1. University: BEIJING UNIVERSITY of CHEMICAL TECHNOLOGY 2. COLLEGE of ENGINEERING PEKING UNIVERSITY 3. UNIVERSITY of SCIENCE AN

Total Page:16

File Type:pdf, Size:1020Kb

Load more

1. University: BEIJING UNIVERSITY OF CHEMICAL TECHNOLOGY http://en.cmse.buct.edu.cn/facultystaff/staff/index.htm 2. COLLEGE OF ENGINEERING PEKING UNIVERSITY http://en.coe.pku.edu.cn/Materials-Science-Engineerin/index.htm 3. UNIVERSITY OF SCIENCE AND TECHNOLOGY BEIJING http://en.mse.ustb.edu.cn/Faculty/Faculty/ 4. University of Chinese Academy of Sciences School of chemical science http://chem.ucas.ac.cn/index.php/en/faculty-staff/pro http://english.nimte.cas.cn/pe/fas/ College of materials science and opto-electronics technology http://cmo.ucas.ac.cn/index.php/en/people/pfs 5. CHINA UNIVERSITY OF PETROLEUM http://www.cup.edu.cn/pub/xyyww/CollegeofScience/postgraduateprograms7/masterprog rams7/111505.htm 6. FUZHOU UNIVERSITY http://cl.fzu.edu.cn/html/English/Faculty/Professor/1.html 7. Xiamen University http://cm.xmu.edu.cn/cmen/waculty/list.htm 8. South China University of Technology http://www2.scut.edu.cn/materials_en/wnstituteofwaterialswcience/list.htm Department of Polymer Materials Science and Engineering http://www2.scut.edu.cn/materials_en/wepartmentofwolymerwaterialswcienceandwngineerin g/list.htm Institute of Materials Science http://www2.scut.edu.cn/materials_en/wnstituteofwaterialswcience/list.htm Department of Inorganic Materials Science and Engineering http://www2.scut.edu.cn/materials_en/2/list.htm Department of Electronic Materials Science and Engineering http://www2.scut.edu.cn/materials_en/wepartmentofwlectronicwaterialswcienceandwngineeri ng/list.htm Department of Metallic Materials Science and Engineering http://www2.scut.edu.cn/materials_en/2017/0705/c11238a170624/page.htm Department of Biomedical Engineering http://www2.scut.edu.cn/materials_en/wepartmentofwiomedicalwngineering/list.htm Institute of Polymer Optoelectronic Materials and Devices http://www2.scut.edu.cn/materials_en/wnstituteofwolymerwptoelectronicwaterialsand wevices/list.htm Institute of Optical Communication http://www2.scut.edu.cn/materials_en/wnstituteofwpticalwommunication/list.htm 9. JINAN UNIVERSITY College of chemistry and material science https://chemmat.jnu.edu.cn/xybgs/list.htm 10. Chongqing University http://study.cqu.edu.cn/info/1376/1110.htm 11. Guizhou University College of Materials and Metallurgy http://mm.gzu.edu.cn/3802/list.htm 12. Yanshan University https://english.ysu.edu.cn/Schools___Departments/School_of_Materials_Science_and_Engin eering/Professors_Information.htm 13. Hunan University http://www-en.hnu.edu.cn/info/1095/2092.htm 14. Jilin University http://dmse.jlu.edu.cn/szdw/js.htm (professors information are not given on this site) 15. Northeast Normal University http://www.nenu.edu.cn/576/list.htm#cjtp 16. Southeast University http://smse.seu.edu.cn/ljrc/list.htm http://smse.seu.edu.cn/szry/list.htm 17. Hohai University