DOCSLIB.ORG

Antibacterial Activity of the Lactoperoxidase System: a Review

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Antibacterial Activity of the Lactoperoxidase System: a Review 887 Journal of Food Protection, Vol. 56, No. 10, Pages 887-892 (October 1993) Copyright©, International Association of Milk, Food and Environmental Sanitarians Antibacterial Activity of the Lactoperoxidase System: A Review LISA M. WOLFSON and SUSAN S. SUMNER* Department of Food Science and Technology, University of Nebraska, Lincoln, Nebraska 68583-0919 (Received for publication April 7, 1993) Downloaded from http://meridian.allenpress.com/jfp/article-pdf/56/10/887/1664249/0362-028x-56_10_887.pdf by guest on 24 September 2021 ABSTRACT Lactoperoxidase is found in the mammary, salivary, and lachrymal glands of mammals and in their respective secretions, e.g., milk, The lactoperoxidase (LP) system is a naturally occurring system saliva, and tears. In milk and saliva, lactoperoxidase exists in a which was first discovered in raw milk. Different groups of bacteria soluble form, but within the cells of salivary and mammary glands, show a varying degree of resistance to the LP system. Gram-negative it is possible that the enzyme could be loosely bound to subcellular catalase-positive organisms, such as pseudomonads, coliforms, salmo- particles (18). This could influence its affinity for different sub­ nellae, and shigellae, are inhibited by the LP system. Depending on the strates and the relative rates of reactions it catalyses. Lactoperoxidase medium pH, temperature, incubation time, cell density, and the particu­ has a molecular weight of 77,500 (30) and is resistant in vitro to lar donor, these microorganisms may be killed. It has been shown that acidity as low as a pH of approximately 3 and to human gastric the LP system can increase storage times of raw milk by delaying juice (32). Lactoperoxidase is actually more active at acidic pH growth of psychrotrophs; perhaps this method could be used to extend values (37). the shelf life of other foods. Bovine milk lactoperoxidase is relatively heat resistant, with the enzyme being only partially inactivated by short-time pasteur­ The antibacterial activity/mechanism of the ization at 74°C, leaving sufficient activity to catalyze the reactions lactoperoxidase (LP) system is well-documented (30). It is between thiocyanate and hydrogen peroxide (32). Cow's milk the major intermediary product of the LP system reaction, contains from 1.2 to 19.4 units per ml and is about 20 times richer hypothiocyanite (OSCN), which oxidizes essential protein in peroxidase activity than human milk (16). Human milk sulfhydryls, resulting in altered cellular system functions and lactoperoxidase activity is low; values range from 0.06 to 0.97 units per ml (41). The highest content of lactoperoxidase (22 units per which causes inhibition of growth and/or death of the micro­ ml) has been reported for guinea pig milk (41). organism (30). The hypothiocyanite ion can be formed by In human saliva, lactoperoxidase has a role similar to that in mixing the components (lactoperoxidase, thiocyanate, and milk. As a component of the LP system, it is involved in the hydrogen peroxide) of the LP system together. inhibition of streptococci which promote dental carries (32). The The lactoperoxidase antimicrobial system is a naturally human infant already possesses salivary lactoperoxidase during the occurring system which has been proven to be both bacteriostatic first few days after birth (32). and bactericidal to a variety of gram-positive and gram-negative microorganisms (29). The LP system can alter many cellular Thiocyanate (SCN) systems, including the outer membrane, cell wall, cytoplasmic The thiocyanate anion is widely distributed in animal tissues membrane, transport systems, glycolytic enzymes, and nucleic and secretions. Thiocyanate is largely a constituent of the extracel­ acids. Nonpathogenic bacteria (5,8,9,23,26-28,36,39,40) as well lular fluid. It is, however, concentrated by certain cells of the body. as pathogenic bacteria (4,6,7,10,12-15,21,33,34,38) have been Whereas the blood serum concentration of thiocyanate is 0.1-0.3 mg%, the salivary concentration has been estimated at 1-27 mg% shown to be inhibited or killed by the LP system. (24). The