EFFECTORSECRETIONCONTROLBYTHEPSEUDOMONASAERUGINOSA
TYPEIIISECRETIONSYSTEM
by
PEIͲCHUNGLEE
Submittedinpartialfulfillmentoftherequirements forthedegreeofDoctorofPhilosophy
Advisor:ARNERIETSCH,PhD.
DepartmentofMolecularBiologyandMicrobiology CASEWESTERNRESERVEUNIVERSITY May,2011 CASE WESTERN RESERVE UNIVERSITY
SCHOOL OF GRADUATE STUDIES
We hereby approve the thesis/dissertation of
______PEI-CHUNG LEE candidate for the ______degreeDoctor of Philosophy *.
(signed)______Piet de Boer (chair of the committee)
______Arne Rietsch
Michael Maguire ______
Pieter de Haseth ______
______
______
March 23 2011 (date) ______
*We also certify that written approval has been obtained for any proprietary material contained therein. This work is dedicated in loving memory to my grandmother, Be-Yun Yang-Lee
“㛶㣲䡏暚” (1917-2006)
and
to the Lee family Table of Contents
List of Tables 5 List of Figures 6 Acknowledgements 8 Abstract 9 Chapter 1: Introduction 11 Pseudomonas aeruginosa and human diseases 12 Protein secretion systems in Gram-negative bacteria 13 T3SS---the molecular syringe 17 The secreted effectors 17 The translocon 20 The apparatus 21 The ATPase complex 24 The regulatory components 26 i. Expression of the T3SS genes 26 ii. Control of needle length 28 iii. Substrate preference switch 31 iv. Control of translocator/effector secretion 32 Triggering of effector secretion 33 The needle tip protein participates in control of effector secretion 34 Regulatory models for control of effector secretion 36 The plug model 36 The LcrG/LcrV titration model 37 The allosteric model 38 The sensor model 39
Chapter 2: Control of Effector Secretion by the T3SS Needle Tip Protein, PcrV 48 Summary 49
1 Introduction 51 Materials and methods 54 Media and culture conditions 54
PexoS-lacZ reporter assay 54 RECC assay 54 Cytotoxicity assay 55 E. coli bacterial two-hybrid analysis 56 FACS analysis 56 Immunoprecipitation 56 Fractionation 57 Overexpression in E. coli and Ni-chromatography 59 MBP-fusion purification 60 Results 60 PcrG and PcrV are negative regulators of effector secretion 60 PcrG and PcrV act differently from their homologs in Yersinia spp. 62 The secretion signal at the N-terminus of PcrV is required for PcrV secretion 63 Non-secreted PcrV loses its ability to regulate effector secretion and to intoxicate host cells 64 Non-secreted PcrV is not a dominant negative mutant but still interacts with PcrG 65 The PcrG/PcrV interaction is not required for control of effector secretion 67 The PcrG/PcrV interaction is involved in PcrV export and PcrG stability 70 Characterizing the functional domains in PcrG 71 Discussion 72
Chapter 3: Control of Effector Secretion by the T3SS
2 Cytoplasmic Protein, PcrG 97 Summary 98 Introduction 100 Materials and methods 102 Media and culture conditions 102 E. coli bacterial two-hybrid analysis 103
PexoS-lacZ reporter assay 103 Protein secretion assay 103 Site-specific cysteine crosslinking 104 MBP pull-down assay 105 Immunoprecipitation 105 RECC assay 106 Results 107 Identifying PcrG interaction partners by bacterial two-hybrid analysis and characterizing the protein binding domains in PcrG 107 The C-terminus of PcrG contains most regulatory activity for control of effector secretion 108 The secretion profiles of the T3SS substrates in different PcrG deletion mutants 109 Identifying T3SS apparatus components interacting with the C-terminus of PcrG by site-specific crosslinking and mass spectrometry 110 PcrG interacts with PcrD in P. aeruginosa 112 The PcrG/PcrD interaction occurs when the apparatus is in the effector secretion “off” state 113 The interaction between PcrD and the C-terminus of PcrG is important for effector secretion control 115 The C-terminus of PcrG may have multiple binding sites 117 Discussion 119
3 Chapter 4: Isolation of PscF Mutants that De-regulate Effector Secretion 141 Summary 142 Introduction 143 Materials and methods 145 Media and culture conditions 145 PscF mutant libraries 145 Selection for effector secretion “on” pscF mutants 146
PexoS-lacZ reporter assay 147 Protein secretion assay 147 Results 147 Library screening for PscF mutants that constitutively secrete effectors 147 PscFQ83R is a PcrV dependent “on” mutant 148 PscFQ79L, L82I, Q83H is a PcrV independent “on” mutant 149 PscFQ79H, Q83H blocks premature effector secretion 150 Discussion 151
Chapter 5: Future Studies 162 The model of PcrG function 164 Isolation of needle mutants that selectively block effector secretion 166 The role of PcrD in substrate secretion 168
Bibliography 171
4 List of Tables
Table 1-1. T3SS homologs in different bacteria 46 Table 1-2. Homologs in the P. aeruginosa T3SS and the S. enteric 47 Flagellum Table 2-1. Strains, plasmids, primers used in this study 90 Table 3-1. Strains, plasmids, primers used in this study 137 Table 4-1.The effector secretion “on” mutants isolated form the PscFQ79*L82*Q83* library 157 Table 4-2. Strains, plasmids, primers used in this study 160
5 List of Figures
Figure 1-1. Protein secretion systems in Gram-negative bacteria 41 Figure 1-2. The T3SS in P. aeruginosa 42 Figure 1-3. Assembly of the P. aeruginosa translocon 43 Figure 1-4. Structural and functional homology between the P. aeruginosa T3SS and the S. enterica flagellum 44 Figure 1-5. The ExsE-C-D-A system in the P. aeruginosa T3SS 45 Figure 2-1. PcrV and PcrG are negative regulators in control of effector secretion 79 Figure 2-2. Overexpression of PcrV has no effect on control of effector secretion 80 Figure 2-3. The N-terminal secretion signal is required for secretion and regulatory activity of PcrV 81 Figure 2-4. Non-secreted PcrV is not a dominant negative mutant but still interacts with PcrG 82 Figure 2-5. PcrG is a non-secreted cytoplasmic protein 83 Figure 2-6. The D12 helix of PcrV is required for control of effector secretion and cytotoxicity 84 Figure 2-7. PcrVL262D and PcrGA16R lose the PcrG/PcrV interaction 85 Figure 2-8. Assembly of PcrV, not the PcrG/PcrV interaction, is required for control of effector secretion 86 Figure 2-9. PcrGA16R regulates effector secretion and the PcrG/PcrV interaction is involved in PcrV secretion and PcrG stability in P. aeruginosa 87 Figure 2-10. The N-terminus of PcrG is the PcrV interacting domain and the C-terminus of PcrG possesses the regulatory activity for control of effector secretion 88 Figure 2-11. Model of PcrV function in control of effector secretion 89 Figure 3-1. Identifying T3SS components that interact with PcrG by the E. coli bacterial two-hybrid analysis 126
6 Figure 3-2. Mapping the protein interaction domains on PcrG 127 Figure 3-3. Effect of PcrG truncated mutants on effector secretion 128 Figure 3-4. The secretion profiles of the T3SS substrates in the 129 strains expressing PcrG truncated mutants Figure 3-5. Identify T3SS components interacting with the C- terminus of PcrG 130 Figure 3-6. Co-purify PcrD with MBP-PcrG by amylose-resin purification 131 Figure 3-7. Co-purify MBP-PcrG with PcrD by immunoprecipitation 132 Figure 3-8. The PcrG/PcrD interaction depends on the activation of effector secretion 133 Figure 3-9. Disruption of the PcrG/PcrD interaction causes de- regulated effector secretion 134 Figure 3-10. PcrG('30-40; '60-70) becomes dominant negative in the pcrV null background 135 Figure 3-11. Models of how PcrG regulates effector secretion by interacting with the apparatus 136 Figure 4-1. Sequences of the needle proteins 155 Figure 4-2. PscFQ83R constitutively secretes effectors in a PcrV- dependent manner 156 Figure 4-3. PscFQ79L, L82I, Q83H (PscFLIH) constitutively secretes effectors independent of PcrV 158 Figure 4-4. PscFQ79H, Q83H blocks premature effector secretion 159
7 Acknowledgments
I want to say thank you to my thesis advisor, Arne Rietsch.
I want to say thank you to the members of the Rietsch lab, Charles Stopford and
Amanda Svenson.
I want to say thank you to my thesis committee members, Piet de Boer, Michael
Maguire and Pieter de Haseth and former member, Patrick Viollier.
I want to say thank you to all the Lee family.
I want to say thank you to my wife, Yu-Ting Su, and my son, Ian.
All of you are essential to me.
8 Effector Secretion Control by the Pseudomonas aeruginosa
Type III Secretion System
Abstract
by
PEI-CHUNG LEE
P. aeruginosa uses a type three secretion system (T3SS) to inject effectors into host cells. The T3SS is important for the virulence of P. aeruginosa. The
T3SS forms a needle protruding from the bacterial surface and a basal apparatus across the envelope. Effector secretion is triggered by host cell contact; however, the mechanism of effector secretion control is still unclear. The needle tip protein,
PcrV, and its chaperone, PcrG, are negative regulators of effector secretion. My thesis study focused on how PcrV and PcrG regulate effector secretion. My data demonstrate that PcrV needs to be secreted and properly assembled at the needle tip in order to control effector secretion. I constructed PcrV and PcrG mutants that abolish the PcrG/PcrV interaction and demonstrated that the
PcrG/PcrV interaction is dispensable for effector secretion control. I showed that
PcrG regulates effector secretion in the cytoplasm in a PcrV independent manner and the C-terminus of PcrG contains most of the regulatory activity. I identified the apparatus component, PcrD, is the interaction partner of the C-terminus of
PcrG and PcrG regulates effector secretion by interacting with PcrD. In addition, I
9 found that the center region of PcrG interacts with PscO, a component of the
T3SS ATPase complex. The PcrG/PscO interaction may stabilize the PcrG/PcrD interaction and control secretion activity of the apparatus. My data support the model that PcrV and PcrG allosterically regulate effector secretion. Assembly of
PcrV at the needle tip and the interaction between PcrG and PcrD stabilize the apparatus in an effector secretion “off” conformation. Once the bacterium contacts with the host cell, PcrV changes its conformation and PcrG is released from the apparatus; therefore, the apparatus switches to an effector secretion “on” conformation. Furthermore, I isolated the mutations in the needle protein, PscF, that cause de-regulated effector secretion, suggesting that the needle can be locked in effector secretion “on” conformation. Therefore, effector secretion is controlled by conformational changes of the apparatus in P. aeruginosa.
10
Chapter 1
Introduction
11 Pseudomonas aeruginosa and human diseases
Pseudomonas aeruginosa is a Gram-negative bacterium and belongs to the J- proteobacteria. The P. aeruginosa genome has ~6.3 million base pairs with high
GC content. P. aeruginosa is an aerobic microbe and exists widely in natural environments, such as water and soil. Morphologically, P. aeruginosa is rod shaped and has a single flagellum at one pole [1].
P. aeruginosa is an opportunistic human pathogen. People with compromised immunity, such as patients with cystic fibrosis, HIV infection, cancer, and burn wound victims, are at risk for infection by P. aeruginosa [2-6]. P. aeruginosa is one of the major causative pathogens in nosocomial infections, e.g. ventilator- associated pneumonia and catheter-associated urinary tract infection [7, 8]. In healthy individuals, P. aeruginosa can also cause infection in ears (Otitis externa, swimmer’s ear)[9, 10], cornea (P. aeruginosa keratitis)[11, 12], and skin (P. aeruginosa dermatitis, hot tub rash)[13, 14]. P. aeruginosa has intrinsic resistance to antibiotics and frequently develops multidrug resistance [15-19], which makes treating P. aeruginosa infections difficult.
P. aeruginosa produces and secretes many virulence factors that affect host cells. The type three secretion system (T3SS) is one of the protein secretion systems that is utilized by P. aeruginosa to deliver its virulence factors into host cells. Presence of the T3SS is associated with increased disease severity in humans. The mortality is increased in patients with respiratory and systemic infections caused by T3SS-positive P. aeruginosa [20, 21]. Presence of the T3SS
12 in P. aeruginosa isolates from ventilator-associated pneumonia patients is also associated with longer persistence of bacteria, higher relapse rates of infection, and cytotoxicity to immune cells [22]. Studies using experimental animals also showed the importance of the T3SS to the virulence of P. aeruginosa. The T3SS is required for survival and systemic spread of P. aeruginosa in mice and causes death in acute lung injury and burn mouse models [23-25]. Therefore, the T3SS is a key contributor to the virulence of P. aeruginosa.
Protein secretion systems in Gram-negative bacteria
Gram-negative bacteria use several mechanisms to secrete their proteins across the envelope. To date six protein secretion systems have been found in
Gram-negative bacteria, named type I to type VI secretion systems (T1SS, T2SS,
T3SS, T4SS, T5SS, and T6SS) (Fig. 1-1)[1, 26].
T2SS and T5SS are two-step protein secretion systems, which transport proteins from the bacterial cytoplasm to the extracellular milieu or bacterial cell surface. Secretion of T2SS and T5SS substrates needs a Sec or Tat secretion system. The Sec and Tat secretion systems are general protein secretion systems that transport protein cargos from cytoplasm to periplasm. The N- terminal signal peptide of the substrates is recognized by the Sec/Tat secretion system. Then the Sec/Tat secretion system transports the substrates across the inner membrane to the periplasm, and the N-terminal signal peptide of the substrates is cleaved. The cleaved substrates are further transported across the
13 outer membrane by the multimeric T2SS or T5SS outer membrane complex.
T5SS is the simplest secretion system because it is only composed of a E-barrel protein complex used for transporting its substrates across the outer membrane.
The T2SS is composed of inner membrane, periplasmic, and outer membrane components, but the inner membrane and periplasmic components are not responsible for transporting substrates across the inner membrane which is executed by the Sec/Tat secretion system. Both T2SS and T5SS transport unfolded substrates since the Sec secretion system transports unfolded substrates. However, folded substrates can be transported by the T2SS if the Tat secretion system is used to secrete folded substrates across the inner membrane
[27-30].
T1SS, T3SS, T4SS, and T6SS are one-step protein secretion systems.
Secretion of substrates in these protein secretion systems does not require a
Sec/Tat secretion system and the substrates are transported across the envelope in one step through the secretion apparatus. However, structural components of the secretion apparatus in the periplasm and outer membrane may be exported by the Sec/Tat secretion system [26, 30].
The T1SS consists of an ABC (ATP-binding cassette) transporter anchored in the inner membrane, an outer membrane component, and an adaptor protein.
The ABC transporter provides energy for the transport of the substrates by hydrolyzing ATP. The adaptor protein is inserted in the inner membrane with a cytoplasmic portion and a periplasmic portion connected with the outer membrane components. Together, the adaptor complex and the outer membrane
14 components form a channel across the envelope. The T1SS substrates have a non-cleavable secretion signal at their C-terminus and are transported in an unfolded state [30, 31].
The T4SS transports DNA and proteins into recipient bacteria or eukaryotic host cells upon cell-cell contact. The horizontal DNA transfer by the T4SS between two bacteria is also known as bacterial conjugation. The T4SS forms an apparatus across the bacterial envelope and a pilus, which serves as a channel, to transport its substrates [32]. Some pathogenic bacteria use type IV secretion to deliver protein virulence factors directly to the host cells. Studies showed that in Helicobacter pylori, integrins in the host cell membrane interact with the accessory protein of pilus, CagL. The integrin-CagL interaction induces host cell membrane ruffling and triggers injection of CagA, the T4SS protein effector of H. pylori, into the host cell cytoplasm [33]. Secretion of pertussis toxin in Bordetella pertussis is also mediated by the T4SS. However, secretion of pertussis toxin is not through a one-step secretion pathway. The subunits of pertussis toxin are first secreted to the periplasm. After assembling in the periplasm, pertussis toxin is secreted across the outer membrane to the extracellular milieu by the T4SS without host cell contact [32].
The T6SS was recently discovered. Genomic studies showed that the T6SS is conserved and widely exists in Gram-negative bacteria [34]. The T6SS contributes to the virulence of human bacterial pathogens, for example Vibrio cholera and Burkholderia thailandensis [35, 36]. A recent study showed that P. aeruginosa also uses the T6SS to intoxicate other bacteria [37]. The Hcp1
15 protein and the VgrG protein family are conserved T6SS structural components and secreted by the T6SS. Purified Hcp1 forms a hexameric ring in vitro [38].
VgrGs are structurally similar to gp27 and gp5, the components of the T4 bacetriophage tail spike complex [39, 40]. Therefore, Hcp1 and VgrGs may form a needle-like structure with VgrGs at the tip. The similarity to the bacteriophage tail spike suggests that the Hcp1/VgrGs needle complex may puncture through the host cell membrane to translocate T6SS substrates similar to the way that bacteriophages deliver their DNA by puncturing through bacterial cell membranes [41].
The T3SS is also called an “injectisome” [42]. Electron microscopy showed that the T3SS forms a “syringe” like structure, which consists of a basal apparatus and a needle protruding from the bacterial cell surface [43, 44]. Many
Gram-negative bacteria use type III secretion to translocate effectors directly from the bacterial cytoplasm into the host cell cytoplasm [45]. Based on phylogenetic analysis of conserved T3SS components, T3SSs have been classified into seven different families: Ysc, Inv-Mxi-Spa, Ssa-Esc, Chlamydiales,
Hcr1, Hcr2, and Rhizobiales [46]. Hcr1, Hcr2, and Rhizobiales families are found in plant pathogens (Hcr1 and Hcr2) and plant symbiotic bacteria (Rhizobiales).
The Chlamydiales T3SS is found in Chlamydia spp. which are strictly intracellular bacteria and human pathogen. Ysc, Inv-Mxi-Spa, and Ssa-Esc T3SS are found in free living animal pathogens. Comparing the phylogenetic trees of T3SS and 16S rRNA showed that bacteria that possess the same family of T3SS may not be closely related species. This suggests that bacteria may have obtained T3SSs
16 horizontally [47]. In addition, one bacterium may have two or more different T3SS from different families. For example, Salmonella enterica has two T3SS, SPI
(Salmonella Pathogenicity Island)-1 and SPI-2. SPI-1 and SPI-2 belong to the
Inv-Mxi-Spa family and Ssa-Esc family, respectively [48]. Bacteria may use different T3SS at different stages of infection. The T3SS found in P. aeruginosa is closely related to the T3SS in Yersinia spp. The P. aeruginosa T3SS and the
Yersinia T3SS belong to Ysc family of T3SS [46].
T3SS---the molecular syringe
The T3SS is composed of more than 20 proteins [42]. The T3SS components can be categorized into five groups: secreted effectors, translocon, apparatus,
ATPase complex and regulatory components. (The diagram of the P. aeruginosa
T3SS is illustrated in Figure 1-2. The homologous components in different T3SS, except effectors, are listed in Table 1-1.)
The secreted effectors
Effectors are proteins that are translocated directly from the bacterial cytoplasm to the host cytoplasm by the T3SS. The number of effectors encoded in the genome varies from species to species and strain to strain [46]. There are four effectors identified in P. aeruginosa, which are ExoS, ExoT, ExoY, and ExoU
[49]. The P. aeruginosa strain we used in our study, PAO1F, has three T3SS effectors, ExoS, ExoT, and ExoY. Although the effectors are secreted by the
T3SS, the effector genes are not located in the T3SS region of P. aeruginosa.
17 The effector genes are distantly spread at different loci in the P. aeruginosa genome. In general, the P. aeruginosa T3SS effectors genes, exoS and exoU, are mutually exclusive. A strain carrying exoS does not carry exoU, and vice versa [50]. However, the reason for this is still unclear.
Effectors usually contain enzymatic activities that interfere with normal cellular functions of the host cells. ExoS and ExoT have GTPase activating protein (GAP) activity and ADP ribosyl transferase (ADPRT) activity. ExoY has adenylyl cyclase activity. ExoU has phospholipase activity. In general, all the effectors contain a short secretion signal peptide (~15 a.a.) at their N-terminus that directs the effectors to be transported by the T3SS [49].
ExoS and ExoT are highly similar to each other (76% sequence identity). Both
ExoS and ExoT have GAP activity and ADPRT activity [51]. The GAP activity promotes the hydrolysis of GTPase-bound GTP to GDP, therefore, activates the
GTPase activity of the target protein, which may interfere with signaling in the host cells. Small GTPases, Rho, Rac, Cdc42, in the host cells are the substrates of ExoS and ExoT. Activating these small GTPases causes disruption of the host cell cytoskeleton [52-56]. The substrates for the ADPRT activity of ExoS and
ExoT are different. Many host cell proteins are substrates of ExoS ADPRT, including Ras and proteins of the ERM family. ADP-ribosylation of Ras and ERM proteins affects host cell survival and disrupts the host cell cytoskeleton [57-61].
The substrates of the ExoT ADPRT are CRK I and CRKII adaptor proteins. ADP- ribosylation of CRKI and CRKII adaptor proteins also disrupts the host cell cytoskeleton, cell adhesion, and cell proliferation [62]. The ADPRT activity of
18 ExoS and ExoT requires a co-factor from the host cell. The co-factor binding domain is located at the C-terminus of ExoS and ExoT, which interacts with 14-3-
3 proteins, cytoplasmic proteins involved in many cellular functions in eukaryotic cells [63-65]. Without the co-factor binding domain, ExoS and ExoT lose their
ADPRT activity. The requirement of a co-factor from the host cell may provide P. aeruginosa a protective mechanism from ADP-ribosylating its own bacterial proteins before the effectors are injected into the host cells. In addition to the co- factor binding domain, a membrane localization domain (MLD) in ExoS and ExoT is responsible for targeting ExoS and ExoT to the host cell plasma membrane, where ExoS and ExoT modify their substrates [51, 66, 67].
ExoU contains phospholipase activity that can hydrolyze phospholipids to lysophospholipids and fatty acids [68, 69]. Therefore, ExoU rapidly disrupts the integrity of the host cell membrane and causes necrotic cell death. The phospholipase activity of ExoU is also dependent on a host cell co-factor. Cu2+,
Zn2+- superoxide dismutase (SOD) in the host cell is the co-factor for the phospholipase activity of ExoU. SOD catalyzes superoxide to oxygen; however, the SOD enzymatic activity is not required for the phospholipase activity of ExoU
[70]. ExoU also has a membrane localization domain (MLD) at its C-terminus, and the C-terminus of ExoU has been demonstrated to be important for the function of ExoU [71, 72].
Like other effectors of P. aeruginosa, ExoY needs a co-factor in the host cell to fully activate its adenylyl cyclase activity. However, the co-factor is still unidentified [73]. ExoY increases the cAMP concentration in the host cells. cAMP
19 is an important secondary messenger in signaling transduction. Injection of ExoY into the host cells disrupts host cell cytoskeleton and increase endothelial permeability [73, 74].
The translocon
Compared with effectors, components of the translocon are more conserved among different T3SS. The translocon consists of three components: two pore forming proteins and one protein located at the tip of the T3SS needle. All the components of the translocon are secreted by the T3SS [75]. The translocon components are essential for translocation of effectors into the host cells but not required for secreting effectors to extracellular milieu [76, 77]. Thus, the translocon components are called “translocators” since they are involved in translocation of the T3SS effectors [78].
In P. aeruginosa, the two pore forming proteins are PopB and PopD, and the needle tip protein is PcrV. The two pore forming proteins can be distinguished by their size. The large pore forming protein, PopB in P. aeruginosa, has two predicted transmembrane domains, and the small pore forming protein, PopD in
P. aeruginosa, has one predicted transmembrane domain [75, 79]. In vitro experiments showed that PopB and PopD interact with each other and are capable of forming pores individually or cooperatively in artificial lipid bilayers [80].
It has been demonstrated that PopB and PopD are inserted into the host cell membrane and cause the hemolysis of red blood cells and LDH release in macrophages, suggesting that PopB and PopD also form pores in the host cell membrane. The estimated inner diameter of PopB/PopD pore in the host cell
20 membrane is ~3-4 nm. PcrV is required for the insertion of PopD in the host cell membrane, whereas insertion of PopB is independent of PcrV [77, 81].
The crystal structure of LcrV, the PcrV homolog in the Yersinia T3SS, has been solved. LcrV forms a dumbbell-like structure with two long D-helices and two globular structures at each ends [82]. In vitro, PcrV self-assembles to a pentameric ring structure with inner diameter ~2-3 nm [83]. The assembled PcrV multimer also has been observed by electron microscopy at the tip of isolated
T3SS needles [84].
The hypothetical model of translocon assembly in P. aeruginosa is that PcrV,
PopB, and PopD are constitutively secreted through the T3SS, and PcrV forms a pentameric ring complex at the T3SS needle tip, providing a platform for assembly of the translocon. Once P. aeruginosa encounters the host cell, PopB inserts into the host cell membrane, and PcrV facilitates the insertion of PopD to form a PopB/PopD pore. The PopB/PopD pore is docked to the needle tip, forming a closed conduit to translocate the effectors from the bacteria to the host cell [75](Fig. 1-3).
The apparatus
The apparatus is structurally and functionally conserved among different T3SS.
In addition, the T3SS apparatus is also structurally similar to the bacterial flagellum [42]. The T3SS apparatus consists of a needle protruding from the bacterial surface and a basal apparatus across the bacterial envelope (Fig. 1-2).
The needle is assembled by polymerization of one single needle protein, which forms a hollow tube connecting to the basal apparatus. Therefore, the needle
21 serves as a channel for secretion of the T3SS substrates. The inner diameter of the needle is ~2-3 nm, suggesting that the T3SS substrates are secreted through the needle in an unfolded or partially unfolded state [44]. The length of the T3SS needle varies between different T3SS, ranging from 45 nm (Shigella flexneri) to
150 nm (S. enterica SPI-2)[85, 86]. The needle length in the Yersinia T3SS ranges from 45 to 58 nm [87]. In P. aeruginosa, the needle protein is PscF, and the length of PscF needle is ~60-80 nm [88]. The crystal structure of MixH, the homolog of PscF in S. flexneri, showed that MixH forms two long anti-parallel D- helices connected by a short peptide turn. A proposed model of needle assembly is that one needle subunit interacts with the other needle subunit through these helices to form a helical structure [89].
The T3SS basal apparatus consists of an outer membrane ring, a putative inner rod, an inner membrane (MS) ring, a putative cytoplasmic ring (C ring), and components for protein export [90](Fig. 1-2). In P. aeruginosa, PscC (outer membrane ring), PscI (inner rod), PscJ (inner membrane ring), PscD and PscQ
(putative cytoplasmic ring) form the main architecture of the apparatus [42]. PcrD,
PscU, PscR, PscS, and PscT are the T3SS components that are located at the cytoplasmic face of the apparatus and associated with the cytoplasmic ring or the inner membrane ring [91]. These proteins are essential for export of the T3SS substrates and involved in switching substrates preference.
Architecturally, the T3SS apparatus and the flagellar apparatus are similar (Fig.
1-4; Table 1-2). Both apparatus have a needle/hook structure protruding from the bacterial cell surface, an outer membrane ring, rods, an inner membrane MS ring
22 and a C ring in the cytoplasm. Although the outer membrane ring component of the T3SS is more closely related to the outer membrane components of the
T2SS, secretin [92], the outer membrane components of the T3SS and the flagellum serve the same function, forming an outer membrane ring for protein secretion. Putatively, the rod of the P. aeruginosa T3SS consists of a single protein, PscI. In contrast, the flagellum has several rod components which assemble distal rod and a proximal rod. Furthermore, the T3SS does not have a homolog of the peptidoglycan ring, the P-ring, in the flagellum. The requirement of different rods and the P-ring may be due to the fact that flagellar rods also rotate. Assembling different rods by different rod components may facilitate rod rotation in different flagellar rings. Both the T3SS and the flagellum have a central channel size ~2-3 nm. Therefore, the substrates are secreted in unfolded or partially unfolded state in both systems [42, 93, 94].
The inner membrane/MS ring, C ring and the cytoplasmic components associated with the inner membrane are conserved between the T3SS and the flagellum. The inner membrane ring component in P. aeruginosa is PscJ and its flagellar homolog is FliF. The C ring components in P. aeruginosa are PscD and
PscQ. The flagellar C ring consists of three proteins: FliG, FliN and FliM. FliG and FliN are the homologs of PscD and PscQ [42, 94]. The cytoplasmic components associated with the inner membrane are PcrD, PscU, PscR, PscS and PscT in P. aeruginosa. Their flagellar homologs are FlhA, FlhB, FliP, FliQ and FliR, respectively. Both FlhA and FlhB have an N-terminal transmembrane domain, which is inserted in the inner membrane, and a C-terminal cytoplasmic
23 domain. FlhA and FlhB are involved in substrate secretion and control of substrate specificity [95-99]. Little is known about the function of FliP, FliQ and
FliR or PscS, PscT and PscR, but these proteins are essential in the flagellum and the T3SS [100, 101]. FliM and FliO are the C ring component and the inner membrane component of the flagellum but there is no homolog found in the P. aeruginosa T3SS.
The ATPase complex
In addition, an ATPase complex is also essential for the T3SS. PscN is the
ATPase of the P. aeruginosa T3SS. PscO, PscL and PscK are considered to be the components of the ATPase complex because their homologs interact with the
ATPase of the Yersinia T3SS and the flagellum [102-104]. The ATPase is conserved between the T3SS and the flagellum. YscN and FliI are the ATPases in the Yersinia T3SS and the flagellum, respectively. In the flagellum, FliI interacts with FliH, the negative regulator of FliI ATPase activity, and FliH interacts with FliJ, a chaperone-like cytoplasmic protein [104, 105]. It is believed that FliI, FliH and FliJ form an ATPase complex and targets the secreted substrates to the flagellar apparatus. The homologs of FliH and FliJ in the
Yersinia T3SS are YscL and YscO, respectively. The interaction between YscN and YscL has been demonstrated by the GST pull-down assay in Y. enterocolitica, and YscL also inhibits the ATPase activity of YscN[103]. It has been demonstrated that FliH and FliJ interacts with the flagellar C ring components, FliN and FliM, respectively. In addition, purifying His-tagged FliM co-purifies FliN, FliJ, FliH and FliI, indicating the FliI/FliH/FliJ ATPase complex
24 interacts with the flagellar C ring[106]. A Similar interaction is also determined between YscL and YscQ, the homolog of FliN[102].
It has been proposed that the ATPase is the energy source for the T3SS, or at least helps substrate unfolding. In S. enterica, the T3SS ATPase, InvC, interacts with the chaperone bound effector. InvC promotes releasing of the chaperone from the effector and unfolds the effector in an ATP hydrolysis dependent manner. Therefore, by interacting with the C ring, the ATPase complex may target the substrates to the apparatus and promote chaperone releasing and substrate unfolding for secretion[107]. Knockout of the ATPases in the T3SS and the flagellum results in a T3SS null phenotype and loss of motility, respectively.
Hydrolysis of ATP may not only provide energy for preparing secretion- competent substrates but also for secreting the substrates through the secretion channel. However, a study in Y. enterocolitica showed that treating with CCCP, the protonophore, fully blocks secretion of the T3SS translocators and effectors and secretion of the T3SS substrates is independent of the MotA/MotB complex, the generator of proton motive force for flagellar movement[108]. Studies in the S. enterica further demonstrated the energy source for the flagellum is the proton motive force, because the ATPase null, 'fliI 'fliH, phenotype can be bypassed by mutations in FlhB, an inner membrane component of the flagellar apparatus, and the CCCP treatment abolishes secretion of the flagellar substrates in the 'fliI
'fliH suppressors. These results indicate that the T3SS and the flagellum secrete their substrates by using proton motive force generated by an unknown
25 mechanism[109, 110]. The energy source and the role of the ATPase complex in type III secretion still require further study.
The regulatory components
The components of the T3SS may have functions in: i. expression of the T3SS genes. ii. needle length control. iii. substrate preference switch. iv. control of translocator/effector secretion.
i. Expression of the T3SS genes
The ExsE-C-D-A system in P. aeruginosa is the best characterized gene regulation system. The ExsE-C-D-A system regulates transcription of the T3SS genes (Fig. 1-5). ExsA, which belongs to AraC/XylS family of transcription factors, is the master transcription activator of T3SS genes. Binding of ExsA to the promoter of the T3SS genes activates gene expression[111, 112]. ExsE is a
T3SS substrate and has inhibitory effect on activation of the T3SS gene expression. The inhibitory effect of ExsE is mediated by ExsC and ExsD. Without host cell contact, ExsE binds to ExsC and ExsD binds to ExsA. Binding of ExsD to ExsA prevents ExsA from binding to T3SS gene promoters. When effector secretion is triggered, ExsE is secreted by the T3SS, allowing ExsC to interact with ExsD. The ExsC/ExsD interaction releases ExsA from ExsD. This allows free ExsA to bind to T3SS gene promoters and activate their expression.