College of Mechanics and Materials http://lcy.hhu.edu.cn/_s130/_t251/2013/0910/c5970a83945/page.psp 18. Jiangnan University School of Chemical and Materials Engineering http://chem.jiangnan.edu.cn/szdw1/jsml.htm 19. Jiangsu University School of materials science and engineering http://material.ujs.edu.cn/Home/Faculty_Staff/Faculty.htm 20. Nanjing University 21. Nanjing Normal University http://schools.njnu.edu.cn/chem/faculty Nanjing University of Aeronautics and Astronautics 22. Nanjing University of Science and technology http://smse.njust.edu.cn/9312/list.htm 23. Nanjing Agricultural University 24. Nanchang University (ncu) http://mse.ncu.edu.cn/inandex.php?c=article&a=type&tid=49 25. Dalian University of Technology Materials Science and Engineering http://faculty- en.dlut.edu.cn/xkjslb.jsp?totalpage=12&PAGENUM=2&urltype=tsites.DisciplineTeacherList&wbtreei d=1013&st=0&id=1188&lang=en 26. Tsinghua University School of materials science and engineering http://www.mse.tsinghua.edu.cn/en/column/91_1.html 27. Fudan University Materials science http://mse.fudan.edu.cn/Data/List/jsyjy 28. University of Science and Technology of China http://en.ustc.edu.cn/_s141/main.psp 29. Zhejiang University http://mse.zju.edu.cn/english/usersearch.php?catalog_id=126065&cmd=user 30. Shanghai Jiao Tong University School of materials science and engineering http://en.smse.sjtu.edu.cn/people/people.aspx?id=1 31. University of science and technology china http://en.ustc.edu.cn/faculty/201105/t20110530_112483.html 32. Inner Mongolia University Chemistry and chemical engineering Materials science and engineering http://chem.imu.edu.cn/szdw1/clkxygc.htm 33. Qinghai University http://jxxy.qhu.edu.cn/szgk/clgcjys/index.htm 34. University of Jinan http://mse.ujn.edu.cn/rcpy/dsfc.htm 35. Ludong University http://www.chem.ldu.edu.cn/bmgk/szdw1/cljys.htm 36. Ocean University of China http://mse.ouc.edu.cn/13508/list.htm 37. Qingdao University http://clxy.qdu.edu.cn/xygk.htm 38. Qingdao University of Science & Technology http://cl.qust.edu.cn/szll/sd.htm 39. Shandong University http://www.cmse.sdu.edu.cn/szll/xssz.htm http://www.cmse.sdu.edu.cn/szll/dsjs.htm 40. Xi'an Jiaotong http://mse-en.xjtu.edu.cn/en/peoples.php?cat_id=1462 41. tsinghua university http://www.chemeng.tsinghua.edu.cn/research/divisions/biochem/Lab_biochem/frame/english site/HTML/faculty.htm 42. Shandong University of Science and Technology http://cmse.sdust.edu.cn/szdw?keys1=professor&keys2=Laboratory&Submit=Find 43. Shandong Normal University http://www.hxc.sdnu.edu.cn/szll/szjj.htm (website is not working properly ) 44. China University of Petroleum (Huadong) http://mse.upc.edu.cn/10792/list.htm 45. Xidian University http://amn.xidian.edu.cn/html/faculty/teacher/index.html 46. Northwestern Polytechnic University http://cailiao.nwpu.edu.cn/english/faculty/materials.htm .
Recommended publications
  • Buformin Suppresses Osteosarcoma Via Targeting AMPK Signaling Pathway