level of thiocyanate is related to diet and habits such as This paper begins with a general discussion of the LP smoking. Thiocyanate is excreted mainly in the urine, and with system and then provides information about the antibacterial normal renal functions, the half-life of elimination is 2 to 5 d (32). activity of the LP system against specific nonpathogenic and The thiocyanate concentration of bovine milk, which varies with pathogenic bacteria. breed, species, and type of feed, has been estimated at 0.1-1.5 mg% (24). COMPONENTS OF THE LP SYSTEM There are two major dietary sources of thiocyanate, glucosinolates, and cyanogenic glucosides. Vegetables belonging to The LP system is made up of three components: the genus Brassica (family Cruciferae), such as cabbage, kale, lactoperoxidase, thiocyanate, and hydrogen peroxide. brussel sprouts, cauliflower, turnips and rutabaga, are particularly rich in glucosinolates, which upon hydrolysis yield thiocyanate in Lactoperoxidase (LP) addition to other reaction products (32). Peroxidases are defined as enzymes whose primary function is Cyanogenic glucosides are also found in cassava, potatoes, to oxidize molecules at the expense of hydrogen peroxide (32). maize, millet, sugar cane, peas, and beans. When hydrolyzed, glucosides release cyanide, which in a reaction with thiosulfate Published as Paper No. 10320, Journal Series, Nebraska Agricultural (metabolic product of sulfur-containing amino acids) is detoxified Research Division, Lincoln, NE 68583-0919. by conversion into thiocyanate (32). The latter reaction is catalyzed JOURNAL OF FOOD PROTECTION, VOL. 56, OCTOBER 1993 WOLFSON AND SUMNER + by the enzyme rhodanase (52). Cyanide from tobacco smoke is Protein-S-SCN + H20 <- - - > Protein-S-OH + SCN' + H metabolized in the same way. Also, sulfenyl derivatives can undergo slow oxidation to sulfonic Hydrogen peroxide acids (35). The SCN moiety can be displaced from sulfenyl thio­ Hydrogen peroxide is the third component of the cyanate by reduction with a sulfhydryl compound, such as lactoperoxidase system. Hydrogen peroxide may be formed endo- dithiothreitol (35). When all the protein sulfhydryls are oxidized by genously. Many lactobacilli, lactococci, and streptococci produce (SCN)2 or SCN", tyrosine, tryptophan, and histidine residues are sufficient hydrogen peroxide under aerobic conditions to activate modified (35). Release of SCN" from sulfenyl thiocyanate is fa­ the LP system. Hydrogen peroxide may also be added or may be vored at low SCN" concentration (2). When SCN" is released, it can generated by the addition of one of a number of hydrogen peroxide- be reoxidized and participate in the oxidation of another sulfhydryl. generating systems. Among the latter are the oxidation of ascorbic As illustrated (Fig. 1) with OSCN", the oxidation of sulfhydr­ acid, the oxidation of glucose by glucose oxidase, the oxidation of yls to sulfenic acid does not consume SCN". Therefore, the amount hypoxanthine by xanthine oxidase, or the manganese-dependent of sulfhydryls oxidized does not depend on the amount of SCN" (2). aerobic oxidation of reduced pyridine nucleotides by peroxidase (24). According to Klebanoff et al. (24), a hydrogen peroxide- H SCN, Protein-S-OH generating system is more effective than added hydrogen peroxide 2°2 Downloaded from http://meridian.allenpress.com/jfp/article-pdf/56/10/887/1664249/0362-028x-56_10_887.pdf by guest on 24 September 2021 as a component of the antimicrobial system. Lactoperoxidase Protein-S-SCN MODE OF ACTION The lactoperoxidase catalyzed reaction yields short-lived inter­ t^O OSCN Protein-SH mediary oxidation products of SCN", which may be further oxi­ Figure 1. Oxidation of sulfhydryls. dized to end-products such as sulfate, C02, and ammonia or may be reduced back to SCN (32). Most researchers agree that the major THE HYPOTHIOCYANITE ION (OSCN) intermediary oxidation product is hypothiocyanite, OSCN" (2,19,20,24,30,32,35). It is proposed that peroxidase-catalyzed oxi­ As stated previously, the hypothiocyanite ion is believed to be dation of SCN" results in the accumulation of OSCN" (32). The the major intermediary oxidation product of the LP system. OSCN" hypothiocyanite ion can be produced by two different pathways. - can be considered the hypohalite of thiocyanogen (SCN)2, whose The oxidation of SCN may yield thiocyanogen (SCN)2, which chemical characteristics are similar to those of other hypohalites, hydrolyzes rapidly to yield hypothiocyanous acid (HOSCN), or including stability in ionic form but instability as the acid (20). OSCN. Many factors affect the stability of hypothiocyanite. The decomposition of OSCN" is strongly dependent on the pH of the Peroxidase solution; OSCN" is more stable at pH 7.5 than pH 5.0 (20). OSCN + 2SCN- + H202 + 2H >(SCN)2 + 2H20 solutions are sensitive to light, yet they are very heat stable (20). Stability of OSCN" solutions decrease on addition of metal ions (Fe, + (SCN)2 + H20 > HOSCN + SCN" + H Ni, Cu, Mn, etc.), glycerol, and ammonium sulfate, as well as the removal of lactoperoxidase (20). + HOSCN<- > H + OSCN Several analytical methods for the estimation of OSCN" have been used. These methods are based either on the reduction of Alternatively, SCN" may be oxidized directly to OSCN". OSCN" to SCN", which can be assayed by the iron-complex method, or on the oxidation of 5-thio-2-nitrobenzoic acid to the colorless Peroxidase disulfide compound 5,5'
Load more

Recommended publications
  • Elevated Hydrogen Peroxide and Decreased Catalase and Glutathione
    Sullivan-Gunn and Lewandowski BMC Geriatrics 2013, 13:104 http://www.biomedcentral.com/1471-2318/13/104 RESEARCH ARTICLE Open Access Elevated hydrogen peroxide and decreased catalase and glutathione peroxidase protection are associated with aging sarcopenia Melanie J Sullivan-Gunn1 and Paul A Lewandowski2* Abstract Background: Sarcopenia is the progressive loss of skeletal muscle that contributes to the decline in physical function during aging. A higher level of oxidative stress has been implicated in aging sarcopenia. The current study aims to determine if the higher level of oxidative stress is a result of increased superoxide (O2‾ ) production by the NADPH oxidase (NOX) enzyme or decrease in endogenous antioxidant enzyme protection. Methods: Female Balb/c mice were assigned to 4 age groups; 6, 12, 18 and 24 months. Body weight and animal survival rates were recorded over the course of the study. Skeletal muscle tissues were collected and used to measure NOX subunit mRNA, O2‾ levels and antioxidant enzymes. Results: Key subunit components of NOX expression were elevated in skeletal muscle at 18 months, when sarcopenia was first evident. Increased superoxide dismutase 1 (SOD1) activity suggests an increase in O2‾ dismutation and this was further supported by elevated levels of hydrogen peroxide (H2O2) and decline in catalase and glutathione peroxidase (GPx) antioxidant protection in skeletal muscle at this time. NOX expression was also higher in skeletal muscle at 24 months, however this was coupled with elevated levels of O2‾ and a decline in SOD1 activity, compared to 6 and 12 months but was not associated with further loss of muscle mass.
    [Show full text]
  • Catalase and Oxidase Test
    CATALASE TEST Catalase is the enzyme that breaks hydrogen peroxide (H 2O2) into H 2O and O 2. Hydrogen peroxide is often used as a topical disinfectant in wounds, and the bubbling that is seen is due to the evolution of O 2 gas. H 2O2 is a potent oxidizing agent that can wreak havoc in a cell; because of this, any cell that uses O 2 or can live in the presence of O 2 must have a way to get rid of the peroxide. One of those ways is to make catalase. PROCEDURE a. Place a small amount of growth from your culture onto a clean microscope slide. If using colonies from a blood agar plate, be very careful not to scrape up any of the blood agar— blood cells are catalase positive and any contaminating agar could give a false positive. b. Add a few drops of H 2O2 onto the smear. If needed, mix with a toothpick. DO NOT use a metal loop or needle with H 2O2; it will give a false positive and degrade the metal. c. A positive result is the rapid evolution of O 2 as evidenced by bubbling. d. A negative result is no bubbles or only a few scattered bubbles. e. Dispose of your slide in the biohazard glass disposal container. Dispose of any toothpicks in the Pipet Keeper. OXIDASE TEST Basically, this is a test to see if an organism is an aerobe. It is a check for the presence of the electron transport chain that is the final phase of aerobic respiration.