Therefore, activation of effector secretion is coupled with expression of the T3SS genes[113-115].
26 A similar mechanism wherein secretion of a negative regulator activates gene expression is found in the flagellum. The flagellar genes are expressed in a highly controlled hierarchy. There are three classes of flagellar genes. In the E. coli and S. enterica flagellar systems, flhD and flhC are the class I genes and the first expressed. FlhD and FlhC form a hetero-mutilmeric complex, FlhD4C2. The
70 FlhD4C2 complex binds to the promoter of the class II genes and recruits V -RNA polymerase to activate expression of the class II genes. The class II genes encode the structural components of the hook and the basal body of the apparatus. FliA, the V28 transcription factor, and FlgM, the anti-V28 protein, are also transcripted as the class II genes. FliA is a transcription activator of the class
III genes that encodes the components of the filament. FlgM is one of the flagellar substrates and inhibits the transcriptional activity of FliA by binding to
FliA. The secretion of FlgM depends on the completion of hook assembly. Once the basal body of the apparatus and the hook are fully assembled, FlgM is secreted through the flagellum. Free FliA then binds to the promoter of class III genes and activates expression of these genes for assembly of the filament[115,
116].
The chaperones of secretion substrates may also participate in control of gene expression in the T3SS and the flagellum. In the Shigella T3SS, the chaperone of the translocators also acts as a co-activator to activate the expression of late effector genes. IpgC is the chaperone of IpaB and IpaC, the pore forming translocators. Contact with the host cells triggers secretion of IpaB and IpaC and releases free IpgC that can bind to MxiE, the transcription factor of the late
27 effector genes. The transcriptional activity of MxiE depends on binding to IpgC.
Therefore, secretion of the translocators activates expression of effectors in S. flexneri[117]. The flagellar chaperone protein, FliT, also controls expression of the flagellar class II genes. FliT is the chaperone of the filament cap protein, FliD, which forms a pentamer on the end of the newly assembled hook and serves as a nucleation site for polymerization of the filament subunits. FliT binds to FliD in the bacterial cytoplasm and facilitates FliD secretion. After FliD is secreted, indicating the completion of hook assembly, free FliT binds to FlhC and inhibits the transcriptional activity of the FlhD4C2 complex, and therefore the expression of the class II genes is turned off[118].
ii. Control of needle length
In the T3SS, the needle length is well controlled. In Yersinia enterocolitica and
P. aeruginosa, the T3SS needles are ~50 nm and ~60-80 nm long, respectively[87, 88]. In the Yersinia T3SS, YscP controls length of the needle. yscP gene deletion results in formation of an extra-long T3SS needle and no secretion of the translocators and effectors[119]. YscP is also secreted by the
T3SS and has a type three secretion substrate specificity switch (T3S4) domain at the C-terminus. The T3S4 domain is required for substrate specificity switch and it has been suggested that YscP interacts with YscU, an inner membrane component of the Yersinia T3SS[120, 121]. The homolog of YscP in P. aeruginosa is PscP. Similarly, deletion of pscP results in no effector secretion and severe defect in translocator secretion[101].
28 Control of needle length is well studied in the Yersinia T3SS. A molecular ruler model has been proposed. The needle length is dependent on the length of YscP; therefore, YscP acts as a ruler to determine the needle length. The molecular ruler model proposes that the N-terminus of YscP interacts with the growing end of the needle, and the C-terminus of YscP interacts with inner membrane- anchored YscU at the cytoplasmic face of the apparatus. Along with the growing needle, the internal region of YscP is stretched. When the internal region of YscP is fully extended, YscP is exported and the length of the needle is determined[87,
94]. This model is supported by adding or deleting the internal region of YscP correspondingly increases or decreases the length of the needle[87]. One question raised with the molecular ruler model is if the YscP ruler remains in the inner channel of the needle before the proper length is reached. The size of the inner channel of the needle is ~2-3 nm, a stationary YscP in the inner channel might obstruct passage of needle subunits. The alternative ruler model proposes that the needle subunits and YscP are alternately secreted by the T3SS. More than one YscP determine the length of the needle. Once the needle reaches the proper length, which is determined by YscP, the T3SS switches substrate specificity to terminate needle assembly[94, 122]. Whereas a recent study showed that the needle length is controlled by one YscP molecule by comparing the theoretical needle length distribution with the experimental needle length distribution in Y. enterocolitica simultaneously expressing different YscPs[123].
Deletion of InvJ and Spa32, the YscP homologs in S. enterica and S. flexneri, also result in loss of needle length control and no substrate secretion[124, 125].
29 Moreover, deletion of InvJ disrupts assembly of the inner rod[126]. Therefore, it was proposed that timing of the substrate switch is determined by assembly of the inner rod. Before the inner rod assembly is completed, the T3SS secretes the inner rod subunit and the needle subunit. InvJ facilitates assembly of the inner rod. After the inner rod is assembled, the T3SS switches its substrate specificity, assembly of the needle is terminated and the needle length is determined[94,
126]. This model also explains why overexpression of the needle subunit results in unregulated needle length in S. enterica and S. flexneri[85, 125]. However, the model does not fit in with the observation that the needle length is correlated with the length of YscP in the Yersinia T3SS. The mechanism that controls the needle length may be different between the Yersinia T3SS and the Salmonella T3SS.
The length of the hook in the flagellum is controlled as well. In the flagellum,
FliK is the homolog of YscP. Adding or deleting the length of FliK correspondingly increases or decreases the length of the hook. However, the distribution of hook length peaks at 55 nm, the wild type hook length, in a fliK null mutant, suggesting that the hook length is still controlled by other mechanisms[127]. Other models, such as the C ring cup model and the molecular-clock model, have been proposed. The C ring cup model proposes that the length of the hook is determined by the volume of the space encompassed by the C ring of the flagellar apparatus since the mutations in the fliG, fliM, and fliN, the genes encoding C ring components, affect the hook length[128]. The hook subunits fill the space of the C ring cup, and the C ring cup serves as a measuring cup to determine how many hook subunits are exported. After the hook is assembled,
30 FliK is secreted and switches the substrate specificity from hook subunit to filament subunit[93, 128]. The molecular-clock model proposes that auto- cleavage of FlhB, the homolog of YscU, determines the length of the hook. The half-life of un-cleaved FlhB is ~ 5 minutes in vitro. Before auto-cleavage of FlhB occurs, the flagellum secretes the hook subunits. Secretion of the hook subunits is shut off after FlhB is auto-cleaved, then the FliK is secreted and the substrate specificity is switched to filament subunits[93, 129].
iii. Substrate preference switch
As mentioned in the previous section, the substrate specificity is changed from early substrates, the needle subunit, to late substrates, translocators and effectors, after needle assembly is completed. An yscP mutant secretes the early substrates but not the late substrates, suggesting that the needle ruler also participates in the substrate specificity switch[119]. YscP regulates the substrate switch by the interaction with YscU. Mutations in yscU bypass the yscP null phenotype and restore secretion of the late substrates[121]. The T3S4 domain at the C-terminus of YscP mediates the YscP/YscU interaction. Deletion of the
T3S4 domain in YscP results in no secretion of the late substrates. Interestingly, deletions at the N-terminus of YscP only affect the needle length but not secretion of the late substrates[120, 130].
YscU has a transmembrane domain at the N-terminus for anchoring in the inner membrane and a cytoplasmic domain at the C-terminus[131]. Like its homolog in the flagellum, FlhB, the cytoplasmic domain of YscU undergoes auto-
31 cleavage and produces a cytoplasmic N-terminal fragment (CN) and a cytoplasmic C-terminal fragment (CC). After auto-cleavage, the CC fragment remains associated with the CN fragment. The non-cleavable YscU mutants,
YscUN263A and YscUP264A, only secrete effectors but not translocators[132]. The corresponding mutation in PscU, the YscU homolog in P. aeruginosa, also causes a similar effect: secretion of PopB and PopD is blocked but not effector secretion[101].
iv. Control of translocator/effector secretion
In P. aeruginosa, the PopN complex is the conserved protein complex that functions as a gatekeeper for substrate secretion, particularly effector secretion.
The PopN complex consists of PopN, Pcr1, Pcr2, and PscB. Deleting any components of the PopN complex results in premature effector secretion[101,
133, 134]. PopN is also a secretion substrate of the T3SS. Like effector secretion, secretion of PopN is dependent on host cell contact, but PopN does not contain any known enzymatic activity[76]. The crystal structure of the whole YopN complex, the homolog of PopN complex in Yersinia spp., has been solved[135]. It showed that SycN and YscB, the homolog of Pcr2 and PscB, respectively, bind to the N-terminus of YopN, and TyeA, the Pcr1 homolog, binds to the C-terminus of YopN. SycN and YscB are the chaperones of YopN. The interaction between
YopN and TyeA is essential for the regulatory activity of YopN. Disruption of the
YopN/TyeA interaction results in premature effector secretion. Furthermore, some TyeA mutants, which cause deregulated effector secretion, do not interfere with the interaction with YopN. Therefore, TyeA has been proposed to interact
32 with the apparatus, which is required for the regulatory function of the YopN complex[136]. Although a non-secreted YopN mutant, whose N-terminal secretion signal has been deleted, loses its ability to control effector secretion,
YopN exerts its regulatory activity in the bacterial cytoplasm. A YopNF234S mutant bypasses the requirement of the N-terminal secretion signal of YopN and YopN chaperone. However, YopNF234S still needs TyeA to control effector secretion.
Therefore, TyeA may tether YopN to the apparatus to regulate effector secretion, which may be facilitated by the chaperones[137].
In the Shigella T3SS and the Salmonella SP-I T3SS, the gatekeepers are
MxiC and InvE, respectively. MixC is also secreted by the Shigella T3SS, but
InvE is a non-secreted protein. Deletion of MxiC results in premature effector secretion but inhibited translocator secretion. A similar phenotype is observed in an InvE deletion mutant[138-140]. MxiC is structurally similar to a YopN-TyeA fusion protein[141], and InvE has been identified as a membrane associated protein[140]. Therefore, the gatekeepers may regulate substrate secretion by interacting with the apparatus. In addition to the gatekeepers, the needle tip protein and its chaperone, for example PcrV and PcrG in P. aeruginosa, respectively, also participate in control of effector secretion[133](discussed in the later secretion).
Triggering of effector secretion
33 The T3SS activates effector secretion upon host cell contact in vivo. Effector secretion also can be triggered without host cell contact in vitro. In the Yersinia
T3SS and the P. aeruginosa T3SS, adding Ca2+ chelators, e.g. EGTA, to remove
Ca2+ from the culture medium triggers effector secretion [142-144]. In contrast, translocator secretion, including PopB, PopD and PcrV, is independent of activation signals. The translocators are constitutively secreted by the P. aeruginosa T3SS[124].
It has been proposed that the low Ca2+ dependent effector secretion phenotype might explain triggering of effector secretion by host cell contact since the Ca2+ concentration in the cytoplasm of the host cells is relatively low.
However, data from our laboratory suggests that low Ca2+ concentration in the host cell cytoplasm is not the triggering signal. Using a Ca2+ ionophore to abolish the Ca2+ gradient across the host cell membrane does not interfere with triggering of effector secretion by host cell contact, suggesting that other host factors may be the physiological trigger of effector secretion[76]. It is known that the P. aeruginosa T3SS can translocate the effectors into various types of human cells and different organisms, such as human, insects and nematodes, implying that a common host factor triggers effector secretion[145-149]. However, the mechanism of how effector secretion is activated by host cell contact in vivo or by removal of Ca2+ in vitro still remains largely unknown.
The needle tip protein participates in control of effector secretion
34 Being a key component of the translocon, PcrV is also a regulator of effector secretion. Deleting pcrV results in premature effector secretion before receiving activation signals, e.g. host cell contact and removal of Ca2+, suggesting that
PcrV is a negative regulator of effector secretion[133, 150]. Deletion of the T3SS needle tip genes, such as ipaD in S. flexneri and sipD in S. enterica, also activates effector secretion[48, 151]. In contrast, LcrV, the needle tip protein in
Yersinia spp., acts as a positive regulator. Effector secretion is inhibited in an lcrV null mutant[152-154]. Although the role of the needle tip proteins in different
T3SS varies, it is a common feature that the needle tip proteins control effector secretion.
The chaperone of the needle tip protein is also a negative regulator in control of effector secretion. LcrG and PcrG are the chaperones in Yersinia spp. and P. aeruginosa, respectively[153, 155]. Deletion of LcrG and PcrG results in premature effector secretion. However, a lcrG null or pcrG null mutant remains cytotoxic to the host cells, suggesting that assembly of the translocon is not affected[133, 153, 156, 157]. The needle tip proteins of the Shigella T3SS and the Salmonella T3SS do not have identified chaperones. However, the N- terminus of IpaD has been suggested to be the chaperone domain. Deletion of the chaperone domain of IpaD also causes premature effector secretion without affecting the invasion ability[158, 159]. Therefore, in addition to the cytoplasmic gatekeeper protein, the needle tip protein and its chaperone also control effector secretion.
35 Regulatory models for control of effector secretion
The cytoplasmic gatekeeper protein complex, e.g. the PopN complex, the needle tip protein and its chaperone prevent effector secretion prior to receiving the activation signals. Several models have been proposed to describe how these proteins regulate effector secretion.
The plug model
A plug model has been proposed to explain how the needle tip protein regulates effector secretion in S. flexneri. It proposes that IpaD, the needle tip protein, functions as a plug at the needle tip to block effector secretion[151].
Removal of the N-terminal secretion signal of IpaD abolishes IpaD secretion and activates effector secretion[159]. Structural modeling based on the crystal structure of IpaD shows that IpaD may form a pentamer at the needle tip and the central channel of the IpaD pentamer is closed[158]. In addition to IpaD, deletion of IpaB, one of the pore forming proteins of the Shigella T3SS, also causes premature effector secretion[160]. IpaB interacts with IpaD and has been detected at the tip of purified needles. The structural modeling also suggests that
IpaD and IpaB can form a 4:1 heterocomplex[158, 161]. Formation of the
IpaD/IpaB heterocomplex at the needle tip explains activation of effector secretion upon host cell contact: Insertion of IpaB in the host cell membrane changes the conformation of the IpaD/IpaB heterocomplex, which opens the plug and allows secretion of another pore forming protein, IpaC, and subsequently effectors.
36 However, the T3SS constitutively secretes the translocators prior to receiving the activation signal, which strongly argues against the model that the needle tip complex functions as physical plug to block protein secretion. Furthermore, the inner diameter of the PcrV pentamer in vitro is ~2-3 nm[83], which is wide enough for unfolded or partially unfolded proteins to pass through. Neither PopB nor PopD, the pore forming proteins of the P. aeruginosa T3SS, have been visualized at the needle tip, and effector secretion in the P. aeruginosa T3SS is still dependent on receiving an activation signal in popB and popD null mutants[76].
The LcrG/LcrV titration model
In contrast to other needle tip proteins that are negative regulators of effector secretion, LcrV, the needle tip protein in the Yersinia T3SS, acts as a positive regulator. LcrG, the cytoplasmic chaperone of LcrV, is a negative regulator. A titration model proposes that control of effector secretion in the Yersinia T3SS is dependent on the ratio of LcrV and LcrG. LcrG blocks effector secretion by binding to the apparatus, and LcrV promotes release of LcrG from the apparatus through the LcrV/LcrG interaction[153, 157]. This model is supported by the observations that overexpression of LcrV stimulates effector secretion and loss of the LcrG/LcrV interaction inhibits effector secretion[162-164]. The titration model allows constitutive translocator secretion because LcrG may only block the acceptor site for effectors and the acceptor site for translocators is not obstructed. However, lcrG and lcrV are in the same operon and induction of more lcrV expression over lcrG expression when effector secretion is triggered
37 has not been demonstrated. In addition, effector secretion is still activated in Y. pseudotuberculosis treated with chloramphenicol, indicating that new protein synthesis is not required for activation of effector secretion[165].
The allosteric model
Since the Pseudomonas T3SS constitutively secretes translocators, the needle tip complex must remain opened for translocator secretion but still prevent effector secretion prior to receiving activation signals. This led to establishment of an allosteric model. The allosteric model proposes that the needle tip complex regulates effector secretion by conformational changes, which are triggered by the activation signal for effector secretion. The conformational change of the needle tip complex transmits the activation signal, propagated through the needle, to the apparatus and induces conformational changes in the apparatus to activate effector secretion. Therefore, the needle tip complex, as well as the needle and the apparatus, has two conformations: effector secretion “on” state and “off” state[166-168]. The allosteric model asserts that the needle tip complex can stay opened for constitutive translocator secretion and in an effector secretion “off” conformation to prevent effector secretion. Needle protein mutants that result in premature effector secretion have been isolated in S. flexneri, Yersinia pestis and P. aeruginosa (Isolation of the needle mutants in P. aeruginosa is discussed in chapter 4), suggesting that the needle can be locked in the effector secretion “on” state[166, 167, 169]. In addition to the effector secretion “on” mutants, needle protein mutants that selectively block effector secretion have been isolated in S. flexneri. These latter
38 mutants only secrete translocators but not effectors even when grown in effector secretion inducing conditions, indicating that the needle is competent to secrete the T3SS substrates but permanently stays in an effector secretion “off” state[168].
The sensor model
The sensor model is based on the gatekeeper complex and was first established in Yersinia spp. The sensor model hypothesizes that the N-terminal secretion signal of YopN is inserted in the export channel of the apparatus and the C-terminus of YopN is tethered to the apparatus through the interaction with
TyeA. The chaperones may stabilize the binding of YopN to the apparatus.
Without activation signal for effector secretion, YopN is not secreted and blocks the acceptor site for effectors on the apparatus to prevent effector secretion.
Once the activation signal is received, YopN is secreted and the acceptor site for effectors is free[137]. Therefore, YopN acts like a sensor for triggering of effector secretion. The plug model and the allosteric model can accommodate the sensor model. The plug at the needle tip blocks effector secretion by preventing sensor secretion. It is possible that the N-terminus of the sensor in the export channel interacts with the needle tip complex to sense the conformational change of the needle tip complex when the activation signal is received[168]. An analogous mechanism in the T3SS is control of needle length by YscP as described in the earlier section. The allosteric model can simply activate sensor secretion by inducing a conformational change of the apparatus. However, the
39 interaction between the needle tip complex and the sensor and the interaction between the sensor and the apparatus have not been demonstrated yet.
40
Figure1Ͳ1.ProteinsecretionsystemsinGramͲnegativebacteria.
41
Figure1Ͳ2.TheT3SSinP.aeruginosa.TheP.aeruginosaT3SSconsistsofmorethan30 proteins.Theneedletipprotein,PcrV,anditschaperone,PcrG,arenegativeregulators ofeffectorsecretion.ThePopNcomplex,consistingofPopN,Pcr1,Pcr2andPscB,also negativelyregulateseffectorsecretioninthecytoplasm.Theeffectors(ExoS,ExoT,ExoU andExoY)andtheirchaperones(SpcSforExoSandExoT.SpcUforExoU.)arenot includedinthisfigure.
42 Figure1Ͳ3.AssemblyoftheP.aeruginosatranslocon.Priortocontactwiththehost cells,theT3SSsecretestranslocatorsbutnoteffectors.Oncethebacteriumhas attachedtothehostcells,PopBandPopDareinsertedinthehostcellmembraneand formaPopB/PopDpore.Theneedletipprotein,PcrV,connectswiththePopB/PopD poreandaclosedconduitisformedforeffectorsecretion.
43 Figure1Ͳ4.StructuralandfunctionalhomologybetweentheP.aeruginosaT3SSand theS.entericaflagellum.Thehomologouscomponentsareinblueandthefunctional analogsareinwhite.TheMotABcomplexisthegeneratorofprotonmotiveforce,which drivesrotationoftheflagellum.TheflagellarCringcomponent,FliM,andinner membranecomponent,FliO,havenohomologsintheT3SS(showningrayfontand underline).
44 Figure1Ͳ5.TheExsEͲCͲDͲAsystemintheP.aeruginosaT3SS.Priortoreceivingofthe activationsignal,ExsEisnotsecretedandbindstoExsC.ExsDbindstoExsAandprevents ExsAfrombindingtothepromoterofT3SSgenes.Wheneffectorsecretionistriggered, ExsEissecretedandExsCbindstoExsD.BindingofExsCtoExsDreleasesExsAfromExsD. FreeExsA,therefore,activatesexpressionoftheT3SSgenes.(E:ExsE,C:ExsC,D:ExsD,A: ExsA)
45 Table1Ͳ1.T3SShomologsindifferentbacteria Pseudomonas Yersiniasp. Shigella Salmonella Escherichia aeruginosa flexneri sp.(SPIͲ1) coli
Poreforming PopB/PopD YopB/YopD IpaB/IpaC SipB/SipC EspD/EspB proteins
Needletip PcrV LcrV IpaD SipD EspA
Needle PscF YscF MixH PrgI EscF
Rod PscI YscI MxiI PrgJ EscI
Needlelength PscP YscP Spa32 InvJ Orf16(?) control
Outermembrane PscC YscC MxiD InvG EscC ring
Innermembrane PscD YscD MxiG PrgH EscD ring PscJ YscJ MxiJ PrgK EscJ
Inner/cytoplasmic PcrD YscV MxiA InvA EscV components PscU YscU Spa40 SpaS EscU
PscR YscR Spa24 SpaP EscR
PscS YscS Spa9 SpaQ EscS
PscT YscT Spa29 SpaR EscT
PscQ YscQ Spa33 SpaO EscQ
ATPase PscN YscN Spa47 InvC EscN
ATPase PscO YscO Spa13 InvI Orf15(?) associated PscL YscL MxiN OrgB EscL
PscK YscK MxiK OrgA Orf4
Gatekeeper PopN/Pcr1 YopN/TyeA MxiC InvE SepL
Transcription ExsA LcrF MxiE HilA/InvF ? Factor
46 Table1Ͳ2.HomologsintheP.aeruginosaT3SSandtheS.entericFlagellum
Flagellum TypeIIIsecretionsystem (Salmonellaenterica (Pseudomonasaeruginosa) serovarTyphimurium) Hook/Needle FlgE(Hook;Diameter:2.5nm) PscF(Needle;Diameter:2Ͳ3nm) Hook/Needlelengthcontrol FliK(hooklength:55nm) PscP(needlelength:60Ͳ80nm) Lring/outermembrane# FlgH(Lring) PscC Rod,Peptidoglycanring,rodassociatedproteins# FlgG(distalrod) PscI(rod) FlgI(Pring,peptidoglycanring) FlgB,FlgC,FlgF(proximalrod) FliE,FlhE(rodͲassociatedproteins) MSring/innermembrane FliF(MSring,innermembrane) PscJ(innermembrane) Cring/innermembrane FliG PscD FliN PscQ FliM* Innermembrane/cytoplasmicapparatuscomponents FlhA PcrD FlhB PscU FliP PscR FliQ PscS FliR PscT ATPase FliI PscN ATPaseassociatedproteins FliJ PscO FliH PscL PscK* Gatekeeperforlatesubstrates# Flk PopN Pcr1 Transcriptionfactors# FlhDC(forClassIIgenes) ExsA(mastertranscriptionfactorfor FliA(V28,forClassIIIgenes) P.aeruginosaT3SS) Secretednegativeregulators# FlgM ExsE
#:Functionalanalogs.*:nohomologintheflagellumortheT3SS.
47 Chapter2 ControlofEffectorSecretionbytheT3SSneedletipprotein,PcrV
48 Summary
The T3SS is important for the pathogenicity of Pseudomonas aeruginosa.
However, the mechanism that controls effector secretion is still unclear. The study in this chapter focuses on how the T3SS needle tip protein, PcrV, and its chaperone protein, PcrG, regulate effector secretion in the P. aeruginosa T3SS.
pcrG and pcrV deletion mutants resulted in premature effector secretion, suggesting PcrG and PcrV negatively regulate effector secretion. Overexpressing pcrG, pcrV, or pcrGV had no effect on control of effector secretion, indicating that
PcrG and PcrV act differently from the Yersinia LcrG/LcrV titration model. The N- terminal secretion signal of PcrV is required for PcrV secretion and control of effector secretion. Although the ability to interact with PcrG remains, the non- secreted PcrV is not a dominant negative mutant, in that it does not interfere with effector secretion controlled by wild type PcrV. These results indicate that PcrV needs to be secreted in order to control effector secretion. PcrV mutants with point mutations were constructed to dissect if the PcrG/PcrV interaction and/or assembly of PcrV are required for the regulatory function of PcrV. PcrVF279R, which interacts with PcrG and fails to assemble at the needle tip, lost the ability to regulate effector secretion. In contrast, PcrVL262D, a mutant that could not interact with PcrG, kept similar regulatory activity and assembly property as wild type PcrV. Therefore, assembly of PcrV at the needle tip is required for control of effector secretion, and the PcrG/PcrV interaction is not necessary. In addition, we defined that the N-terminus of PcrG is the PcrV interacting domain and the C- terminus of PcrG has most of the activity for control of effector secretion.
49 In conclusion, secretion and proper assembly of PcrV on the T3SS needle tip is necessary for the regulatory function of PcrV. We hypothesize that PcrV regulates effector secretion through an allosteric mechanism. PcrG acts in a
PcrV-independent manner in the cytoplasm and may interact with the T3SS apparatus to control effector secretion.
50 Introduction
P. aeruginosa uses the T3SS to intoxicate its host cells. The T3SS directly translocates effectors from the bacterial cytoplasm into the host cell cytoplasm where the effectors interfere with normal cellular function of the host cell. The
T3SS forms a syringe like structure, which is composed of an apparatus across the bacterial envelope and a needle protruding from the bacterial cell surface[49].
PcrV is the needle tip protein in the P. aeruginosa T3SS. The presence of
PcrV at the needle tip has been visualized by electron microscopy[84]. In vitro, purified PcrV self-oligomerizes into a pentamer and forms a doughnut like structure with an inner diameter ~2-3 nm[83]. PcrV serves as a platform for assembly of the T3SS translocon which consists of PcrV, PopB and PopD and mediates translocation of the effectors[77].
Presence of the T3SS is important for the virulence of P. aeruginosa in human diseases and experimental animal models of disease[20-25]. Because PcrV is essential for the virulence mediated by the P. aeruginosa T3SS, PcrV has been considered as a therapeutic target for treating P. aeruginosa infections.
Moreover, PcrV is secreted by the T3SS and located outside of the bacterial cells, which makes PcrV easily accessible for drug targeting. Indeed, anti-PcrV antibodies have been developed against the P. aeruginosa T3SS. Administration of anti-PcrV antibodies reduces the virulence of P. aeruginosa in animal models.
In vitro cell line studies showed that the anti-PcrV antibody prevents assembly of the translocon in the host cell membrane and inhibits cytotoxicity of P. aeruginosa[170-176]. An engineered human anti-PcrV antibody Fab fragment
51 has been developed for treating ventilator-associated P. aeruginosa infection in patients[177].
In addition to assembly of the translocon, the needle tip protein participates in control of effector secretion. In P. aeruginosa, S. flexneri, and S. enterica, the needle tip protein is a negative regulator of effector secretion[48, 133, 151].
Several models have been proposed to describe how the needle tip protein negatively regulates effector secretion. The plug model proposes that the needle tip protein acts as a plug to prevent effector secretion. If the needle tip protein physically blocks effector secretion by capping the secretion channel, secretion of the pore-forming translocators must be blocked as well. This is supported by the observation in S. flexneri that the translocators are not secreted by the bacteria in the mid-log growth phase without the artificial inducer of effector secretion, Congo red[178]. However, in P. aeruginosa, it has been demonstrated that the translocators are constitutively secreted by the T3SS[76]. In a 'exsE P. aeruginosa strain, the T3SS genes are highly expressed, and multiple T3SS apparatuses are assembled in each cell. However, effector secretion is blocked until the activation signal for effector secretion is received. In contrast, secretion of the translocators, including PopB, PopD and PcrV, is independent of the activation signal[76, 113]. Constitutive translocator secretion strongly argues against the plug model.
The allosteric model proposes that the needle tip protein controls effector secretion by inducing conformational changes of the apparatus. Therefore, the needle tip protein, the needle and the apparatus have two different
52 conformational states: effector secretion “on” and “off”. In the allosteric model, the needle tip protein can accommodate an opened structure for translocator secretion and an effector secretion “off” state to prevent effector secretion.
However, conformational changes in the needle tip protein, the needle and the apparatus have not been demonstrated yet.
The LcrG/LcrV titration model in Yersinia spp. is based on the observation that
LcrV, the needle tip protein, is a positive regulator and LcrG, the needle tip chaperone, is a negative regulator. The titration model proposes that LcrG binds to the apparatus and blocks effector secretion. LcrV interacts with LcrG and releases LcrG from the apparatus to activate effector secretion[153, 157].
Although LcrV and PcrV share high degree of similarity, the roles of PcrV and
LcrV in effector secretion are opposite. Both PcrG, the homolog of LcrG in P. aeruginosa, and PcrV are negative regulators in effector secretion[133].
However, like the LcrG/LcrV interaction, the PcrG/PcrV interaction may be important for the regulatory function of PcrG and PcrV. PcrV and PcrG may cooperatively control effector secretion by binding to the apparatus.
We investigated how PcrV regulates effector secretion in P. aeruginosa. We confirmed that PcrV and PcrG are negative regulators in control of effector secretion. We demonstrated that the N-terminal secretion signal is required for secretion of PcrV, which is essential for the regulatory activity of PcrV. We constructed PcrV and PcrG point mutants and showed that the PcrG/PcrV interaction is not necessary to control effector secretion. The PcrG/PcrV interaction facilitates PcrV exports and promotes PcrG stability. Moreover, we
53 showed that PcrV needs to be present and well assembled at the needle tip in order to control effector secretion and PcrG regulates effector secretion in the cytoplasm in a PcrV-independent manner. In conclusion, our results suggest that
PcrV allosterically regulates effector secretion at the needle tip.
Materials and methods
Media and culture conditions
All E. coli strains were routinely grown at 37°C in LB medium containing 10g/l
NaCl. P. aeruginosa was grown at 37°C in a modified LB medium (LB-MC) containing 200mM NaCl, 0.5mM CaCl2 and 10mM MgCl2. Strains and plasmids used in this study are listed in Table 2-1. Primers used in this study are listed in
Table 2-1. Construction of the plasmids was described in reference #150.
PexoS-lacZ reporter assay
All the strains tested with the PexoS-lacZ reporter assay have their chromosomal exoS gene replaced by a lacZ reporter gene. Overnight cultures were 1:300 diluted in 3 ml of LB-MC medium. After 2 hours of incubation at 37 °C, 1 ml of culture was added into 1 ml of pre-warmed 1 ml LB-MC medium and another 1 ml of culture was added into 1 ml of pre-warmed 1 ml LB-MC medium with 5 mM
EGTA. The cultures were incubated at 37 °C for an additional 2 hours. Then the cultures were put on ice for 10 minutes. The E-galactosidase activity was determined with the protocol described by Millier[179].
RECC assay
54 P. aeruginosa was diluted 1:250 from overnight cultures and grown at 37 °C to mid-log phase (OD600 ~ 0.4) in LB-MC medium with 5 mM EGTA (the Ca2+ chelator). At this point, 4ml of culture were aliquoted in two microcentrifuge tubes and spun down, the supernatants were removed and one cell pellet was resuspended in 2 ml pre-warmed LB-MC medium without EGTA, the other in 2 ml pre-warmed medium with EGTA. The cultures were incubated at 37 °C for an additional 30 minutes. Then the cultures were placed on ice for 10 minutes. 1 ml of each culture was spun down and 0.5ml of the supernatant was transferred to a fresh microcentrifuge tube. The secreted proteins in supernatant were precipitated by adding trichiloroacetic acid (TCA) to the supernatant (final concentration: 10%). The remainder of the culture was used to determine the
OD600. Cell pellets and TCA precipitated supernatant samples were resuspended in 1x SDS sample buffer to correspond to an OD600 of 10. The samples were then boiled at 95 °C for 10 minutes. The supernatant and pellet protein samples were separated by SDS-PAGE, transferred to PVDF membrane and probed with specific antibodies. Primary antibodies were detected by using horse-raddish peroxidase conjugated secondary antibodies and an enhanced chemiluminescent detection reagent (SuperSignal West Pico (Pierce)). Exposure times for cell and supernatant fractions varied.
Cytotoxicity assay
The human A549 lung cancer cell line was used as host cells for P. aeruginosa infection to determine cytotoxicity. 3*105 A549 cells were cultured in 24-well plate with RPMI-1640 medium and 10% FBS. After overnight incubation at 37°C, 5%
55 CO2, the old medium was removed and replaced with fresh RPMI-1640 medium without FBS. The A549 cells were infected with P. aeruginosa at M.O.I.=10 at
37°C, 5% CO2 for 5 hours. At this point, A549 cells were gently washed with
PBS and fixed with 1% paraformaldehyde. Fixed A549 cells were observed under phase-contrast microscope. Percentage of round A549 cells was calculated as (number of round cells)/(number of round cells+ number of attached cells)
E. coli bacterial two-hybrid analysis
The Zif/omega bacterial two-hybrid system was used in this study. PcrV was fused to the omega subunit of RNA polymerase and PcrG was fused to the monomeric DNA binding protein, Zif. Expression of the fusion proteins was induced with 5 PM IPTG. Overnight cultures were 1:300 diluted in 3 ml of LB medium. After 2 hours of incubation at 37 °C, 1 ml of culture was added into 1 ml of pre-warmed 1 ml LB medium and another 1 ml of culture was added into 1 ml of pre-warmed 1 ml LB medium with 5 PM IPTG. The cultures were incubated at
37 °C for an additional 2 hours. Then the cultures were put on ice for 10 minutes.