    Buformin Suppresses Osteosarcoma Via Targeting AMPK Signaling Pathway

    Open Life Sciences 2020; 15: 409–417 Rapid Communication Yan Ding#, Shiqiao Lv#, Guangrun Li, Jinpeng Cui, Yunzhen Chen* Buformin suppresses osteosarcoma via targeting AMPK signaling pathway https://doi.org/10.1515/biol-2020-0041 primary cultured osteosarcoma tissues, buformin increased received March 8, 2020; accepted May 8, 2020 tumor sensitivity to cisplatin. ‒ Abstract Conclusions Buformin could suppress tumor growth Background ‒ Buformin has been reported to be a and invasion of osteosarcoma through directly targeting - powerful anticancer drug by activating the AMPK signal. the AMPK signaling pathway. Moreover, buformin in Herein, we aimed to investigate the effects of buformin hibited the abnormal metabolism and notably increased on osteosarcoma. the cytotoxicity of cisplatin, and therefore represents a Material and methods ‒ Cellular proliferative abilities new potential treatment option for osteosarcoma. were determined by cell counting kit-8 and colony formation Keywords: buformin, osteosarcoma, AMPK signal pathway, assays. Cellular invasion was investigated using a transwell synergistic effect system. Cell cycle was examined by flow cytometry. Western blot was performed to measure the expression of key proteins. Synergistic effects of buformin and cisplatin were validated in seven fresh osteosarcoma tissues. 1 Introduction Results ‒ Buformin suppressed the growth of U-2 OS cells in a dose-dependent manner (IC50 = 69.1 µM).Moreover, In children and adolescents, osteosarcoma is the most [ ] buformin induced cell cycle arrest (P < 0.001) and impaired common malignancy originating from bone 1 .Globally, cellular invasion (P = 0.038). Phosphorylation of AMPK was the incidence of osteosarcoma is approximately 3.4 cases [ ] upregulated by buformin, while phosphorylation of S6, per million people every year 2 .
  • Colorado State University System Board of Governors Meeting Agenda February 7, 2018

    Colorado State University System Board of Governors Meeting Agenda February 7, 2018

    Colorado State University System Board of Governors Meeting Agenda February 7, 2018 BOARD OF GOVERNORS February 7-9, 2018 CSU – Pueblo Occhiato Student Center WEDNESDAY, FEBRUARY 7, 2018 CSU System Board of Governors Retreat – Tundra 008A, Occhiato Student Center 1:30 – 5:00 p.m. University Partnerships in the 21st Century Opening and Context Setting – Tony Frank 1:30 p.m. – 1:35 p.m. International Discussions of current and emerging partnerships with universities in China, Taiwan, 1:35 p.m. – 2:45 p.m. Saudi Arabia and Mexico BREAK Domestic Discussion about Athletic Conference Academic Consortia, Land Grant University (LGU) 3:00 p.m. – 3:45 p.m. Consortia, and Beyond Campus Innovations (BCI) Opportunities Colorado Trends, lessons, and considerations when exploring partnerships 3:45 p.m. – 4:15 p.m. Executive Session 4:15 p.m. – 5:00 p.m. Informal dinner – La Tronica’s, 1143 E. Abriendo Avenue, Pueblo, CO 81004 (Social Event) 6:00 p.m. Page 1 of 1 UNIVERSITY PARTNERSHIPS IN THE 21ST CENTURY INTERNATIONAL International Initiatives/Partnerships at Colorado State University Office of International Programs International Student Enrollment International Student Enrollment Education Abroad Participation 1600 1400 1200 Not For Credit 1000 800 For Credit 600 Less Than 8 Weeks 400 For Credit 8 Weeks or More 200 0 Education Abroad Participation STUDY RESEARCH INTERNSHIPS SERVICE- LEARNING China Programs • High school and university relationships • Research initiatives • Confucius Institute International Partnerships Strategic Partners include:
  • RAFT-Mediated Pickering Emulsion Polymerization with Cellulose Nanocrystals Grafted with Random Copolymer As Stabilizer

    RAFT-Mediated Pickering Emulsion Polymerization with Cellulose Nanocrystals Grafted with Random Copolymer As Stabilizer

