of the Techn i cal Assis t ance Pro gram of the United States to Iran, with Spe cial Ref er ence to the Role of Utah State Uni versit y” (M.S. thesis, Utah State Uni versit y, 1958), 39; Jahangir Amuzegar, Tech nical As sistance in The ory and Prac tice: The Case of Iran (New York: Fred er ick A. Praegar, 1966). + 5Gwen H. Haws, ed., Iran and Utah State Univer sity: Half a Centur y of Friendship and a De cade of Contr acts (Lo gan: Utah State Uni versit y, 1963), 7; “Iran’s Best Neighbor—Utah,” Deseret News, Decem ber 17, 1956, 1, in Jour - nal His tory of the Church of Je sus Christ of Lat ter-day Saints (chro no log i cal scrap book of typed en tries and news pa per clip pings), Ar chives, Fam ily and Church Hist ory Depar tmen t, Church of Je sus Christ of Lat ter-day Saints, Salt Lake City (hereaf ter LDS Church Ar chives). JESSIE L. EMBRY/UTAH UNIVERSITIES AND IRAN, 1950–64 145 ment in Iran. In 1926 Reza Khan, a mil it ary leader who beg an his ca - reer as a noncom mis sioned of ficer and rose to the rank of col onel, over threw the 130-year Qajar dy nasty and es tablished him self as king. He changed his name to Reza Shah Pahlavi or Reza Shah, as the Ira ni - ans called him. Reza Shah focused on chang ing his coun try to meet West ern economic and polit ica l standar ds. He also att empted to “moder n ize” dress standar ds and reduce the inf luence of Muslim re - li gious leaders. For ex ample, he elim inat ed the veil for women, an im - por tant symbol of the dif fer ences bet ween men and women in Mus- lim so ciet y. While Amer icans saw Reza Shah’s moves as prog ressiv e, his methods were oft en cruel. A 1960 Time Mag a zine ar ti cle re called that the Shah “did not mind machine gunn ing ob streper ous peas- ants” as he “man han dle[d] Iran into a mod ern world.”6++ The Shah’s re forms in cluded impr ov ing ag ricul tur e, so in 1939 he appea led to the U.S. State Depart ment for a spec ial ized adv isor . Given the alr eady est ablished Utah connec t ions, members of the Ira- nian Le gat ion in Washing t on, D.C., and the U.S. State De part ment recom mended Franklin S. Har ris, then presi den t of BYU and an expert in ag ricul tur e. Har ris spent almos t a year in Iran studying con di - tions and mak ing rec om men da tions.7+++ When he left, he sugg ested that the Iran ian gov ernmen t hire two Utahns to con tinue his work. Since USU focused on ag ricul tur e and had the state’s lead ing aut hor i - ties in ir ri ga tion and soil tech nol ogy, he rec om mended pro fes sors Lu-

++ 6“Iran,” Time Mag a zine, Sep tem ber 12, 1960, 25. For more in for ma - tion on Ira nian his tory, see Nikki R. Keddie, Roots of Rev o lu tion: An In ter pre- tive Histor y of Moder n Iran (New Hav en, Conn.: Yale Uni versit y Press, 1981), which she up dated in Moder n Iran: Roots and Re sults of Revo lu tion (New Ha - ven, Conn.: Yale Uni versit y Press, 2003). “Shah” was a ti tle used by Ira nian lead ers. Su san Whit ney, “An Equal Voice: Mus lim Women Speak Out,” Deseret News, April 20, 2002, E-1, gives a more con tem po rary view of how some Musl im women view cov er ing their heads and their role in so ciet y. Rather than see ing Is lamic rule as con trol ling, they see it as respect ful of Al - lah (God). +++ 7Haws, Iran, 7–8 said that State Depart ment and De part ment of Ag ricul ture per son nel rec om mended Har ris. Har ris re corded in his jour nal that a combi na t ion of for mer USU studen ts and State Depart ment people rec om mended him. Frank lin S. Har ris, Jour nal, June 8, 14, and Au gust 8, 1939, 1061–62, 1073–74, type script, LDS Church Ar chives. I used this type - script for 1939–40. 146 The Journal of Mor mon His tory ther M. Winsor, an irrigationist, and Don W. Pittman, a soil technol o- gist and chemist. Pittman ar rived in Iran with his wife in Sept em ber 1940. They com pleted their work and left sepa r ately despit e World War II in Jan uar y and Sept em ber 1943. Winsor ar rived in Iran with - out his fami ly a week bef ore the Japa nese bombed Pearl Harbor . He stayed in Iran througho ut the war because he feared transpor tat ion bomb ings.8++++ World War II brought more polit ica l changes to Iran, but the Utah connec t ions sur vived. The Al lies wanted the use of the rich Ira- nian oil. Fol lowing his tor ica l patt erns, Great Brit ain and the So viet Un ion occu pied Iran in 1941, split ting the coun try in half. Fear ing that Reza Shah support ed the Ger mans, the Al lies remo ved him from power, exi l ing him to Afr ica where he died in 1944. The English and the So viet s al lowed his twenty-one-year-old son, Moham med Reza Pahlavi, who had been schooled in Switzer land, and the Iran ian mil i - tary sys tem, to take over as a puppet ruler. An ind ica t ion of his low status was that, when Al lied lead ers Franklin D. Roose v elt, Winston Chur chill, and Joseph Sta lin met to det er mine war strat egy at the Teh - ran con fer ence in 1943, they did not no tify the Shah that they were com ing.9* Fol lowing World War II, Chur chill and Sta lin relax ed their con - trol over Iran and al lowed the Shah to become the ruler in fact. Mo - hammed Reza Pahlavi con tin ued his fat her’s plans to west ern ize the coun try. At the time, Great Brit ain owned nearly all of the oil com pa- nies and kept most of the prof its. The Shah wanted to nat iona l ize business and elimi nat e for eign con trol so that money would stay in his coun try to pay for his expen siv e seven-year plan to ref orm Iran. He succeeded in taking over the oil com pan ies, but his remo val of the Brit ish eng ineers who knew how to op er ate the equipmen t result ed in a drop in oil produc t ion and rev en ues. Funding for his reform movement also dipped. The Shah was not disco ur aged. He and the prime min ist ers

++++ 8“Mrs. Pittman Return s from Persia,” Logan Herald Journal, May 18, 1943; “Soil Ex pert Com pletes Work in Iran,” Sep tem ber 13, 1943, clip ping file, USU Spec ial Col lec tions. The newspa per ar ticles do not list Mrs. Pittman’s first name. See also Lu ther M. Winsor, Life His tory of Lu ther M. Winsor (Murray, Utah: R. Fenton Murray, 1962), typesc ript, USU Spe cial Col lec tions. * 9“Iran,” Time, 25–26. JESSIE L. EMBRY/UTAH UNIVERSITIES AND IRAN, 1950–64 147 used Iran’s lo cat ion—a long bor der with the So viet Un ion—to solic it aid from both the Russians and the Amer icans. Such aid took the form not only of mil it ary support but also eco nomic assis t ance and techn ica l adv ice to assist in the Shah’s westernization plans.10**

P OINT FOUR/USAID Those goals dove tailed with Pres i dent Harry S. Truman’s strat - egy of neu tral iz ing the So viet Un ion’s in flu ence by of fer ing tech ni cal aid to Third World coun tries. Truman anno unced these plans as part of his in au gu ral ad dress in 1949: “We must em bark on a bold new program for making the bene fits of our sci en tific advances and indus - trial prog rams available for the im prove ment and growth of under devel oped na tions.”11*** Since this aid was the fourth goal spec if ied in Truman’s ad dress, the new for eign assis t ance prog ram was inf or - mally re ferred to as Point Four. While the prog ram’s name changed fre quently, the con cept re - mained the same. John F. Kenned y re named the prog ram USAID (United States Agency for In ter nat ional Dev elop men t) in 1960,**** a name which has con tin ued in use to the presen t.12 But as Iran i ans liked to explain, Point Four or USAID was alwa ys the same or gan i za- tion. “It is the same donk ey, but the sad dle has been changed.”13+ Aft er Tru man’s an nounce ment, Cong ress had to appr ove the idea, and more im por tantly, pro vide fund ing. It passed a law which re - quired that the U.S. gov ernmen t and the for eign gov ernmen t sign an agree ment spec if ying that the coun try agreed to accept U.S. aid. The neg o tia t ions were time-consum ing, so at first Iran agreed to a tem porary compact in 1950. A per manen t aid package came in 1951. Point Four goals were lofty. The United States hoped to share its techn ica l knowledg e and impr ove the qual ity of life for the peo ple of the world. By do ing so, it hoped to show that the free world’s econom -

** 10Keddie, Mod ern Iran, 105–31. *** 11Sergei Y. Shenin, The United States and the Third World: The Or ig ins of Post war Re la tions and the Point Four Prog ram (Hun ting ton, N.Y.: Nova Suance Pub lish ers, 2000), 26. **** 12For an ex pla na tion of changes in Point Four, see Clar ence Hendershot, Pol i tics, Po lem ics, and Ped a gogy (New York: Van tage Press, 1975), 11–53. + 13Haws, Iran, 9. 148 The Journal of Mor mon His tory ics, pol it ics, and the way of life were better than Comm un ism. In her in ter view, Helen Milligan explained that the Russians only wanted to keep the wheat fields of Iran; the Brit ish only wanted to save their oil fields. But the Amer icans wanted to help the Iran ian peo ple.14++

P OINT FOUR AND UTAH As part of the 1950 agree ment, Iran agreed to accept techn i - cians. (U.S. techn ica l adv isors were re ferred to as techn ic ians whether they were feder al or univ ersit y con tract emplo y ees. An imme diat e need was find ing someone to dir ect the new prog ram. In 1950 Frankl in S. Har ris, who was then pres i dent of USU, was working tem por arily in Washing t on, D.C., with the State Depart ment. On March 10, Glen Taggart, a feder al emplo yee in the Of fice of For - eign Ag ri cul tural Re la tions of the U.S. De part ment of Ag ri cul ture and fu ture USU presi den t, called Har ris and asked if he “would consider an appoin tmen t to the For eign Ser vice in Iran,” add ing that Har ris was the gov ernmen t’s first choice. Within four months Har - ris had resig ned his po sit ion at USU and was in Iran as the dir ect or of Point Four.15+++ Once Har ris ar rived in Iran, he rec og nized that Point Four needed to hire techn ic ians in many ar eas to impr ove life for Iran ians. U.S. law pro vided for di rect hires and uni versit y con tracts. Because of his con nect ions in Utah and other con tacts bet ween Utahns and Ira- nians, Har ris sugg ested that the U.S. State Depart ment con tract with Utah universities. Point Four of fic ials liked Har ris’s sugg est ion. E. Reesman Fryer, who was in charge of Point Four for the State Depart ment, wrote to another feder al admin istr at or that con tracts with Utah made sense be - cause “cli ma tic, top o graph i cal and ag ri cul tural sim i lar i ties in Iran have enco ur aged an in ter change of spe cial ists and studen ts bet ween Utah and the Near East for many years. The inst itu t ions in Utah train the great est number of Iran ian studen ts, and spec ial ists from this State have served with dist inct ion in the past in adv isor y capac it ies to the Gov ernmen t of Iran.” Henry G. Bennett, the first Point Four di -

++ 14Helen Milligan, Oral His tory, in ter viewed by Jessie Embry, June 23, 1998, 13. +++ 15Frankl in S. Har ris, Jour nal, March 10 and 31, April 26, and July 15, 1950, 1663–64, 1666, 1669, 1683, type script, USU Spe cial Col lec tions. I used the USU type script for the 1950s. JESSIE L. EMBRY/UTAH UNIVERSITIES AND IRAN, 1950–64 149 rect or (killed in an air plane crash in Iran in 1952), support ed Utah techn ic ians because of their work ethic. He wrote to the dean of ag ri - cultur e at USU, “I like these Utah fel lows. They usu ally get things done.”16++++ Frankli n S. Har ris also told USU Pres i dent Louis L. Madsen, “USU stands very high in Iran because of the success of the studen ts who retur n to serve the coun try.” U.S. of fic ials, Utah techn ic ians, and the state newspa pers also ref erred to simi lar climat e and ag ricul tur e as rea sons for Utah con tracts in Iran. With the Mor mons’ expe r ience in ir ri ga tion, co op er a tives, and “the spirit of ru ral ag ri cul tural im - prove ment,” the Deseret News felt that Utahns would help the “semi-arid plat eau” in Iran to “blossom as a rose.”17* BYU Presi den t Er nest L. Wilkinson felt the feder al gov ernmen t select ed Utah univ ersi t ies not only for the sim i lar climat e but “be - cause the cul tural habit s of our facult y (in par tic u lar the non-use of to- bacco and alco hol ) par al leled the hab its of the or thodo x Iran ians and would be pleasing to them.”18** All three Utah univ ersi t ies agreed to part ic ipat e. Each uni versity had unique assig nmen ts. USU’s con tract was for ag ricul tur e. The Univ ersit y of Utah’s was for public health. The BYU’s con tract was for sec ond ary ed u ca tion, al though once on site, the tech ni cians also worked with primary schools. In May 1951 the U.S. and the Iran ian gov ernmen ts signed a for - mal agreemen t ext end ing the work that Har ris had beg an. Wil liam Warne, a car eer for eign ser vice em ployee, became the dir ect or of Point Four in Iran in No vem ber, and Har ris became the “Techn ica l Ad vi sor to the [U.S.] Am bas sa dor in mat ters per tain ing to Point Four

++++ 16E. Reesman Fyer, Let ter to Mr. [no first name given] Matzger, May 1, 1951, Dean A. Pet erson Col lec tion, Box 2, fd. 2, Perry Spe cial Col lec tions; hereaf ter Pet erson Col lec tion; see also Henry Bennett, Let ter to Rudger Walker, March 7, 1951, Louis L. Madsen Papers, USU Spe cial Col lec tions. * 17Frank lin S. Har ris, Let ter to Louis Madsen, April 11, 1951, Madsen Papers; “Real Grass Roots Aid for Iran ian Farm ers,” Deseret News, in Jour nal Hist ory, May 15, 1951, 1–2. ** 18Er nest L. Wilkinson, Lett er to Jo seph M. Stokes, Assis t ant Deput y Dir ec tor for Tech ni cal Ser vices, Janu ar y 3, 1956, Box 2, fd. 8; Fryer, Memo to Metzger, May 1, 1951, Box 2, fd. 2, Pet erson Col lec tion. 150 The Journal of Mor mon His tory work and other mat ters.”19*** Point Four’s or ga ni za tion in cluded an over all dir ect or and a dir ect or for each coun try. In ad dit ion, each Point Four div ision such as edu ca t ion and ag ricul tur e had a U.S. di - rect or and a coun try dir ect or. Why were the Utah univ ersi t ies in ter ested in the con tracts? They receiv ed funds to pay the techn ic ians and it pro vided resear ch expe r ience for their facult y and other techn ic ians.20**** But finances were not the only mo tiva tion. Univ ersit y presi den ts—Ray Olpin (U of U), Er nest L. Wilkinson (BYU), and Louis Walker (USU) explained, “It is believ ed that the peoples of the United States and other nat ions have a common in ter est in the economic and soc ial free dom of all peoples. Such prog ress can fur ther the se cure growth of the demo - cratic ways of life, the expan sion of mutu a lly ben e fic ial commer ce, the de vel op ment of in ter na tional un der stand ing and good will and the main tenance of world peace.”21+

FIRST UTAHNS IN IRAN In Oct ober 1951 when the first Utahns ar rived in Iran, Point Four faced ur gent concer ns in ag ricul tur e, health, and edu ca t ion througho ut the coun try. Wil liam Warne assig ned the con tract em- ploy ees to work with U.S. feder al emplo y ees in the main of fice in Teh - ran and in the ostans (states). Welling Roskelley from USU headed the Point Four ag ricul tur al div ision in Iran. USU Prof essor Cleve Milligan stayed in Teh ran to work in ir rig at ion. Bruce Holmes Ander son, who was working on a mast er’s deg ree in ag ricul tur e under Milligan, and Jay Hall, who had complet ed a mast er’s deg ree in an ima l husband ry and later worked for the USU Ext ension Ser vice, went to Shir az. BYU so ci ol ogy prof es sor Reed Brad ford di rected all Point Four work in Resha. BYU edu ca t ion prof essor Max Berryessa stayed to work in Teh ran, and public school teacher Glen Gagon planned edu ca t ional

*** 19Har ris, Jour nal, May 12, 1951, 1728, USU Spe cial Col lec tions. **** 20USU’s orig i nal con tract, June 26, 1951, was for $100,000; six amend ments brought the to tal to $729,072 by April 9, 1954. BYU’s orig i nal con tract, June 30, 1951, was for $65,000; four amend ments brought the to - tal to $246,335 by July 23, 1953. + 21Mem o ran dum of Agreemen t signed by the pres i dents of Brigham Young Uni versit y, the Uni versit y of Utah, and Utah State Ag ri cul tural Col - lege, June 26, 1951, Recor d Group 1240A, Box 2, Na tional Ar chives, Col - lege Park, Marylan d. JESSIE L. EMBRY/UTAH UNIVERSITIES AND IRAN, 1950–64 151

Gordon Van Epps, a USU tech ni cian from Ephraim, Utah, su pervises work ers digging po ta toes on the Uni versity of Karadj ex peri men tal farm in 1961. Photo by Bertis L. Embry, courtesy of Jessie L. Embry. prog rams in Shi raz. When the Utahans ar rived, the Iran ian gov ernmen t was very un sta ble.22++ Hist or ian Nikki Keddie pointed out some rea sons. First, peasan ts and city resi den ts faced eco nomic stress from high in ter est rates and taxes. Product s from the West threat ened the mer chants or ba zaar group. Re li gious leaders op posed the Shah’s westernization plans. Nomad ic tribes re sisted plans to force them to sett le in stable comm un it ies. British and Ameri can gover nmen ts threatened to boy - cott Iran ian oil if the Iran ian gov ernmen t con trolled the fields. The Tudeh (Com mun ist party) which had started dur ing Reza Shah grew in power because of these con cerns. The party urged that Iran for get deal ing with Great Brit ain and the United States and turn to Russia

++ 22This ac count sum ma rizes Keddie, Mod ern Iran, 110–31. I fol low Keddie’s spell ing of “Mosaddeq” rather than “Mossaddeq.” Keddie does not men tion the ri ots that the Utahns dis cuss, so it is dif fi cult to de ter mine exact ly how they fit in the larger pictur e. I have included notes dur ing this dis cus sion for di rect quotes from Keddie. 152 The Journal of Mor mon His tory

In the 1960s, Iran was a land of con trasts be tween the modern and the tra di- tional. Here cam els gather at a wa ter well on the Uni versity of Karadj cam pus. Photo by Bertis L. Embry, courtesy of Jessie L. Embry. for aid. Iran had a parl ia ment (majiles) that included a few repr esen ta- tives from many sec u lar and re li gious po lit i cal par ties. Co ali tions elected a prime min ist er who was oft en not the Shah’s choice. Al- though the Tudeh was banned, it inf luenced Iran ians. In March 1951, for ex am ple, a re li gious na tion al ist as sas si nated the prime min - ist er, Gener al Ali Razmera. The Shah proposed Hosain Ala as his re - placemen t; but in April, the Iran ian par lia ment chose Dr. Moham - med Mosaddeq “a high-born West ern-trained liber al nat iona l ist in tel - lec tual” who had opposed Reza Shah in 1929.23+++ While many Iran ians liked Mosaddeq the Shah, the Brit ish, and the Amer icans did not. To expr ess their dis plea sure with the Shah and foreig n inf luence, Iran ians demon s trated, carr ying “Yank ees Go Home” signs. Some times these marches turned into ri ots and vio - lence. The Tudeh did not alwa ys support the prime min ist er. In July 1952 some Iran ians att acked Mosaddeq’s home next door to the Teh -

+++ 23Ibid., 88. JESSIE L. EMBRY/UTAH UNIVERSITIES AND IRAN, 1950–64 153

A Point 4 tech ni cian demon strates how to irri gate in row-and-furrow cul ture, a de par ture from Iran’s trad itional broadc ast-and- flood-ir ri ga tion farm ing. Iran and Utah State Uni ver sity (Lo gan: Utah State Uni versity, ca. 1963), 78.

ran Ostan’s Point Four of fices. Ac cord ing to BYU edu ca t ion techn i - cian and Point Four edu ca t ion di rec tor Max Berryessa, the Amer i - cans escaped tak ing Mosaddeq with them. When Berryessa re turned, he found burned cars in the compo und and bul let holes in the bath - room att ached to his of fice which faced Mosaddeq’s home.24++++ USU technican Bruce Ander son lived in Shir az, six hundr ed miles from Teh ran. The dirt roads req uired a full two days to make the trip to the capi t al. He wrote in his jour nal on July 30, 1952, “Teh - ran is now quiet aft er all the troubles a few days ago.” His wife Lula wrote to her par ents, “It is usua lly calm[er] in Shir az and we miss out on all the exc itemen t and demon str at ions.” But that changed in April 1953. The Amer icans usua lly went to the mov ies Wednesda y even ings but stayed home when an Iran ian friend warned them of an att ack planned by Mosaddeq’s support ers. Wil liam Warne was also con- cerned and asked the Point Four emplo y ees in Shir az to remain at home with their fami lies and not to go to their offices. As tensions con tin ued to mount, the five Point Four fami lies

++++ 24Keddie, Roots of Rev o lu tion, 132–41; Max Berryessa, “Our Life To - gether: A Persona l His tory of the Max and Janet Berryessa Fam ily,” 1998, type script, Perry Spe cial Col lec tions, 65. 154 The Journal of Mor mon His tory

A van dal ized truck in the Point Four com pound in Teh ran af ter Com mu nist vio lence in 1953. Iran and Utah State Uni ver sity (Lo gan: Utah State Uni - versity, ca. 1963), 31. sought refug e with Quahqa’is, an anti-gov ernmen t nomad ic tribe. Glen Gagon had set up tent schools for the tribe and dev eloped friendships with key fig ures. The tribes men pro tected the Amer icans for three days un til it was safe to retur n to their homes in Shir az.25*As a re sult of the problems in Shir az, Warne and Loy W. Henderson, the U.S. amba s sador to Iran, conv inced Mosaddeq to apolo g ize to the Amer icans there and promise futur e pro tec tion on April 23, 1953.26** Anti-Amer ican ism flared up again a few months later. Bruce Ander son recor ded his fears in his jour nal, “It appears that the commies were ready to take over the coun try, to assa ssi nat e Mossadek [sic] and rule Iran. All the Amer ican homes were assig ned and from

* 25“In ci dents in the Lives of Bruce Holmes An derson and Lula Ellis An der son,” type script, n.d., in fam ily pos ses sion; and Lula An der son, Let - ter to Folks, April 1953. Used by per mis sion of Lula Ellis An derson. ** 26Wil liam Warne, Let ter to Loy W. Henderson, April 23, 1953, Re - cord Group 469 250, Box 8, fd. 506 la beled “Shi raz, Iran.” JESSIE L. EMBRY/UTAH UNIVERSITIES AND IRAN, 1950–64 155 the spoils they would pay for the rev olu tion.”27*** In re sponse to the ri - ots, the U.S. of fic ials in Iran or dered all depend en ts to leave. Some Utahns had complet ed their two-year assig nmen t, and those techn i - cians re turned with their fami lies to Utah. Others who planned to stay for a second tour of duty sent their fami lies to Switzer land and Ger - many. They did not want to re turn to the United States because the feder al gov ernmen t would not pay for their passag e back to Iran. Ac - cord ing to Point Four leaders, the techn ic ians stayed to show the Iran gov ernmen t that the United States was will ing to pro vide assis t ance de spite po lit i cal up ris ings. Early in Aug ust 1953, the U.S. Cen tral In tel li gence Agency (CIA) and the Brit ish planned a coup to over throw Mosaddeq. The plan called for the Shah to re place Mosaddeq as prime min ist er. How - ever, Mosaddeq learned of the plan, proba bl y through the Tudeh, and succeeded in re tain ing his power. The Shah and his wife left Iran as they had agreed to if the plan failed. Anti-Shah rio t ing inc reased aft er he left. But the CIA funded the larg est riot on Aug ust 17. The Amer ican agency hired a crowd to yell Tudeh slog ans and knock down stat ues of the Shah and his fa ther. The U.S. am bassa dor then asked Mosaddeq to con trol the crowds. The Tudeh com plained and refuse to support Mosaddeq. On Aug ust 19 a group of “strongmen” and the Shah’s mil i tary moved against Mosaddeq. Once again, the Tudeh refused to support Mosaddeq because of act ions he had taken to con trol the crowd two days bef ore. Mosaddeq gave up. He sur vived a mil it ary trial, but his for eign min is- ter, Hosain Fatemi, was tried and executed.28**** Aft er Mosaddeq left of fice, the Iran ian gov ernmen t signed an agreemen t that retur ned the power and half the prof its to “the world oil car tel com pa nies.”29+ While the majiles met, the Shah con trolled elect ions. He appoin ted Fazlollah Zahedi as prime min ist er to replace Mosaddeq. Zahedi’s son, Ardeshir Zahedi, a USU gradu at e, was mar - ried to Prin cess Shahnaz, the Shah’s daught er.30++ In 1955 the Shah re-

*** 27“In ci dents in the Lives of Bruce and Lula Ellis An derson. ” **** 28Keddie, Mod ern Iran, 130. + 29Ibid., 130. ++ 30“The Prin cess and the Agg ie,” Deseret News, in Jour nal His tory, De- cem ber 17, 1956, 1. 156 The Journal of Mor mon His tory moved Zahedi and became “Iran’s single ruler.”31+++ Still the Shah did not feel that he had complet e power un til 1967 when he declar ed himself Emper or of Iran.32++++ With the over throw of Mosaddeq in Aug ust 1953, a new group of Utahns ar rived in Iran in the fall witho ut their fami lies. As the Shah took con trol, the de penden ts in Eur ope and the fami lies of the new con tract emplo y ees joined them in April 1954. But now there were only BYU and USU techn ic ians. The Univ ersit y of Utah’s con tract was not renew ed in 1953. It had been dif ficult for the Univ ersit y of Utah to hire people with public health expe r ience; as a result, there were disag reemen ts bet ween its techn ic ians and the Point Four health of fi - cials, who dec ided to use only feder al emplo y ees.33*

AMERICAN AND IRANIAN VIEWS OF POINT FOUR Amer ican pol icy dur ing the 1950s was that Point Four was essen tial and that Iran needed spec ial help. M. J. Regan, act ing chief of ag ri cul ture for the Iran Point Four prog ram for ten months in 1953, wrote in his com plet ion report, “The friendly con tacts and prog res- sive work accom plished by the techn ica l aid prog ram was largely re - sponsi ble for keeping Iran from going behind the Iron Cur tain.”34** Helen Milligan expr essed the same feel ings fifty years later. When her sis ter asked if the Milligans would have accept ed an assig nmen t in Iran again, Milligan replied, “Yes, because I feel like we got there soon enough so the comm un ists didn’ t take over.”35*** But there was more to the techn ica l assis t ance than just con - trol ling the Com mun ists, at least from the Amer icans ’ point of view. The Amer icans felt a sense of mission. The term was even used in the tit le of Point Four, United States Oper at ional Mission/ Iran (USOM/I). In a speech in Iran in 1952, Wil liam Warne explained ,

+++ 31Keddie, Mod ern Iran, 135. ++++ 32“Iran’s Shah Crowns Him self and His Em press,” National Geo - graphic, March 1968, 301. * 33Dean Pet erson, Let ter to L. O. Horsfall, Feb ru ary 3, 1954, Box 2, fd. 4, Pet erson Col lec tion. Horsfall was the Uni versit y of Utah em ployee in charge of its con tract emplo y ees. ** 34M. J. Regan, End-of-Tour Repor t, Decem ber 1953, type script, USU Spe cial Col lec tions. *** 35Milligan, Oral His tory, 12–14. JESSIE L. EMBRY/UTAH UNIVERSITIES AND IRAN, 1950–64 157

“The United States of Amer ica feels it has been blessed by God. . . . Amer ica is giv ing some of her self to help others to help them- selves.”36**** The Utah techn ic ians tried to impr ove Iran ian life. Jay Hall helped import chick ens. Aft er brood ing 500 unex pect ed chicks in his home in Shir az, he dis tribut ed them to lo cal farm ers, replac ing their small chick ens with the new Amer ican ones. While the Amer ican chick ens were larger and looked very promis ing, many died of nat ive disea ses. Bruce Ander son planted plots using con trolled plant ing and fur row ir rig at ing while others used the Iran ian methods of broadca st - ing the seed and flood-ir rig at ing. Most demon str at ion plots showed that the Amer ican farm ing methods inc reased produc t ion, as long as the ir rig at ion was done properl y.37+ BYU techn ic ians started schools to demon str ate Amer ican teaching techn iques and also sponsor ed summer teacher workshops .38++

Shifts in Univer sity Contr acts Un til 1955 Point Four focused on im me diat e problems such as spray ing mos qui tos to con trol ma laria, im prov ing wa ter sup plies, and pro vid ing updat ed seed and ma chiner y to the Iran ian peo ple. In com plet ing the as sign ments, Amer i cans worked to gether but not with Iran ian gov ernmen t emplo y ees. Once these concer ns were met, the U.S. gov ernmen t shifted its focus to train ing Iran ians to take over. This new prog ram was called in teg rat ion. Hav ing the Iran ians take respon si bi l ity sounded very good in theor y. In report ing the USU con tract in 1956, Rudger H. Walker, dean of the Col lege of Ag ricul - ture at USU, ex plained, “The prog ram must be an Iran ian prog ram,

**** 36Wil liam Warne, quoted in “Of fice of Insti tut ional Pro jects Abroad of the Amer i can Coun cil on Ed u ca tion,” June 27, 1956, Pet erson Col lec - tion. + 37Jay Hall, Oral His tory, in ter viewed by Jessie Embry, March 19, 1999, 7–8, 14; Bruce An derson, Let ter to Folks, Au gust 16, 1952, Bruce and Lula Ander son fami ly papers. ++ 38Glen Gagon, “A Study of the Dev el op ment and Im ple men ta tion of a Sys tem of Ele men tary Edu ca t ion for the Ghasghi and Basseri No madic Tribes of Fars Ostan, Iran” (M.S. the sis, Brigham Young Uni ver sity, 1956). 158 The Journal of Mor mon His tory not an Amer ican prog ram.”39+++ In con trast, my fat her felt that the sys - tem did not work because “the US seems to want to turn over all they can to the for eigners who neit her know how to op er ate or in many cases want to know. As a result much time, ef fort, and mat er ia ls are wasted.” Yet at the same time, he agreed with the concept under l ying in teg rat ion, “One can only help people by teaching them to help them selves.”40++++ In teg rat ion was not the only change in 1955. That year Cong ress and the State Depart ment exam ined all the feder al aid prog rams and es pe cially ques tioned con tract ing with uni ver si ties. Some felt that Point Four’s ar range ments with in sti tu tions of higher ed u ca tion al - lowed the gov ernmen t agency to shirk its respon si bi l ity to ob tain FBI clear ance and hire trained per sonnel. To cor rect the problem, Con- gress mandat ed that uni versit y con tracts have a clear assig nmen t to work with a univ ersit y in the for eign coun try. Aft er 1955 Utah State Univ ersit y’s assig nmen t was only to work with Karadj Ag ricul tur al Col lege (founded in 1937) teaching classes and super vising an exper i - men tal farm.41* The init ial BYU con tract was for second ar y edu ca t ion. But with the combined ef forts of all Point Four emplo y ees prior to 1955, the BYU techn ic ians—prof essor s and public school teachers from Provo hired by BYU—worked with ele men tary, second ar y, and ter tiary edu ca - tion. Feder al re cords listed their assig nmen ts as “var io us” while USU was listed as “ag ricul tur e.” Er nest L. Wilkinson, BYU’s presi den t, re - corded in his jour nal that Point Four of fic ials—he did not say whom—told him “we did not have a spec ific prog ram [and] the scat-

+++ 39R. H. Walker, USU Repor t, May 14, 1956, Daryl Chase Papers, USU Spe cial Col lec tions. ++++ 40Bertis L. Embry, Let ter to Mother, Feb ru ary 16, 1962. All Embry corr espon dence is in my posses sion. * 41Rus sell Andrus, Memo to FOA/W of fice, De cem ber 11, 1953, Box 53, un cata logued, Recor d Group 469, Na tional Ar chives. Uni versit y con - tracts were a very small part of the Point Four pro gram in Iran. Bet ween 1951 and 1964, ap proxi mately ninety Amer i can Mor mons served as ag ri - cul tural and ed u ca tional ad vi sors in Iran. Utah State Uni ver sity’s ag ri cul - tural con tract (1951–64) was one of the larg est and lon gest. Others in - cluded the Uni versit y of Utah (health, 1951–53), Brigham Young Uni versit y (edu ca t ion, 1951–55, 1959–61), Syra cuse Univ ersit y (aud iov isua l), and Uni - versit y of Southern Cali f orn ia (business) . JESSIE L. EMBRY/UTAH UNIVERSITIES AND IRAN, 1950–64 159 tered work we were doing . . . was fitt ed better for gov ernmen t emplo y - ees.”42** BYU’s admin istr at ion was working with the Teachers Col lege at the Univ ersit y of Teh ran to assist in teaching classes, consult ing profes sors, and im prov ing li brary fa cil i ties. While BYU tech ni cians and admin istr at ors expect ed a smooth transf er from one con tract to the next, some thing USU accom plished, it took un til 1957 bef ore all the paper work was complet ed bet ween the Teh ran and Provo inst itu t ions. Some BYU prof essor s wonder ed if there were other rea sons why their con tract was not renew ed. The Mor mon presence in Iran made some Amer ican of fic ials unea sy, and the Mor mons were quick to read re li gious dis crim i na tion into the de ci sion not to ex tend BYU’s con tract. As the techn ic ians complet ed their assig nmen ts in 1955, most planned to retur n to the United States and their prev io us jobs. Boyd McAffee, a pub lic school teacher from Provo who worked on the BYU con tract from 1953 to 1955, felt that, if he stayed for an other year, he could com plete some project s he had begun. He beg an neg o - tiat ing for an ext ension in Jan uar y 1955. Aft er months of pro tracted talks, he recor ded in May that Hoyt C. Turner, the Point Four di rect or of edu ca t ion in Iran, had unex pect edly req uested that other BYU per - sonnel also ext end. McAffee complained in his jour nal, “Why . . . did - n’t he ask them months ago?”43*** Those going home were unable to change their plans at the last min ute. It was just as well. In an other sur prise dev elop men t, McAffee learned on Aug ust 12, 1955, that his con tract would not be ext ended and that BYU’s in volve ment in Iran would ter mi nate on Au gust 31. Bitt erly disap poin ted, McAffee lamen ted, “It seems that our own people are not in ter ested in eit her us or the prog ram here for which we have worked so hard.” His suspi c ions mult iplied when U.S. of fic ials refused to give him a rea son or support him in an appea l for a dif fer - ent dec ision. “Ev ery one seems to be in complet e ig nor ance about the whole BYU gov ern ment con tact can cel la tion causes.”44**** Others felt the same way. A. Reed Morrill, a BYU edu ca t ion

** 42Rus sell Andrus, Memo to FOA/W of fice, De cem ber 11, 1953, Box 53, un cata logued, Recor d Group 469, Na tional Ar chives; Er nest L. Wilkinson, Jour nal, No vem ber 17, 1955, Perry Spe cial Col lec tions. *** 43Boyd McAffee, Jour nal, Janu ary 30, March 31, April 2 and 13, May 12, 1955, 347, 382, 384, 390, 409, LDS Church Ar chives. **** 44McAffee, Jour nal, Au gust 12, 28, and 31, 1955, 446, 454–55. 160 The Journal of Mor mon His tory technican, said that the con tract was “ter mi nated abruptly. . . . (No log ica l expla na t ion was known.)” Dean A. Pet erson wrote, “Aft er sev - eral months of discus sion, we sud denly disco v ered that our con tract with the Gov ernmen t is not be renew ed or ext ended” and that those who wanted to stay in Iran would have to be hired dir ectly by Point Four.45+ George Stewart, a BYU prof essor who had been hired on the USU con tract and who su per vised all the Utah con tracts aft er Dean Pet erson left in 1953, had writt en to BYU Presi den t Er nest L. Wilkinson four months ear lier in April 1955. He passed on a ru mor of in ter nal dis agree ments in the Point Four Ed u ca tion Di vi sion in Iran that focused on the BYU group. Stewart said there were “two or three an tag on ist ic spir its” who felt “that the LDS people have been given a much more kindly re cept ion by the Iran ians than have the people from the east ern United States who drink, smoke, and carry on in other ways of hav ing a good time.” He had been in meet ings with Ira- nian min ist ers who “have taken the trouble to explain” to U.S. of fi - cials “that they are par tic ularl y pleased with the way that the Utah group live and the att empt that they make to be of sincer e ser vice to the Iran ians,” oft en point ing out that the other Amer icans seemed in - ter ested only in a salar y. Dean Pe terson agreed. In a lett er to Boyd McAffee, he wrote, “I could tell of many instances where the Iran ians have openly expr essed their pref er ence for the Utah techn ic ians be - cause of the way the LDS live and are dev oted to giv ing out stand ing ser vice.” Stewart had writt en to Wilkinson sev eral months ear lier sug - gest ing, “As a purely persona l feel ing, I think that it is one way in which Iran and other parts of the Mid dle East might properl y be opened up to the re li gious mission ar y work”—mean ing because of the posi t ive re sponse to the Utah techn ic ians.46++ Er nest L. Wilkinson told U.S. State Depart ment of fic ial Russel l Andrus at a univ ersit y presi den ts’ meet ing his deduc t ion that the BYU con tract had not been renew ed because of “reli gious in toler ance in the staff in Iran,” par tic u larly on the part of Clark Gregor y, a Point

+ 45A. Reed Morrill, End of Tour Repor t, Oc to ber 28, 1955, Box 6, fd. 4; Dean A. Pet erson, Let ter to Saul Kupfer, Sep tem ber 1, 1955, Box 5, fd. 7, both doc u ments in Pe ter son Col lec tion. ++ 46George Stew art, Let ter to Er nest L. Wilkinson, April 6, 1955; Dean A. Pet erson, Let ter to Er nest L. Wilkinson, April 19, 1955; Stewar t, Let ter to Wilkinson, Janu ary 8, 1955; all three in Box 3, fd. 7, Pet erson Col lec tion. JESSIE L. EMBRY/UTAH UNIVERSITIES AND IRAN, 1950–64 161

Four att or ney who had re placed Wil liam Warne as head of Point Four in Iran in 1953. He claimed that Greg ory had told Washing t on of fi - cials that there were too many of the same faith in Iran. Wilkinson was conv inced that Greg ory’s att itude inf luenced the State Depart - ment.47+++ Wilkinson wrote lett ers to the Point Four of fic ials in Washing - ton and to the Utah con gres sio nal del e ga tion looking for answ ers. He also grilled Hor ace F. Bryne, act ing chief of the Greece-Tur - key-Iran Div ision of Point Four. Bryne had been in Iran as the dir ec - tor of the work in Shir az in 1951 and had worked with the BYU tech- nic ians. He might have been the “so called friend” that Dean Pet erson com plained about in a lett er to Boyd McAffee. Pet erson claimed that some one “who worked with us in Iran and who are in key posi - tions in Washing t on are fa vor ing their kind rather than Utahns.” In his con versa t ions, Wilkinson found Bryne’s respons es “en tirely un- sat isfac t ory. I feel quite sure that he was not tell ing me all he knew.” In Oc to ber 1955, Ol i ver Caldwell, the As sis tant Com mis sioner of U.S. Ed u ca tion, cor rob o rated some of Wilkinson’s sus pi cions: An English couple complained to Caldwell that the United States was paying mission ar ies to go to Iran. This couple “were church people and Caldwell thought they were proba bly en vi ous of the work of BYU facult y members. The English couple . . quoted one of our Utah persons as saying he had accept ed the posi t ion only because he

+++ 47Wilkinson, Let ter to Stewar t, Decem ber 22, 1955, Box 2, fd. 18, Pe - terson Col lec tion. Wilkinson also expr essed this concern in his jour nal at a Point Four univ ersit y con tract meet ing in Lan sing, Mich ig an, on No vember 17, 1955: “I took part in the dis cus sion and de manded to know why our con - tract was ter mi nated. I was told that it was be cause we did not have a spe cific pro gram but the work we were do ing was the scat tered kind of work which was fit ted better for gov ern ment em ploy ees. Since dis cus sion had been asked for on gener al princ iples rather than par tic ular con tracts, I felt it was in ap pro pri ate for me to pur sue the mat ter fur ther. But I have learned def i - nitely since that our con tract was ter mi nated because the Admin istr a tor in Iran thought there were too many teachers ‘of the same faith’ in Iran and be cause of jeal ousies over the suc cess of our pro gram. This was sub stan ti - ated to me by a very high of fi cial in the gov ern ment. I in tend to pur sue this matt er and to reg ist er a vig or ous pro test in Washing t on.” Wilkinson, Jour - nal, No vem ber 17, 1955, Perry Spe cial Col lec tions. 162 The Journal of Mor mon His tory wanted to be a mis sionar y.”48++++ Like most gossip, it is dif ficult to pin down sources for the anti-Mor mon sto ries. Marion Merkley, as sis tant su per in ten dent of Salt Lake School Dis trict and dir ect or of the Point Four edu ca t ion prog ram in Jor dan, told his sist er, Rissa Clarke, a BYU edu ca t ion tech- nic ian in Iran, that Clark Greg ory had told him that they were going to reduce the BYU techn ic ians to no more than four since he thought they were en tirely too many in Iran and “Utahns were rather clann ish in Iran” (which was true). Rissa, whose husband, John, was also a BYU edu ca t ion techn ic ian, passed the report on to Dean Pet erson who promptly told Wilkinson.49* How ever, Greg ory did not men tion those concer ns to Wilkinson. He explained that BYU’s con tract was not being ext ended because of the new pol icy of U.S. uni versi t ies working with Iran ian univ ersi t ies and the short age of Point Four funds to con tinue pro- grams on their prev io us scale. In a lett er to Wilkinson, Greg ory explained, “This Mission is ear nestly seek ing to pro vide as much techn i- cal assis t ance to the Iran ian gov ernmen t as available U.S. funds will pro vide and as much as they want and can use ef fect ively, with lo cal funds, for prog ram oper at ions. Based on these cond it ions, it is unlikely, at the presen t time that this Mission will req uest a Brigham Young Uni ver sity con tract.”50** But he was not en tirely cand id. Just as Wilkinson had feared, two months ear lier Greg ory had sent a tele- gram to his super vi sors in Washing t on, D.C., “Ind i cat ions also of growing problem inher ent in hav ing too [many] . . . of any one faith working as unit in coun try pre domi nately Muslim. ”51*** If hav ing too many Mor mons was the problem, then why was the USU con tract re newed? Greg ory might have rec og nized the his - toric asso c ia t ion be tween USU and Iran, ack nowledg ed USU’s ag ri - cultur al exper tise, and de cided that end ing the BYU con tract would re duce the number of Mor mons in Iran belo w a crit ica l threshold.