The E-galactosidase activity was determined by the protocol described by Millier
[179].
FACS analysis
FACS analysis for detecting surface-localized PcrV is described in reference
#150.
Immunoprecipitation
56 Overnight cultures were diluted 1:300 into fresh LB-MC medium and grown at
37°C for ~ 3 hours. 5ml of culture were pelleted and resuspended in IPP150 buffer (10 mM Tris pH 7.5, 150 mM NaCl, 1 mM PMSF) at an OD600 of 5. The cell suspensions were kept on ice and sonicated four times for 30 seconds at power level 4 (Sonicator Cell Disruptor (W200R) Heat System Ultrasonics Inc.).
The cell lysates were pelleted at 4°C 13,200 rpm for 10 minutes and the supernatants were transferred to a new microcentrifuge tube. 45 ȝl of the supernatant was taken out and mixed with 15 ȝl of 4x SDS sample buffer as input control. The remainder of supernatant was pre-cleared with 20ȝl of IPP150- washed protein A/G agarose beads (Santa Cruz Biotechnology) for 15 minutes.
The beads were removed by centrifugation at 8,000 rpm for 3 minutes and the supernatant was transferred to a new microcentrifuge tube. 3ȝl rabbit anti-VSV-G antibody (Sigma) was added to each tube and the supernatant were incubated at
4°C on a rocker for 45 minutes. Then 30ȝl of IPP150-washed protein A/G agarose beads were added to each tube and the samples were rocked for an additional 45 minutes at 4°C. The beads were then pelleted, washed 3 times with wash buffer (10 mM Tris pH 7.5, 50 mM NaCl, 1% Triton X-100, 1 mg/ml BSA) and resuspended in 60ȝl 1x SDS sample buffer. The samples were incubated at
55°C for 10 minutes to elute proteins bound to the beads. Then the samples were vortexed and centrifuged. The supernatant were collected as elution fraction.
Fractionation
57 P. aeruginosa PAO1F ǻexsE ǻfleQ pcrG(i3VG) transformed with pPSV18 (ampR for the source of Elactamase) was grown overnight in LB-MC medium without antibiotics. The overnight cultures were diluted 1:300 in 12 ml of fresh LB-MC medium and cultured at 37 °C to mid-log phase (OD600 ~0.3-0.4). 1 mil of culture was removed and spun down. 0.5 ml of the supernatant was collected and the secreted proteins were precipitated with 10 % TCA. The precipitated protein samples were re-suspended in 100 Pl of 1XSDS sample buffer as secreted fraction. Spheroblast formation was carried out based on the technique of Cheng et al. (Cheng et al., 1971). 10 ml of the remaining culture were pelleted and resuspended in 0.9 ml PEB buffer (20% sucrose, 30 mM Tris pH 8.0). 100 ȝl of a 10mg/ml lysozyme solution in PEB buffer and 5 ȝl of 400 mM EDTA pH 8.0, were added into the 0.9 ml PEB cell suspension. The suspension was incubated at room temperature for 20 minutes. Then the bacteria were pelleted at 5,000 xg for 5 minutes. 75ȝl of the supernatant were removed and mixed with 25ȝl of 4x sample buffer as periplasm fraction. The remaining supernatant was discarded and the cell pellet was resuspended in 1 ml of cold PBS with 1 mM PMSF.
Formation of spheroblast was confirmed by microscopy. The spheroblast suspension was sonicated four times with 30 second interval at power level 4
(Sonicator Cell Disruptor (W200R) Heat System Ultrasonics Inc.). The tube was kept on ice to prevent overheating of the samples. Lysis of the cells was confirmed by microscopy. After sonication, un-lysed cells were removed by centrifugation (10 minutes, 13,200 rpm at 4°C). The supernatant was transferred to ultracentrifuge tubes and centrifuged at 4°C, 45000 rpm for 1 hour. 75ȝl of the
58 supernatant fraction were removed and mixed with 25ȝl of 4x sample buffer as cytoplasmic fraction samples. The pellet was resuspended in 1ml 1x SDS sample buffer as membrane fraction samples. Internally VSV-G tagged PcrG was detected by Western blotting using a commercial rabbit anti-VSV-G antibody
(Sigma). The fractionation was controlled by detecting OprH (membrane fraction),
ȕ-lactamase (periplasmic fraction), RpoA (cytoplasmic fraction) and PcrV
(secreted fraction).
Overexpression in E.coli and Ni-chromatography
Combinations of PcrG, PcrV and mutants of either protein were expressed in E. coli BL21(DE3) Codon+ -RP (Stratagene) using the pDuet1 co-overexpression plasmid (Novagen). Bacteria were grown overnight in 2x YT broth with 30ȝg/ml chloramphenicol and 60ȝg/ml carbenicillin. The overnight culture were diluted
1:300 into fresh 2xYT broth and grown at 37 °C for 2-2.5 hours. IPTG (final concentration: 100ȝM) was added into the culture to induce expression of PcrG and PcrV. The culture were incubated at 37 °C for an additional 25 minutes, and then placed on ice. 5 ml of culture were spun down and the pellets were resuspended in cold Equilibrium buffer (50 mM Na2PO4 300 mM NaCl, 5 mM imidazole, 1 mM PMSF pH 7.0) and normalized to OD600= 5. The cell suspensions were sonicated 4 times with 30 second interval at power level 4
(Sonicator Cell Disruptor (W200R) Heat System Ultrasonics Inc.). The cell lysate was centrifuged 13,200 rpm for 10 minutes at 4°C. 45 ȝl of the supernatant were removed and mixed with 15 ul of 4x SDS sample buffer as input control.
Equilibrium buffer washed TALON beads (50 ul of original volume of bead
59 suspension) were added to the remaining supernatant and the suspension was incubated at 4 °C on a rocker 1 hour. The beads were then pelleted by centrifugation (8,000 rpm for 3 minutes) and washed 4 times with Equilibrium buffer. 200 ȝl Elution buffer (50 mM Na2PO4 300 mM NaCl, 300 mM imidazole, 1 mM PMSF pH 7.0) was added to the washed beads to elute bounded proteins.
The elution process was repeated once and the two elution fractions were combined and mixed with proper volume of 4XSDS sample buffer. The protein samples were separated by SDS-PAGE and transferred to a PVDF membrane.
PcrV and His-tagged PcrG were detected by Western blotting.
MBP-fusion purification
The purification of MBP-PcrG fusion proteins is described in reference #150.
Results
PcrG and PcrV are negative regulators of effector secretion.
To confirm the role of PcrG and PcrV in control of effector secretion, we first deleted pcrG and pcrV genes in P. aeruginosa and determined effector secretion by the PexoS-lacZ reporter assay and the RECC assay. The PexoS-lacZ reporter assay is based on the feature that activation of effector secretion is coupled with expression of the T3SS genes in P. aeruginosa. The P. aeruginosa T3SS gene exoS is replaced by a lacZ reporter gene whose expression is then controlled by the exoS promoter. Therefore, triggering effector secretion also induces the activity of E-galactosidase, the gene product of lacZ. The RECC (Re-Establish
60 Calcium Control) assay is a modified secretion assay to determine if effector secretion is Ca2+ regulated. The P. aeruginosa strains were first grown in the culture medium without Ca2+ to induce secretion of the effectors and expression of the T3SS genes. Induction of the T3SS gene expression prevents the interference that may result from different protein expression levels. The bacteria were then pelleted and re-suspended in culture medium with or without Ca2+.
After a defined period of incubation the bacterial cultures were centrifuged and the supernatant and the cell pellets were collected to determine if adding Ca2+ back to the culture medium blocks effector secretion[76].
As shown in Fig. 2-1A, effector secretion is regulated by presence of Ca2+in the culture medium. Removal of Ca2+ by adding EGTA induced effector secretion, which is reflected by increase of E-galactosidase activity. pcrG and pcrV deletions resulted in deregulated effector secretion; in other words, effector secretion was constitutively activated even if Ca2+ was present in the culture medium. Furthermore, the pcrGV double deletion resulted in more effector secretion than the pcrG or pcrV single deletion (Fig. 2-1A). Secretion of the effector, ExoT, is also examined by the RECC assay to confirm the observation by the PexoS-lacZ reporter assay. EoxT secretion is deregulated in the pcrG and pcrV deleted strains. The pcrGV double deletion also caused more deregulated
ExoT secretion than the pcrG or pcrV single deletion (Fig. 2-1B). Expressing pcrG, pcrV or pcrGV from plasmids complemented the corresponding gene deletions in the P. aeruginosa chromosome (Fig. 2-1A). Expressing pcrG or pcrV from the plasmids in the pcrGV double deletion mutant reduced the level of
61 effector secretion to the level caused by a single pcrG or pcrV deletion (Fig. 2-
1C). These results demonstrated that PcrG and PcrV are negative regulators for control of effector secretion in P. aeruginosa. The regulatory activity of PcrV and
PcrG in controlling effector secretion are additive.
PcrG and PcrV act differently from their homologs in Yersinia spp.
The P. aeruginosa T3SS and the Yersinia T3SS are closely related. In the
Yersinia T3SS, LcrG and LcrV are the homologs of PcrG and PcrV, respectively.
A titration model has been proposed to describe effector secretion controlled by
LcrG and LcrV in the YersiniaT3SS. The titration model proposes that control of effector secretion depends on the relative protein levels between LcrG and LcrV.
One of the observations that supports the Yersinia titration model is that overexpression of LcrV activates effector secretion[153]. To test if control of effector secretion in P. aeruginosa also depends on the protein expression level of PcrV and PcrG, we overexpressed pcrV from the plasmid in the PexoS-lacZ reporter strain with wild type pcrV on the chromosome. As shown in Fig. 2-2, overexpression of PcrV was induced with IPTG; however, effector secretion in the pcrV overexpressing strains was still controlled by Ca2+ as in the non- overexpressing strain. Removal of Ca2+ activated similar level of effector secretion in non-overexpression and overexpression strains. We also determined if pcrG overexpression and pcrGV co-overexpression affect effector secretion.
Similarly, overexpression of pcrG or pcrGV had no effect on control of effector secretion (data not shown). Unlike the Yersinia T3SS, effector secretion in P.
62 aeruginosa is not determined by the protein expression level of PcrV and PcrG.
Furthermore, the pcrV deletion activates effector secretion, but the lcrV deletion inhibits effector secretion. Thus, the titration model is not applicable in the P. aeruginosa T3SS. Control of effector secretion is not dependent on the expression level of PcrG and PcrV, which implies that PcrG and PcrV regulate effector secretion through a non-competitive inhibitory mechanism. PcrG and
PcrV may bind to the apparatus and induce conformational changes of the apparatus to control effector secretion.
The secretion signal at the N-terminus of PcrV is required for PcrV secretion.
PcrV is the T3SS needle tip protein and is constitutively secreted by the P. aeruginosa T3SS. Since PcrV is a negative regulator in effector secretion, PcrV may function as a plug or control conformation of the apparatus at the needle tip.
It is also possible that PcrV may block the acceptor site of effectors in the cytoplasm. Studies have shown that the N-terminus of T3SS substrates is sufficient to export a reporter protein through the T3SS, and the a.a. 2-20 of LcrV are essential for secretion of LcrV[180]. Based on the homologies between PcrV and LcrV we truncated the a.a. 3-21 of PcrV to test if the N-terminus of PcrV contains the secretion signal required for secretion of PcrV. As shown in Fig. 2-
3B, PcrV(¨3-21) was secretion incompetent with or without Ca2+, indicating the
N-terminus of PcrV is essential for PcrV secretion. In the P. aeruginosa T3SS, the translocators, including PcrV, are secreted in a Ca2+-independent manner,
63 whereas the effectors, e.g. ExoS, are only secreted upon removal of Ca2+. We then made a fusion protein that has the N-terminal secretion signal of ExoS (a.a.
1-21) fused with the non-secreted PcrV (a.a. 22-294) to see if the N-terminal secretion signal from a different type of T3SS substrate can complement secretion of PcrV. Fusing the N-terminal secretion signal of ExoS, a.a. 1-21, to the non-secreted PcrV(22-294) restored secretion of PcrV. Interestingly, the
ExoS(1-21)-PcrV(22-294) fusion protein was secreted in a Ca2+-independent manner similar to wild type PcrV (Fig. 2-3B). This result showed that an N- terminal secretion signals is required for the secretion of PcrV. Furthermore, the
N-terminal secretion signals of the T3SS substrates are not the determinant to distinguish different types of secretion substrates. The N-terminal secretion signals serve as a general secretion signal for all T3SS substrates, regardless of the type of the substrates. The determinant that targets PcrV for export in a Ca2+- independent manner resides in another part of PcrV, not the N-terminal secretion signal.
Non-secreted PcrV loses its ability to regulate effector secretion and to intoxicate host cells.
Next, we tested if PcrV needs to be secreted to control effector secretion. The
PexoS-lacZ reporter assay and the RECC assay consistently showed that the non- secreted PcrV failed to regulate effector secretion (Fig. 2-3A and 3B). Fusing the
N-terminal secretion signal of ExoS to non-secreted PcrV restored PcrV secretion, the ExoS-PcrV fusion protein also re-gained the ability to regulate
64 effector secretion (Fig. 2-3A). This result demonstrated that the N-terminal secretion signal of PcrV is required for the regulatory function of PcrV and suggested that PcrV may need to be secreted to regulate effector secretion.
Because PcrV is required for insertion of the pore-forming protein, PopD, in the host cell membrane, a pcrV null mutant fails to intoxicate host cells due to an inability to assemble the translocon[77]. We infected the human lung epithelial cancer cell line, A549, with P. aeruginosa strains expressing the non-secreted
PcrV and the ExoS-PcrV fusion protein to determine if loss of PcrV secretion coincides with loss of the ability to intoxicate host cells. As expected, the non- secreted PcrV failed to promote intoxication of host cells like the pcrV null mutant
(Fig. 2-3C), indicating that there is no PcrV present at the needle tip and that no functional translocator complex is formed. The ExoS-PcrV fusion protein expressing strain is fully capable of intoxicating host cells. These results demonstrates that PcrV secretion is required for control of effector secretion, which also correlates with the ability to intoxicate host cells since assembly of a functional translocon requires presence of PcrV at the needle tip.
Non-secreted PcrV is not a dominant negative mutant but still interacts with PcrG.
PcrG and PcrV purified from E. coli interact with each other and form a 1:1 complex in vitro[181]. In the Yersinia T3SS, the LcrG/LcrV interaction is important for controlling effector secretion[162, 163]. The non-secreted PcrV may have lost the interaction with PcrG and thereby the activity to control effector secretion. To
65 detect the interaction between PcrV and PcrG in vivo we inserted a VSV-G
(Vesicular Stomatitis Viral Glycoprotein) tag into the chromosomal copy of pcrG in P. aeruginosa and performed immunoprecipitation by using anti-VSV-G antiserum to pull down VSV-G tagged PcrG. As shown in Fig. 2-4C, wild type
PcrV was co-precipitated with VSV-G tagged PcrG, demonstrating that PcrV interacts with PcrG in P. aeruginosa. The non-secreted PcrV was also co- precipitated with VSV-G tagged PcrG, demonstrating that the non-secreted PcrV still interacts with PcrG. The PcrG/PcrV interaction is not a factor that affects the regulatory activity of the non-secreted PcrV.
The localization of LcrG is unclear in the Yersinia T3SS. LcrG is located in the cytoplasm of Y. enterocolitica and Y. pseudotuberculosis, but LcrG is secreted in
Y. pestis[162, 182-184]. However, a non-secreted LcrG mutant still complements the lcrG null phenotype, suggesting LcrG exerts its control activity in the cytoplasm[185]. We also examined the subcellular localization of PcrG in order to determine the place at which PcrG may regulate effector secretion. We used centrifugation to isolate different cell fractions and then detected the presence of
VSV-G tagged PcrG by Western blotting. We found that PcrG was mostly located in the cytoplasmic fraction and no signal of PcrG was detected in the supernatant
(extracelluar) fraction. In the periplasmic and the cell membrane fractions, weak signals of VSV-G tagged PcrG were detected (Fig. 2-5). We also performed the fractionation experiment in T3SS null mutants (deletion of pscO, a component of the ATPase complex, and deletion of pscD, a structural component of the T3SS
C ring) and observed similar results: PcrG is mainly located in the cytoplasmic
66 fraction, and weak signals were detected in the periplasmic and membrane fractions (data not shown). Therefore, PcrG is located in the cytoplasm, and the small amount of PcrG in the periplasm and cell membrane might be contaminations due to the limitation of technique.
Since the N-terminus of PcrV is required for control of effector secretion and
PcrG interacts with PcrV in the cytoplasm, one possible mechanism is that PcrG and PcrV form a regulatory complex in the cytoplasm and the N-terminus of PcrV is required for targeting the PcrG/PcrV complex to the T3SS apparatus for control of effector secretion. If this mechanism is true, the non-secreted PcrV should act as a dominant negative mutant because the non-secreted PcrV is able to compete with wild type PcrV for PcrG binding. We induced overexpression of pcrV('3-21) from the plasmid in the PexoS-lacZ reporter strain with wild type pcrV on the chromosome and determined if the non-secreted PcrV is a dominant negative mutant. As shown in Fig. 2-4A and 4B, although the non-secreted PcrV was overexpressed, effector secretion still depended on removal of Ca2+. This result demonstrated that the non-secreted PcrV is not a dominant negative mutant and further supported the hypothesis that PcrV needs to be secreted and assembled on the needle tip for its regulatory function.
The PcrG/PcrV interaction is not required for control of effector secretion.
Overexpression of the non-secreted PcrV had no dominant negative effect, but it is still possible that a small amount of the PcrG/wild type PcrV complex binding to the apparatus is sufficient to control effector secretion. The crystal structure of
67 LcrV showed that the C-terminus of LcrV forms a long D-helix, D12[82]. Deleting the D12 helix of LcrV abolishes the interaction with LcrG and inhibits effector secretion in the Yersinia T3SS[163]. We truncated the putative D12 helix of PcrV to determine if loss of the putative PcrG interacting domain affects effector secretion in P. aeruginosa. A partial D12 deletion mutant, PcrV('268-295), and a full D12 deletion mutant, PcrV('249-295), were constructed and expression of the PcrV D12 truncated mutants was confirmed by Western blotting (data not shown). The PexoS-lacZ reporter assay showed that both D12 deletion mutants lost the ability to control effector secretion, suggesting that the PcrG/PcrV interaction might be important for controlling effector secretion (Fig. 2-6A).
However, the D12 helix of PcrV is also involved in oligomerization of PcrV[83].
The loss of control activity may be due to the inability of mutant PcrV to form a pentamer at the needle tip. We used the cytotoxicity assay to determine if the
D12 deletion mutants form a functional PcrV needle tip complex. Like a pcrV null mutant, strains expressing the D12 deletion mutants were not able to intoxicate the host cells, indicating that these mutants could not assemble a functional needle tip complex (Fig. 2-6B).
To fully determine if the PcrG/PcrV interaction is required for regulation of effector secretion, we constructed two pcrV mutants, pcrVL262D and pcrVF279R, which have the mutations in the D12 helix of PcrV. We first examined if these
PcrV mutants are able to interact with PcrG by E. coli two-hybrid analysis. We fused PcrG and PcrV to the omega subunit of RNA polymerase and the zinc- finger DNA binding domain of murine Zif268. If the PcrG/PcrV interaction occurs,
68 the protein complex will recruit RNA polymerase and activate expression of the reporter gene, lacZ. Consistent with the previous pull-down assay in P. aeruginosa, the E. coli two-hybrid analysis showed that wild type PcrV and PcrG interact with each other. PcrVL262D did not interact with PcrG, but PcrVF279R still interacted with PcrG (Fig. 2-7A). Next, we co-overexpressed His-tagged PcrG and PcrV in E. coli, BL21, and performed a pull-down assay by using a cobalt- based resin to purify His-tagged PcrG. As we expected, wild type PcrV and
PcrVF279R were co-precipitated with His-tagged PcrG, however, no PcrVL262D was co-precipitated (Fig. 2-7E). These results demonstrated that the F279R mutation does not interfere with the PcrG/PcrV interaction, but the L262D mutation abolishes the PcrG/PcrV interaction.
We next introduced the L262D and F279R mutations into the chromosomal pcrV gene of P. aeruginosa and determined if these PcrV mutants regulate effector secretion by the PexoS-lacZ reporter assay and the RECC assay.
PcrVL262D and PcrVF279R were stably expressed and secreted in P. aeruginosa
(Fig. 2-8B). The RECC assay and the PexoS-lacZ reporter assay consistently showed that PcrVL262D, the non-PcrG-interacting mutant, regulated effector secretion as wild type PcrV; however, PcrVF279R, which still interacts with PcrG, lost its ability to regulate effector secretion (Fig. 2-8A and 8B). These results demonstrated that the PcrG/PcrV interaction is not required for control of effector secretion.
We further examined if these PcrV mutants are cytotoxic. As shown in Fig. 2-
8C, wild type PcrV and PcrVL262D were able to intoxicate host cells and caused
69 cell rounding. In contrast, PcrVF279R was defective in intoxicating host cells. We also used an anti-PcrV antibody and fluorescence-activated cell sorting (FACS) flow cytometry to detect the presence of PcrV on the T3SS needle tip. The FACS analysis showed that wild type PcrV and PcrVL262D were present at the needle tip, but PcrVF279R was poorly detectable at the needle tip (Fig. 2-8D). The signal intensity of PcrVF279R is about 20% of wild type PcrV or PcrVL262D, suggesting that
PcrVF279R failed to assemble or formed a weak and non-functional complex at the needle tip. Despite loss of the interaction with PcrG, PcrVL262D forms a functional needle tip complex and keeps the regulatory function in effector secretion.
Furthermore, these data showed that the ability to form a functional needle tip complex correlates with the cytotoxicity and the ability to regulate effector secretion. Therefore, PcrV needs to be secreted and properly assembled at the needle tip to regulate effector secretion. The interaction between PcrG and PcrV is not required for the regulatory function. PcrV and PcrG independently regulate the effector secretion at the needle tip and in the cytoplasm, respectively.
The PcrG/PcrV interaction is involved in PcrV export and PcrG stability.
While performing the two-hybrid analysis, we observed that the Zif-PcrG fusion protein was only detectable in E. coli strains expressing wild type PcrV or
PcrVF279R but not detectable in the PcrVL262D expressing strain and the no-PcrV control strain, implying that PcrG is unstable if PcrG is not bound to PcrV (Fig. 2-
7B). To further confirm that the loss of the PcrG/PcrV interaction affects the stability of PcrG, we constructed a PcrGA16R mutant based on the observation
70 that Yersinia LcrGA16R does not interact with LcrV. We first used bacterial two- hybrid analysis to examine if PcrGA16R interacts with PcrV. The two-hybrid analysis showed that PcrGA16R does not interact with PcrV, and Western blotting also showed that the Zif-PcrGA16R fusion protein was unstable (Fig. 2-7D). These observations are consistent with the findings that purified PcrG is unstable without PcrV in vitro[181]. The decreased PcrG stability was confirmed in the P. aeruginosa strains expressing PcrGA16R or PcrVL262D (Fig. 2-9C). These results demonstrated that the PcrG/PcrV interaction affects the stability of PcrG.
Again, the PcrG/PcrV interaction is not required for regulation of effector secretion because PcrGA16R was able to control effector secretion (Fig. 2-9A and
9B). We also observed that secretion of PcrV was reduced in PcrGA16R and PcrG deletion mutants, especially when Ca2+ was present in the culture medium (Fig.
2- 9B). The similar phenotype was observed in the PcrVL262D mutant, where export of PcrVL262D was reduced compared to wild type (Fig. 2-8B). The reduced
PcrV secretion in these mutants indicates that the PcrG/PcrV interaction facilitates secretion of PcrV.
Characterizing the functional domains in PcrG
Since PcrG interacts with PcrV and regulates effector secretion, we tried to characterize the functional domains in PcrG. We constructed two truncated PcrG mutants, PcrG(2-40) and PcrG(41-95), and fused these mutants and wild type
PcrG with maltose binding protein (MBP). The PexoS-lacZ reporter assay showed that MBP-PcrG(wild type) and MBP-PcrG(41-95) were able to control effector
71 secretion; however, effector secretion was deregulated in the strain expressing
MBP-PcrG(2-40) (Fig. 2-10A). Then we used an amylose-resin based pull-down assay to purify MBP-fused PcrG and determine if these MBP-PcrG fusion proteins interact with PcrV in P. aeruginosa. PcrV was co-purified with the MBP-
PcrG(wild type) and MBP-PcrG(2-40) fusion protein but not the MBP-PcrG(41-95) fusion protein (Fig. 2- 10B). The results from the PexoS-lacZ reporter assay and the MBP pull-down assay demonstrated that PcrG(1-40) contains the PcrV interacting domain and PcrG(41-95) possesses the activity to control effector secretion. These results further support the previous observations that the regulatory activity of PcrG in effector secretion and the PcrG/PcrV interaction can be separated from each other.
Discussion
In type III secretion, effector secretion is tightly controlled to ensure that effectors are effectively delivered to host cells. The mechanism used by the
T3SS to control effector secretion remains largely unclear. However, the needle tip proteins participate in control of effector secretion in all T3SS.
In this chapter, I investigated how the needle tip protein, PcrV, regulates effector secretion in P. aeruginosa. PcrV has to be secreted and properly assembled at the needle tip in order to control effector secretion. The N-terminal secretion signal is crucial for PcrV secretion and control of effector secretion. The role of the PcrG/PcrV interaction and assembly of PcrV at the needle tip in effector secretion control was analyzed by using point mutations. PcrVL262D,
72 which fails to interact with PcrG, is able to assemble a functional needle tip complex and regulate effector secretion. Although PcrVF279R, which keeps the ability to interact with PcrG, was secreted, it fails to form a needle tip complex and lost the ability to control effector secretion. Therefore, the PcrG/PcrV interaction is not required for control of effector secretion, and PcrV forms a complex and regulates effector secretion at the needle tip. Similar to the
PcrVF279R phenotype, the small deletion ('328-332) in the C-terminus of IpaD, the needle tip protein of the S. flexneri T3SS, abolishes assembly of IpaD at the needle tip and results in de-regulated effector secretion[186]. IpaD has been proposed to form a plug, consisting of four IpaD and one IpaB, at the needle tip to prevent effector secretion[158]. However, internal deletions of IpaD and deletion of the last three amino acids of IpaB result in premature effector secretion but still retain the ability to invade the host cells, indicating that these needle tip protein mutants can form a needle tip complex with an open conformation to allow de-regulated effector secretion prior to host cell contact[159, 187].
Our laboratory previously used the RECC assay to demonstrate that PcrV,
PopB and PopD, are secreted by the T3SS in a Ca2+ independent manner, indicating that the T3SS constitutively secretes the translocators prior to receiving an activation signal for effector secretion[76]. The constitutive secretion of translocators strongly argues against PcrV functioning as a physical plug at the needle tip to block effector secretion. The needle tip complex must remain open for translocator secretion. An argument against open conformation of the
73 needle tip complex is that detection of translocators in presence of Ca2+ results from leakage before the needle tip complex is assembled at the needle tip during synthesis of the T3SS apparatus. A feature of the RECC assay is adding Ca2+ back to the culture medium to determine if protein secretion is dependent on presence of Ca2+. If the constitutive translocator secretion is from the leakage of newly synthesized apparatus, we should have observed effector secretion in the presence of Ca2+ as well. However, by the RECC assay, we observed that effector secretion is totally blocked by adding Ca2+ back to the culture medium; meanwhile, the translocators are still secreted at a level comparable to no Ca2+ condition. Therefore, leakage from newly synthesized apparatus is unlikely to be the cause of constitutive translocator secretion in the presence of Ca2+.
The titration model proposes that LcrV acts as a positive regulator in the cytoplasm and that control of effector secretion depends on the relative protein level of LcrV and LcrG. In the P. aeruginosa T3SS, PcrV and PcrG are negative regulators. Overexpression of PcrV and PcrG has no effect on effector secretion, implying that PcrV and PcrG regulate effector secretion through a non- competitive inhibitory mechanism. In other words, PcrV and PcrG may bind to other sites, not the acceptor site for effectors, in the apparatus and induce conformational changes of the apparatus. Our results demonstrated that PcrV regulates effector secretion at the needle tip; therefore, the allosteric model best describes how the needle tip protein regulates effector secretion in P. aeruginosa. We also showed that PcrG regulates effector secretion in a PcrV- independent manner in the cytoplasm. The hypothesis that PcrV and PcrG
74 independently regulate effector secretion at different locations is supported by the additive effect on effector secretion in the pcrGV double deletion mutant.
Therefore, we propose that the apparatus is in an effector secretion “on” state in absence of PcrV and PcrG. Assembly of PcrV at the needle tip and binding of
PcrG to the apparatus in the cytoplasm stabilize the apparatus in an effector secretion “off” state (Fig. 2-11A).
Moreover, a pcrG deletion mutant retains the ability to intoxicate the host cells, indicating PcrV is still able to form a functional translocon at the needle tip when effector secretion is activated, which consists with the phenotype of ipaD mutants with internal deletions at the N-terminus of IpaD[159]. IpaD is a self-chaperoning protein, whose chaperone domain is located at the N-terminus. Deleting the chaperone domain of IpaD results in de-regulated effector secretion, but the IpaD mutant is still able to invade host cells[158, 159]. This result supports that PcrV and PcrG independently regulate effector secretion at different subcellular locations. Furthermore, it suggests that PcrV at the needle tip can exist in a conformation that allows protein secretion to occur and keeps the ability to form the translocon to intoxicate the host cells.
The allosteric model can be used to adapt the sensor model. PcrV and PcrG keep the apparatus in effector secretion “off” conformation to prevent secretion of
PopN, the putative sensor in the P. aeruginosa T3SS (Fig. 2-11B). The sensor model suggests that the N-terminus of the sensor is inserted into the secretion channel of the apparatus or is tethered to the needle tip complex. However, tethering the N-terminus of the sensor to the needle tip complex seems to be
75 unlikely because deletion of PcrV results in partial de-regulation of effector secretion. If the needle tip complex regulates effector secretion by tethering with the sensor, a fully de-regulated effector secretion phenotype should have been observed in a PcrV deletion mutant. No evidence shows that the needle tip complex interacts with the sensor, and InvE, the PopN homolog in the
Salmonella T3SS, is a non-secreted protein[140]. Therefore, PcrV and PcrG keep the apparatus in the effector secretion “off” state to prevent PopN secretion, and PopN may block effector secretion by binding to the acceptor site for effectors at the cytoplasmic face of the apparatus. When the activation signal is received, for example host cell contact, assembly of the functional translocon changes the conformation of PcrV, which further induces the conformational change in the needle and apparatus to the effector secretion “on” state; thereby,
PopN is secreted and effector secretion is activated.
Isolation of needle mutants locked in effector secretion “on” state supports the allosteric regulation model. The “on” needle mutants have been isolated in S. flexneri, Y. pestis, and P. aeruginosa[166, 167, 169]. However, determining the helical packing of isolated needles from S. flexneri by electron microscopy showed that there is no detectable difference between wild type needles and the
“on” mutant needles, suggesting that the conformational change between effector secretion “on” and “off” states is subtle[188]. The other explanation is that the default state of the wild type needle is “on”, and isolation of the needles separates the needles from the apparatus and allows wild type needles to switch to default “on” state. Analyzing the helical packing of needle mutants that are
76 locked in effector secretion “off” state may be able to discern the conformational change between “off” mutant needles and wild type needles.
We demonstrated that PcrG is not secreted and located in the cytoplasm.
Therefore, PcrG regulates effector secretion in the cytoplasm. We also constructed point mutants, PcrVL262D and PcrGA16R, to abolish the PcrG/PcrV interaction. Both PcrVL262D and PcrGA16R lose the PcrG/PcrV interaction but still keep the ability to regulate effector secretion, demonstrating that the PcrG/PcrV interaction is not necessary for control of effector secretion. The PcrG truncation mutants further confirmed that the PcrV interacting domain is located at the N- terminus of PcrG and the C-terminus of PcrG contains the regulatory activity for control of effector secretion. We found that loss of the PcrG/PcrV interaction leads to degradation of PcrG. Although PcrG is unstable in the mutants that lose the PcrG/PcrV interaction, effector secretion is still well controlled in these mutants, suggesting a small amount of PcrG is sufficient to regulate effector secretion. PcrG may regulate effector secretion by directly blocking the acceptor site for effectors or binding to other sites on the apparatus to control the conformation of the apparatus. Direct binding to the acceptor site for effectors seems to be less likely because overexpression of PcrG does not affect effector secretion and only low levels of PcrG are required to regulate effector secretion.