    RSC Advances View Article Online PAPER View Journal | View Issue RAFT-mediated Pickering emulsion polymerization with cellulose nanocrystals grafted with random Cite this: RSC Adv.,2018,8, 28660 copolymer as stabilizer† Liangjiu Bai, ab Xinyan Jiang,ab Beifang Liu,ab Wenxiang Wang,*ab Hou Chen, *ab Zhongxin Xue,ab Yuzhong Niu, ab Huawei Yangab and Donglei Weiab The synthesis of a RAFT-mediated Pickering emulsion was firstly achieved by using cellulose nanocrystals (CNCs) grafted with a random copolymer as the stabilizer. Firstly, poly(acrylonitrile-r-butyl acrylate) (poly(AN-r-nBA)) was synthesized by Cu(0)-mediated CRP, which was further modified via a click chemistry strategy to obtain poly(ethylene tetrazole-r-butyl acrylate) (poly(VT-r-nBA)). Then, poly(VT-r- nBA) was grafted onto the CNCs through a Mitsunobu reaction to obtain poly(VT-r-nBA)-g-CNCs. Stabilized by poly(VT-r-nBA)-g-CNCs, an O/W RAFT-mediated Pickering emulsion was formed for the preparation of well-controlled poly(methyl methacrylate) (PMMA) particles with water-soluble potassium Creative Commons Attribution 3.0 Unported Licence. persulfate (KPS) as an initiator and oil-soluble 4-cyanopentanoic acid dithiobenzoate (CPADB) as a chain Received 4th May 2018 transfer agent. Rheological analysis suggested that the prepared Pickering emulsion possessed good Accepted 26th July 2018 stability under the influences of changes in strain, time, frequency and temperature. Furthermore, the DOI: 10.1039/c8ra03816c recycling and further utilization of the poly(VT-r-nBA)-g-CNCs could
  • 2019-3 Report

    2019-3 Report

    UHM-2019 Spring Regional Director Report Regional Office: USA Hawaii Date: February 8, 2019 No Item Quantity/Status Names of 1 OPHS of UHM Institutions New Potential School of Public Health ShanGhai University of Traditional 2 Members Chinese Medicine, Schhol of Public Health of Xiaonan Medical (Please University specify) Paid Members 3 Yes (up to current year) 2018 APHA conference in San Diego The American Public Health Association’s (APHA) Annual MeetinG and Expo took place in San DieGo, California from November 10-14, 2018. There are more than 12,000 attendees - the larGest GatherinG of public health professionals and over 1,000 scientific sessions that brinG toGether US and international public health colleaGues to educate, network, and inspire each other. The theme of this meetinG was “CreatinG the Healthiest Nation: Health Equity Now” and the conference provided the opportunity to network with experts and colleaGues about emerGinG public health issues and the latest research and practice. A total of 17 faculty and students from the OPHS attended and presented their research at the conference. We also hosted an exhibit booth in the APHA Exhibition Hall to show a wide variety of academic and research activities of our Bachelor, Master, and Doctorate programs, includinG our international exchanGe proGram and collaboration with APACPH. In addition, OPHS orGanized a public health social niGht to celebrate and network with colleaGues, friends, students, and alumni during the meeting. 4 2018 summer international exchange Program A total of 13 students from three Schools of Public Health of Wuhan, Fudan and NanchanG Universities came to Hawaii for the international exchanGe proGram for one month in 2018 summer.
  • CURRICULUM VITAE June 1998