    [Show full text]
  • Myeloperoxidase Mediates Cell Adhesion Via the Αmβ2 Integrin (Mac-1, Cd11b/CD18)
    Journal of Cell Science 110, 1133-1139 (1997) 1133 Printed in Great Britain © The Company of Biologists Limited 1997 JCS4390 Myeloperoxidase mediates cell adhesion via the αMβ2 integrin (Mac-1, CD11b/CD18) Mats W. Johansson1,*, Manuel Patarroyo2, Fredrik Öberg3, Agneta Siegbahn4 and Kenneth Nilsson3 1Department of Physiological Botany, University of Uppsala, Villavägen 6, S-75236 Uppsala, Sweden 2Microbiology and Tumour Biology Centre, Karolinska Institute, PO Box 280, S-17177 Stockholm, Sweden 3Department of Pathology, University of Uppsala, University Hospital, S-75185 Uppsala, Sweden 4Department of Clinical Chemistry, University of Uppsala, University Hospital, S-75185 Uppsala, Sweden *Author for correspondence (e-mail: [email protected]) SUMMARY Myeloperoxidase is a leukocyte component able to to αM (CD11b) or to β2 (CD18) integrin subunits, but not generate potent microbicidal substances. A homologous by antibodies to αL (CD11a), αX (CD11c), or to other invertebrate blood cell protein, peroxinectin, is not only integrins. Native myeloperoxidase mediated dose- a peroxidase but also a cell adhesion ligand. We demon- dependent cell adhesion down to relatively low concen- strate in this study that human myeloperoxidase also trations, and denaturation abolished the adhesion mediates cell adhesion. Both the human myeloid cell line activity. It is evident that myeloperoxidase supports cell HL-60, when differentiated by treatment with 12-O- adhesion, a function which may be of considerable tetradecanoyl-phorbol-13-acetate (TPA) or retinoic acid, importance for leukocyte migration and infiltration in and human blood leukocytes, adhered to myeloperoxi- inflammatory reactions, that αMβ2 integrin (Mac-1 or dase; however, undifferentiated HL-60 cells showed only CD11b/CD18) mediates this adhesion, and that the αMβ2 minimal adhesion.
    [Show full text]
  • Francisella Tularensis 6/06 Tularemia Is a Commonly Acquired Laboratory Colony Morphology Infection; All Work on Suspect F
    Francisella tularensis 6/06 Tularemia is a commonly acquired laboratory Colony Morphology infection; all work on suspect F. tularensis cultures .Aerobic, fastidious, requires cysteine for growth should be performed at minimum under BSL2 .Grows poorly on Blood Agar (BA) conditions with BSL3 practices. .Chocolate Agar (CA): tiny, grey-white, opaque A colonies, 1-2 mm ≥48hr B .Cysteine Heart Agar (CHA): greenish-blue colonies, 2-4 mm ≥48h .Colonies are butyrous and smooth Gram Stain .Tiny, 0.2–0.7 μm pleomorphic, poorly stained gram-negative coccobacilli .Mostly single cells Growth on BA (A) 48 h, (B) 72 h Biochemical/Test Reactions .Oxidase: Negative A B .Catalase: Weak positive .Urease: Negative Additional Information .Can be misidentified as: Haemophilus influenzae, Actinobacillus spp. by automated ID systems .Infective Dose: 10 colony forming units Biosafety Level 3 agent (once Francisella tularensis is . Growth on CA (A) 48 h, (B) 72 h suspected, work should only be done in a certified Class II Biosafety Cabinet) .Transmission: Inhalation, insect bite, contact with tissues or bodily fluids of infected animals .Contagious: No Acceptable Specimen Types .Tissue biopsy .Whole blood: 5-10 ml blood in EDTA, and/or Inoculated blood culture bottle Swab of lesion in transport media . Gram stain Sentinel Laboratory Rule-Out of Francisella tularensis Oxidase Little to no growth on BA >48 h Small, grey-white opaque colonies on CA after ≥48 h at 35/37ºC Positive Weak Negative Positive Catalase Tiny, pleomorphic, faintly stained, gram-negative coccobacilli (red, round, and random) Perform all additional work in a certified Class II Positive Biosafety Cabinet Weak Negative Positive *Oxidase: Negative Urease *Catalase: Weak positive *Urease: Negative *Oxidase, Catalase, and Urease: Appearances of test results are not agent-specific.