We also found that loss of the PcrV/PcrG interaction results in decreased secretion of PcrV. Therefore, PcrG serves as a secretion chaperone of PcrV.
PcrG may keep PcrV in a secretion competent state by preventing oligomerization of PcrV in the cytoplasm or targeting PcrV to the apparatus.
77 In this chapter, our results demonstrated that PcrV has to be secreted and assembled at the needle tip to control effector secretion in P. aeruginosa. PcrV may regulate effector secretion by controlling the conformation of the apparatus.
PcrV and PcrG likely stabilize the apparatus in effector secretion “off” state. The
PcrG/PcrV interaction is not necessary for control of effector secretion by PcrV and PcrG. PcrG regulates effector secretion in the cytoplasm, perhaps through an interaction with the apparatus.
78 Figure2Ͳ1.PcrVandPcrGarenegativeregulatorsincontrolofeffectorsecretion.A) TheeffectofpcrG,pcrVandpcrGVdeletionsoneffectorsecretionwasanalyzedbythe PexoSͲlacZreporterassay.B)Theeffector,ExoT,secretionwasdeterminedbytheRECC assayandWesternblotting.RopAservesasexpressioninternalcontrolandsecretion negativecontrol.C)ExpressingpcrG,pcrVandpcrGVinthepcrGVdoubledeletion strain.TheeffectorsecretionwasmonitoredbyPexoSͲlacZreporterassay.Expressionof pcrGandpcrGVwasinducedwith10PMIPTGandexpressionofpcrVwasinducedwith 125PMIPTG.
79 Figure2Ͳ2.OverexpressionofPcrVhasnoeffectoncontrolofeffectorsecretion.P. aeruginosawithwildtypepcrVonthechromosomewastransformedwithpPSV35ͲpcrV plasmidorpPSV35vectoronly.TheexpressionofpcrVwasinducedbytheinducer, IPTG.OverexpressionofPcrVwasconfirmedbyWesternblotting,andtheeffecton effectorsecretionwasmonitoredbythePexoSͲlacZreporterassay.
80 Figure 2Ͳ3. The NͲterminal secretion signal is required for secretion and regulatory activityofPcrV.A)TheeffectofnonͲsecretedPcrVoneffectorsecretionisdetermined by the PexoSͲlacZ reporter assay and B) the RECC assay. C) Cytotoxicity of the nonͲ secretedPcrVmutant.
81 Figure2Ͳ4.NonͲsecretedPcrVisnotadominantnegativemutantbutstillinteracts withPcrG.A)NonͲsecretedPcrVwasoverexpressedintheP.aeruginosastrainwith wildtypepcrVonthechromosome.EffectorsecretionwasmonitoredbythePexoSͲlacZ reporterassay.B)OverexpressionofnonͲsecretedpcrVwasinducedwithIPTGandthe proteinlevelofPcrVinthebacterialpelletwasanalyzedbyWesternblotting.C) DetectingthePcrG/PcrVinteractionbyusingantiͲVSVͲGantibodytopullͲdownVSVͲG taggedPcrGfromcelllysateofP.aeruginosa.A'pcrVP.aeruginosastrain,whose chromosomalcopyofpcrGwastaggedwithVSVͲGandexsEgenewasdeletedto uniformlyinduceexpressionoftheT3SSgenes,wastransformedwiththeplasmids carryingwildtypepcrVorpcrV('3Ͳ21).ExpressionofwildtypePcrVandnonͲsecreted PcrVwasinducedwithIPTG.
82 Figure2Ͳ5.PcrGisanonͲsecretedcytoplasmicprotein.Differentsubcellularfractionsof P.aeruginosastrainsexpressingwildtypepcrGorVSVͲGtaggedpcrGwereisolatedby centrifugation.ThepresenceofVSVͲGtaggedPcrGwasdetectedbyantiͲVSVͲGantibody and Western blotting. WC: whole cell lysate. S: supernatant (secreted proteins in LB medium). C: cytoplasmic fraction. P: periplasmic fraction. M: cell membrane fraction. The markers for different subcellular fractions are: PcrV for supernatant; EͲlactamase (Bla) for periplasm; outer membrane protein (OprH) for outer membrane; RNA polymeraseDsubunit(RpoA)forcytoplasm.
83 Figure 2Ͳ6. The D12 helix of PcrV is required for control of effector secretion and cytotoxicity. A) The plasmids carrying pcrV('268Ͳ295) and pcrV('249Ͳ295) were transformedintoa'pcrVP.aeruginosastrain.ExpressionofwildtypePcrVandPcrV D12truncatedmutantswasinducedwithIPTG.Effectorsecretionwasdeterminedby the PexoSͲlacZ reporter assay. B) Human A549 cells were infected with the 'pcrV P. aeruginosastrainsexpressingwildtypepcrV,pcrV('268Ͳ295)andpcrV('249Ͳ295).The morphology of the cultured A549 cells was observed under a phase contrast microscope.
84 A) C)
B) D)
E)
Figure 2Ͳ7. PcrVL262D and PcrGA16R lose the PcrG/PcrV interaction. A) and C). The interactionbetweenPcrGandPcrVwasanalyzedbytheE.colitwoͲhybridanalysis.Wild typePcrV,PcrVL262D,andPcrVF279RwerefusedtoomegasubunitofRNApolymerase,and PcrG was fused with Zif. B) and D) The expression of omegaͲPcrV and ZifͲPcrG were detectedbyWesternblotting.E)TheHisͲtaggedPcrGandPcrVwerecoͲoverexpressed in the E. coli, BL21. HisͲtagged PcrG was pulled down by cobaltͲresins. The coͲ precipitationofPcrVandHisͲtaggedPcrGweredetectedbyWesternblotting.Figure2Ͳ7 AͲDweredonebyC.StopfordinRietschlab.
85 Figure2Ͳ8.AssemblyofPcrV,notthePcrG/PcrVinteraction,isrequiredforcontrolof effector secretion. A) Effector secretion in the PcrVL262D and PcrVF279R mutants was determinedbythePexoSͲlacZreporterassayB)andtheRECCassayandWesternblotting. C) Cytotoxicity of PcrVL262D and PcrVF279R. D) The presence of PcrV on the bacterial surfacewasdetectedbyFACSusinganantiͲPcrVantibody(rabbitorigin)andanantiͲ rabbitIgGAPCconjugatedsecondaryantibody.Allstrainsweregrownintheabsenceof Ca2+toinduceandnormalizeexpressionofPcrV,exceptthewildtypewithCa2+control treatment(w.t.+Ca2+).PurifiedPcrVproteinwasaddedtoonesampleofthepcrVnull mutant before performing the antibody staining procedure in order to rule out the possibility that secreted PcrV was nonͲspecifically crosslinked to the bacterial cell surface('pcrV+PcrV).Figure2Ͳ8DwasdonebyC.StopfordinRietschlab.
86 Figure 2Ͳ9. PcrGA16R regulates effector secretion and the PcrG/PcrV interaction is involvedinPcrVsecretionandPcrGstabilityinP.aeruginosa.A)Effectorsecretionin A16R thePcrG mutantwasdeterminedbythePexoSͲlacZreporterassayB)andtheRECC assayandWesternblotting.C)TheproteinstabilityofPcrGinP.aeruginosaexpressing mutantPcrGormutantPcrV.TheP.aeruginosastrainsweregrownintheabsenceof Ca2+toinduceexpressionoftheT3SSgenesandtheproteinlevelofVSVͲGtagedPcrGin thebacterialpelletwasdeterminedbyWesternblotting.Figure2Ͳ9CwasdonebyA. RietschinRietschlab.
87 Figure2Ͳ10.TheNͲterminusofPcrGisthePcrVinteractingdomainandtheCͲterminus ofPcrGpossessestheregulatoryactivityforcontrolofeffectorsecretion.A)Effector secretionintheMBPͲPcrGtruncatedmutantswasdeterminedbythePexoSͲlacZreporter assay. B) The interaction between PcrV and the MBPͲPcrG truncated mutants were analyzed by the MBP pullͲdown assay. The MBPͲPcrG mutants were pulled down by amyloseͲresins.ThecoͲprecipitationofPcrVwasdetectedbyWesternblotting.Figure2Ͳ 10AwasdonebyC.StopfordinRietschlabandFigure2Ͳ10BwasdonebyA.Rietschin Rietschlab.
88
Figure2Ͳ11. ModelofPcrVfunctionincontrolofeffectorsecretion.A)PcrGandPcrV allostericallyregulateeffectorsecretion.PcrVattheneedletipandPcrGinthe cytoplasmstabilizetheapparatusintheeffectorsecretion“off”state.PcrGmay regulateeffectorsecretionbyinteractingwithanunidentifiedapparatuscomponent.In theabsenceofPcrVandPcrG,forexampledeletionofpcrGandpcrV,theapparatusisin theeffectorsecretion“on”state.B)Combiningtheallostericmodelwiththesensor model.PcrVandPcrGcontroltheapparatusintheeffectorsecretion“off”conformation andpreventsecretionofPopN.Oncetheactivationsignalisreceived,PcrVattheneedle tipchangesitsconformationandPcrGisreleasedfromtheapparatus.Therefore,the conformationoftheapparatusisswitchedtoeffectorsecretion“on”stateandthe acceptorsiteforeffectors(ASE)isfreeforeffectorsecretion.
89 Table2Ͳ1.Strains,plasmids,primersusedinthisstudy Strain # genotype reference r BL21(DE3) E. coli B F– ompT hsdS(rB– mB–) dcm+ Tet galO(DE3) Stratagene Codon+ - RP endA Hte [argU proL Camr] KDZif1ǻZ two-hybrid analysis strain lacking rpoZ (encoding Z) and Reference harboring a test promoter-lacZ fusion to detect Zif- [189] dependent two-hybrid interactions RP1831 PAO1F, wild type P. aeruginosa PAO1 Reference [190] RP1868 PAO1F ǻexoS::GFP-lacZ this study RP3082 PAO1F ǻpcrG2 ǻexoS::GFP-lacZ this study RP2645 PAO1F ǻpcrV2 ǻexoS::GFP-lacZ this study RP3335 PAO1F ǻpcrGV2 ǻexoS::GFP-lacZ this study RP3666 PAO1F pcrG(A16R) ǻexoS::GFP-lacZ this study RP3466 PAO1F pcrV(L262D) ǻexoS::GFP-lacZ this study RP3468 PAO1F pcrV(F279R) ǻexoS::GFP-lacZ this study RP3898 PAO1F pcrG(i3VG) ǻexoS::GFP-lacZ this study RP3900 PAO1F pcrG(i3VG, A16R) ǻexoS::GFP-lacZ this study RP4348 PAO1F pcrG(i3VG) pcrV(L262D) ǻexoS::GFP-lacZ this study RP4349 PAO1F pcrG(i3VG) pcrV(F279R) ǻexoS::GFP-lacZ this study RP3929 PAO1F ǻexsE ǻfleQ pcrG(i3VG) this study RP3770 PAO1F ǻexsE ǻfleQ ǻpcrV2 this study
Plasmid Relevant features reference pPSV37 colE1 origin, gentR, PA origin, oriT, lacUV5 promoter, this study lacIq, stops in every reading frame preceding the MCS and T7 terminator following the MCS (relative to the lacUV5 promoter) pEXG2 Allelic exchange vector, colE1 origin, oriT, gentamycin Reference resistance, [113] sacB pDuet1 Co-expression vector with T7 origin, bla resistance Novagen pACTR-AP- pACYC origin, tetR, plasmid allowing for the creation of Reference Zif N-terminal [189] fusions to Zif, the zinc-finger DNA binding domain of the murine Zif268 protein, under control of a lac promoter pBRZ colE1 origin, bla, plasmid allowing for the creation of N- Reference terminal [189] fusions to the Zsubunit of RNA polymerase under control of a lac promoter pZifVG pACTR-AP-Zif modified to include a linker encoding the this study VSV-G tag between the fusion partner and the Zif moiety
pMal pPSV37 encoding a signal-sequenceless malE gene this study
90 (codons 27- 396) lacking a stop codon followed by a polylinker to create MBP fusions pP37-pcrG pcrG under control of the lacUV5 promoter in pPSV37 this study pP35-pcrV pcrV under control of the lacUV5 promoter in pPSV35 this study pP37-pcrV pcrV under control of the lacUV5 promoter in pPSV37 this study pP37-pcrGV pcrGV under control of the lacUV5 promoter in pPSV37 this study pP35- pcrV lacking codons 3-21 under control of the lacUV5 this study pcrV(ǻ3-21) promoter pP35- codons 1-21 of exoS fused to codons 22-294 of pcrV, this study exoS(1-21)- expressed pcrV(22-294) under the control of the lacUV5 promoter pP35- pcrV lacking codons 249-294 under control of the This study pcrV(1-248) lacUV5 promoter pP35- pcrV lacking codons 268-294 under control of the This study pcrV(1-267) lacUV5 promoter pEXG2- allelic exchange vector which deletes exoS and inserts Reference ǻexoS::GFP- translationally coupled versions of GFP and lacZ in its [191] lacZ place pEXG2- allelic exchange vector designed to delete codons 6-88 this study ǻpcrG2 of pcrG pEXG2- allelic exchange vector designed to delete codons 44- this study 'pcrV2 180 of pcrV pEXG2- allelic exchange vector designed to replace the this study pcrG(i3VG) chromosomal copy of pcrG with a version of the open reading frame in which codons 55-57 have been replaced by 3 tandem repeats of the VSV-G tag pEXG2- allelic exchange vector designed to replace the this study pcrG(i3VG, chromosomal copy of pcrG(A16R) with a version of the A16R) open reading frame in which codons 55-57 have been replaced by 3 tandem repeats of the VSV-G tag pEXG2- allelic exchange vector designed to delete pcrG and this study ǻpcrGV2 pcrV starting at codon 6 of pcrG and ending at codon 180 of pcrV pEXG2- allelic exchange vector designed to introduce the L262- this study pcrV(L262D) >D mutation into pcrV pEXG2- allelic exchange vector designed to introduce the F279- this study pcrV(F279R) >R mutation into pcrV pEXG2- allelic exchange vector designed to introduce the A16- this study pcrG(A16R) >R mutation into pcrG pACZif- two-hybrid plasmid encoding a MvaU-Zif fusion protein Reference mvaU [189]
pBRZ-mvaT two-hybrid plasmid encoding a MvaT-Zfusion protein Reference [189] pAcZif-pcrG two-hybrid plasmid encoding a PcrG-Zif fusion protein this study
91 pBRZ-pcrV two-hybrid plasmid encoding a PcrV-Zfusion protein this study pBRZ- two-hybrid plasmid encoding a PcrV(L262D)-Zfusion this study pcrV(L262D) protein pBRZ- two-hybrid plasmid encoding a PcrV(F279R)-Zfusion this study pcrV(F279R) protein pZifVG-pcrG two-hybrid plasmid encoding a PcrG-VSV-G tag-Zif this study fusion protein pZifVG- two-hybrid plasmid encoding a PcrG(A16R)-VSV-G tag- this study pcrG(A16R) Zif fusion protein pDuet-pcrG T7 promoter expression vector for the expression of an this study aminoterminally His-tagged version of PcrG pDuet-pcrV T7 promoter expression vector for the expression of an this study untagged version of PcrV pDuet-pcrGV T7 promoter expression vector for the concomitant this study expression of an amino-terminally His-tagged version of PcrG and an untagged version of PcrV pDuet- T7 promoter expression vector for the concomitant this study pcrG(A16R) expression of pcrV an amino-terminally His-tagged version of PcrG(A16R) and an untagged version of PcrV pDuet-pcrG T7 promoter expression vector for the concomitant this study pcrV(L262D) expression of an amino-terminally His-tagged version of PcrG and an untagged version of PcrV(L262D) pDuet-pcrG T7 promoter expression vector for the concomitant this study pcrV(F279R) expression of an amino-terminally His-tagged version of PcrG and an untagged version of PcrV(F279R) pMal-pcrG plasmid encoding an MBP-PcrG fusion protein under this study control of a lacUV5 promoter pMal-pcrG(2- plasmid encoding an MBP-PcrG(aa 2-40) fusion protein this study 40) under control of a lacUV5 promoter pMal- plasmid encoding an MBP-PcrG(aa 41-95) fusion this study pcrG(41-95) protein under control of a lacUV5 promoter
Primers
name Sequence (5’ to 3’) description T7ter1 AGCTTTAGCATAACCCCTTGGGGCCTCTAAACG T7 terminator GGTCTTGAGGGGTTTTTTGAT
92 T7ter2 CAAAAAACCCCTCAAGACCCGTTTAGAGGCCCC AAGGGGTTATGCTAA stops1 AATTGTAGCTAGCTAGG stops in stops2 AATTCCTAGCTAGCTAC every reading frame ZifVG-sense GGCCGCCGGTACCAAGCTTCCTCGAGTCTATAC Inserts VSV- AGATATTGAAATGAATAGATTAGGAAAACA G tag ZifVG-AS TCGATGTTTTCCTAATCTATTCATTTCAATATCTG and extra TATAAAGCTTGACTCGAGGGGTACCGGC restriction enzyme sites malE-5R ATATAGAATTCTAAGGAGGCGCCCCCATGAAAAT amplify malE CGAAGAAGGTAAACTGG lacking malE-3K ATATAGGTACCTGCGGCCGCCTTGGTGATACGA a signal GTCTGCGC sequence and stop codon pcrG5E AAAAAGAATTCGGATTCCCTACCATGGGCGACAT clone pcrG in GAA pPSV37 pcrG3H AAAAAAAGCTTTTCCTCAGATCAACAAGCCACGC A pcrV2-5R AAAGAATTCTGGCTTGTTGATCTGAGGAATCACG clone pcrV in A pPSV35 and pcrV2-3H AAAAAAAGCTTCGGCTGGTTCATGGATACCTCTA pPSV37 pcrVd3-21-5R GAATTCTGGCTTGTTGATCTGAGGAATCACGATG clone GAAGCGGCGCCTGCCAGTGCCGAGCAGGAGGA pcrV(ǻ3-21) A in pPSV35 pcrVS1- ATCGCTTCAGCAGAGTCCGTCTTTCGCCGTCGA 1. round 215R(2) ATTGCACCAGGCCGCCAGTGCGGCGCCTGCCA PCR to GTGCCGAGCAGGAGGAA create exoS(1-21)- pcrV(22-294) fusion pcrVS1-21- AAAAAGAATTCTGGCTTGTTGATCTGAGGAATCA 2. round 5R(1) CGATGCATATTCAATCGCTTCAGCAGAGTCCGTC PCR to TTTCGCCGT create exoS(1-21)- pcrV(22-294) fusion pGdel5-1 AAAAAGAATTCGGGCTGCCGGTGCTGTCCTACC 5’ flanking A primer to delete/mutat e pcrG pcrG2-5-2 AACTCGAGCCGCAAGCATGCTGAAGGTGTATTC internal GTTCATGTCGCCCA primer to delete pcrG (5’ flank) pcrG2-3-1 TTCAGCATGCTTGCGGCTCGAGTTCCGATGCGT internal GGCTTGTTGATCT primer to
93 delete pcrG (3’ flank) pcrG2-3-2 AAAAAAAGCTTCCGCGGTCAGCGCCTTGAGCTC 3’ flanking GT primer to delete/mutat e pcrG pcrGi3VG5-2 CTATATCGGTGTATTTTCCTAATCTATTCATTTCA convert pcrG ATATCTGTATACTTCCCCAACCTGTTCATCTCGAT with 1 GTCCGTGTACTCTCGCTCCGGCGCCTGGAA VSV-G tag inserted to one with 3 inserted (internal 5’ flank primer) pcrGi3VG3-1 AACAGGTTGGGGAAGTATACAGATATTGAAATGA convert pcrG ATAGATTAGGAAAATACACCGATATAGAGATGAA with 1 CAGACTAGGCAAAGCCGCCGAAGAGGA VSV-G tag inserted to one with 3 inserted (internal 3’ flank primer) pcrV5-22 AACTCGAGCCGCAAGCATGCTGAAGGCCAGCAC Internal 5’ GATCCGCTCGCT flank primer to make pcrV deletion pcrV5-1 AAAAAgaattcCCGGCCGGTGCTGATCGTTTCCAT 5’ flank primer to make pcrV deletion pcrV3-12 TTCAGCATGCTTGCGGCTCGAGTTGTCGGCGAT internal 3’ CCCAGGTGGAAGGACA flank primer to make pcrGV deletion pcrV3-2 AAAAAAAGCTTCCAGGGCCCGGGCCGAGTAGAA 3’ flank primer to make pcrGV deletion pcrVL262Drev TAGCGGGAGCTGGTGTCGTTGTCCAGGGTGGTC introduce TTCTCGTT L262D mutation (internal primer for 5’ flank) pcrVL262Dfor AACGAGAAGACCACCCTGGACAACGACACCAGC introduce TCCCGCTA L262D
94 mutation (internal primer for 3’ flank) pcrVL262Dtest AACGAGAAGACCACCCTGGA primer to test for presence of mutation pcrVF297Rrev ACGCTGTCGTATTTCTGGATGCGGCGGTTGAGC introduce GCCTCGACCGCCGA F279R mutation (internal primer for 5’ flank) pcrVF297Rfor TCGGCGGTCGAGGCGCTCAACCGCCGCATCCA introduce GAAATACGACAGCGT F279R mutation (internal primer for 3’ flank) pcrVF297Rtest TCGGCGGTCGAGGCGCTCAACCGCCG primer to test for presence of mutation pcrGA16R-3-1 TGCGGGCGACCGTCCAGGCCCGAGAACTGGCG introduce ATTCGCGA A16R mutation (internal primer for 3’ flank) pcrGA16R-5-2 TCGCGAATCGCCAGTTCTCGGGCCTGGACGGTC introduce GCCCGCA A16R mutation (internal primer for 5’ flank) pcrGA16Rtest TGCGGGCGACCGTCCAGGCCCGA primer to test for presence of mutation GfZif-3Xho AAAAACTCGAGGGGCGGCCGCGATCAACAAGCC clone pcrG ACGCATCGGCGT into GZif2-5Nde AAAAACATATGAACGAATACACCGAAGACA pACTR-AP- Zif and pZiVG VOm-5H AAAAAAAGCTTTGGCTTGTTGATCTGAGGAATCA clone pcrV CGA into pBRZ VOm-3Not AAAAGCGGCCGCGATCGCGCTGAGAATGTCGC GCAGGA pcrG5-Bam AAAAAGGATCCGAACGAATACACCGAAGA clone pcrG
95 into pDuet-1, together with pcrG3H pcrV5EX AAAAACATATGGAAGTCAGAAACCTTAATGCCGC clone pcrV T into pcrV3K AAAAAGGTACCTCGGCTGGTTCATGGATACCTCT pDuet-1 A GM2-70-5 AAAAAGGTACCAACGAATACACCGAAGACACCC clone pcrG T into pMal, together with pcrG3H GM2-40-3 AAAAAAAGCTTTCAGGCAAGCCCCAGGCCTTGC clone CAC pcrG(2-40) into pMal, together with GM2-70-5 GM41-5 AAAAAGGTACCGCGGACGCCGGCGAGCTGCTG clone pcrG(41-95) into pMal, together with pcrG3H
96 Chapter 3
Control of Effector Secretion by the T3SS Cytoplasmic Protein, PcrG
97 Summary
PcrG is the chaperone of the T3SS needle tip protein, PcrV, and a negative regulator of effector secretion. In the previous chapter, we demonstrated that the
PcrG/PcrV interaction is dispensable for the regulatory function of PcrG, and
PcrG regulates effector secretion in the bacterial cytoplasm. We hypothesize that
PcrG interacts with other T3SS components in the cytoplasm or inner membrane to regulate effector secretion. The goal of this study is to isolate and identify the
T3SS components that interact with PcrG and understand how PcrG regulates effector secretion. We used bacterial two-hybrid analysis to determine the interaction between PcrG and known T3SS components. We also constructed maltose-binding-protein (MBP)-PcrG fusion proteins and used a site-specific crosslinking method to crosslink proteins interacting with PcrG. The protein complexes containing MBP-PcrG were purified using an amylose-resin, analyzed by SDS-PAGE and identified by mass spectrometry. In addition to PcrV, we found that PscO interacts with PcrG by the two-hybrid analysis. PscO binds to the center region of PcrG and PcrV binds to the N-terminus of PcrG. The PcrV interacting domain is not required for controlling the effector export and the PscO interacting domain enhances the regulatory activity of the C-terminus of PcrG.
We also found that PcrG is involved in translocator secretion, especially in modulating PcrV export. The C-terminus (a.a.60-95) of PcrG contains most of the activity to control effector secretion. The crosslinking experiment and mass spectrometry showed that the apparatus component, PcrD, interacts with the C- terminus of PcrG. Further co-purification experiments demonstrate the
98 PcrG/PcrD interaction depends on the status of the apparatus. The PcrG/PcrD complex is more stable when the effector secretion is off and loss of the
PcrG/PcrD interaction results in de-regulated effector secretion. In summary, our results demonstrate that PcrG regulates effector secretion through interacting with PcrD.
99 Introduction
Many Gram negative bacteria use T3SSs to translocate effectors into host cells. Effector secretion is well controlled and only activated upon host cell contact to ensure effectors are properly delivered into host cell cytoplasm[49]. In the P. aeruginosa T3SS, the needle tip protein, PcrV, and its chaperone, PcrG, are negative regulators in control of effector secretion[101, 133]. We previously demonstrated that PcrV allosterically regulates effector secretion at the T3SS needle tip by forming a needle tip complex, and PcrG regulates effector secretion in the bacterial cytoplasm in a PcrV-independent manner.
LcrG, the homolog of PcrG in the Yersinia T3SS, is also a negative regulator in control of effector secretion. LcrG and PcrG can mutually complement each other[101, 183]. Despite the controversy regarding LcrG secretion, LcrG exerts its regulatory activity in the bacterial cytoplasm since non-secreted LcrG mutants are able to regulate effector secretion[185]. Although there is no known chaperone for IpaD, the needle tip protein in the Shigella T3SS, IpaD seems to be self-chaperoning and the N-terminus of IpaD contains the chaperone domain.
Deleting the chaperone domain of IpaD results in de-regulated effector secretion without affecting the invasion ability of Shigella flexneri[158, 159]. Similarly, deletion of PcrG or LcrG does not interfere with the cytotoxicity of the bacteria[133, 153, 182], suggesting that the needle tip proteins are still able to form a functional translocon when the chaperones are removed.
100 The PopN/YopN/MxiC family proteins are cytoplasmic negative regulators in
T3SS. Yersinia YopN forms a complex with TyeA and the YopN chaperones,
SycN and YscB. TyeA is a small cytoplasmic protein and the N-terminus of TyeA interacts with the C-terminus of YopN[135]. Point mutations in TyeA, which cause de-regulated effector secretion, have been isolated. Some of the point mutations are located in the YopN interacting domain and disrupt the interaction between
TyeA and YopN. Other than interfering with the YopN/TyeA interaction, some point mutations are surface exposed but not located in the YopN interacting domain. Therefore, TyeA is proposed to interact with the T3SS apparatus and tether YopN to the apparatus to regulate effector secretion[136]. Although the
LcrG/LcrV titration model is not applicable in the P. aeruginosa T3SS and the
PcrG/PcrV interaction is not necessary for the regulatory activity of PcrG, PcrG may still regulate effector secretion in the cytoplasm by interacting with the apparatus. However, the interaction partner of any of these cytoplasmic regulators in the apparatus has not been identified yet.
The inner membrane components of the protein secretion apparatus, PscU,
PscR, PscS, PscT and PcrD in P. aeruginosa, are conserved between the T3SS and the flagellum. The homologs of PscU and PcrD in the flagellar T3SS are
FlhB and FlhA, respectively[42, 94]. As we described in the chapter 1, FlhB is auto-cleaved and involved in the substrate specificity switch[129]. Similarly, a
PscUN263A mutant selectively blocks secretion of PopB and PopD but not effectors, suggesting that PscU controls substrate specificity as well[101]. PcrD and FlhA are the largest protein (~700 a.a.) in the T3SS and the flagellum. FlhA
101 has a C-terminal cytoplasmic domain and an N-terminal transmembrane domain which is required for the interaction with the flagellar MS ring[98]. Affinity blotting showed that the cytoplasmic domain of FlhA (FlhAc) interacts with FlhB and the flagellar substrates, such as the hook subunit and the filament subunit[105].
Furthermore, FlhAc also interacts with the components of the ATPase complex,
FliI, FliH and FliJ[96]. Therefore, FlhA may function as a platform at the cytoplasmic face of the apparatus to coordinate secretion of flagellar substrates.
Topologically, the cytoplasmic and inner membrane anchored T3SS components of the apparatus are likely to interact with the cytoplasmic negative regulators of effector secretion. We hypothesized that PcrG regulates effector secretion by interacting with the components of the apparatus. We found that
PcrG interacts with PscO, a components of the ATPase complex, and PcrD. The interaction between PcrG and PcrD is necessary for control of effector secretion by PcrG, indicating that PcrG regulates effector secretion through interacting with
PcrD. Like the PcrG/PcrV interaction, the PcrG/PscO interaction is not required for the regulatory activity of PcrG; however, it may stabilize the interaction between PcrG and PcrD.
Materials and Methods
Media and culture conditions
All E. coli strains were routinely grown at 37°C in LB medium containing 10g/l
NaCl. P. aeruginosa was grown at 37°C in a modified LB medium (LB-MC)
102 containing 200mM NaCl, 0.5mM CaCl2 and 10mM MgCl2. Strains and plasmids used in this study are listed in Table 3-1.
E. coli bacterial two-hybrid analysis
The cIO/Į-subunit bacterial two-hybrid system was used to determine the interaction between PcrG and the T3SS components. The T3SS components were fused to the C-terminus of D subunit of RNA polymerase and PcrG was fused to the C-terminus of cIO DNA binding protein. Expression of the fusion proteins was induced with 5 PM IPTG. Overnight cultures were 1:300 diluted in 3 ml of LB medium. After 2 hours of incubation at 37 °C, 1 ml of culture was added into 1 ml of pre-warmed 1 ml LB medium and another 1 ml of culture was added into 1 ml of pre-warmed 1 ml LB medium with 5 PM IPTG. The cultures were incubated at 37 °C for an additional 2 hours. Then the cultures were put on ice for 10 minutes. The E-galactosidase activity was determined by the protocol described in “Materials and methods” of Chapter 2.
PexoS-lacZ reporter assay
The PexoS-lacZ reporter assay was performed as described in the “Materials and
Methods” of Chapter 2.
Protein secretion assay
The protein secretion assay was used to determine secretion of the T3SS substrates in the P. aeruginosa strain, PAO1F 'exsE 'fleQ 'pcrG, expressing different PcrG truncated mutants. Overnight culture of each truncated PcrG mutants were 1:250 diluted in fresh LB-MC medium without EGTA and incubated at 37 °C to mid-log phase (OD600~0.4). Then 4ml of culture were aliquoted in
103 two microcentrifuge tubes and spun down, the supernatants were removed and one cell pellet was resuspended in 2 ml pre-warmed LB-MC medium without
EGTA, the other in 2 ml pre-warmed medium with EGTA. The cultures were incubated at 37 °C for an additional 30 minutes. Then the cultures were placed on ice for 10 minutes. 1 ml of each culture was spun down and 0.5ml of the supernatant was transferred to a fresh microcentrifuge tube. The secreted proteins in supernatant were precipitated by adding trichiloroacetic acid (TCA) to the supernatant (final concentration: 10%). The remainder of the culture was used to determine the OD600. Cell pellets and TCA precipitated supernatant samples were resuspended in 1x SDS sample buffer to correspond to an OD600 of 10. The samples were then boiled at 95 °C for 10 minutes. PcrV, PopB, PopD,
ExoS, ExoT and ExoY in the cell pellet and the supernatant samples were detected by Western blotting. The intensity of detected bands was determined by the software, ImageJ. The percentage of protein secreted was calculated as:
100*supernatant band intensity/(supernatant band intensity+pellet band intensity).
The results presented are the average of 3 independent experiments ±SD.
Site-specific cysteine crosslinking
MBP-PcrG cysteine mutants were expressed in the P. aeruginosa strain, PAO1F
'exsE 'pcrG. Overnight cultures were 1:100 diluted in 200 ml of fresh LB-MC medium and incubated at 37 °C for 2.5 hours (OD600~0.5-0.6). The OD600 of each culture was determined and normalized. The cell pellets were spun down and resuspended in 1xPBS (1.06 mM KH2PO4, 155.17 mM NaCl, 2.97 mM
Na2HPO4, pH 7.4) with 1 mM freshly prepared PMSF and 0.5 mM freshly
104 prepared Succinimidyl-4-(N-maleimidomethyl)cyclohexane-1-carboxylate
(SMCC). The cell suspensions were incubated at room temperature in dark for
30 minutes. Then the cells were spun down and washed once with MBP pull- down washing buffer (20 mM Tris pH 7.5, 200 mM NaCl, 10 mM E- mercaptoethanol, 1 mM EDTA, 1 mM PMSF, 0.5% NP-40). The crosslinked cells were resuspended in 1 ml of MBP pull-down washing buffer and subjected to the
MBP pull-down assay or the immunoprecipitation assay.