    CURRICULUM VITAE June 1998

    CURRICULUM VITAE Jack W. Hou Home Address: Office Address: 3915 Davids Road Dept. of Economics Agoura Hills, CA 91301 California State University Long Beach, CA 90840-4607 TEL: (818)991-8488 TEL: (562)985-4710 FAX: (562)985-5804 E-mail: [email protected] Citizenship: U.S.A. Fields: Labor Economics, International Economics, Economics of China. Dissertation: Public-Private Wage Differentials: A Dual Selection Approach Dissertation Committee: Dr. John C.H. Fei, Dr. T.N. Srinivasan, Dr. Joseph Tracy Education: Ph.D, Yale University, May 1989 M.Phil., Yale University, December 1988 M.A., Yale University, May 1987 Course work, Washington University, St. Louis, 1982-83 Course work, University of Georgia, 1981-82 B.A., National Taiwan University, June 1979. Teaching Experience: Professor (California State University - Long Beach): 8/98- Associate Professor (California State University - Long Beach): 8/93 -7/98 Assistant Professor (California State University - Long Beach): 8/89 - 8/93 University Adjunct Professor (Huazhong University of Science and Technology), June 2018 - Adjunct Chair Professor (School of Economics, Jinan University, Guangzhou, China): June 2016 - Distinguished Professor (School of Economics, Southwestern University of Finance and Economics, Chengdu, China): June 2012 - Scholar of the Yellow River Distinguished Professor (Henan University, Kaifeng, China): 2011 - University Fellow (Nankai University, Tianjin, China): December 2008 - Distinguished Lecturer, School of Economics, Jilin University: May/June, 2010 Dr. Deng-hwei Lee Academic Chair Professor (National Sun-Yat Sen U., Taiwan): Summer 2006 Visiting Associate Professor (UCLA), 1999-2011 Visiting Professor (Soochow University), Fall 1996 Visiting Assistant Professor (Purdue University): 8/88 - 5/89. Lecturer (Yale University): 9/87 - 5/88.
  • PRESS RELEASE the 2018 China-Malaysia Higher Education

    PRESS RELEASE the 2018 China-Malaysia Higher Education

    PRESS RELEASE The 2018 China-Malaysia Higher Education Exchange Conference in Shandong Province KUALA LUMPUR, Malaysia, Oct. 18, 2018 - On September 28th, the 2018 China- Malaysia Higher Education Exchange Conference was held at Qingdao Hengxing Institute of Technology. The event was successfully hosted by Education Malaysia Global Services (EMGS). Six higher educational institutions from Malaysia participated in this event. The purpose of the event was to share high-quality educational resources and strengthen bilateral relations between China and Malaysia, especially in the field of higher education. Part of the program was visiting schools in Jinan. The objective of the visit was to showcase the six participating universities in Malaysia and promote their courses. The delegations from Malaysia was headed by Mr. Helmy Bin Sulaiman, Acting Head of Marketing & Communication of EMGS. Additionally, leaders from Qingdao Education Bureau and Qingdao University, Ocean University of China, Qingdao Technological University, Qingdao University of Science and Technology, Qingdao Agricultural University and other high schools in Jiaozhou and Zhongzhong were also present at the event. Both parties aim to build a high-quality educational platform for high school and college students and create more opportunities for students in China to further their study in Malaysia. The exchange program also witnessed the signing of Letter of Intent (LOI) between Qingdao Hengxing Institute of Technology and National University of Malaysia (UKM), University of Kuala Lumpur (UniKL) and Raffles University Iskandar for collaborations in student and academic exchange, joined research and mobility programs. -End- .
  • Wtc Meeting Attendace Globecom 2017 Singapore