++++ 48Wilkinson, Notes, Oc to ber 11 and 25, 1955, Pet erson Col lec tion. * 49Dean Pet erson, Let ter to Wilkinson, No vem ber 28, 1955, Box 2, fd. 8, Pe ter son Col lec tion. ** 50Clark Greg ory, Let ter to Er nest L. Wilkinson, De cem ber 1, 1955, Box 3, fd. 7, Pet erson Col lec tion. *** 51Clark Greg ory, Tele gram to Fitz ger ald, Seager, Holmgreen, Oc to - ber 15, 1955, USOM/I, State Depar t ment Recor ds (Recor d Group 469), Na - tional Ar chives. JESSIE L. EMBRY/UTAH UNIVERSITIES AND IRAN, 1950–64 163

Bruce Ander son dis cussed Mor mon-re lated concer ns with Ray John- son, who headed the Point Four ag ri cul tural prog ram in Iran, and concluded that Johnson “was doing ev ery thing to strengthen the Utah con tract and was not anti-Mor mon.”52****

T HE MORMON CHURCH IN IRAN Were Greg ory’s con cerns about Mor mons just if ied? In some ways they were. All the techn ic ians from USU and BYU were Mor - mons, and many of those from the Uni ver sity of Utah were also Church members. Franklin S. Har ris was pleased in 1951 aft er the con tracts were signed that other Mor mons would come to Iran. He hoped to or gan ize LDS units in Iran. When he came to Utah to en- cour age the three Utah univ ersi t ies to sign con tracts in May 1951, he visit ed Church Presi den t Da vid O. McKay. In a lett er to his fami ly after this meet ing, he report ed that the First Presi denc y “set me apart as Presi den t of the Teh ran branch and gave me aut hor ity to make what - ever or ga ni za tion seemed nec es sary in this coun try.” Be cause Mus lim and Iran ian rules prohib it ed mission ar y ef forts by any reli gion, Har - ris con tin ued, “There is of course no idea of prose l yt ing.”53+ But the Mor mon techn ic ians felt a sense of mission to help the world and, in doing so, to share their reli gion. One of the first BYU ed u ca tion tech ni cians, J. Rich ard Brown, asked Mor mon Apos tle and Sec ret ary of Ag ricul tur e Ezra Taft Benson, “There’s one thing that bothers me just a lit tle bit, and I don’t know quite how to appr oach it. We know that we have our respon si bi l ity to spread the gospel, but we’ve been told by our instruc tors at the for eign lang uage inst itut e that we’d better for get those kinds of things.” Accor d ing to Brown, “Benson looked at me and said, ‘You can alwa ys call them to repen - tance.’ I found out that he was ser io us.” If Brown had in ter preted these instruc tions in the trad it ional Mor mon sense, he would have vi - olat ed both Ira nian law and State De part ment pro tocol, as Benson was well aware.54++ Ac cord ing to hear say ev idence from other techn i - cians, Brown did take the adv ice too lit er ally, and the Point Four of fi -

**** 52Bruce An derson, Jour nal, Feb ruar y 6–11, 1956, Bruce and Lula An der son fam ily pa pers. + 53Frank lin S. Har ris, Let ter to Fam ily, No vem ber 30, 1951, pho to copy in my pos ses sion. ++ 54J. Richar d Brown, Oral Hist ory, in ter viewed by Jessie Embry, No - 164 The Journal of Mor mon His tory cials in Iran almos t sent him home because he was too open about his Mormon beliefs. Benson’s adv ice to ano ther couple was more helpful and spe- cific. Ac cord ing to Helen Milligan, she and her husband were unde - cided about going to Iran when they enco un tered Benson by chance at a ser vice sta tion in Cache Val ley and asked his adv ice. Benson told them, “I know you can’t prose lyte, but you can go and answ er ques- tions and you can live your re li gion. If you’ll go and treat it as a mission, I’ll promise you that you’ll go there and re turn home in peace and safety.”55+++ Boyd McAffee remem bered that Thorpe B. Isaacson visit ed Iran in his capac ity as a trustee for Utah State Univ ersit y but also met privat ely with the Mor mons in his role as a counselor in the Presid ing Bishop r ic. Accor d ing to McAffee, Isaacson “had alwa ys been skept i - cal of such gov ernmen t work as Point 4, but not any more aft er seeing the work here where we are trying to help people live better.” McAffee then commen ted solemnl y, “We are truly on a Mission. This is as much of a Mission field as any place on earth.”56++++ The Mor mons did not have to preach to stand out. Their di etary code made them conspic u o us. At nearly ev ery occa sion—so cial or prof essiona l—the Iran ians of fered them tea. When they explained that they did not drink tea for reli gious rea sons, the Iran ians accept ed their refusa l respect ful ly since they, as Muslims, also had reli gious di - etary restric tions. Inst ead of tea, the Mor mons asked for hot wat er (they feared drinking unboiled wat er) with lemon. Later many Ira- nian hosts pro vided fruit juices.57* Ac cord ing to J. Richar d Brown, the Iran ians did not know about Mor mons but “they knew we were dif fer ent. On many occa sions people said, ‘I like all of these Amer icans, but you people are dif fer ent.’” Brown added, “We had to be care ful explain ing. Those Iran ians who worked dir ectly with us knew quite a bit by the time we got through.” Iran ians cont inued to not ice diff erences bet ween the Mormons and other Amer icans. Grace Farnsworth, whose husband was a li brary vem ber 10, 1998, 16. +++ 55Milligan, Oral His tory, 9–10. ++++ 56McAffee, Jour nal, June 8, 1954, 185–86. * 57Grace Farnsworth, Oral Hist ory, in ter viewed by Jessie Embry, No - vem ber 6, 1998, 9; Lula Ellis An derson, Oral His tory, in ter viewed by Jessie Embry, March 1, 1999, 17. JESSIE L. EMBRY/UTAH UNIVERSITIES AND IRAN, 1950–64 165 techn ic ian at the Univ ersit y of Teh ran Teachers Col lege bet ween 1959 and 1961 said that her landlor d commen ted ap prov ingly, “‘Re - ally, you’re sort of Muslims’ because of the fact that we didn’ t drink. They were n’t supposed to drink, but they did. He felt that we were ideal tenan ts because of our liv ing hab its.”58** When the Mor mons worked with other Point Four emplo y ees, they of ten met toget her soc ially and prof es sion ally. So non-Mor mon Amer icans also no ticed the dif fer ence in Mor mon beliefs. For ex ample, Lula Ander son remem bered the par ties that she hosted for Point Four emplo y ees in Shir az and visit ing of fic ials from Teh ran. “It was nice and lots of fun alt hough there is a dif fer ence in en ter tain ing strictly Utah people and a mixed crowd. LDS people are sat isf ied with good food and simple en ter tainmen t, while some others are dead- heads un less they’ve had a few cock tails.” Wil liam McSwain, a Univ ersity of Utah visua l aid spec ial ist, obser ved to Lula Ander son that Point Four emplo y ees were “a bit suspi c ious of all these Utah people. ” How ever, the par ties “broke down their suspi c ions and they disco v - ered we were people just like themsel ves.”59*** These part ies were not held af ter Point Four gave the Utah univ ersi t ies sepa r ate assig nmen ts and techn ic ians no lon ger worked closely with feder al emplo y ees.

Mor mon Worship Ser vices in Iran The Mor mons started hold ing re li gious ser vices im me di ately after their ar rival. On Sunday, Oct ober 26, 1951, the week end aft er the first Utahns came, Franklin S. Har ris presided over a sac ramen t meet - ing at the new ar riv als’ ho tel. The fol lowing week more techn ic ians ar - rived. Ano ther group came at the end of No vem ber. On No vem ber 25, 1951, with sev enty-three mem bers in clud ing childr en in att endance, Har ris or gan ized a branch in Teh ran, a meet ing he desc ribed as “very sat is fy ing.” Har ris se lected George Stew art, an ed u ca tion techn ic ian from BYU and Joseph Coulam, an ag ricul tur al techn ic ian from USU, as his counsel ors. USU techn ic ian Welling Roskelley was super in tenden t of the Sunday School, and BYU dir ect or Dean Pet erson was branch clerk. At the first meet ing, all the new of ficers spoke. Also speaking was Gussie Stobbe, the wife of L. M. O. Stobbe, a Salt

** 58Brown, Oral Hist ory, 12; Grace Farnsworth, Oral Hist ory, 9. *** 59Lula An derson, Lett er to Folks, April 9 and May 19, 1952, Bruce and Lula An derson fam ily papers. 166 The Journal of Mor mon His tory

Lake City phy sic ian on the Univ ersit y of Utah con tract.60**** The branch met in the ho tel un til the new ar riv als found homes to rent. Many moved next door to each other in Shimron, a suburb on the out skirts of Teh ran. They creat ed a “lit tle Utah” where they held Church meet ings and soc ials. The Iran ian gov ernmen t al lowed the meet ings with the under stand ing that they were for Amer icans only. Helen Milligan reca lled, “For awhile they had a police man at the door to be sure that there weren’ t any Persians that came.”61+ When the Utahns were assig ned to work in other ostans, Har ris appoin ted one man in each area to be the group or branch leader. Bruce An der son be came the pre sid ing of fi cer in Shi raz. In ad di tion to the Mor mon techn ic ians and their fami lies from BYU, Univ ersit y of Utah, and USU, who were assig ned to Shi raz, other Amer icans who were Point Four emplo y ees but not Mor mons also att ended the meet ings. The group init ially met on Sunday but switched to Fri - days, the Muslim day of worship, since Sunday was a reg ular work day.62++ Since there were only two Mor mon fami lies in Ahwaz, there was no for mal branch. But J. Richar d Brown reca lled, “Some how or other, I didn’ t bring it up, but [other Amer icans] did. They said, ‘We need to have some Bible study. Would you help us?” Brown agreed and planned the les sons, be ing “care ful not to throw too many things at them that they would be disma yed at or of fended by.” The group “went through parts of the Old Test amen t, almos t line by line.”63+++ Alt hough Utahns were stat ioned through out Iran, the main LDS branch was in Teh ran. Aft er Franklin S. Har ris complet ed his two-year assig nmen t and pre pared to leave in May 1952, he re or ga- nized the branch. His counselor George Stewart be came the new branch presi den t. Joseph Coulam con tin ued to serve as a counselor, and Dean Pe terson be came the other counselor . Har ris re - corded in his jour nal, “The Branch has unity and strength,” add ing “We leave this branch with much re gret. We have enjo yed the

**** 60Frank lin S. Har ris, Jour nal, Sep tem ber 30, Oc to ber 14 and 28, No - vem ber 5, 20, and 25, 1951, USU Spec ial Col lec tions. + 61Milligan, Oral Hist ory, 12. ++ 62Lula An derson, Oral His tory, 13. +++ 63Brown, Oral His tory, 11. JESSIE L. EMBRY/UTAH UNIVERSITIES AND IRAN, 1950–64 167 group so thor oughly.”64++++ When Boyd McAffee ar rived in 1953, he was delight ed to find the Church so well or gan ized in Shir az. “It was re ally good to meet in those ser vices with our own people,” McAffee re corded in his jour - nal. “The ser vices were conduct ed as complet ely as if we were home.” When McAffee’s wife, Louise, and their childr en were al lowed to come to Iran in the spring of 1954, they also att ended church meet - ings in Shir az with the other Utahns and their fami lies and the non-Mor mon Point Four emplo y ees and fam i lies, in clud ing an Afr i - can Amer ican Sam Fuhr. Whenev er McAffee went to Teh ran, he at- tended the ser vices there and felt that was a treat to meet with a larger group of mem bers. But no matt er where he went, McAffee wrote, “No doubt we are all better LDS mem bers now than ever bef ore in our lives . . . [in] this land far from our na tive land.” For McAffee, who was oft en frustr ated in his prof essiona l work, LDS ser vices “made us ap- pre ciat e our blessings even more.” Aft er one meet ing culmi nat ing an espe c ially hard week, he wrote, “It did me good to re gain a spirit of brotherl y love. I almos t lost it last week.” He con tin ued, “These weekly meet ings do much to keep us united and spir itu a lly geared to the huge task at hand: That of helping other people. ”65* From 1955 to 1957, the only Mor mons on uni ver sity con tracts were those from Utah State Univ ersit y who lived in Karadj, thirty-five miles from Teh ran, alt hough other Mor mons with business and mil i - tary assig nmen ts lived in Teh ran. It is not clear where the branch met dur ing those years. In 1957 when the BYU techn ic ians re turned to work at the Teachers Col lege, they joined with the business and mil i - tary Mor mon fami lies in Teh ran. From then un til 1964 when the USU con tract ended, the branch met in Teh ran for two months and then in Karadj for a month. The meet ings were held in mem bers’ homes. The branch owned fold ing chairs which passed from member to member depend ing on where the meet ings were.66** Dean Farnsworth, a BYU li brary tech ni cian from 1959 to 1961

++++ 64Har ris, Jour nal, May 11 and 18, 1952, USU Spec ial Col lec tions. * 65McAffee, Jour nal, Oc to ber 11, 1953, Janu ary 3, April 18, June 13, Sep tem ber 5, Oc to ber 1, 1954, and Janu ary 28, 1955, 33, 101, 162, 188, 251, 265, 343. ** 66Persona l knowl edge; Dean Farnsworth, Oral His tory, in ter viewed by Jessie Embry, No vem ber 6, 1998, 8. 168 The Journal of Mor mon His tory

The Uni versity of Karadj built eight Amer i can-style homes (in clud ing mod ern bath rooms and kitch ens) for USU tech ni cians and their fam i lies. “Prog ress Re - port, April 26, 1958-De cem ber 31, 1959: The Im provement of the Col lege of Agri cul ture of the Univer sity of Tehran,” Special Collec tio ns, Merrill-Cazier Li - brary, Utah State Uni versity, Lo gan. Courtesy of USU Special Col lec tions. and branch presi den t for part of that time, re called, “The branch in Teh ran fluctu at ed. Somet imes it was almos t all ser vice men. Some - times it was almos t all techn ic ians. Some times it was very large and somet imes it was extr emely small, depend ing on the assig nmen ts.” Ac cord ing to my fat her’s lett er to his mother, “About 65 mem bers are going home and most of them will not be re placed” in the spring of 1961. These were the seven fami lies who had been in Iran on the BYU contr act.67*** The branch members were nearly all Amer icans. Even Iran ians who had joined the Church while they att ended col lege in Utah did not asso c iat e with the members at church because many were gov ernment of fic ials, re quired to be Muslim to keep their jobs. I re call my fami ly giv ing one Iran ian a ride to church occa siona lly. Gordon Van

*** 67Bert Embry, Let ter to Mother, Feb ru ary 12, 1961. JESSIE L. EMBRY/UTAH UNIVERSITIES AND IRAN, 1950–64 169

Epps, who served as branch presi dent from 1963 to 1964, re mem - bered two, Higgigi and Godarze, who had been studen ts at USU. Van Epps reca lled, “I remem ber them bear ing their test imo n ies some Sunda ys. Sun days are work days there so they could n’t att end our meet ings very of ten unless they were trav el ing in the area. But tears would stream down their faces as they would bear their test imo n ies.” Iran’s po lit ica l struggles would, he feared, leave them vul ner able. “Godarze had a po sit ion high up in the ag ricul tur e min istr y for the coun try. I imag ine that he was killed when Khomeni came in. I don’t know unless he was able to escape the coun try, which I hope he was. I wonder about Higgigi.”68**** Aft er the USU con tract ended in 1964, the branch con tin ued to meet exclu siv ely in Teh ran where all the members, mostly U.S. mil i - tary fami lies lived. For a short time in 1967, the mem bers used the Amer i can non de nom i na tional Protestant church for meet ings. Da vid Ream, a U.S. mil it ary of ficer and a branch leader, reca lled a meet ing with its min ist er who asked for rent. The branch retur ned to meet ing in homes to avoid the added expense. For a while the branch met on Frida ys, but some members felt uncom f ort able hav ing ser vices on a day other than Sunday so worship was retur ned to that day. Meet ings were held in the aft er noon so that two Iran ian members could att end oc ca sion ally. USU pro fes sor Anson Call, who ful filled an in di vid ual con tract from 1967 to 1969, reca lled that only three Mor mon fami lies were meet ing at that time.69+ Dur ing much of this per iod, the branch was not an of fic ial church unit. When my fami ly was in Iran, our member ship re cords stayed in North Lo gan, and my fat her paid his tithing to that ward. Branch leader ship changed as needed and not alwa ys in the expect ed way. Dean Farnsworth assumed he was branch presi den t because Golden Woolf was head of the BYU con tract and had other re sponsi - bil it ies. Two USU techn ic ians, Glen Wahlquist and Raymond Farnsworth, served as clerk and counselor re spect ively. (Dean and

**** 68Gordon Van Epps, Oral Hist ory, in ter viewed by Jessie Embry, June 2, 1999, 22. + 69Da vid Ream, email to Jessie Embry, Aug ust 6, 1999, print out in my pos session; Teh ran Branch Minut es, Janu ar y 1, 1967, LDS Church Ar - chives; see also Anson Bowen Call, “A Good, Long Life: The Aut obi og raphy of Anson Bowen Call, Jr., 1900–1993”, as told to Carole Call King, type - script, USU Spec ial Col lec tions. 170 The Journal of Mor mon His tory

Ray were not re lated.) The other counselor , “Kay Mor ris [was] not a mem ber of our team.” Alt hough Farnsworth did not say, Mor ris was proba bl y with the U.S. mil i tary.70++ Un til the late 1970s, the Teh ran Branch was under the jur isd ic tion, first, of the In ter nat ional Mission and then of the Swiss Mis sion.71+++ A highlight for the branch came when Gener al Aut hor it ies visited. Like Thorpe Isaacson, some were in Iran on other business, but they took the time to visit with the lit tle group of Mor mons there. Dur ing the 1960s, four apost les came to Iran. Spencer W. Kimball repr e sented the Kiwanis Club, Richar d L. Ev ans the Ro tary Club, Ezra Taft Benson as Eur opean Mission Presi den t, and Howard W. Hunter at Benson’s re quest. Benson re turned in 1971 to repr e sent the United States at an Iran ian cele brat ion.72++++

Types of Mormon Wor ship Services The types of meet ings held in Iran changed with the size and lo - cat ion of the branch. Sac ramen t meet ing was alwa ys the first to be held; but Helen Milligan remem bered that the Teh ran Branch also held Pri mary, Mutua l, Sunday School, and priest hood meet ings when she was in Iran in the early 1950s. Childr en and youth classes of- ten combined sev eral age groups. Depend ing on the size of the home, the adults stayed in the liv ing room and the childr en gather ed in cor - ners or bedr ooms for their classes. Since all the women worked with the childr en, the branch held a spec ial adult meet ing Sunday eve - nings. The group of ten stud ied the Old Test amen t because “we could look out our windo ws and see them har vest ing grain with a sickle.”73* From 1960 to 1962 when my fam ily lived in Karadj, the branch held priest hood meet ing early in the morn ing; Pri mary met dur ing the same time slot. Because of the dist ance, the branch had Sunday School one week and sac ramen t meet ing the next. Since LDS wards served the sac ramen t at both Sunday School and sac ramen t meet ing then, the branch members par took of it each week. Those in Teh ran, accor d ing to Maxine Shirts, whose husband Mor ris was with the BYU

++ 70Dean Farnsworth, Oral Hist ory, 8. +++ 71Teh ran Iran Branch, Manusc ript His tory, LDS Church Ar chives. ++++ 72Jessie L. Embry, Mor mon Wards as Com munity (Binghamton, N.Y.: Global Pub li ca tions, 2001), 94. * 73Milligan, Oral Hist ory, 13; see also Max Berryessa, Oral His tory, in - ter viewed by Jessie Embry, No vem ber 3, 1998, 6. JESSIE L. EMBRY/UTAH UNIVERSITIES AND IRAN, 1950–64 171 group from 1959 to 1961, also held an eve ning meet ing. Maxine grate fully re mem bered, “Mor ris usua lly stayed with the kids. He said I was with them all week.”74** In 1963 when Gordon Van Epps became branch presi den t, the schedule was changed slightly. Sac ramen t meet ing, Sunday School, priest hood, Relief Soc iet y, and Pri mary were held in a two-hour block. There was no Mu tual because the youth were too scatt ered to meet for a weekda y act iv ity. The teenag e boys att ended priest hood meet ing; the teenag e girls taught Pri mary so the women could att end Relief Soc iet y. Aft er the BYU con tract ended, the branch held sac ra- ment meet ing, Relief Soc iet y, priest hood meet ing, and Jun ior Sunday School.75*** Mor mon So cial Ac tiv i ties Since the first Utahns lived so close tog ether in Teh ran, they cre - ated a “lit tle Utah.” Max Berryessa explained , “Primar ily it was because of our church af fil ia t ion” that they lived so close. “We knew our wives would have a close rela t ionship with Amer ican friends.” Nearly all the homes had swim ming pools, and mem bers gather ed at them to visit, play games, dance, and talk. When Bruce Ander son went to Teh - ran on business dur ing the summer of 1952, he att ended a party nearly ev ery night—eit her din ner at homes or ho tels, swimming at mem bers’ homes, Bible study classes, farew ell par ties for techn ic ians and their fami lies, or mov ies. These soc ials were an impor tant part of the members ’ lives. Lula Ander son told her fa ther in 1955 aft er they had moved to Teh ran that she was alwa ys en ter tain ing because “our chief plea sures here are our friendships. ”76**** Grace Farnsworth re mem bered that, when she was in Iran (1959–61), “We would have group cele brat ions for the hol ida ys, for Thanksgiving, Christma s, the Fourth of July, and the Twenty-fourth of July. We kept our asso c ia t ion close that way.” Dur ing the time I was in Iran (1960–62), the childr en in the USU com plex fre quently played night games. We were alwa ys tog ether. When we went to church in Teh ran, some one alwa ys inv ited us to dinner . When we had church in Karadj, a fam ily from Teh ran came to our home. Even af ter the

** 74Maxine Shirts, Oral His tory, in ter viewed by Jessie Embry, June 21, 1999, 4. *** 75Persona l knowl edge; Van Epps, Oral His tory, 22; Ream, email. **** 76Jessie Embry, Mor mon Wards, 96–97. 172 The Journal of Mor mon His tory

Utahns left in 1964, Da vid Ream reca lled “freq uent pot luck suppers, with home-cranked ice cream, at the homes of var io us members on Fri day, Ira nian hol i days, or Sun days af ter church.”77+

Mor mon Fam ily Life Fami ly life for wives and childr en also changed over the years. From 1951 to 1953 childr en in Teh ran att ended an in ter nat ional school run by the Presb y ter ian Church. By 1954 the U.S. gov ernmen t had started a school for depend en ts which Point Four childr en could att end. Mildr ed Bunnell, whose husband worked for USU, had taught high school and was assig ned to teach a fourth-grade class. Mor mon Leah Hart, whose hus band was a Point Four em ployee, had a de gree in business and second ar y edu ca t ion from the Univ ersit y of Utah; she taught typ ing and short hand in the early 1960s.78++ Un til 1961 the Amer ican school did not include a high school, so my older brother Lloyd att ended the Presb y ter ian school for one year where he learned some Farsi. The second year we were in Iran, he att ended the Teh ran Amer ican School. Dean Farnsworth’s two older childr en also att ended the Presb y ter ian school, which he remem - bered as “quite demand ing.”79+++ In the early 1950s, those who were sent to the ostans had to home-school their childr en. Lula Ander son was concer ned since she was trained as sec ret ary and not a teacher. She was grateful there were other Amer icans to help with the teaching. Jay Hall’s wife, Beth, was an ele men tary school teacher; and as her small childr en reached school age, she pur chased the Galbert sys tem, then a popu lar home study sys tem, and taught many of the childr en in Shir az, includ ing the Andersons. Jay bragged that his childr en did very well when they re - turned the United States. Later Ander son was grateful to move to Teh ran where her childr en could att end school.80++++ In the 1950s and 1960s trad it ion, many techn ic ians’ wives were homemak ers. My mother did not work out of the home, for ex ample. She had five childr en plus the chal lenge of man ag ing a home in a new coun try. Many other wives hired Iran ians to cook, clean, and tend chil-

+ 77Ream, email. ++ 78Mil dred Bunnell, Oral His tory, in ter viewed by Jessie Embry, June 17, 1999, 6. +++ 79Persona l knowl edge; Dean Farnsworth, Oral His tory, 13. ++++ 80Hall, Oral His tory, 7; Lula An derson, Oral His tory, 2, 8. JESSIE L. EMBRY/UTAH UNIVERSITIES AND IRAN, 1950–64 173 dren. Such inex pen siv e househol d help al lowed some Amer ican wives to work in the U.S. comm un ity. Aft er the Andersons moved to Teh ran, Lula worked as a sec re tary for the Point Four and the U.S. em - bassy of fice. Imogene Wood worked as a sec ret ary for the Corp of En - gi neers.81* Wives who soc ial ized usu ally sought their friends among the other Utah Mor mon women, but a few reached bey ond the Mor mon group. Mildr ed Bunnell took knitt ing lessons and “did sweat ers for my grandchi ldr en with bears and kitt ens on the back.” Maxine Shirts was inv olved with a group of women at the of ficers ’ club who spon- sored clothing drives for an or phanag e.82** Only a few Utahans learned Farsi. Clark Ballard and Bruce An- derson, who were in Iran the long est, could speak it quite well. My father learned words from his Iran ian driv ers when he was on trips. Dean and Grace Farnsworth took classes when they first ar rived, but the classes were discon tin ued aft er a short time. Grace felt that Golden Woolf, the BYU dir ect or in Iran, was old, had a dif ficult time learn ing lan guages, and dec ided it was not worthwhi le since most of the Iran ian coun ter parts and assis t ants spoke English. When Lula Ander son got her job as a Point Four and em bassy sec re tary, a Persian maid tended her preschoo l childr en. The youngst ers “proba bl y spoke Farsi to the ser vants, but they wouldn’ t speak it to us.” Ander son and other wives learned enough to “get by” in mar kets.83***

M ORMON INTERACTION WITH IRANIANS Accor d ing to my fat her, the Iran ians resist ed the Amer ican presence in Iran. How ever, in the fall of 1962 aft er my fami ly left, feel ings soft ened. In Sept em ber an earthq uake destr oyed whole vil lages and killed more than 10,000 peo ple under the col lapsing “thick-walled, mud-brick houses.” One vil lage lost 3,000 of its 6,500 resi den ts; in another 3,200 of 4,500 died. Those who sur vived lost their homes and all their posses sions.84**** Branch Presi den t Gordon Van Epps wrote to the First Presi - dency and asked if the Church could help. The First Presi denc y

* 81Lula An derson, Oral His tory, 8; Wood, Oral His tory, 12. ** 82Bunnell, Oral Hist ory, 2, 8; Shirts, Oral Hist ory, 8. *** 83Lula An derson, Oral His tory, 21–22. **** 84“Iran: The Night the Earth Went Wild,” Time Mag a zine, Sep tem ber 174 The Journal of Mor mon His tory agreed to ship clothing to the impo v er ished sur viv ors. It was one of the Church’s first ef forts to pro vide assis t ance in an area where it did not have an es tablished net work of units and of ficers. CARE, Inc., shipped the goods, and branch members dis tribut ed the clothing per - sona lly to avoid their di version to enr ich cor rupt gov ernmen t of fi - cials. This dir ect ser vice creat ed good will among the Iran ians, but the Amer icans learned the hard way about techn iques of distr ibu t ion. At first the Mor mons di vided the goods on site; but the resi den ts at the first vil lage, ang ry that ev ery one did not receiv e the same amount of clothing, tore up the wooden shipping crates for firew ood and threw rocks at the Mor mons. At the second vil lage, the Mor mons kept the supplies in the truck; but when childr en disco v ered that not ev ery thing was distr ibut ed, the vil lag ers again stoned the Mor mons. Aft er this expe r ience, the Mor mons sorted and repacked the twenty-two tons of clothing they had receiv ed, set up tents, and had the vil lag ers come through in or derly lines with each per son receiv ing the same goods. For ex ample, the Mor mons gave each woman five dresses.85+ The Iran ians were im pressed that the Amer ican Mor mons would make such ef fort to help people they would never see again. Ac - cord ing to Gordon Van Epps, “From that time on there was a tremen - dous dif fer ence in the feel ings of the studen ts and facult y to ward we Amer icans. ” The driver whom the Church hired from the col lege usu- ally did not do man ual labor , but he helped dis tribut e goods. When the techn ic ians retur ned to campus, “It made a dif fer ence in the classes and in walking around the campus of the col lege there in the friendli ness. You could just feel the changes that were made.”86++

T HE END OF UTAH UNIVERSITY CONTRACTS Aft er BYU signed a new con tract, its techn ic ians worked with the Teacher’s Col lege for four years, av er ag ing seven emplo y ees dur - ing the two con tract per iods. Each prof essor —eit her from BYU’s Col - lege of Edu ca t ion or con tracted from ano ther uni versit y (e.g., Mor ris Shirts from the Col lege of Souther n Utah)—worked with a coun ter - part and an as sist ant. Dean Farnsworth did not get along with his

14, 1962, 38–39. + 85Van Epps, Oral Hist ory, 11. ++ 86Ibid., 12–13. JESSIE L. EMBRY/UTAH UNIVERSITIES AND IRAN, 1950–64 175 coun ter part who was not “cong e nial.” He worked mainly with an assis - tant, Parvin Amin Salehi, who “as most enlight ened Iran ian women, had to be a diplo mat and be submis sive to peo ple like my coun ter part. Yet she was quite well trained in li brary sci ence.”87+++ When BYU’s con tract came up for renewa l in 1959, Golden Woolf agreed to an ex tension with some misg iv ings since BYU’s rela - tionship to the Univ ersit y of Teh ran Teachers Col lege and its role in the edu ca t ional sys tem was unclear . The con tract was ext ended un til 1961, and Woolf remained in charge. Then the U.S. Point Four program claimed that the ob ject ives had been met and a new type of program was needed. BYU’s con tract was not renew ed. Clar ence Hendershot, the dir ect or of Point Four Edu ca t ion, dis agreed that the goals had been met, but agreed with Woolf that, since the Univ ersit y of Teh ran Teachers Col lege did not know which dir ect ion it was going, the BYU techn ic ians did not know what was expect ed. BYU tech- nic ian John Clarke stayed on as a U.S. emplo yee to work with gen eral ed u ca tion pro grams in Iran.88++++ USU con tin ued to work at the Karadj Col lege un til 1964. Prof es - sors or ext ension agents taught classes, assist ed on the farm, and over- saw other assig nmen ts. My fa ther, for ex ample, taught ba sic electr ica l eng ineer ing classes, worked on the cam pus’s electr ic sys tem, oversa w farm ma chin ery at the ag ri cul tural col lege (his orig i nal as sign ment), and ad vised the Point Four propert y manag emen t div ision in Teh ran. The work was extr emely frustr at ing. The prof essor s and studen ts were not in ter ested in working on the farm; the work ers did not know how to read and had a hard time under stand ing the machin er y. For exam ple, because the work ers per sist ently used the wrong mo tor oil, the machin er y freq uently broke down.89* The Shah appr e ciat ed USU’s ef forts. In 1961 Ardeshir Zahedi, the Shah’s son-in-law and a 1950 grad uat e of USU, pre sented USU Pres i dent Daryl Chase with the Or der of the Crown on be half of the Shah in cer emo n ies held at the Ho tel Utah. Zahedi an nounced that the honor rec og nized USU’s “in de fat i ga ble sup port of ed u ca tion and

+++ 87Dean Farnsworth, Oral Hist ory, 5. ++++ 88Hendershot, Pol i tics, Po lem ics, and Ped a gogy, 126–27, 130–31. * 89Bertis L. Embry, Oral His tory, in ter viewed by Jessie L. Embry, Sep - tem ber 4, 1983, 85, in my pos ses sion; Bertis L. Embry, Day Book, Feb ru ary 5, 1962, in my pos ses sion; Van Epps, Oral His tory, 6–7. Ambassadar Ardeshir Zahedi, repre sent ing the Shah of Iran, con fers the Order of the Crown on Daryl Chase, pres i dent of Utah State Uni versity. Iran and Utah State Univer sity (Lo gan: Utah State Uni versity, ca. 1963), 119.

176 JESSIE L. EMBRY/UTAH UNIVERSITIES AND IRAN, 1950–64 177 in ter na tional un der stand ing. It would take hours of talking and many books to desc ribe the great friend ship that exist s bet ween Iran and Utah.” Chase accept ed on beha lf of USU’s forty-nine facult y members who had served in Iran. “They were amba ssa dor s of good will, just as the [eighty-five] studen ts from Iran here are amba ssa dor s of good will.90** Alt hough the Shah appr ec iat ed the ef forts, ev ery two years USU strug gled with both the Iran ian and the U.S. gov ernmen t to get its con tract re newed. By 1964 Clark Ballard told Chase that, while the techn ic ians “con tinue[d] to enjo y good prest ige” in Karadj, “we have made our max i mum con tri bu tion un less con di tions change dra mat i- cally.” By “cond it ions,” he meant that, alt hough the dean of the Keradj Ag ricul tur al Col lege did not want ano ther uni versit y to take over, U.S. funds had been cut and the Iran ian gov ernmen t seemed un - in ter ested in edu ca t ion. Still, Ballard hoped to creat e a grain leg ume resear ch cen ter in Iran. That ef fort failed.91***

T HE IRANIAN MISSION But the Utah Mor mon inf luence con tin ued. In 1975 Spencer W. Kimball, then LDS Church presi den t, called Dean Farnsworth, who had retur ned to BYU’s English De part ment, as presi den t of a mission in Iran. The Church News, which usua lly lists all mission presi den ts and their assig nmen ts, included the Farnsworths’ names but did not iden tify their assig nmen t. For the next three years, Dean and Grace Farnsworth dir ected a small but ded icat ed group of young men who learned Farsi and shared their messag e wher ever possi ble. They could not tract and could talk only to people who appr oached them. The Farnsworths left Iran in 1978.92**** Later that year, polit ica l problems erupted again; and early in 1979 a conser va tive Islamic group over -

** 90Bob Mitchel l, “Iran Deco rates USU Presi den t,” Deseret News, 28 April 1961, Jour nal His tory, 7. *** 91Clark Ballard, Let ter to Burgoyne, 26 May 1963, USU; Daryl Chase, Lett er to Mar tin G. Weiss, asso c iat e dir ect or, crops resear ch div ision, 26 Au- gust 1963, Box 17, fd. 4, Chase Papers; Clark Ballard, Let ter to Daryl Chase, 14 Oc to ber 1962, Ballard to Chase, no date, Box 27, fd. 4, Chase Papers. **** 92Grace Farnsworth, Oral His tory, 9-10; “5 Mission Pres i dents Called,” Church News, June 21, 1975, 12. 178 The Journal of Mor mon His tory threw the Shah.93+ The only Mor mon mission in a Muslim coun try was closed. The Mor mon Church, like the U.S. gov ernmen t found that its spec ial rela t ionship with the Shah and his gov ernmen t prev ented con - tin u ing re la tion ships with his suc ces sors. One hist o rian even claimed that U.S. aid, includ ing Point Four, caused the rev olu t ion. “Huge Amer i can sales of arms, ag ri cul tural equip ment, high tech nol ogy, and consumer goods inad v er tently helped destabilize Iran’s econ omy and con trib uted to the Ira nian Rev o lu tion.”94++ Un til 2001 a group of BYU and USU techn ic ians and their wives held bi-monthly soc ial gather ings in Utah Val ley. Some ind iv idu a ls also worked with what Dale D. Clark, a for mer U.S. Depart ment of Ag - ricul tur e and State Depart ment emplo yee, called the “Iran-Utah Group.” In 1998 Mohammad Khatami, then pres i dent of Iran, wrote to Dale Clark asking for “exchang es of scholars, art ists, and other groups to break down two decades of hos til ity and suspi c ion” be - tween the United States and Iran. Clark con tacted Max Berryessa, who had ret ired from BYU’s Col lege of Edu ca t ion. Berryessa polled the soc ial group, who agreed to sign a lett er support ing such ex- changes, and Clark dev eloped a plan to rein troduce volun tary fund - ing and ex changes in Iran. Alt hough nothing hap pened, Clark and the for mer techn ic ians still hoped that Mor mons could con tinue to have con tacts in Iran.95+++

S UMMARY From 1912 to 1978, a small but sig nif i cant group of Utahns, nearly all of them Mor mons, held U.S. gov ernmen t con tracts in Iran. Those who worked from 1951 to 1964 in Iran for the three Utah uni - versi t ies felt a sense of mission. They were spread ing the gospel of democ racy and showing Iran, a Third World coun try, that the U.S. plan had more to of fer than the USSR’s comm un ist system. Nearly all the Utahns were also members of the Church of Jesus Christ of Lat ter-day Saints. They sup ported their church’s belief that

+ 93Keddie, Mod ern Iran, 214–39. ++ 94Keddie, Roots of Rev o lu tion, 276. +++ 95Dale D. Clark, Let ter to Mohammad Khatami, 28 Sep tem ber 1998; Max Berryessa, Let ter to Dale D. Clark, n.d.; Pro posal to the Gov ern ment of Iran, “Re viv ing the Iran-Utah Uni ver si ties Pro gram,” pho to cop ies in my pos ses sion. JESSIE L. EMBRY/UTAH UNIVERSITIES AND IRAN, 1950–64 179 the United States was a cho sen land that had a re sponsi bi l ity to assist all of God’s chil dren through out the world. While they could not prose l yte, they pract iced their reli gion among themsel ves and hoped to set a good exam ple for the Iranian people. Accor d ing to the Utahns, the Iran ians appr ec iat ed the Mor - mons’ stan dards, but the U.S. gov ernmen t was concer ned about the presence of a clan nish reli gious group in Iran. Alt hough other fact ors were inv olved, this reli gious per cept ion was one rea son why the U.S. gov ernmen t cancelled the BYU con tract in 1955. The LDS Church con tin ued to win friends, espe c ially fol lowing the 1962 earthq uake. That rapport may have al lowed the Church to es tablish a mis sion in Iran dur ing the late 1970s.96++++ The story of how Utah Mor mons worked and worship ped in Iran dur ing the height of the Cold War in the 1950s and 1960s pro - vides an in ter est ing look into the his tory of the LDS Church dur ing that time per iod. The Church was a small intermountain or gan iza - tion, but it was gain ing inf luence in the United States and the world. The members ’ sense of mis sion gained them both friends and ene - mies as they cre ated a comm un ity, shared their secu lar knowledg e, and practiced their religion.

++++ 96The LDS Church Hist or i cal De part ment has doc umen ted the mis - sion, but del i cate po lit i cal sit u a tions pre vent those re cords from be ing open to re search ers. MOR MON ISM AND GUER RIL LAS IN BOLIVIA

David Clark Knowlton

MORMON GROWTH AND TERRORISM

IN MAY 1989, TWO LDS MIS SION ARIES from Utah, Jeffrey Brent Ball and Todd Ray Wil son,* were assa ssi nat ed in Bolivia by a lit tle-known guer rilla movemen t, the Frente Ar mada de Liberación Zárate

* DAVID CLARK KNOWLTON {[email protected]} is an asso ci ate pro fessor of an thro pol ogy at Utah Val ley State Col lege. His spec ial ties in - clude the an thro pol ogy of Bolivia and Mor mon ism. The resear ch for this pa per pro voked his dismissa l from Brigham Young Uni versit y. He pre- sented a version of it at the in ter na tional con gress, “New Rel i gious Move - ments: On Mis sions and Mis sion ar ies: The In ter na tional Ex pan sion of Re li - gious and Mag i cal Movemen ts,” May 15–17, 1994, in Recife, Brazil. Recen t pub li ca tions in clude “Queremos hablar: el bloqueo de 2004 en Co pa ca - bana como ejemplo de la sociología de movilizaciones masivas” (“We Want to Speak: The 2004 Blockades in Copa ca bana as an Exam ple of the Soc iol - ogy of Mass Mo bi li za tions” in Conflictos políticos y movimientos sociales en Bolivia (Po lit i cal Con flict and So cial Move ment in Bolvia), ed ited by Nicho las Rob bins (La Paz, Bolivia: Plura, 2006), and “Rel ig ious Preju d ice and the For mat ion of Mor mon and non-Mor mon Selves in Utah: A View from Phenomenological An thro pol ogy” in The Fu ture of Prej u dice: Psy cho anal y sis and the Pre ventio n of Prej u dice, ed ited by Henri Parens, Afaf Mahfouz, Stu art W. Twemlow, and Da vid E. Scharff (Lanham, Md.: Rowman and Littlefield, 2006). Sources: I gather ed the data on which this paper is based dur ing sev - eral ethnographic trips to Bolivia self-fi nanced (1989) and fi nanced by the Col lege of Fami ly, Health and Soc ial Sciences at Brigham Young Univ ersit y

180 DAVID CLARK KNOWLTON/MORMONS AND GUERRILLAS 181

Willka (FAL-ZW, the Zárate Willka Armed Liber at ion Front).1 Alt hough these mur ders fit into a patt ern of att acks by mil it ant move ments on LDS targ ets, includ ing the assa ssi na t ion of three na- tive LDS mission ar ies in Peru, the deaths of these two U.S. elders stood out in the consc iousness of North Amer ican Lat ter-day Saints. The mur ders were widely re ported, unlik e the assa ssi na t ions of the Per uv ian elders. 2** The FAL-ZW was part of a range of pop u lar mil i tant org a ni za - tions of the time in Bolivia; but unlik e the others, it chose the Church of Jesus Christ of Latt er-day Saints as one of its major targ ets. Besides as sas si nat ing the two An glo Amer i can mis sion ar ies in a work ing-class neighbor hood of the coun try’s larg est city, La Paz, it bombed as many as five LDS chapels bet ween 1980 and 1990, and threat ened Filiberto Cardozo, the mayor of the sub ur ban city of El Alto de La Paz, with death if he did not close all Mor mon chapels. 3*** As jus ti fi ca tion, the guer ril las stated their oppo si t ion to “gring os who come to deceiv e

(1991 and 1994). These data in clude doc u men tary ma ter ial as cited belo w, as well as ethnographic data gather ed through par tic ipan t ob ser va tion. This paper depends on earl ier field work I per formed in Bolivia in 1985, with fund ing from the In sti tute for Latin Amer i can Stud ies at the Uni versity of Texas at Aust in as well as from Richar d N. Adams, the Rappaport Pro fessor of So cial Sci ence at the Uni versit y of Texas at Aust in, and ad di - tional resear ch in 1979 with fund ing from the Inter-Amer i can De vel op - ment Founda tion. In ad dit ion it draws on my expe r ience as an LDS mission - ary in Bolivia be tween 1974 and 1976. I presen ted ear lier versions of this pa - per un der the ti tle “Vi o lence and Mor mon ism in the Cru ci ble of So cial Movemen t: The Cases of Bolivia and Chile” at the In ter na tional Con gress on New Rel ig ions and the In ter nat ional Expan sion of Rel ig ious and Mag i - cal Movemen ts (Recife, Brazil, May 1994); and as “Mor mon ism and Guer - ril las in Bolivia” at the Soc iet y for Latin Amer ican Stud ies ann ual meet ings (Leeds, United King dom, March 1996). 1Zárate Willka was an In dian in de pend ence leader in the late nine - teenth cen tury and has be come a hero of the con tem po rary In dian move - ment in Bolivia. ** 2These Per u vian el ders were Manuel An to nio Hi dalgo and Christ ian Andreani Ugarte, killed Au gust 1990, and Oscar Zapata, killed March 1991. *** 3Da vid Clark Knowlton, “Mission ar ies and Ter ror,” Sunstone, No. 72 (Au gust 1989): 10–15. 182 The Journal of Mor mon His tory the poor and hum ble peo ple.”4**** This paper explor es the back ground and con text of FAL-ZW mil it ancy, as well as the growth of Mor mon - ism in Bolivia, that tog ether made LDS mission ar ies and chapels tar- gets of a rev o lu tion ary strug gle.