MBP pull-down assay
Crosslinked cell suspensions in MBP washing buffer were sonciated 4 times with
30 second interval at power level 4 (Sonicator Cell Disruptor (W200R) Heat
System Ultrasonics Inc.). The cell lysate was centrifuged 13,200 rpm for 10 minutes at 4°C to remove unlysed cells. 30 Pl of cell lysate were removed to a fresh tube and mixed with 10 Pl of 4xSDS sample buffer as input control. 900 Pl of cell lysate were transferred to a fresh tube and mixed with 200 Pl washed amylose-resins (150 Pl of original bed volume and washed 3 times with MBP washing buffer). The mixtures were incubated at 4 °C on a rocker for 1 hour.
Then the amylose-resins were spun down and washed 3 times with MBP washing buffer. Bound proteins were eluted with 450 Pl of elution buffer (20 mM
Tris pH 7.5, 200 mM NaCl, 10 mM E-mercaptoethanol, 1 mM EDTA, 1 mM PMSF,
0.5% NP-40, 10 mM maltose) twice. Total 900 Pl of elution samples were precipitated with 100 Pl TCA. Precipitated proteins were resuspended in 40 Pl of
1xSDS sample buffer as elution portion.
Immunoprecipitation assay
105 Crosslinked cell suspensions in MBP washing buffer were sonciated 4 times with
30 second interval at power level 4 (Sonicator Cell Disruptor (W200R) Heat
System Ultrasonics Inc.). The cell lysate was centrifuged 13,200 rpm for 10 minutes at 4°C to remove unlysed cells. 30 Pl of cell lysate were removed to a fresh tube and mixed with 10 ml of 4xSDS sample buffer as input control. 900 Pl of cell lysate were transferred to a fresh tube and precleared with 100ȝl of washed protein A/G agarose beads (50 Pl of original bed volume and washed 3 times with MBP washing buffer) for 15 minutes. The beads were removed by centrifugation at 8,000 rpm for 3 minutes and the supernatant was transferred to a new tube. 6ȝl rabbit anti-VSV-G antibody (Sigma) was added to each tube and the supernatants were incubated at 4°C on a rocker for 45 minutes. Then 200 ȝl of washed protein A/G agarose beads were added to each tube and the mixtures were rocked for an additional 45 minutes at 4°C. The beads were then pelleted, washed 3 times with MBP washing buffer and resuspended in 40ȝl 1x SDS sample buffer. The samples were incubated at 55°C for 10 minutes to elute proteins bound to the beads. Then the samples were vortexed and centrifuged.
The supernatant were collected as elution fraction.
RECC assay
Secretion of ExoS and ExoT in the pcrV null P. aeruginosa strain, PAO1F 'pcrV
'fleQ, and the pcr1 null P. aeruginosa strain, PAO1F 'pcr1 'fleQ, was determined by the RECC assay. The procedure of the RECC assay is described in “Materials and Methods” of Chapter 2.
106 Results
Identifying PcrG interaction partners by bacterial two-hybrid analysis and characterizing the protein binding domains in PcrG
To identify the T3SS components that interact with PcrG we used the E. coli bacterial two-hybrid system to determine the interaction between PcrG and other
T3SS components in P. aeruginosa, specifically those located in the cytoplasm and the inner membrane. As shown in Figure 3-1, we found PcrG interacts with
PscO. PscO is predicted to be a cytoplasmic protein and its homolog in the flagellum is FliJ. Deletion of pscO results in a T3SS null phenotype (no translocator and effector secretion, data not shown).
To define the protein interaction domains in PcrG, we constructed different truncated PcrG mutants and used bacterial two-hybrid analysis to determine the interaction between PcrV, PscO and the PcrG mutants. As shown in Figure 3-2, we found that the PcrV interacting domain is located at the N-terminus of PcrG
(a.a. 1-20). This observation is consistent with the non-PcrV interacting PcrG point mutant, PcrGA16R, which has the point mutation in the first 20 a.a. of PcrG.
The center region (a.a 20-70) of PcrG contains the PscO interacting domain.
Shorter internal deletions, '30-40 or '60-70, in PcrG greatly reduced the
PcrG/PscO interaction (data not shown). A combined deletion mutant, PcrG
('30-40; '60-70), totally lost the ability to bind to PscO. Therefore, the a.a. 30-40 and a.a. 60-70 of PcrG constitute the PscO interacting domain. However, the C- terminus of PcrG, which contains most of the regulatory activity (see below), does not bind to PcrV or PscO.
107 The C-terminus of PcrG contains most regulatory activity for control of effector secretion
We next determined if the truncations affect control of effector secretion by using the PexoS-lacZ reporter assay. Since PcrG is unstable when it loses the interaction with PcrV, we fused these truncated PcrG mutants to the C-terminus of maltose binding protein (MBP) to stabilize PcrG. The reporter assay showed that the MBP-PcrG(w.t.) fusion protein regulates effector secretion, indicating that the fused MBP does not interfere with the regulatory function of PcrG. MBP-
PcrG(21-95) regulated effector secretion at a similar level to the MBP-PcrG(w.t.)
(Fig. 3-3), consistent with our previous finding that the PcrG/PcrV interaction is not required for control of effector secretion. MBP-PcrG(2-70), which interacts with PcrV and PscO, failed to regulate effector secretion. Effector secretion in the strain expressing MBP-PcrG(2-70) is as de-regulated as in a pcrG null strain. In contrast, MBP-PcrG(60-95), which does not interact with PcrV or PscO, still has
~60% of the regulatory activity of wild type PcrG. MBP-PcrG('30-40; '60-70), the non-PscO interacting mutant, regulated effector secretion as wild type PcrG.
These results demonstrated that the C-terminus of PcrG contains the regulatory domain to control effector secretion. In addition, the PcrG/PcrV interaction is not necessary for control of effector secretion. The PscO interacting domain enhances the regulatory activity of the C-terminus of PcrG but is not essential for control of effector secretion.
108 The secretion profiles of the T3SS substrates in different PcrG deletion mutants
To analyze the secretion profiles of individual T3SS substrates, we expressed the MBP-PcrG truncated mutants in a P. aeruginosa strain whose chromosomal exsE, fleQ and pcrG are deleted. The purpose of deleting exsE is to induce expression of the T3SS genes uniformly to maximize the numbers of apparatuses and substrates in order to avoid interference caused by different expression levels. We also deleted fleQ, the master regulator in flagellar biosynthesis to prevent non-specific secretion by the flagellum. Then we used the protein secretion assay to analyze secretion of different T3SS substrates. As shown in Figure 3-4, removal of Ca2+ induced effector secretion and translocator secretion was also up-regulated, indicating that the substrate specificity is changed and the secretion activity of the T3SS is up-regulated. The secretion profiles of the effectors, ExoS, ExoT and ExoY, were consistent with the result in the PexoS-lacZ reporter assay suggesting that the C-terminus of PcrG possesses most of the regulatory activity for controlling effector secretion (Figure 3-4A).
Interestingly, the translocator secretion in the presence of Ca2+ condition was also affected by the PcrG truncated mutants (Figure 3-4B and 4E). PopB and
PopD were secreted in a similar pattern in the strains expressing the PcrG truncated mutants. In the strains expressing MBP-PcrG(21-95) and MBP-
PcrG(60-95), effector secretion was inhibited; however, PopB and PopD secretion was up-regulated, about 30% higher than in the strain expressing wild
109 type PcrG. In the pcrG null strain or the strain expressing PcrG(2-70),
PopB/PopD secretion was 50% higher than in the wild type strain. Although PcrV is one of the translocators, which is constitutively secreted by the T3SS, PcrV secretion profile is totally different from PopB/PopD secretion. PcrV secretion was decreased in all PcrG truncated mutants no matter if Ca2+ is present in the culture medium. Non-PcrV interacting PcrG mutants, such as PcrG(21-95) and
PcrG(60-95) and pcrG null mutant have similar level of PcrV secretion, confirming the phenotype we described in Chapter 2 that loss of PcrG/PcrV interaction results in decreased PcrV export. The PcrG/PcrV interaction facilitates
PcrV export. However, PcrV export was severely reduced in the PcrV interacting mutant, PcrG(2-70). Since PcrG(2-70) also interacts with PscO, the PcrG/PscO interaction may inhibit PcrV export. Indeed, the non-PscO interacting mutant,
PcrG('30-40;'60-70), exported more PopB, PopD and PcrV than wild type PcrG
(Fig. 3-4E). Loss of the PcrG/PscO interaction might up-regulate translocator secretion by enhancing the general secretion activity of the T3SS. In summary, the secretion profiles of the T3SS substrates showed that the C-terminus of PcrG controls the substrate specificity for effector secretion and PcrG is also involved in translocator secretion.
Identifying T3SS apparatus components interacting with the C-terminus of
PcrG by site-specific crosslinking and mass spectrometry
110 Since the C-terminus of PcrG is essential for control of effector secretion, we hypothesized that PcrG interacts with other T3SS components through its C- terminus to regulate effector secretion. In an agreement with this hypothesis, a
PcrGR85ER86E mutant showed a mild de-regulated effector secretion phenotype
(Fig. 3-9A), suggesting that R85 and R86 may be the amino acids that interact with other T3SS components to regulate effector secretion. To identify the T3SS component that interacts with R85 and R86 of PcrG, we used a site-specific crosslinking method to crosslink the amino acids on two proteins that interact with each other. We first replaced P84, R85, R86 and P87 of PcrG with cysteines individually and fused MBP to the N-terminus of these PcrG mutants. Notably, there is no cysteine in wild type PcrG. All these MBP-PcrG cysteine mutants regulate effector secretion as MBP-pcrG(w.t.), indicating these cysteine mutants are functional and still interact with the unidentified T3SS component (data not shown). Then we used the membrane-permeable crosslinker, SMCC, to covalently crosslink the cysteine on PcrG with primary amine groups from the amino acids on other proteins in proximity (Fig. 3-5A). The crosslinked MBP-
PcrG/apparatus protein complexes were purified by amylose affinity purification and separated by SDS-PAGE. Any protein crosslinked with MBP-PcrG will produce a MBP-PcrG protein complex that has a molecular weight higher than 50 kD, the molecular weight of uncrosslinked MBP-PcrG. Therefore, we cut the gel from 50 kD to 150 kD into four slices (Figure 3-5B) and used mass spectrometry to identify the proteins in the slices. The proteins identified were analyzed for the presence of T3SS apparatus components. The apparatus component, PcrD, was
111 identified by mass spectrometry in both uncrosslinked (~77 kD, in slice #2) and crosslinked (~130 kD, in slice #3) molecular weights, indicating that PcrD interacts with PcrG.
PcrG interacts with PcrD in P. aeruginosa
To demonstrate that PcrG and PcrD interact with each other, we introduced a
VSV-G tag at the C-terminus of PcrD and used MBP-PcrGP84C to crosslink and pull down the protein complex. Effector secretion was not affected by the C- terminal VSV-G tag in PcrD (data not shown). The MBP-PcrG pull-down experiment showed that more PcrD was co-purified with MBP-PcrGP84C when the crosslinker was added, suggesting the crosslinking process stabilizes the MBP-
PcrG/PcrD complex (Fig. 3-6). A ~130 kD band (the expected molecular weight of the MBP-PcrG/PcrD 1:1 complex) indicates that PcrD directly interacts with the
C-terminus of PcrG. In addition, a VSV-G signal was also detected at molecular weight ~160 kD, suggesting that an additional protein complex containing VSV-G tagged PcrD was co-purified by the MBP-PcrG pull-down assay. Furthermore, removal of Ca2+ from the culture medium decreased the amount of PcrD co- purified with MBP-PcrG and the ~130 kD and ~160 kD bands were no longer observed, indicating the PcrG/PcrD interaction is associated with the activation of effector secretion (Figure 3-6). Then we performed a reciprocal immunoprecipitation experiment by using anti-VSV-G antibody to immunoprecipitate VSV-G tagged PcrD. As shown in Figure 3-7A, the VSV-G
112 tagged PcrD was immunoprecipitated by the anti-VSV-G antibody and protein
A/G beads. The blot detecting MBP-PcrG by using anti-MBP-antibody confirmed that both the ~130 kD and ~160 kD bands contained MBP-PcrG, demonstrating that the ~130 kD complex is the MBP-PcrG/PcrD 1:1 complex and the ~160 kD complex consists of MBP-PcrG, VSV-G tagged PcrD and unknown proteins
(Figure 3-7B). The anti-VSV-G blot also showed a crosslinker-dependent band above (~10 kD shift) the uncrosslinked PcrD, suggesting that a ~10 kD protein is crosslinked to PcrD. The ~130 kD complex and ~160 kD complex were not observed in the anti-VSV-G blot due to high background signals after long exposure.
The PcrG/PcrD interaction occurs when the apparatus is in the effector secretion “off” state
We hypothesized that effector secretion in P. aeruginosa is controlled by an allosteric regulation mechanism. The apparatus changes its conformation when the activation signal for effector secretion is received. Therefore, the acceptor site for effectors on the apparatus is revealed or formed to export effectors.
Because removal of Ca2+ from the culture medium triggers effector secretion and abolishes the PcrG/PcrD interaction, we tried to investigate if the PcrG/PcrD interaction is also disrupted in P. aeruginosa mutants with a de-regulated effector secretion phenotype. In a pcr1 null strain, effector secretion is fully activated even when Ca2+ is present in the culture medium (Figure 3-8B), suggesting that
113 the apparatus is in the effector secretion “on” state. Consistent with removal of
Ca2+, the PcrG/PcrD interaction was decreased in the pcr1 null strain (Figure 3-
8A), indicating that the PcrG/PcrD interaction is lost when the apparatus is in the effector secretion “on” state. As we described in Chapter 2, deletion of pcrV results in a partially de-regulated effector secretion phenotype (Fig. 3-8D). The partial effector secretion “on” phenotype may result from the apparatus oscillating between effector secretion “on” and “off” conformations. Since the PcrG/PcrD interaction depends on the conformation of the apparatus, we expected the
PcrG/PcrD interaction to be partially decreased in a pcrV null strain. As shown in
Figure 3-8C, the amount of PcrD co-purified with MBP-PcrG in the pcrV null strain was less than in a wild type strain. However, with longer crosslinking time the co-purified PcrD in the pcrV null strain reached the same level as in the wild type strain. Meanwhile, the levels of co-purified PcrD were similar between long and short crosslinking times in the wild type strain. This result showed that the apparatus in the wild type strain stably stays in the effector secretion “off” conformation when Ca2+ is present. In the pcrV null strain, the apparatus oscillates between “on” and “off” conformations; therefore, the rate of crosslinking is reduced. Longer crosslinking time allows newly formed PcrG/PcrD complex to be crosslinked and purified. In conditions where effector secretion is fully activated, e.g. removal of Ca2+ or deletion of pcr1, the apparatus is in an “on” conformation and switches to an “off” conformation at a very low frequency. Thus, only a small amount of PcrD was co-purified.
114 The interaction between PcrD and the C-terminus of PcrG is important for effector secretion control
As mentioned previously, the R85E and R86E mutations in PcrG result in mild de-regulated effector secretion. Therefore, we constructed a MBP-PcrG(P84C,
R85E, R86E) mutant to determine if these mutations affect binding of PcrG to
PcrD. The PexoS-lacZ reporter assay confirmed that the P84C mutation, which provides cysteine for crosslinking with PcrD, had no effect on control of effector secretion but the R85E and R86E double mutation caused a mildly deregulated effector secretion (Fig. 3-9A). We then expressed the MBP-PcrG(P84C, R85E,
R86E) fusion protein in the P. aeruginosa strain with VSV-G tagged PcrD and performed the MBP pull-down experiment. As shown in Fig. 3-9B, the amount of
PcrD co-purified with MBP-PcrG(P84C, R85E, R86E) was reduced, demonstrating that the R85E and R86E mutations disrupt the interaction with
PcrD. Therefore, the interaction between the C-terminus of PcrG and PcrD likely participates in control of effector secretion.
The de-regulated effector secretion caused by the R85E and R86E mutations is more profound if the PscO interacting domain is deleted. As shown in Fig. 3-9A, a synergistically up-regulated effector secretion (~75% of deregulated effector secretion caused by pcrG null) was observed in the MBP-PcrG('30-40; '60-70;
P84C, R85E, R86E) mutant. Meanwhile, MBP-PcrG('30-40; '60-70; P84C) regulated effector secretion at a similar level as wild type PcrG. Furthermore, the
MBP-PcrG(2-70) mutant, whose last 25 a.a. are deleted, totally loses the regulatory activity (Figure 3-3). This result suggests that binding of the C-
115 terminus of PcrG to PcrD is essential for control of effector secretion and the
PscO binding domain in the central region of PcrG stabilizes the interaction between PcrG and PcrD.
We found that PcrG('30-40; '60-70) is sensitive to the conformation of the apparatus. Although PcrG('30-40; '60-70) complemented the pcrG null mutant,
PcrG('30-40; '60-70) totally lost the ability to regulate effector secretion in the pcrGV double null strain, indicating the regulatory activity of PcrG('30-40; '60-
70) requires the presence of PcrV (Figure 3-10A). We further tested if loss of the regulatory activity of PcrG('30-40; '60-70) is due to absence of PcrV by expressing PcrG('30-40; '60-70) in the 'pcrG pcrVF279R P. aeruginosa strain. In
Chapter 2, we demonstrated that PcrVF279R is secreted and still able to interact with PcrG but fails to assemble at the needle tip, resulting in de-regulated effector secretion. Similar with the phenotype of the pcrGV double null strain,
PcrG('30-40; '60-70) also lost the ability to control effector secretion in the
'pcrG pcrVF279R strain, suggesting that expression of PcrV or the PcrG/PcrV interaction is not the factor causing loss of the regulatory activity of PcrG('30-40;
'60-70) (Fig. 3-10A). The regulatory activity of PcrG('30-40; '60-70) depends on assembly of PcrV at the needle tip. In the pcrV null mutant, the apparatus is in a partial effector secretion “on” conformation and the interaction between the C- terminus of PcrG and PcrD is weakened. The loss of regulatory activity of
PcrG('30-40; '60-70) may be due to the fact that the C-terminus of PcrG fully
116 loses the interaction with PcrD in the pcrV null and pcrVF279R strains. Therefore, the PscO interacting domain may stabilize the PcrG/PcrD interaction.
The C-terminus of PcrG may have multiple binding sites
The simplest model to describe how PcrG regulates effector secretion is that PcrG binds the apparatus to prevent effector secretion. When the activation signal for effector secretion is received, PcrG is released from the apparatus and the effectors are secreted. PcrG('30-40; '60-70) loses its regulatory activity in the pcrV null background, suggesting that PcrG('30-40; '60-70) cannot bind to the apparatus in the absence of PcrV. To test if PcrG('30-40; '60-70) is a loss- of-function mutant and cannot compete with wild type PcrG for binding to the apparatus in the absence of PcrV at the needle tip, we expressed PcrG('30-40;
'60-70) from the plasmid in a pcrV null P. aeruginosa strain that still has wild type pcrG on the chromosome. We expected that effector secretion in the strain expressing PcrG('30-40; '60-70) should be similar in the strains expressing wild type PcrG, because wild type PcrG, no matter if expressed from the plasmid or from the chromosome, should have a dominant regulatory effect. Interestingly, effector secretion was up-regulated more in the strain expressing PcrG('30-40;
'60-70) from the plasmid with 10 PM IPTG (Fig 3-10B). Using more IPTG (100
PM) to induce PcrG('30-40; '60-70) expression resulted in fully up-regulated effector secretion (Fig. 3-10C), indicating that the enhanced effector secretion is due to expression of PcrG('30-40; '60-70). This result suggested that in the
117 context of pcrV null, PcrG('30-40; '60-70) actually is a dominant negative mutant and competes with wild type PcrG for an unknown binding site which is important for control of effector secretion.
Since the C-terminus of PcrG possesses most of the activity for control of effector secretion, it is possible that the dominant negative effect of PcrG('30-40;
'60-70) in the pcrV null background is mediated by the C-terminus of PcrG. We then tested if the R85E and R86E mutations in the C-terminus of PcrG, which abolish the PcrG/PcrD interaction, affect the dominant negative effect of
PcrG('30-40; '60-70). We expressed PcrG(P84C, R85E, R86E) and PcrG('30-
40; '60-70; P84C, R85E, R86E) in the pcrV null strain with wild type PcrG expressed from the chromosome. Both PcrG mutants could not compete with wild type PcrG, indicating that the R85E and R86E mutations disrupt the interaction between the mutant PcrG and the unknown binding site. Therefore, in addition to binding to PcrD, the C-terminus of PcrG may bind to an unknown site.
The interaction between the C-terminus of PcrG and the unknown site is essential for PcrG to regulate effector secretion but is not directly involved in switching effector secretion “on” or “off” since PcrG('30-40; '60-70) competes with wild type PcrG for the unknown site but loses the regulatory activity. The unknown site may serve as an anchoring site for targeting PcrG to the apparatus and the interaction between the C-terminus of PcrG and PcrD is responsible for control of effector secretion, which is stabilized by the PscO/PcrG interaction.
118 Since we showed that translocator secretion is up-regulated in the PcrG('30-
40; '60-70) mutant, the putative PscO interacting domain may be responsible for controlling the secretion activity of the apparatus (Fig. 3-4E). An alternative explanation for the dominant negative phenotype of PcrG('30-40; '60-70) in the absence of PcrV is that the secretion activity of the apparatus is up-regulated by the PcrG('30-40; '60-70) mutant and deletion of pcrV leads to loss of substrate specificity control. Therefore, combination of the increased secretion activity and the loss of substrate specificity control results in fully de-regulated effector secretion.
Discussion
In P. aeruginosa and Yersinia spp., the chaperones of the needle tip proteins are negative regulators of effector secretion. We have shown that PcrG regulates effector secretion in the cytoplasm in a PcrV independent manner. Consistently, it has been demonstrated that LcrG exerts its regulatory activity in the cytoplasm[185]. However, the mechanism of how the cytoplasmic negative regulators control effector secretion is still unknown. We hypothesized that PcrG interacts with the T3SS components of the apparatus in the cytoplasm to regulate effector secretion.
This chapter characterized the functional domains in PcrG. The C-terminus of
PcrG contains most of the activity for control of effector secretion and the central region of PcrG contains the PscO interacting domain (Figure 3-11A). By using
119 the site-specific crosslinking method and the MBP pull-down assay, I identified that PcrD interacts with the C-terminus of PcrG. We found that the PcrG/PcrD interaction is associated with the conformational state of the apparatus. The
PcrG/PcrD interaction is more stable when the apparatus is in effector secretion
“off” state. Furthermore, we showed that the PcrGR85E,R86E mutant, which causes deregulated effector secretion, loses the PcrG/PcrD interaction; therefore, PcrG regulates effector secretion through interacting with PcrD.
PcrD is an essential protein in the P. aeruginosa T3SS. Deletion of PcrD results in a T3SS null phenotype. Like its homolog in the flagellum, FlhA, the N- terminus of PcrD (~300 a.a.) is predicted to be a transmembrane domain, and the C-terminus (~400 a.a.) of PcrD is the cytoplasmic domain. Therefore, PcrD is anchored in the inner membrane with a C-terminal domain in the cytoplasm. The crystal structures of the cytoplasmic domains of FlhA and InvA, the homolog of
PcrD in the Salmonella SP-1 T3SS, have been solved[192-194]. The cytoplasmic domains of FlhA and InvA are highly similar. They can be divided into four subdomains with a linker domain at the N-terminus that connects to the transmembrane domains. Temperature sensitive point mutants of FlhA have been isolated and all the point mutations are located in the cytoplasmic domain of FlhA. Intragenic suppressors of the temperature sensitive point mutants suggest that the suppressors restore substrate secretion by inducing a conformational change of FlhA[195]. Furthermore, molecular dynamic simulations suggest that the distance between subdomain 2 and 4 of the FlhA cytoplasmic domain oscillates. These results suggest that the FlhA cytoplasmic
120 domain exists in two different conformational states, which are important for substrate secretion[192]. We demonstrated that PcrG regulates effector secretion by interacting with PcrD and the PcrG/PcrD interaction is more stable when effector secretion is off. Therefore, binding of PcrG to PcrD may promote the effector secretion “off” conformation of PcrD. These results support the allosteric model that effector secretion is controlled by conformational changes in the apparatus.
While the allosteric model is preferred, it is possible that PcrG may bind to the acceptor site for effectors in the apparatus and therefore block effector secretion.
However, overexpression of PcrG does not affect effector secretion activated by removal of Ca2+ or deletion of PcrV (data not shown), suggesting that PcrG does not compete with effectors. It is less likely that PcrG directly binds to the acceptor site of effectors since PcrG is not secreted and deletion of PcrG results in partially de-regulated effector secretion. Unlike PcrG, overexpression of the secreted cytoplasmic negative regulator, PopN, inhibits effector secretion in a pcrV null strain or when Ca2+ is removed from the medium (data not shown).
Deletions of the components of the PopN complex cause fully de-regulated effector secretion, suggesting that the PopN complex is more likely to bind to the acceptor site. Therefore, PcrG in the cytoplasm, together with PcrV at the needle tip, likely promotes the effector secretion “off” state and prevents secretion of
PopN, which occupies the acceptor site for effectors.
By using bacterial two-hybrid analysis, we found that PcrG interacts with PscO and the PscO interacting domain is located at the a.a. 30-40 and a.a. 60-70 of
121 PcrG. The PscO interacting domain is dispensable for control of effector secretion since PcrG('30-40; '60-70) complements a pcrG null mutant. However, losing the PscO interacting domain makes the PcrG mutant more sensitive to the conformation of the apparatus because PcrG('30-40; '60-70) loses its regulatory activity and if the apparatus is in a partial effector secretion “on” state.
PcrG regulates effector secretion through the interaction between the C-terminus of PcrG and PcrD. Therefore, the PcrG/PscO interaction may stabilize the
PcrG/PcrD interaction. The dominant negative phenotype caused by PcrG('30-
40; '60-70) in the pcrV null strain indicates that PcrG binds an additional unknown protein. The simplest explanation is that PcrG is released from the apparatus and binds to an unknown protein to activate effector secretion.
However, the de-regulated effector secretion caused by the deletion of PcrG clearly demonstrates that PcrG does not bind to another protein in order to activate effector secretion. This additional interaction must be essential for PcrG to regulate effector secretion and persistent when effector secretion is activated.
The additional interaction may be located at the C-terminus of PcrG because
MBP-PcrG(2-70), which lacks the last 25 a.a. of PcrG, totally loses the regulatory activity and the R85E and R86E mutations abolish the dominant negative effect.
The unknown C-terminal interaction partner of PcrG may be a component of the apparatus or PcrG itself. Thus, we propose a multiple binding model if the additional binding partner is the apparatus and a PcrG dimer model if PcrG interacts with itself (Fig. 3-11B). In the multiple binding model, the additional interaction with the apparatus functions as an anchor for PcrG to regulate
122 effector secretion. The interaction between the C-terminus of PcrG and PcrD stabilizes the apparatus in effector secretion “off” state, which is enhanced by the
PcrG/PscO interaction. When the activation signal is received, PcrG remains anchored to the apparatus but loses the interaction with PcrD, perhaps the interaction with PscO as well. Thereby, the apparatus switches to the effector secretion “on” state. The PcrG dimer model proposes that PcrG needs to form a dimer, or multimer, to regulate effector secretion and the dimerization domain is located at the C-terminus. The PcrG dimer binds to PcrD to prevent effector secretion and the PcrG/PscO interaction still functions as a stabilizer. Both models explain the dominant negative phenotype in a pcrV null background. The
PcrG('30-40; '60-70) mutant may compete for the anchoring binding site on the apparatus or form a wild type/mutant heterocomplex with weakened binding affinity to the apparatus. In addition, the de-regulated effector secretion phenotype in a pcrG null mutant also fits into both models since no PcrG, either monomer or multimer, binds to the apparatus.
Another possible model is that the putative PscO interacting domain of PcrG controls the secretion activity of the apparatus and the C-terminus of PcrG controls the substrate specificity. This model is supported by the fact that translocator secretion is up-regulated in the PcrG('30-40; '60-70) mutant and combination of deletion of the putative PscO interacting domain and the
R85E/R86E mutations results in synergistically up-regulated effector secretion.
The fully deregulated effector secretion in the pcrV null strain expressing
PcrG('30-40; '60-70) is due to the fact that up-regulated secretion activity
123 enhances de-regulated effector secretion caused by deletion of pcrV. The C- terminus of PcrG('30-40; '60-70) still interacts with PcrD in the pcrV null strain.
Therefore, it is able to compete with wild type PcrG for binding of PcrD and exerts dominant negative effect. However, this model cannot explain that in the
MBP-PcrG(2-70) mutant, which still interacts with PscO, effector secretion is de- regulated to the same level as the pcrG null mutant.
In the flagellum, FliT is the secretion chaperone of FliD, the filament cap protein. FliT facilitates secretion of FliD and interacts with FliJ, one of the components of the ATPase complex[196, 197]. It has been demonstrated that
FliJ interacts with FlhA and facilitates binding of the FliD/FliT complex to FlhA. In addition, free FliT competes with the FliD/FliT complex for the binding with FliJ. It has been proposed that the free FliT/FliJ interaction may limit secretion of FliD by occupying the secretion sites on the apparatus[198]. Similarly, we found that
PcrG interacts with PscO and PcrV secretion is limited by the PcrG/PscO interaction. It is possible that the PcrG/PscO interaction plays a similar role to that of their homologs in the flagellar T3SS to control PcrV secretion. While we used the bacterial two-hybrid analysis to identify the PcrG/PscO interaction, we could not co-purify PscO with MBP-PcrG by the MBP pull-down assay. A proper buffering condition for the pull-down assay or a site specific crosslink at the PscO interacting domain may be necessary to stabilize the PcrG/PscO complex.
In addition to the MBP-PcrG/VSV-G PcrD 1:1 complex, we found some additional protein complexes were co-purified with MBP-PcrG and VSV-G PcrD.
The 160 kD protein complex purified by the MBP pull-down assay and the VSV-G
124 PcrD immunoprecipitation suggests that this complex consists of MBP-PcrG,
VSV-G tagged PcrD and an unknown protein. Since the MBP-PcrG/VSV-G PcrD
1:1 complex is ~ 130 kD, the unknown protein is expected to be ~30 kD. By the
VSV-G PcrD immunoprecipitation, we also found a crosslinker-dependent 10 kD shift, suggesting that another unknown protein with molecular weight ~10 kD forms a complex with PcrD. Few apparatus components are candidates responsible for the 30 kD shift and the 10 kD shift. PscU is autocleaved to a 29 kD inner membrane-anchored fragment and a 10 kD cytoplasmic fragment, and it has been demonstrated that FlhB and FlhA interact with each other[105]. Other apparatus components, such as PscR (~24 kD) and PscS (~10 kD), are possible candidates because their flagellar homologs also interacts with FlhA[199]. The components of the PopN complex are good candidates as well because PopN is
~30 kD and Pcr1, Pcr2 and PscB are ~10 kD. However, further studies are needed to identify the unknown proteins causing the shifts.
This chapter analyzed how PcrG regulates effector secretion in the bacterial cytoplasm. PcrG regulates effector secretion by interacting with the apparatus component, PcrD. My data suggest that the putative PcrG/PscO interaction is a stabilizer of the PcrG/PcrD interaction and a regulator of PcrV secretion. In addition to the interaction with PcrD, the C-terminus of PcrG likely makes a second essential contact with an unidentified protein, possibly another apparatus component or PcrG itself. PcrG interacts with the apparatus to regulate effector secretion, which provides a model of how related cytoplasmic regulators control effector secretion in the T3SS.
125
Figure3Ͳ1.IdentifyingT3SScomponentsthatinteractwithPcrGbytheE.colibacterial twoͲhybridanalysis.TheP.aeruginosaT3SScomponentswerefusedtoDsubunitof RNApolymerase,andPcrGwasfusedtocIODNAbindingprotein.Expressionofthe fusionproteinswasinducedwithIPTG.TheinteractionbetweenPcrGandtheT3SS componentstriggeredexpressionofthelacZreportergenewhichwasdeterminedby measuringtheEͲgalactosidaseactivity.
126
Figure3Ͳ2.MappingtheproteininteractiondomainsonPcrG.Theproteininteraction domainsonPcrGweredeterminedbytheE.colibacterialtwoͲhybridanalysis.