    Wtc Meeting Attendace Globecom 2017 Singapore

    WTC MEETING ATTENDACE GLOBECOM 2017 SINGAPORE Najah Abu Ali University of the United Arab Emirates Ana García Armada University Carlos III de Madrid Ramy Amer Trinity College Dublin Alagan Anpalagan Ryerson University Imran Shafique Ansari TAMU at Qatar Nirwan Ansari NJIT Srikrishna Bhashyam IIT Madras Vijay K Bhargava University of British Columbia Suzhi Bi Shenzhen University Azzedine Boukerche University of Ottawa Wei Chen Tsinghua University Gaojie Chen University of Oxford Wen Chen Shanghai Jiao Tong University Shanzhi Chen Datang Zhiyong Chen Shanghai Jiao Tong University Xiaoming Chen Zhejiang University Bruno Clerckx Imperial College London Daniel Benevides da Costa Federal University of Ceará Luis M. Correia IST, University of Lisbon Shuguang Cui Texas A&M University/ UC Davis Huaiyu Dai North Carolina State University Linglong Dai Tsinghua University Swades De IIT Delhi Ugo Dias University of Brasilia Zhi Ding University of California, Davis Yinan Ding BUPT Zhiguo Ding Lancaster University Rui Dinis FCT - Universidade Nova de Lisboa, Portugal Octavia A. Dobre Memorial University Xiaojiang Du Temple University Salman Durrani Australian National University Hesham ElSawy King Abdullah University of Science and Technology Yuguang Fang University of Florida Mark Flanagan University College Dublin Hacène Fouchal University of Reims Yue Gao Queen Mary University of London 1 Ali Ghrayeb Texas A&M University at Qatar Andrea Giorgetti University of Bologna Chen Gong USTC Southern University of Science and Technology, Yi Gong China University of Idaho Mohsen Guizani Pengwenlong Gu Telecom ParisTech Li Guo BUPT Mounir Hamdi HBKU Shuai Han Harbin Institute of Technology Hossam Hassanein Queen's University Ruisi He Beijing Jiaotong University Bo Hu BUPT Jie Hu UESTC Rose Qingyang Hu Utah State University Cunqing Hua Shanghai Jiao Tong University Yunjian Jia Chongqing University Nan Jiang Queen Mary University of London Tamer Khattab Qatar University Chia-Han Lee Academia Sinica Khaled B.
  • Iotaas 2020: Program at a Glance DATE TIME Online Room a Online Room B

    Iotaas 2020: Program at a Glance DATE TIME Online Room a Online Room B

    IoTaaS 2020: Program At A Glance DATE TIME Online Room A Online Room B Opening Ceremony 1. Welcome Speech of General 09:00-09:20 Chair 2. Welcome Speech of EAI Tencent Meeting ID: 688 462 967 Password: 2020 Keynote Speech: Coding and Modulation for Machine-Type 09:20-10:00 Communications Prof. Baoming Bai Tencent Meeting ID: 688 462 967 Password: 2020 Keynote Speech: Few-Shot Image Classification via Contrastive Self- 10:00-10:40 Supervised Learning Prof. Guizhong Liu Tencent Meeting ID: 688 462 967 Password: 2020 19 Nov. Algorithm and Information Session 1 Network Session 1 11:00-12:20 Session Chair: Fang Yong Session Chair: Liu Yanming Tencent Meeting ID: 725 528 335 Tencent Meeting ID: 639 386 127 Password: 2020 Workshop on Edge Intelligence and Computing For Iot Communications And Algorithm and Information Session 2 14:00-16:00 Applications (1st Harf) Session Chair: Zhang Chen Session Chair: Chen Xiang Tencent Meeting ID: 273 251 994 Tencent Meeting ID: 156 570 396 Password: 2020 Workshop on Edge Intelligence and Computing For Iot Communications And System & Hardware Session 16:10-17:50 Applications (2st Harf) Session Chair: Chen Wenhui Session Chair: Chen Xiang Tencent Meeting ID: 751 932 354 Tencent Meeting ID: 156 570 396 Password: 2020 Workshop on Satellite Application Session Communications Session Chair: Abdullah Ghaleb 09:00-10:20 and Spatial Information Network Tencent Meeting ID: 672 146 720 Session Chair: Li Jingling Password: 2020 Tencent Meeting ID: 239 301 133 Network Session 2 Artificial Intelligence Session Session Chair: Li Bo Session Chair: Zhang Jingya 10:30-11:50 Tencent Meeting ID: 515 118 859 Tencent Meeting ID: 922 725 202 Password: 2020 Password: 2020 20 Nov.
  • 36X48 Tri-Fold Template