U.S. FOREIGN EXPANSION AND MORMONISM The imag es of gring os and their decep t ion of the poor are pow - er ful in Boliv ian po lit ica l and so cial rhet or ic. While on the one hand most of the mis sionar ies and of fic ials of the Church in Bolivia were grin gos (i.e., Amer i can cit i zens), nev er the less the mean ing of this word and the links by which the FAL-ZW connect ed it with the Church as jus tif ica t ion for vio lence are any thing but clear. To make sense of it and the accu sa t ion of decep t ion, it is useful to beg in with the patt ern of LDS growth in the coun try to iden tify the par ticu lar status that Mor mon ism came to occup y in that so ciet y. Al though Lat ter-day Saints may pre fer to see the growth of the Church as driven by spir itua l ends and pol ic ies, to accom plish its ends the Church relies on soc ial fact ors that can mil it ate in its fa vor or, con - trariwise, impede its growth, despit e the Church’s depend enc y on them.5+ How ever these soc ial fact ors also give mean ing, in tent, and pur pose to the Church in ways that may seem strange to many Lat - ter-day Saints. Here we must dis cover the soc ial dy namics of Mor - mon ism in Bolivia that made it a useful targ et for FAL-ZW. The Church of Jesus Christ of Lat ter-day Saints has expe r ienced very high growth rates in Bolivia. Over the five years preced ing 1991,

**** 4“Zárate Willka amenaza matar a Al calde y concejales de El Alto,” Hoy, 1 de junio de 1989, 7. Pho to cop ies of clip pings of these ar ti cles, most of them witho ut page num bers, are in my pos session. + 5Mark Grover’s “The Matur ing of the Oak: The Dy namics of Lat - ter-day Saint Growth in Latin Amer ica,” Dia log ue: A Jour nal of Mor mon Thought 36, no. 2 (Sum mer 2005): 79–104, il lustr ates this in ter nal logic, as does Freder ick S. Wil liams and Fredrick G. Wil liams’s From Acorn to Oak Tree: A Per sonal Histor y of the Es tab lishme nt and First Quar ter Centur y De vel op - ment of the South Amer ican Mission s (Fullerton, Ca lif.: Et Cet era Graphics, 1987). But the soc io log i cal logic be hind the arg umen t of this paper can be per haps most clearly demon strated in the writ ings of Da vid Mar tin, espe - cially Tongues of Fire: The Explo sion of Pentecostalism in Latin Amer ica (Ox - ford, Eng.: Blackwell Pub lish ers, 1993), and Pentecostalism: The World Their Par ish (Ox ford, Eng.: Blackwell Pub lishers, 2001). DAVID CLARK KNOWLTON/MORMONS AND GUERRILLAS 183 the Church’s member ship inc reased by some 75 per cent, from 40,000 mem bers to 71,000. While the rapid ity of that growth—i.e., the sud - den appear ance of Mor mons througho ut the ur ban ar eas of the coun - try in what to Bo liv ians seemed a sur prisingl y well-financed push—is an impor tant fact or in this story, it must be contextualized in the pat- terns es tablished early in the his tory of Mor mon ism in the coun try that give it pur pose and form. The finan c ial ar gumen t may seem sur - pris ing to many Lat ter-day Saints, but the amount of money and time req uired by the Church’s mission ar y endea vor, alt hough do nated by mem bers, still makes a large and crit ica l impact on Boliv ian so ciet y. This fact alone makes Mor mon inv estmen t in Bolivia seem un usual. Furt her more, to these fund ing sources must be added the Church’s pur chase of land and construc tion of Mor mon chapels that appear ed quickly all over the ur ban landscape bet ween the 1970s and 1980s. Boliv ians could not help asking why gring os were spend ing so much money and ef fort in their coun try, nor were Mor mon rea sons eit her as appar ent or as persua sive as Church of fic ials and mis sionar ies believed—as this paper il lus trates. The Church of Jesus Christ of Lat ter-day Saints est ablished a con tin uing presence in Bolivia in the early 1960s with the inf lux of U.S. per sonnel who worked with USAID and other gov ernmen t aid pro grams.6++ Aft er the Boliv ian rev olu t ion of 1952, the United States was concer ned about left ist in fluences on the new gov ernmen t and att empted to per suade it to fol low U.S. dir ect ion by pro vid ing such huge amounts of for eign aid that Bolivia, dur ing this per iod, was the rec ipi en t of the larg est amount of aid of any coun try in South Amer - ica.7+++ As a re sult, rela t ively large numbers of U.S. person nel were dispatched to Bolivia on vari o us gover nmen t al or mili t ary assig nmen ts, among them Anglo Mor mons who were to dev elop the Church in

++ 6An des Mis sion, Manu script His tory, mi cro film, De cem ber 5, 6, 7, 1964, CR/MH 6311, Ar chives, Fam ily and Church His tory Depar t ment, Church of Je sus Christ of Lat ter-day Saints, Salt Lake City (hereaf ter LDS Church Ar chives). +++ 7Her bert Klein, Bolivia: The Evo lu tion of a Mul ti eth nic So ci ety (Ox ford, Eng.: Ox ford Uni versit y Press, 1982); James Dunkerley, Re bel lion in the Veins: Po lit ical Strug gle in Bolivia, 1952–82 (London: Verso Books, 1984); James Malloy, Bolivia: The Un com pleted Rev o lu tion (Pitts burgh, Pa.: Uni versity of Pitts burgh Press, 1970); James Malloy and Rich ard Thorne, eds., Be - yond the Rev o lu tion: Bolivia since 1952 (Pittsburgh, Pa.: Uni versit y of Pitts - 184 The Journal of Mor mon His tory

Bolivia and set some of its dy namics. 8++++ Af ter World War II, many young An glo Mor mons made ca reers in gov ern ment, the mil i tary, and in ter na tional busi ness. Among them were Mor mons who had complet ed missions in Latin Amer ica in an earlier pe riod, par ticu larl y in Mexico, Ar gen tina, and Brazil. As a re - sult they had the lang uage and cul tural skills that qual i fied them for in ter nat ional ser vice and made them overrepresented in U.S.-based inst itu t ions working in this area compar ed to the popu la t ion as a whole.9* Many North Amer icans re sided in Bolivia in the early 1960s, in - cluding sever al North Ameri can Mormon fami lies aff ili at ed with devel op ment as sis tance and the U.S. mil i tary.10** Bo liv ian Mor mon ism started among them and ex tended to their friends and net works, once the mission ar ies ar rived in 1964. burgh Press, 1971); Christ o pher Mitch ell, The Leg acy of Pop uli sm in Bolivia (New York: Praeger, 1977). ++++ 8This dual gov ern ment/re li gious func tion of Mor mon gov ern ment em ploy ees leads to some of the con tra dic tions Julio Córdova poses on the ba sis of his sur vey data for El Alto, as I elabo rate belo w. Julio Córdova Villazon, “Los Evangélicos: en tre la protesta y la compensación: mi norías religiosas y sectores urbano-populares: el caso de El Alto,” Tesis de Licenciatura para optar por el título académico de Licenciado en Sociología, Universidad Mayor de San Andrés (La Paz, Bolivia, Diciembre de 1990). * 9As an il lustr a tion, in 1950 there were 926,700 Lat ter-day Saints in the United States ac cord ing to of fi cial Church ac counts. In 1960 there were 1,422,700. These num bers form 0.6 per cent and 0.8 per cent of the United States popu la t ion respec t ively. To be repr esen t at ive of the popu la t ion, one would ex pect that, out of ev ery hun dred gov ern ment or busi ness of fi cials working in Latin Amer ica, less than one would be a Mor mon. The numbers requir ed drop sub stan tially if we con sider how many Amer i can Mor mons were ac tu ally act ive and, as a fur ther restr ic tion, how many served mis sions at the time, par tic ularly in Latin Amer ica. At that point, the numbers would more likely be one in ten thou sand. A sim ple pe rusal of the role of Amer i - can ex pa tri ates in LDS his tory in Latin Amer ica il lustr ates that they are far more common than one in ten thousand—and even more common than one in a hundr ed. Mor mons out weighed their presence in the pop ula tion in terms of their ad van tage to gov ern ment and business ex pansion in Latin Amer ica. ** 10For the Amer i can in f lu ence on the Bo liv ian econ omy, see DAVID CLARK KNOWLTON/MORMONS AND GUERRILLAS 185

Ac cord ing to the Deseret Morning News 2005 Church Al ma nac, “Norval Jesperson, a mem ber, who in 1962 became the dir ect or of the Amer i can-Bo liv ian Cen ter in Cochabamba in tro duced the gospel to a num ber of Bol iv i ans. . . . In 1963 Jesperson, along with two other Church members, Duane Wilcox and Dube Thomas, who lived in La Paz, helped the Church gain leg al status. ”11*** In 1964 the first LDS branches were or gan ized in Bolivia. But the work of these North Amer icans and others who fol lowed them inf luenced the Church’s presence in Bolivia. They pro vided a con nect ion bet ween gov ern men tal and of fi cial cir cles that has proven im por tant over time. In ev i ta bly the so cial class and oc cu pa tional per spec tives of U.S. Mor mons in Bolivia color ed the attr act ions of Boliv ians to Mor - monism. This for eign presence in Bolivia, includ ing the Mor mons, had a strong po lit ica l char act er. The United States, as men tioned, was concer ned about strong left ist in fluences aft er Bolivia’s 1952 rev o- lut ion and 1953 agrar ian ref orm. Once the mil it ary came to power in 1964, the United States poured in fund ing to coun ter left ist act iv i- ties by pro vid ing dev elop men t and a strong nat ional gov ernmen t. It is impor tant to note that, dur ing this per iod, one of the most impor - tant so cial and po lit i cal or ga ni za tions was the Cen tral Obrera Bolivia, the nat ional labor or gan iza t ion, which had a strong left ist, mil it ant cast. Fur ther more in the late 1960s, Che Guevarra en tered the Boliv ian lowlands to att empt to mount a people’s rev olu - tion.12****He was caught and killed in Yancahuazú by Boliv ian forces with Amer i can sup port. As a result of the asso c ia t ion bet ween Mor mons and the U.S. business, aid, and diplo mat ic missions, it is not sur prising that, dur - ing the 1980s, most LDS members with whom I spoke per ceived a gen eral as so ci a tion be tween Bo liv ian Church lead ers and right-wing

Cornelius Zondag, The Bo livian Econ omy, 1952–65: The Rev o lu tion and Its Af - ter math (New York: Praeger, 1966). *** 11Deseret Morning News 2005 Church Al ma nac (Salt Lake City: Deseret Morn ing News, 2004), 279. **** 12James Dan iel, The Com plete Bo livian Dia r ies of Che Guevara (New York: Stein and Day, 1968); Regis Debray, Che’s Guer rilla War (Bal ti more, Md.: Pen guin, 1975). 186 The Journal of Mor mon His tory pol i tics.13+ This re la tion ship among Mor mon ism, right-wing pol i tics, and U.S. for eign as sis tance fur ther more found an other in sti tu tional- ization in the on going rela t ionship bet ween the state of Utah (LDS Church head quar ters and a state where the ma jor ity of the pop u lat ion is Mor mon), and Bolivia. Prog rams included “Part ners of the Amer i - cas,” “Sist er Cities” arr angemen ts, and Utah-based, non-gover nmen t al org an iza t ions that have receiv ed semi-off ic ial sponso rship from USAID and the Church, such as the Andean Childr en’s Founda t ion, Brigham Young Uni ver sity’s Benson In sti tute, Choice Hu man i tar ian, a group ded i cated to ru ral de vel op ment and hu man i tar ian ser vice, and the in ter re lated ac tiv i ties of the Church’s Hu man i tar ian Ser vices Com- mitt ee, among others. 14++ To under stand why such rela t ionships are per - ceived as right wing, it is impor tant to note the flour ishing dev elop - ment of left ist par ties and so cial movemen ts in Bolivia, con trasted with the dearth of a left in the United States. As a result, ref orm ist Amer i - cans, even if they are lib eral, would be seen as right wing.15+++ Of par tic ular impor tance, USAID con tracted with Utah State Uni ver sity to pro vide ag ri cul tural de vel op ment as sis tance to Bolivia in the 1960s.16++++ Out of this prog ram came three of the first four mission presi den ts in Bolivia: Keith Robert s (for mer dean of the De - part ment of Ag ri cul tural Eco nom ics at Utah State Uni ver sity, had re sided in Bolivia from 1965 to 1967 and had also done aid work in

+ 13For ex am ple, see René Cabrera, Re gional Di rec tor, Pre sid ing Bish- op ric’s Of fice, La Paz, Bolivia, in ter viewed July 1991 by Da vid Knowlton, notes in my pos ses sion. See also John L. Hart, “Ide als El evate Conv ert to New Heights,” Church News, Feb ruar y 19, 1984, 7, is about Bo liv ian Mor - mon Jorge LeaZo Ro dri guez, early conv ert, prom i nent banker, and long-time Church of fi cial. ++ 14Greg ory S. Jones, “A Cri tique of the An dean Chil dren’s Foun da - tion” (M.A. thesis, Brigham Young Uni versit y, 1994). Much of this in for ma - tion is drawn from more than thirty years’ inv olvemen t with Bolivia. Aft er serv ing a Bo liv ian mis sion (1974–76), as a studen t, then as a pro fes sional an thropol og ist, I have been inv olved with al most all of these or gan iza t ions in one capac ity or ano ther. +++ 15C. F. Lesley Gill, Tee ter ing on the Rim: Global Re structur ing, Daily Life and the Armed Re treat of the Bo livian State (New York: Colum bia Uni versit y Press, 2000). ++++ 16Zondag, The Bo liv ian Econ omy, 1952–65. DAVID CLARK KNOWLTON/MORMONS AND GUERRILLAS 187

Iran); Keith Allred, and Devere McAllister, both Utah State Univ ersity facult y members who had also resided in Bolivia doing dev elop - ment work. In Bolivia, Robert s, Allred, and McAllister funct ioned as loca l Church leaders while ful fill ing their prof essiona l ob li ga- tions.17* Only Frankl in K. Gib son, an Ar i zona att or ney, and first of the first four presi den ts of the Bolivia Mission, had not worked for Utah State. This con nec tion be tween U.S. dip lo matic, mil i tary, and de vel- opmen t ef forts in Bolivia and the Church became clear by the 1970s. When popu list gener al Juan José Torres, rep re sent ing left ist fac tions of the mil it ary, took over the gov ernmen t in a coup d’ètat in 1970, among many other act ions, he threat ened to ban the LDS Church from Bolivia, prec isely because of its rela t ionship with U.S. “impe r ia l - ism” as under st ood in the dir ect and in dir ect in ter ven tions that were then part of U.S. pol icy.18**Torres was over thrown in 1971 by right- wing Colo nel Hugo Banzer Suarez, af fil iat ed with the Falange, the hist or i cally fas cist Bo liv ian So cial ist party. Ezra Taft Benson, as Church presi den t, called Banzer, in a pub lic meet ing in Bolivia, “the best presi den t Bolivia had ever had.”19*** Alt hough the point never came up dir ectly in docu men ts or re - search mat er ia ls, I can not help suspect ing that the over all an ticom - mun ist and right-wing pol it ics of Church leaders like Benson, dur ing the cold war per iod, also played a role in the Church’s becom ing a tar- get of the mil it ant left. While Benson may be an out lier, he is only so because of his asso c ia t ions with the John Birch So ciet y. The broadly right ist and anti-Marxist sen timen ts were widely shared by other Gen- eral Au thor i ties and led to sim i lar as so ci a tions be tween right ist lead-

* 17For ex am ple, see An des Mis sion, Manusc ript His tory, March 31, 1967. ** 18This threat was com monly dis cussed in Bolivia among Mor mons in 1974 while I was a mis sion ary in the coun try. *** 19He made this statemen t on Janu ary 12, 1979, when reded i cat ing Bolivia for mission ar y work, and this praise was com monly repor ted among mem bers in La Paz where I did field work June-De cem ber 1979. See also Carlos Pedraja, “Historia de la Iglesia en Bolivia,” http:///www. boliviamission.org/cgi-bin/downlog.cgi?ac tion+down load&doc+church_ his tory_bolivia.doc (ac cessed Sep tem ber 24, 2006). 188 The Journal of Mor mon His tory ers and the Church.20**** Under Banzer’s gov ernmen t, LDS Church member ship con tin - ued to expand. But Mor mon ism also con tin ued to be ex tremely con - trov ersia l in Boliv ian nat iona list and leftist polit i ca l and int ellec tua l circles. 21+ At the time, many were concer ned with what was called “the inva sion of the sects.” There was a strong ar gumen t that Evang el ica l Protestant groups and Mor mons were financed from the United States and were part of the gener al U.S. agenda to main tain po lit ica l and eco nomic heg emon y over the reg ion. Such an agenda included the domi na t ion of Bolivia’s Ind ian masses by “Euro-Bo liv ians” those of pri mar ily Eu ro pean phys i cal or i gin and cul ture.22++ The sep a ra tion bet ween re li gion and pol it ics, taken more or less for granted in the United States, was somet hing that did not make sense within the Bolivian field of ar gumen t. As a re sult, the soc ial re al ity of the Church’s growth in Bolivia was primar y in these crit ics’ anal ysis. They saw a church strongly asso c iat ed with the right wing and with United States gover nmen t al and busin ess int erest s. This is the broader con text. How ever, we must still exam ine how the patt ern of Church growth furt her con tribut ed to mak ing the LDS Church an ideo log ica lly valuable tar get for the FAL-ZW.

LDS GROWTH IN BOLIVIA The init ial LDS branches were est ablished in 1964 in the cit ies of La Paz and Cochabamba almost si mul taneo usly.23+++ Branches in the cit ies of Oruro and Santa Cruz soon fol lowed. Growth was most rapid, how ever, in the city of La Paz; and that dy namic will be the focus of this paper because La Paz was where many of the polit ica l ideol - o gies and ac tions against Mor mon ism de vel oped. Fur ther more, La

**** 20Greg ory A. Prince and Wm. Rob ert Wright, David O. McKay and the Rise of Moder n Mor moni sm (Salt Lake City: Uni versit y of Utah Press, 2005). Al though this topic per meat es much of the book, includ ing the fer vent anti-Com mun ist sen ti ments of Clare Middlemiss, McKay’s sec ret ary, see esp. chap. 12, “Confr on ta tion with Com mun ism.” + 21Julio Córdova Villazón dis cusses some of these per cep tions of non-Cath o lic re li gions in gen eral, in clud ing Mor mon ism, in his ex cel lent “Los Evangélicos.” ++ 22Fausto Reinaga’s Tesis India (La Paz, Bolivia: Ediciones PIB, 1971), is most instruc tive on these dev el op ments. +++ 23An des Mis sion, Manusc ript His tory, Decem ber 6, 7, 1964. DAVID CLARK KNOWLTON/MORMONS AND GUERRILLAS 189

Paz has played a crit ica l role in Boliv ian pol it ics because of its soc ial conf licts. Situ at ed in the densely pop ulat ed norther n altiplano above 3,000 met ers, La Paz is not only the larg est city in the nat ion with close to a mil lion and a half inhab it ants (almos t a fifth of all Boliv ians), it is also the cen ter of the Mor mon popu la t ion. I do not have LDS mem- bership fig ures for Bolivia’s dif fer ent cit ies, but the LDS popu la t ion can be substan tiat ed by the lo cat ion of Mor mon stakes, a ter rit or ial unit that re quires the presence of at least a few thousand members. By the end of 1991, the end of the per iod of guer rilla act iv ity, Bolivia had eleven stakes, five (46 per cent) of them in metr opol it an La Paz.24++++ The next larg est concen trat ion of members was in the lowland boom- town of Santa Cruz, with three stakes (27 per cent), fol lowed by the val - ley city of Cochabamba, with two stakes (18 per cent). Only one stake (9 per cent) was in the altiplano city of Oruro, where Prot est ant ism first est ablished it self in late ninet eenth-cen tury Bolivia, in asso c ia - tion with the area’s lib er al ism and min ing.25* Nev er the less, this pop u la tion pat tern thor oughly links Mor - mon ism with urban growth in each of these cit ies. La Paz man if ests the dif fi cul ties be tween a dom i nant mes tizo, His panic ur ban pop u lation and a massiv e im mi grant popu la t ion from the nearby Aymara-speak ing altiplano that brought new cul tural forms and pol i - tics into the city espe c ially from the 1960s to the presen t.26** La Paz, the de facto capi t al of Bolivia and seat of gov ernmen t, grew sub stan tially in the last half of the twen tiet h cen tury, due to its rela t ion with the densely pop ulat ed Aymara-speak ing ru ral area sur - round ing it. In 1960, some three years bef ore Mor mon ism was le-

++++ 24Deseret News 1993–1994 Church Al ma nac (Salt Lake City: Deseret News, 1994), 193–94. * 25Da vid C. Knowlton, “Searching Minds and Quest ing Hearts: Prot estant ism and Soc ial Con text in Bolivia” (Ph.D. diss., Univ ersit y of Texas at Aus tin, 1988). ** 26See, for ex am ple, Fernando Cal derón, Urbanización y etnicidad: el caso de La Paz (Cochabamba, Bolivia: CERES, 1984) or Godofredo Sandoval Z. and M. Fernanda Sostres, La Ciudad Prometida: pobladores y organizaciones sociales en El Alto (La Paz, Bolivia: ILDIS, 1989). The terms mes tizo, In dian, and white are used in Bolivia in an ethn ic, ra cial, and class sense. Al though per ceived in ev ery day life as impor tant, the terms do not fit neatly into any of those cate g o ries. For more on the ethn ic ity is sue, see Klein, Bolivia: The Evo lu tion of a Mul ti eth nic So ci ety. 190 The Journal of Mor mon His tory gally est abl ished in Bolivia, La Paz had a popu la t ion of around 400,000. By 1970, this pop u la tion had grown by 25 per cent to around 500,000, by 58 per cent in the sub se quent de cade to 790,000 in 1980, and by 67 per cent in the fol lowing de cade to 1,320,000 in 1990.27***Dur ing this per iod, La Paz, which had beg un with 11.7 per - cent of the to tal nat ional pop ula t ion, had inc reased its share to 18.1 per cent in 1990.28**** Thirty-eight per cent of La Paz’s inhab it ants orig i - nated out side the city in 1976; and 25.3 per cent of the im mi grants (64 per cent) came from the nearby Aymara-speak ing coun tryside. 29+ This immi grat ion has formed the city’s cen tral dy namic re sult ing in an ethn ica lly complex, bi lin gual city, with dense and con trad ic tory cultur al pol it ics. Most of the new comers, alt hough they may also speak Span ish, speak Aymara.30++ This fact or is not only impor tant in the expan sion of Mor mon ism but also in the growth of other non-Catho lic reli g ions, a flourish ing range of socia l movemen ts and other polit i ca l org an iza t ions, and the dev elop men t of the guerr illa chal lenge to Mor mon ism, among others. This ur ban growth pro - vided the key possi bi l ity of Mor mon ism dev elop ing in the coun try at the same time it fos tered the growth of the left ist move ments, such as the FAL-ZW, that conf licted with it. La Paz was built in a rather nar row river val ley that drains the high altiplano. Init ial urban growth occur red within the val ley walls, with the result that pri mar ily upper-cla ss, white suburb s were to the south in the lower reg ions, while more lower-class, Ind ian neigh bor - hoods were built to the north and along the val ley’s steep slopes.31+++ Later growth, beg inn ing in the 1960s but booming in the 1980s, took place above the edge of the val ley on the altiplano, primar ily in the

*** 27W. Willkie, ed., Sta tis ti cal Ab stract of Latin Amer ica 30, no. 1 (1993): 124, a pub li ca tion of the UCLA Latin Amer i can Cen ter. **** 28Ibid., 125. + 29Xa vier Albó et al., Chukiyawu: La cara aymara de La Paz. II. Una odisea, buscar pega (La Paz, Bolivia: CIPCA, 1982). ++ 30Ibid.; Fernando Cal derón, Urbanización y etnicidad: el caso de La Paz (Cochabamba, Bolivia: CERES, 1984); and Sandoval Z. and Sostres, La Ciudad Prometida. +++ 31I use the ethn ic terms that were common in Bolivia prior to the rev - o lu tion of 1952 and which are once again com ing into use, since they re - spond to the pol it ica l is sues I am trying to bring into fo cus—namely, the impor tance of how ethn ic ity and race were under st ood in socio-po lit ica l and DAVID CLARK KNOWLTON/MORMONS AND GUERRILLAS 191 sub urb known as El Alto.32++++ In 1900 the city of La Paz had a mere 58,015 in hab it ants, di - vided almos t complet ely along caste lines into 18,184 whites, 13,648 mest i zos, and 26,183 In di ans, marked by so cial, le gal, and res i den tial seg re ga tion.33* This sit u a tion changed dra mat i cally with the rev olu t ion of 1952 and the subse q uent agrar ian ref orm in 1953. With the lift ing of jur id ica l caste restric tions (that lim ited where Ind ians could live and work), the div ision of ag ricul tur al land among the In di ans, and the ex pan sion of pop u lar ed u ca tion to the Ind ian comm un it ies, a number of crit ica l changes ensued. Im me di ately af ter the re forms, in dig e nous com mu ni ties ded i - cated themsel ves to solid if ying their hold on the land, alt hough they also expanded to fill economic niches abandoned by elites in the reg ional mar ket towns and even in the cit ies. Aft er the ref orm, most whites aban doned the rur al towns and coun tryside, mov ing first to reg ional cit ies, and then to La Paz.34** They were fol lowed a lit tle later by much of the trad it ional mest izo popu la t ion. Thus, much of La Paz’s growth in the fift ies can be attr ibut ed to whites and mes ti zos. In compar ison El Alto de La Paz grew by some 133.9 per cent between 1976 and 1985. This per iod included the end of the Banzer dic- ta tor ship and its po lit i cal econ omy. Se vere dif fi cul ties emerged in the tran si tion to de moc racy, in clud ing hy per in f la tion and high lev els of un em ploy ment.35*** This per iod was also char act er ized by high Ind ian mi gra tion to La Paz. In 1950 El Alto had only 11,000 in hab it ants. By 1976 it claimed 95,434, and by 1985 some 223,239 per sons. By 1987

re li gious terms. ++++ 32Albó et al., Chukiyawu; Sandoval Z. and Sostres, La Ciudad Prometida. * 33For La Paz’s pop u la tion in 1900, see Olen E. Leon ard, “La Paz, Bolivia: Its Pop ula tion and Growth,” Amer i can So cio log i cal Re view 13, no. 4 (Au gust 1948): 452. For the so cial backg round of sep a ra tion, see Klein, Bolivia. ** 34Albó et al., Chukiyawu; Ju dith Maria Buechler, “Peas ant Mar ket ing and So cial Rev o lu tion” (Ph.D. diss., McGill Uni ver sity, Mon treal, Can ada, 1972); Da vid A. Prest on, Farmers and Towns: Ru ral Ur ban Re lation s in High- land Bolivia (Norwich, Eng: Univ ersit y of East Anglia, 1978). *** 35Sandoval Z. and Sostres, La Ciudad Prometida, 63. 192 The Journal of Mor mon His tory its pop u la tion was es ti mated at 356,514,36****making it the third or fourth larg est city in its own right in Bolivia, depend ing on var io us popu la t ion es timat es. It is also a unique city because the vast major ity of its resi den ts come from ru ral, Ind ian or ig ins. As a re sult, it is a natu - ral ex ten sion of the geo graph i cally el e vated (more In dian) neigh bor - hoods of La Paz. In short, the soc ial and cultur al dy namics of the city were domi - nated over the forty years be tween 1952 and 1992 by the col lapse of the for mer sys tem of rela t ively closed castes and the compe t it ion for soc ial mobi l ity, expr essed in ethn ic terms in a lim ited urban space that has suf fered extr eme economic crises dur ing the same per iod.37+ The city has a sedimented ethn ic qual ity, making Indianness a div id - ing point of class and of the city’s pol it ics. As a re sult, an or gan iza - tion’s re lat ionship with In dians can be def in ing in giv ing it a presence and iden tity in Bo liv ian so cial life. The first Mor mon branch in La Paz was est ablished in 1964 in the upper mid dle-class, white zone of Sopocachi (Branch I), where un - til re cently the Church had its headq uar ters in its own of fice build ing, down the block from the Min istr y of Def ense, and around the cor ner from the U.S. amba ssa dor ’s resi dence. 38++ This sit ing also gave Mor - mon ism a def in ite soc ial posi t ion in the coun try. Its of fice build ing was a promi nen t symbol , marking what to many is a crit ica l rela t ionship bet ween it, right ist mil it ary gov ernmen ts, and U.S. in ter ests in the coun try. Shortly aft er ward a branch was opened in the mid dle-class neighbor hood of Miraflores (Branch II), near the Boliv ian Pen tag on (Estado Mayor). Both of these branch loca t ions are im por tant since a sig nif ican t number of top Bo liv ian Mor mon leaders have come from these upper-mid dle-class, white zones. They have im ported their culture into Mor mon life, giv ing a com plex ethn ic and sociopolitical cast to Mor mon ism’s exis t ence in the cultur al and eco nomic pol it ics of ev - ery day Bo liv ian life. A dif fer ent kind of branch, La Paz III, the first with an eth nic char act er, was founded in Aug ust 1967. Accor d ing to the mission his-

**** 36Ibid. + 37Albó et al., Chukiyawu; Córdova “Los Evangélicos; James Dunkerley, Re bel lion in the Veins: Po lit ical Strug gle in Bolivia, 1952–82 (Lon - don: Verso Books, 1984). ++ 38An des Mis sion, Manu script His tory, De cem ber 6, 1964. DAVID CLARK KNOWLTON/MORMONS AND GUERRILLAS 193 tory, “We started our first branch in the mission among pure Lamanites. . . . In De cem ber other Lamanite branches, La Paz IV and Juliaca, were opened.”39+++ A crit i cal di men sion de vel oped with this prob lem atic con join - ing of Mor mon lang uage/iden tity with Boliv ian re al ity and dis - course. To Mor mons, the Lamanites are Amer ican Ind ians and are the descen dan ts, accor d ing to the Book of Mor mon, of Isr ael ites on this con tinen t. They are also a people upon whom Anglo Mor mons have a par tic ular obli gat ion to best ow the gospel. As a re sult an elec- tive af fin ity de vel oped be tween An glo pa ter nal ism and that of upper-class white Boliv ians. In both cases and in ways that find scrip- tural sup port from the Book of Mor mon, this rela tion ship con tained con cepts of “civ i liz ing” the In dian.40++++ It also fit into quest ions that the Bo liv ian po lit i cal spec trum, par tic u larly the right wing, posed concern ing the ambiv a lent place of the Ind ian in nat ional life. Fur ther - more, it served white and mes tizo Boliv ians to make a claim for leg it i - macy as Ind ians (and hence as Boliv ians) in the face of an in creasing Ind ian iden tity movemen t that den ied Indianness to whites and mes - tizos. Mor mons consider race in terms of descen t, not in terms of cultural be long ing. As a result, Mor mon ideas of Lamanite conf licted and con - trasted with the no tions of Ind ian resur gence and just if ica t ion dev eloped by the inc reasingl y strong Indianist movemen t in Bolivia.41* The con trast ing claims be tween the Book of Mor mon as a re puted his tory

+++ 39Ibid., Jan u ary 1, 1968. Juliaca, a city in Puno, Peru, on the other side of Lake Titicaca, was soon transf erred to the Per uv ian Mission. ++++ 40On the trou bled con cept of Lamanite from so cio log i cal and an thro - po log i cal per spec tives, see Armand Mauss, All Abraham’ s Childr en: Chang - ing Mor mon Concep tion s of Race and Lineag e (Ur bana: Uni ver sity of Il li nois Press, 2003), chap. 5, “Old Lamanites, New Lamanites, and the Ne go ti a tion of Iden tity,” 114–57; and Thomas W. Murphy, “Imag in ing Lamanites: Na - tive Amer i cans and the Book of Mor mon” (Ph.D. diss., Uni ver sity of Wash - ingt on, 2003). For an in ter nal Mor mon crit ique of this posi t ion by two Mex- ican Amer ican Mor mons, see Eduar do Pag an, “Dark Truths and the Hu - man Soul: Wick ed ness and Cul ture in the Book of Mor mon,” Sun stone Sym po sium, March 19, 1994, Wash ing ton, D.C., pho to copy in my pos ses - sion; and Josué Sanchez, “Muéstrenme a un Lamanita,” in his El Libro de Mor mon ante la crítica (Salt Lake City: Pub lisher’s Press, 1992) 257–301. * 41A large lit er a ture is dev el op ing on Indianism in Bolivia. An in tro - 194 The Journal of Mor mon His tory of the in dig eno us peoples in gener al and the Indianist movemen t’s claims to repr esen t the spec ific Ind ian peo ple of Bolivia, their hist ory, and their claim to a place at the nat ional ta ble, seem ir rev oca bl y poised for conf lict, just by the founda t ion of this branch and the way it fit in Boliv ian and Mor mon so cial rea l ity. La Paz Branch III, the first “Lamanite branch,” was locat ed in the neighbor hood of Munaypata, the pri mar ily Ind ian sect ion of the upper reaches of the val ley. Branch IV was in the vil las or un sta ble neighbor hoods of the hillsides above Miraflores, par ticu larl y Villa Armonía, with its immi grants from souther n Bolivia, most of them Quech ua-speak ing mes ti zos, in my ex pe ri ence, al though nu mer ous resi den ts are Aymara speak ers as well.42** It is im por tant to note the rapid growth out side the upper-mid dle-class, white, and mes tizo neigh bor hoods and into the poorer more In dian neigh bor hoods at a time these neighbor hoods were beg inn ing to expand rapidl y. In Febr uar y 1968, Branch III was div ided, and Branch V was formed, also in the upper area of the city. A month later in March 1968, Branch VI was est ablished in the even tual boomt own in El Alto’s mid dle-class, mest izo town of Ciudad Satelite, and Branch VII in the “Ind ian” boom ar eas of Villa Ballivian and Alto Lima. With this step, the Church was poised to take advan tage of the stupen do us growth of this re gion in subse q uent years. By 1975, the branches in El Alto and the upper reaches of the city con stitut ed 68 per cent of the to tal member ship of La Paz. While I do not have spec ific mem bership fig ures for the branches for the years be tween 1976 and the presen t, this patt ern of growth has ev i - dently con tin ued. Three of the five La Paz stakes are locat ed in this zone (La Paz Const itu t ion, which includes the norther n area of the city), with the other two stakes in El Alto. Fur ther more, each of these latt er two stakes includes sub stan tial numbers of members in the vil - las, the poorer neigh bor hoods on the slopes. As a result, the ac tual duc tion to the liter a ture can be found in the writ ings of the Bo liv ian/Span - ish an thro pol o gist and Je suit Xa vier Albó, for ex am ple, “El ret orno del indio,” Revista Andina 9, no. 2 (1991): 299–366; or in Ma rie-Chantal Barre, Ideologías indigenistas y movimientos indios (México Distrito Feder al: Siglo Veintiuno, 1987). This movemen t has only grown in impor tance since the 1990s and now is one of the most im por tant po lit i cal forces in the coun try. ** 42I spent seven and a half months of my LDS mission to Bolivia in this neighbor hood and this branch. DAVID CLARK KNOWLTON/MORMONS AND GUERRILLAS 195 num ber is prob a bly higher. Ano ther dy namic of Mor mon expan sion in Bolivia appear ed in Oct ober 1968 when mission ar ies beg an to work in the pro vinc ial town of Viacha (now prac ti cally a suburb of La Paz). Viacha is Aymara-speak ing and, hence, In dian. By 1976, branches had been opened as well in the pro vinc ial, Aymara towns of Achacachi, Corocoro, Guaqui, San ti ago de Huata, Patacamaya, and Puerto Acosta. In the 1960s, towns like these boomed, depend ing on their locat ion in the mar ket ing net work that crossed the altiplano, as Ind ians moved out of rur al comm un it ies to occup y the ar eas aban doned by mest izo and white elites fol lowing the 1953 agrar ian re form. De spite what would seem to be a propi t ious area for Mor mon growth, given the rapidl y changing socia l env ir onmen t, mission a ry work has been dif ficult at best here, log ging only modest suc cess. Nev er theless, these ar eas, along with Branches III, VII, and XII of La Paz, were the focus of act ive prose l yting in the Aymara lang uage. Sign ifi can tly, other than in the case of Huacuyo43*** and Compi, Mor mon prose ly tiz - ing has been un success ful among the dispersed ru ral popu la t ion of the Aymara-speak ing altiplano, alt hough other non-Catho l ic churches, such as the Sev enth-day Adv en tists, have been phenom - enally success ful here dur ing the same per iod. The LDS Church re - mains a church of Bolivia’s larg est cit ies. Alt hough its main presence is in the poorer, more Ind ian neigh bor hoods, it is pri mar ily Span ish speak ing.

PECULIARITIES OF MORMONISM IN BOLIVIA This con flict be tween the use of Ind ian lan guages and be ing a Span ish-speak ing Church is one of the con trad ic tions of Mor mon ism in Bolivia that so ciol o g ist Juan Córdova Villazon disco v ered in his 1989 sur vey of El Alto. He found in this booming re gion of pri mar ily Ind ian backg round that “the Mor mons pre domi nat e in the poor est sect or, ([where they are] 4 per cent [of the to tal]) and in the mid dle, comf ort able class ([where they are] 3 per cent [of the to tal]). They almost do not have a presence in the mid dle sect ors (1 per cent).”44****He also found that “the Mor mons have [of all the non-Cath olic re li gions

*** 43Da vid C. Knowlton, “Prot est ant ism and So cial Change in a Rur al Aymara Com mu nity” (M.A. thesis, Uni versit y of Texas at Aust in, 1982). **** 44Córdova, “Los Evangélicos,” 84. Since Córdova’s thesis is not easi ly 196 The Journal of Mor mon His tory sur veyed] the second highest per cent age of Aymara (12 per cent) and the high est per cent age of Span ish on this level (24 per cent), and the low est per cent age of bi lin gual ism of all the con fes sions.”45+ He in ter - prets this coun ter-in tuit ive fact in the fol lowing way: The Mormon Church fol lows the con tra dic tory ten dency of the socio-eco nomic sec tors that com pose it. . . . In terms of lan guage it con cen trates on those who speak Aymara or Span ish, with a low per - cent age of bi lin gual ism. As we have shown, their ser vices are car ried out solely in Span ish. This con fession rep resents a chan nel to ward westernization. This is ver ified if we notice that in their deep linguis tic iden ti ties the Mor mons tend to ward the us age of Span ish. The el e - vated per cent age of Aymara speakers on an ex ternal level is the ex - pres sion of sec tors who find them selves en tering the pro cess of occidentalization yet they still have a rel a tively free space for speaking their ma ter nal tongue.46++ By 1991, there were of fic ially 71,000 mem bers of the Mor mon Church in Bolivia. If we appor tion them ac cord ing to the per cent ages der ived from the presence of stakes, this would give us roughly 32,270 Mor mons in La Paz, or a rela t ive 2.4 per cent of the to tal urban popu - lat ion. Of these, some 19,364 were found in the up per reaches of the city and in El Alto. For El Alto alone, this would come to 12,908 mem - avail able in the United States, I pro vide the orig i nal text behind my transla - tion. “Los mormones predominan en tre el sect or pauperizado ([donde son] 4% [del to tal]) y en el estrato medio ‘acomodado’ ([donde son] 3% [del to tal]). Casi no tienen presencia en tre el sec tor medio (1%).” + 45Ibid., 129: “Los Mormones tienen el segundo porcentaje más elevado de aymara (12%) y el más alto porcentaje de castellano en este nivel (24%), y el más bajo porcentaje de bilingüismo de todas las confesiones.” ++ 46Ibid. “La Iglesia Mormona sigue la tendencia contradictoria de los sectores socio-económicos que la componenen . . . en el aspecto id iomático concentra a quienes se expresan en aymara o en castellano, con bajo porcentaje de bilingüismo. Según hemos comprobado, los cultos se llevan sólo en castellano. Esta confesión representa un cana l hacia la occident- alización. Esto se verifica si constamos que en las identidades lingüísticas profundas, los mormones tienden hacia el uso del castellano. El elevado porcentaje de Aymara parlantes en el nivel externo es la expresión de sectores que encontrándose en el proceso de occidentalización, aún tienen un espacio relativamente ‘li bre’ como para expresarse en su lengua mat- erna.” DAVID CLARK KNOWLTON/MORMONS AND GUERRILLAS 197 bers, or a rough rela t ive per cent age of 3.58 per cent, dist inctly higher than the distr ibu t ion in the en tire urban zone. In ter est ingly, Córdova’s sur vey found that 3 per cent of the popu la t ion of El Alto claimed to be Mor mon.47+++ In Córdova’s sam ple, only 66.3 per cent of the heads of household in El Alto claimed to be Catho lic. This left an ast ound ing 33.7 percen t claiming other reli g ious aff ili a t ions.48++++ Of this to tal, 7 per cent were Assem bl y of God, 4 per cent Adv en tists, 4 per cent Jeho vah’s Wit- nesses, 2 per cent Nazarenes, 1 per cent Quak ers, 2 per cent mem bers of “Dios Boliviana,” 3 per cent Bapt ists, 1 per cent Holi ness, 3 per cent others, and 3 per cent not respond ing.49* Thus, besides the LDS Church, other groups have also grown in Bolivia over a brief per iod of time to con sti tute a sig nif i cant por tion of the pop u la tion. Yet sig nif i - cantly, Mor mon ism shows a dif fer ent class prof ile than these other groups within El Alto.

GUERRILLA ATTACKS: FRENTE ARMADA DE LIBERACIÓN ZÁRATE WILLKA In 1989, when the Church in Bolivia had grown by a stunn ing 37.5 per cent in a brief two-year per iod,50** two An glo mis sion ar ies, El- ders Ball and Wilson, were gunned down by as sas sins who awaited their ar rival home at night in a working-cla ss neighbor hood near the city’s main ceme t ery.51*** Accor d ing to their mission presi den t, Stev en R. Wright, the guer ril las had careful ly stud ied the movemen ts of the mission ar ies and had even taken the mission ar y lessons in prepa r a- tion for the as sas si na tion.52**** The mission ar ies appear to have been a careful ly cho sen targ et as part of a broader guer rilla agenda, since the guer ril las had prev io usly bombed two chapels (in the neighbor hood of Pampajasi—above Villa Armonía—and the sec ond near the ceme -

+++ 47Ibid., 67. ++++ 48Ibid., 28. * 49Ibid., 67. ** 50Note that this growth rate was the high est in South Amer ica dur ing that two-year pe riod. The Mormon member ship for the con tinen t as a whole grew 29.1 per cent. These cal cu la tions are based on mem bers from se - quen tial Deseret News and Church Al ma nacs for 1989–90, 1991–92. *** 51Knowlton, “Mis sion ar ies and Ter ror.” **** 52Stev en R. Wright, in ter viewed by Da vid Knowlton, spring 1992, notes in my pos ses sion. 198 The Journal of Mor mon His tory tery where they later assa ssi nat ed the mission ar ies). Both of these ar - eas are zones of Aymara mig rants to the city. A half-hour or so aft er the assa ssi na t ion, the guer ril las pro vided a handw ritt en man if esto to the nat ion’s dai lies.53+ It read: The vi o la tion of our na tional sov er eignty can not re main un pun ished. The Yan kee in vad ers who come to mas sa cre our peas ant broth ers are warned the same as their in ternal lack eys. The poor have no other path than to rise up in arms. “Our hatred is impla cable and our war is to death.” Zárate Willka Armed Lib er a tion Front.54++ At the time, FAL-ZW was primar ily known for a botched 1989 attempt to bomb the mo tor cade of U.S. Sec ret ary of State George Schultz, in pro test of U.S.-financed att acks on the peasan t farm ers who grew coca, which others transf ormed into cocaine. Ini tially then, the man if esto seems to ref er dir ectly to U.S. pressur es against the product ion of coca and the vio len t repr ession of coca produc ers ’ pro tests by mil it ary and police forces. It is im por tant to note that FAL-ZW was but one of a range of guer rilla or gan iza t ions oper at ing in Bolivia at the time and that it was build ing on a his tory of guer rilla move ments, such as the ELN (the Nat ional Liber at ion Army), which was act ive in the 1970s, fol lowing the kill ing of the in ter nat ional rev olu t ionar y Che Guevarra in the coun try. The Indianist Katarista move ment dev eloped its own guer - rilla or ga ni zat ion, the EGTK (The Tupac Katari Guer rilla Army), which be came strongly act ive in the years fol lowing the FAL-ZW’s attacks on Mor mon ism and which builds on some of the same ideo log i - cal ar gumen ts as the FAL-ZW.55+++ The EGTK is desc ribed as fol lows by the MIPT Ter ror ism Knowledg e Base of the Na tional Memo r ial Inst i - tute for the Prev en tion of Ter ror ism in Oklahoma City (http://

+ 53“Dos misionares mormones norte americanos asesinades por gropo teroriste,” Presencia (La Paz, Bolivia), 25 de Mayo de 1989. ++ 54Since this doc u ment is not eas ily avail able, I pro vide the orig i nal: “La violación de nuestra soberanía nacional no puede quedar impune, los invasores yan quis que vienen a masacrar a nuestros hermanos campesinos están advertidos al igual que sus lacayos internos. A los pobres no nos queda otro camino que alzarnos en armas. ‘Nuestro odio es im pla ca ble y nuestra guerra es a muerte.’ FAL Zárate Willka.” I do not know the source of the quo ta tion em bed ded in the man i festo. +++ 55Jaime Iturri Salmón, EGTK: la Guer rilla Aymara en Bolivia (La Paz, Bolivia: Ediciones Vaca Sag rada, 1992). DAVID CLARK KNOWLTON/MORMONS AND GUERRILLAS 199

www.tkb.org/Home.jsp): The Tupac Katari Guerrilla Movement, also known by its Spanish ac- ro nym EGTK, was an in dig e nous Bo liv ian ter ror ist en tity. EGTK mem bers be lieved that Bolivia should be returned to its pre-co lo nial sta tus, in terms of its form of gov ernment, eco nomic sys tem and so - cial struc ture. EGTK hoped to de crease West ern in flu ence in Bolivia and in crease the in dig enous In dian pop u lace’s power over the coun - try’s cul ture and pri or i ties. With this ob jec tive in mind, EGTK con - ducted ter rorist at tacks, frequently low-level bomb ings, of power py - lons, oil pipe lines, gov ern ment fa cil i ties, and mis sion ary churches. In ad dition to frequent attacks on domes tic power and oil facil ities, EGTK bombed sev eral Mormon churches within Bolivia, and also bombed a U.S. Agency for Inter na tional Devel op ment (USAID) mo - tor pool.56++++ In other words, the FAL-ZW was part of a con text of mil i tant or - ga ni za tion and mo bi li za tion.57* It built on a rad ica l left ist cul ture and hist ory of guer rilla movemen ts in Bolivia and is relat ed to a his tory of la bor strug gles and In dian or ga niz ing. This cul ture was par tic u larly strong in the nat ion’s public univ ersi t ies and helped give mean ing and pur pose to the expe r ience of im mi grat ion and cultur al struggle by Ind ian mig rants to the cit ies and their childr en.58** As Iturri Salmón notes, the rad i cal iza tion of In dian or ga ni za tion led to a strug gle against the Boliv ian state as well as the symbolic, cultur al, and reli - gious or gan iza t ions that seemed to main tain the Ind ian in a posi t ion

++++ 56MIPT Ter ror ism Knowl edge Base, http://www.tkb.org/ Group. jsp?groupID=4289 (ac cessed June 10, 2005). * 57It should be noted that a number of mil i tant groups chose Mor mon prop erty and per son nel as targ ets in Bolivia, Chile, Peru, and Co lom bia dur ing the late 1980s and early 1990s. That they have done so, and that Mor - mons have con tinued to be threatened in Co lom bia into the presen t cen - tury, il lustr ates the value of Lat ter-day Saints as a targ et. ** 58For inf or mat ion on the Bol iv ian left, see Guillermo Lora, Historia del Movimiento Obrero en Bolivia: Lucha revolucionaria de los 60 (La Paz, Bolivia: Ed it o rial La Muela del Diablo, 1991); as an in tro duct ion to the lit er - a ture on con tem po rary so cial movemen ts, see Fernando Calderon and Alicia Szmukler, La política en las calles (Cochabamba, Bolivia: CERES, 2000). 200 The Journal of Mor mon His tory of weak ness and depend enc y.59*** To this I would add the issue of the U.S. presence in Bo liv ian life and its role in subor dinat ing the in ter - ests of the Indianists. The 1980s led to a strengthen ing of the Ind ian movemen t, a wid- en ing disper sion of its ideol ogy and debat es around it, and to in- creased feel ings of frustr at ion on the part of many Boliv ians. Aft er the struggles to wrest demo c ratic con trol from the mil it ary dict at or- ships, the coun try went through a per iod of extr eme economic insta - bil ity and hyper inf lat ion. At this time, the United Left Party (UDP), a coa li tion of many left ist groups, gov erned in the fig ure of Presi den t Hernán Siles Zuazo. The UDP was unable to bring the promised social change that the left, and par ticu larl y the Ind ian part ies of the left, desir ed. The UDP’s col lapse and the subse q uent rise to power in 1985 of the old oli gar chy in the form of the Nat ional Rev olu t ionar y Party (MNR) and its shift to neoliberalism, fol lowing the demands of mult i - lat eral agenc ies and the United States, left many of the left very frus- trated with elect oral pol it ics. The left in creasingl y felt lit tle possi bi l ity of obt ain ing its ends through the elect oral process, par ticu larl y given the economic and polit ica l power of the United States and the mult i - lat eral agenc ies, such as the World Bank and the Inter-Amer ican De- vel opmen t Bank, in which Wash ing ton plays an im por tant role. Boliv ian mass cultur e has been very sensi t ive to U.S. in ter fer - ence in its af fairs and to the broad range of pressur es loosely def ined as “im per i al ism.” It was (and is) not uncom mon to see ban ners flying from the Nat ional Uni versit y of San Andrés saying “Yan quis out,” or some such slog an. At the time of the mission ar ies’ assa ssi na t ion, U.S. pressur e against Bolivia’s coca produc t ion was in tensely felt and very visi ble. The rela t ively tiny city of La Paz had one of the larg est North Amer ican dele gat ions on the con tinen t and its af fairs were widely re - ported in the press, includ ing at times vio len t enco un ters bet ween the U.S.-trained anti-nar cot ics force and coca produc ers. The con nect ion with Mor mon ism, though, seems strong er than merely a weak asso c ia t ion with the broad label of impe r ia l ism. The FAL-ZW delib er at ely chose to attack Anglo Mormon mission a ries. Besides the guer ril las’ att empt to bomb Schultz’s mo tor cade, they had alr eady att acked the Nat ional Cong ress Build ing, bombed the two Mor mon chapels alr eady men tioned in La Paz, and subse q uently bombed one in Santa Cruz in July 1989, and threat ened the mayor of