127 Figure3Ͳ3.EffectofPcrGtruncatedmutantsoneffectorsecretion.ThepMalͲpcrG (MBPͲPcrG)plasmidsweretransformedintothePexoSͲlacZreporterstrainwith chromosomalpcrGdeleted.TheexpressionofMBPͲPcrGtruncatedwasinducedwith10 PMIPTG,andeffectorsecretionwasdeterminedbytheEͲgalactosidaseactivityassay.
128
E) Figure3Ͳ4.ThesecretionprofilesoftheT3SSsubstratesinthestrainsexpressingPcrG truncatedmutants.ThepMalͲpcrGplasmidsweretransformedintoaP.aeruginosa strainwithchromosomalexsE,fleQ,andpcrGdeleted.ExpressionofMBPͲPcrGwas inducedwith20PMIPTG.BacteriaweregrowntomidͲloginLBmediumandthenspun down.ThecellpelletswereresuspendedinLBmediumwithorwithoutEGTAand incubatedat37°Cfor30minutes.Thenthebacterialcultureswerespundown,andthe supernatantandpelletproteinsampleswerecollected.TheT3SSsubstrates,ExoS,ExoT, ExoY,PopB,PopDandPcrV,inthesupernatantandpelletportionsweredetectedby Westernblotting,andtheintensityofdetectedbandswasdeterminedbythesoftware, ImageJ.Thepercentageofproteinsecretedwascalculatedas:100*supernatantband intensity/(supernatantbandintensity+pelletbandintensity).Theresultspresentedare averageof3independentexperiments±SD.
129
A) B)
Figure3Ͳ5.IdentifyT3SScomponentsinteractingwiththeCͲterminusofPcrG.A) CrosslinkingMBPͲPcrGcysteinemutantswithunknownT3SScomponentsbyusing SMCC.B)pMalͲpcrGR85CplasmidwastransformedintoaP.aeruginosastrainwith chromosomalexsEandpcrGdeleted.TheexpressionofMBPͲPcrGR85Cwasinducedwith 10PMIPTG.BacteriacellsweregrowntomidͲloginLBmediumwithoutEGTA.The membraneͲpermeablecrosslinker,SMCC,wasadded,andtheMBPͲPcrGR85Cprotein complexeswerepurifiedbyamyloseͲresins.Purifiedproteincomplexeswereseparated bySDSͲPAGEandstainedwithCommassiveblue.Themolecularweightsrangesofcut sliceswere:slice#1:50Ͳ60kD,slice#2:60Ͳ75kD,slice#3:75Ͳ100kD,slice#4:100Ͳ150 kD.Theproteinscontainedineachslicewereidentifiedbymassspectrometry.
130
Figure3Ͳ6.CoͲpurifyPcrDwithMBPͲPcrGbyamyloseͲresinpurification.pMalͲ pcrG(w.t.)orpMalͲpcrGR84CplasmidsweretransformedintoaP.aeruginosastrain whosechromosomalexsEandpcrGweredeletedandpcrDwastaggedwithVSVͲGat theCͲterminus.ExpressionofMBPͲPcrGR84Cisinducedwith10PMIPTG.Bacteriacells weregrowntomidͲloginLBmediumwithorwithoutEGTA.Thebacteriacellswere crosslinkedbySMCCandsonicated.TheMBPͲPcrGR84Cproteincomplexeswerepurified byamyloseͲresins.PurifiedproteincomplexeswereanalyzedbyWesternblotting.The coͲpurifiedVSVͲGtaggedPcrDwasdetectedbyantiͲVSVGantibody.
131 A) B)
Figure3Ͳ7.CoͲpurifyMBPͲPcrGwithPcrDbyimmunoprecipitation.pMalͲpcrGR84C plasmidwastransformedintoaP.aeruginosastrainwhosechromosomalexsEandpcrG weredeletedandpcrDwastagged/untaggedwithVSVͲGattheCͲterminus.Expression ofMBPͲPcrGR84Cwasinducedwith10PMIPTG.BacteriacellsweregrowntomidͲlogin LBmedium.ThebacteriacellswerecrosslinkedbySMCC,andtheVSVͲGtaggedPcrD wereimmunoprecipitatedbyusingantiͲVSVͲG(mouseorigin)antibodyandproteinA/G beads.PurifiedproteincomplexeswereanalyzedbyWesternblotting.A)The immunoprecipitatedVSVͲGtaggedPcrDwasdetectedbyantiͲVSVGantibody(rabbit origin)andB)coͲpurifiedMBPͲPcrGwasdetectedbyantiͲMBPantibody(rabbitorigin).
132
Figure3Ͳ8.ThePcrG/PcrDinteractiondependsontheactivationofeffectorsecretion. A)andC):ThePcrG/PcrDinteractioninpcr1orpcrVnullstrainwasdeterminedbythe MBPͲPcrGpullͲdownassay.B)andD):UsingtheRECCassaytodetermineeffector secretioninapcr1orpcrVnullstrain.
133 A)
B) Figure3Ͳ9.DisruptionofthePcrG/PcrDinteractioncausesdeͲregulatedeffector secretion.A)TheR85EandR86EmutationswereintroducedintowildtypePcrGand PcrG('30Ͳ40;'60Ͳ70)andtheplasmidscarryingmutantpcrGweretransformedintoa pcrGnullP.aeruginosastrain.ExpressionofPcrGwasinducedwith10PMIPTGand effectorsecretionwasdeterminedbythePexoSͲlacZreporterassay.B)TheeffectofR85E andR86EmutationsonthePcrG/PcrDinteractionwasdeterminedbytheMBPͲPcrG pullͲdownassay.
134 A) B) C) Figure3Ͳ10.PcrG('30Ͳ40;'60Ͳ70)becomesdominantnegativeinthepcrVnull background.A)pMalͲpcrG('30Ͳ40;'60Ͳ70)plasmidwastransformedinto'pcrG,'pcrG 'pcrV('pcrGV),and'pcrGpcrVF279Rstrains.ExpressionofMBPͲPcrGwasinducedby10 PMIPTG.EffectorsecretionwasdeterminedbythePexoSͲlacZreporterassay.B&C) pMalͲpcrG('30Ͳ40;'60Ͳ70)plasmidwastransformedintoa'pcrG'pcrV('pcrGV) strains.ExpressionofMBPͲPcrGwasinducedbyB)10PMorC)100PMIPTG.Effector secretionwasdeterminedbythePexoSͲlacZreporterassay.
135 Figure3Ͳ11.ModelsofhowPcrGregulateseffectorsecretionbyinteractingwiththe apparatus.A)ThefunctionaldomainsinPcrG.B)MultiplebindingsitesmodelandPcrG dimermodel.TheinteractionbetweentheCͲterminusofPcrGandPcrDcontrols effectorsecretion.ThePcrG/PscOinteractionstabilizesthePcrG/PcrDinteraction.The CͲterminusofPcrGmakesthethirdessentialbindingwiththeapparatus(multiple bindingsitesmodel)orPcrGitself(PcrGdimermodel)regardlesstheeffectorsecretion statesoftheapparatus.
136 Table3Ͳ1.Strains,plasmids,primersusedinthisstudy
Strain # genotype reference E. coli two-hybrid analysis strain BN469 RP1831 PAO1F, wild type P. aeruginosa PAO1 Reference [190] RP3082 PAO1F ǻpcrG2 ǻexoS::GFP-lacZ See Chapter 2 RP2645 PAO1F ǻpcrV2 ǻexoS::GFP-lacZ See Chapter 2 RP3335 PAO1F ǻpcrGV2 ǻexoS::GFP-lacZ See Chapter 2 RP5930 PAO1F DpcrG2 pcrV(F279R) ǻexoS::GFP-lacZ This study RP4990 PAO1F ǻexsE ǻfleQ ǻpcrG2 This study RP4564 PAO1F ǻexsE ǻpcrG2 This study RP5835 PAO1F ǻexsE ǻpcrG2 pcrD-2xVG This study RP5861 PAO1F ǻexsE ǻpcrGV2 pcrD-2xVG This study RP3034 PAO1F ǻpcr1 ǻfleQ This study RP3027 PAO1F ǻpcrV ǻfleQ This study
Plasmid Relevant features reference pPSV37 colE1 origin, gentR, PA origin, oriT, lacUV5 promoter, See lacIq, stops Chapter 2 in every reading frame preceding the MCS and T7 terminator following the MCS (relative to the lacUV5 promoter) pEXG2 Allelic exchange vector, colE1 origin, oriT, gentamycin reference[1 resistance,sacB 13] pACOCI35 Two-hybrid plasmid encoding a OCI DNA binding This study protein pBRDLN Two-hybrid plasmid encoding a D-subunit of RNA This study polymerase pMal pPSV37 encoding a signal-sequenceless malE gene See (codons 27- Chapter 2 396) lacking a stop codon followed by a polylinker to create MBP fusions pMal-pcrG plasmid encoding an MBP-PcrG fusion protein under See control of a lacUV5 promoter Chapter 2 pMal- plasmid encoding an MBP-PcrG(a.a. 21-95) fusion This study pcrG(21-95) protein under control of a lacUV5 promoter pMal- plasmid encoding an MBP-PcrG(a.a. 60-95) fusion This study pcrG(60-95) protein under control of a lacUV5 promoter pMal-pcrG(2- plasmid encoding an MBP-PcrG(a.a. 2-70) fusion This study 70) protein under control of a lacUV5 promoter pMal- plasmid encoding an MBP-PcrG('30-40;'60-70) fusion This study pcrG('30- protein under control of a lacUV5 promoter 40;'60-70)
137 pMal- plasmid encoding an MBP-PcrGP84C fusion protein This study pcrGP84C under control of a lacUV5 promoter pMal- plasmid encoding an MBP-PcrGP85C fusion protein This study pcrGP85C under control of a lacUV5 promoter pMal- plasmid encoding an MBP-PcrGP84C, R85E, R86E fusion This study pcrGP84C, R85E, protein under control of a lacUV5 promoter R86E pMal- plasmid encoding an MBP-PcrG('30-40;'60-70),P84C fusion This study pcrG('30-40;'60- protein under control of a lacUV5 promoter 70),P84C pMal- plasmid encoding an MBP-PcrG('30-40;'60-70),P84C,R85E,R86E This study pcrG('30-40;'60- fusion protein under control of a lacUV5 promoter 70), P84C,R85E,R86E pBRDLN- Two-hybrid plasmid encoding a D-PcrV fusion protein This study pcrV pBRDLN- Two-hybrid plasmid encoding a D-PscO fusion protein This study pscO pACOCI35- Two-hybrid plasmid encoding a OCI-PcrG fusion protein This study pcrG pACOCI35- Two-hybrid plasmid encoding a OCI-PcrG(a.a. 21-95) This study pcrG(21-95) fusion protein pACOCI35- Two-hybrid plasmid encoding a OCI-PcrG(a.a. 60-95) This study pcrG(60-95) fusion protein pACOCI35- Two-hybrid plasmid encoding a OCI-PcrG(a.a. 2-70) This study pcrG(2-70) fusion protein pACOCI35- Two-hybrid plasmid encoding a OCI-PcrG('30-40;'60- This study pcrG('30- 70)fusion protein 40;'60-70) pEXG2- allelic exchange vector designed to introduce the F279- See pcrV(F279R) >R Chapter 2 mutation into pcrV pEXG2- allelic exchange vector designed to delete pcrG and See ǻpcrGV2 pcrV starting Chapter 2 at codon 6 of pcrG and ending at codon 180 of pcrV pEXG2- allelic exchange vector which deletes exoS and inserts Reference ǻexoS::GFP- translationally coupled versions of GFP and lacZ in its [191] lacZ place pEXG2- allelic exchange vector designed to delete codons 6-88 See ǻpcrG2 of pcrG Chapter 2 pEXG2- allelic exchange vector designed to delete codons 44- See 'pcrV2 180 of pcrV Chapter 2 pEXG2- allelic exchange vector designed to replace the This study pcrD-2xVG chromosomal copy of pcrD tagged with 2 tandem repeats of the VSV-G tag at the C-terminus of PcrD
Primer name Sequence (5’ to 3’) description GfcI-5SsP AAAAAaatattGAACGAATACACCGAAGACACC primers to
138 CT make cIO- PcrG fusion GfcI-3Asc AAAAAggcgcgccTCAGATCAACAAGCCACGCA protein TCGGCGT AlpO-5Not ATATAgcggccgcaAGCCTGGCTCTGCTGTTGC Primers to GCGT make DLN- PscO fusion AlpO-3Bam TATATggatccTCAGCTTGAGCATGGCCAGGT protein VAlp-5Not AAAAAgcggccgcCGAAGTCAGAAACCTTAATG Primers to CCGCTCGCGA make DLN- VAlp-3Bam AAAAAggatccCGGCTGGTTCATGGATACCTC PcrV fusion TA protein pcrG21-5 AAAAAaatattGCGCGACAGCGAGGAACGCGG 5’ cIO two- C hybrid primer for pcrG(21- 95) pcrG60-5 AAAAAaatattGGAAGAGGAGCTGCTGGCCGA 5’ cIO two- A hybrid primer for pcrG(60- 95) pcrG2-70-3 AAAAAggcgcgccTCACATGCGCCGCAGTTCG 3’ cIO two- GCCA hybrid primer for pcrG(2-70) GM2-70-5 AAAAAggtaccAACGAATACACCGAAGACACC primers to CT make MBP- GM2-70-3 AAAAAaagcttTCACATGCGCCGCAGTTCGGC PcrG(2-70) CA fusion protein
pcrG3H AAAAAaagcttTTCCTCAGATCAACAAGCCACG 3’ primer to CA make MBP- PcrG fusion protein with GM2-70-5 GM21-5K AAAAAggtaccCGCGACAGCGAGGAACGCGG primer to C make MBP- PcrG(21-95) fusion protein with pcrG3H GM60-95-5 AAAAAggtaccGAAGAGGAGCTGCTGGCCGAA Primer to make MBP- PcrG(60-95) with pcrG3H MBP-pcrG2-5B AAAAAGGATCCAACGAATACACCGAAGACA 5’ primer to CCCT make MBP- PcrG cysteine mutants
PcrG-P84C3H AAAAAAAGCTTTCAGATCAACAAGCCACGCA 3’ primer to TCGGCGTCGGACGCCGACACCGGGTACCC make MBP- TGCTCGCCCT PcrG(P84C)
139 with MBP- pcrG2-5B PcrG-R85C3H AAAAAAAGCTTTCAGATCAACAAGCCACGCA 3’ primer to TCGGCGTCGGACGACACGGCCGGGTACCC make MBP- TGCTCGCCCT PcrG(P85C) with MBP- pcrG2-5B pcrG(PRR84CE AAAAAAAGCTTCAGATCAACAAGCCACGCAT PcrG (P84C, E)-3H CGGCGTCGGCTCTTCACACCGGGTACCCTG R85E, R86E) CTCGCCCT 3' primer
Gd30-40-5-2 CAGCAGCTCGCCGGCGTCCGCCAGGCGGC Deleting PcrG CGCGTTCCTCGCTG a.a. 30-40 (Internal primer for 5’ flank) Gd30-40-3-1 CAGCGAGGAACGCGGCCGCCTGGCGGACG Deleting PcrG CCGGCGAGCTGCTG a.a. 30-40 (Internal primer for 3’ flank) pcrGd60-70-5-2 CTGCGTCGGCTGGGAACTGCGGGCGGCTC Deleting PcrG GCGCCAGCTCTCG a.a. 60-70 (Internal primer for 5’ flank) pcrGd60-70-3-1 CGAGAGCTGGCGCGAGCCGCCCGCAGTTC Deleting PcrG CCAGCCGACGCAG a.a. 60-70 (Internal primer for 3’ flank) pcrDCVG2-5-2 CTCGATGTCCGTGTACACTTTTCCTAATCTA Primers to TTCATTTCAATATCTGTATACAACACGATCCT make 5’ flank GCCAAGCGGCTG for introducing pcrR-5-1 AAAAAgaattcAAGGACGTGGTGCAGCTCACC 2xVSV-G tag GAGT to the C- terminus of PcrD pcrDCVG2-3-1 ATGAATAGATTAGGAAAAGTGTACACGGACA Primers to TCGAGATGAACAGGTTGGGCAAATGAGCGC make 3’ flank CGATCCGCTGATTCCCTG for introducing pcrR3H AAAAAaagcttCGTTGCCGGAGCCTGTCAGGC 2xVSV-G tag ACGGT to the C- terminus of PcrD
140 Chapter 4
Isolation of PscF Mutants that De-regulate Effector Secretion
141 Summary
The needle is the extracelluar structure of the T3SS and the channel for secretion of substrates. In addition to the structural function, the needle is involved in control of effector secretion. Needle protein mutants have been identified in Yersinia spp. and Shigella flexneri that cause de-regulated effector secretion. The allosteric model proposes that the needle changes its conformation to regulate effector secretion. Isolation of the needle protein mutants interfering with effector secretion is important to understand the role of the needle in control of effector secretion. We used an antibiotic resistance reporter assay to isolate needle protein mutants that constitutively secrete effectors in P. aeruginosa. We found that the PscFQ83R and PscFQ79L, L82I, Q83H mutants constitutively secrete the effectors. Assembly of PcrV at the needle tip is required for the function of PscFQ83R. In contrast, PscFQ79L, L82I, Q83H secretes effectors in a PcrV-independent manner, and the de-regulated effector secretion may be due to the Q79L mutation. Interestingly, a PscFQ79H, Q83H mutant selectively blocks premature effector secretion resulting from deletion of the negative regulators of effector secretion. Consistent with the results in S. flexneri, our results show that the mutations at the C-terminus of PscF affect effector secretion. Further studies are required to demonstrate that the C-terminus of the needle protein mediates the conformational changes controlling effector secretion.
142 Introduction
The T3SS forms a needle-like structure protruding from the bacterial surface.
The needle is essential for the T3SS since it serves as a channel for secretion.
The needle consists of one protein, which polymerizes to form a hollow helix with inner diameter ~2-3 nm. Therefore, the substrates likely pass through the inner channel of the needle in unfolded or partially unfolded state[44].
Host cell contact activates effector secretion. When a bacterium contacts the host cell, the translocators, including the needle tip protein and the two pore- forming proteins, assemble a translocon complex. The translocon forms a pore in the host cell membrane and connects with the needle; therefore, a conduit is formed for delivery of the effectors. Assembly of the translocon may transduce the activation signal and induce a conformational change in the needle tip protein to activate effector secretion. The allosteric model proposes that the needle tip protein controls effector secretion by changing the conformation of the apparatus.
The activation signal from the host cells is transduced from the needle tip to the apparatus, and the needle is the path of signal transduction. Thus, the needle exists in two different conformations: effector secretion “on” and “off” [166-168].
The crystal structure of the needle protein, MxiH, in Shigella flexneri showed that MxiH forms two anti-parallel D-helices connected by a Pro-Ser-Asn-Pro turn.
The long C-terminal helix bends and creates a head portion and a tail portion.
The structural modeling suggests that the N-terminal D-helix of MxiH forms the backbone of the needle and the C-terminal D-helix coats the backbone of the
143 needle (Fig. 4-1B). The head portion of the C-terminal D-helix orients outward of the needle and the tail portion of the C-terminal D-helix makes several intermolecular contacts with other needle subunits. It has been proposed that activation of effector secretion may change the degree of bending of the C- terminal D-helix[89].
Point mutations that result in constitutive effector secretion have been isolated in MxiH and the Yersinia needle protein, YscF[166-168]. Some mutations, which are consistently found in the center region of YscF and MxiH, may activate effector secretion by interfering with assembly of the needle tip complex. In MxiH, the D73A mutation, which results in premature effector secretion, is located at the tail portion of the C-terminal helix. The D73A mutation may alter the intermolecular interaction between the tail portion and the head portion of an adjacent needle protein[89]. Furthermore, mutations that do not alter the needle length but severely disrupt the hemolysis and invasion abilities of S. flexneri are also located at the tail portion of MxiH[166]. These observations suggest that the needle proteins are not only a structural component but also involved in control of effector secretion. However, using electron microscopy could not detect the conformational difference of the helices between wild type needles and effector secretion “on” needles isolated from S. flexneri, suggesting that the conformational change of the needle might be subtle[188].
In this chapter, we tried to isolate needle protein mutants that constitutively secrete effectors in P. aeruginosa. We constructed pscF, the needle protein gene in the P. aeruginosa T3SS, mutant libraries and screened the mutant libraries
144 with a PexoS-tetracycline resistant gene (PexoS-tetR) reporter assay, which is similar to the PexoS-lacZ reporter assay. In the PexoS-tetR reporter assay, the exoS gene is replaced by the tetracycline resistance gene, whose expression is, therefore, controlled by the exoS promoter. Since activation of effector secretion is coupled with expression of the T3SS genes, we can easily isolate effector secretion “on” mutants by selecting tetracycline resistant clones on tetracycline plates. We isolated an effector secretion “on” mutant, which has a Q83R point mutation at the very C-terminus of PscF. The function of PscFQ83R requires assembly of PcrV at the needle tip. We also isolated a PscFQ79L, L82I, Q83H mutant which constitutively secretes effectors in a PcrV-independent manner. Moreover, a PscFQ79H, Q83H mutant selectively blocks premature effector secretion. These mutants affect effector secretion differently, suggesting that the C-terminus of e4PscF is important for control of effector secretion in the P. aeruginosa T3SS.
Materials and methods
Media and culture conditions
All E. coli strains were routinely grown at 37°C in LB medium containing 10g/l
NaCl. P. aeruginosa was grown at 37°C in a modified LB medium (LB-MC) containing 200mM NaCl, 0.5mM CaCl2 and 10mM MgCl2. Strains and plasmids used in this study are listed in Table 4-2.
PscF mutant libraries
145 Error-prone PCR mutagenesis was used to construct the randomly mutagenized full-length pscF library. pPSV35-pscF plasmid DNA was used as template and the pscF ORF was amplified by using M13forward primer, M13reverse primer,
Taq polymerase (Choice Taq Blue, Denville) and mutagenic dNTPs (10 mM dTTP, 10 mM dCTP, 1 mM dGTP, 1 mM dATP). PCR products were digested with EcoRI and HindIII and ligated into pPSV35 vector. The size of the randomly mutagenized pscF library was ~310,000 clones with 1.2% re-ligation rate. The site-specific mutagenized pscF library (pscFQ79*L82*Q83*) was constructed by using pscF5R primer and pscFQ79N, L82N, Q83N primer, which has random nucleotides introduced into the condons of Q79, L82 and Q83. Pfx50 DNA polymerase, which has 3’-5’ exonuclease activity (Invitrogen), and 2.5 mM dNTPs were used to amplify pscF ORF and pPSV35-pscF plasmid DNA was used as template. The amplified PCR products were digested with EcoRI and HindIII and ligated into pPSV35 vector. The pscFQ79*L82*Q83* library size was ~106,500 clones with 0.86% re-ligation rate.
Selection for effector secretion “on” pscF mutants
Plasmid DNA purified from the pscF mutant libraries were transformed into the P. aeruginosa strain, PAO1F 'pscF 'exoS::tetR, and the transformed bacteria were plated on LB agar plates containing tetracycline (10 g/l tryptone, 5 g/l yeast extract, 11.7 g/l NaCl, 10 mg/l MgCl2, 0.5 mM CaCl2, 15 g/l agar, 250 Pg/ml tetracycline). The tetracycline plates were incubated at 37°C overnight and tetracycline resistant clones were picked up and re-streak on new tetracycline plates to confirm the tetracycline resistant phenotype. The plasmid DNA of the
146 confirmed tetracycline resistant mutants were purified and re-transformed into the
P. aeruginosa strain, PAO1F 'pscF 'exoS::lacZ. Effector secretion was determined by the PexoS-lacZ reporter assay to confirm effector secretion “on” phenotype. The effector secretion “on” pscF mutant plasmids were then purified and sequenced.
PexoS-lacZ reporter assay
The PexoS-lacZ reporter assay was performed as described in the “Materials and
Methods” of Chapter 2.
Protein secretion assay
The protein secretion assay was used to determine secretion of ExoS and ExoT in the P. aeruginosa strain, PAO1F 'exsE 'fleQ 'pscF, expressing wild type
PscF and PscFLIH. The procedure of the protein secretion assay is described in
“Materials and Methods” of Chapter 3. ExoS and ExoT in the cell pellet and the supernatant samples were detected by Western blotting.
Results
Library screening for PscF mutants that constitutively secrete effectors
To isolate PscF mutants that constitutively secrete effectors, we used an error- prone PCR mutagenesis method to generate a full-length randomly mutagenized library and used primers with random nucleotides at specific sites to generate site-specific mutagenized libraries. The site-specific mutagenized libraries, which have random mutations at PscF codons D14, A17, A44, D45, N46, Y64, N65,
147 S68, T71 and R75, were based on the conserved amino acids and the mutants from YscF or MxiH (Fig. 4-1).
The plasmid libraries carrying mutant pscF were transformed into a PexoS-tetR
P. aeruginosa strain. No tetracycline resistant clone was isolated from the site- specific mutagenized libraries. Screening the full-length randomly mutagenized pscF library gave 17 tetracycline resistant clones (1,438,000 clones screened; the library size is 310,000) in the presence of Ca2+. The mutant pscF plasmids were isolated from the tetracycline resistant clones and re-transformed into a pscF null strain with PexoS-lacZ reporter to confirm constitutive effector secretion phenotype. All mutants displayed an effector secretion “on” phenotype. All 17 mutant PscF had the same mutation, glutamine 83 to arginine (Q83R).
PscFQ83R is a PcrV dependent “on” mutant
Construction of a pscFQ83R mutant with a different codon sequence confirmed that the Q83R mutation caused the partially de-regulated effector secretion phenotype (Fig. 4-2). The Q83 residue is located near the C-terminus of PscF and is conserved among PscF, YscF and MxiH (Fig. 4-1). Point mutations, which interfere with effector secretion and bacterial invasion, cluster in the C-terminal helix of MxiH but no mutation in the conserved Q83 residue, Q80 in MxiH, has been reported. To test if combining a pcrV null with pscFQ83R generates synergistic effect on activation of effector secretion, we transformed the plasmid carrying pscFQ83R into a pcrV deleted P. aeruginosa strain and determined
148 effector secretion by the PexoS-lacZ reporter assay. Interestingly, combining
PscFQ83R with pcrV deletion did not synergistically activate effector secretion but inhibited effector secretion in both the presence and absence of Ca2+ (Fig. 4-2).
The inhibitory phenotype was recapitulated in a pcrVF279R strain expressing pscFQ83R, suggesting that assembly of PcrV at the needle tip is required for activity of the PscFQ83R mutant.
PscFQ79L, L82I, Q83H is a PcrV independent “on” mutant
The structural modeling of MxiH suggests that the last five amino acids of
MxiH make direct contact with three surrounding MxiH monomers, and the point mutations interfering with effector secretion are located near the C-terminus of
MxiH[166, 168]. We constructed a site-specific mutagenized library which has random mutations introduced to Q79, L82, and Q83 residues of PscF and screened the library for more effector secretion “on” mutants using the PexoS-tetR selection. 20 tetracycline resistant clones were isolated, and the mutant plasmids were sequenced. As listed in Table 4-1, 10 different PscF mutants were identified, and 9 of these mutants had a substitution of glutamine to arginine at residue 83
(Q83R). Like the single Q83R mutant PscF, these mutants, which have the Q83R mutation and other mutations on Q79 and L82, all required PcrV for activity. In other words, Q83R is responsible for the de-regulated effector secretion phenotype, which requires PcrV assembled at the needle tip in order to secrete
149 effectors. However, the amino acid Q83 is not located in the putative PcrV interacting domain of PscF.
The PscFQ79L, L82I, Q83H mutant, PscFLIH, is the only mutant that constitutively secretes effectors but has a histidine, instead of arginine, substitution at a.a. 83.
The PscFLIH mutant constitutively secretes effectors in the presence and absence of PcrV, demonstrating that PscFLIH is not PcrV-dependent (Fig. 4-3A). Although effector secretion was constitutively activated, no synergistic or additive effect on effector secretion was observed in the pcrV null strain expressing PscFLIH.
Furthermore, removal of Ca2+ activated effector secretion to a similar level in both wild type PscF and PscFLIH strains with wild type pcrV on the chromosome.
However, the level of effector secretion activated by removal of Ca2+ was greatly reduced in the pcrV null strain expressing PscFLIH, suggesting that PscFLIH is less responsive to removal of Ca2+ if no PcrV is present at the needle tip. The phenotype was confirmed by the protein secretion assay (Fig. 4-3B). Therefore, in the PscFLIH mutant, assembly of PcrV is not required for effector secretion but facilitates optimal effector secretion triggered by removal of Ca2+.
PscFQ79H, Q83H blocks premature effector secretion
Since histidine and arginine are positively charged amino acids and single glutamine to arginine substitution at residue 83 results in de-regulated effector secretion, we introduced a Q83H single mutation into PscF to determine if a histidine at residue 83 also causes constitutive effector secretion as PscFQ83R
150 and PscFLIH. The PscFQ83H behaves like wild type PscF, suggesting that the
Q83H mutation alone is not sufficient to de-regulate effector secretion (data not shown). I further mutated the glutamines at residue 79 and 83 of PscF to histidines. The PscFQ79H, Q83H mutant still regulates effector secretion as wild type
PscF. However, when we tested if PscFQ79H, Q83H is PcrV-dependent, we found that de-regulated effector secretion resulting from pcrV deletion was abolished
(Fig. 4-4). We further tested if PscFQ79H, Q83H blocks de-regulated effector secretion in the pcrG null, pcrGV double null, and popN null strains. PscFQ79H,
Q83H blocked de-regulated effector secretion caused by deletions of all negative regulators. And, effector secretion activated by removal of Ca2+ was reduced in the negative regulator null strains expressing PscFQ79H, Q83H, particularly in the pcrGV double null stain and the popN null strain. Interestingly, removal of Ca2+ activated similar level of effector secretion in wild type PscF and PscFQ79H, Q83H if the negative regulators remained intact on the chromosome (Fig. 4-4). This result suggests that PscFQ79H, Q83H selectively blocks premature effector secretion caused by deletion of the negative regulators of effector secretion.
Discussion
Isolation of the PscF mutants altering control of effector secretion provides direct evidence that the structural component of the T3SS needle also participates in control of effector secretion. We found that the PscFQ83R and
PscFLIH mutants, which have mutations at the C-terminus of PscF, constitutively
151 secrete effectors. The effector secretion “on” mutant, MxiHD73A, also has a point mutation near the C-terminus of MxiH, suggesting that the C-terminus of needle proteins is involved in control of effector secretion[166]. Structural modeling of
MxiH suggests that the C-terminus, the tail portion, of MxiH directly makes contact with other needle proteins. Furthermore, the D73A mutation in the tail portion makes close contact with the head portion of another MxiH in the model[89]. Therefore, PscFQ83R and PscFLIH may affect the tail-head interaction between PscF monomers, which leads to de-regulated effector secretion.
However, the structural modeling also suggests that the tail portion of MxiH interacts with the N-terminal D-helix, the backbone of the needle, of the nearby
MxiH monomer[89]. Mutations at the tail portion may disrupt assembly of the needle and cause de-regulated effector secretion by creating a “leaky” needle. A leaky needle may have a dysfunction in assembly of the needle or the needle tip complex; therefore, effectors leak out from a loose needle or uncapped needle.
Indeed, deletion of the last five amino acids of MxiH abolishes assembly of the needle. Although effector secretion is constitutively activated, PscFQ83R requires assembly of PcrV at the needle tip in order to secrete the effectors, suggesting that PcrV at the needle tip may help the PscFQ83R to maintain a functional needle structure. Thus, the PscFQ83R mutant may be leaky or structurally unstable.
Unlike PscFQ83R, PscFLIH constitutively secretes effectors in a PcrV- independent manner, suggesting that PscFLIH forms a more stable needle. Since arginine and histidine are positive-charged amino acids, I constructed a PscFQ83H mutant to test if the de-regulated effector secretion is due to change of the
152 charge at residue 83. However, the PscFQ83H mutant acts as wild type PscF.
Therefore, the charge change at residue 83 is not the key factor that causes de- regulated effector secretion. De-regulated effector secretion may be due to steric-hindrance since the functional group of arginine is longer than the functional groups of glutamine and histidine. In addition, mutating the leucine at residue 82 to isoleucine does not alter effector secretion (data not shown). Thus, the Q79L mutation may be the key mutation responsible for the activation phenotype of PscFLIH. The Q79 may directly participate in a conformational change that is related to control of effector secretion.
To demonstrate that the needle changes its conformation, we could use the site-specific cysteine crosslinking method that we used previously to crosslink
PcrG and its interaction partner in the apparatus. Since there is no cysteine in wild type PscF and Q79 may participate in a conformational change of the needle, we can replace the amino acids near the residue 79 with cysteines and use bi- functional crosslinkers with different arm lengths to crosslink proximal inter- or intra-subunit amino acids. Then we can compare the crosslinking patterns between PscFLIH and wild type PscF or between triggered and un-triggered conditions. Furthermore, we may use mass spectrometry to detect which amino acids are crosslinked with the cysteine in PscF.