    36X48 Tri-Fold Template

    Teaching at the Center for American Culture at Guizhou University and at Guizhou Normal University Guiyang, China Background Preparation Presentations Impact During the summer of 2011, Presbyterian College in Clinton, SC Surveys were distributed to students at Guizhou and Guizhou Normal and Greenville Technical College in Greenville, SC partnered to Universities for the purpose of assessing the impact of the establish a collaboration with Guizhou University in Guiyang, China presentations made by GTC faculty. The results were overwhelming aimed at increasing the Chinese public’s understanding of the positive. United States in a similar manner to the Confucius Institutes which the Chinese government had established at American institutions to Faculty participants were required to provide summaries and improve the American public’s understanding of China. On reflections of their experiences in the classrooms and China generally. September 26, 2011, Dr. Ketih Miller, President of GTC, was Kathryn Hix encompassed many of the common sentiments in an op notified by Dr. John Griffith, President of PC, that the grant ed article about this project published in the Greenville News June 9, application submitted to the US Department of State for this 2012“…when I think back on this trip, I remember most fondly the endeavor had been approved. relationships I formed with colleagues and students. We were treated Guizhou University Campus to amazing meals, sightseeing adventures and even an amazing performance at the Peking Opera. But what resonates with me most is the great rapport we established with the people, our counterparts in In the fall of 211, the Center for International Education at GTC China.” The intellectual and experiential knowledge gained by the The GTC faculty traveled faculty participants will now be shared with the GTC community.
  • Supplemental: First Observation of D+ → Ηµ +Νµ and Measurement of Its

    Supplemental: First Observation of D+ → Ηµ +Νµ and Measurement of Its

    + + Supplemental: First Observation of D ! ηµ νµ and Measurement of its Decay Dynamics M. Ablikim1, M. N. Achasov10;c, P. Adlarson64, S. Ahmed15, M. Albrecht4, A. Amoroso63A;63C , Q. An60;48, Anita21, X. H. Bai54, Y. Bai47, O. Bakina29, R. Baldini Ferroli23A, I. Balossino24A, Y. Ban38;k, K. Begzsuren26, J. V. Bennett5, N. Berger28, M. Bertani23A, D. Bettoni24A, F. Bianchi63A;63C , J Biernat64, J. Bloms57, A. Bortone63A;63C , I. Boyko29, R. A. Briere5, H. Cai65, X. Cai1;48, A. Calcaterra23A, G. F. Cao1;52, N. Cao1;52, S. A. Cetin51B, J. F. Chang1;48, W. L. Chang1;52, G. Chelkov29;b, D. Y. Chen6, G. Chen1, H. S. Chen1;52, M. L. Chen1;48, S. J. Chen36, X. R. Chen25, Y. B. Chen1;48, W. S. Cheng63C , G. Cibinetto24A, F. Cossio63C , X. F. Cui37, H. L. Dai1;48, J. P. Dai42;g, X. C. Dai1;52, A. Dbeyssi15, R. B. de Boer4, D. Dedovich29, Z. Y. Deng1, A. Denig28, I. Denysenko29, M. Destefanis63A;63C , F. De Mori63A;63C , Y. Ding34, C. Dong37, J. Dong1;48, L. Y. Dong1;52, M. Y. Dong1;48;52, S. X. Du68, J. Fang1;48, S. S. Fang1;52, Y. Fang1, R. Farinelli24A, L. Fava63B;63C , F. Feldbauer4, G. Felici23A, C. Q. Feng60;48, M. Fritsch4, C. D. Fu1, Y. Fu1, X. L. Gao60;48, Y. Gao38;k, Y. Gao61, Y. G. Gao6, I. Garzia24A;24B, E. M. Gersabeck55, A. Gilman56, K. Goetzen11, L. Gong37, W. X. Gong1;48, W. Gradl28, M. Greco63A;63C , L. M. Gu36, M. H. Gu1;48, S. Gu2, Y. T.
  • Shaped Three-Dimensional Electrochemical Paper Microdevice