*** 59Iturri Salmón, EGTK, 35–38. DAVID CLARK KNOWLTON/MORMONS AND GUERRILLAS 201

El Alto with death unless he closed the area’s Mor mon chapels. I also receiv ed threats that I took ser io usly and fled from Bolivia, in ter rupt - ing my fieldw ork. In short, the FAL-ZW ded icat ed a sub stan tial por- tion of its en tire guer rilla ef fort to att acking Mor mons spec if ica lly, somet hing that is quite rare in the his tory of rad ica l guer rilla or gan i - zat ions in Latin Amer ica. The FAL-ZW gener ally was desc ribed as rela t ively ill-trained and un usual in its oft en con fusing ideol ogy .60****The Bo liv ian daily Última Hora char act er ized FAL-ZW ideol ogy as “nour ished by a strange amalg am of Marxism, Maoism, and Indigenism.” This “strange amalg am,” how ever, was at the time very common in the popu lar sa lons and caf es of La Paz among those in volved in edu ca t ion and in the univ ersi t ies and nor mal schools. The pop ular ity of this ide- ology was enhanced by volu mi nous news paper report s on the lat est act iv it ies of the Shin ing Path in Peru, par ticu larl y when classmat es told of the exc itemen t that movemen t has caused among soc ial sci - ence major s in Peru. Col leagues in Bolivia ind icat ed that Zárate Willka orig inat ed among public school teachers and col lege studen ts, par ticu larl y soc i - ol ogy ma jors, at the Uni ver sity of San Andres. Fur ther more, those ar - rested, fol lowing in tense U.S. pressur e and FBI assis t ance, includ ing a re ward of US$500,000 of fered for in for mat ion lead ing to the ar rest of those re sponsi ble for the assa ssi na t ions and who were publicly iden ti - fied were af fil iat ed with the Univ ersit y Mayor de San Andres Depart - ment of Soc iol ogy and with Indianist par ties.61+ These two cat eg or ies, stu dents at the Univ ersit y Mayor of San Andres and nor mal school gradu at es were repr esen tat ive of an increas ing num ber of sec ond-gen er a tion im mi grants to La Paz from the campo. They have att ained a cert ain mobi l ity within the city, man - if ested in their at tempt to att ain prof essiona l stand ing, yet find their mobi l ity blocked by the lack of jobs and the rela t ively low-sala r ied po- sit ions for these highly trained per sons whose subject matt er inv olves

**** 60Like the other guer rilla group that ded i cated much ef fort to at tack - ing Mor mons, the Lautaro Youth Movemen t in Chile, the FAL-ZW is al most not stud ied. See, for exam ple, the bibl i og ra phy pro vided by the MIPT Ter - ror ism Knowl edge Base, http://www.tkb.org/Group.jsp?groupID=4321 (ac cessed June 9, 2005). + 61Knowlton, “Mis sion ar ies and Ter ror.” 202 The Journal of Mor mon His tory a crit i cal per spec tive on the very con sti tu tion of so ci ety.62++ The Bo liv ian news pa per Hoy respond ed to this structur al niche in expr essing then-com mon fears that FAL-ZW might someho w be as- soc iat ed with the Per uv ian Shin ing Path. In part, this was because the FAL-ZW oper ated within and seemed to dir ect its ef forts to ward the so-called marg inal pop u la tions of the vil las and El Alto. The pa per ex - pressed much ambiv a lence about this sect or of La Paz, but at the same time desc ribed its struc tural situ a t ion: The ur ban marginal zones of La Paz can be a pro pitious “soup of gen- era tion” for their inten tions to destabilize the sys tem. . . . The city of El Alto could of fer them that oppor tunity, given their pecu liar pref erences, for which the threat to the mayor of El Alto and the as sas si na - tion of the two North Amer ican Mor mon mission ar ies in a popu lar zone of La Paz seem to co in cide with our hypoth esis and the ev i dent tendency of the group Zárate Willka to carry out its ac tions in mar - ginal urbanizations, more than in the coun tryside. . . . In Bolivia El Alto of fers them this possi bil ity, because of its prox im ity to an anarchized univer sity and var ious high schools which func tion in extremely bad con di tions, “ob jec tive fac tors” for the surgence of an ur - ban guer rilla war with its mem bers recruited from these ed uca tional cen ters, ac cord ing to the ex perts. . . . At the same time, El Alto and the mar ginal zones where groups of young stu dents live, who have only recently been torn from their peasant roots in pre cari ous condi tions and with dif ficul ties finding work, and with standing the rejec tion of the soci ety that is installed in the city, can be orga nized into the princi - pal cen ter of recruit ment for the pur poses of a guer rilla war or urban ter ror ism.63+++ One of the issues fueled by this structur al bind concer ned eth-

++ 62In ter views I conduct ed att est to this per cept ion in this popu la tion. See, for ex am ple, Knowlton, “Search ing Minds and Quest ing Hearts.” +++ 63“Sendero Luminoso y el Frente Armado Zárate Willka,” Hoy (La Paz, Bolivia), 3 de Junio de 1989. “La marginalidad urbana en La Paz puede ser un apropiado ‘caldo de cultivo’ para sus intenciones de desestabilizar el sistema. . . . La ciudad de El Alto podría ofrecerles esa oportunidad dadas sus peculiaridades, por lo que la amenaza al al calde de El Alto y el asesinato de los dos misioneros mormones norteamericanos en una zona popu lar de La Paz parecen coincidir con estas hipótesis y una supuesta tendencia del grupo ‘Zárate Willka’ a desarrollar su acción en urbanizaciones marginales, más que en el cam po. . . . El Alto ofrece esa oportunidad, por su DAVID CLARK KNOWLTON/MORMONS AND GUERRILLAS 203 nic iden tity.64++++As noted above, daily life in La Paz has been marked by the col lapse of the for mer jur id ica l sys tem of quasi- castes—such as In- dian, mes tizo, and white—that man if ested it self both in laws and in pract ices of so cial exclu sion. The structur es of in equal ity and the labels remain, as do the impor tant indexical mark ers of ind ig eno us com mu ni ties and in dig e nous lan guages spo ken by the par ents and rela t ives of many of these young peo ple. The sys tem of strat if ica t ion that oper ates in Bolivia is accor d ing to per ceived ethn ic ity: whites at the top and In di ans at the bott om. This patt ern was strong in the late 1980s and con tin ues to the momen t, alt hough Ind ians have risen and chal lenged the he ge mony of whites and mes ti zos. Nev er the less the sys tem of strat i fi ca tion op er ates daily through dis crim i na tion in terms of dress, lan guage choice, fes ti val par tic i pa tion, em ploy ment, and med i cal ser vices.65* This inev it able issue in La Paz life is con- stantly part of most dis cussions and per vades the hor i zons of most cit - izens ’ consc iousness. How one under stands one’s own ethn ic iden tity in an ambiv a len t structur al and ideolo gi ca l posi t ion is a burning question for Paceños (resi den ts of La Paz). Out of this quandar y dev eloped the vit al Indianist movemen t of re vi tal iza tion, in clud ing the con struc tion of a ur ban In dian iden tity as crit ica lly Boliv ian and neces sar y for nat ional life and prog ress. A bur geon ing lit er atur e has arisen on which the young can cut their vecindad con una universidad anarquizada y unos colegios secundarios que funcionan con ínfimas condiciones, ‘factores objetivos’ para el surgimiento de una guer rilla ur bana con elementos reclutados en esos centros edu- cativos, según los especialistas. . . . El Alto y las zonas marginales, donde viven grupos de jóvenes estudiantes recién arrancados de sus raíces camp- esinas en condiciones precarias y con dificultades de empleo soportando el rechazo de la sociedad instalada en la ciudad, se pueden constituir en princi pal centro de reclutamiento para las intenciones de la guer rilla y el terrorismo urbanos.” ++++ 64This pa per ref ers to events in 1989, but the struc tures lead ing to the assa ssi na t ion of the mission ar ies remained and have fueled massiv e unr est. In the last three years (2003–06), it has brought down two U.S.-sup ported gov ern ments and has led to the elect ion of Bolivia’s first ind ig eno us presi - dent de spite U.S. op po si tion. * 65Libbett Crandon, From the Fat of Our Souls: So cial Change, Po lit ical Process, and Medi cal Plur ali sm in Bolivia (Berkeley: Univ ersit y of Cali f orn ia Press, 1991). 204 The Journal of Mor mon His tory teeth.66** At the momen t Indianism is very strong in Bolivia. But in the 1980s, it was growing and was very strong in working class and poor neighbor hoods of ru ral or ig in such as in El Alto, alt hough it did not have the of fic ial power and leg it imac y it now does. The role of ind ig e nous re li gion in the face of the on slaught of sects from the West, espe c ially the United States, has been much discussed. Many ar gue that for eign sects destr oy neces sar y ele ments of an al ready eroded in dig e nous iden tity.67***This dis cus sion is par tic u- larly crit ica l because many of the or gan izers of Indianist synd icat es (un ions), etc. have a back ground in non-Catho lic reli gions, such as Meth od ism.68****These synd icat es, unif ied in the Confederación Sindical Única de Trabajadores Campesinos de Bolivia (CSUTCB), have become a crit ica l force in bring ing down recen t gov ernmen ts and are led by Felipe Ovispe, a for mer guer rilla in the rev olu t ionar y Indianist EGTK. Álvaro García Linero, elected as vice presi den t in 2005 in the Indianist nat ional gov ernmen t, is also a for mer guer rilla in the EGTK. These groups came into promi nence af ter the FAL-ZW was brok en; how ever, they shared the ba sic Indianist per spect ive and concern about foreig n and nat ional org an iza t ions as inim i ca l to In- dian cul ture and life. Is sues of Indianism are also impor tant for many conv erts to Mor mon ism and have become part of the socio-cul tural pol it ics of Mor mon exis t ence. One respons e is to note that the Book of Mor mon pro vides an In dian iden tity that has the vir tue of not being af fil iat ed with any par ticu lar loca l comm un ity and thus is bey ond Bo liv ian sys - tems of strat if ica t ion. It comes with value pro vided by the pinna cle of the dev eloped world and mo der nity, the United States. The rea l ity of this iden tif ica t ion is strongly felt by many LDS mem bers who rew rite their in dig eno us past to fit Mor mon mythic canons with the pur pose of leg it imat ing the Book of Mor mon with its promise of futur e

** 66Barre, Ideologías indigenistas y movimientos indios. *** 67I viv idly remem ber one long and vi tal dis cus sion about the na ture of in dig e nous spir i tu al ity, par tic u larly in the con text of its chal lenge by Mor mon ism and Prot es tant ism, in 1985 in a comedor pop u lar off the plaza Isabel La Católica in La Paz, with a group of young, self-styled Ind ian in tel - lec tua ls. They strongly felt that Mor mon ism was a clear and presen t dan ger to in dig e nous iden tity. **** 68Julio Córdova, “Capacidades políticas del movimiento evangélico bol ivi ans,” Nuevos Actores Sociales 1 (2002): 193–258. DAVID CLARK KNOWLTON/MORMONS AND GUERRILLAS 205

revindication as their sa cred his tory. This strat egy became clear to me when I spoke at a fireside in La Paz, Bolivia, in a working-cla ss class ward, about the rel a tive dearth of ar che o log i cal ev i dence for the Book of Mor mon. The neg at ive reac t ion by numer ous people in the aud ience ind icat ed the impor tance they assig ned to the Book of Mor - mon as “their” hist ory. A Boliv ian LDS ar cheol o g ist has also writt en works for the Mor mon au di ence ar gu ing that the Book of Mor mon makes sense of Bolivia’s ar cheol ogy and that the ruins of high civ i li za- tions there are Book of Mor mon sites where people can find their faith vali dat ed. Córdova, in light of his 1989 sur vey, ar gues this idea more con- cretely. Re fer ring to the fact that Mor mon ism seems to draw its adher ents from the lower so cioeco nomic strata, yet has very low ind ices of bi lin gual ism and uses Span ish pre dom i nantly, he arg ues that one has to under stand this distr ibu t ion of Mor mons in terms of the sym - bolic and prac ti cal of fer ings of Mor mon ism to these pop u la tions. He ar gues that Mor mon ism pres ents a set of

sym bols and at ti tudes that make refer ence to a “North Amer i can and mid dle class life style”—includ ing the Book of Mormon in the way it is read—which sepa rate s Mormon ism from other non-Catho lic reli - gions. [The Mor mon’s] “luxu ri ous” churches, their sports grounds, their liberal social prac tices, their empha sis on the nu clear family, etc., every thing points to “upward social mo bil ity” anchored in the pop u lar ur ban en vi ron ment. Their prac ti cal of fer ings are com posed of a set of per sonal con tacts with bour geois strata of the city of La Paz which per mits, from time to time, ac cess to sources of jobs and some scholar ships. This is the same pro cess that is veri fied in the nu merous young peo ple who at tend this church from time to time. It deals with a re li - gious path of cul tural dif feren ti a tion from their Aymara background. . . . We can say hypo theti cally that the mid dle com fortable stra tum sees in this pair of offer ings dom i nated by their symbolic pole, a re li gious answer to their desires for social mo bil ity and a distanc ing from their poor Aymara sur round ings. We find a search for so cial cul tural dif fer - en ti a tion from the sur round ings. On the other hand, the im pov erished sec tor is ori ented by these of ferings but dom i nated by their sin gle prac - tice. In a search of al terna tives for sur vival, the most de pressed sec tors attempt to find eco nom ically in the dissi dent confes sions a “network of 206 The Journal of Mor mon His tory

mu tual as sis tance” that can re duce the weight of the crisis. 69+

This patt ern, furt her more, fits into a con text of numer ous dis- cussions and debat es about the natur e of mo der nity, rat iona l ity, knowledg e, epist emol o gy, and ont olo gy, fueled by the rela t ively re - cent and rapid spread of mass edu ca t ion due to a massiv e ind ig e nous move ment to ob tain it. An thropol o g ist Juan Ossio obser ves that, in Peru, the growth of the New Is rael offshoo t of the Sev enth-day Ad ven - tists and the Shin ing Path guer rilla movemen ts both stemmed from popu lar att empts to appr opr i ate the sym bols and hist ory of the enlight enmen t and mo der nity for their own soc ial ends.70++ The case is sim i lar for Bolivia where popu lar dis cussion struggles with these issues, in terms of an ideo log i cal com pe ti tion by nu mer ous pros e lyt ing groups—po lit i cal, ed u ca tional, pop-cul tural, and re li gious—to com- pre hend the world and art ic ulat e a strat egy in the face of its confus ing and con tra dic tory re al ity. When FAL-Zárate Willka de nounced the “gring os who come to lie to the poor and humble” in their lett er threat en ing the mayor of El Alto with death if he did not close the Mor mon chapels, they strongly connect ed their att acks on Mor mons with this situ a t ion of ideolog ica l strug gle and the role they saw Mor mons taking. This tie is strength-

+ 69Córdova, “Los Evangélicos,” 84–85. Be cause of the dif fi culty in ob - tain ing the orig ina l text in the United States I pro vide the orig ina l Span ish: “Sus templos ‘lujosos’, los ambientes deportivos, las prácticas sociales de corte lib eral, su énfasis en la fami lia nuclear , etc., todo apunta al ‘ascenso so cial’ tan anclado en el ámbito urbano-popu lar . La oferta ‘práctica’ está constituida por un conjunto de contactos personales con estratos burgueses de la ciudad de La Paz que permiten, excepcionalmente, el acceso a fuentes de trabajo y algunas becas. “Es el mismo proceso que se verifica en los numerosos jóvenes que temporalmente asisten a esta confesión. Se trata de un camino ‘religioso’ de diferenciación cul tural con su origen aymara . . . podemos decir hipo- téticamente que el estrato medio ‘acomodado’ ve en este par de ofertas dominadas por su polo simbólico, una respuesta RELIGIOSA a sus anhelos de ascenso so cial y distanciamiento de su entorno aymara y pobre. Se trata de la búsqueda de una diferenciación socio-cul tural del medio. En cambio, el sec tor pauperizado se orienta por estas ofertas, pero dominadas por su sola práctica. ++ 70Juan Ossio, Violencia estructural en el Perú, antropología (Lima, Perú: Asociación Peruana de Estudios e Investigación para la Paz, 1990). DAVID CLARK KNOWLTON/MORMONS AND GUERRILLAS 207 ened when one no tices that one of the persons charged with the mission ar ies’ as sas si nat ion, Susana Zapana Hanover, was a for mer mem - ber of the Mor mon Church. Hers was one of the early fami lies that joined in Branch VIII, the hillside vil las just above Sopocachi.71+++

W HY MORMONS SPECIFICALLY? But, why did FAL-Zárate Willka spec if ica lly choose to att ack Mor mons when there are other reli gions prose l yt ing in the same neighbor hood that have greater numbers of members? In 1992 the Boliv ian Nat ional Census calcu lat ed that some 10 per cent of the pop- u la tion was Protestant.72++++ In con trast, the LDS Church claimed only 1 per cent of the almos t 7 mil lion Boliv ians for that date.73*Some of these, such as the Assem blies of God, tended to use their asso c ia t ion with the United States as an impor tant ele ment in attr act ing con- verts74** and were also con tro versia l at the pop ular level. Nev er theless, none of them had or have as tight an asso c ia t ion with the U.S. gov ernment and other Amer ican symbol s as the Mor mons. The LDS Church, dur ing the 1970s and 1980s, un der took a mas - sive build ing pro gram that con structed rel a tively el e gant cha pels of white cinderblock with cast-brass lett er ing in most neighbor hoods. While I do not have the det ails for construc tion of chapels and their loca t ion, one index of the presence of chapels is the to tal number of con gre ga tional units per na tional pop u la tion. In 1987 there was one Mor mon unit per 50,000 Bo liv i ans—sub stan tially fewer in met ro pol i - tan La Paz. In con trast, Brazil in 1987 had one unit per 271,000 per - sons, and the rapidl y growing Ec uador had one unit per 101,941 persons. Fur ther more, if we calcu lat e that each mis sion in Bolivia had around 180 mission ar ies, then there were 360 for the to tal coun try, or

+++ 71Ethnographic sources from the for mer Branch VIII have es tab - lished this re la tion ship. ++++ 72Clifton L. Hol land, comp., “Programa Latinoamericano de Estudios Socioreligiosos” (“The Latin Amer ican Prog ram on Sociore- ligious Stud ies”) Data Base on Rel i gion in the Amer i cas, www.prolades.org (ac cessed June 24, 2002). Most Evan gel i cals, but not all, are Pen tecos t als, but the most common umbr ella term in Eng lish-lang uage scholar ship on Latin Amer ica is “Protestant.” * 73Deseret News 1993–1994 Church Al ma nac, 193. ** 74Leslie Gill, “‘Like a Veil to Cover Them’: Women and the Pen tecos - tal Move ment in La Paz,” Amer i can Eth nol o gist 17, no. 5 (1990): 708–21. 208 The Journal of Mor mon His tory one per ev ery 17,222 persons, compar ed with one per 26,867 in Ecua - dor and one per 55,556 in Colom bia. In La Paz the densit y of mission - ar ies was greater. Since most mission ar ies in the 1980s were North Amer i cans, they formed the most sig nif i cant pop u la tion of North Amer i cans work ing in these ex pand ing neigh bor hoods of mi grants. To hundr eds of thousands of Boliv ians, LDS mission ar ies are the only U.S. cit izens they have ever met. None of the other reli gious groups, even though more numer ous, had such a strong public presence in their build ings as the Mor mons, nor did they have as visi ble and numer ous a corps of for eign mission ar ies. Stev en Wright, the Boliv ian mission presi den t in the late 1980s, told me that he warned Church headq uar ters in Salt Lake City that he had more mission ar ies than places for them to work.75***Dur ing those years of eco nomic ad just ment, fol low ing the hy per-in fla tion of 1985, Bolivia was enjo ying one of the highest growth rates of any area in South Amer ica. Furt her more none of the other re li gious groups had as strong a connec t ion with upwar d soc ial mobi l ity and the clear re ject ion of Aymara iden tity, as commonl y under st ood, coupled with the asso c ia - tion with Boliv ian and for eign elites. These fact ors ind icat e the ideolog i cal and so cial pres sure that Mor mon pros e lyt ing was plac ing on these neigh bor hoods of mig rants. I ar gue, con seq uently, that these fact ors were im por tant trigg ers in FAL-Zárate Willka’s dec ision to tar- get the Mor mon Church in its ideolog ica l/po lit ica l campaig n. Such a re la tion ship forces us to re con sider our def i ni tion of pol i tics to include re li gious issues, such as those raised by the growth of Mor mon - ism in this part icu lar socia l, ideolo gi ca l, and econo mic cont ext. Al though the at tacks on the LDS Church had ended by the 1990s, it is still impor tant to under stand the ways in which the trajec - tory of the mil it ant left and that of the LDS Church in tersect ed. If nothing else, it helps us com prehend the so cial lo cat ions of the in ter - nat ional Church of Jesus Christ of Lat ter-day Saints and the dy namics of its growth. Since then, aft er a brief reg ression in growth, Mor mon - ism has con tin ued to grow strongly in this landlock ed Andean coun - try. The left has taken a dif fer ent path—that of att acking the struc- tures of neoliberalism. In creasingl y the left sets the agenda of the coun try’s futur e, includ ing the con text in which the LDS Church will exist and grow in the country.

*** 75Wright, in ter view, spring 1992. REVIEW S

Duwayne R. Ander son. Farewell to Eden: Coming to Terms with Mormon ism and Sci ence. N.p.: 1stBooks, 2003. xxx + 321 pp.; notes, “Sug gested Read - ings” at the end of each chap ter; four ap pen di ces, in dex. Pa per: $20.75; ISBN 1-4107-5384-0

Reviewed by Trent D. Stephens

There co mes a time in the life of al most all think ing per sons when they expe r ience a clash of faith and fact. The clash may come early or late, may occur of ten or seldom, and may be minor or prof ound. Unf or tu- nately, those who ex pe ri ence their first such clash rel a tively late in life and for whom the clash is pro found tend to feel com pletely iso lated and alone. It seems to be a com mon ex pe ri ence that in di vid u als en coun ter - ing such a clash bel ieve that their ex per ience is uncom mon, even unique. They oft en feel that they have no where to turn, no one in whom to con - fide, no one with whom to share a com mon ex pe ri ence. They frequen tly turn to ec cle si ast i cal lead ers, who all too of ten don’t have a clue and fur - ther have no idea where to ref er the person for help, even if they rea l ize the person ac tu ally needs help. They may turn to the Church Handbook of In struc tions, which gives di rect ions to ec cle sia st i cal lead ers on how to ob - tain pro fes sional help for le gal mat ters, psy cho log i cal prob lems, mar - riage prob lems, prob lems of abuse, and finan c ial prob lems. But no where does it of fer adv ice on what to do with a person who has an in tel lec tual prob lem. The best ad vice seems to be “from such turn away” (2 Tim. 3:5). Un for tu nately, the rejoin der that is both ac cu rate and all too of ten ap pro priat e is, “That may be easy for you to say.” As I read the chapt er, “Beg in nings,” in Duwayne R. An derson’s book, Fare well to Eden: Coming to Terms with Mor moni sm and Scie nce, my heart was bro ken. I felt so sorry for the not un com mon plight of this young in tel lec tual who wanted so des per ately to know the truth. He de - scribed his all too fami l iar life of growing up in a fami ly where the truth, though ide al ized and given lip ser vice, was all too of ten shunned or

209 210 The Journal of Mor mon His tory moved into the shado ws of “things we don’t talk about.” Such fami lies of- ten have a way ward, in tel lec tual, black sheep, such as Duwayne’s Un cle Marlo, who has a Ph.D. in geol ogy and who seldom comes up in conv er- sat ion, and then only as one who is lost from the fold. Ander son states, “My life had been planned for me” (xiv): mis sion, mar riage, BYU. It was aft er gradu at ing from BYU that he “dec ided, for the first time, to read the Bi ble from cover to cover. This was one of the most disturb ing expe r iences in my life, for the Old Test a ment is a book filled with the most un imag inable in human ity and vio lent crime I could have an tic ipat ed” (xvi). He then goes on to desc ribe a small por tion of the “cru elty and de bauch ery” out lined in, for ex am ple, Num bers 31. I must con fess that I was a bit star tled at An derson’s ob vi ous shock. I know that people can grow up in in tel lec tual iso la tion, and I admit to not paying a lot of att en tion to the people around me (my wife reminds me of this de fect in my person al ity quite reg u larly), but how can an in tel - li gent per son grow up, go to school, and serve a mis sion witho ut ever read ing Num bers 31, along with the rest of the Bi ble? The next step in An derson’s saga, un for tu nately, was not sur pris ing to me. Ander son made an appoin tmen t with his bishop. “The discus sion with the bishop was very trou bling.” The bishop was no help at all. Fur - ther more, “the stake pres i dent repeated the bishop’s an swer.” An derson “withdr ew in men tal agon y” as he imag ined the bloody atroc it ies commit ted by the Is ra el ites. He stated, “For the first time in my life. I was drawing to [sic] the conclu sion that my eccle sia st i cal lead ers were unable to deal with a se ri ous ques tion. They seemed to tally blindsided by the is - sues, as if they had eit her never read the Old Test a ment or had never put any thought into it” (xviii). I wish that ev ery leader in the Church would read at least this chap ter of Fare well to Eden. This prob lem is real, it ser i - ously af fects the lives of thousands of peo ple, and it is n’t go ing to go away by being ig nored. Unable to find someone with whom to have a rea sonable, in tel li- gent con ver sa tion about his con cerns, Duwayne An der son, fol low ing an all-too-com mon path, drifted away from the Church. His connec t ions to the Church, how ever, also fol lowing a com mon and pred ict able path, re - mained. He ex plored websites where other dis af fected in tel lec tu als dis - cussed Church mat ters and of ten vented their frustr a tion. He read some of the common stock of “anti-Mor mon” liter atur e. This liter atur e not only ad dressed the hist ory of the Mor mon-sci ence in ter face but the hist o - ric ity of the Church it self. For ex am ple, An derson stated, “The most im - me di ate thing I learned from Brodie [No Man Knows My His tory] were the many det ails about Joseph Smith and church his tory that the church ig nored, glossed over, or den ied” (xxii). The more he read the more alien ated from the Church he felt. Ev - ery other in tel lec tual with whom he in ter acted seemed to have had the same ex pe ri ence. He came to rea l ize that his ex pe ri ence was not unique and con cluded that “many others like us” (any think ing per son) would ul - REVIEWS 211

ti mately fol low the same path. The only people who remained ac tive mem bers of the Church must be ei ther id i ots or li ars. An derson con - cluded: “For the skep ti cal and sci en tific, the ev i dence is clear, and the jury has reached its ver dict; [as an ex am ple] the Book of Mor mon is a prod uct of a 19th cen tury au thor . . .” (286) Theref ore, any one who still be lieves in the Book of Mor mon and, by ext en sion, in the Church of Je - sus Christ of Lat ter-day Saints is not skep ti cal and is con se quently unsc i - en tific. That is not an uncom mon con clu sion for one who has taken the path that An der son has fol lowed. The bulk of Fare well to Eden is also, un for tu nately quite pred ict able. The first chapt ers deal with the dif fer ences be tween sci ence and Mor - mon ism, as ex pressed pri mar ily by the lead ers of the Church, who are, for the most part, un trained in the sci ences. Chap ter 1, “What Is Mor - mon ism?” pro vides a twenty-six-page thumbnai l sketch of Mor mon his - tory with an empha sis on “the uncom pro mising requ iremen t within the LDS Church of accept ing and fol lowing the teachings of the church’s proph ets and lead ers” (8). An derson in cludes a four teen-point list of “Funda men tals in Fol lowing the Prophet,” by El der Ezra Taft Benson in 1980 (10). He also quotes from Pres i dent Thomas S. Monson: “Remem - ber that faith and doubt canno t exist in the same mind at the same time. My faith did not come to me through sci ence, and I will not per mit so-called science to destr oy it” (20). The remain ing chapt ers cover issues of complex it y, cosmol ogy, geol ogy, biol ogy, and the Book of Mormon. Most of what is presen ted there is not par tic ularly new or unique. Most of the book seems to be di rected to ward the un in formed, whether inside or out of the church. The absence of a bibl iog raphy is a major flaw in this book. The list of “Sug gested Read ings” at the end of each chap ter looks more like high school read ing as sign ments than se ri ous ref er ences ad dress ing the meat of the sub ject. The pau city of ref er ences to recen t, respon si ble works on the topic of sci ence and Mor mon ism is par tic ularly con spic u ous. One chap ter is rather unique, how ever, aside from the extr emely valuable aut o bio graphi ca l ma ter ial in the book. That is Chapt er 8, “Sta - tis tics Re lat ing Mor mon ism and Sci ence.” An der son quotes from the En- cyclo pe di a of Mormon i sm, which states, “A 1940 study est ab lished that Utah led all other states in the num ber of sci en tific men born there in pro por - tion to the pop u la tion (Thorndike, pp. 138-39)” (295). Un for tu nately, as Richar d Woott on states in his Saints and Sci enti sts (Mesa, Ariz.: EduTech, 1992), “The 1992 En cy clo pe dia of Mor mon ism publ ished by Macmillan was un aware of it [Woot ton’s 1956 dis ser ta tion] as a ref er ence for sci ence and Mor mon ism.” It’s also un for tunate that An derson is un aware of Woott on’s 1955 and 1990 stud ies. Most members of the Church ap pear equally una ware of this chapt er in Mor mon his tory. The ba sis for Woott on’s resear ch was the 1949 edi tion of Amer i can Men of Sci ence and the 1990 (17th) edi tion of Amer i can Men and Women of Sci ence. These books pro vide the premier 212 The Journal of Mor mon His tory list ings and bi og ra phies of U.S. sci en tists with advanced de grees. Woot- ton’s study found that Utah (at 1,886 per mil lion, 32 per cent above the sec ond place state) led the na tion, with Idaho (at 1,421 per mil lion) as sec ond, in the num ber of sci en tists listed in the 1949 edi tion per mil lion of the 1900 white pop u la tion, which was matched for the av er age age of those listed in Amer i can Men of Sci ence. Again, in the 1990 edi tion of Amer i can Men and Women of Sci ence, Woott on found that Utah (at 1,658 per mil lion, 21 per cent above the sec ond-place state, Del a ware) led the nat ion by state of per capit a birth of those listed in rela tion to the white pop ula tion of 1950 (Idaho had dropped to sixth). In con trast, An derson chose the SESTAT study con ducted by the Na tional Sci ence Foun da tion, which in cludes sci en tists and en gi neers with bach elors’ deg rees or greater. This study looked at the birth state of sci en tists and en gi neers nor mal ized to the num ber born in the state who have a col lege deg ree. An derson also nor mal ized his data to 2000 cen sus data rather than nor mal izing them to birth data from fifty years in the past. Woott on used the fifty-year-old data be cause they matched the av er - age age of those listed in Amer i can Men and Women of Sci ence, thus com - par ing the birth data of sci en tists with the popu la tion at the time they were born. An derson, by using 2000 cen sus data, does not seem to rea l - ize that new borns don’t do a lot of sci ence. It is also un for tu nate that An derson is not aware of Woot ton’s stud - ies for other rea sons. An derson says that when he receiv es a sur vey form, he sim ply tosses it into the trash. Most of us do the same. In deed, sur - veys with a 15 per cent retur n are thought to be suc cess ful. In that reg ard, Woot ton’s responses are remar kable: 63 per cent response to his 1955 sur vey and 65 per cent to his 1992 sur vey. In his Chap ter 5, An derson arg ues that there is a big dif fer ence be - tween the age of the earth as rep resen ted in the scrip tures and in sci - ence. Woot ton stated in Saints and Sci enti sts that “no geol og ists [in his sur vey] . . . came in against the ‘hundr eds of mil lions of years’” when asked about the age of the earth. In Chap ter 6, An derson pointed out that the scriptur es are not in agreemen t with the bio log ica l data con - cern ing evo lu tion. Woott on found in his study that, “While most Utah bi - ol og ists are Strong Mor mons, we found none who be lieved in Spe cial Creat ion as against evo lu tion.” Woott on’s sur vey def ined Strong Mor - mon as “Mor mons who responded to the ques tionnair e that they have conv ict ions that are eit her Strong or Very Strong that Joseph Smith was inspir ed by God in the for ma tion of the Mor mon Church [81 per cent of the LDS sci en tists in the 1992 sur vey listed them selves as Very Strong and an ad di tional 4 per cent listed them selves as Strong].” In An derson’s “Fi nal Thoughts,” he states, “It should be clear by now that many key doc trines of the Church of Je sus Christ of Lat ter-day Saints are in con sist ent with sci ence. . . . It’s dif fi cult to see how any church could have its foun da tional ma ter ial at more odds with what we know from sci ence” (311). An derson ap par ently sees sci en tists as in vin ci - REVIEWS 213

ble, un bi ased har vest ers of knowl edge wield ing Occam’s ra zor to cut through the chaff and iden tify in fal li ble ker nels of truth. Un for tu nately, natur e, human his tory, and theol ogy are all much more compl icat ed than that. Not only are there data to ob tain and sift but there is the much larger issue of the in ter pret a tion of those data. Occam’s ra zor falls short all too frequen tly. As a result, there is a lot of room for faithful sci - en tists who do not have to be id io ts or liars to recon cile their faith with their scien t ific expe ri ence. An derson states, “So aw ful are the pros pects of such treat ment [be - ing branded as apost ates and being cast out] at the hands of friends, fami ly, and asso ci ates that many in tel lec tua ls within the church simply can not bear to face the tri als” (316). I to tally agree with An derson’s per - cept ion. What a trag edy when this occurs—a s it does all too of ten. “Not sur prisingl y, many members choose to keep quiet and main tain out ward appear ances rather than risk the pain and ang uish of the church’s wrath and the feel ing they have be trayed and lost their fam i lies” (318). I agree com pletely with this as sess ment as well, but I also know that there are many of us who are not afraid to speak up for what we bel ieve to be true, both in sci ence and rel ig ion. I ap plaud Duwayne Ander son for his ef - forts. What is truly unf or tunate , and what is brought into sharp fo cus by Fare well to Eden is that un inf ormed bishops and stake presi dents don’t have access to a list of sci en tists who are strong, act ive members of the Church when they enco un ter a young per son who dis cov ers one or more of these ap par ent con f licts be tween sci ence and rel i gion. If young peo - ple (or older peo ple, for that mat ter), could be di rected to a mem ber of the Church who is an ac tive, pro duc tive sci en tist, they could at least be as sured that they are not alone in their quest for an swers, that many, many peo ple have taken the same path when con fronted for the first time with a clash bet ween faith and fact, and that there are paths that lead to recon cil ia tion rather than to despair and alienat ion.

TRENT D. STEPHENS {[email protected]} is a prof essor of anat omy and em bry ol ogy in the De part ment of Bi o log i cal Sci ences, Idaho State Uni ver sity, and bishop of Pocatello Univ ersit y Eight eenth Ward.

Wil liam E. Evenson and Duane E. Jeffery. Mor mon ism and Evo lu tion: The Au thor i ta tive State ments. Salt Lake City: Greg Kofford Books, 2005. i-iv, + 122 pp., 6 pho to graphs, in dex. Pa per: $15.95; ISBN 1-58958-093-1

Reviewed by D. Jeffrey Meldrum

In a time when repeat ed legislations and judications over the impo sit ion of in tel lig ent desig n in high school sci ence classr ooms cap ture news 214 The Journal of Mor mon His tory head lines and when an i mated ex changes be tween “evo lu tion ists” and “anti-evo lu tion ists” oc cupy the ed i to rial pages of lo cal pa pers, a sur pris - ing number of Lat ter-day Saints are essen tially ig no rant of the Church’s of fi cial po si tion on the funda men tal mat ters at is sue. This lack of in for - ma tion ap plies even to rea son ably inf ormed LDS col lege stu dents ma jor - ing in the bi o log i cal sci ences. I am a pro fessor of anat omy and an thro pol ogy in the De part ment of Bi o log i cal Sci ences at Idaho State Uni versit y, a campus that hosts a major ity of LDS studen ts. I teach two sect ions of or ganic evolu t ion, taken by sen iors major ing in our depart ment. I appr aise my studen ts’ knowl edge of and at ti tudes to ward evo lu tion with a gener ic pre-assess - ment ques tion naire and an ini tial writ ing assig n ment; the result s show how litt le the typi ca l LDS studen t under stands the doctr inal po sit ion of the Church on mat ters relat ing to the physi cal or i gins of the earth and its inhab it ants. They frequ ently ap peal to their upbr ing ing in a Mor mon fam ily as jus ti fi ca tion for their in cli na tions to ward a ba si cally fun da men - tal ist young-earth creationism posi t ion, one that is dec idedl y anti-evo lu - tion. Most of these studen ts are quite sur prised to learn that the LDS Church is one of a num ber of Christ ian and non-Christ ian de nom i na - tions that has no of fi cial po sit ion con cern ing God’s mo dus ope randi in prepar ing the earth as a tempo r al abode for the human fami ly, or in pro - vid ing physi cal ta ber na cles for the first of his spirit chil dren to take up res i dence here. Based on my own chil dren’s ed u ca tional ex pe ri ences, it is clear that ano ther po ten tial source of div erse and oft en con tra dict ory inf or ma tion is the semi nar y classr oom and, to a lesser deg ree, Insti tute of Re li gion classes. Given this some times con fused state of af fairs, Mor mon ism and Evo - lu tion pro vides a very useful and ac ces si ble ref er ence to the sur pris ingly lim ited au thor i ta tive statemen ts by the LDS First Pres i dency on this sub - ject. Evenson and Jeffery clearly spell out, in both the preface and an afterword, the crit er ia met by docu men ts included in this handy booklet. The core of these ma ter i als con sti tutes what has come to be called the “BYU packet.” Readers of the Jour nal of Mor mon Histor y will be in ter ested in these statemen ts, even if the creationism/evo lu tion de bate is not of press ing per sonal in ter est to them, if only because these doc u ments trace a thread that gives a fasc inat ing glimpse into one aspect of Mor mon in - tel lec tual hist ory reaching back al most a cen tury. Wil liam Evenson is an ad min istr a tor and physics pro fessor at Utah Val ley State Col lege, where he moved in 2004 upon ret ir ing from Brigham Young Uni versit y. Dur ing his thirty-four years at BYU, Evenson was a pro fessor of physics, dean of Gen eral Ed uca tion, dean of Phys i cal and Math e mat i cal Sci ences, and as so ci ate ac a demic vice pres i dent. Duane E. Jeffery is a pro fessor of in teg rat ive biol ogy at Brigham Young Uni ver sity. He has pub lished pro fes sion ally in var i ous bi o log i cal jour nals and on matt ers of Mor mon ism and sci ence in Mor mon per iod ica ls. He REVIEWS 215

has receiv ed numer ous teach ing awards at BYU and serves as a mem ber of the Board of Di rec tors of the Na tional Cen ter for Sci ence Ed uca tion. As Evenson ex plains in the in tro duc tion, he and Jeffery assem bled the “BYU packet” in response to the per en nial and large vol ume of stu- dent ques tions on the sub ject. Be cause Evenson had authored “Evo lu - tion,” for the En cy clo pe dia of Mor mon ism, 4 vols. (New York: Macmillan, 1992, pp. 1,669–70), BYU Pro vost Bruce Hafen di rected him in 1992 to assem ble a packet of mat er ia ls that could be made avail able to stu dents and that would rep resen t the “of fi cial Church po si tion” on the sub ject. This packet con tained a cover lett er appr oved by the BYU Board of Trust ees, dated June 1992, and au tho rized for distr i bu tion with the packet, the 1909 First Pres i dency statemen t en ti tled, “The Or i gin of Man,” a brief ex cerpt on the topic of hu man or i gins from the 1910 First Pres i dency Christ mas mes sage, the 1925 state ment en ti tled, “‘Mor mon’ View of Evo lu tion,” and Evenson’s En cy clo pe dia of Mor mon ism ar ti cle, because it con tained au tho rized ex cerpts of the 1931 First Pres i dency min- utes not other wise avail able to the pub lic. The other selec tions in Mor mon ism and Evo lu tion con sist of an appen dix that adds a se ries of twelve (la beled A-L) “other aut hor i ta tive statemen ts,” which are doc umen ts pro duced un der the First Presi dency’s spon sor ship, statemen ts pub lished by the Presi dent of the Church over his sig natur e alone, or docu men ts appr oved for publ ica tion by the First Presi denc y as a body. Evenson stresses that in both the prep a ra tion of the BYU packet and the inclu sion of the appen d ix items, he and his co-ed i tor made no att empt to achieve a “bal ance” in pro- and anti-evo lut ion statemen ts. In- stead, these of fic ial views are in tended to “pro vide the ba sis for eval uat - ing other expr es sions that are not them selves au thor i ta tive” (p. 3). No less sig nif ican t than drawing these se lected docu men ts to gether un der one con ven ient cover is the added per spec tive sup plied by the brief in tro duc tion pre ced ing each doc u ment that es tab lishes its his tor i cal and doc trinal con text. The great est con trib u tor to these in tro duc tions was Jeffery, whose foun da tional ar ti cle “Seers, Sa vants, and Evo lu tion: The Un com fort able In ter face” (Dia log ue: A Jour nal of Mor mon Thought 8 [Fall/Win ter 1973]: 41-69) is es sen tial read ing for any one in ter ested in the hist ory of the Church’s po si tion rel a tive to evo lu tion. The eccle sia st ica l hist ory of many LDS doctr ines goes for the most part un ap prec iat ed by the Church member ship at large, its dev el op ment over time of ten un remar ked. How ever, rev ela tion does not oc cur in a vac - uum. Di rec tion and clar i fi ca tion of ten come in di rect re sponse to his tor i - cal and so cial cir cumstances of the times. For exam ple, the First Presi - dency is sued its 1909 statemen t in the year marking the hun dredth an ni - versar y of Charles Dar win’s birth and the fift iet h ann iv ersar y of the pub li ca tion of his Or i gin of Spe cies. This statemen t was drafted by a commit tee of Gen eral Au thor i ties in 1908, in an tic i pa tion of the events and dis cus sion that would ac com pany these cel e brated an ni ver sa ries. Its fi nal 216 The Journal of Mor mon His tory version was ap proved by the First Presi dency under Joseph F. Smith. The prin ci pal points of this statemen t may be char ac ter ized by the fol lowing ex cerpts: God cre ated man in his own im age. . . . All men and women are in the si - mil i tude of the uni ver sal Fa ther and Mother, and are liter ally the sons and daughter s of De ity. (20) The cre ation was two-fold–firstly spir i tual, sec ondly tem po ral. (17) The spirit of man is in the form of man. (20) Adam was the first man of all men . . . and the pri mal par ent of our race. (23) True it is that the body of man en ters its ca reer as a tiny germ or em bryo, which be comes an in fant, quick ened at a cer tain stage by the spirit whose ta ber na cle it is, and the child, af ter be ing born de vel ops into a man. There is nothing in this, how ever, to in dicate that the origi nal man, the first of our race, began life as anything less than a man, or less than the hu man germ or em bryo that be comes a man . . . The Church of Je sus Christ of Lat ter-day Saints, bas ing its be lief on di vine rev ela tion, an cient and mod - ern, proclaims man to be the di rect and lin eal off spring of Deity. (23–24) As an other exam ple of his tor i cal con text, the 1925 statemen t came in response to press in quir ies stem ming from the pub lic spec ta cle of the fa mous Scope’s trial. Rather than reis sue the exist ing 1909 statemen t, the First Presi denc y under Heber J. Grant relea sed a dramat ica lly abridged version, omit ting all statemen ts that have been con strued by some to be anti-evo lu tion in sen ti ment and that seem to dis miss evo lu tion as merely the “theo ries of men.” In stead, the 1925 statemen t fo cused on human - kind’s spir i tual or i gin and on Mor mon ism’s dis tinc tive as ser tion of the lit eral div ine par ent age of our spir its: “The doctr ine of pre-exis t ence pours [a] won der ful f lood of light upon the other wise myst er i ous prob - lem of man’s or ig in. It shows that man, as a spirit, was beg ott en and born of heav enly par ents” (32, em pha sis mine). Am bi gu ities in the earl ier 1909 statemen t con cern ing the man ner in which the phys i cal body orig i nated were per ceived then, as they are to - day, by many who read the en tire statemen t. It seems ap par ent that the au tho rized mes sage to priest hood quo rums that fol lowed in 1910 came in response to ques tions stem ming from those am bi gu ities and was an at - tempt to ad dress the quer ies by ac knowl edg ing three pos si ble means for the phys i cal cre ation of the hu man ta ber na cle, but lend ing af fir ma tion to none of them (Appen d ix A). One of these ack nowledg ed possi bi l it ies is of par tic u lar in ter est: “Whether the mor tal bod ies of man evolved in nat u ral pro cesses to pres ent per fec tion, through the di rec tion and power of God . . . are ques tions not fully answ ered in the rev ealed word of God” (44). The prov enance of the en try on evo lu tion in the En cy clo pe dia of Mor mon ism is par tic u larly in ter est ing as it re flects the po si tion adopted REVIEWS 217

by the cur rent pres i dent of the Church, Gordon B. Hinckley. The orig i - nal draft for the ar ticle pro gressiv ely expanded with ad dit ions recom - mended by the as so ci ate ed i tor of the En cy clo pe dia and by adv isors from among the Quo rum of the Twelve, ref lect ing the range of opin ions voiced by var i ous breth ren through out Church hist ory. Un der Pres i dent Hinckley’s lead ership, how ever, the ar ti cle was con densed to the brief state ment now compr ising the first half of the fina l ar ticle, combined with the excer pt from the of fic ial First Presi denc y min utes. It was de- cided to reit er ate that at pres ent no greater res o lu tion ex ists be yond that ind icat ed by the con tents of the BYU packet and that ult imat ely the mat- ter falls be yond the pur view of their ap ost olic call ing and mission—in short, “Leave ge ol ogy, bi ol ogy, ar che ol ogy, and an thro pol ogy, no one of which has to do with the salva tion of the souls of mankind, to scien tific resear ch, while we mag nify our call ing in the realm of the Church . . . ” (38). In deed, when Trent Stephens and I were writ ing our book1* and sought a clar if ica tion of the Church’s posi t ion on this matt er from the Of fice of the First Pres i dency, the an swer we receiv ed in early 1995, via our mu tual stake pres i dent, in cluded an ex cerpt from Evenson’s con cise en cy clo pe dia ar ti cle and the com plete 1909 First Pres i dency state ment. An other valu able doc u ment in Mor mon ism and Evo lu tion is the full text of the 1931 seven-page memo ref erred to as the “First Presi dency Min utes” excer pted in the En cy clo pe dia of Mor mon ism ar ti cle. Pub lished in full, it est ab lishes the con text of those ex cerpts and adds per spec tive on the dy nam ics of the discus sion and the div ersit y of persona l opin ions held by the Gen eral Au thor i ties on these mat ters, at that time and also at pres ent. When con sid er ing the con text of any of these early statemen ts, one should also be aware of the sci en tific par a digms which then pre- vailed—most of which have also un derg one rev i sion and de vel op ment over time. The early decades of the twen ti eth cen tury saw con sid er able dis cus sion and de bate within the sci en tific com mu nity over par tic u lars of the pro cesses of evo lu tion. The mod ern evo lu tion ary syn the sis now gen - er ally accepted emerged out of that de bate in light of new data. Recen t ad vances in the many sci en tific disc ipl ines in which evo lu tion remains the uni fying prin ci ple should also be weighed and con sid ered. The suc - ces sive re fine ment of the sci en tific un der stand ing of these pro cesses should not be con strued to in di cate that evo lu tion is “just an other theory” in the col lo quial sense that is likely to be replaced by an other par a - digm, as some pro po nents of in tel li gent desig n have tried to arg ue. (See Stephens and Meldrum, Evo lu tion and Mor mon ism.) In that the aut hors’ stated goal was to make these brief aut hor it a -

1 * Trent D. Stephens and D. Jeffrey Meldrum, Evo lu tion and Mor mon ism: A Quest for Under stand ing (Salt Lake City: Sig natur e Books, 2001). 218 The Journal of Mor mon His tory tive statemen ts acces si ble in a “more readily avail able con text and for - mat,” they have suc ceeded. That some will be dis ap pointed to find the prono uncemen ts of their fav orit e aut horit y omitted is una voidabl e unt il the mem ber ship rec og nizes, as the BYU Board of Trust ees clar i fies, that “for mal statemen ts by the First Pres i dency are the de fin i tive source of of - fi cial Church posi t ions” (p. 2).