The mutations of glutamine to histidine at residue 79 and 83 of PscF, PscFQ79H,
Q83H, result in an interesting phenotype: blocked premature effector secretion caused by deletion of the negative regulators and reduced effector secretion triggered by removal of Ca2+. The mutations of Q79H and Q83H may elevate the
153 energy barrier or threshold that is required for activation of effector secretion.
However, the level of effector secretion activated by removal of Ca2+ is the same between wild type PscF and PscFQ79H, Q83H if the negative regulators are not deleted, suggesting the threshold for effector secretion is unaltered. An alternative explanation is that changing the substrate specificity by deleting the negative regulators of effector secretion may interfere with assembly of PscFQ79H,
Q83H. However, a pcrG or popN null strain is able to intoxicate host cells, suggesting that deletion of pcrG or popN does not interfere with assembly of wild type PscF. Further studies are required to understand how PscFQ79H, Q83H prevents premature effector secretion.
By using the PexoS-tetR selection assay, we isolated PscF mutants that constitutively secrete effectors. Our results show that the C-terminus of PscF is important for control of effector secretion in P. aeruginosa. The mutations at the
Q79 residue affect effector secretion differently, suggesting the Q79 residue is critical. However, more studies are required to demonstrate that activation of effector secretion induces a conformational change of the needle.
154 A)
B)
Figure4Ͳ1.Sequencesoftheneedleproteins.A)Sequencealignmentoftheneedle proteinsinP.aeruginosa(PscF),Y.pestis(YscF)andS.flexneri(MxiH).Thegreenbox marksthemutationsitesthatcauseconstitutiveeffectorsecretioninYscFandMxiH. Theyellowboxmarksthemutationsitesthatselectivelyblockeffectorsecretionbut allowtranslocatorsecretioninMxiH.Theredunderlinemarkstheaminoacidsthatwere mutagenizedinthePscFmutantlibraries.B)ThecrystalstructureofMxiHshowsthat MxiHformstwoantiͲparallelaͲhelices.TheNͲterminalhelixisthebackboneofthe needle(formstheinnertube)andtheCͲterminalhelix,forminganouterlayer,coatsthe innertube.
155
Figure4Ͳ2.PscFQ83RconstitutivelysecreteseffectorsinaPcrVͲdependentmanner.The plasmidscarryingwildtypepscFandpscFQ83Rweretransformedinto'pscF,'pscF'pcrV and'pscFpcrVF279Rstrains.ExpressionofpscFwasinducedwith10PMIPTG.Effector secretionwasdeterminedbythePexoSͲlacZreporterassay.
156
Table4Ͳ1.Theeffectorsecretion“on”mutantsisolatedformthePscFQ79*L82*Q83* library.Foldofinduction:therelativelevelofeffectorsecretioncomparedwithwild typePscFinpresenceofCa2+.PcrVdependence:thePscFmutantswereexpressedina 'pcrVstraintodetermineifthePscFmutantsneedPcrVtosecreteeffectors.Effector secretionwasdeterminedbythePexoSͲlacZreporterassay.
157
Figure4Ͳ3.PscFQ79L,L82I,Q83H(PscFLIH)constitutivelysecreteseffectorsindependentof PcrV.A)TheplasmidscarryingwildtypepscFandpscFLIHweretransformedinto'pscF and'pscF'pcrVP.aeruginosastrains.ExpressionofpscFwasinducedwith10PMIPTG. EffectorsecretionwasdeterminedbythePexoSͲlacZreporterassay.B)Theplasmids carryingwildtypepscFandpscFLIHweretransformedintoa'exsE'fleQ'pscFstrain anda'exsE'fleQ'pscF'pcrVstrain.ExpressionofPscFwasinducedby10PMIPTG. BacteriaweregrowntomidͲloginLBmediumandthenspundown.Thecellpelletswere resuspendedinLBmediumwithorwithoutEGTAandincubatedat37°Cfor30minutes. Thenthebacterialcultureswerespundown,andthesupernatantandpelletprotein sampleswerecollected.Theeffectors,ExoSandExoTinthesupernatantandpellet portionsweredetectedbyWesternblotting
158
Figure4Ͳ4.PscFQ79H,Q83Hblocksprematureeffectorsecretion.Theplasmidscarrying wildtypepscFandpscFQ79H,Q83HweretransformedintopscFnullP.aeruginosastrains withchromosomalgenedeletionofpcrV,pcrG,pcrGandpcrV,orpopN.Expressionof pscFwasinducedwith10PMIPTG.EffectorsecretionwasdeterminedbythePexoSͲlacZ reporterassay.
159 Table4Ͳ2.Strains,plasmids,primersusedinthisstudy
Strain # genotype reference RP1831 PAO1F, wild type P. aeruginosa PAO1 Reference [190] RP2377 PAO1F ǻpscF ǻexoS::GFP-lacZ This study RP4976 PAO1F ǻpscF ǻexoS::tetR This study RP5033 PAO1F ǻpscF ǻpcrV2 ǻexoS::GFP-lacZ This study RP4787 PAO1F ǻpscF ǻpcrG2 ǻexoS::GFP-lacZ This study RP3403 PAO1F ǻpscF ǻpcrGV2 ǻexoS::GFP-lacZ This study RP4790 PAO1F ǻpscF ǻpopN ǻexoS::GFP-lacZ This study RP3108 PAO1F ǻexsE ǻfleQ ǻpscF This study
Plasmid Relevant features reference pPSV35 Shuttle vector with gentamicin resistance gene Reference (aacC1), PA origin, lacIq, and the lacUV5 promoter and [113] MCS of pUC18 pEXG2 Allelic exchange vector, colE1 origin, oriT, gentamycin Reference resistance, [113] sacB pPSV35- pscF (wild type) under control of the lacUV5 promoter This study pscF in pPSV35 pPSV35- pscFQ83R under control of the lacUV5 promoter in This study pscFQ83R pPSV35 pPSV35- pscFLIH under control of the lacUV5 promoter in This study pscFLIH pPSV35 pPSV35- pscFQ79H,Q83H under control of the lacUV5 promoter in This study pscFQ79H,Q83H pPSV35 pEXG2- allelic exchange vector designed to delete ORF of pcrG This study ǻpscF pEXG2- allelic exchange vector designed to delete ORF of This study ǻpopN popN pEXG2- allelic exchange vector designed to delete codons 6-88 See ǻpcrG2 of pcrG Chapter 2 pEXG2- allelic exchange vector designed to introduce internal See ǻpcrV2 deletion in pcrV Chapter 2 pEXG2- allelic exchange vector designed to delete pcrG and See ǻpcrGV2 pcrV starting Chapter 2 at codon 6 of pcrG and ending at codon 180 of pcrV pEXG2- allelic exchange vector which deletes exoS and inserts This study ǻexoS::tetR tetracycline resistant gene in its place
Primer name Sequence description pscF5R AAAAAgaattcGGAGGACTAAGCATGGCG Primers for CAGATATTCA amplifying pscF pscF3H AAAAAaagcttTCAGATCTTCTGCAGGATG ORF and CCT inserting into pPSV35
160 pscF5-1 AAAAAgaattcGCGACGAACTGGAGTTCA Primers to CGATTCGCT make 5’ flank for deleting pscF5-2 AACTCGAGCCGCAAGCATGCTGAACTG pscF gene CGCCATGCTTAGTCCTCTGT pscF3-1 TTCAGCATGCTTGCGGCTCGAGTTCTG Primers to CAGAAGATCTGAACATGGACA make 3’ flank for deleting pscF3-2 AAAAAaagcttCGCCTTTGGACTGGCCGA pscF gene CGGATAGA popNn5-1 AAAAAgaattcGCGAGCAGCGCCAGGCTC Primers to TGGTCGGGAT make 5’ flank popN5-2 AACTCGAGCCGCAAGCATGCTGAAGTC for deleting CATCGTGGCTGTGGTTCCTGGTC popN gene popNn3-1 TTCAGCATGCTTGCGGCTCGAGTTCTCT Primers to GGCAGGTGCTGGTGACAGGGGA make 3’ flank popNn3-2 AAAAAaagcttGGTGCCGCTGTCCTCGAA for deleting ATCCAGTT popN gene pscF-Q83R AAAAAAAGCTTTCAGATCTTGCGCAGGA 3’ primer to TGCCTTGCATCAGGT make pscF(Q83R) with pscF5R pscFQ79NL82NQ8 AAAAAAAGCTTTCAGATCTTNNNNNNG 3’ primer to 3N ATGCCNNNCATCAGGTCGCGCAGCGC make ACGGGT pscFQ79*L82* Q83* library with pscF5R M13for CCCAGTCACGACGTTGTAAAACG Primers to amplify pscF M13rev AGCGGATAACAATTTCACACAGG ORF from pPSV35 to make pscF full length mutant library pscF(LIH) AAAAAAAGCTTTCAGATCTTATGTATGAT Primer to make GCCGAGCATCAGGT pscF(Q79L, L82I, Q83H) with pscF5R pscF(Q79H,Q83H AAAAAAAGCTTTCAGATCTTATGCAGGA Primer to make TGCCGTGCATCAGGT pscF(Q79H, Q83H) tet5R2 AAAAAGAATTCACGCAGTCAGGCACCG Primers to TGTATGAAATCTAACAATGCGCTCATCG insert tetR gene TC into the linker tet3Age AAAAAACCGGTTCAGGTCGAGGTGGCC region in 'exoS CGGCTCC locus
161 Chapter 5
Future Studies
162 The T3SS secretes effectors upon receiving the activation signal. However, the mechanism of effector secretion control is unclear. The needle tip protein and the chaperone of the needle tip protein are negative regulators of effector secretion. In my thesis, I studied how the needle tip protein, PcrV, and its chaperone, PcrG, regulate effector secretion in P. aeruginosa.
My data demonstrate that proper assembly of PcrV at the needle tip is required for control of effector secretion but the PcrG/PcrV interaction is not necessary for the regulatory function of PcrV or PcrG. I also showed that PcrG regulates effector secretion by interacting with the apparatus component, PcrD, and PcrG interacts with PscO, which may be responsible for control of secretion activity. My findings support the allosteric model that PcrV and PcrG regulate effector secretion by inducing the conformational changes of the apparatus. In addition, I isolated PscF, the needle protein, mutants that constitutively secrete effectors. These needle mutants suggest that the needle can be locked in effector secretion “on” conformation.
Based on my research, I propose three models to describe how PcrG regulates effector secretion: a multiple binding sites model, a PcrG dimer model and a secretion activity/specificity model. I will determine which one is the model of PcrG function. In addition to the needle mutants that are locked in effector secretion “on” conformation, I will isolate the needle mutants that selectively block effector secretion to demonstrate the needle can be locked in effector secretion “off” conformation. These needle mutants will provide more structural information about how effector secretion is controlled by the conformational
163 changes of the apparatus. Since PcrG regulates effector secretion by interacting with PcrD and the homolog of PcrD in the flagellum is involved in export of flagellar substrates, I will also determine the role of PcrD in secretion substrate recognition in the P. aeruginosa T3SS.
The model of PcrG function
We found that the C-terminus of PcrG controls effector secretion by interacting with the apparatus component, PcrD. The C-terminus of PcrG also makes an additional contact, which is essential for the regulatory activity of PcrG, with an unidentified protein. The C-terminus of PcrG persistently interacts with an unidentified protein in both effector secretion “on” and “off” states. I propose the multiple binding model and the PcrG dimer model to describe how PcrG regulates effector secretion. The multiple binding model proposes that the unidentified protein is an apparatus component. The PcrG dimer model proposes that PcrG forms a dimer, or multimer, to regulate effector secretion and the C- terminus of PcrG is the dimerizing domain. We can determine if PcrG interacts with itself by using bacterial two-hybrid analysis. If PcrG interacts with itself, I can try to isolate PcrG mutants that do not form a dimer and test if PcrG needs to form a dimer to regulate effector secretion. If PcrG does not interact with itself, then the multiple binding model will be favored.
We have shown that deletion of the last 25 a.a. of PcrG totally abolishes the regulatory activity of PcrG. Therefore, the residues responsible for the essential
164 interaction with the unidentified apparatus component are located in the last 25 amino acids. We can use the same approach that we used to discover the
PcrG/PcrD interaction and introduce more cysteines to different sites of the C- terminus of PcrG to crosslink PcrG and the unidentified apparatus component.
Because LcrG and PcrG mutually complement each other, we can mutate the conserved residues in the C-terminus of PcrG and identify mutants that fully lose the regulatory activity. We will then test if these mutants are dominant negative. If a mutant is dominant negative, it suggests that the mutation disrupts the
PcrG/PcrD interaction but not the interaction between PcrG and the unidentified apparatus component. If a mutant is not dominant negative and loses the regulatory activity, it suggests that the mutated amino acid is responsible for the essential interaction.
An alternative model that does not propose an additional interaction with the apparatus or PcrG itself is that the putative PcrG/PscO interaction controls secretion activity and the PcrG/PcrD interaction controls substrate specificity. To test this model, I will try to demonstrate the PcrG/PscO interaction in P. aeruginosa by the MBP pull-down assay. The PcrG/PscO interaction may be transient or weak; therefore, I might need to introduce cysteines in the putative
PscO interacting domain and use crosslinkers to crosslink the PcrG/PscO complex. If PcrG interacts with PscO, I will try to isolate non-PcrG interacting
PscO mutants and confirm that loss of the PcrG/PscO interaction results in up- regulation of secretion activity. If PscO cannot be co-purified with PcrG, which suggests that the PscO/PcrG interaction in the E. coli two-hybrid system is an
165 artifact, I will perform the crosslinking/pull-down experiment and use mass spectrometry to identify which T3SS component is crosslinked to the cysteines in the a.a. 30-40 and a.a. 60-70 region of PcrG. Then I will try to demonstrate the interaction between PcrG and the unidentified protein is responsible for controlling secretion activity. Furthermore, this model proposes that the C- terminus of PcrG('30-40; '60-70) still interacts with PcrD in a pcrV null strain. I will determine if the C-terminus of PcrG('30-40; '60-70) still interacts with PcrD in a pcrV null strain by the MBP pull-down assay.
Isolation of needle mutants that selectively block effector secretion
By using the PexoS-tetR selection method, we can isolate PscF mutants that constitutively secrete effectors, suggesting that these PscF mutants are locked in the effector secretion “on” state. However, the de-regulated effector secretion phenotype might be due to the effectors leaking from an unstable mutant needle or the mutations in the needle affecting assembly of PcrV at the needle tip. A needle mutant that blocks effector secretion but still allows translocator secretion avoids these arguments and shows that the needle can be locked into an effector secretion “off” state. Furthermore, comparing the effector secretion “on” and “off” needle mutants will provide more information about the conformational changes in the needle.
The biggest challenge for isolation of the effector secretion “off” pscF mutants is to distinguish the pscF mutants that selectively block effector secretion from
166 pscF null mutants. We could use the PexoS-lacZ reporter assay to isolate mutants that do not secrete effectors, but determining if the isolated mutants secrete the translocators by the secretion assay and Western blotting is laborious and inefficient. Therefore, we need a reporter system that allows us to detect translocator secretion more efficiently. The PexoS-lacZ reporter assay or the PexoS- tetR selection assay used to monitor effector secretion is based on the fact that
ExsE, the negative regulator of T3SS gene expression, is secreted as an effector.
I tried to couple translocator secretion with expression of a reporter gene in order to build a reporter assay to monitor translocator secretion. Like ExsE, FlgM is secreted by the flagellum and a negative regulator of flagellar class III gene expression. Secretion of FlgM activates expression of the class III genes[115,
116]. We fused FlgM to the C-terminus of PcrV and replaced the class III gene, fliC, with a tetracycline resistance gene. Therefore, the PcrV-FlgM fusion protein is secreted by the T3SS as a translocator and expression of the tetracycline resistance gene is controlled by the promoter of fliC. We also deleted fliF, the flagellar MS ring component, to prevent non-specific secretion of PcrV-FlgM through the flagellum. The genotype of this reporter strain is pcrV-flgM 'fliC::tetR
'fliF. Combining the PexoS-lacZ reporter system in this strain to make a dual- reporter strain, pcrV-flgM 'fliC::tetR 'fliF 'exoS::lacZ was inefficient. The mutant we are selecting for is an effector secretion “off” mutant. In other words, ExsE is not secreted by the mutant. Therefore, there is only a small number of apparatuses and a low level of PcrV-FlgM being secreted, which leads to low tetracycline resistance. Therefore, the dual-reporter strain is not optimal for
167 selecting the effector secretion “off” mutant. To enhance secretion of PcrV-FlgM,
I constructed a 'exsE pcrV-flgM 'fliC::tetR 'fliF strain. The 'exsE pcrV-flgM
'fliC::tetR 'fliF strain exhibits high tetracycline resistance in a type III secretion dependent manner (data not shown).
I will use the 'exsE pcrV-flgM 'fliC::tetR 'fliF strain and the PexoS-lacZ reporter strain to isolate effector secretion “off” PscF mutants. We will first select tetracycline resistant clones, which represent a population where functional PscF needles are assembled and capable of secreting translocators. I will then purify the plasmids and re-transform them into the PexoS-lacZ reporter strain. The effector secretion “off” mutants will form white colonies on the X-gal plates with
EGTA, indicating that effector secretion is not triggered by removal of Ca2+ in the
PscF mutants.
The role of PcrD in substrate secretion
PcrD is the largest protein in the P. aeruginosa T3SS. PcrD is anchored in the inner membrane by the transmembrane domain at the N-terminus and the C- terminus of PcrD is the cytoplasmic domain. The flagellar homolog of PcrD is
FlhA. The interaction between FlhA and the flagellar substrates has been demonstrated by affinity blotting[105]. Furthermore, truncations at the C-terminus of FlhA result in premature late substrate secretion[200]. These results suggest that FlhA acts as a platform for substrate secretion and participates in control of
168 substrate secretion. In the P. aeruginosa T3SS, PcrD may have similar functions as FlhA.
MBP-PcrG, PcrD and an unknown protein form a ~160 kD complex. We also found a ~10 kD unknown protein that can be crosslinked to PcrD. We can use the same pull-down assays to purify these PcrD protein complexes and identify the unknown proteins by mass spectrometry. Since we have antibodies for detecting the translocators and effectors, we will determine if T3SS substrates are co-precipitated with PcrD by the immunoprecipitation assay to demonstrate if
PcrD interacts with the T3SS substrates in P. aeruginosa.
The cytoplasmic domain of PcrD is ~400 a.a., and the crystal structures of
FlhA and InvA, the PcrD homolog in the Salmonella T3SS, show that the cytoplasmic domain consists of a less structured N-terminal linker and four well- structured subdomains[192-194]. To test if PcrD controls effector secretion, we can introduce small deletions into the cytoplasmic domain of PcrD. The last 100 a.a. of PcrD are a good candidate since FlhA C-terminal truncations, whose ~last
100 a.a. are truncated, causes premature late substrate secretion[200].
I will also determine if the PopN complex interacts with PcrD. We have constructed functional VSV-G tagged Pcr1, Pcr2 and PscB strains. I will try to use a different tag, for example Myc tag, to label Pcr1, Pcr2 and PscB and express these myc-tagged proteins in the VSV-G tagged PcrD strain. Then I will perform the immunoprecipitation assay to determine if PcrD interacts with Pcr1,
Pcr2 and PscB. Since we have the antibody that recognizes PopN, I can detect
169 PopN without labeling PopN. If PcrD does not interact with the PopN complex, I will try to identify which apparatus component interacts with the PopN complex.
We have constructed a set of P. aeruginosa strains in where individual apparatus components are tagged with VSV-G. Therefore, I can use the immunoprecipitation assay to identify the interaction partner of the PopN complex in the apparatus.
170 Bibliography
1. Joanne M. Willey LMS, Christopher J. Woolverton: Prescott, Harley, and
Klein's Microbiology. NY: McGraw-Hill; 2008.
2. Bodey GP: Pseudomonas aeruginosa infections in cancer patients:
have they gone away? Curr Opin Infect Dis 2001, 14(4):403-407.
3. Branski LK, Al-Mousawi A, Rivero H, Jeschke MG, Sanford AP, Herndon
DN: Emerging infections in burns. Surg Infect (Larchmt) 2009,
10(5):389-397.
4. Lyczak JB, Cannon CL, Pier GB: Lung infections associated with
cystic fibrosis. Clin Microbiol Rev 2002, 15(2):194-222.
5. Sorvillo F, Beall G, Turner PA, Beer VL, Kovacs AA, Kerndt PR:
Incidence and determinants of Pseudomonas aeruginosa infection
among persons with HIV: association with hospital exposure. Am J
Infect Control 2001, 29(2):79-84.
6. Williams BJ, Dehnbostel J, Blackwell TS: Pseudomonas aeruginosa:
host defence in lung diseases. Respirology 2010, 15(7):1037-1056.
7. Chastre J, Fagon JY: Ventilator-associated pneumonia. Am J Respir
Crit Care Med 2002, 165(7):867-903.
8. Mittal R, Aggarwal S, Sharma S, Chhibber S, Harjai K: Urinary tract
infections caused by Pseudomonas aeruginosa: a minireview. J
Infect Public Health 2009, 2(3):101-111.
9. van Asperen IA, de Rover CM, Schijven JF, Oetomo SB, Schellekens JF,
van Leeuwen NJ, Colle C, Havelaar AH, Kromhout D, Sprenger MW: Risk
171 of otitis externa after swimming in recreational fresh water lakes
containing Pseudomonas aeruginosa. BMJ 1995, 311(7017):1407-
1410.
10. Seyfried PL, Fraser DJ: Pseudomonas aeruginosa in swimming pools
related to the incidence of otitis externa infection. Health Lab Sci 1978,
15(1):50-57.
11. Green M, Apel A, Stapleton F: Risk factors and causative organisms in
microbial keratitis. Cornea 2008, 27(1):22-27.
12. Schornack MM, Faia LJ, Griepentrog GJ: Pseudomonas keratitis
associated with daily wear of silicone hydrogel contact lenses. Eye
Contact Lens 2008, 34(2):124-128.
13. Chandrasekar PH, Rolston KV, Kannangara DW, LeFrock JL, Binnick SA:
Hot tub-associated dermatitis due to Pseudomonas aeruginosa.
Case report and review of the literature. Arch Dermatol 1984,
120(10):1337-1340.
14. Jacobson JA: Pool-associated Pseudomonas aeruginosa dermatitis
and other bathing-associated infections. Infect Control 1985,
6(10):398-401.
15. Hancock RE: Resistance mechanisms in Pseudomonas aeruginosa
and other nonfermentative gram-negative bacteria. Clin Infect Dis
1998, 27 Suppl 1:S93-99.
172 16. Hancock RE, Speert DP: Antibiotic resistance in Pseudomonas
aeruginosa: mechanisms and impact on treatment. Drug Resist Updat
2000, 3(4):247-255.
17. Nordmann P, Naas T, Fortineau N, Poirel L: Superbugs in the coming
new decade; multidrug resistance and prospects for treatment of
Staphylococcus aureus, Enterococcus spp. and Pseudomonas
aeruginosa in 2010. Curr Opin Microbiol 2007, 10(5):436-440.
18. National Nosocomial Infections Surveillance (NNIS) System Report,
data summary from January 1992 through June 2004, issued October
2004. Am J Infect Control 2004, 32(8):470-485.
19. Biedenbach DJ, Moet GJ, Jones RN: Occurrence and antimicrobial
resistance pattern comparisons among bloodstream infection
isolates from the SENTRY Antimicrobial Surveillance Program (1997-
2002). Diagn Microbiol Infect Dis 2004, 50(1):59-69.
20. Hauser AR, Cobb E, Bodi M, Mariscal D, Valles J, Engel JN, Rello J: Type
III protein secretion is associated with poor clinical outcomes in
patients with ventilator-associated pneumonia caused by
Pseudomonas aeruginosa. Crit Care Med 2002, 30(3):521-528.
21. Roy-Burman A, Savel RH, Racine S, Swanson BL, Revadigar NS,
Fujimoto J, Sawa T, Frank DW, Wiener-Kronish JP: Type III protein
secretion is associated with death in lower respiratory and systemic
Pseudomonas aeruginosa infections. J Infect Dis 2001, 183(12):1767-
1774.
173 22. El Solh AA, Akinnusi ME, Wiener-Kronish JP, Lynch SV, Pineda LA,
Szarpa K: Persistent infection with Pseudomonas aeruginosa in
ventilator-associated pneumonia. Am J Respir Crit Care Med 2008,
178(5):513-519.
23. Vance RE, Rietsch A, Mekalanos JJ: Role of the type III secreted
exoenzymes S, T, and Y in systemic spread of Pseudomonas
aeruginosa PAO1 in vivo. Infect Immun 2005, 73(3):1706-1713.
24. Holder IA, Neely AN, Frank DW: Type III secretion/intoxication system
important in virulence of Pseudomonas aeruginosa infections in
burns. Burns 2001, 27(2):129-130.
25. Pankhaniya RR, Tamura M, Allmond LR, Moriyama K, Ajayi T, Wiener-
Kronish JP, Sawa T: Pseudomonas aeruginosa causes acute lung
injury via the catalytic activity of the patatin-like phospholipase
domain of ExoU. Crit Care Med 2004, 32(11):2293-2299.
26. Hayes CS, Aoki SK, Low DA: Bacterial contact-dependent delivery
systems. Annu Rev Genet 2010, 44:71-90.
27. Coulthurst SJ, Palmer T: A new way out: protein localization on the
bacterial cell surface via Tat and a novel Type II secretion system.
Mol Microbiol 2008, 69(6):1331-1335.
28. Johnson TL, Abendroth J, Hol WG, Sandkvist M: Type II secretion: from
structure to function. FEMS Microbiol Lett 2006, 255(2):175-186.
174 29. Henderson IR, Navarro-Garcia F, Desvaux M, Fernandez RC, Ala'Aldeen
D: Type V protein secretion pathway: the autotransporter story.
Microbiol Mol Biol Rev 2004, 68(4):692-744.
30. Bleves S, Viarre V, Salacha R, Michel GP, Filloux A, Voulhoux R: Protein
secretion systems in Pseudomonas aeruginosa: A wealth of
pathogenic weapons. Int J Med Microbiol 2010, 300(8):534-543.
31. Delepelaire P: Type I secretion in gram-negative bacteria. Biochim
Biophys Acta 2004, 1694(1-3):149-161.
32. Alvarez-Martinez CE, Christie PJ: Biological diversity of prokaryotic
type IV secretion systems. Microbiol Mol Biol Rev 2009, 73(4):775-808.
33. Backert S, Selbach M: Role of type IV secretion in Helicobacter pylori
pathogenesis. Cell Microbiol 2008, 10(8):1573-1581.
34. Cascales E: The type VI secretion toolkit. EMBO Rep 2008, 9(8):735-
741.
35. Ma AT, Mekalanos JJ: In vivo actin cross-linking induced by Vibrio
cholerae type VI secretion system is associated with intestinal
inflammation. Proc Natl Acad Sci U S A 2010, 107(9):4365-4370.
36. Schwarz S, West TE, Boyer F, Chiang WC, Carl MA, Hood RD, Rohmer L,
Tolker-Nielsen T, Skerrett SJ, Mougous JD: Burkholderia type VI
secretion systems have distinct roles in eukaryotic and bacterial cell
interactions. PLoS Pathog 2010, 6(8).
37. Hood RD, Singh P, Hsu F, Guvener T, Carl MA, Trinidad RR, Silverman
JM, Ohlson BB, Hicks KG, Plemel RL et al: A type VI secretion system
175 of Pseudomonas aeruginosa targets a toxin to bacteria. Cell Host
Microbe 2010, 7(1):25-37.
38. Mougous JD, Cuff ME, Raunser S, Shen A, Zhou M, Gifford CA,
Goodman AL, Joachimiak G, Ordonez CL, Lory S et al: A virulence locus
of Pseudomonas aeruginosa encodes a protein secretion apparatus.
Science 2006, 312(5779):1526-1530.
39. Hachani A, Lossi NS, Hamilton A, Jones C, Bleves S, Albesa-Jove D,
Filloux A: Type VI secretion system in Pseudomonas Aeruginosa:
secretion and multimerization of VgrG proteins. J Biol Chem 2011.
40. Pukatzki S, Ma AT, Revel AT, Sturtevant D, Mekalanos JJ: Type VI
secretion system translocates a phage tail spike-like protein into
target cells where it cross-links actin. Proc Natl Acad Sci U S A 2007,
104(39):15508-15513.
41. Pukatzki S, McAuley SB, Miyata ST: The type VI secretion system:
translocation of effectors and effector-domains. Curr Opin Microbiol
2009, 12(1):11-17.
42. Cornelis GR: The type III secretion injectisome. Nat Rev Microbiol 2006,
4(11):811-825.
43. Kubori T, Matsushima Y, Nakamura D, Uralil J, Lara-Tejero M, Sukhan A,
Galan JE, Aizawa SI: Supramolecular structure of the Salmonella
typhimurium type III protein secretion system. Science 1998,
280(5363):602-605.
176 44. Blocker A, Jouihri N, Larquet E, Gounon P, Ebel F, Parsot C, Sansonetti P,
Allaoui A: Structure and composition of the Shigella flexneri "needle
complex", a part of its type III secreton. Mol Microbiol 2001, 39(3):652-
663.
45. Hueck CJ: Type III protein secretion systems in bacterial pathogens
of animals and plants. Microbiol Mol Biol Rev 1998, 62(2):379-433.
46. Troisfontaines P, Cornelis GR: Type III secretion: more systems than
you think. Physiology (Bethesda) 2005, 20:326-339.
47. Gophna U, Ron EZ, Graur D: Bacterial type III secretion systems are
ancient and evolved by multiple horizontal-transfer events. Gene
2003, 312:151-163.
48. Kaniga K, Trollinger D, Galan JE: Identification of two targets of the
type III protein secretion system encoded by the inv and spa loci of
Salmonella typhimurium that have homology to the Shigella IpaD and
IpaA proteins. J Bacteriol 1995, 177(24):7078-7085.
49. Hauser AR: The type III secretion system of Pseudomonas
aeruginosa: infection by injection. Nat Rev Microbiol 2009, 7(9):654-
665.
50. Feltman H, Schulert G, Khan S, Jain M, Peterson L, Hauser AR:
Prevalence of type III secretion genes in clinical and environmental
isolates of Pseudomonas aeruginosa. Microbiology 2001, 147(Pt
10):2659-2669.
177 51. Barbieri JT, Sun J: Pseudomonas aeruginosa ExoS and ExoT. Rev
Physiol Biochem Pharmacol 2004, 152:79-92.
52. Pederson KJ, Vallis AJ, Aktories K, Frank DW, Barbieri JT: The amino-
terminal domain of Pseudomonas aeruginosa ExoS disrupts actin
filaments via small-molecular-weight GTP-binding proteins. Mol
Microbiol 1999, 32(2):393-401.
53. Henriksson ML, Sundin C, Jansson AL, Forsberg A, Palmer RH, Hallberg
B: Exoenzyme S shows selective ADP-ribosylation and GTPase-
activating protein (GAP) activities towards small GTPases in vivo.
Biochem J 2002, 367(Pt 3):617-628.
54. Goehring UM, Schmidt G, Pederson KJ, Aktories K, Barbieri JT: The N-
terminal domain of Pseudomonas aeruginosa exoenzyme S is a
GTPase-activating protein for Rho GTPases. J Biol Chem 1999,
274(51):36369-36372.
55. Kazmierczak BI, Engel JN: Pseudomonas aeruginosa ExoT acts in
vivo as a GTPase-activating protein for RhoA, Rac1, and Cdc42.
Infect Immun 2002, 70(4):2198-2205.
56. Krall R, Schmidt G, Aktories K, Barbieri JT: Pseudomonas aeruginosa
ExoT is a Rho GTPase-activating protein. Infect Immun 2000,
68(10):6066-6068.
57. Vincent TS, Fraylick JE, McGuffie EM, Olson JC: ADP-ribosylation of
oncogenic Ras proteins by pseudomonas aeruginosa exoenzyme S
in vivo. Mol Microbiol 1999, 32(5):1054-1064.
178 58. McGuffie EM, Frank DW, Vincent TS, Olson JC: Modification of Ras in
eukaryotic cells by Pseudomonas aeruginosa exoenzyme S. Infect
Immun 1998, 66(6):2607-2613.
59. Soong G, Parker D, Magargee M, Prince AS: The type III toxins of
Pseudomonas aeruginosa disrupt epithelial barrier function. J
Bacteriol 2008, 190(8):2814-2821.
60. Maresso AW, Deng Q, Pereckas MS, Wakim BT, Barbieri JT:
Pseudomonas aeruginosa ExoS ADP-ribosyltransferase inhibits ERM
phosphorylation. Cell Microbiol 2007, 9(1):97-105.
61. Maresso AW, Baldwin MR, Barbieri JT: Ezrin/radixin/moesin proteins
are high affinity targets for ADP-ribosylation by Pseudomonas
aeruginosa ExoS. J Biol Chem 2004, 279(37):38402-38408.