    Shaped Three-Dimensional Electrochemical Paper Microdevice

    Electronic Supplementary Material (ESI) for RSC Advances. This journal is © The Royal Society of Chemistry 2020 Origami-Based "Book" Shaped Three-Dimensional Electrochemical Paper Microdevice for Sample-to-Answer Detection of Pathogens Tao Hea, Jingwen Lia,b,Lisheng Liuc,d, Shenguang Gea, Mei Yana,e, Haiyun Liua,f,, Jinghua Yua,e a Collaborative Innovation Center of Technology and Equipment for Biological Diagnosis and Therapy in Universities of Shandong, Institute for Advanced Interdisciplinary Research (IAIR), University of Jinan, Jinan 250022, P.R. China b College of Biological Sciences and Technology, University of Jinan, Jinan 250022, P.R. China c Key Laboratory of Animal Resistance Research, College of Life Science, Shandong Normal University, Jinan, 250014, P. R. China d Clinical Laboratory,Shandong Cancer Hospital Affiliated to Shandong University,Shandong Academy of Medicine Science, Jinan, 250117, P. R. China. e School of Chemistry and Chemical Engineering, University of Jinan, Jinan, 250022, P. R. China f College of Chemistry, Chemical Engineering and Materials Science, Key Laboratory of Molecular and Nano Probes, Ministry of Education, Shandong Provincial Key Laboratory of Clean Production of Fine Chemicals, Shandong Normal University, Jinan, 250014, P. R. China Corresponding author.Tel.: +86-531-82767161; Fax: +86-531-82765956. E-mail address: [email protected] Table S1: LAMP primers set Primer Sequence (5 ~ 3) FIP: GACGACTGGTACTGATCGATAGTTTTTCAACGTTTCCTGCGG BIP: CCGGTGAAATTATCGCCACACAAAACGCCACCGCCAGG F3: GGCGATATTGGTGTTTATGGGG B3: AACGATAAACTGGACCACGG LF: GACGAAAGAGCGTGGTAATTAAC LB: GGGCAATTCGTTATTGGCGATAG Manufacturing procedures of wax-printing paper electrode The paper was first printed with wax using an office printer, then heated at 120 °C for 1 min on the hotplate to melt the printed wax, which diffused through the paper to form the same hydrophobic circle.
  • Analysis of Climate Change in the Coastal Zone of Eastern China

    Analysis of Climate Change in the Coastal Zone of Eastern China

    International Journal of Geosciences, 2012, 3, 379-390 http://dx.doi.org/10.4236/ijg.2012.32042 Published Online May 2012 (http://www.SciRP.org/journal/ijg) Analysis of Climate Change in the Coastal Zone of Eastern China, against the Background of Global Climate Change over the Last Fifty Years: Case Study of Shandong Peninsula, China Qing Tian1, Qing Wang1, Chao Zhan1, Xiguo Li2, Xueping Liu3 1Coast Institute, Ludong University, Yantai, China 2Hydrology and Water Resources Survey Bureau, Yantai, China 3Yantai Meteorological Bureau, Yantai, China Email: [email protected] Received December 20, 2011; revised February 16, 2012; accepted March 15, 2012 ABSTRACT The climate change in Shandong Peninsula, China was analyzed in this paper by the non-parametric Mann-Kendall test, Accumulated Difference Curve and Order Cluster Analysis methods, based upon the datas of annual mean, maximum and minimum temperature and annual precipitation, precipitation from June to September over the past 50 years. Re- sults obtained showed a number of observations: 1) The annual mean temperature of Shandong Peninsula showed a significant increasing trend, with a distinct abrupt change point detected around 1990, during the past 5 decades. The warming of the Peninsula over the last 50 years was due mainly to the significant increase of annual minimum tem- perature. The annual maximum temperature demonstrated a mixed trend of decreasing and increasing, but was statisti- cally insignificant, and no abrupt change was detected; 2) The annual precipitation exhibited a decreasing trend during the past 5 decades, with an abrupt change detected around 1980 at most stations; but there was an earlier transition point at 1966, at a few stations.