D. JEFFREY MELDRUM {[email protected]} is an asso c i ate prof essor of anat - omy and an thro pol ogy at Idaho State Uni ver sity. Re cently re leased from a seven-year stint as Scout mast er, he is now ward clerk.

Kyle R. Walker, ed. United by Faith: The Jo seph Sr. and Lucy Mack Smith Fam ily. Amer i can Fork, Utah: Cov e nant Com mu ni ca tions, 2005. v, 436 pp. Pho to graphs, notes, name in dex. Cloth: $24.95, ISBN 1-59156-998-2

Reviewed by Su san Easton Black

Kyle Walker is to be con grat ulated for bring ing to gether in one vol ume life sketches of ten members of the Joseph Smith Sr. fami ly. Al though Walker could have tack led the writ ing alone, hav ing writt en a doct oral disser tat ion on the fami ly dy namics of the Smiths,1** he chose in stead to bring ac claimed his to ri ans, well-known Smith de scen dants, an ad min is- trat or from Brigham Young Univ ersit y-Idaho, and a strong writer from the Church Ed u ca tional Syst em to gether to as sist him. In so do ing, they created a reso urce to better under stand the sup port ive na ture of the Smith fami ly in the Rest o ra tion pro cess, which con trasts with Dan Vogel’s depic t ion of a dysfunc t ional fam ily.2*** With this said, readers may find the tit le of the book prob lem atic. It sug gests that all members of the Joseph Sr. and Lucy Mack Smith family have place within its cov ers. Bur ied in the three-page preface is the disclaimer , “The vol ume is ded icat ed exclu sively to the Smith fami ly who sup ported Jo seph Smith; hence, the reader will note the ab sence of a chap ter on Jo seph (iv).” The ed i tor rea sons, “There has been ex ten sive pub li ca tion doc u ment ing the life of Jo seph Smith, and the reader is re - ferred to those vol umes for in for ma tion on him” (iv). Thus, by de sign the book omits a bio graphi cal sketch of the Prophet Joseph, the very person who united the fam ily in one faith. I, for one, would have ap prec i -

1 ** Kyle R. Walker, “The Jo seph Sr. and Lucy Mack Smith Fam ily: A Fam ily Pro- cess Anal ysis of a Ninet eenth-Cen tury Household,” (Ph.D. diss., Brigham Young Uni ver sity, 2001). 2 *** Dan Vogel, Joseph Smith: The Making of a Prophet (Salt Lake City: Sig na ture Book, 2004). REVIEWS 219

ated a con clud ing chap ter ana lyzing how and why the life expe ri ences of the Smith fami ly united them in faith. I would have also ap prec i ated a bib li og ra phy. Nev er the less, read ers will dis cover that United by Faith is a con tri bu tion to our un der stand ing of Mor mon ism’s “First Fam ily.” Each of the ten chapt ers con tains a bio graphi ca l sketch of one member of the Smith fami ly—Fat her Smith, Mother Smith, Alvin, Hyrum, Sophronia, Sam uel, Wil liam, Kathar ine, Don Carlos, and Lucy. The chap ters be gin with a brief but in ter est ing ep i sode from the fi nal mo ments in that par ticu lar fami ly member’s life. Then fol lows a chro no- log ica l nar rat ive that highl ights sig nif ican t benchmarks in that life. Un- for tu nately, benchmarks are rep et i tious. Whether writ ing of the ep i- demic in Leba non, New Hamp shire, that led to the crip pling of young Jo seph, Mother Smith giv ing birth to a child, crop fail ure in Norwich, Ver mont, the pur chase of a farm in Pal myra, New York, young Jo seph’s First Vision, Moroni’s vis its, the found ing of the Church, or the mar tyr - dom, not ing such events in more than one chap ter creates rep et i tion. In - clud ing these ep i sodes is cu ri ous since Jo seph’s fa ther and his sib lings wrote prec ious lit tle about key sub jects per tain ing to his life. When fam - ily members did write, it was mostly of their own ex pe ri ences. The au - thors took lit er ary li cense in fill ing the biog raphi cal void, but not al ways success ful ly. Con tribu t ors Dean Jarman and Kyle Walker admit, “Sam uel [Smith]’s early life is known only through the gener al his tory of the Smith fami ly” (206). Walker has a lead ing, if not dom inan t, role in authoring. Four of the chapt ers, in clud ing the long est, a sixty-page sketch of Wil liam Smith, were penned by him. Com ple ment ing Walker’s writ ings are those of vet - eran his to rians. For exam ple, Lavina Field ing Ander son shares her insights into the life of Lucy Mack Smith;3**** Rich ard Lloyd An derson dis - cusses new dis cov er ies about Alvin Smith; and Ron ald K. Esplin ad - dresses the overlook ed con tri bu tions of Hyrum Smith. From these rec og nized schol ars, read ers learn about the prom i nent pub lic role that Mother Smith played in Nauvoo aft er the tragic deaths of her sons Jo - seph and Hyrum (69), the impor tance of Alvin’s earn ings and how they helped to pur chase the Pal myra farm (89), and the persona l rela tion ship be tween Hyrum and his sec ond wife, Mary Field ing Smith, through cor - respon dence from Lib erty Jail (138). Well-known Smith descen dan ts Mark L. McConkie and Gracia N. Jones write on Joseph Smith Sr.4+ and Sophronia Smith McCleary respec - tively. Per haps in def er ence to their pro gen i tors, his tor i cal as sump tions in their writ ings should be overlook ed, such as, “Through the role of Pa -

3 **** See also Lavina Field ing Ander son, Lucy’s Book: A Criti cal Edition of Lucy Mack Smith’s Famil y Memoi r (Salt Lake City: Sig natur e Books, 2001). 4 + See also Mark L. McConkie, The Father of the Prophet: Sto ries and In sights from the Life of Jo seph Smith, Sr. (Salt Lake City: Bookcraft, 1993). 220 The Journal of Mor mon His tory tri arch, Fa ther Smith dev el oped an in creased sensi t iv ity to the feel ings of others, a sensi t iv ity which seemed to in crease the Saints’ af fect ion for him and con cur rently enhanced their abil ity to ex er cise faith in his presence” (18). Fail ure to cite a source for this con clu sion leaves me un con - vinced. The same could be said of un doc umen ted feel ings at trib uted to Sophronia: “For Sophronia, leav ing her many rel a tives was painful, since she was old enough to rea l ize she might be saying good bye to her be - loved grand par ents for the last time” (167). The af fec tion ate, in ter pret a - tive na ture of these chap ters is more hon or ific and eu lo giz ing than other sketches of the Smiths. As is to be expect ed in any compi la tion, the writ ing is unev en, but Walker’s authored es says keep pace with the more rec og nized schol ars. Where his pace slows is his too-frequen t rel i ance upon sec ond ary sources. In so doing, he misses hist or i cal tid bits that would spice up a chap ter or two. For ex am ple, when writ ing of the funer al of Don Carlos Smith, readers may have found it amusing if Walker had included John C. Bennett’s call ing the Nauvoo Leg ion to arms to prick with their bay o - nets women sit ting in the wrong chairs.5++ For au thors who do not rely heavily on the readily acces si ble sec - ond ary sources, con f licts arise, sug gest ing that hist ory is only as sup port - ive as its sources. Scholars Richar d Ander son and Ron ald Esplin pit them selves against each other when writ ing of young Jo seph con tract ing typh us fev er, caused by the bac il lus Rick ett sia prowazekii, or ty phoid, caused by Sal mo nella typhi bact er ia. Readers won der which is cor rect (86, 124). Con cerns over ac cu racy of de tails sub side when read ing chap - ters on the ne glected sist ers of Jo seph since those are filled with refr eshing, litt le-known bio graphi ca l de tails. Yet each is dis turbing in a pecu l iar way. Con cern shifts from ac cu racy to ques tions about the causes of their pov erty, suf fer ing, and per se cu tion long af ter the mar tyr dom of Jo seph. Read ers will won der why the sist ers were not better cared for nor lon ger remem bered. How ever, the book is worthwhi le for these chap ters alone.

SU SAN EASTON BLACK (su [email protected]), a prof essor of Church hist ory and doctr ine at Brigham Young Univ ersit y, co-ed ited with Andr ew C. Skin ner Jo seph: Ex plor ing the Life and Mini str y of the Prophet (Salt Lake City: Deseret Book, 2005).

Devery S. An der son and Gary James Bergera, eds. Jo seph Smith’s Quorum of the Anointed, 1842-1845: A Doc u men tary His tory. Fore word by Todd

5 ++ John C. Bennett court mar tial, Manusc ript Docu men t File, Nauvoo Le gion, 1842, Ar chives, Fami ly and Church Hist ory De part ment, Church of Jesus Christ of Lat ter-day Saints, Salt Lake City. REVIEWS 221

Compton. Salt Lake City: Sig na ture Books, 2005. A Smith-Pettit Foun da - tion Book. ix + 265 pages. Foreword, intro duc tion, appen dix, abbre vi a - tions, bi og ra phies, in dex. Cloth: $39.95; ISBN 1-56085-186-4

Devery S. Ander son and Gary James Bergera, eds. The Nauvoo Endow - ment Com pa nies, 1845-1846: A Doc u men tary His tory. Fore word by Rich ard S. Van Wagoner . Salt Lake City: Sig na ture Books, 2005. A Smith-Pettit Foun da tion Book. ix + 648 pages. Fore word, in tro duc tion, ap pen di ces, ab bre vi a tions, in dex. Cloth: $39.95; ISBN 1-56085-187-2

Reviewed by Roger D. Launius

One of the most sig nif i cant be liefs about Mor mon Nauvoo is that it is where Joseph Smith complet ed his work of res tor at ion. Among the Mor - mons, a pow er ful in ter pre ta tion is that Jo seph Smith is sig nif i cant not just for his life but for his rel i gious in no va tions. As Ron ald K. Esplin com mented in an in sight ful es say about Nauvoo, “Nauvoo was, and is, and will be impor tant to Latt er-day Saints because it was the City of Jo - seph. It was the city he built, where he lived and acted, where he died. Above all, it was the city where he ful filled his rel i gious mis sion. . . . In a very real sense, his other la bors were pro logue.”1+++ Nothing was more sig - nif i cant to this achieve ment than the re li gious in no va tions he in cor po - rated into the rel i gion. These two books, both ed ited by Devery S. An - derson and Gary James Bergera, doc u ment in ex cru ci at ing de tail the ef - forts of Smith and his inner cir cle to est ab lish the prac tice of the Mor mon temple en dowmen t. As doc u men tary recor ds that range far in repr o duc ing pri mary source ma ter ial on the sub ject, both works are of excep t ional value. They open a windo w into the eso teric prac tices that emerged in Nauvoo in the 1840s and found their place in some strains of Mor mon ism fol lowing the death of the found ing prophet. Jo seph Smith’s Quor um of the Anointed deals with the de vel op ment of the rit u als that took place in the up per room of Jo seph Smith’s Red Brick Store beg inn ing in 1842, por tions of which were acc iden tally witnessed by some in the city. For in stance, Ebenezer Rob in son, who later em braced the Reor g a nized Church and later still de parted from it, for exam ple, desc ribed walking inno cently into the upper room only to see “John Taylor , one of the twelve Apost les, in a long white gar ment, with a white turban on his head, and drawn sword in his hand, ev i dently repr e- sent ing the ‘cherubims and f lam ing sword which was placed at the east of the gar den of Eden, to guard the tree of life’” (p. 79). Rob in son was not part of Jo seph Smith’s inner cir cle and did not par tic ipat e in these

1 +++ Rona ld K. Esplin, “The Sig nif icance of Nauvoo for Lat ter-day Saints,” Jour - nal of Mor mon His tory 16 (1990): 72. 222 The Journal of Mor mon His tory cer emo nies. Like others who be came part of the Reor g a nized Church, he was repulsed by them. Not so many others—who em braced the en dowmen t as Jo seph Smith taught them, even as it evolved dur ing the last cou ple of years of the Prophet’s life. As George A. Smith reca lled in 1874: He [Jo seph Smith] stated that the Twelve were then in structed to ad min is - ter in the or di nances of the Gos pel for the dead, be gin ning with bap tism and the lay ing on of hands. This work was at once com menced. It soon be - came ap par ent that some had long re cords of their dead, for whom they wished to ad min is ter. This was seen to be but the be gin ning of an im - mense work, and that to ad min is ter all the or di nances of the Gos pel to the hosts of the dead was no light task. The Twelve asked Jo seph if there could not be some shorter method of ad min is tering for so many. Jo seph in ef - fect replied—“Th e laws of the Lord are im mu table, we must act in per fect com pli ance with what is re vealed to us. We need not expect to do this vast work for the dead in a short time. I expect it will take at least a thou sand years.” (38) These ideas an chor the faith of the Lat ter-day Saints to this day. This work does a fine job of doc umen t ing through primar y sources how the ideas emerged in Nauvoo. Ar ranged chro no log i cally, var i ous sources are con nected to gether to de scribe the pro cess of teaching these ideas among the Church’s elite. The Nauvoo En dow ment Com pa nies is in es sence a se quel to Jo seph Smith’s Quor um of the Anointed. It deals with ef forts af ter Jo seph Smith’s death to en sure that the tem ple en dowmen t was ad min ist ered to as many Saints as possi ble prior to the depar ture of the main part of the Church from Nauvoo in 1846. Again, it ar ranges in chrono log ica l or der the many ac counts of temple work dur ing 1845 and 1846. The washings and anointings; the eter nal mar riage cer emo nies; the rit ual pas sage from the Gar den of Eden through the telestial, ter restr ial, and ce lest ial glo ries; the adopt ions; and other en dowmen ts depict ed in these pri mary ac- counts sug gest the evo lu tion of the rit ua ls even af ter the death of Jo seph Smith and the prom ulg at ion of this aspect of Mor mon theol ogy among the rank and file in the Church. The events of this ef fort are related in such ac counts as this one by Abraham Owen Smoot: On Sat ur day the 18th of Dec[em ber] 1845, hav ing been called on by the Coun cil of the Twelve Apos tles, I went to the Tem ple in Nauvoo to re - ceive my en dow ment, at the hour of 8 o’clock in the morn ing I was re - ceived into the prep a ra tion rooms, with sev eral oth ers of my breth ren, and I was there pre pared to be con ducted into the wash ing and anointing room, where I re ceived my washings in clean and pure wa ter, pre pa ra tory to my anointing, which I re ceived under the hands of Sam uel Bent, Pres i - dent of the High Coun cil. I was then pre sented with a gar ment, b[e]aring the marks of the Priest hood, which I was in structed to wear as a pre ven - tion from evil. I was now pre pared for the re cep tion of fur ther or di nances in the House of the Lord which were to me sub lime, great and glo ri ous, REVIEWS 223

mak ing on my mind en dur able im pres sions, or as the prophet said, “en - grav ing upon the heart or writ[t]en upon its in ner parts &c.” (82–83) The haste with which these en dowmen ts were un der taken is rev eal - ing. On Feb ru ary 6, 1846, the last day be fore en dowmen ts were sus - pended, 512 peo ple in eight dif fer ent com pa nies went through the Nauvoo Tem ple. The in ten tion of making these cer emo nies avail able to as many of the Lat ter-day Saints as pos sible prior to de part ing from the city was appar ent in these act ions. Such widespr ead admin istr a tion helped to stan dard ize the prac tice among those who went west with Brigham Young. What is most remar kable about both of these books from my per - spect ive is the hier ar chies creat ed in the rit ua ls in which men were en- dowed to be come kings and gods and women to be come queens and priest esses. The Mor mon temple con cept as it emerged in Nauvoo with its se crecy, rit u al is tic washings and anointings, in can ta tions, pre oc cu pa - tion with Old Test a ment imag es, and elabo rate rites pro vided for eter nal exa l ta tion dur ing which faithful Mor mons would “inher it thrones, king - doms, princ i pal i ties, and pow ers, domin ions, all heights and depths” (D&C 132:20) im plies that those who did not ex pe ri ence this same en - dowmen t must oc cupy an eter nally subser vi ent sta tion. The tem ple rit u - als as doc u mented here al ways man dated a second-cl ass po si tion for women beneat h their priest hood-hold ing husbands, but women of the faith would be ex alted above all others. Did this set of ideas emerge am - biv a lently over time or was it de lib er ately fost ered by sta tus anx i ety or other more sub tle fac tors? Both Jo seph Smith’s Quor um of the Anointed and The Nauvoo Endow - ment Com pa nies are wel come ad di tions to the liter a ture of Mor mon Nauvoo. They pres ent highly useful doc u men tary ma ter i als for all to re - view. Hist o rians will find them helpful in under stand ing the evo lu tion of the Mor mon temple con cept and the prac tice of rit u als in the city. Ge ne - al o gists and bel iev ing LDS will profit from the wealth of biog raphi ca l and ca non i cal ma te rial con tained in these works.

ROGER D. LAUNIUS {[email protected]} chairs the Div ision of Space His- tory at the Smithso n ian Insti tut ion’s Nat ional Air and Space Museum in Washing t on, D.C., and is for mer chief his tor ian of the Na tional Aeronau t ics and Space Admin istr a tion (1990-2002). Among his Mor mon works are Jo seph Smith III: Pragmatic Prophet (Urbana : Univ ersit y of Il li nois Press, 1988); Dif fer - ing Vi sions: Disse nters in Mor mon Histor y, co-ed ited with Linda Thatcher (Ur - bana: Uni ver sity of Il li nois Press, 1994); and two works co-ed ited with John E. Hallwas: Cul tures in Conf lict: A Doc u mentar y Histor y of the Mor mon War in Il - li nois (Log an: Utah State Uni versit y Press, 1995); and Kingdom on the Missi s- sippi Re visited: Nauvoo in Mor mon Histor y (Ur bana: Uni ver sity of Il li nois Press, 1996). 224 The Journal of Mor mon His tory

Donald R. Moorman with Gene A. Sessions. Camp Floyd and the Mor mons: The Utah War. 1992; rtd., Salt Lake City: Uni versity of Utah Press, 2005. xx, 332 pp. Pho to graphs, maps, notes, in dex. Pa per: $19.95; ISBN 0-8748-084-56

Reviewed by William P. MacKinnon

When Don ald R. Moorman died of can cer at age forty-nine in 1980, he left ten related but dif fer ent manusc ripts on the or i gins and pros ecu tion of the Utah War (1857–58) and the im pact of the U.S. Army’s pres ence in Utah Ter ri tory dur ing the next three years. He had resear ched and writ ten these drafts be tween 1962 and 1980. Over the next twelve years, a self less ef fort by a few dev oted col leagues in the Hist ory Depar t ment at Weber State Univ ersit y in Ogden shaped this mat er ial into a co her ent book that ap peared in 1992. Now, aft er thir teen years, the book retur ns to print in a paper back edit ion. The aim of Moorman’s friends was to presen t his resear ch, dist inc - tive writ ing style, and an a lyt ica l judg ments rather than theirs. The ef fort was so pro longed that Jerome Bernstein, one of its spear heads, died, passing the torch to Moorman’s un f lag ging friend Gene A. Sessions, chair man of Weber State’s His tory Depart ment. In both 1992 and 2005, Ses sions made it clear that Camp Floyd and the Mor mons was “Don’s book”—that he and his col lab o rat ors had resis ted the tempt a tion to al ter aspect s of the manusc ript with which they person ally dis agreed be cause of mat ters of fact, in ter pre ta tion, lan guage, or the sim ple pas sage of time. The 2005 edi tion is un changed from 1992, except for Ses sions’s new four-page preface which sup ple ments his orig i - nal preface. Given that backg round, it is appr o priat e to ask what Moorman in - tended and how well Camp Floyd and the Mor mons ac com plishes his pur - pose. He appar ently left no draft in tro duct ion, and his ed it o rial succes - sors did not att empt to creat e one for him. The first edit ion was published as a vol ume in the Uni versit y of Utah Press’s statehood cen ten nial ser ies. Dis ting uished Utah hist o rian Charles S. Pet erson, who wrote the forew ord, viewed the book then through the lens of Utah’s pro longed and id io syn cratic jour ney to ward state hood. From a cur rent per spec tive, the book seems more use ful when viewed as six teen es says on five in ter - related subject s: (1) the events that made Camp Floyd nec es sary; (2) the camp’s impact on Utah’s Mor mons, their gov ern men tal heg emon y and econ omy; (3) the army’s im por tant de vel op ment of ter ri to rial roads; (4) the in f lu ence of gar ri son life on the army it self; and (5) the im pact on Utah’s no madic Na tive Amer i cans. Some of these chapt er-es says are bril liant successes —nar rat ives spar kling with verve, ana lyt ica l skill, and ground-breaking resear ch. This REVIEWS 225

mat er ial has stood the test of time and remains the standar d treatmen t of its sub ject. Yet other chap ters strike me as off-targ et, unba l anced, and dated. Per haps most frustr at ing is the ext ent to which some chap ters are a mix ture of both qual i ties. The f lat spots de rived, I be lieve, from Moorman’s in ter pret ive judg ments, dis tract ing fac tual er rors, and puz zling but im por tant omis - sions. The ap pear ance of ar rest ing schol ar ship by other his to ri ans since the 1970s is not, of course, some thing Moorman could con trol, al though the mat ter of some how ac knowl edg ing such new de vel op ments or cor - rect ing ob vi ous er rors must have posed a dif fi cult di lemma for his ed i - tors and pub lisher. In not in ter ven ing, they may not have served read ers well. Most hist o ri ans have viewed the Utah War as an event be gin ning with Winfield Scott’s gener al cir cu lar on May 28, 1857, org a niz ing the Utah Expe d i tion, and end ing with Al bert Sid ney Johnston’s march through Salt Lake City on June 26, 1858. Moorman knew that the cam - paign was neit her so short nor so simple. His work quite prop erly dealt with both the ten-year or i gins of the conf lict as well as the pro longed, cont ent ious per iod of feder al “occu pa t ion” that follo wed the sett ling of Johnston’s dust. Because only the first two chap ters deal with events preced ing the army’s en trance into Salt Lake City, Camp Floyd and the Mor mons is not a cam paign his tory in the conv en tional sense. It thus meshes well with Nor man F. Furniss’s splen did The Mor mon Conf lict, 1850–1859 (New Hav en, Conn.: Yale Uni versit y Press, 1960), which con - cen trates on the early phases and min i mizes the Utah War’s post-1858 im pact. Based no doubt on his awareness of Moorman’s views, Gene Ses sions com mented in his 2005 preface that Moorman would be dis ap - pointed to hear Furniss’s study, rather than his own, desc ribed so frequently as the standar d nar rat ive his tory of the Utah War. Such dis ap- point ment per haps ex plains why Moorman men tions Furniss’s study only once in his text (al though he cites it ten times in the notes).1++++ Ses - sions co gently obser ved in his 2005 preface: “Whether Furniss’s excel - lent book rea lly is still the best work on the sub ject does not mat ter and is in many ways imma ter ial, because Moorman’s vol ume . . . does not attempt to repeat the work of Furniss or any one else” (xiii). From the perspec tive of my own long in ter est in the Utah War,2* Moorman’s most valu able work compr ises seven chapt ers: 4, “The Scourge of Gold: Fairfield,” 5, “Life at Camp Floyd,” 8, “The March into

1 ++++ Moorman may have delib er ately avoided consult ing two major works about Camp Floyd complet ed bef ore his death: Don Richar d Mathis, “Camp Floyd in Ret- rospect” (M.A. the sis, Univ ersity of Utah, 1959); and Thomas G. Alex an der and Leon ard J. Arrington, “Camp in the Sagebr ush: Camp Floyd, Utah, 1858–1861,” Utah His tor i cal Quar terly 34 (Win ter 1966): 3–21. He cites nei ther. 2 * Wil liam P. MacKinnon, “Stranger in a Strange Land: My Forty-Five Years 226 The Journal of Mor mon His tory the Wil der ness,” 13, “Unsaintly City,” 14, “Disquiet in Zion,” 15, “The Eco nomic Im pact of the Utah War: An Analy sis,” and the “Epi logue.” These chapt ers showca se Moorman’s extr aor dinar y abil ity to creat e vivid desc rip tions of people, situ a tions, and soc ial forces through vi gnettes de- rived from unusua l sources. Ses sions ex presses mild dis com fort with his “pep pery and de fi ant” col league’s “col or ful lan guage” and “pur ple prose.” I find Moorman’s style del ightful-–an in teg ral part of the his to - rian’s essen tial need to tell a story while marsha l ing less dramat ic facts and sta tist ics. Hence, one finds the fol lowing classic por trait of the gam - bling scene in Fairfield, Utah (“Frogtown”), the sor did hamlet abutt ing Camp Floyd: The de bris of a dis placed so ci ety was drawn to the ba sin from the far reaches of the con ti nent—cardsharps fresh from the goldfields of Cali for - nia, Mex i cans muf fled in their se ra pes who could lose a for tune with out mov ing a mus cle, smartly dressed Monte deal ers from the river trade whose good or ill luck was not be trayed by a change in fa cial ex pres sion, and dis charged soldiers and team sters. In its time, the gam bling halls of Fairfield be came leg end, being more nu mer ous and no tori ous than those in any other frontier town of equiva len t size. But to the Saints, the town was a den of vi pers. (64) With equal aplomb, Moorman limns the boredom and bruta l ity of mil i tary life at Camp Floyd it self; the sur prisingly vi o lent, wide-open char ac ter assumed by post-war Salt Lake City; and the boom/bust im - pact of army spend ing on non-Mormon specu la tors, LDS Church leaders, and in di vid ual set tlers. Moorman’s prose is com pel ling, al though oc - ca sion ally—in the ap par ent pursuit of verve—the au thor strays into the unsupportable. For exam ple, Moorman desc ribes Thomas L. Kane as “a heavily built, erect man slightly under six feet in height” (32) while Kane’s bi og ra pher viewed him as “small in stat ure” and Kane’s 1882 ap - plica tion for a mil it ary pension says he stood five feet four and weighed 122 pounds.3** Simi larly, Moorman sketches a dramat ic por trait of Al fred Cumming as “tub built” and “some what on the heavy side of two hun - dred pounds” (41), al though Cumming ac tu ally weighed nearly four hun - dred pounds and was so well in su lated that he oc ca sion ally strode about Camp Scott in win ter in his shirt-sleeves.4*** These dis crep an cies at least prompt cau tion about the au thor’s tit - il lat ing but harsh de scrip tion of Chief Just ice Delana R. Eckels (mis - with the Utah War and What I Have Learned,” Yale Univer s ity Libr ary Gazette 80 (Oc- to ber 2005): 18–19. 3 ** Alber t L. Zobell Jr., Sen tinel in the East: A Bi og raphy of Thomas L. Kane (Salt Lake City: Nich o las G. Morg an, Sr., 1965), 10; Mat thew J. Grow, email to MacKinnon, March 27, 2005. 4 *** For Cumming’s weight, see commen ts by his nephew, Joseph Bryan Cumming, in Ray R. Cann ing and Beverly Beeton, The Gen teel Gen tile: Let ters of Eliz a- REVIEWS 227

spelled “Eckles”) as “out wardly resem bling the Charles Dick ens pro to type of a ruthless, ham-fisted mer chant of in dustr ial Eng land” and as a “fire-breath ing na tion al ist who could ac com mo date no be liefs or ac tions but those that sup ported the po si tion of the fed eral gov ern ment” (103). One needs to square these char ac ter ist ics with Eckels’s subse quent no to - ri ety as one of In di ana’s most prom i nent Con fed er ate (not Un ion) sym - pa thizers and his kindly men tor-guard ian ship in Utah of or phaned In- dian lads, litt le Engl ish girls, and Hoo sier law studen ts. Fina lly, in terms of bal ance if not ac cu racy, Moorman four times char ac ter ized As so ci ate Just ice John Cradlebaugh as “one-eyed” witho ut a sin gle ref er ence to Presi dent Bu chanan’s well-known vi sion prob lem or that of Dan iel H. Wells, whom the ed i tor of the Salt Lake Tribune called the “One-Eyed Pi - rate of the Wasatch.”5**** Per haps Moorman’s most valu able achievemen t was his docu men ta - tion in Chapt er 8 of mil i tary trail explo ra tions and road-build ing pro - jects dur ing 1858–60 that ra di ated in all di rec tions from or to ward Camp Floyd. This flurry of top o graph i cal en gi neer ing and con struc tion ac tiv - ity fac il it ated the comple tion in Utah of both the transcon tinen tal tele- graph (1861) and the trans con ti nen tal rail road (1869) while ben ef it ing its popu la tion on a scale dwarf ing that of any other Amer ican ter rit ory. Even in the short run, it was ci vil ians, not the army, who most benef ited from the new knowl edge and infr a struc ture gen er ated by these war-related sur veys. Barbara Beeton has docu men ted Capt ain James H. Simpson’s trail-blazing accom plishmen ts in Utah dur ing 1858–59,6+ but Moorman quite prop erly doc u ments the far broader story of Camp Floyd’s sur veying and eng ineer ing achievemen ts. I only wish that his ac - knowl edg ment of Al bert Sid ney Johnston’s lead ership was less grudg ing and that he had com mented on Johnston’s for tuit ous insis t ence on blazing a new trail from Camp Floyd to New Mex ico in 1858. As LeRoy R. Hafen pointed out in 1946, this track be came the prin ci pal wagon route be tween east-cen tral Utah and Col o rado.7++ Ano ther con tribu t ion of Moorman’s book is his recog nit ion (Chap - ter 16) of the sig nif ican t post-1858 act iv ity of the Utah War’s par tic i - pants, par tic ularly dur ing the Civil War. Yet valu able as it is, Moorman’s discus sion barely scratches the po ten tial of this rich lode for rewar d ing study. Missing, then, is the story of a vast num ber of other people as well as sig nif ican t soc ial forces trigg ered by the Utah War: the Anglo red is-

beth Cumming, 1857–1858 (Salt Lake City: Tanner Trust Fund and Univ ersity of Utah Libr ary, 1977), 101. 5 **** “Blood-Atoners Tes tify,” Salt Lake Tri bune, Sept ember 16, 1876. 6 + Barbara Beeton, “James Her vey Simpson in the Great Ba sin,” Montana: The Maga zine of Wester n Histor y 28 (Win ter 1978): 28–43. 7 ++ LeRoy R. Hafen, “Colo nel Loring’s Expe d it ion across Colo rado in 1858,” Col o rado Mag a zine 23 (1946): 49–75. 228 The Journal of Mor mon His tory cov ery of the Grand Can yon, Rus sia’s sale of Alaska, the Engl ish for ma - tion of Brit ish Colum bia, and the repeat ed, pun it ive trunca tion of Utah’s bor ders to form or expand Nevada, Colo r ado, Nebr aska, and Wy oming. The Utah War’s ep i logue con tains far-reach ing po lit i cal and top o graph i- cal con sequ ences in ad di tion to the downstr eam eco nomic and persona l im pact ad dressed in lim ited fashion in Camp Floyd and the Mor mons.8+++ The sec ond fac tor con trib ut ing to Moorman’s suc cess is his re - markable knack for exploit ing sources unused by his prede ces sor-his t or i - ans or even those who have fol lowed. Ses sions touches brief ly on the ex- tent to which Moorman—a non-Mor mon and per haps an athe ist—won ex- traor dinar y access to the recor ds of the old Church Hist o rian’s Of fice from their (then) less-than-open-handed keep ers. Yet this is only half the story of Moorman’s resear ch suc cess. Moorman also drew on wonder ful doc u ments held by pri vate col lec tors and pub lished in ob scure his tor i cal jour nals un exploi ted by other writers. For ex am ple, Brigham Young was oddly fasc i nated by the possi bi l i ties of long bows and crossbo ws for moun tain war fare, an in ter est to which Nauvoo Leg ion musi cian Myron Brewer pan dered by of fer ing to org a nize a squad of Mor mon ar chers. Moorman also tells the story of how Brewer, with two conf eder ates, at - tempted to forge Camp Floyd quar ter mast er drafts on a massiv e scale (chap. 14). This Byzantine coun ter feit ing plot al most result ed in Brigham Young’s in dict ment and did have the un in tended con se quence of forc ing the resig nat ion of U.S. marsha l Pet er K. Dotson. Ano ther story to which Moorman makes a gen uine con tribu t ion is that of the Sec ond U.S. Dra - goons’ ag o niz ing Oc to ber-No vem ber 1857 march from Fort Leavenworth to Fort Bridger. He does so through the ac count by Wil liam G. Cham - bers, mast er of transpor tat ion, of this lon gest cold-weather trek in Amer - i can mil i tary his tory. Here to fore the dra goons’ ex traor di nary march has been known only by the repor t of the reg i ment’s col o nel, Philip St. George Cooke, and the jour nal of his bu gler, Wil liam D. Drown. Yet in presen t ing for the first time snip pets from James Sweeney’s col or ful nar ra tive of Cap tain Randoleh B. Marcy’s No vem ber-June trek to New Mexico and back, pur portedl y the only first-per son acco unt beside Marcy’s own, Moorman failed to no tice that it is bo gus. Ac cord ing to army recor ds in the Na tional Ar chives, Pri vate Sweeney spent the en - tire win ter of 1857–58 at Camp Scott-Fort Bridger rather than on the trail with Marcy. The book’s im ages are also a mixed bag. C. C. Mills’s 1858–59 pho - to graphs of Camp Floyd, espe c ially his rare panor amic sweeps, are prob - a bly their first display since Sec ret ary of War Floyd saw them in 1859. Disap point ingly, the book’s single map fails to trace most of the trail-blazing expe d i tions to which Moorman de votes Chapt er 8. Readers

8 +++ See Wil liam P. MacKinnon, “Epi logue to the Utah War: Im pact and Leg acy,” Jour nal of Mor mon His tory 29 (Fall 2003): 186–248. REVIEWS 229

may also reg ret the absence of a bibl iog raphy , since ci tat ions are oft en in ac cu rate or based on col lec tions at the LDS Church Ar chives that have since been re or ga nized. Not with stand ing its mul ti ple strengths, Camp Floyd and the Mor - mons is weak ened by er rors of fact, in ter pret a tion, and omission agg ra - vated by a reg rett able lack of bal ance in sev eral chapt ers. For exam ple, there are nu mer ous prob lems with names: Cap tain John Wolcott Phelps be comes the laugh ably dif fer ent “Wil liam Phelps” (272), Gen eral Newman S. Clark’s first ini tial is render ed as “A” (146), Mor mon judge Jeter Clinton’s given name be comes “Pet er” (236), Apos tle John Taylor be comes “George” (284 note 27), Na than Au gustus Mon roe Dudley im - prob a bly becomes North Americus Man ning Dudley (111),9++++ ed i tor-pub- lisher J. H. Bea dle is “Beale” (244), Yale’s fa bled Coe Col lec tion is de - scribed as the “Cole” trove (300 note 69), le gal hist o rian Arie W. Poldervaart is cited as Arnie Podervaart (283 note 12), and the for mi da - ble Wil liam Adams (“Wild Bill”) Hickman is persis t ently desc ribed as “Billy” (238). Such er rors can, of course, be cor rected in the next print - ing, de pend ing on how the pub lisher jug gles the com pet ing forces of a quest for ac cu racy and the cost of new print ing plates. More wor risome are the book’s other er rors of fact. T. B. H. Sten- house was not in Utah dur ing 1851 to “wit ness” Judge Perry E. Brocchus’s di sastr ous pub lic ut ter ance (9); he did not reach Salt Lake City un til 1859. Ebenezer Hanks’s Feb ruar y 6, 1858, lett er desc rib ing Thomas L. Kane in Cal if or nia was writt en to Amasa Lyman, not Brigham Young (287 note 35); Brigham Young de cided on a non-mil i tary res o lu tion of the con f lict in March 1858, not the prior De cem ber-Janu - ary (30). Rus sell, Ma jors, and Waddell’s 2,600 wagons requir ed nearly the same number of teamst ers, not 1,000 men (31). Kane did not ar rive “un - an nounced” at the White House in De cem ber 1857 (32); James C. Van Dyke had ar ranged the meet ing. Kane’s fa ther died on Feb ru ary 21, 1858, be fore Thomas reached Salt Lake City, not be fore he en tered Utah (33). Kane did not travel across the souther n desert with his “black ser - vant” Osborne, since Osborne had left the Kane house hold in Phil a del - phia months ear lier for a job in San Franc isco (34). Al fred Cumming refused, rather than ac cepted, the role of Kane’s sec ond in his pu ta tive Camp Scott duel with Al bert Sid ney Johnston (38). The 1853 posse seek - ing to ar rest Jim Bridger at Black’s Fork was led by Joseph L. Hey wood and James Fer guson, not Bill Hickman (48). J. E. Farmer was a ci vil ian, not an en listed “pri vate,” with the Sev enth U.S. In fan try (97). Serg eant Wil liam H. Mor ton died from gorg ing him self at the end of Marcy’s ar - du ous trek to New Mex ico, not from “expo sure and fa tigue” (152). Fitz

9 ++++ Moorman may have unwit tingly conf lated the pompo us Dudley’s name with the nick name (“the Great North Amer ican Dudley”) that his fel low-of ficers be - stowed upon him. 230 The Journal of Mor mon His tory

John Por ter was Al bert Sid ney Johnston’s assis tant, not “act ing” adju t ant gen eral (254). Lorenzo Thomas, was a lieu ten ant col o nel, not a “gener al” (216). John W. Gunnison was mur dered in 1853, not 1855 (183). In dian Agent Gar land Hurt rode into Johnston’s biv ouac near South Pass on Oc - to ber 23, 1857, rather than “crawl[ing] mis er a bly” into Mor mon-oc cu - pied Fort Bridger (187). Johnston heard of Steptoe’s def eat in Washing - ton Ter ri tory while he was at Camp Floyd, not Fort Bridger (192). Eu - gene Bandel of the Sixth U.S. In fan try was a serg eant in 1858, not a pri vate (193). Gen eral Joe Shelby, not Utah War vet eran Henry Hopkins Sibley, was “one of the last men to sur ren der his com mand dur ing the Civil War” (279). Civil War gen er als Henry Heth, John F. Reynolds, and John Buford did not win ter to gether at Camp Scott in 1857–58, but they did serve to gether at Camp Floyd (279). The 1857–58 expe di tion to as - cend the Col o rado River was com manded by Jo seph Christma s Ives of the top o graph i cal en gi neers, not Cap tain W. P. Blake (287 note 38). In what I would call er rors of omission rather than in ac cur a cies, Moorman in expl i ca bly gives no more than a sen tence or two to three of the most sig nif ican t events of the Utah War: (1) Brigham Young’s proc la - ma tion of mar tial law on Sep tem ber 15, 1857; (2) Ma jor Lot Smith’s de - struc tion of three fed eral sup ply trains on the night of Oc to ber 4–5, 1857; and (3) the strike by Ban nock and Norther n Sho shone war riors on the Mor mon Fort Limhi Mis sion on Feb ru ary 25, 1858. Young’s de cree and Smith’s raid, more than any other act ions, conv inced the Amer ican publ ic and Buchanan’s admin istr at ion that Utah was out of con trol, led by a fed er ally sworn but rebel lious gov er nor. As a result, both Young and Smith were ind icted for trea son. The Fort Limhi massa c re, accor d ing to Da vid L. Bigler, was a rev ersa l so stra teg ic that Brigham Young im me di - ately shifted plans from a spring of fen sive by the Nauvoo Leg ion to a strat egy of with drawal, if not ac com mo da tion. Moorman’s by pass ing these events is puz zling. Most dam ag ing of the book’s short falls, though, are what I see as er rors of in ter pret a tion. In Chap ter 7, Moorman arg ues that the Moun - tain Mead ows Mas sa cre was in duced largely by in flam ma tory be hav ior of what he calls Misso uri cowbo ys trav el ing with the Baker-Fancher party but some how ab sent from the slaugh ter. Even Ses sions has dist anced him self from this tra di tional but highly fan ci ful in ter pre ta tion, com ment - ing in 2005, “I doubt the very exis t ence of the in fa mous ‘Mis souri Wild - cats’ who play such a prom i nent role in Don’s chap ter on the Moun tain Meado ws af fair” (xvi). I be lieve this chapt er should be read only with Juanita Brooks’s Moun tain Mead ows Mas sa cre, Will Bagley’s Blood of the Proph ets, and Richar d E. Turley, Glen M. Leon ard, and Ron ald W. Walker’s forth com ing Trag edy at Moun tain Mead ows at hand. Ses sions’s 2005 preface praises Moorman for writ ing “a bal anced nar rat ive that he pains takingl y compi led from the docu men ts he read. Per haps the best and most co gent ex am ple of this is in Chap ter 7, ‘Trag- edy at Moun tain Meado ws’” (xiii). I canno t agree. As a non-Mor mon na- REVIEWS 231

tive of Il linois who came to Utah only at mid-life, Moorman surely cannot be ac cused of rel i gious or fa mil ial bias. Yet his treat ment of Al bert Sidney Johnston, Brigham Young, and Utah’s feder al ju dic iary shows a puz zling, per cep ti ble pat tern of em pha sis and omis sion. For exam ple, Moorman is fairly unf org iv ing on ben ign subject s such as Young’s will ing ness to cede min ing, freight ing, and mer can tile ac tiv it ies to non-Mor mons in fa vor of farm ing, grazing, and the dev el op - ment of home in dustr ies (chap. 15). Yet on life-and-death is sues relat ing to le gal mat ters, Moun tain Meado ws, and mil it ary strat egy, he leaves Young’s be hav ior and judg ments un ques tioned. Even leav ing aside the con ten tious mat ter of who bears what respon si bil ity for the unpr ec e- dented slaugh ter at Moun tain Mead ows, I find it odd that Moorman would de scribe at length the army burial party’s 1859 erec tion of a memo rial cairn and cross but remain si lent about Young’s in excus able de - struc tion of these mark ers when he vis ited the mead ows two years later. Moorman likewise does not de scribe Young’s in tended ar rangemen ts to send the child sur vi vors of the massa cre back east in freight wag ons, ac - com pa nied by a group of Mor mon matrons, which he reduced in size because some had not fully repaid their PEF debt. Al bert Sid ney Johnston was so aghast at Young’s in sensi tiv ity that he pro vided more com fort able army spring wag ons for the trauma tized chil dren and det ailed two com - pa nies of dra goons to es cort them as far as Fort Leavenworth rather than the ci vil ian teamst ers. As ano ther exam ple, Moorman quotes George A. Smith’s mock ery of fed eral judges who trav eled with a bodyg uard of eighty dra goons, yet on the next page, he notes witho ut com ment that Brigham Young en - tered a fed eral court room “with a ner vous as sem bly of sev eral hundr ed of his fol low ers, well-armed and ea ger to as sure the safety of the Lion of the Lord” (104–5). Fi nally, I agree with Moorman that “Bill Hickman’s car eer as a crimi na l had repeat edly made a fool of just ice, and a more il - log i cal can di date for the bar could not be imag ined” (244–45). Thus, I canno t under stand Moorman’s fail ure to men tion that, in Jan uar y 1857, Young and the leg is la tive as sem bly pet i tioned Con gress and the U.S. presi den t to ap point Hickman as Utah’s U.S. at tor ney and did so in lan - guage so in tem per ate that it helped to inc ite the Utah War. Per haps more than some, I ap prec iat e Moorman’s commen t: “In retr o spect it is dif ficult not to ad mire Brigham Young, a tow er ing leg end in his own time who, like the vast major ity of the Saints, had his mind wrapped around the roots of rel i gious con sciousness” (18). Still, I pref er Moorman’s ad di tional assess men t that Young “came to sym bol ize the most rev ered as well as dis liked qual i ties of the Mor mon temper a ment” (18) to Moorman’s exces siv e praise of him as “a bril liant tac tic ian” (26) who ex e cuted “mas ter ful stra te gic ma neu ver[s]” (40). I also can not agree with Moorman’s repeat ed char act er izat ion of the Utah War as “blood- 232 The Journal of Mor mon His tory less” (23).*10 If Camp Floyd was a mixed blessing for Utah Ter rit ory of the late 1850s, Dona ld Moorman’s book about it is for toda y’s readers a work of com men su rately un even char ac ter and use ful ness. It is a fas ci nat ing study of the latt er stages of the Utah War and its pre-Civil War aft er math that canno t be ig nored, yet one that must be read with an awareness of its consid er able f laws and lim it a tions. For readers will ing to thread this in tel lec tual mine field, the rewar ds are sub stan tial. Those in clined to dis - miss the book out of hand will miss op por tun i ties; those who ac cept it at face value may drop into hist or ica l pit falls. The his to riog ra phy of the Utah War is litt ered with his to rians who dev oted decades to resear ching this fasc inat ing struggle only to fall vic - tim to death, ill ness, or inhi bi tions bef ore publ ishing all of what they in - tended to say. Among them are Dale L. Mor gan, Hami l ton Gardner, LeRoy Hafen, E. Cecil McGavin, M. Hamlin Can non, Fran cis W. Craigin, Frank Evans, Al bert L. Zobell Jr., Philip S. Klein, Richar d D. Poll, Charles Kelly, and Har old Schindler. Thanks to the tenac ity and ex traor - di nary friend ship of Jerry Bernstein, Gene Sessions, and others, Don ald R. Moorman and his work have largely escaped the fate of these unful - filled Utah War hist o ri ans. For this out come, Moorman’s read ers—even the most skept ica l among us—should be grateful, both to him and to his in de fat i ga ble col leagues.