62. Sun J, Barbieri JT: Pseudomonas aeruginosa ExoT ADP-ribosylates
CT10 regulator of kinase (Crk) proteins. J Biol Chem 2003,
278(35):32794-32800.
63. Henriksson ML, Troller U, Hallberg B: 14-3-3 proteins are required for
the inhibition of Ras by exoenzyme S. Biochem J 2000, 349 Pt 3:697-
701.
64. Henriksson ML, Francis MS, Peden A, Aili M, Stefansson K, Palmer R,
Aitken A, Hallberg B: A nonphosphorylated 14-3-3 binding motif on
exoenzyme S that is functional in vivo. Eur J Biochem 2002,
269(20):4921-4929.
179 65. Hallberg B: Exoenzyme S binds its cofactor 14-3-3 through a non-
phosphorylated motif. Biochem Soc Trans 2002, 30(4):401-405.
66. Pederson KJ, Krall R, Riese MJ, Barbieri JT: Intracellular localization
modulates targeting of ExoS, a type III cytotoxin, to eukaryotic
signalling proteins. Mol Microbiol 2002, 46(5):1381-1390.
67. Pederson KJ, Pal S, Vallis AJ, Frank DW, Barbieri JT: Intracellular
localization and processing of Pseudomonas aeruginosa ExoS in
eukaryotic cells. Mol Microbiol 2000, 37(2):287-299.
68. Phillips RM, Six DA, Dennis EA, Ghosh P: In vivo phospholipase
activity of the Pseudomonas aeruginosa cytotoxin ExoU and
protection of mammalian cells with phospholipase A2 inhibitors. J
Biol Chem 2003, 278(42):41326-41332.
69. Sato H, Frank DW, Hillard CJ, Feix JB, Pankhaniya RR, Moriyama K,
Finck-Barbancon V, Buchaklian A, Lei M, Long RM et al: The mechanism
of action of the Pseudomonas aeruginosa-encoded type III cytotoxin,
ExoU. Embo J 2003, 22(12):2959-2969.
70. Sato H, Feix JB, Frank DW: Identification of superoxide dismutase as
a cofactor for the pseudomonas type III toxin, ExoU. Biochemistry
2006, 45(34):10368-10375.
71. Rabin SD, Veesenmeyer JL, Bieging KT, Hauser AR: A C-terminal
domain targets the Pseudomonas aeruginosa cytotoxin ExoU to the
plasma membrane of host cells. Infect Immun 2006, 74(5):2552-2561.
180 72. Rabin SD, Hauser AR: Functional regions of the Pseudomonas
aeruginosa cytotoxin ExoU. Infect Immun 2005, 73(1):573-582.
73. Yahr TL, Vallis AJ, Hancock MK, Barbieri JT, Frank DW: ExoY, an
adenylate cyclase secreted by the Pseudomonas aeruginosa type III
system. Proc Natl Acad Sci U S A 1998, 95(23):13899-13904.
74. Vallis AJ, Finck-Barbancon V, Yahr TL, Frank DW: Biological effects of
Pseudomonas aeruginosa type III-secreted proteins on CHO cells.
Infect Immun 1999, 67(4):2040-2044.
75. Mattei PJ, Faudry E, Job V, Izore T, Attree I, Dessen A: Membrane
targeting and pore formation by the type III secretion system
translocon. Febs J 2011, 278(3):414-426.
76. Cisz M, Lee PC, Rietsch A: ExoS controls the cell contact-mediated
switch to effector secretion in Pseudomonas aeruginosa. J Bacteriol
2008, 190(8):2726-2738.
77. Goure J, Pastor A, Faudry E, Chabert J, Dessen A, Attree I: The V
antigen of Pseudomonas aeruginosa is required for assembly of the
functional PopB/PopD translocation pore in host cell membranes.
Infect Immun 2004, 72(8):4741-4750.
78. Mueller CA, Broz P, Cornelis GR: The type III secretion system tip
complex and translocon. Mol Microbiol 2008, 68(5):1085-1095.
79. Frithz-Lindsten E, Holmstrom A, Jacobsson L, Soltani M, Olsson J,
Rosqvist R, Forsberg A: Functional conservation of the effector
protein translocators PopB/YopB and PopD/YopD of Pseudomonas
181 aeruginosa and Yersinia pseudotuberculosis. Mol Microbiol 1998,
29(5):1155-1165.
80. Schoehn G, Di Guilmi AM, Lemaire D, Attree I, Weissenhorn W, Dessen A:
Oligomerization of type III secretion proteins PopB and PopD
precedes pore formation in Pseudomonas. Embo J 2003, 22(19):4957-
4967.
81. Dacheux D, Goure J, Chabert J, Usson Y, Attree I: Pore-forming activity
of type III system-secreted proteins leads to oncosis of
Pseudomonas aeruginosa-infected macrophages. Mol Microbiol 2001,
40(1):76-85.
82. Derewenda U, Mateja A, Devedjiev Y, Routzahn KM, Evdokimov AG,
Derewenda ZS, Waugh DS: The structure of Yersinia pestis V-antigen,
an essential virulence factor and mediator of immunity against
plague. Structure 2004, 12(2):301-306.
83. Gebus C, Faudry E, Bohn YS, Elsen S, Attree I: Oligomerization of PcrV
and LcrV, protective antigens of Pseudomonas aeruginosa and
Yersinia pestis. J Biol Chem 2008, 283(35):23940-23949.
84. Broz P, Mueller CA, Muller SA, Philippsen A, Sorg I, Engel A, Cornelis GR:
Function and molecular architecture of the Yersinia injectisome tip
complex. Mol Microbiol 2007, 65(5):1311-1320.
85. Tamano K, Aizawa S, Katayama E, Nonaka T, Imajoh-Ohmi S, Kuwae A,
Nagai S, Sasakawa C: Supramolecular structure of the Shigella type
182 III secretion machinery: the needle part is changeable in length and
essential for delivery of effectors. Embo J 2000, 19(15):3876-3887.
86. Chakravortty D, Rohde M, Jager L, Deiwick J, Hensel M: Formation of a
novel surface structure encoded by Salmonella Pathogenicity Island
2. Embo J 2005, 24(11):2043-2052.
87. Journet L, Agrain C, Broz P, Cornelis GR: The needle length of bacterial
injectisomes is determined by a molecular ruler. Science 2003,
302(5651):1757-1760.
88. Pastor A, Chabert J, Louwagie M, Garin J, Attree I: PscF is a major
component of the Pseudomonas aeruginosa type III secretion needle.
FEMS Microbiol Lett 2005, 253(1):95-101.
89. Deane JE, Roversi P, Cordes FS, Johnson S, Kenjale R, Daniell S, Booy
F, Picking WD, Picking WL, Blocker AJ et al: Molecular model of a type
III secretion system needle: Implications for host-cell sensing. Proc
Natl Acad Sci U S A 2006, 103(33):12529-12533.
90. Schraidt O, Marlovits TC: Three-dimensional model of Salmonella's
needle complex at subnanometer resolution. Science 2011,
331(6021):1192-1195.
91. Wagner S, Konigsmaier L, Lara-Tejero M, Lefebre M, Marlovits TC, Galan
JE: Organization and coordinated assembly of the type III secretion
export apparatus. Proc Natl Acad Sci U S A 2010, 107(41):17745-17750.
92. Burghout P, van Boxtel R, Van Gelder P, Ringler P, Muller SA,
Tommassen J, Koster M: Structure and electrophysiological
183 properties of the YscC secretin from the type III secretion system of
Yersinia enterocolitica. J Bacteriol 2004, 186(14):4645-4654.
93. Chevance FF, Hughes KT: Coordinating assembly of a bacterial
macromolecular machine. Nat Rev Microbiol 2008, 6(6):455-465.
94. Cornelis GR: The type III secretion injectisome, a complex
nanomachine for intracellular 'toxin' delivery. Biol Chem 2010,
391(7):745-751.
95. Ferris HU, Minamino T: Flipping the switch: bringing order to flagellar
assembly. Trends Microbiol 2006, 14(12):519-526.
96. Zhu K, Gonzalez-Pedrajo B, Macnab RM: Interactions among
membrane and soluble components of the flagellar export apparatus
of Salmonella. Biochemistry 2002, 41(30):9516-9524.
97. Minamino T, Macnab RM: Domain structure of Salmonella FlhB, a
flagellar export component responsible for substrate specificity
switching. J Bacteriol 2000, 182(17):4906-4914.
98. Kihara M, Minamino T, Yamaguchi S, Macnab RM: Intergenic
suppression between the flagellar MS ring protein FliF of Salmonella
and FlhA, a membrane component of its export apparatus. J Bacteriol
2001, 183(5):1655-1662.
99. Williams AW, Yamaguchi S, Togashi F, Aizawa SI, Kawagishi I, Macnab
RM: Mutations in fliK and flhB affecting flagellar hook and filament
assembly in Salmonella typhimurium. J Bacteriol 1996, 178(10):2960-
2970.
184 100. Minamino T, Macnab RM: Components of the Salmonella flagellar
export apparatus and classification of export substrates. J Bacteriol
1999, 181(5):1388-1394.
101. Rietsch A: unpublished results.
102. Jackson MW, Plano GV: Interactions between type III secretion
apparatus components from Yersinia pestis detected using the yeast
two-hybrid system. FEMS Microbiol Lett 2000, 186(1):85-90.
103. Blaylock B, Riordan KE, Missiakas DM, Schneewind O: Characterization
of the Yersinia enterocolitica type III secretion ATPase YscN and its
regulator, YscL. J Bacteriol 2006, 188(10):3525-3534.
104. Minamino T, MacNab RM: FliH, a soluble component of the type III
flagellar export apparatus of Salmonella, forms a complex with FliI
and inhibits its ATPase activity. Mol Microbiol 2000, 37(6):1494-1503.
105. Minamino T, MacNab RM: Interactions among components of the
Salmonella flagellar export apparatus and its substrates. Mol
Microbiol 2000, 35(5):1052-1064.
106. Gonzalez-Pedrajo B, Minamino T, Kihara M, Namba K: Interactions
between C ring proteins and export apparatus components: a
possible mechanism for facilitating type III protein export. Mol
Microbiol 2006, 60(4):984-998.
107. Akeda Y, Galan JE: Chaperone release and unfolding of substrates in
type III secretion. Nature 2005, 437(7060):911-915.
185 108. Wilharm G, Lehmann V, Krauss K, Lehnert B, Richter S, Ruckdeschel K,
Heesemann J, Trulzsch K: Yersinia enterocolitica type III secretion
depends on the proton motive force but not on the flagellar motor
components MotA and MotB. Infect Immun 2004, 72(7):4004-4009.
109. Paul K, Erhardt M, Hirano T, Blair DF, Hughes KT: Energy source of
flagellar type III secretion. Nature 2008, 451(7177):489-492.
110. Minamino T, Namba K: Distinct roles of the FliI ATPase and proton
motive force in bacterial flagellar protein export. Nature 2008,
451(7177):485-488.
111. Brutinel ED, Vakulskas CA, Brady KM, Yahr TL: Characterization of
ExsA and of ExsA-dependent promoters required for expression of
the Pseudomonas aeruginosa type III secretion system. Mol Microbiol
2008, 68(3):657-671.
112. Frank DW, Iglewski BH: Cloning and sequence analysis of a trans-
regulatory locus required for exoenzyme S synthesis in
Pseudomonas aeruginosa. J Bacteriol 1991, 173(20):6460-6468.
113. Rietsch A, Vallet-Gely I, Dove SL, Mekalanos JJ: ExsE, a secreted
regulator of type III secretion genes in Pseudomonas aeruginosa.
Proc Natl Acad Sci U S A 2005, 102(22):8006-8011.
114. Urbanowski ML, Lykken GL, Yahr TL: A secreted regulatory protein
couples transcription to the secretory activity of the Pseudomonas
aeruginosa type III secretion system. Proc Natl Acad Sci U S A 2005,
102(28):9930-9935.
186 115. Brutinel ED, Yahr TL: Control of gene expression by type III secretory
activity. Curr Opin Microbiol 2008, 11(2):128-133.
116. Anderson JK, Smith TG, Hoover TR: Sense and sensibility: flagellum-
mediated gene regulation. Trends Microbiol 2010, 18(1):30-37.
117. Mavris M, Page AL, Tournebize R, Demers B, Sansonetti P, Parsot C:
Regulation of transcription by the activity of the Shigella flexneri
type III secretion apparatus. Mol Microbiol 2002, 43(6):1543-1553.
118. Yamamoto S, Kutsukake K: FliT acts as an anti-FlhD2C2 factor in the
transcriptional control of the flagellar regulon in Salmonella enterica
serovar typhimurium. J Bacteriol 2006, 188(18):6703-6708.
119. Stainier I, Bleves S, Josenhans C, Karmani L, Kerbourch C, Lambermont I,
Totemeyer S, Boyd A, Cornelis GR: YscP, a Yersinia protein required
for Yop secretion that is surface exposed, and released in low Ca2+.
Mol Microbiol 2000, 37(5):1005-1018.
120. Agrain C, Callebaut I, Journet L, Sorg I, Paroz C, Mota LJ, Cornelis GR:
Characterization of a Type III secretion substrate specificity switch
(T3S4) domain in YscP from Yersinia enterocolitica. Mol Microbiol
2005, 56(1):54-67.
121. Edqvist PJ, Olsson J, Lavander M, Sundberg L, Forsberg A, Wolf-Watz H,
Lloyd SA: YscP and YscU regulate substrate specificity of the
Yersinia type III secretion system. J Bacteriol 2003, 185(7):2259-2266.
187 122. Moriya N, Minamino T, Hughes KT, Macnab RM, Namba K: The type III
flagellar export specificity switch is dependent on FliK ruler and a
molecular clock. J Mol Biol 2006, 359(2):466-477.
123. Wagner S, Stenta M, Metzger LC, Dal Peraro M, Cornelis GR: Length
control of the injectisome needle requires only one molecule of Yop
secretion protein P (YscP). Proc Natl Acad Sci U S A 2010,
107(31):13860-13865.
124. Magdalena J, Hachani A, Chamekh M, Jouihri N, Gounon P, Blocker A,
Allaoui A: Spa32 regulates a switch in substrate specificity of the type
III secreton of Shigella flexneri from needle components to Ipa
proteins. J Bacteriol 2002, 184(13):3433-3441.
125. Kubori T, Sukhan A, Aizawa SI, Galan JE: Molecular characterization
and assembly of the needle complex of the Salmonella typhimurium
type III protein secretion system. Proc Natl Acad Sci U S A 2000,
97(18):10225-10230.
126. Marlovits TC, Kubori T, Lara-Tejero M, Thomas D, Unger VM, Galan JE:
Assembly of the inner rod determines needle length in the type III
secretion injectisome. Nature 2006, 441(7093):637-640.
127. Koroyasu S, Yamazato M, Hirano T, Aizawa SI: Kinetic analysis of the
growth rate of the flagellar hook in Salmonella typhimurium by the
population balance method. Biophys J 1998, 74(1):436-443.
188 128. Makishima S, Komoriya K, Yamaguchi S, Aizawa SI: Length of the
flagellar hook and the capacity of the type III export apparatus.
Science 2001, 291(5512):2411-2413.
129. Ferris HU, Furukawa Y, Minamino T, Kroetz MB, Kihara M, Namba K,
Macnab RM: FlhB regulates ordered export of flagellar components
via autocleavage mechanism. J Biol Chem 2005, 280(50):41236-41242.
130. Agrain C, Sorg I, Paroz C, Cornelis GR: Secretion of YscP from
Yersinia enterocolitica is essential to control the length of the
injectisome needle but not to change the type III secretion substrate
specificity. Mol Microbiol 2005, 57(5):1415-1427.
131. Allaoui A, Woestyn S, Sluiters C, Cornelis GR: YscU, a Yersinia
enterocolitica inner membrane protein involved in Yop secretion. J
Bacteriol 1994, 176(15):4534-4542.
132. Sorg I, Wagner S, Amstutz M, Muller SA, Broz P, Lussi Y, Engel A,
Cornelis GR: YscU recognizes translocators as export substrates of
the Yersinia injectisome. Embo J 2007, 26(12):3015-3024.
133. Sundin C, Thelaus J, Broms JE, Forsberg A: Polarisation of type III
translocation by Pseudomonas aeruginosa requires PcrG, PcrV and
PopN. Microb Pathog 2004, 37(6):313-322.
134. Yang H, Shan Z, Kim J, Wu W, Lian W, Zeng L, Xing L, Jin S: Regulatory
role of PopN and its interacting partners in type III secretion of
Pseudomonas aeruginosa. J Bacteriol 2007, 189(7):2599-2609.
189 135. Schubot FD, Jackson MW, Penrose KJ, Cherry S, Tropea JE, Plano GV,
Waugh DS: Three-dimensional structure of a macromolecular
assembly that regulates type III secretion in Yersinia pestis. J Mol Biol
2005, 346(4):1147-1161.
136. Joseph SS, Plano GV: Identification of TyeA residues required to
interact with YopN and to regulate Yop secretion. Adv Exp Med Biol
2007, 603:235-245.
137. Ferracci F, Schubot FD, Waugh DS, Plano GV: Selection and
characterization of Yersinia pestis YopN mutants that constitutively
block Yop secretion. Mol Microbiol 2005, 57(4):970-987.
138. Martinez-Argudo I, Blocker AJ: The Shigella T3SS needle transmits a
signal for MxiC release, which controls secretion of effectors. Mol
Microbiol 2010, 78(6):1365-1378.
139. Botteaux A, Sory MP, Biskri L, Parsot C, Allaoui A: MxiC is secreted by
and controls the substrate specificity of the Shigella flexneri type III
secretion apparatus. Mol Microbiol 2009, 71(2):449-460.
140. Kubori T, Galan JE: Salmonella type III secretion-associated protein
InvE controls translocation of effector proteins into host cells. J
Bacteriol 2002, 184(17):4699-4708.
141. Deane JE, Roversi P, King C, Johnson S, Lea SM: Structures of the
Shigella flexneri type 3 secretion system protein MxiC reveal
conformational variability amongst homologues. J Mol Biol 2008,
377(4):985-992.
190 142. Kim J, Ahn K, Min S, Jia J, Ha U, Wu D, Jin S: Factors triggering type III
secretion in Pseudomonas aeruginosa. Microbiology 2005, 151(Pt
11):3575-3587.
143. Pettersson J, Nordfelth R, Dubinina E, Bergman T, Gustafsson M,
Magnusson KE, Wolf-Watz H: Modulation of virulence factor
expression by pathogen target cell contact. Science 1996,
273(5279):1231-1233.
144. Forsberg A, Viitanen AM, Skurnik M, Wolf-Watz H: The surface-located
YopN protein is involved in calcium signal transduction in Yersinia
pseudotuberculosis. Mol Microbiol 1991, 5(4):977-986.
145. Jander G, Rahme LG, Ausubel FM: Positive correlation between
virulence of Pseudomonas aeruginosa mutants in mice and insects.
J Bacteriol 2000, 182(13):3843-3845.
146. D'Argenio DA, Gallagher LA, Berg CA, Manoil C: Drosophila as a model
host for Pseudomonas aeruginosa infection. J Bacteriol 2001,
183(4):1466-1471.
147. Mahajan-Miklos S, Tan MW, Rahme LG, Ausubel FM: Molecular
mechanisms of bacterial virulence elucidated using a Pseudomonas
aeruginosa-Caenorhabditis elegans pathogenesis model. Cell 1999,
96(1):47-56.
148. Frithz-Lindsten E, Du Y, Rosqvist R, Forsberg A: Intracellular targeting
of exoenzyme S of Pseudomonas aeruginosa via type III-dependent
translocation induces phagocytosis resistance, cytotoxicity and
191 disruption of actin microfilaments. Mol Microbiol 1997, 25(6):1125-
1139.
149. Hauser AR, Engel JN: Pseudomonas aeruginosa induces type-III-
secretion-mediated apoptosis of macrophages and epithelial cells.
Infect Immun 1999, 67(10):5530-5537.
150. Lee PC, Stopford CM, Svenson AG, Rietsch A: Control of effector
export by the Pseudomonas aeruginosa type III secretion proteins
PcrG and PcrV. Mol Microbiol 2010, 75(4):924-941.
151. Menard R, Sansonetti PJ, Parsot C: Nonpolar mutagenesis of the ipa
genes defines IpaB, IpaC, and IpaD as effectors of Shigella flexneri
entry into epithelial cells. J Bacteriol 1993, 175(18):5899-5906.
152. Bergman T, Hakansson S, Forsberg A, Norlander L, Macellaro A,
Backman A, Bolin I, Wolf-Watz H: Analysis of the V antigen lcrGVH-
yopBD operon of Yersinia pseudotuberculosis: evidence for a
regulatory role of LcrH and LcrV. J Bacteriol 1991, 173(5):1607-1616.
153. Nilles ML, Williams AW, Skrzypek E, Straley SC: Yersinia pestis LcrV
forms a stable complex with LcrG and may have a secretion-related
regulatory role in the low-Ca2+ response. J Bacteriol 1997,
179(4):1307-1316.
154. Price SB, Cowan C, Perry RD, Straley SC: The Yersinia pestis V
antigen is a regulatory protein necessary for Ca2(+)-dependent
growth and maximal expression of low-Ca2+ response virulence
genes. J Bacteriol 1991, 173(8):2649-2657.
192 155. Allmond LR, Karaca TJ, Nguyen VN, Nguyen T, Wiener-Kronish JP, Sawa
T: Protein binding between PcrG-PcrV and PcrH-PopB/PopD encoded
by the pcrGVH-popBD operon of the Pseudomonas aeruginosa type
III secretion system. Infect Immun 2003, 71(4):2230-2233.
156. Skryzpek E, Straley SC: LcrG, a secreted protein involved in negative
regulation of the low-calcium response in Yersinia pestis. J Bacteriol
1993, 175(11):3520-3528.
157. Nilles ML, Fields KA, Straley SC: The V antigen of Yersinia pestis
regulates Yop vectorial targeting as well as Yop secretion through
effects on YopB and LcrG. J Bacteriol 1998, 180(13):3410-3420.
158. Johnson S, Roversi P, Espina M, Olive A, Deane JE, Birket S, Field T,
Picking WD, Blocker AJ, Galyov EE et al: Self-chaperoning of the type
III secretion system needle tip proteins IpaD and BipD. J Biol Chem
2007, 282(6):4035-4044.
159. Picking WL, Nishioka H, Hearn PD, Baxter MA, Harrington AT, Blocker A,
Picking WD: IpaD of Shigella flexneri is independently required for
regulation of Ipa protein secretion and efficient insertion of IpaB and
IpaC into host membranes. Infect Immun 2005, 73(3):1432-1440.
160. De Geyter C, Wattiez R, Sansonetti P, Falmagne P, Ruysschaert JM,
Parsot C, Cabiaux V: Characterization of the interaction of IpaB and
IpaD, proteins required for entry of Shigella flexneri into epithelial
cells, with a lipid membrane. Eur J Biochem 2000, 267(18):5769-5776.
193 161. Veenendaal AK, Hodgkinson JL, Schwarzer L, Stabat D, Zenk SF, Blocker
AJ: The type III secretion system needle tip complex mediates host
cell sensing and translocon insertion. Mol Microbiol 2007, 63(6):1719-
1730.
162. Matson JS, Nilles ML: LcrG-LcrV interaction is required for control of
Yops secretion in Yersinia pestis. J Bacteriol 2001, 183(17):5082-5091.
163. Hamad MA, Nilles ML: Structure-function analysis of the C-terminal
domain of LcrV from Yersinia pestis. J Bacteriol 2007, 189(18):6734-
6739.
164. Lee VT, Tam C, Schneewind O: LcrV, a substrate for Yersinia
enterocolitica type III secretion, is required for toxin targeting into
the cytosol of HeLa cells. J Biol Chem 2000, 275(47):36869-36875.
165. Lloyd SA, Norman M, Rosqvist R, Wolf-Watz H: Yersinia YopE is
targeted for type III secretion by N-terminal, not mRNA, signals. Mol
Microbiol 2001, 39(2):520-531.
166. Kenjale R, Wilson J, Zenk SF, Saurya S, Picking WL, Picking WD, Blocker
A: The needle component of the type III secreton of Shigella
regulates the activity of the secretion apparatus. J Biol Chem 2005,
280(52):42929-42937.
167. Torruellas J, Jackson MW, Pennock JW, Plano GV: The Yersinia pestis
type III secretion needle plays a role in the regulation of Yop
secretion. Mol Microbiol 2005, 57(6):1719-1733.
194 168. Blocker AJ, Deane JE, Veenendaal AK, Roversi P, Hodgkinson JL,
Johnson S, Lea SM: What's the point of the type III secretion system
needle? Proc Natl Acad Sci U S A 2008, 105(18):6507-6513.
169. Davis AJ, Diaz DA, Mecsas J: A dominant-negative needle mutant
blocks type III secretion of early but not late substrates in Yersinia.
Mol Microbiol 2010, 76(1):236-259.
170. Imamura Y, Yanagihara K, Fukuda Y, Kaneko Y, Seki M, Izumikawa K,
Miyazaki Y, Hirakata Y, Sawa T, Wiener-Kronish JP et al: Effect of anti-
PcrV antibody in a murine chronic airway Pseudomonas aeruginosa
infection model. Eur Respir J 2007, 29(5):965-968.
171. Goure J, Broz P, Attree O, Cornelis GR, Attree I: Protective anti-V
antibodies inhibit Pseudomonas and Yersinia translocon assembly
within host membranes. J Infect Dis 2005, 192(2):218-225.
172. Neely AN, Holder IA, Wiener-Kronish JP, Sawa T: Passive anti-PcrV
treatment protects burned mice against Pseudomonas aeruginosa
challenge. Burns 2005, 31(2):153-158.
173. Frank DW, Vallis A, Wiener-Kronish JP, Roy-Burman A, Spack EG,
Mullaney BP, Megdoud M, Marks JD, Fritz R, Sawa T: Generation and
characterization of a protective monoclonal antibody to
Pseudomonas aeruginosa PcrV. J Infect Dis 2002, 186(1):64-73.
174. Shime N, Sawa T, Fujimoto J, Faure K, Allmond LR, Karaca T, Swanson
BL, Spack EG, Wiener-Kronish JP: Therapeutic administration of anti-
195 PcrV F(ab')(2) in sepsis associated with Pseudomonas aeruginosa. J
Immunol 2001, 167(10):5880-5886.
175. Holder IA, Neely AN, Frank DW: PcrV immunization enhances survival
of burned Pseudomonas aeruginosa-infected mice. Infect Immun 2001,
69(9):5908-5910.
176. Moriyama K, Wiener-Kronish JP, Sawa T: Protective effects of affinity-
purified antibody and truncated vaccines against Pseudomonas
aeruginosa V-antigen in neutropenic mice. Microbiol Immunol 2009,
53(11):587-594.
177. Baer M, Sawa T, Flynn P, Luehrsen K, Martinez D, Wiener-Kronish JP,
Yarranton G, Bebbington C: An engineered human antibody fab
fragment specific for Pseudomonas aeruginosa PcrV antigen has
potent antibacterial activity. Infect Immun 2009, 77(3):1083-1090.
178. Bahrani FK, Sansonetti PJ, Parsot C: Secretion of Ipa proteins by
Shigella flexneri: inducer molecules and kinetics of activation. Infect
Immun 1997, 65(10):4005-4010.
179. Miller JH: A Short Course in Bacterial Genetics: A Laboratory Manual
and Handbook for Escherichia Coli and Related Bacteria. Plainview,
NY: Cold Spring Harbor Laboratory Press; 1992.
180. Broms JE, Francis MS, Forsberg A: Diminished LcrV secretion
attenuates Yersinia pseudotuberculosis virulence. J Bacteriol 2007,
189(23):8417-8429.
196 181. Nanao M, Ricard-Blum S, Di Guilmi AM, Lemaire D, Lascoux D, Chabert J,
Attree I, Dessen A: Type III secretion proteins PcrV and PcrG from
Pseudomonas aeruginosa form a 1:1 complex through high affinity
interactions. BMC Microbiol 2003, 3:21.
182. DeBord KL, Lee VT, Schneewind O: Roles of LcrG and LcrV during
type III targeting of effector Yops by Yersinia enterocolitica. J
Bacteriol 2001, 183(15):4588-4598.
183. Matson JS, Nilles ML: Interaction of the Yersinia pestis type III
regulatory proteins LcrG and LcrV occurs at a hydrophobic interface.
BMC Microbiol 2002, 2:16.
184. Lawton DG, Longstaff C, Wallace BA, Hill J, Leary SE, Titball RW, Brown
KA: Interactions of the type III secretion pathway proteins LcrV and
LcrG from Yersinia pestis are mediated by coiled-coil domains. J Biol
Chem 2002, 277(41):38714-38722.
185. Reina LD, O'Bryant DM, Matson JS, Nilles ML: LcrG secretion is not
required for blocking of Yops secretion in Yersinia pestis. BMC
Microbiol 2008, 8:29.
186. Espina M, Olive AJ, Kenjale R, Moore DS, Ausar SF, Kaminski RW, Oaks
EV, Middaugh CR, Picking WD, Picking WL: IpaD localizes to the tip of
the type III secretion system needle of Shigella flexneri. Infect Immun
2006, 74(8):4391-4400.
187. Roehrich AD, Martinez-Argudo I, Johnson S, Blocker AJ, Veenendaal AK:
The extreme C terminus of Shigella flexneri IpaB is required for
197 regulation of type III secretion, needle tip composition, and binding.
Infect Immun 2010, 78(4):1682-1691.
188. Cordes FS, Daniell S, Kenjale R, Saurya S, Picking WL, Picking WD,
Booy F, Lea SM, Blocker A: Helical packing of needles from
functionally altered Shigella type III secretion systems. J Mol Biol
2005, 354(2):206-211.
189. Vallet-Gely I, Donovan KE, Fang R, Joung JK, Dove SL: Repression of
phase-variable cup gene expression by H-NS-like proteins in
Pseudomonas aeruginosa. Proc Natl Acad Sci U S A 2005,
102(31):11082-11087.
190. Bleves S, Soscia C, Nogueira-Orlandi P, Lazdunski A, Filloux A: Quorum
sensing negatively controls type III secretion regulon expression in
Pseudomonas aeruginosa PAO1. J Bacteriol 2005, 187(11):3898-3902.
191. Rietsch A, Wolfgang MC, Mekalanos JJ: Effect of metabolic imbalance
on expression of type III secretion genes in Pseudomonas
aeruginosa. Infect Immun 2004, 72(3):1383-1390.
192. Saijo-Hamano Y, Imada K, Minamino T, Kihara M, Shimada M, Kitao A,
Namba K: Structure of the cytoplasmic domain of FlhA and
implication for flagellar type III protein export. Mol Microbiol 2010,
76(1):260-268.
193. Saijo-Hamano Y, Imada K, Minamino T, Kihara M, Macnab RM, Namba K:
Crystallization and preliminary X-ray analysis of the C-terminal
cytoplasmic domain of FlhA, a membrane-protein subunit of the
198 bacterial flagellar type III protein-export apparatus. Acta Crystallogr
Sect F Struct Biol Cryst Commun 2005, 61(Pt 6):599-602.
194. Worrall LJ, Vuckovic M, Strynadka NC: Crystal structure of the C-
terminal domain of the Salmonella type III secretion system export
apparatus protein InvA. Protein Sci 2010, 19(5):1091-1096.
195. Minamino T, Shimada M, Okabe M, Saijo-Hamano Y, Imada K, Kihara M,
Namba K: Role of the C-terminal cytoplasmic domain of FlhA in
bacterial flagellar type III protein export. J Bacteriol 2010, 192(7):1929-
1936.
196. Yokoseki T, Kutsukake K, Ohnishi K, Iino T: Functional analysis of the
flagellar genes in the fliD operon of Salmonella typhimurium.
Microbiology 1995, 141 ( Pt 7):1715-1722.
197. Imada K, Minamino T, Kinoshita M, Furukawa Y, Namba K: Structural
insight into the regulatory mechanisms of interactions of the flagellar
type III chaperone FliT with its binding partners. Proc Natl Acad Sci U
S A 2010, 107(19):8812-8817.
198. Bange G, Kummerer N, Engel C, Bozkurt G, Wild K, Sinning I: FlhA
provides the adaptor for coordinated delivery of late flagella building
blocks to the type III secretion system. Proc Natl Acad Sci U S A 2010,
107(25):11295-11300.
199. McMurry JL, Van Arnam JS, Kihara M, Macnab RM: Analysis of the
cytoplasmic domains of Salmonella FlhA and interactions with
199 components of the flagellar export machinery. J Bacteriol 2004,
186(22):7586-7592.
200. Hirano T, Mizuno S, Aizawa S, Hughes KT: Mutations in flk, flgG, flhA,
and flhE that affect the flagellar type III secretion specificity switch in
Salmonella enterica. J Bacteriol 2009, 191(12):3938-3949.
200