WIL LIAM P. MACKINNON {[email protected]} is an in depend en t hist o - rian and manage men t consul tant in Bloomfield Hills, Mich i gan, and a mem - ber of the Mor mon His tory As so ci a tion Board. His ar ti cles, essa ys, and book rev iews about Utah’s ter ri to rial per iod and the U.S. Army’s west ern cam - paigns have appear ed in this jour nal and thirty oth ers since 1963. The first volume of his docu men tary hist ory of the Utah War will appear from Ar thur H. Clark in 2008.

Pa tricia Lyn Scott and Linda Thatcher, eds. Women in Utah His tory: Par a - digm or Par adox? Lo gan, Utah: Utah State Uni versity Press, 2005. xviii, 438 pp. Pho to graphs, notes, in dex. Pa per: $19.95; ISBN 10: 0-87421-625-7

Reviewed by Linda Wilcox DeSimone

From the tit le only, one might think that this book would be a compr e- hensiv e acco unt of “women in Utah hist ory,” out lin ing in a careful ly con-

10 * See my “‘Lonely Bones’: Utah War Leader shi p and Vi olence ,” Jour nal of Mor mon His tory 33, no. 1 (Spring 2007): forthcom ing. REVIEWS 233

structed nar rat ive the role and accom plishmen ts of women dur ing Utah’s 150-plus years of recor ded hist ory. But as the fact that it has ed i - tors rather than an aut hor gives away, this is not a single nar rat ive but rather an an thol ogy of twelve es says on var i ous fac ets of women’s par tic i - pa tion in Utah’s hist ory. As such it is best read as a se ries of sep a rate pieces rather than a his tor i cal whole, for while in di vid ual au thors gener - ally do a com mendable job of deal ing with the assig ned topic, there is a fair amount of dupl ica t ion among the var io us chapt ers. Al most thirty years in the mak ing, this pro ject beg an with a workshop put tog ether by a task force on Women in Utah His tory of the Utah Commis sion for the Obser vance of In ter nat ional Women’s Year (IWY) in 1977. The workshop creat ors later formed the Utah Women’s Hist ory Asso c ia tion and dec ided to write and publ ish a book on women in Utah’s hist ory. A num ber of chap ters were as signed, writ ten, and pre - sented as a lec ture se ries around the state in the mid-1980s, and their au - thors have updat ed the orig i nal chap ters for this vol ume. The pro ject was largely supported by the Utah State Hist or i cal So ci ety, which also pro vided most of the won der ful pho to graphs—around sev enty!—which are a trea sure in them selves. Su san Whet stone was the book’s able photo ed i tor. The book beg ins with a com par ison of pol yg amo us and monog a - mous Mor mon women by Jessie L. Embry and Lois Kelley, fol lowed by a chap ter on the le gal sta tus of women by Lisa Madsen Pearson and Carol Cornwall Madsen. The next two chap ters deal with women in churches (largely non-Mormon) by John Sillito and ethn ic women by Helen Zeese Papanikolas, fol lowed by chapt ers on farm women by Cynthia Sturgis and “gain fully emplo yed” women by Mir iam B. Murphy. There are essa ys on women in edu ca t ion by Mary Clark and Patr ic ia Lyn Scott, women’s clubs and asso ci a tions by Jill Mulvay Derr, women of let ters by Gary Top - ping, women in the arts by Mar tha Sonntag Bradley-Evans, and women in pol i tics by Kathryn L. MacKay. The book concludes with a chapt er on women’s life cy cles by Jessie L. Embry. Each chap ter cov ers a dif fer ent time pe riod. Some fo cus on the ter - ri to rial pe riod. Others sur vey a cen tury (1877–1977), early twen ti eth cen - tury (1900–1940, 1890–1940), or the whole pe riod from 1847 through 2004. Clearly the reader will find in this book much of Mor mon women’s hist ory, a good deal of which is al ready fairly well known to studen ts of Mor mon hist ory. The strength of this col lec tion is in in teg rat ing the expe ri ences and achievemen ts of the “other” women into the state’s history. Their sto ries are more strik ing be cause of their rel a tive un fa mil iar - ity to most read ers. Helen Zeese Papanikolas, for ex am ple, pro vides a lively, clear, and fo cused acco unt of ethn ic women, includ ing Na tive Amer icans and Afr ican Amer icans as well as immi g rants—and not just the more fami l iar Greeks and Ital ians, but groups like Ar me ni ans and 234 The Journal of Mor mon His tory

Asians. It is worth not ing that some of these “ethn ic” women were also Mor mon. Papanikolas gives us a good feel for what life was like for the women in these com mun i ties and how they were per ceived by others. I also found Mir iam Murphy’s essa y on “Gain fully Emplo yed Women” a fas ci nat ing ac count of the op por tu ni ties and dif fi cul ties, setbacks and prog ress, of women in Utah’s work force over the years. Al - though by 1950 women made up al most one-fourth of the Utah work force, Murphy notes that they were still prac ti cally inv is i ble: “But for some these women remained as myst er i ously unseen as if they were in pur dah. An econ o mist and bank vice-pres i dent writ ing a 1956 text book would note ‘the extr emely small per cent age of women who are gain fully emplo yed’ in Utah. Men ran the working world and that was the impor - tant and visi ble thing. That they could never have run it with out the la - bor of women did not oc cur to most men or women in the 1950s” (213). An other excel lent chap ter explor es one par tic u lar thread of a tran - si tional shift from ru ral to ur ban val ues and methods. In it Cynthia Sturgis pro vides a det ailed acco unt of how farm women’s roles changed from pro duc ers of goods and ex perts on home tasks to be ing con sum ers of prod ucts (and thus “house hold man agers”), rel i ant on uni versit y ex- perts in do mest ic sci ence to teach them how to run their homes and raise their chil dren. While ini tially resis t ant, the farm women even tu ally traded their tra di tional au thor ity for “pro fessiona l” methods and mod - ern la bor-sav ing con ven iences. Sturgis ef fec tively traces the other so cial, cultur al and economic dev elop men ts surr ounding this shift. An other workman like es say is the chap ter on the le gal sta tus of women dur ing the ter ri to rial pe riod, writ ten by the mother-daugh ter team of Carol Cornwall Madsen and Lisa Madsen Pearson. It sets the Utah ex pe ri ence in the con text of both na tional de vel op ments and dif - fer ences with other west ern states and ter ri to ries. The au thors careful ly desc ribe and explain a wide range of leg al is sues and syst ems in ter rit o - rial Utah: the court syst em, mar riage and div orce laws, cust ody and guard ian ship is sues, women’s prop erty rights reg ard ing real est ate and wills, in her i tance laws, the right to sue or be sued, fema le law yers, jury duty and pol it i cal rights—includ ing suf frage and the right to hold of - fice—creat ing a very readable ac count of how Utah Ter ri tory’s leg al system treated women and how women, in clud ing the oc ca sional fema le at - tor ney, funct ioned within it. With sev eral chap ter top ics being “women in” var io us disc ipl ines (ed uca tion, churches, arts, pol i tics, let ters, etc.), there’s a dan ger of an es - say be com ing ba si cally a cat a logue or list of no ta ble in di vid u als. Jill Mulvay Derr’s chap ter on women’s clubs and as so ci a tions “sam ples rather than lists” (249) such groups and pres ents rea lly var ied ex am ples of women’s asso c ia t ions—soc iet y clubs, “daughter s” org an iza t ions (DAR, DUP, etc.), mothers ’ groups, studen t and youth groups, women’s aux il ia - ries, etc. Gary Top ping, writ ing about women of lett ers, refr eshingl y moves REVIEWS 235

quickly from the nine teenth cen tury into the twen ti eth and in cludes po - ets, his to ri ans, and en vi ron men tal writ ers as well as fic tion writ ers. The strength of his essa y lies in his careful choices of sub jects, his at ten tion to con text, and his fine crit ica l eye, which succ inctly eval uat es the writ ers’ work. Mar tha Sonntag Bradley-Ev ans has a simi lar chal lenge in cor ral - ling the his tory of Utah women in the var io us “arts,” (music, dance, drama, visua l arts, appl ied arts/crafts), any one of which in it self could pro duce a long list of fema le wor thies. Her so lu tion is to set her essa y within the concep tua l framew ork of gender iden tity as a soc ial con struc - tion, desc rib ing how the arts were consid er ed appr o priat e for women as an adorn ment in their do mest ic sphere but were less ac cept able for women who had aspi r a tions in the publ ic or pro fessiona l arena. The essay also helps reha bi l itate the repu ta tion of women’s trad it ional or folk art such as weav ing, quilt ing, and other domes t ic crafts. There is a wealth of in for ma tion and det ail in these essa ys, so how well does the book ac com plish its pur pose? The ed i tors state: “The chief goal of this book is to in teg rate Utah women of all ethn ic and rel ig ious backg rounds into the broader field of women’s stud ies” (ix) and “This book’s pri mary objec t ive is to make the his tory of Utah’s women more vis i ble, to cel e brate their achieve ments, to ap pre ci ate their strug gles and sac ri fices, and to see more clearly the work that still remains to be done” (x). This list sets out five am bi tious ob jec tives. The goal of in teg rat ing women of all back grounds into the field of women’s stud ies would seem to have been achieved fairly di rectly in John Sillito’s chapt er on women in churches, which con cen trates on those other than Mor mon, and in Helen Papanikolas’s chap ter on ethn ic women—and to some ex tent in many of the other chap ters such as those on women in let ters and the arts. The over all im pact of the sev eral stud ies gather ed here cer tainly achieves the first two el emen ts of the “ob jec tives”—vis i bil ity and cel ebr a - tion—while I as sume any “ap prec i a tion” will be up to read ers rather than the au thors, as will the more dif fi cult task of see ing what still needs to be done in the field, since the ed it ors do not pro vide an expl icit “futur e re search” list. There are a few prob lems related to the book’s pro duc tion. A num - ber of typos es caped proof read ing: “Sale” Lake City (123), the ap point - ment of a “women” state school su per in ten dent (xiii), a woman’s “spere” (337), women in still ing their peo ple’s “vales” in their chil dren (144). There are also some us age issues such as women pro test ing the “em i - nent” pas sage of a bill (374) and “women” suf frage (372), where ev ery - where else—even on the same page—it is ref erred to as “woman” suf frage. And then there are some slippages of fact: Carol Gilligan’s name is spelled as “Giligan” (249); a Salt Lake City publ i ca tion date is listed as 1803, prob a bly meant to be 1893 (124 note 59); the ac count of the two wives of Clar ence Merrill seems to mis iden tify Julia as the daugh ter of George A. and Bathsheba Wil son Bigler Smith rather than the more likely Bathsheba Smith Merrill (19); and only the St. Ann’s School, not 236 The Journal of Mor mon His tory the or phanag e, “still oc cupies a handsome red-brick build ing” on Twenty-first South and Fifth East (116)—pos si bly one of the ca su al ties in the pro cess of up dat ing these twenty-five-year-old es says for the pres ent pub li ca tion. This up dat ing, in ci den tally, was ac com plished with vary ing de grees of suc cess. In most cases, it was prob a bly done in the form of rev i sion rather than add ing new ma ter ial, al though some au thors took a dif fer ent ap proach. Mir iam B. Murphy, for exam ple, added a “Post script: Fast For - ward to a New Cen tury,” which deftly iden ti fies a number of trends in women’s em ploymen t in Utah in the past half cen tury along with useful sta tist ics, simi lar to her appr oach in the main es say. Mary R. Clark and Patr ic ia Lyn Scott’s chapt er on women in edu ca t ion pur ports to cover the whole pe riod from 1847 to 2004, but post-1980 de vel op ments are con fined to the last two pages. Kathryn L. MacKay added three para - graphs at the beg inn ing of her essa y on women in pol i tics and three at the end which com ment on Olene Walker, Utah’s first woman gov er nor, and men tion re cent fe male state leg is la tors and con gres sio nal of fice hold - ers. Espe cially in these two cases, the past quar ter cen tury seems to re - ceive fairly thin cov er age com pared with the rest of the per iod these authors cover. Despite these mi nor dif fi cul ties, the book serves a valu able pur - pose in fi nally bring ing these long-awaited essa ys to pub li ca tion. It pro - vides use ful and de tailed over views of Utah’s women’s roles in many fac - ets of the state’s hist ory which can serve as a spring board for fur ther explo ra tion. And it serves up for the reader some fine pieces of writ ing, many del ight ful sto ries, and of course the mar vel ous pho to graphs.

LINDA WILCOX DESIMONE {lindadesimone@ya hoo.com} is assis tan t book rev iew ed i tor for the Jour nal of Mor mon Histor y.

Debbie Palmer and Dave Perrin. Keep Sweet: Children of Polyg amy. Lis ter, Brit ish Co lum bia: Dave’s Press, 2004. xv, 396 pp. (No pho to graphs, maps, notes, bib li og ra phy, or in dex.) Pa per: $28.85 (Ca na dian); ISBN 0–0968–7943–3–5

Jenny Jessop Larson. Brain wash to Hog wash: Es cap ing and Ex pos ing Po lyg- amy. St. George, Utah: Jenco Pub lish ing, 2004. iii, 240 pp. Pho to graphs. Pa per: $20.00.

Kathleen Tracy. The Secr et Story of Pol yg amy. Naperville, Ill.: Sourcebooks, 2002. ix, 230 pp. Bib li og ra phy, in dex. Paper: $16.95; ISBN 1–57071–723–0

Reviewed by Brian C. Hales REVIEWS 237

Deb bie Palmer and Dave Perrin teamed to write Keep Sweet: Chil dren of Po lyg amy. The ti tle co mes from a phrase frequen tly emplo yed by Funda - men tal ist Lat ter-day Saint (FLDS) leader Rulon Jeffs (1909–2002) to hearten his fol low ers as they con fronted life’s chal lenges. Dave Perrin, a vet er i nar ian, who has authored sev eral other books,1** prac ticed near the FLDS com mun ity of Boun ti ful, Brit ish Co lum bia. In 1982 he mar ried a woman who had bro ken away from the nearby Mor mon funda men tal ist group. Through his con tacts with the FLDS, he met Debbie Palmer and fol lowed her through her expe ri ences with the po lyg a mist fac tion. Keep Sweet gives a brief his tory of Mor mon po lyg amy to 1904 and then jumps ahead to the Mor mon fun da men tal ist movemen t of the 1920s and 1930s (x–xi, 189–90). The Ca na dian con nec tion to Mor mon funda men tal ism be gan in 1947 when a small group of Lat ter-day Saints at Cardston, Al berta, Canada, was excom mun icat ed from the Church for prac tic ing po lyg amy. Trav el ing to Creston, Brit ish Co lum bia, an iso lated area in the southea st por tion of the prov ince not far from the U.S.-Cana - dian border , they formed a new set tle ment called Boun ti ful. Within a few years they aligned them selves with funda men tal ists at Short Creek, Ar i - zona. Leroy John son, the po lyg a mist prophet, vis ited them in 1961.2*** Ray Blackmore be came the first lo cal leader of the group un til his death in 1974.3**** Palmer and Perrin have creat ed a remar kable acco unt of Debbie’s life within the funda men tal ist group. Born in 1955 to Dalmon Oler, Palmer reca lled: “My fa ther had six wives and I have forty-seven brothers and sis ters” (back cover). She reco unts her expe ri ences growing up within that dist inct ive env i ron ment. Her conf licts with her fa ther’s plu- ral wives created immense stress for her. She also reco unts in ci dents of sex ual abuse com mit ted by teen age boys in the com mun ity (74–77), al - though she never ac cuses lead ers or par ents of be ing in volved. Palmer re mem bered early di vi sions within the Ca na dian po lyg a - mist group (14–15, 40–44) but notes a gener al unity sup port ing Leroy Johnson. She quotes an undat ed Blackmore ser mon: “All peoples, Jew or Gen tile, who don’t seek out and come un der the sound rev ela tion of our prophet and rev ela tor, LeRoy Sunderland John son, are in dark ness at noon day, and the great de stroyer, yea even Luc i fer, son of the morn ing, will take them and drag them down into eter nal dam nat ion in the last day” (80). At age fift een, Debbie was dir ectly af fected by a doctr ine unique to

1 ** Don’t Turn Your Back in the Barn (2000), Dr. Dave’s Stallside Manner (2001), and Where Does It Hurt? (2003), all published by Dave’s Press. 2 *** Leroy S. Johnson, The L. S. John son Ser mons. 7 vols. (Hildale, Utah: Twin Cit - ies Cour ier, 1983–84), 7:60. 3 **** Ibid., 7:57, 229. 238 The Journal of Mor mon His tory the FLDS called the “Law of Plac ing.” She relates: “The priest hood breth ren were putt ing a stop to men think ing they could run af ter young girls at will, and were start ing the syst em of ‘placemen t mar riage,’ whereby God would tell the prophet ex actly who each young woman prom ised to marry in the pre-ex ist ence” (5). “The Lord would make the de ci sion and tell the prophet whom we . . . were as signed to marry. Only the prophet would know for sure who was prom ised to us in the spirit world” (249). The Law of Plac ing fig ured prom inen tly in this young girl’s life (5, 63, 163, 189, 198, 202, 203, 204, 215). While Deb bie and the other Boun ti ful po lyg a mists est eemed early Church lead ers Jo seph Smith, Brigham Young, and John Taylor as proph - ets (189), they failed to iden tify the con trast bet ween the law of plac ing and Brigham Young’s 1853 teachings: “I am free, and so are you. My ad- vice to the sist ers is, Never be sealed to any man un less you wish to be. I say to you High Priests and El ders, Never from this time ask a woman to be sealed to you, un less she wants to be; but let the wid ows and chil dren alone.”4+ He also in structed: “When your daugh ters have grown up, and wish to marry, let them have their choice in a husband, if they know what their choice is. But if they should hap pen only to guess at it, and marry the wrong man, why let them try again; and if they do not get in the right place the sec ond time, let them try again. That is the way I shall do with my daugh ters and it is the way I have al ready done.”5++ Obe di ently, Palmer prom ised fun da men tal ist prophet Leroy John- son, “I’ll never marry any one the Lord has not rev ealed to be the right one. I’ll marry any one you in struct me to” (270). For tu nately for her, the man she pref erred was the same man the prophet had se lected. In 1969 at age fif teen, she be came the sixth wife of Ray Blackmore, then fifty-seven. She imme d iat ely became a stepmo ther to thirty-two chil dren, most of whom were older than she. “My old est daught er is my aunt and I am her grand mother” she reca lled. “When I was assig ned to marry my first husband, I became my own step-grandmo ther since my fat her was al ready mar ried to two daught ers of my new husband” (back cover). As a mar ried woman, she ago nized over Jo seph Musser’s Law of Chas tity,6+++ which states that sex ual rela tions are only accept able when a wife is fer tile. Ab sti nence dur ing lac ta tion, men stru a tion, and preg nancy is mandat ed. “This command men t weighed heavily on a woman; if she deceiv ed her husband and did not inf orm him of the proper times, she

4 + Brigham Young, April 8, 1853, Jour nal of Discourses, 26 vols. (Lon don and Liv - er pool: LDS Booksell ers Depo t, 1855–86), 6:307. 5 ++ Fred C. Col lier, ed., Teachings of Presi dent Brigham Young, (Salt Lake City: Col - lier’s Publish ing, 1987), 3:292; dis course given April 16, 1854. 6 +++ On May 6, 1936, the sixty-four-year-old Musser recor ded in his jour nal a strict law gov ern ing sex ual rela t ions in mar riage. These reg u lat ions are ac cepted as stan - dard for many Mormon funda me nt alist s toda y. REVIEWS 239

would be guilty of adul ter at ing the birth ca nal, and the con se quences would be ‘dire and se vere’” (281, see also 300–303). Palmer chron i cles the poi gnant events lead ing up to hus band’s 1974 death of leu kemia, which is where her nar ra tive ends. She was rea s - signed to marry ano ther man and remained in the com mun ity for another four teen years. In 1988 at age thirty-five, she left Mor mon fun da - men tal ism. Palmer and Perrin’s book is a trea sure trove of ac counts of early funda men tal ist lead ers and their deal ings within the group. While many names have been changed, the au thors ret ained the names of Priest hood Counc il members. Funda men t alist minis t er ial contr ibu t ions of men such as Guy Musser, son of Jo seph W. Musser, are recor ded in de tail (83, 118, 202–3, 267, 270, 324). Rich ard Jessop is also men tioned (267, 324) with numer o us refer ences to Leroy Johnson. I feel some skept ic ism about the accu r acy of word-for-word conv ersa tions that oc curred de cades be fore the book’s writ ing. Per haps all read - ers will not find the book “shock ing” as Jon Krakauer as serts on a back-cover endorse ment, but cer tainly I agree that the au thors have cre - ated a “richly det ailed por trait” and “heart-rend ing story” of poly g a mist life in Boun ti ful, Brit ish Co lum bia, dur ing the mid-twen ti eth cen tury. Jenny Jessop Larson, prior to pub lishing her boldly ti tled Brain wash to Hog wash: Es cap ing and Ex pos ing Po lyg amy, had a dream: In my dream I was talk ing to my sis ter who had died. A man’s voice came be tween us like a flash of light en ing [sic]. He said, “I in ter rupt your dream to tell you what to name your book.” I threw my hands into the air as I said to him. “Oh, I’m dream ing! How will I re mem ber it un til morn - ing?” In a very monotone voice he re peated three times, “From Brain - wash to Hog wash.” His voice faded away and I awoke from a sound sleep. (v) The ti tle also ref lects Jenny Jessop’s per sonal response to plu ral mar riage. She was born in 1934 to Vergel Yeates Jessop and Verna Spencer Jessop, mak ing her a niece to Mor mon funda men tal ist leaders Richar d S. Jessop (FLDS Priest hood Counc il) and J. Lyman Jessop (Allred Priest hood Coun cil). She spent her first twelve years in and around Short Creek with the Mor mon fun da men tal ists lo cated there. In 1946, her mother escaped from her po lyg a mous mar riage and took her fam ily to St. George, Utah. Nev er theless, twelve-year-old Jenny con tinued to main tain con tacts with her funda men tal ist friends and fami ly for years. Larson re calls that, af ter her par ents’ ex com mu ni ca tion from the LDS Church in about 1940, “my Mom’s double cousin Mae came into the pic ture” soon af ter ward as her fat her’s plu ral wife (7). She con cluded: “I saw enough of po lyg amy to know that there was al ways a fa vor ite wife. Of course maybe it would n’t be too bad if I could be the first and fa vor ite wife. That way I could carry the man’s name and be his fa vor ite too. 240 The Journal of Mor mon His tory

There weren’t very many first wives who were fa vor ite wives too, the way I saw it. The plu ral wives were usu ally a lot youn ger and pret tier but it didn’t take very many years for them to look as hagg ard and tired as the other wives” (49). In Larson’s po lyg amo us fami ly, her mother, the first wife, was appar ently not the fa vor ite: “If I was a man and had to choose be tween Mae, a litt le young teenag er, and Mom, a sickly woman with a bunch of kids, I don’t think it would be hard to dec ide. Espe c ially if I was forty years old like Daddy was. I know Mom tried to make it work but it was too hard to share her husband with a pretty young girl. Of course Daddy wanted it to work! His spot in the Celes t ial Kingdom de pended on poly g - amy accor d ing to his rel i gion” (20). Al though Vergel had ap par ently supported Verna and her nine chil dren, af ter the plu ral mar riage “Daddy did n’t give us any money so Mom had to get on pub lic wel fare” (21; see also 35). One of Jenny’s Short Creek child hood mem o ries was of “a funny man who built a lit tle one room house out of old tires. . . . His wife was pretty and she had a lit tle baby. That man wouldn’t let his wife wear jew - elry. He’d go around growl ing like a lion. He claimed to be the one mighty and strong. I thought he was mighty odd. His name was Ben LeBaron” (24). Jenny’s mem ory of the 1944 po lyg amy raid when she was ten is an in ter est ing nar ra tive from the child’s perspec t ive, also unique in that she desc ribes her fat her’s tra vails apart from the more famo us fif- teen men who were tried in Phoen ix. Jenny’s fa ther was con victed and in car cer ated in Den ver, Col o rado (61–65). Larson, un like Deb bie Palmer resist ed the “Law of Plac ing”: “God tells men who to marry and yet we’re all sup posed to be his chil dren. No one ever talked about God asking if the girls minded who he had chosen for them. Besides, why did he have to tell it to a man? Didn’t he think girls had ears? I know of quite a few girls who were told who to marry, that did n’t like the idea at all. Even tears did n’t keep them from be ing given to some old gee zer they did n’t want. If its [sic] God’s will and you get your rewar d in heaven you must keep in mind that the more you suf - fer here, the big ger the rewar d in Heaven” (42). Then she added her own com men tary: “Hog wash!” Larson did not live at Short Creek aft er age twelve and does not al - ways spec ify how she knows some of the ep i sodes she de scribes. How - ever, many of her nar ra tives fit other ac counts. For in stance, she states that, af ter at tend ing school through the eighth grade, girls “were sup - posed to get mar ried.” She no ticed the disap pear ance about this time of sev eral girls her age: “It wasn’t hard to fig ure out what happened. When- ever any young girl came up miss ing you au to mat i cally knew she’d been given to some old man in po lyg amy. . . . Aft er sev eral months of ab sence the girl would reap pear car rying a baby. The big mys tery was solved. Many times the girls did n’t even leave town. They would stay un der cover dur ing the day only to sneak out at night to take a lit tle stroll” (30, 34). REVIEWS 241

She also reported: “I’d al ready been told it was all right to marry a first cousin if your last names weren’t the same” (70). By the time Jenny was six teen, even though she was liv ing in St. George, she receiv ed “sev eral mar riage pro pos als from the boys from Short Creek.” The most for mal pro posal came when she was sev en teen and was called out of class to talk to a visi t or wait ing in the hall: I saw an older guy from Short Creek standing there and I sort of sus - pected what it was all about. He asked me to go for a walk so we could talk. As we left the build ing and started walk ing up the side walk, he looked at me and told me the breth ren had sent him down to talk to me about mar - riage. They thought I would make him a good wife and he was sent to pro - pose to me. When he asked me if I would marry him I gasped, “My gosh! I don’t even know you. I mean I know you but we’ve never dated. Be sides I’m not ready for mar riage!” . . . He begged me to go with him out to talk to the breth ren. . . . My thoughts were get ting wild. Who the heck did they think I was any way, some piece of fur ni ture be ing auc tioned off? Well, I had news for them. What right did those old men have trying to con trol my life? . . . What hogwash! (77) Jenny refused to go with him, mar ried a non-pol yg amist at age eight een (79), and kept her dis tance from all rel i gions pro fessing po lyg amy as a tenet. This homespun memoir is full of in ter est ing recol lec tions and the writer’s frustr a tions with po lyg amy be gin ning in the 1940s. The sec ond half of the book con tains more than a dozen vig nettes of other ind iv idu - als who suf fered as a con sequence of FLDS polyg amy. No in dex is pro - vided, but the text is richly supple mented with doz ens of pho to graphs, many never prev i ously publ ished. While it may be dif fi cult to doc umen t some of Jenny Jessop Larson’s asser tions, she has pro duced a fasc i nat ing and en ter tain ing rec ol lec tion that would prove useful to any one in ter - ested in Mor mon fun da men tal ism as prac ticed at Short Creek (later Col- o rado City), Ar i zona. In De cem ber 2001, Kathleen Tracy, a Los An geles–based writer fo - cused her jour nal ist ic att en tion on Mormon pol yg amy. As the aut hor of more than twenty books and as a con tribu t or to numer ous domes tic and in ter na tional mag a zines, she knew a story when she saw one and wrote The Secr et Story of Pol yg amy. Un for tunate ly, it is un likely that stu dents of Mor mon hist ory will find her con tri bu tion very useful. While four chap ters of The Secr et Story of Po lyg amy are de voted to a hist ory of the LDS Church and po lyg amy (19–79), it ap pears that her eye for the sensa tional got the best of her. In ad di tion to a sum mary of the well-known pre-1890 pe riod of Mor mon po lyg amy, she also in cludes a three-page dis cus sion of the al leged connec tion of the Spaulding Manusc ript to the Book of Mor mon (40–42), four pages on the Moun tain Mead ows Mas sa cre (67–70) and four pages on “blood atone ment” (35, 74–76). Her sources in clude a disturb ingly dis pro por tion ate num ber of ac knowl edged anti-Mor mon writ ers (24, 31, 242 The Journal of Mor mon His tory

38, 40, 70, 76, 116), and she claims, “It is ex tremely dif fi cult for any non-Mormon to obtain a copy of the book [Doctr ine and Cov enan ts]” (79). Con cern ing the his tory of con tem po rary po lyg amy, Tracy com mits an er ror that is com mon to es sen tially all his to ri ans doc u ment ing the rise of post-1904 po lyg amy. She skips over the cru cial start-up years of 1904 to 1934 witho ut a sin gle sen tence (80–81).7++++ The de tails she pro - vides are of ten in er ror but in vari ably create a neg a tive view of the LDS Church and its lead ers (115, 118). Echo ing a com mon Mor mon fun da - men tal ist tra di tion not found in the teach ings of LDS Church lead ers, she claims that “a min i mum of three [plu ral wives] was requir ed” (27) and “the more wives you had, the higher your place would be in heaven” (37).8* Un for tu nately Tracy pro vides no ref er ences for such statemen ts as: “In 1978, 70 per cent of the teen age brides [in Utah] were preg nant at

7 ++++ For exam ple in deal ing with the 1904–34 pe riod of rene g ade plur al mar - riages, Rich ard S. Van Wagoner , Mor mon Po lyg amy: A His tory (Salt Lake City: Sig na - ture Books, 1989), 182–85, discusses the 1904–11 conf lict of Apost les John W. Tay- lor and Matthias Cowley with their quor um, then moves imme d iat ely to a discus sion of Lorin Woolley and his claims dur ing the 1920s and 1930s. Ad mitt edly a one-volume his tory may have requi red compr ession; how ever, that cruc ial per iod has been sign ifi can tly negle cted. 8 * Tracy is repeat ing a com mon funda men tal ist trad it ion that equates the blessings of exa lt at ion with the number of wives. Lorin Woolley was appar ently the first to sugg est this idea in 1932: “To be the head of a Dispen sa t ion, 7 wives neces sar y. [The head of] the Pa triar chal Or der must have 5 wives. Pres iden t of the Church—3 wives.” Quoted in Joseph White Musser, “Book of Remem br ance,” 21, holo g raph, n.d., pho tocop y in my posses sion; see also Items from a Book of Re mem brance of Joseph W. Musser (N.p., n.d.), 16; Moroni Jessop, Testi mon y of Moroni Jessop (N.p., n.d.), 2, phot ocop y in my posses s ion. The LeBaron pol yga mi sts in Mexi co appar en tly share this doc trine: “A small per cent age of the lead ers of the sect have be tween five and nine wives, adher ing to the sect’s code of build ing up a ‘quor um.’ Three are needed for a ru dimen tary quor um, five wives are ade quat e for a med ium quor um, but seven and some times twelve wives are requir ed for the high est quo rum of all.” Janet Bennion, Desert Patr iar chy: Mormon and Menno nite Comm uni ties in the Chih uah ua Val- ley (Tucson: Univ ersity of Ar izona Press, 2004), 135. I am una ware that any LDS Church leader ever taught that a greater num ber of wives and pos ter ity equates to greater eter nal glory. Presi den t Wilford Wood ruff’s lett er to Sam uel Amos Woolley, fourth bishop of Salt Lake City Ninth Ward, on May 22, 1888 (bef ore the Man if esto), states that be ing mar ried to two wives consti tuted full com pli ance: “You ask some other ques tions concern ing how many liv ing wives a man must have to fulf ill the law. When a man, ac cord ing to the rev ela t ion, mar ried a wife under the holy or der which God has rev ealed and then mar ried an other in the same way . . . so far as he has gone he has obeyed the law. I know of no re quiremen t which makes it nec es sary for a man REVIEWS 243

their wed dings. And a young woman is more apt to be raped in Utah than she is in Cal i for nia” (119). She also assert s: While civil divorce s in Utah are easily got ten, it is very diffi cult for Mor mon women in general to ob tain di vorces in the Church be cause of the doc trine of ce les tial mar riage. . . . Af ter a civil di vorce, a woman’s “tem ple recom mend” is re voked; in other words, she is then consid ered un wor thy to en ter the Tem ple un til she can prove to the heads of the Church that the di vorce was not caused by adul tery. To do this, the woman has to describe her sexual activ i ties in a series of letters to male church au thor i ties. Once she is deemed wor thy again, she needs to ob tain a “can cel la tion of seal ing” so she does n’t have to spend eter nity with her ex-hus band and so she can re marry in the church. In ad di tion to the can - cel la tion of sealing, Mor mon women have al ways been re quired to ob tain per mis sion from their es tranged part ners and the Mor mon church First Pres i dency be fore be ing al lowed to re marry in a tem ple cer e mony. (115) How ever she pro vides a use ful bib li og ra phy and in dex. Despit e her mis taken view that John Dan iel Kingston is “one of Utah’s most prom i nent Mor mons” (v), she pro vides one of the best in-depth looks at the super-sec ret Kingston fi nan cial em pire cur rently avail able, a gen uine con tri bu tion. She also fur nishes a de tailed though un doc umen ted hist ory of sixt een-year-old Mary Ann Kingston’s or deal (8–18, 85–121, 143–74), who was forced to marry her uncle, Da vid Ortell Kingston. When she tried to es cape, her fat her, John Dan iel Kingston, belt-whipped her un til she fainted. John Dan iel pled guilty and served a seven-month jail sen tence (151, 168). Dav id Ortell fought the charges, was con victed of incest, and was given a four-year prison term (154–81). Tracy also in cludes an in ter est ing his tory of for mer po lyg a mist wives and Tapes try against Po lyg amy founders Carmen Thompson, Laura Chapman, Vicky Prunty, Rowenna Erickson, and Lillian Bowles, recor d ing their frustr at ions with poly g amy and Utah state law enf orce- ment agenc ies (123–42). It appears that Tracy’s lim ited resear ch and bia ses have under - mined the useful ness of the hist ory of plu ral mar riage she pro vides. Nev - er the less, her doc u men ta tion of some con tem po rary prac tices of po lyg - amy, espe cially concer n ing the Kingston clan, will be help ful to any one study ing Mor mon dis sent ers prac tic ing plu ral mar riage to day.

BRIAN C. HALES {[email protected]} is the aut hor of Mod ern Po lyg amy and Mor mon Fun da men tal ism: The Gen er a tions af ter the Man i festo (Salt Lake City: Greg Kofford Books, 2006), the co-au thor with Max Ander son of The Priesthood of Moder n Pol yg amy: An LDS Perspec tive (1992), and is webmaster of mormonfundamentalism.com, a website ded i cated to pro vid ing a hist or i cal and doctr inal exam i na t ion of Mormon funda m ent alist topics.

to have three liv ing wives at a time.” Pho tocop y of typesc ript in my posses sion. 244 The Journal of Mor mon His tory

Susan Easton Black and Andrew C. Skin ner, eds. Joseph: Explor in g the Life and Minis try of the Prophet. Salt Lake City: Deseret Book, 2005. Illus tra- tions, notes, bib li og raphy, index. Cloth: $23.95; ISBN 1-59038-471-7

Re viewed by John C. Thomas

Among the many books pub lished about Jo seph Smith in 2005 is this col lec tion of essa ys, al most all of which were writ ten by facult y members in the Col lege of Rel i gious Edu ca tion at Brigham Young Uni versit y. The com pan ion vol ume to a six-hour ser ies of the same name pro duced by BYU Telev ision (now avail able as a DVD), Jo seph may be use ful for a general Lat ter-day Saint au di ence but it is not es sen tial read ing for in formed read ers. The pro ducer of the com pan ion telev i sion ser ies said that the book emerged be cause “great schol ar ship . . . was go ing into the writ ing” of the script. He also said it would help view ers to “delve deeper into the dif fer ent as pects of Jo seph’s life.”1** I sus pect that most read ers of the Jour nal of Mor mon Histor y would dis agree with his assess men t. The essa ys do not delve very deeply into the Prophet’s life or min istr y, they rarely re- veal or em ploy new sources, and they al most never sugg est or even en- gage new or al ter na tive in ter pre ta tions of fa mil iar events. Some one who views the doc umen tary and then goes to the book to “delve deeper” will prob a bly be dis ap pointed, though the foot notes and bib li og ra phy may of fer help ful leads. The book it self is well con structed, con tain ing thirty-nine chapt ers with endnotes, a sev en teen-page bib li og ra phy, and a twenty-page index. Thirty-nine il lustr a tions by well-known art ists sup ple ment the text, and some of the art may spur as many thoughts and ques tions as do the essays. I see some par al lels be tween the top i cal struc ture of Jo seph and the first twenty-two chap ters of Church Histor y in the Fulness of Times, a sur vey of Mor mon hist ory pro duced by the Church Ed uca tional Syst em. In - deed, the essa ys fo cus on early Mor mon hist ory as much as they do on Jo seph him self. Over all, I think that Jo seph makes a rather slim con tribu - tion to our under stand ing of the Prophet. In fact, two books that Su san Easton Black helped edit years ago seem to probe Joseph Smith in more in ter est ing ways.2*** This new an thol ogy fa vors breadth over depth. That said, some es says do com mun i cate thought-pro vok ing ob ser - va tions: Scott Faulring assert s that Jo seph tran scribed sev eral Nephite

1 ** Mi chael Hunter, quoted in “Jo seph: An Aud io vi sual His tory,” BYU Tele vi - sion, Sept ember 2005, 2. 2 *** Larry C. Por ter and Su san Easton Black, eds., The Prophet Jo seph: Es says on the Life and Mis sion of Jo seph Smith (Salt Lake City: Deseret Book, 1988); Susan Easton REVIEWS 245

“Caractors” from the plates for the ben ef it of Ol i ver Cowdery rather than Mar tin Har ris, as has usu ally been as sumed (94 note 17). Kent Jack - son pro vides a fine-grained nar ra tive of the pains taking pro cess to pro - duce the first edit ion of the Book of Mormon, not ing, for instance, that Egbert Grandin’s em ploy ees placed some “forty thou sand pieces of type” to print a typ i cal six teen-page sig na ture (115 note 13). In Rob ert J. Matthews’s over view of Jo seph’s “trans la tion” of the Bi ble, he reco unts that scribes cop ied the en tire text of the Old and New Test a ments by hand, then later anno tated these manusc ripts as the Prophet stud ied the King James Version and dic tated rev i sions (178–79). Stev en Harper arg ues that early rev ela tions iden ti fied “the main - stream [Amer ican] cul ture,” with its empha sis on self-in ter est and ind i - vid ua l ism, as “the most dan ger ous ‘en emy’” stalk ing the in fant Church. The call to gather, Harper con tends, helped pro tect Lat ter-day Saints against this threat as it requir ed them “to de cide whether to serve them - selves or the Lord” (134–35). Mil ton Backman con cludes that one of the primar y pur poses of the School of the Prophet s was to help mem bers “rec og nize and learn to list en to the Spirit” (171). In his essa y about the call of the Twelve and the Sev enty, Rich ard E. Turley Jr. repor ts that Jo - seph Smith rev iewed, al tered, and appr oved a list of twelve apost les pro - posed by the Three Wit nesses be fore the calls were is sued (233, 239 note 14), and he also shares some in ter est ing pro phetic pred ic tions in reg ard to those calls (230–35). Reid Neilson treats the 1837 fi nan cial cri sis in Kirtland as the “mer id ian of Joseph Smith’s spir itua l ca reer,” ad dressing ques tions about Jo seph’s pro phetic au thor ity be fore and af ter those events that may merit fur ther in quiry (264). Alex Baugh help fully clar i fies the mean ing of Gov er nor Lilburn Boggs’s 1838 “ext er mi nat ing or der.” Though Boggs treated the Mor - mons unfairl y, his or der did not aut hor ize a blood bath, nor did it cause the Haun’s Mill mas sa cre, nor did it al low any Misso ur ian to gun down any Mor mon he met, con trary to per sist ent folk tales. In stead, the gov er - nor used “ext er mi nate” in a manner con sist ent with Web ster’s 1828 dic - tio nary def in it ion—“to drive from within the lim its or bor ders” of his state (292–93). Baugh repr o duces most of Gov er nor Christ o pher S. Bond’s June 1976 statemen t that resc inded Boggs’ or der, branded it un - con sti tut ional, and expr essed “deep reg ret for the injus t ice and undue suf fer ing” it caused. Baugh also notes that Gov er nor Bond first issued his ges ture of goodwi ll to mem bers of the Far West Stake of the Reor g a - nized Church (292–94, 295 note 16). Wil liam Hartley shares Wandle Mace’s poig nant acco unt of a Church con fer ence out side Quincy, Il li nois in May 1839, where the sing - ing of a hymn about Zion deeply moved the Prophet. So recen tly freed

Black and Charles D. Tate Jr., eds., Jo seph Smith: The Prophet, the Man (Provo, Utah: BYU Rel ig ious Studies Center , 1993). 246 The Journal of Mor mon His tory from im pris on ment in Mis souri, “Jo seph was over come” as he con tem - plated the words of the hymn in light of recen t events—“he could scarcely refr ain from weep ing” as he stood to speak (316). Kent Jack son sur veys Jo seph’s Nauvoo preach ing, remind ing us how heavily he rel ied on the Bi ble com pared to mod ern scrip ture and sum ma riz ing key doc trinal con - tri bu tions of those ser mons (371, 373–77). Cynthia Doxey ob serves that one pur pose of the Nauvoo Rel ief So ci ety was to prepar e women for tem ple or di nances (364). Fred Woods dem on strates that the Nauvoo city or dinance on rel ig ious lib erty, rather than serv ing as a cloak for Mor - mon mo nopoly , sprang from Jo seph’s deep-seated views about human agency and rel i gious freedom (380–85). Rich ard Bennett en gages crit ics of the Nauvoo Leg ion, ob serv ing that it dif fered lit tle from other city mi - lit ias in Il linois and that Joseph’s appoin tmen t as lieut enan t gener al by no means sig naled Nauvoo’s in de pend ence from the state’s reg ular chain of command. On the other hand, he ack nowledg es that overlap ping ju- risd ic tion be tween leg ion mem bers and the Nauvoo po lice force and the use of some le gion mem bers to prev ent Jo seph’s extr a di tion to Mis souri prob a bly agg ra vated neighbors’ fears of Mor mon power (394–97). Lastly, Don ald Can non and Zachary Largey con sider what it means to say that the mar tyr dom of a prophet would “seal” his tes ti mony (406–8).

JOHN C. THOMAS {[email protected]} is a mem ber of the ed i to rial board of the Jour nal of Mor mon Histor y and a fac ulty mem ber of the De partmen t of Re li gious Ed u ca tion at BYU–Idaho.

Edwin Brown Firmage and Rich ard Collin Mangrum, Zion in the Courts: A Le gal His tory of the Church of Je sus Christ of Lat ter-day Saints, 1830–1900. Ur bana: Uni versity of Il li nois Press, 1988, xvii, 430 pp. Notes, bib li og ra - phy, index. Pa per: $19.99; ISBN 0-252-01498-7

Reviewed by John S. Dinger

Though pub lished al most twenty years ago, Zion in the Courts is still the au thor ity on the le gal ex pe ri ence of the Lat ter-day Saints. Both au thors are well qual if ied to write this book; Firmage and Mangrum are both accom plished law pro fessors at the Uni versit y of Utah and Creigh ton Uni - versit y respec tively. The book’s pur pose, in the words of its au thors, is to “exam ine . . . Mor mon ex pe ri ences with the civil law and Mor mon at - tempts to im ple ment a church court sys tem” (ix). Though this goal is a lofty one, the au thors are able to achieve it and more. The real strength of the book is plac ing the Mor mons in their nine teenth-cen tury le gal set - ting, which explains why many of the events in their his tory happened the way they did. For ex am ple, af ter grant ing the Nauvoo Char ter in 1840, the Il li - REVIEWS 247

nois State Leg is la ture at tempted to repea l it, be gin ning in 1842 and suc - ceed ing in 1846. Though the Saints were hor ri fied at this ac tion, it was not a new one. The au thors ex plain that these prob lems were al ready being discussed at the time and were not spec if i cally targ eted at Mor mons: “Al though the United States Su preme Court in Charles River Bridge v. War ren Bridge had just rejected the no tion that state leg is la tures could grant charters ir rev o ca ble by later leg is la tures, the 1819 case Dartmouth College v. Wood ward, which had held that a later leg is la ture could not uni - later ally mod ify a char ter granted by an ear lier leg is la ture, still in f lu - enced the thinking of many in state and lo cal gov ern ment” (88–89). Such back ground and con text is im por tant when an a lyzing such Mor mon statemen ts as: “What rel i ance can be placed upon a leg is la ture that will one session grant a char ter to a city, with ‘per petua l suc cession,’ and another session take it away?”1**** In the beg inn ing, the act ions of the Il linois leg is la ture were not di rected only at ha rass ing the Mor mons. There was a pop ular and leg al movemen t to ward repea l ing all charters. It is clear that, when Nauvoo’s was repea led, it was less about le gal ity and more about prej u dice. Zion in the Courts pro vides many sim i lar in stances of con text and backg round for events in Mormon his tory. Zion in the Courts is di vided into three parts, each of which describes a dist inct per iod in LDS leg al hist ory. The first sect ion, “Early Mor mon Leg al Ex pe ri ence,” dis cusses le gal strug gles from the New York pe riod through Nauvoo. The sec ond sec tion, “A Turbu lent Co exis t ence: Church and State Rela tions in Utah,” fo cuses pri mar ily on the le gal is - sues and ef forts relat ed to the prac tice of poly g amy. The third and fina l sec tion, “The Ec cle si ast ic Court Syst em in the Great Ba sin,” dis cusses spec ific top ics in the late ninet eenth cen tury, such as gen tile law, Church courts, disput e reso lu tion, land pol icy, and wat er law. The first sect ion dis cusses many of the court tri als fa mil iar to Mor - mon hist ory, such as le gal com plaints about Jo seph Smith’s trea sure-dig - ging and his lawsuit against Philastus Hurlburt, but also in tro duces law- suits not com monly dis cussed such as the 1835 Pratt v. Howell, in which Parley P. Pratt sued to reco ver dam ages for as sault in Men tor, Ohio: an in di vid ual threw eggs at him while he was preach ing. De spite its some - what comic char ac ter, this seemingl y insig nif ican t case shows that the Saints were will ing to use the court sys tem early on to ad dress wrongs di - rected to ward them. The le gal response to Mor mon po lyg amy has receiv ed sust ained at - ten tion for decades, most no ta bly in Sa rah Barringer Gordon’s award-win ning The Mor mon Ques tion: Po lyg amy and Con sti tu tional Con flict in Nine teenth-Cen tury Amer ica (Cha pel Hill: Uni versit y of North Carolina Press, 2002). Still, the analy sis pro vided by Firmage and Mangrum re -

1 **** Edi t or ial, The Wasp, quoted in Histor y of the Church, 5:306. John Taylor was then The Wasp’s ed i tor. 248 The Journal of Mor mon His tory mains im por tant. While The Mor mon Question deals with so phis ti cated le - gal quest ions of Con sti tu tional in ter pret a tion and the ef fect of the Mor - mon cases on U.S. leg al hist ory, Zion in the Courts is com pre hen sive enough to give the reader the whole story but is also easy to read and un - derstand , even for the ca sual reader. The major strength of the third sect ion is the discus sion of LDS Church courts and how they dev el oped from their or ig ins in high coun- cil courts from the 1830s on. It is es pe cially in ter est ing to see that Church courts face the same is sues of state and fed eral courts: ju ris dic - tion, rules of ev i dence, ap pel late pro ce dures, and en force ment of de ci - sions. This dis cus sion is par tic u larly sig nif i cant in its de scrip tion and anal y sis of ex com mu ni ca tion cases, par tic u larly be cause such re cords are not ac ces si ble to day. The au thors desc ribe, in part, the rea sons for con - duct ing such hear ings: To achieve the twin objec tives of social harmony and persona l righ- teous ness among the Saints, ec cle si as ti cal lead ers wielded sanc tions with some acu ity. The key con cept was re pentance, which usu ally in cluded ask - ing for give ness of the per son or persons wronged. Church lead ers ex - tolled the vir tues of vol un tary rec on cil i a tion, en cour ag ing mem bers to freely re quest and ex tend for give ness to other com mu nity mem bers. Vol - untary recon cil i a tion , even if the threat of sanction s hovered in the back - ground, en hanced so cial har mony by increas ing the chances of a per ma - nent so lu tion. . . . A bishop in an 1883 case . . . “ex pressed his re gret at the neces sity of having to sit in judgment on his brethren . Said he has always endeav ored to bring about a rec on cil i a tion among the par ties be fore pro - ceed ing to trial.” . . . De spite con cil ia tory ef forts, how ever, church courts used their pow ers to en sure they would be taken se ri ously. Mem bers who re fused to appear at the hear ing were disfellowshipped for “con tempt of the priest hood” and were re stored only af ter will ingly sub mit ting to the court’s ju ris dic tion. (288–89) The discus sion of such time-spec ific top ics as wat er law, land pol - icy, and torts will prob a bly have lim ited appea l for the gener al reader. Over all, Zion in the Courts is an ex cel lent study that main tains an en dur - ing appea l both to those in ter ested in Mor mons and the law or, more gen er ally, nine teenth-cen tury Mor mon le gal and so cial his tory. The book’s most sig nif i cant lim i ta tion is that its analy sis ends with 1900. As a law studen t at the Uni versit y of Utah, I was able to take a course from Collin Mangrum when he was a vis it ing pro fes sor. He com mented that he planned to write a second vol ume, cov er ing from 1900 to the pres ent. I sin cerely hope that this pro ject will come to fru - ition. Hav ing Pro fes sor Mangrum’s take on events such as the Reed Smoot hear ings, the Equal Rights Amend ment, the Mor mon as pects of civil rights le gal is sues, and the Church’s cur rent in volvemen t in the anti-gay rights movemen t would be a great ad dit ion to Mor mon scholar - ship.

JOHN S. DING ER {john.ding er@ya hoo.com} is a pros e cut ing at tor ney in REVIEWS 249

Idaho and the ed i tor of a forth com ing volume on the Nauvoo High and City Coun cils.

John W. Welch, ed. The Worlds of Jo seph Smith, A Bi cen ten nial Confer ence at the Li brary of Congress. Provo, Utah: BYU Stud ies, Vol. 44, no. 4 (Spe cial Is sue 2005). x, 316 pp. Pho to graphs, notes, in dex. Pa per: $19.95; no ISBN

Reviewed by Daniel P. Dwyer, O.F.M.

Two hundr ed years af ter his birth, in May 2005, Jo seph Smith was the sub ject of a con fer ence spon sored by Brigham Young Uni versit y and the Li brary of Con gress. The result of the sym po sium was this vol ume of sev en teen papers by men and women from within and out side the Church of Je sus Christ of Lat ter-day Saints. The pa pers are di vided into five cate g o ries, each based on a plenar y session of the con fer ence. Ac - cord ing to the aut hors of the in tro duc tion, Rich ard L. Bushman, James H. Hutson, Rob ert L. Mil let, Rich ard E. Turley Jr., and John W. Welch: Sev eral in ter est ing points of dis cus sion, con sen sus, and di ver gence arose in this con ferenc e. While all agreed that the sincer ity and signif i canc e of Jo seph Smith was not to be doubted, peo ple won dered, Can he best be un der stood in an Amer i can con text or transnationally? Should he be ap - proached through the tools of En light enment ratio nality or Ro man tic sensi bil i ties? How should, or how can, his ef ful gent approach to re li gion be char ac terized? How and why have his sem i nal ideas be come so in flu en- tial in the lives of his many adher ent s? What do his prophet ic insights and prom ises of fer to people today the world over? (x) In four of the five plenar y sessions, a princ i pal pa per was fol lowed by three response pa pers. The one ex cep tion is Part 3, a sin gle es say by Dallin H. Oaks called “Joseph Smith in a Persona l World.” Part 1 is “Jo- seph Smith in His Own Time” with the princ i pal pa per being Richar d L. Bushman’s “Jo seph Smith’s Many His to ries”; Part 2 is “Joseph Smith and the Reco v ery of Past Worlds,” with the princ ipa l pa per being Terryl L. Givens’s “Jo seph Smith: Proph ecy, Pro cess, and Plen i tude.” Part 4, “Jo - seph Smith and the Theolog i cal World,” is based on Da vid Paulsen’s “Jo- seph Smith Chal lenges the Theolog i cal World”; and fi nally, Part 5, “Jo - seph Smith and the Making of a Global Rel i gion,” is led by Douglas J. Davies’s “World Rel i gions: Dy nam ics and Constr aints.” This spec ial is sue also in cludes pho to graphs of a displa y constructe d for the conf er ence. As in any com pi la tion, the qual ity of the papers var ies, but a no ta - ble featur e of this work is the lack of polemic. The appr oach taken to Jo - seph Smith by each of the presen t ers was respect ful. If this is the strong point of this work, it is also a weak ness, for if “all agreed that the sin cer - 250 The Journal of Mor mon His tory ity and sig nif i cance of Jo seph Smith was not to be doubted,” then it is clear that harsh crit ic ism of Smith or doubts about his mo tives were not se ri ously en ter tained. Still, many of the essa ys were thought pro vok ing, and the civil tone of the dis course was refr eshing. Though the focus of this compi la tion is on the person and work of Jo seph Smith, it also ven tures into the related issues of the Book of Mor - mon and Mor mon ism as a po ten tial “world rel i gion.” A fasc i nat ing part of this book for the non-Mor mon reader is found in the sect ions that deal with Smith’s chal lenge to the world of theol ogy. There are in ter est - ing jux ta po si tions of Cath o lic, East ern Or tho dox, Mor mon, and Protestant out looks on au thor ity, de i fi ca tion, Chris tol ogy, mis sion, and rit ual. One en coun ters some in triguing grounds for futur e di a logue among these trad it ions. For ex am ple, from a Catho lic per spec tive, a key sec tion of this work is found in Roger R. Keller’s paper , “Aut hor ity and World wide Growth.” Keller says of his own conv ersion to Mor mon ism: “When I saw that I did not have the aut hor ity [as a Presb y ter ian min ist er] to ad min is- ter the sav ing or di nances of the gos pel of Je sus Christ through the priest - hood of God rest ored by Jo seph Smith, that made all the dif fer ence for us [Keller and his wife], and we be came Lat ter-day Saints” (308). He fur - ther notes: “The retur n of the au thor ity to ad min ist er the sav ing or di - nances of the gos pel is the heart of the Rest o ra tion. Likewise, the loss of the au thor ity, with the loss of the orig i nal Quo rum of the Twelve Apos- tles, is the heart of the apos tasy or ‘fall ing away’ (2 Thessalonians 2:3) that made a res to ra tion nec es sary” (309). Ca thol i cism, Or tho doxy, and Mor mon ism share a com mon concern with au thor ity; and none of these ac cept the Protestant un derstand - ing of sola scriptura. Whether there was in deed a “great apos tasy” there - fore be comes a cru cial is sue. The early post-ap ost olic church should be an area of se ri ous com mon study for schol ars from these three tra di - tions. If the au thor ity of Christ was not lost, the Catho lic and/or Or tho - dox Church would seem to have a claim on Lat ter-day Saints, and Joseph Smith’s “res to rat ion” would be redun dan t at best. If, on the other hand, it were someho w proved that aut hor ity was indeed lost, then Catho lic and Or thodo x Christ ians might find the claims of the Lat ter-day Saints more com pel ling. Like wise, Cath o lic, Or tho dox, and Protestant scrip ture schol ars should en gage some of the in ter est ing points raised in Mar ga ret Barker’s “Jo seph Smith and Preexilic Is ra el ite Rel i gion.” Barker very cor rectly notes that “Latt er-day Saint scholars might have more in common with the more rad i cal el e ments in con tem po rary bib li cal schol ar ship than with the strictly tra di tional and con ser va tive people” (71). While some co op er a tion has taken place in this area, ser i ous scrip ture scholars may wish to be more en gaged with LDS schol ars in the study of the Bi ble; and meth ods of con tem po rary bib li cal schol ar ship might be ex ten sively used to an a lyze the texts of lat ter-day scrip tures. REVIEWS 251

From a hist or i cal point of view, the most fruitful por tion of this work is Part 1, “Joseph Smith in His Own Time.” The aut hors reex am ine Jo seph Smith’s Amer ican con text but make an att empt to situ at e Joseph Smith in the broader cur rents of world hist ory. Richar d L. Bushman issues a sort of chal lenge in this reg ard: “It is doubt ful that a purely Amer i - can hist ory of the Mor mon prophet will explain him. His mind ranged far bey ond his own time and place, and we will have to fol low if we are to un derstand . A small hist ory will not ac count for such a large man” (18). This compi la tion is based on the his tor ica l recor d, but much of it is de voted to philo soph i cal and theo log i cal re flec tions on the pres ent and the futur e. There is lit tle in the way of new inf or ma tion about Jo seph Smith. Ob vi ously, de spite the pos i tive con tri bu tions that this work makes, hist o ri ans will con tinue to ask ques tions of fact, and will search for ev i dence that might, once and for all, solve the enigma that is Jo seph Smith—for the ba sic ques tions still remain. Did Joseph Smith write the Book of Mor mon? Did he rea lly have writ ings of Abraham and Moses in his pos session? Can the Book of Mor mon some day be proved true, or def i nitely dis proved? The ev i dence may never be persua sive for all. In the fi nal analy sis, hist o ri ans, like all other men and women, will have to wrest le with the pe ren nial and com plex rela tion ship be tween faith and rea son. Nev er theless, this vol ume pres ents the work of ded i - cated schol ars who are will ing to en gage each other with can dor, mu tual respect and se ri ous thought. That, in it self, makes this a worthwhi le, and some times ex cit ing, work.

DAN IEL P. DWYER, O.F.M. {[email protected]} is a Cath o lic priest and a Fran cis can friar. Born in Schenectady, New York, he earned his doc tor ate in hist ory at Tulane Univ ersit y in New Or leans in 1995. He is a member of the Mor mon His tory As so ci a tion and an associate professor of history at Siena Col lege in Loudonville, New York.

John P. Hatch, ed. Danish Apos tle: The Di a ries of Anthon H. Lund, 1890–1921. Sig nif i cant Mor mon Di a ries Se ries. Salt Lake City: Sig na ture Books in as so ci a tion with the Smith-Pettit Foun da tion, 2006. lxxiv + 822 pp. Chronol ogy, char ac ters, photo graphs, notes, in dex. Cloth: $100 (lim - ited edi tion); ISBN 1-56085-185-6

Reviewed by Richard D. Ouellette

Dan ish Apos tle is the tenth vol ume in the Sig natur e Books ong o ing Sig nif - i cant Mor mon Di a ries Se ries. This in valu able se ries has pro vided re- searchers with pub lished edit ions of some of the most im por tant pri - mary sources in Mormon, Utah, and West ern hist ory. A major ity of the vol umes is sued thus far have fo cused on those crit i cal tran si tional de - 252 The Journal of Mor mon His tory cades be tween 1890 and 1920 when the U.S. gov ern ment forced the Church of Je sus Christ of Lat ter-day Saints to aban don po lyg amy and theoc ra tic pol i tics. To date, the ser ies includes such per ti nent recor ds from that pe riod as the jour nals or memoirs of Reed Smoot, B. H. Rob- erts, Rudger Clawson, John Henry Smith, and James Henry Moyle. To this impr essiv e lineup, John P. Hatch now adds the dia ries of Anthon H. Lund, one of the era’s most valu able recor ds. Anthon H. Lund has been largely forg ott en. Litt le has been writ ten about the man. He pub lished few works, never founded a set tle ment, never served as Church presi dent, never held a prom i nent po lit i cal of - fice, and rarely, if ever, stirred con tro versy. Yet Lund served in the First Presi dency for al most two de cades. He was some thing of a pi o neer for in ter na tional Mor mon ism, par tic u larly Scan di na vian Mor mon ism. He worked be hind the scenes to shape some of the Church’s most last ing hist or ica l and theolog ica l works. He wielded substan tial clout as a pol it i - cal, finan c ial, and edu ca tional powerbr oker. And he worked tirelessl y to dampen fires of con tro versy that en gulfed those around him.1+ Lund was born in Den mark in 1844, only weeks bef ore the mur - der of Jo seph Smith. He was raised by his grand mother aft er the un - timely death of his young mother. Fol lowing the exam ple of his un cle, Lund joined the LDS Church on his twelfth birthda y. He was a preco - cious young man with a gift for lang uages and a read ing abil ity far beyond that of his peers. While still in his mid-teens, he served a pros ely - tizing mission in which, among other respon si bi l i ties, he read Engl ish to Dan ish mem bers and presided over the Aalborg Branch. In 1862 he emi g rated with his grandmo ther to the United States and sett led in Sanpete County, Utah, a stronghold of Scand ina vian Saints. He was just eigh teen. Over the next quar ter-cen tury, Lund taught school, mar ried Sa rah Ann (“Sanie”) Pet erson, ac quired U. S. cit i zen ship, raised a large fam ily, served in the Utah Ter ri to rial Leg is la ture, com pleted sev eral mis sions, and served as pres i dent of the Scan di na vian Mis sion. In 1889, to the sur - prise of vir tu ally ev ery one, the Quo rum of the Twelve Apost les se lected the rel a tively unk nown Lund to replace the late Erastus Snow, the apos -

1 + For recen t biog raphi ca l essa ys, see Jennifer L. Lund, “Out of the Swan’s Nest: The Min is try of Anthon H. Lund, Scan dina vian Apos tle,” Jour nal of Mor mon His tory 29 (Fall 2003): 77–105, and “Anthon H. Lund: Counselor to Joseph F. Smith and Heber J. Grant (1901–21),” in Michael K. Winder, ed., Coun selor to the Prophet s (Roy, Utah: Eborn Books, 2001), 250–73; Bruce A. Van Orden, “Anthon H. Lund: Gent le Danish Apost le,” in Pi o neers in Ev ery Land, ed ited by Bruce A. Van Orden, D. Brent Smith, and Everett Smith Jr. (Salt Lake City: Bookcraft, 1997), 163–82. For bio- graphi ca l det ails of Lund’s life, see D. Mi chael Quinn, The Mormon Hier ar chy: Exte n - sions of Power (Salt Lake City: Sig natur e Books in as soc ia t ion with Smith Resear ch As- so ci ates, 1997), 666–67. REVIEWS 253

tle who opened the Scan di na vian mis sion in 1850. As a new apost le, Lund be came Church Hist o rian, su per in tenden t of the LDS Board of Ed - uca tion, and presi dent of the Manti Tem ple, the Eur o pean Mis sion, and the Utah Ge nea log i cal So ci ety. In 1901, Jo seph F. Smith, the new Church presi dent, selected Lund as his second coun selor. Lund subse quen tly became a lead ing fig ure in many of the Church’s finan c ial and edu ca tional insti tut ions—ZCMI, LDS Univ ersit y, Zion’s Sav ings Bank, Utah Na tional Bank, Knight Sugar, and the Ho tel Utah. In 1910, Lund became Smith’s first coun selor, replac ing the late John R. Winder. While ret ain ing many of his pre vi ous re spon si bil i ties, Lund now be came pres i dent of the Salt Lake Temple, the State Hist or ica l So ciet y, Amal gam ated Sugar, and Con- sol idat ed Salt, and a member of the com mission oversee ing the construc - tion of the state capitol. Dur ing his de cades of ser vice, Lund also served as an ed i to rial sound ing-board for the Church’s best hist o ri ans and theo lo gians: An - drew Jenson, B. H. Rob erts, James E. Talmage, Charles W. Penrose, and John A. Widtsoe. Their col lab o ra tion result ed in such last ing works as The Histor y of the Church, The Ar ti cles of Faith, and Je sus the Christ. Rec og - niz ing Lund’s ex em plary sev en teen years of ser vice to Jo seph F. Smith, in 1918 the new LDS pres i dent, Heber J. Grant, ret ained Lund as first coun selor. As the lon gest-serv ing mem ber of the Twelve be hind Grant, Lund stood next in line to be come Church pres i dent. But he died in March 1921 from com pli ca tions as so ci ated with a du o de nal ul cer. Among his ap ost olic breth ren in the Quo rum of the Twelve and the First Pres i dency, Anthon H. Lund was some thing of an anom aly. At the time of his or di na tion in 1889, his col leagues were all na tive-Eng - lish-speak ers from England, Canada, and the United States. Few could speak other lang uages. Those who hadn’t been reared as Mor mons came from An gli can, Meth od ist, Pres by te rian, or Con gre ga tion al ist back- grounds. With out ex cep tion, all were prac tic ing po lyg a mists. And aside from George Teasdale, all were related to one an other through blood or mar riage.2++ In con trast, Lund came from Den mark, a non-Eng lish-speak - ing coun try. He knew sev eral Eu ro pean lan guages. He came from a Lu - theran backg round, was a lifelong mo nog amist , and had no kin among the apos tles. Rather than spec u late on mil len nial or doc trinal mat ters like some of his ap ost olic prede ces sors, moreo ver, Lund pref erred to fo - cus on the tem po ral pro grams and prog ress of the Church. And while some of his col leagues were reg u larly embr oiled in per sonal, rel i gious, and po lit ica l con flicts, Lund was consid er ed a peacemak er who, despit e his unwa ver ing com mitmen t to the Mor mon Church and the Repub l ican Party, fost ered co mity among ad versar ies. Lund, in ef fect, em bod ied

2 ++ Thomas G. Alex an der , Mor moni sm in Tran sition: A Histor y of the Latter-da y Saints, 1890–1930 (Urbana: Univ ersit y of Il li nois Press, 1986), Tables 1–2, 311–12; Quinn, Mormon Hier ar chy , Appen d ix 2, 641–725. 254 The Journal of Mor mon His tory

Mor mon ism’s tran si tion from the com bat ive, tribal, po lyg a mist, and mille nar ian idea ls of the Great Ba sin Kingdom to the assim i lated, in ter - na tional rel i gion of the twen ti eth-cen tury. He was, in a sense, a pi o neer of mod ern Mor mon ism. As Hatch explains in the in tro duct ion to Dan ish Apos tle, the dia ries of Anthon H. Lund number forty-one vol umes and span some six de - cades, from 1860 to 1921. Lund wrote spo rad i cally dur ing the first three de cades, but became a some what reg u lar, if terse, di a rist in 1890. Fol lowing his 1898 mission to Pal est ine, how ever, his en tries impr oved dra mat i - cally in both de tail and reg u lar ity. Over the remain ing twenty-three years of his life, Lund pro duced one of the great Mor mon dia ries. In the 1970s, five de cades af ter his fat her’s death, George Can non Lund do - nated the di a ries to the LDS Ar chives with the stip ula tion that they must be open for resear ch. They quickly be came a piv otal source. D. Michael Quinn cited Lund repeat edly in “The Mor mon Hi er ar chy, 1832–1932: An Amer i can Elite” (Ph.D. diss., Yale Uni versit y, 1976). And the di a ries proved in dis pens able to Thomas G. Al ex an der’s sem i nal Mor mon ism in Tran sition: A His tory of the Lat ter-day Saints, 1890–1930. Anthon H. Lund stood at the epicen ter of rel ig ion, pol it ics, fi - nance, ed u ca tion, and his tor i cal schol ar ship in Utah. And be cause he was an in tel li gent, pas to ral, and con cil ia tory man, in di vid u als of all stripes came to him with their in ter ests and con cerns. Read ers will there - fore find a bonanza of inf or ma tion and anec do tes in Dan ish Apos - tle—some mov ing, some funny, many fasc inat ing. I’ll list but a few: George and Abra ham Can non’s vis ceral reac tion to the death of their son and brother (8-9); the strip ping of Moses Thatcher’s priest hood and apos tle ship (24); Apost le Frank lin D. Rich ards’s ev i dence for an 1830 rather than 1829 dat ing of the Melchizedek Priest hood rest o ra tion (28); Lorenzo Snow’s expla na t ion for the or ig ins of his couplet, “As God was—so man is. As God is so man may be” (31); Lund’s loss for words over the Scofield min ing di sast er (83); the dis cov ery of Jo seph Smith’s earl i est jour nal (89); the clash be tween Presi dent Jo seph F. Smith and Lorenzo Snow’s heirs (162–63); foot races be tween Lund, his breth ren, and their wives (242–43); the debate over a sec ond man i festo on plur al mar riage (271); Lund’s vigor ous de fense of women’s suf frage (411–12); Lund’s refusa l to al low deposed apos tle Matthias Cowley to bless his son (413); the em bar rassing applause Joseph F. Smith and compan y receiv ed at a wres tling match (454); Gov er nor Wil liam Spry’s and Bishop Charles W. Nibley’s ef forts to get LDS lead ers to withdr aw their suppor t for a pro hibi tion bill (569); LDS leaders ’ reac tion to Jo seph F. Smith’s vision of the spirit world (710, 713); and Patr i arch Hyrum G. Smith’s ef fort to have his of fice sust ained be fore that of the pres i dency (723). Suf fice it to say, there is a plethor a of sto ries and inf or ma tion here. Hatch sug gests that Lund wrote his di a ries “as if he were speak ing to a close friend” (xxxvi). The dia ries served as an out let for gossip, crit i - cisms, and ob ser va tions that the dip lo matic Lund would have shared REVIEWS 255

with few others. In 1901, for exam ple, shortly aft er Jo seph F. Smith suc - ceeded Lorenzo Snow as LDS presi dent, Lund had this to say about one of Brigham Young’s more color ful sons: John W. Young was in the office. He told me about how much money he spent in Wash ing ton [D.C.] in or der to in flu ence opin ion in our fa vor. I have my doubts on this mat ter. I have heard that large sums we[re] placed in his hands and there had been no ac count ing. As he has no idea how he spends money, and he spent a for tune[,] he has an idea he spent it for the Church. I have an idea that he thought Brigham [Young Jr.] was the right - ful succes sor to Prest. [Lorenzo] Snow and that he came ex pecting to ma - nip u late his brother in fi nan cial mat ters. (157) Lund com mented on an ex hibit at the state fair: “We saw Bro. C. C. A. Christensen’s pic ture. We could tell it was his as soon as we saw it for he has lit tle versa til ity while his idea is good” (92). He wrote of Apos- tle-Sen a tor Reed Smoot: “I wish he would quit using his put on twang in speak ing” (485). And of Apost le Heber J. Grant’s busi ness acu men he re- marked: “How many schemes rev olve in his head!” (99). Though can did, Lund was also a pru dent di a rist. He recor ded the most sen si tive in for ma tion in short hand or for eign lan guages. In Oc to - ber 1896, for in stance, Apost le Lund wrote: “I was ap pointed a mis sion to go and see the Sevier and Panguitch [Utah] Stake and work with the lead ing men for {elect ing Pres Geo. Q [Can non] as our Sen a tor [Dan - ish]}” (23). In 1908, dur ing the LDS lead ership’s be lated crack down on new plu ral mar riages, Lund noted: “A man from Idaho asked {if his daugh ter could go in as a sec ond wife. The pres i dent said any one whom she took will be cut off from the Church. [short hand]}” (375). Lund ap - par ently deemed some mat ters too con tro versia l to recor d at all, even in a for eign lan guage. Cir cum stan tial ev i dence in di cates that in 1897–98, sev eral years af ter Wood ruff’s 1890 Man i festo with draw ing of fi cial sup - port for new plu ral mar riages, the loyal Lund sol em nized two clan des- tine plu ral mar riages at Wood ruff’s reques t. Lund men tioned nei ther event in his di ary. His pen fell com pletely and conspic u o usly si lent dur - ing the trip to souther n Cal i for nia to per form the first seal ing.3+++ Sig na ture Books ob vi ously could not pub lish all 8,720 pages of the Lund di a ries. John P. Hatch had to de cide what to in clude and exclude and theref ore fo cused ex clu sively on the three decades Lund served as a Gen eral Aut hor ity. Read ers in ter ested in the first thirty years of Lund’s dia ries will still need to con sult the holo graph. Hatch fur ther lim its the pa ram e ters by con cen trat ing on “en tries fo cused on meet ings with other LDS lead ers or prom i nent Utahns” (6). As a result, read ers will find lit tle here about Lund’s mar riage, fam ily, and the sun dry trips and mis sions he took as a Gen eral Au thor ity—the 1891–93 Manti Tem ple pres i dency,

3 +++ B. Carmon Hardy, Sol emn Cov e nant: The Mor mon Po lyg a mous Pas sage (Ur - bana: Univ ersit y of Il li nois Press, 1992), 223–25. 256 The Journal of Mor mon His tory his 1893–96 Eu ro pean Mis sion pres i dency, the 1898 trip to Pal est ine, the 1903 excur sion to Can ada, the 1909 trip to Eu rope, or the 1919 ded i ca - tion of the Ha waii Tem ple. Given that Lund spent much of his early apost le ship away on missions and didn’t write many det ailed en tries at the time, Hatch de votes just thirty-five pages to the di ary en tries dated be tween 1890 and mid-1898. All in all, then, Dani sh Apostle has a def in ite the matic and chro no log i cal con cen tra tion: It fo cuses on Lund’s meet ings with prom i nent re li gious, fi nan cial, po lit i cal, and ed u ca tional fig ures in Utah dur ing his de cades as an apos tle and counselor , par ticu larl y the years 1898–1921. Hatch’s par ame ter s seem reason abl e. Witho ut exclud ing much of Lund’s life and min istr y, the size of the book would have been pro hibi - tive. Given the clar ity of Hatch’s pa ram et ers, moreo ver, a pub lisher could eas ily sup ple ment Dan ish Apos tle with Lund’s mis sion di a ries or Lund’s pre-apos t olic di a ries. Hav ing said that, I must say that I (and prob a bly Hatch as well) wished that Lund’s mis sion and travel en tries could have been ret ained. Hatch in cludes three in triguing en tries from Lund’s Pal es- tin ian mis sion that left me want ing more (41–42). And given that Apos- tle Matthias Cowley sol em nized a clan dest ine plu ral mar riage in Big Horn, Wy o ming, dur ing Lund’s brief stop over with Jo seph F. Smith, I would like to have known what Lund wrote dur ing that visit.4++++But again, these are events left for an other book (hope fully). Within the par ame t ers that Hatch has set, I am not fully qual if ied to as sess his se lec tion of en tries, for I have not read Lund’s un abridged di a ries. What I can say, how ever, is that his se lec tion pro cess seems con - sist ent through out. Many of the same sub jects ap pear again and again—plu ral mar riage, coun cil meet ings, elec tion days, pro hi bi tion, the Utah State Capitol Com mission, and so on. There weren’t many en tries that did n’t broach a sub ject dis cussed in an ear lier or sub sequen t en try. Given this top i cal con ti nuit y, I was gener ally, if not al ways, capa ble of fol - lowing Lund’s report ing of events. To pro vide a less sub jec tive assess men t of Hatch’s se lec tions, how - ever, I’ve com pared Dan ish Apos tle with some of the sec ond ary schol ar - ship on Lund’s era to det er mine if the book includes diar y en tries that schol ars have found use ful. What I’ve found is that Hatch pro vides an im - pressiv e num ber of such en tries on a wide range of subject s. He in cludes Lund’s ironic 1901 ob ser va tion con cern ing LDS lead ers’ po lit i cal pref er - ence: “In reg ard to a sen a tor[, Thomas] Kearns is thought to be the man who can do us the most good; but what a man to send east! It will be a

4 ++++ D. Mi chael Quinn, “LDS Church Aut hor ity and New Plu ral Mar riages, 1890–1904,” Di alog ue: A Jour nal of Mor mon Thought 18 (Spring 1985): 94. Lund later wrote about the matt er on Decem ber 1, 1910, an en try that Hatch pro vides (p. 445). REVIEWS 257

bit ter pill for many to swal low” (101).5*He in cludes Lund’s dis plea sure at the 1903 dec i sion to up grade the name of di minu t ive Brigham Young Acad emy to Brigham Young Univ ersit y: “I hope their head will grow big enough for the hat” (248).6**He in cludes Lund’s 1903 response to the warn ing that a sugar fac tory pro posed for Cache County would com pete with the Church-af fil i ated sugar trust: “I was afraid greater harm would be done if the people should get an idea that Pres. Smith would hinder our peo ple from start ing in dustr ies for fear of the Trust” (237).7***He includes Presi dent Jo seph F. Smith’s 1910 instr uc tions to the Twelve con - cern ing a pro hibi tion bill: “He said: ‘Yes, I want the breth ren to say nothing of State wide pro hibi tion. We may get lo cal op tion and I think that is the best we can do.’ I brought the Coun cil his mes sage, and quite a dis - cus sion arose. {Three apost les were very cha grined [French]}” (438).8**** Given Dan ish Apos tle’s in clu sion of many of the ref er ences schol ars have found notew or thy, I would con clude—again, speak ing as some one who has not ex am ined the orig i nal di a ries—that Hatch has ad mi ra bly per - formed the oner ous task of par ing down forty-one jour nal vol umes to a sin gle book. None theless I found some ci ta tions that Hatch did n’t, but per haps should have, included. I’ll cite one exam ple. On Decem ber 1, 1897, as Lund prepar ed for his mis sion to Pal est ine, he recor ded: “Pres i dent Woodr uff took me to one side and spoke to me concern ing Mrs. Mountfert. I was rather ast on ished.” On the ba sis of this and other pieces of ev i dence, D. Michael Quinn and B. Carmon Hardy suspect that Wilford Wood ruff inf ormed Lund he had been sealed to Madam Lydia Mountford the prev i ous Sep tember in a clandes t ine plur al mar- riage.9+How ever, Wood ruff’s bi og ra pher, Thomas G. Al ex an der, thinks Mountford and the LDS leader were good friends rather than part ners in plu ral mar riage. He in ter prets Lund’s ast on ish ment as a sense of sur - prise that Mountford, a Pal est in ian Christ ian, would ac com pany him and his compan ion to Pales t ine.10++ Un for tu nately, while Hatch re tained an ear lier fore shad ow ing of the Wood ruff-Lund con ver sa tion dated No vem -

5 * Quoted in Alex an der , Mormon i sm in Transi tion , 17, and Quinn, Mormon Hier - ar chy, 354–55. 6 ** Quoted in Alex an der , Mormon i sm in Transi tion , 166, and Gary James Bergera and Rona ld Priddis, Brigham Young Uni ver sity: A House of Faith (Salt Lake City: Sig natur e Books, 1985), 13. 7 *** Quoted in Alex an der , Mormon i sm in Transi tion , 79. 8 **** Quoted in Brent G. Thompson, “‘Stand ing be tween Two Fires’: Mor mons and Pro hi bi tion, 1908–1917,” Jour nal of Mor mon His tory 10 (1983): 42. 9 + Quoted in Quinn, “New Plu ral Mar riages,” 62–65; Hardy, Solem n Cove nant , 227–32. 10 ++ Thomas G. Alex an der , Things in Heaven and Earth: The Life and Times of 258 The Journal of Mor mon His tory ber 18, 1897 (41), he did n’t include the Decem ber 1 en try. What ever the truth of the mat ter, I think the de bate over this pas sage ren ders it im por - tant enough to in clude in Dani sh Apostle . Unf ortu nat ely, while Hatch re - tained an ear lier fore shad ow ing of the Wood ruff-Lund con ver sa tion dated No vem ber 18, 1897 (41), he did n’t see fit to in clude the sub se - quent Decem ber 1 en try. Hatch men tions the Mountford con tro versy and ac tu ally quotes part of Lund’s De cem ber 1 en try in the in tro duc tion, but I think it should have been included in its en tirety in the main body of the work.11+++ Hatch pro vides a sturdy schol arly scaf fold ing for Dan ish Apos tle. The in tro duc tory essa y is out stand ing; it gives the reader a firm grasp of Anthon H. Lund’s life, fam ily, and con tri bu tions, as well as a sense of what to expect from the dia ries. My one crit ic ism here is that Hatch does n’t say enough about his own la bors with the di a ries. Did he work with the orig i nal Lund di a ries at the LDS Church Ar chives, with D. Mi- chael Quinn’s transc ript ion at Yale’s Beinecke Libr ary, or with a private copy pro vided by the Lund fam ily? If he completed the bulk of his la bors at the LDS Church Ar chives, did he work with the orig ina l dia ries, the mi cro film copy, or the typesc ript? Who translate d the short hand and for - eign lan guage en tries? And from whom did he obt ain per mission to pub - lish the dia ries? Besides the in tro duct ion, Hatch also pro vides a chro nol - ogy of Lund’s life and bio graph i cal sketches of prom i nent fig ures men - tioned in the di a ries, both of which are quite help ful, though the lat ter could have been more de tailed. The in dex, while gener ally ade quat e, has more than a few oversight s. I found ref er ences to John M. Can non on some pages (224, 243, 344) unl isted in the index. Fina lly, Hatch sup plies first-rate explan a tory footno tes to help the reader un derstand cer tain di - ary en tries. He ren ders com pli cated sub jects com pre hen si ble and ad - dresses historiographical ques tions with skill. I found the footno tes so useful I wished there were more. On av er age of about twice per chap ter I found myself wishing for a footno te to help me better under stand Lund’s com ments. The presen ta tion of the di a ries is im pressiv e. We’ve grown ac cus- tomed to Ray Mor ales’s handsome desig n for the Sig nif ican t Mor mon Dia ries Ser ies. Con nie Dis ney’s Basker ville font is a plea sure to read. I sat with the book for long pe ri ods at a time and never expe ri enced eye-strain. The col lect ion of pho to graphs, not a standar d featur e of the ser ies, is a won der ful ad di tion. They enable us to vi sua l ize Lund, his fam -

Wilford Woodr uff, a Mor mon Prophet (Salt Lake City: Sig natur e Books, 1991), 324–29, 431–32 note 85. 11 +++ Quinn, “New Plur al Mar riages,” 90 note 323 and 92 note 328, cites two other Lund en tries that, I would ar gue, should also have been included in Dani sh Apos tle. Hatch al ludes to one (on p. 113 note 6) but doesn’t include it in the main text. REVIEWS 259

ily, and the First Presi dency as we read along, al though I think pho to - graphs of the Quo rum of the Twelve cer tainly, and per haps Lund’s most im por tant po lit i cal and busi ness as so ci ates as well, should have been in - cluded. Fi nally, I found remar kably few typo graph i cal er rors for a book of this size and a text of this com plexit y. John P. Hatch, Sig natur e Books, and the Smith-Pettit Founda t ion are to be com mended for this work. Short of read ing Anthon Lund’s un - abridged dia ries in the LDS Ar chives, any one studying the end of pio - neer Utah and the be gin nings of mod ern Mor mon ism should read Dan- ish Apos tle.

RICH ARD D. OUELLETTE {[email protected]} holds a B.A. in hist ory from the Univ ersit y of Utah. He is the au thor of “Mor mon Stud ies,” Re li gious Stud ies Re view 25, no. 2 (April 1999): 161–69, and “Zion’s Gal lows: The Cul tural Ge og ra phy of the Mor mon Tem ple Lot Site,” Jour nal of the John Whitmer His tor i cal As so ci a tion 25 (2005): 161–74.

Carol Cornwall Madsen. An Advo cate for Woman: The Public Life of Emmeline B. Wells, 1870–1920. Provo, Utah: Brigham Young Univer sity Press/Salt Lake City: Deseret Book, 2006. xiii, 498 pp. Pho to graphs, notes, in dex. Pa per: $21.95; ISBN: 0842526153

Reviewed by Claudia L. Bushman

Carol Madsen’s thor ough study of Emmeline B. Wells, one of Zion’s pre- emi nent women, has long been an tic i pated and is greatly ap prec i ated. This careful ly crafted, me tic ulo usly resear ched mono graph sets out to tell “how a young girl from a small mill vil lage in rur al Massa chusett s was able, through the strength of her conv ic tions and de ter mi na tion, to trans form her self into a self-con fi dent, na tion ally known spokes per son for women and for her faith” (2). This life story is a chron icle of success against heavy odds. New Eng land girl, Mor mon con vert, jour nal ist, ac tiv ist, re former, plu ral wife, Church worker, pol i ti cian, and club woman, Wells is de - scribed in her old age as “our litt le, del i cate, great-minded Presi dent [of the LDS Rel ief So ci ety], walk ing softly, yet with fierce in de pend ence into the room” (98). Wells had not al ways been this in de pend ent. She mar - ried three times. Her first hus band de serted her, and their only son died young. She was the plu ral wife of Newel K. Whit ney for his last five years and the mother of two of his chil dren. She later became the sev enth and last wife of Dan iel H. Wells, and they had three chil dren. Then she was a widow for thirty years. This thrice-mar ried mother of six never had a close mari t al rela t ionship. Her feelings of “inad e q uacy, lonel iness, and 260 The Journal of Mor mon His tory con stant long ing for ‘the shelt er and pro tect ion of a strong arm’” (23) forced her into self-rel iance. Be cause Madsen has a su per f lu ity of ma te ri als—thou sands of wor - thy quo ta tions—she has di vided Wells’s publ ic and pri vate lives into sepa - rate vol umes. This publ ic book is then di vided into neat, top i cal chap - ters, each able to stand alone, as sev eral of them have in ear lier versions. Tan ta lizing private facts are dropped into the nar ra tive as neces sar y. Given the wealth of ma ter ial and Wells’s par tic u larly det ailed ex pe ri ence, a com pos ite life story would be too long, but rend ing her life down the middle might have been recon sid er ed. Would a chrono log i ca l div ision have been more suc cess ful? Is not Wells’s endless con cern about woman’s strength a reac t ion to her own abandon men t by her three husbands? This book leaves us hun gry for more persona l life. Al though Wells’s early am bi tion was to write po etry and fic tion, she spent thirty-seven years ed it ing the inf lu en tial Woman’s Ex po nent, the ac com plish ment for which she is best known. The jour nal was the ef fec - tive publ ic voice of Mor mon women. The Ex po nent gave Wells a cause, a plat form, a precar io us livel ihood, and an open ing into pub lic life. Her name first appear ed on the mast head in No vem ber 1875 when she was forty-seven. Two years later, she was the ed i tor and in time the pub lisher, business manag er, and owner, a posi t ion she main tained un til the paper closed in 1914. As ed i tor she de voted much space to the de fense of po lyg amy on moral and soc ial grounds. Plur al mar riage advanced woman’s status by making her less sub or di nate and more inde pend en t with space for per- sonal de vel op ment, she arg ued. “We are not in bond age as [the Gen tiles] sup pose. We are per fectly capa ble of think ing for ourselv es” (52). She also ag it ated for woman suf frage and statehood with suf frage. Aft er plu- ral mar riage was of fi cially dis con tinued in 1890 and suf frage rein stated in 1896, those top ics were ob so lete. Much of this story has been told bef ore in gener al terms. Here the ma ter ial is squarely Emmeline-centric. Madsen’s acco unt of these sto ries with their juicy quo ta tions from speeches, let ters, and sev eral news pa - pers are the strength of this book. The writer is in to tal com mand of her ma te ri als and char ac ters and in cludes de tailed in for ma tion not avail able else where. Her com men tary shows the com plex ity of the vivid play ers working for the suf frage, woman’s rights, and state hood movemen ts of the per iod along with those who op posed them. We tend to deal with the tri um phant sim pli fied versions of these movemen ts. But here each con ven tion and cam paign is desc ribed in det ail. Emmeline Wells and Zina Young Wil liams trav eled to Washing t on, D.C., in 1879 to the Na tional Woman Suf frage Asso ci a tion’s (NWSA) an - nual con ven tion to rep resen t Utah’s women who were in dan ger of los ing the vote they had happi ly ex er cised. Wells and Wil liams were in vited to ad dress the con ven tion. Writes Madsen: REVIEWS 261

Emmeline used this speak ing op por tu nity to chas tise Con gress for seek ing to re move the bal lot from Utah women. “Con gress had better heed what wrong is con tem plated to be done by taking away the only safety they enjoy,” she warned. “The women of Utah have never bro ken any law of that Ter ri tory, and it would be un just as well as im poli tic to de- prive them of this right.” Zina Williams followe d, rein forc ing Emmeline’s mes sage, and asked the women of the con ven tion to aid them in their fight to retain the bal lot. In sup port, Sara Spencer then re minded the au - di ence that the women had been in vited to the con ven tion and added that polyg amy was “pref er a ble to the li censed so cial evil, which is be ing ad vo - cated by many of our bloated pub lic men.” (163–64) The Utah women were well treated, but Zina felt she was viewed as a cur ios it y. “Dear me, what an aw ful thing to be an Ele phan t. The lad ies all look at me so queer,” she wrote in her di ary (163). Wells con sid ered the expe ri ence a great per sonal tri umph and con fided to her di ary,. “I thank God I was the first to rep resen t our women in the Halls of Con - gress” (170). In this piv otal life expe ri ence, she pro moted herself as well as her church and home land. There were many cam paigns, con ven tions, meet ings, and elec tions to which Wells lent her voice, her cor respon dence, her ed i to ri als, and her prest ige. Utah women lost the vote in March 1887, due to the Edmunds-Tucker Act, but such set backs did not stop Wells. At one dis ap - point ing junc ture, when Wells was asked what she would do next, she replied: “We are go ing to do just as we did be fore, only better if we can. . . . We are go ing to la bor in the in ter ests of human ity, in the edu ca tion and el eva tion of women and chil dren; we are go ing to help pro mote the in ter - ests of Zion with all the energy and abil ity we pos sess” (190). In de fat i ga - ble as well as in spi ra tional and won der fully quot able, Wells car ried on. B. H. Rob erts of the First Coun cil of the Sev enty was a thorn in suf fra gists’ side—in clud ing Wells’s—at the Utah con sti tu tional con ven tion for statehood in 1895. By then Utah women had had sev en teen years of the vote and al most a decade witho ut it. Rob erts op posed woman suf - frage. He claimed to reg ard women highly but arg ued that “their in f lu - ence did not come from pub lic plat forms but rather from the hearthside and that the pol it ica l arena could do nothing but deba se them,” a fami l - iar arg umen t even to day. He pris sily claimed that only the most shame- less women would sully them selves by go ing to the polls (283). Wells ex - pressed her disma y in the Ex po nent: “It is piti ful to see how men opposed to woman suf frage try to make the woman bel ieve it is because they worship them so, and think them far too good, and one would rea lly think to hear those el o quent or a tors talk, that laws were all framed pur posely to pro tect women in their rights, and men stood ready to def end them with their lives” (284). This book is full of the lively quo ta tions sur round ing these piv otal events, but the things said were not nec es sar ily those that made the dif - fer ence. Wells worked tirelessly and did, as she said, more work than any 262 The Journal of Mor mon His tory other seven people in act ivi t ies like lobb ying, pet it ioning, sending lett ers, giv ing speeches, and writ ing ed i to ri als. Wells was presen t at the events, but she was not nec es sar ily cen tral. When the del eg ates voted on April 18, 1895, Utah’s con sti tu tion in cluded suf frage, making it the third state where women could vote. But was Wells respon si ble? Pol i tics are very com pli cated and re sults dif fi cult to credit. In 1899, Emmeline Wells, then sixty-nine, went to Washing ton to at tend meet ings of the Na tional Coun cil of Women (NCW) just af ter B. H. Rob erts’s elec tion to the House of Rep resen ta tives. She sensed an i - mus against her because of the wide spread movemen t to prev ent Rob - erts, a pol yg amist , from taking his seat. The di lemma of the women leaders: Should the Na tional Coun cil of Women add its voice to the dis sent - ers, thereby of fend ing the Utah Rel ief So ci ety and Young La dies’ Mu tual Im prove ment As so ci a tion, two char ter and very sup port ive mem bers? Wells’s di lemma: If there was a con dem na tory reso lu tion, should the Utah del eg ates walk out? To com plicat e their dec ision, the Utah women were pri vately ad vised by suf frage leader May Wright Sewall to vote for the anti-Rob erts reso lu tion, a golden op por tun ity for them to gain wider accep ta nce and prestige. In the closed-door ses sion of the res o lu tions com mit tee, Emmeline Wells and Ann M. Cannon, both on the com mit tee, tried to block pas- sage of the anti-Rob erts reso lu tion, sug gest ing the sub sti tut ion of a less persona l reso lu tion. They ac tua lly won the day, but the op po si tion de - manded that their neg a tive views also be presen ted in a mi nor ity reso lu - tion at the gen eral meet ing the next day.

Fi nally, af ter the lengthy dis cus sion, a vote was taken on the mi nor ity [anti-Rob erts] res o lu tion. It was de feated thirty-one to six teen, leav ing the ma jor ity [the more mod er ate com pro mise] vote be fore the con ven tion. At this point, Emmeline Wells de cided to speak, de clar ing that “the seat - ing of Mr. Rob erts need not be regarded as any men ace on the part of the people of Utah. Pre vi ous to his nom i na tion,” she explained, “I did all I could to de feat him. I did this as a Re pub li can and a suf fra gist.” But, she contin ued, he had been elected by the cit i zens of Utah and should be al- lowed to take his con gres sio nal seat. She con cluded by ex press ing her re - gret that “the Mor mon ques tion should have been made the main work of the con ven tion.” . . . “There is lit tle doubt,” the Salt Lake Tribune re ported, “that the final result was at tained by the weight of the rep resen ta tives from the Na tional Women’s Re lief So ci ety and the Young La dies’ Mu tual Im prove ment So ci ety of Utah, whose ar gu ments and emo tional ap peals led” to the fa vor able out come. (411) This seg ment is an ex am ple of the Wells-centric fo cus of this book. Many groups opposed Rob erts, and his muted rebuk e by the NCW made lit tle dif fer ence in the fina l outcome of his case. More is said of Rob erts in this book, but I saw no ref er ence to his fail ure to be seated in Cong ress. The ac tion of Wells on her many stages is the fo cus here, not the larger pic ture. REVIEWS 263

Wells con cluded her suf frage work by writ ing the Utah chap ter in the great suf frage his tory ed ited by Su san B. An thony and Eliz a beth Cady Stanton. She went on to be come ac tive in other org a ni za tions such as the Daugh ters of the Rev o lu tion and the Na tional House hold Eco - nomic Con fer ence. She at tended her last suf frage conv en tion in 1902 at age sev enty-four. As the older, de voted ref orm work ers died out, they were replaced by youn ger lead ers who cared less about na tional rela tion - ships and or ga ni zat ions and who granted their sen iors less def er ence. Wells feared that the Mor mons might return to iso la tion, los ing the hard-won respect of their prede ces sors. In a lett er to Susa Young Gates, she la mented, “If our sist ers could only com prehend that we can never be ‘pol ished stones, etc’ witho ut some prep a ra tion—and that we must meet and min gle with peo ple to remo ve prej ud ice” (441–42). When na tional woman suf frage was fi nally att ained in 1920, Emmeline Wells had not only “sur vived to rel ish this mo ment, but through her met ic ulo us recor d keep ing and through her let ters, ed i to ri als, ar ti cles, and di a ries, she [had] left her own per ma nent ac count of this remar kable story” (369). It is a mo ment of tri umph that the au thor, as well as Emmeline, shares with the reader. In 1910 at age eighty-two, Emmeline Wells suc ceeded to the pres i - dency of the Rel ief So ci ety. The Deseret News found her a nat ur al for this job as she had “come to be looked upon well nigh as an or acle, so fami l - iar is she with all [Rel ief Soc i ety] workings down to the small est de tail.” Wells con sid ered this un expected ele va tion to be the “crown ing point” of her work for women (475). How ever, Wells’s Rel ief So ci ety work is scarcely dis cussed and is prob a bly (and sur pris ingly) rel eg ated to the forthcom ing Vol ume 2 on her pri vate life. She presided over Rel ief So ci - ety board meet ings un til a month be fore her death at age ninety-three in April 1921. Wells is less known than her con tem po rary Eliza R. Snow. One rea - son is that Snow has a firm lock on the LDS hymna l and par ticu larl y the doc trine of the Mother in Heaven. For an other, Wells’s pol it i cal and orga ni zat ional in fight ing is too com plex and ephemer al to pro vide the tension, cli max, and success of the long-lived his tor i cal vi gnette. For another, Wells’s major con cerns—the de fense of plu ral mar riage, woman suf frage, Utah state hood, and par tic i pa tion in na tional and in ter na tional clubs—are no lon ger cur rent. Wells was an im por tant ac tor in and chron i - cler of her per iod, and times have changed. But the writer of such per ti nent sen ti ments as these should be remem bered. In 1895, she wrote in her di ary, “I have desir ed with all my heart to do those things that would ad vance women in moral and spir i - tual as well as edu ca t ional work and tend to the roll ing on of the work of God upon the earth” (307–8) At age sev enty, she wrote in her di ary, “I am not sure which is the right course to pur sue but am de ter mined to stand for women” (341). Or, as she wrote to Susa Young Gates in 1909, “I have not fol lowed any one else, but I hope I have kept within the ra dius 264 The Journal of Mor mon His tory of the true light” (459). These are words to remem ber and live by. Emmeline Wells per son i fied the di lemma of women seek ing to de - fine Amer i can wom an hood in the nine teenth cen tury, an ef fort still un - der way in the twenty-first. Wells found strength in her rel i gion, an alien org an iza t ion to many of her suf frage al lies. Mor mon ism, with all its past and cur rent ten sions, is still a seething source of power to those seeking to create their own lives and to de fine them selves against the world. Emmeline B. Wells has long been an exam ple and men tor to these LDS women ex am in ing their past. We owe thanks to Carol Cornwall Madsen for this excel lent recon struc tion of Wells’s work.

CLAUDIA L. BUSHMAN {cmb35@co lum bia.edu} has writ ten about the LDS fe male past in Mor mon Sisters: Women in Early Utah (1976; rpt. Lo gan: Utah State Univ ersit y Press, 1997); Build ing the Kingdom: A Histor y of Mor mons in Amer ica (New York: Ox ford Uni ver sity Press, 1999), and in her most recen t book, Con tem po rary Mor mon ism: Lat ter-day Saints in Mod ern Amer ica (Westport, Conn.: Praeger, 2006). She was the found ing ed i tor of Ex po nent II.

Anita Cosby Thomp son. Stand As a Wit ness: The Bi og ra phy of Ardeth Greene Kapp. Salt Lake City: Deseret Book, 2005. xv, 389 pp. Pho to - graphs, notes, in dex. $22.95 cloth. ISBN 1–59038–488–1

Reviewed by Cherry B. Silver

Stand As a Wit ness is an aut hor ized biog ra phy of a very inf lu en tial women leader in the Church of Je sus Christ of Lat ter-day Saints. The Young Women’s val ues which Ardeth Greene Kapp and her board prepared are still rec ited ev ery week in girls’ classes around the Church. Be - hind these statemen ts, we learn, lies a phi los o phy of persona l de vel op - ment and espr it de corps close to Ardeth Kapp’s own life out look. Born in 1931 and reared in Glenwood, Al berta, Can ada (pop ula - tion 258 in the 2000 census), Ardeth was the third of five chil dren. Her fa ther Edwin (“Ted”) Greene raised cows, tur keys, pigs, and sheep on an eighty-acre farm. Her mother Julia (“June”) Leavitt Greene ran a twenty-by-twenty-foot gen eral store in Glenwood. As might be expected, Ardeth as sisted in the store and helped at home with her youn ger sist ers. Ardeth later said, “I think that I just grew up with a sense of pur pose and plan ning. I learned it from the crops, with Dad plant ing and har vest ing and Mom buying and sell ing” (20–21). Just bef ore her fat her’s death, they talked through ma ter ial for a book, Ech oes from My Prai ries (Salt Lake City: Bookcraft, 1979), “de signed to pro vide life les sons from their expe ri ences as a fa ther and a daugh ter” (234). Feel ings of in ad equac y as a studen t early under mined Ardeth’s self-es teem. She had the grace and REVIEWS 265

humor to translat e pain ful expe r i ences from her own child hood into learning perspec tiv es in Mir acles in Pinaf ores and Blue Jeans (Salt Lake City: Deseret Book, 1977) and The Gentle Touch (Salt Lake City: Deseret Book, 1979) (233–34). When she could not make up elev enth-grade classes missed be cause of her reco v ery from se ri ous ear surg ery, her par - ents ar ranged for her to com plete high school in Provo, liv ing in an apart ment off cam pus. Here she be gan to over come the rep u ta tion of not be ing col lege mat er ial. She grad u ated among the top ten stu dents and was voted “Rep resen ta tive Girl” of the sen ior class (84–85). Be fore she left Glenwood, her fam ily en ter tained four mis sion ar ies, includ ing El der Heber Kapp. Ardeth thought he was won der ful. He wrote in his jour nal, “‘Met the bishop’s daugh ter. She is cute and fun but kind of young’” (69). They met again in Utah aft er his mission. In this sect ion of the biog ra phy, Thompson pro vides sto ries of Ardeth’s spir i - tual awak en ings and persona l growth. Ardeth and Heber mar ried in June 1950 in the Cardston Al berta Tem ple. When chil dren did not come to their mar riage, Heber and Ardeth gradu a lly built a matur e philos o phy for facing diff icul t ies: “We who do not have chil dren can wal low in self-pity—or we can expe r ience ‘birth pains’ as we strug gle to open the pas sagewa y to eter nal life for ourselv es and others,” wrote Ardeth in My Neigh bor, My Sister , My Friend (Salt Lake City: Deseret Book, 1990), 127. “I bear tes ti mony that in stead of wrap - ping our empty and ach ing arms around ourselv es, we can reach out to others. As we do so, one day we can even be able to hold our friends’ babies and rejoice” (quoted 133). Aft er mar riage she worked in stores and busi nesses, man i fest ing en ergy, in ven tiveness, and great in ter est in peo ple. How ever, at age thirty Ardeth receiv ed a prompt ing: “Time is passing. You must return to school and get your de gree” (140). She earned a bache lor’s de gree in el e - men tary ed u ca tion at the Uni versit y of Utah in three years while con tinu - ing to work full time, then be gan teaching fourth grade near their home in Bount iful, Dav is County. While a stu dent, she also taught her ward’s MIA Maids and Lau - rels. Girls who de clared they were too busy to at tend Mu tual were out - matched by Ardeth’s night-and-day schedule. Teacher and girls became friends and co-work ers on an elabo r ate fashion show to raise funds for the stake rec reat ion cen ter: “She later remem bered that in the midst of the fur or of prep a ra tion, she sent a si lent prayer heav en ward, which she repeated ev ery day un til the event was com pleted: ‘Heav enly Fa ther, if you’ll help me to lead these girls suc cess fully through all of this prep a ra - tion to a suc cess ful out come, I prom ise I’ll never get myself in volved in a such a big pro ject again!’ It was a prom ise she was dest ined not to keep” (146). A call ing to the Youth Cor rela tion Com mit tee be gan her ser vice on the gen eral Church level. She also be gan working on a mast er’s de - gree at Brigham Young Uni versit y in the fall of 1968 and grad u ated in 266 The Journal of Mor mon His tory

Au gust 1971 in cur ric u lum de vel op ment along with Car o lyn Rasmus, who became a lifelong friend and later her ad min istr a tive assis t ant when Kapp served as Young Women presi den t. Pres i dent Har old B. Lee called Kapp to be sec ond coun selor to gen eral pres i dent Ruth Hardy Funk when he reor g a nized the MIA in No - vem ber 1972. Sist er Funk desc ribed Ardeth Kapp’s mo dus ope randi: “She loves to be given an as sign ment, with the result s that are expected, then to be left alone to do it” (213). At this point, the bi og ra phy of fers in side views of how gen eral boards ma neu ver through cor rela tion and ap proval pro cesses. When Ruth Funk and her coun sel ors were relea sed in July 1978, Ardeth joined the Stu dent Life Fac ulty at BYU. Pres i dent Jeffrey R. Hol - land asked her to chair the Ad vi sory Com mit tee on Women’s Con cerns. Here the bi og ra pher had a chance to pro vide con text on sec ond-wave fem i nist issues over equal ity of op por tu nity and pay. She does not. She sim ply states that Ardeth took the as sign ment with reluc tance, rea l ized she had much to learn, and worked “on is sues such as up ward mo bil ity for fema le fac ulty” (252). In the spring of 1984, Ardeth felt that an other ma jor Church call - ing was com ing. Two days bef ore April con fer ence, Presi dent Gordon B. Hinckley telephoned, and on Sat ur day Ardeth Greene Kapp was sus- tained as Young Women gener al presi dent. She and her board aimed to give young women a sense of iden tity and “ad di tional rec og ni tion” to coun ter the vagueness of their po si tion in the Church struc ture com - pared to Aaronic Priest hood young men (275). Priest hood lead ers agreed with her appr oach, yet early in her admin istr a tion, they cancelled a Church-wide Young Women satel lite broad cast that had al ready been ap proved. Stunned, she might have pro tested. In stead, she called a spe - cial board meet ing to explain “that an idea might be right, but the tim- ing must be right, too.” With this expe r i ence, she dev el oped a phi los o - phy of loy alty: “I be lieve in who the Breth ren are and I don’t ques tion the rev ela tion they re ceive. . . . I also be lieve that [when] you have a stew ard ship and a re spon - si bil ity, . . . you are a re source to the Breth ren; you’re not ask ing for some - thing that you want. You’re bringing infor ma tion to them to help them guide and direct what they want for the young women of the Church and what you can help facil i tat e. Learning to work with the Brethren is to un - derstand that there’s only one or ga ni za tional chan nel, and it is the priesthood channel.” (277) The new Young Women’s theme and seven val ues were fi nally in - tro duced with great vi sual im pact at a No vem ber 1985 con fer ence car - ried by satel lite broad cast. A year later the first Young Women world-wide cel ebr a tion was held. An est i mated “300,000 young women in 128 na tions launched he lium-filled bal loons with mes sages of test i mony and hope at tached, creat ing a rainbo w of goodwi ll througho ut the world” (297). Bell ring ing was the mo tif of the sec ond world wide cel e - REVIEWS 267

bra tion held in 1989 in recog nit ion of Brigham Young’s call ing his daugh ters to daily devotionals. My husband and I were la bor ing as mis - sionar ies with distr ict call ings in remo te Lubumbashi, Zaire, Afr ica, and worked fran tica lly to lo cate bells for the young women to ring. Those Af- ri can girls in their sanda ls, long, col or ful, wrapped skirts and blouses responded posi tively to the vi brancy of the Young Women val ues. They car ried ban ners as they marched and sang in French “Called to Serve,” em u lat ing the Ta ber na cle pro ces sional which had orig i nally an nounced the Young Women Theme. Since her relea se as Young Women gener al pres i dent in April 1992, Ardeth has served be side her hus band, when he was called as pres i dent of the Can ada Van cou ver Mission and later as pres i dent of the Cardston Al berta Tem ple. She con tinues to hold spe cial as sign ments in Utah. Af- ter working with Ardeth at This Is the Place Her i tage Park, El der M. Rus- sell Ballard com mented, “She has a great sense of his tory and she’s very creat ive. Her mind does n’t slow down. It’s go ing 100 miles an hour all the time!” (355). Later he pred icted, “Ardeth’s name will be number ed among the great women of the Church” (371). Read ers gener ally will en joy this story of a dy namic Mor mon women leader and wel come the book’s hon esty of out look and use of many pri mary sources—journals, in ter views, let ters, and per sonal rec ol - lec tions. In an in ter view, aut hor Anita Thompson explained that she had been in ter ested in trac ing Ardeth Kapp’s jour ney from smalltown Glenwood, Al berta, to Young Women gener al pres i dent. In agreeing to a bi og ra phy, Kapp had instructed her, “When you fin ish I want people to know me, and I don’t want it to be a docu men tary.” So Thompson used a litm us test in select ing mat er ial: if the story made her cry, if the story made her laugh, she used it.1++++ Other than se lect ing, Thomp son does not ap pear to cri tique or ana lyze the ac count she nar rates. Hist ory buffs, theref ore, may be dis ap pointed on three or four counts. No ci ta tions are given, except par en thet i cally in the text and then only for pub lished speeches, books, and scrip ture verses. Al though Ardeth’s early writ ings are sum ma rized on pages 233–34 and later works are men tioned on 311 and 359, no for mal bib li og ra phy lists Kapp’s books and ar ti cles. Hist or i cal facts are hard to pin down. Inst ead of appear ing in chro no log i cal se quence, births, mar riages, and car eers of her sib lings are tucked into chap ters along the way. More conse qu en tially, Anita Thompson does not situ at e Ardeth Kapp’s achievemen ts in any com par a tive con texts. That is left for fu ture bi og ra phers or his to ri ans.

1 ++++ Doug Wright, “Ev ery day Lives, Ev ery day Val ues: In ter view with Ardeth Kapp and Anita Thompson about Stand as a Wit ness: The Bi og raphy of Ardeth Greene Kapp,” Pro gram orig ina lly aired on KSL Ra dio on No vember 6, 2005, also http://deseretbook.com/au thors/au thor-in ter view?au thor_id=4860&interiew_id =3035. 268 The Journal of Mor mon His tory

Hor i zon tally in time, one ought to com pare Kapp’s methods of meet ing so cial chal lenges with lead ers of other nat ional and in ter na tional youth groups. Ver ti cally, one needs to place her in the stream of Lat ter-day Saint youth lead ers. And cer tainly one would want to as sess the ef fect of Ardeth Kapp’s in no va tions on sub se quent YWMIA pro grams. De spite these lim i ta tions, the nar ra tive Stand As a Wit ness of fers useful in sights into the transformational years of the Young Women’s pro gram and into the strengths of its gifted leader.

CHERRY BUSHMAN SIL VER {cherry.sil [email protected]} has a B.A. from the Univ ersit y of Utah, A.M. from Boston Univ ersit y, and Ph.D. from Har vard Univ ersit y in English lit er atur e. She was a mission ar y in Côte d’Ivoire and Zaire, Af rica, with her hus band, Barnard. She be came ac quainted with Pres i - dent Kapp while serv ing on the Rel ief So ci ety gener al board un der Elaine L. Jack (1990–97). Af ter teach ing Amer i can lit er a ture at BYU, she is now an no - tat ing the Emmeline B. Wells di ar ies.

Vickie Cleverley Speek. “God Has Made Us a King dom”: James Strang and the Mid west Mor mons. Salt Lake City: Signa ture Books, 2006. xii, 396 pp. Pho to graphs, maps, notes, ap pen di ces, in dex. Cloth: $34.95; ISBN: 1-56085-192-9

Reviewed by Robin Scott Jensen

In 1930, Milo M. Quaife, ed i tor of both James K. Polk’s and Meriwether Lewis’s di a ries, as well as the his tory of Il li nois by Thomas Ford, published his ten-year work on James J. Strang.1* Quaife un der took the first scholarl y appr oach to the many ques tions concern ing Strang’s life, and his work brought forth new insight s as well as new ques tions; it should still be con sulted as part of any ser i ous study of Strang. Since 1930, more schol ars have ad dressed Strang’s life and his in f lu ence over those who fol lowed him. Vickie Speek has now con trib uted to that body of knowledg e with her new work on Strang, his fol low ers, and his church—the Church of Je - sus Christ of Lat ter Day Saints (Strangites). Speek, an acclaimed jour nal - ist, has been studying Strangism for fift een years. Her study is refr esh- ingly dif fer ent in sev eral ways, but one cruc ial el emen t stands out: Speek em pha sizes the story of Strang’s be liev ers inst ead of fo cus ing solely on Strang him self. As con tro versia l as Strang’s methods of est ab lish ing and

1 * Milo M. Quaife, The King dom of Saint James: A Nar rative of the Mor mons (New Ha ven, Conn.: Yale Univ ersit y Press, 1930). See page 193 of Quaife’s work for the time he spent studying Strangism. REVIEWS 269

runn ing his church may be and as im por tant as it is to un derstand his mo dus oper andi, Speek recog nizes the sig nif i cance of tell ing the un told story of those who held fer vent be liefs in the pro phetic king. Yet like Quaife in 1930, Speek also raises ad di tional ques tions about Strang and his Church. At times the sim i lar i ties be tween the Strangite Church and the Mor mon Church are strik ing. So too are the con tinua l par al lels bet ween Jo seph Smith and James Jesse Strang. Perse cu t ion seemed to constan tly dog the two groups, ene mies from witho ut and op por tun ists and trai tors from within. Both churches grew as a result of mis sion ary work, but each had unique doctr ines that strengthened some mem bers’ test i mo nies and weak ened the resolv e of others. Both lead ers claimed that an gels min is- tered to them, translat ed anc ient recor ds, and be came mar tyrs to their rel ig ion. Speek, like many con tempo r ary Mor mons, had not heard of Strangism or its founder un til she in ad ver tently stum bled across rem - nants of Strangism in Voree, Wiscon sin; how ever, the story she learned has been well crafted in this nar ra tive. Speek char ac ter izes Strang as an in tel li gent and dis cern ing man. Born in New York, Strang was a tal ented young man, prone to in tel lec - tual ac tiv it ies over physi ca l ex er tion. His gift for debat e helped him become a tal ented law yer and news pa per ed i tor. He mar ried Mary Perce in 1836. Like so many of his fel low Amer i cans, he responded to the prom - ise of quick money in land specu la tion far ther west and moved to south- east ern Wis con sin in 1843 where his wife’s fam ily resided. While he was est ab lishing his law prac tice, he beg an inv est ig at ing the faith of Moses Smith, his wife’s rela t ive. Moses Smith had been a member of the Mor- mon Church since shortly aft er its found ing. Strang, ear lier a self-pro - claimed atheist or ag nost ic, was driven to in vest ig ate Mor mon ism and wanted to hear it straight from its founder, Joseph Smith. Ac cord ing to the Strangite recor d, when Strang visit ed Nauvoo in 1844, he was bap tized and or dained an el der into the LDS Church. Jo - seph Smith then asked Strang to in vest ig ate a possi ble place in Wiscon - sin where the Saints could set tle. Strang return ed to Wis con sin and made the report to Smith. In answ er to Strang’s lett er, Smith wrote back less than a fort night bef ore he was killed at Carthage. This lett er from Smith, accor d ing to Strang and his fol low ers, appoin ted Strang to be the leader of the LDS Church fol lowing Smith’s death. Strang was to call the Saints to Voree, Wiscon sin, and there build a temple. The day Smith was killed, an ang el visit ed Strang and anointed Strang to the new of fice of prophet. Strang wasted no time in pro vid ing proof to po ten tial fol low ers of his ap pointmen t. He found three brass plates that many felt were of an - cient or ig in and translat ed them; like Smith more than twenty years earlier, witnesses at tested to the find’s mi rac u lous na ture. Speek unf ortu nat ely off ers litt le criti ca l analy sis for these contr o - versia l top ics in Strangite his tory. As the plates of Voree and lett er of ap- 270 The Journal of Mor mon His tory pointmen t pro vided Strang with the stron gest ev i dence of di vine succes - sion, crit ics oft en first att acked the gen uine na ture of these ar ti facts. Likewise, hist or i cal works on Strangism should fo cus on the ques tions sur round ing the ar ti facts as well. Speek, who has spent more than a de - cade studying Strang and his Church, has de vel oped in sight into some of the more con tro ver sial as pects, in clud ing the au then tic ity of Jo seph Smith’s lett er of appoin tmen t and the plates found at Voree. Under stand - ing the sources is es sen tial in un derstand ing what the Strangites claim. Al most all of the his to rians who have writt en about Strangism claim that the let ter of ap point ment was a forg ery.2** Speek, how ever, pro vides lit tle in the way of mod ern analy sis and sources. Other such events are nar - rated to the reader witho ut hypo the ses from other hist o ri ans or from Speek’s own work with the sources. A lack of analy sis in no way de stroys the useful ness of the book but leaves much for the read ers to an a lyze on their own. Strang beg an an agg ressiv e mission ar y pro gram desig ned to bring Mor mons and non-Mor mons alike to Voree. Speek shows the read ers the dif fer ent ind iv idu a ls who made their way into the Strangite Church. Char ac ters like John C. Bennett and Wil liam Smith did Strang more harm than good. Their check ered his tory in the Mor mon Church had preceded them, and Strangites were not will ing to trust them. Other char act ers like George J. Adams and John E. Page did some good by preach ing and bring ing at ten tion to the Church, but even tua lly left it with bit ter feel ings on both sides. Still others, like War ren Post and Lorenzo D. Hickey, were faithful to Strang to the end of their lives. Speek has rightly given these ind iv idu a ls an im por tant posi t ion in the story of Strangism, for with out them, Strangism would not have reached its peak. Strangism brought in many conv erts because of Strang’s init ial reject ion of the con ten tious issue of pol yg amy. Mormons, shocked at the news in Nauvoo of “spir i tual wifery,” turned to Strang in hopes of find - ing a version of Mor mon ism with out pol yg amy. How ever, Strang soon in tro duced poly g amy into the Church and his fami ly, lead ing to tria ls and misun der stand ings. Strang’s first plu ral wife, Elvira Field, att ended Strang on a mission ar y tour dressed as a teenag e boy. Some members disco v ered her iden tity, and the news sent schisms and apos tasy through out the church. When the Strangites beg an to prac tice po lyg - amy more openly, dif fi cul ties simi lar to those that plagued the Utah Mor mons arose. Al though Strang ap pointed Voree as his “gather ing place,” Bea ver

2 ** The best source that discusses the lett er’s aut hen tic ity is Charles Eberstadt, “A Let ter that Founded a Kingdom,” Auto g raph Collec tor s’ Journal, Oct ober 1950. See also D. Mi chael Quinn, Mor mon Hi er ar chy: Or i gins of Power (Salt Lake City: Sig na ture Books, 1994), 423 note 134 for other sources declar ing the lett er a forg ery. REVIEWS 271

Is land in Lake Michi gan be came the cen tral lo ca tion of Strangites who wished to prac tice their faith. How ever, Bea ver Is land was a fuel stop for the many steamboat s tra versing the lake and home to many non-Mor - mon fish er men who did not take kindly to the Strangite pres ence. These suspi c ions were agg ra vated when Strang had himself crowned king over the Strangites in July 1850. Strang’s rule, ac cord ing to the gen tiles on and around the island, was not a just reign. Speek doc umen ts the Strangite prac tice of “con se cra tion” (steal ing non-Mor mon prop erty for the good of the kingdom). In con trast to her earl ier lack of anal ysis on found ing events, she de votes an en tire chap ter to con se cra tion on Bea ver Is land and what happened when the Strangites left. Uti lizing many sources, both neg a tive and pos i tive, Speek pro vides sig nif i cant anal y sis of the thefts. Not sur pris ingly, these crimes were a main rea son for the an tago nism be tween the Strangites and the gen tiles. But Strang’s dic ta to rial rule of Beav er Is land was the even tual cause of his down fall. Po lyg amy and the recen t trend to ward—or forced ap pear ance of—bloomers seemed to dom i nate gen tile de scrip tions of the Mor mons on Bea ver Is land. These prob lems, with per haps un spo ken others, caused many Strangites to be come dis sat is fied. Two for mer mem - bers, Thomas Bed ford and Al exan der Wen tworth, fur i ous at Strang’s iron rule, shot and fa tally wounded him in 1856. And like those who killed Jo seph Smith, Bedf ord and Wen tworth en tirely escaped the law. Some of Strang’s close asso ci ates asked him on his deathbed who was to lead the Church, but, ac cord ing to one repor t, Strang, with “a tear . . . in his eye . . . said, ‘I do not want to talk about it’” (224). Al though Strang had capi t al ized on Smith’s am big uo us succes sion plans at his death, he did not cor rect the po ten tial prob lem that would fol low his own death. Many members hoped for a succes sor to Strang but lost hope as months and years passed. When Strang was car ried off Bea ver Is land wounded, he left five wives who were all preg nant. Aft er Strang died at Voree on July 9, 1856, his wives were left on their own to sur vive, some find ing new homes with sib lings or par ents, and still others remar rying. All felt lost rel i giously after their husband and rel i gious leader was gone. Speek doc umen ts the lives of each woman and what became of her aft er Strang’s death. Per- sonal rel i gious con vic tion is ob vi ously dif fi cult to track, but the sources hint that each of Strang’s wives even tu ally left the Strangite movemen t. Al though they all viewed Strang in a pos i tive light, they each felt that his rel i gious life had el emen ts that con tra dicted the good, hon est man they knew and called husband. A few Strangites remained faith ful to Strang and his memor y through out the nine teenth and twen ti eth cen tu ries. A son cap tured their dif ficult y: “They waited; and when no div ine man if est a tion came, . . . they be gan to doubt them selves and their past.” Speek com ments, “When they thought of the king’s ad vice to take care of their fam i lies rather than jeop ar dize their safety for the sake of the church, ‘they did as 272 The Journal of Mor mon His tory he or dered, and they have been do ing that since, as best they knew’” (317). The story of this group is the story of the ded i cated few who hon - ored the memor y of their prophet by car rying their tra dit ion to the fol - low ing gen er a tions. Speek’s stron gest con tri bu tion is her abil ity to en- large the prev i ous story of Strang. She deftly weaves an in ter est ing nar ra - tive of his five wives in as many chapt ers. She also de scribes the Strangites who scat tered fol low ing Strang’s as sas si na tion. And fi nally, we are also treated to a brief discus sion of modern Strangites and their sta - tus as a rel ig ion. Upon all three top ics, litt le or nothing has been writt en be fore. In sev eral as pects, Speek has opened up the topic of Strangite stud ies that should have been ad dressed long ago. Speek’s work, in some ways, will blaze the trail for years to come for fu ture writ ers of Strang and the peo ple he in f lu enced. No one in ter ested in the hist ory of Strang or his Church can overlook God Has Made Us a Kingdom. There are still un an swered ques tions, unmen tioned par al lels, and miss ing con text in the cur rent Strangite his- to riog ra phy, but Speek’s work will help schol ars iden tify some of those top ics and will ig nite their in ter est in Strang and the fasc inat ing people who fol lowed him.

ROBIN SCOTT JENSEN {rsjensen12345@ya hoo.com} gradu ated from Brigham Young Univ ersit y with a mast er’s in his tory and is cur rently working on a second mast er’s in li brary sci ence at the Univ ersit y of Wiscon sin at Mil- wau kee. He works for the Jo seph Smith Papers pro ject at the LDS Church Ar chives. BOOK NO TICE

The Journal of Mormon His tory in vites con tri bu tions to this de part ment, par tic u larly of pri vately pub lished fam ily his to ries, lo cal his to ries, bi og ra phies, his tor i cal fic tion, pub li ca tions of lim ited cir cu la tion, or those in which histor i cal Mor monism is dealt with as a part or mi nor theme.

and his mission to Denmar k Rulon T. Bur ton. By My Own Hand: (1946–49). He in cludes sta tist ics: The Life Story of Rulon T. Bur ton. 26,413 doors knocked on, 4,722 Draper, Utah: Ta ber na cle Books, new homes vis ited for the first 2003. x, 665 pp. Map of Bur ton time, av er age monthly expenses Ward, il lus tra tions, Ap pen dix: $48.22 (330). His adult di ary, be - “Mor mon Pi o neer An ces try.” Pa- gun in 1954, has con tinued to the per: $27.95; ISBN 0–9640–696–8–7 pres ent, now on com puter. The di - Rulon T. Bur ton. Mission ar ies Two. a ries them selves must be a me tic u - Draper, Utah: Ta ber na cle Books, lous recor d, but the story writ ten 2003. xiv, 450 pp. Maps, il lustr a- from them for a broader aud ience tions, ap pen di ces. Pa per: $19.95; is a fas ci nat ing doc u ment in its ISBN 9–780964–069695 own right. A de scen dant of Rob ert Taylor This two-vol ume au to bi og ra phy Bur ton of the LDS Presid ing Bish - had its or ig ins in a pocket diar y op ric, Rulon was born March 3, Rulon T. Bur ton’s fa ther gave him in 1938 when he was twelve to re- 1926, to Field ing Garr Bur ton and cord “the per for mances of our clar - Melba Stewart Lindsay Bur ton on i net trio.” Then in Sep tem ber 1943, Truman Av en ue in South Salt Lake when he was sev en teen, he beg an and grew to manhood in the same keep ing his di ary in ste nog ra phers’ house, sur rounded by aunts, uncles, notebooks. He journaled his World and cousins, includ ing his own four War II ex pe ri ence in the South Pa - sib lings. cific with the U.S. Navy (1944–46) He speaks cand idly of his failed

273 274 The Journal of Mor mon His tory and child less first mar riage and the to the fam ily-cen tered con cen tra - happi ness of his second mar riage to tion of his adult hood is espe c ially Jo sephine (“Jo”) Omer, his edu ca - in ter est ing. Rulon’s mother was a tion as an at tor ney (1965–70), in - redo ubt able piano teacher and mu- clud ing an in tern ship in Washing - sic ian, who must ered a twelve-piece ton, D.C., his leg al prac tice as per - ward or chestr a that “for as long as I haps the first spec ial ist in can remem ber” played weekly for bankr uptcy law in Utah (a ca reer that Sunday School, ac com pa ny ing had many chal lenges and setbacks of hymns and pro vid ing prelude and its own) (1970–95), and the rear ing post lude numbers (100). He also of their three chil dren. sang in a male quin tet or gan ized by For Mormon readers, this au to - his mother that per formed in wards bi og ra phy of an al ways be liev ing and around the val ley and at comm un ity ac tively par tic i pat ing Mor mon man, events. Rulon started playing clar i - fully car rying on the com mit ment of net in fifth grade, took elo cut ion his bel iev ing par ents, is a windo w and drama lessons, per formed rou- into Church bel iefs and prac tices tinely in ward dra mat ics and was, at dur ing the twen ti eth cen tury. One of age sev en teen, the ward drama di - Burt on’s earl iest memo r ies is, on a rec tor. hot sum mer day, stand ing across a Al though there was no slack en - picket fence from an equally small ing in the num ber of Church call - cousin in the adjoin ing yard (neit her ings ext ended to Rulon and Jo as of their heads topped the fence), try- adults, they ac cepted fully the ing not very ener get ica lly to catch Church’s em pha sis on teaching the the drowsy grasshop pers on the gos pel to their chil dren. “We held fence, but dis cuss ing, “When will Je - daily fam ily scrip ture study, faith- sus come again?” (13). fully [from 5:50 to 6:10 A.M.], and . . . Bur ton served three times on a Mon day night fam ily home eve - high coun cil, served four mis sions nings,” keep ing minut es from 1974 (three with his wife), as a coun selor in on in a “det ailed Fami ly His tory the bishop ric, and as a temple or di - Jour nal” (427–28). The par ents of - nance worker. In ad di tion to teach- fered “cash incen tives for scrip ture ing in the aux il ia ries, Jo also served read ing,” at tended all Church meet - as stake Re lief So ci ety pres i dent. Be - ings, and held kneel ing fami ly cause Jo had earl ier been mar ried in prayer and pri vate prayer twice the tem ple, then wid owed, a pe cu liar daily. Each week they held a fami ly qual ity of their rela tion ship was the coun cil, and Rulon, in response to lengthy ne go ti a tions to can cel her the stake pres i dent’s urg ing, also be - first temple seal ing to per mit her gan con duct ing “reg u lar weekly in - seal ing to Rulon in 1978 af ter eigh - ter views with each of our chil dren” teen years of mar riage. plus “in ter views for spec ial oc ca - The Church’s shift in em pha ses sions.” He de scribes these twenty- be tween gen er a tions from the ward- minut e in ter views as at tended by “a cen tered ac tiv i ties of Bur ton’s youth sweet spirit” and the chil dren’s ap- BOOK NOTICE 275

pre ci a tion for re ceiv ing “one hun- graph of him with the first printed dred per cent of their fa ther’s at ten - copy in his hands, his face is alight tion” (435). Jo later be gan in ter view - with joy (638). ing them as well. Rulon also gave He tells of the book’s of fic ial reg u lar fa ther’s bless ings on such oc - re cep tion. The Cor re la tion De part - ca sions as the start of a new school ment pur chased the first cop ies. El - year, ill ness, or leav ing home. der Da vid B. Haight reques ted “By pre cept and me tic u lous ex- twenty-five cop ies to sup ply his fam- am ple, we en deav ored to teach both ily, “Pres i dent Thomas Monson sent respect and obed i ence.” Rulon and a man to our of fice to ob tain a com- Jo let the chil dren know that they al - puter dis kette . . . [to in stall] on his ways accept ed call ings. “The chil - com puter,” and Pres i dent James E. dren never learned our bishop’s first Faust, speaking in a meet ing to his name from us. . . . The same was true chil dren and grand chil dren, held of their teach ers” (436). up the vol ume and rec om mended Supper time heard daily repor ts that they each ac quire a copy (645). from the chil dren about how well It was “of fic ially ac cepted for use by they felt they had done at re strain ing sem i nar ies and in sti tutes of the un de sir able be hav ior. “Not hit ting” Church” (645). Bur ton also had af ter about a week of daily repor ts what must have been the spec ial shifted “to report ing verba l abuse, plea sure of repor t ing to Deseret and even tu ally vol un tarily re port ing Book’s gener al manag er that a book on their own unkind thoughts” his com pany had refused to pub lish (432–33). had sold 10,000 copies in its first Bur ton also in cludes a chap ter year when, ac cord ing to the man- on books that inf lu enced him in ager, “sales above 3,000 for a church youth and adult hood and his own ref er ence book the first year” would pub lish ing ven tures, in clud ing his have been con sid ered “a win ner” eight-year ef fort to pro duce We Be- (646). lieve: Doctr ines and Princi ples of the The rev iew cop ies of By My Church of Je sus Christ of Lat ter-day Own Hand and Mis sion ar ies Two Saints. He de signed it as a ref er ence were uncor rected proofs and had work, with 898 doctr inal statemen ts no index, a def ic iency which has ar ranged in al pha bet i cal or der from hope fully been cor rected in the fi - “Adv ersit y” to “Zion” (chap. 40). Al - nal volume . though he was first den ied per mis - In Mis sion ar ies Two, the second sion to quote Gener al Aut hor ity vol ume of Bur ton’s au to bi og ra phy, statemen ts by the Church Copy- he desc ribes three mis sions that he rights and Per missions of fice, his and Jo served as a couple, thus ful - persis t ence coupled with his “good fill ing a recen t but strong em pha sis spirit” result ed in the book’s be com - in LDS mis sion ary work. ing the “only private ly publ ished The first was in the Mic ro nesia book to have been rev iewed by [Cor - Guam Mis sion on Majuro in the rela tion]” (632, 645). In a pho to - Marsha ll Is lands (1990–91). Each 276 The Journal of Mor mon His tory chapt er beg ins with a por trait and sion were not lacking in in tel li- brief vi gnette of an other mis sion ary gence, but they were de fi cient in cou ple. Bur ton’s main con cern was abil ity to learn, which is not the the lack of leader ship train ing on the same thing. . . . They sim ply have not part of male members, a lack he rem- ac quired the learn ing techn iques or ed ied with no ta ble success by pro vid - the thinking tools” (68–69). Us ing ing simpl if ied inst ruct ions, close tu- the loca l form of “King stor ies” was tor ing, and reg u lar, con cen trated suc cess ful in teach ing gos pel prin ci - priest hood in ter views. The Burtons ples clearly. (Ex am ples are in cluded also worked in tensiv ely in a struc- in an appen d ix.) tured pro gram they created to help Next came a “ser vice mission” mem bers over come al co hol ad dic- at the Se nior Mission ar y Train ing tion and wrote a ten-les son Fam ily Cen ter in Provo, Utah, from Oc to - Home Eve ning Idea Book so that the ber 1993 to June 1994. Based on mission ar ies could teach the people their own ex pe ri ences, they pre - how to hold these fam ily gather ings pared an eigh teen-page hando ut on (218). The Burtons also launched the how to train loca l people in leader - semi nar y pro gram in the Mar shall- ship prin ci ples, ef fec tive fellow ship- ese lan guage. En roll ment reached ping, and harmo n io us int erfac ing sixty, includ ing 20 per cent non-Mor - with the full-time pros e ly tiz ing mis - mons, with an “av er age att endance sion ar ies. They felt that their ef forts of about thirty studen ts. For is land - were suc cess ful: “Those couples to ers not used to reg i mented hours, whom we gave leader ship train ing this at ten dance recor d was remar k- . . . came into classes be wil dered. able” (17). They floated out on clouds. They Based on Bur ton’s di ary and let - were happy cou ples” (271). This ma - ters home, this ac count also brings te rial is re pro duced in Ap pen dix B. into high rel ief the chal lenges of liv - Despite the Burtons’ success, ing in a trop i cal en vi ron ment, in- they were relea sed in an abrupt clud ing a typhoon that un cov ered five-minut e meet ing with a new di - small Jap anese tanks ten yards from rec tor be cause “we are chang ing the their apart ment. A cul tural dis cov ery cur ric u lum” (272). De spite their was that the seven is land lan guages disap point ment, they im me di ately frequen tly lacked spe cific names for beg an plann ing for ano ther mis - com mon trees and flow ers. “The sion, which they served in Pa pua, prob lem was not a mere matt er of ed- New Guinea (1995–96). Again, they uca t ion, it was somet imes a matt er of had suc cess with the sem i nary pro - non ex is tent vo cab u lary.” Most high gram and lead ership train ing, in- school grad uat es could not pass en - clud ing prepar ing for the creat ion trance ex am i na tions for BYU-Ha - of a stake presided over by lo cal waii. “The island people in the mis- mem bers. REFLECTIONS OF A MORMON HISTORIAN LEONARD J. ARRINGTON ON THE NEW MORMON HISTORY Essays by Leonard J. Arrington Edited by Reid L. Neilson and Ronald W. Walker

Conﬂict between matters of faith and historical truth has been a conundrum at the heart of doing and telling the history of The Church of Jesus Christ of Latter-day Saints (also known as the Mormon Church). Some of the best essays on that topic were written by Leonard J. Arrington, perhaps the best-known member of the group of professionals who founded the New Mormon History of the late twentieth century. Now, Arrington’s essay on history and the Mormons are collected in a single source work.

368pp, 23 b&w illus., biblio, index · bound in rust linen cloth · foil stamped spine · full-color dust jacket

ISBN 978-0-87062-348-6 · $36.95

THE ARTHUR H. CLARK CO. 2800 Venture Drive · Norman, OK 73069 · 1 800 627 7377 ahclark.com Scottish Shepherd The Life and Times of John Murray Murdoch, Utah Pioneer Kenneth W. Merrell

John Murray Murdoch was an American immigrant, and this volume tells the story of his life and the unique times in which he lived. In Utah he participated in the military preparations and maneuvers against the United States Army in the 1857 Utah War; he helped to settle the Wasatch County area and became one of the first elected officials of the county; and he established the first sheep cooperative in Wasatch County, Cloth $27.95 and helped to establish the sheep ranching industry in Utah. It is the “everyman” aspect of John Murdoch’s life that makes his story so compelling.

A Rascal by Nature, A Christian by Yearning A Mormon Autobiography Levi S. Peterson “I will introduce myself with a few facts. I was born and raised in Snowflake, a Mormon town in northern Arizona. I have lived most of my adult life in the cities of the American West. Although I consider myself a religious person, I know very little about God. At first I intended this book to be about wilderness, but as I wrote it, it became an autobiography with many themes. Among these themes are wilderness, my vexed Cloth $29.95 and vexing relationship with Mormonism, my moral and emotional qualities, and my family.” So begins the autobiography of educator and author Levi S. Peterson.

The University of Utah Press Order online from www.UofUpress.com or dial 1.800.621.2736 Polygamy on the Pedernales Lyman Wight’s Mormon Villages in Antebellum Texas, 1845 to 1858 Melvin C. Johnson Lyman Wight was one of the more colorful leaders of the Mormon splinter groups that emerged after the 1844 murder of Joseph Smith Jr. He led his followers to Texas, where they founded multiple frontier towns. $19.95 paper, 0-87421-628-1 $36.95 cloth, 0-87421-627-3

Beneath These Red Cliffs: An Ethnohistory of the Utah Paiutes Ronald L. Holt Since the 1850s the Utah Paiutes have lived out a continuous tale of crippling dependency and uphill struggle for recognition and self-rule, a history that was crafted by white settlers, the Mormon church, and the federal government. $24.95 paper, 0-87421-637-0

A Voice in the Wilderness: Conversations with Terry Tempest Williams Edited by Michael Austin In her readily recognizable voice, with her familiar felicity of language, the naturalist, author, and activist talks about wildness, place, art, eroticism, democracy, writing, being Mormon, and much else in these collected interviews $19.95 paper, 0-87421-634-6

The Marrow of Human Experience: Essays on Folklore by William A. Wilson Edited by Jill Terry Rudy with the assistance of Diane Call Internationally renowned scholar “Bert” Wilson considers the importance of folklore; illuminates its place in national, cultural, and religious identity; and shares the insights into traditional Mormon culture for which he is known.

$24.95 paper, 0-87421-653-2

UTAH STATE UNIVERSITY PRESS WWW.USU.EDU/USUPRESS 1-800-621-2736 CoCompempellillinngg NNewew HiHiststoriorieses

Sergeant Nibley, Ph.D.: Memories of an Unlikely Screaming Eagle Hugh Nibley and Alex Nibley Professor Hugh Nibley knew well the history of human conflict, but on June 6, 1944, at Utah Beach, he learned more about war than he had ever gleaned from books. Both a soldier and a scholar, Nibley gives an intimate, firsthand account of how he saw WWII from his unique position of being in both frontline foxholes and behind-the-scenes war rooms. Hardcover $24.95

The Price We Paid: The Extraordinary True Story of the Willie and Martin Handcart Pioneers Andrew D. Olsen Although the story of the Willie and Martin handcart pioneers may feel familiar, most of us know only selected anecdotes from this dramatic saga. In this new book, Andrew Olsen provides the most comprehensive and accessible account of this epic journey—all the way from Liverpool to the Salt Lake Valley. Accented by many firsthand stories, readers will be immersed in the challenges and miracles of this amazing trek as never before. Hardcover $25.95

DESERET BOOK PUBLISHERS Available at Deseret Book, DeseretBook.com, 1-800-453-4532, or wherever LDS books are sold.