    [Show full text]
  • SUPPLEMENTARY DATA Supplementary Figure 1. The
    SUPPLEMENTARY DATA Supplementary Figure 1. The results of Sirt1 activation in primary cultured TG cells using adenoviral system. GFP expression served as the control (n = 4 per group). Supplementary Figure 2. Two different Sirt1 activators, SRT1720 (0.5 µM or 1 µM ) and RSV (1µM or 10µM), induced the upregulation of Sirt1 in the primary cultured TG cells (n = 4 per group). ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary Table 1. Primers used in qPCR Gene Name Primer Sequences Product Size (bp) Sirt1 F: tgccatcatgaagccagaga 241 (NM_001159589) R: aacatcgcagtctccaagga NOX4 F: tgtgcctttattgtgcggag 172 (NM_001285833.1) R: gctgatacactggggcaatg Supplementary Table 2. Antibodies used in Western blot or Immunofluorescence Antibody Company Cat. No Isotype Dilution Sirt1 Santa Cruz * sc-15404 Rabbit IgG 1/200 NF200 Sigma** N5389 Mouse IgG 1/500 Tubulin R&D# MAB1195 Mouse IgG 1/500 NOX4 Abcam† Ab133303 Rabbit IgG 1/500 NOX2 Abcam Ab129068 Rabbit IgG 1/500 phospho-AKT CST‡ #4060 Rabbit IgG 1/500 EGFR CST #4267 Rabbit IgG 1/500 Ki67 Santa Cruz sc-7846 Goat IgG 1/500 * Santa Cruz Biotechnology, Santa Cruz, CA, USA ** Sigma aldrich, Shanghai, China # R&D Systems Inc, Minneapolis, MN, USA † Abcam, Inc., Cambridge, MA, USA ‡ Cell Signaling Technology, Inc., Danvers, MA, USA ©2016 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db15-1283/-/DC1 SUPPLEMENTARY DATA Supplementary
    [Show full text]
  • Peroxisomal Disorders and Their Mouse Models Point to Essential Roles of Peroxisomes for Retinal Integrity
    International Journal of Molecular Sciences Review Peroxisomal Disorders and Their Mouse Models Point to Essential Roles of Peroxisomes for Retinal Integrity Yannick Das, Daniëlle Swinkels and Myriam Baes * Lab of Cell Metabolism, Department of Pharmaceutical and Pharmacological Sciences, KU Leuven, 3000 Leuven, Belgium; [email protected] (Y.D.); [email protected] (D.S.) * Correspondence: [email protected] Abstract: Peroxisomes are multifunctional organelles, well known for their role in cellular lipid homeostasis. Their importance is highlighted by the life-threatening diseases caused by peroxisomal dysfunction. Importantly, most patients suffering from peroxisomal biogenesis disorders, even those with a milder disease course, present with a number of ocular symptoms, including retinopathy. Patients with a selective defect in either peroxisomal α- or β-oxidation or ether lipid synthesis also suffer from vision problems. In this review, we thoroughly discuss the ophthalmological pathology in peroxisomal disorder patients and, where possible, the corresponding animal models, with a special emphasis on the retina. In addition, we attempt to link the observed retinal phenotype to the underlying biochemical alterations. It appears that the retinal pathology is highly variable and the lack of histopathological descriptions in patients hampers the translation of the findings in the mouse models. Furthermore, it becomes clear that there are still large gaps in the current knowledge on the contribution of the different metabolic disturbances to the retinopathy, but branched chain fatty acid accumulation and impaired retinal PUFA homeostasis are likely important factors. Citation: Das, Y.; Swinkels, D.; Baes, Keywords: peroxisome; Zellweger; metabolism; fatty acid; retina M. Peroxisomal Disorders and Their Mouse Models Point to Essential Roles of Peroxisomes for Retinal Integrity.
    [Show full text]
  • Kinetic Approaches to Measuring Peroxiredoxin Reactivity
    Mol. Cells 2016; 39(1): 26-30 http://dx.doi.org/10.14348/molcells.2016.2325 Molecules and Cells http://molcells.org Established in 1990 Kinetic Approaches to Measuring Peroxiredoxin Reactivity Christine C. Winterbourn*, and Alexander V. Peskin Peroxiredoxins are ubiquitous thiol proteins that catalyse demonstrated surprisingly low reactivity with thiol reagents such the breakdown of peroxides and regulate redox activity in as iodoacetamide and other oxidants such as chloramines the cell. Kinetic analysis of their reactions is required in (Peskin et al., 2007) and it is clear that the low pKa of the active order to identify substrate preferences, to understand how site thiol is insufficient to confer the high peroxide reactivity. In molecular structure affects activity and to establish their fact, typical low molecular weight and protein thiolates react -1 -1 physiological functions. Various approaches can be taken, with H2O2 with a rate constant of 20 M s whereas values of including the measurement of rates of individual steps in Prxs are 105-106 fold higher (Winterbourn and Hampton, 2008). the reaction pathway by stopped flow or competitive kinet- An elegant series of structural and mutational studies (Hall et al., ics, classical enzymatic analysis and measurement of pe- 2010; Nakamura et al., 2010; Nagy et al., 2011) have shown roxidase activity. Each methodology has its strengths and that to get sufficient rate enhancement, it is necessary to acti- they can often give complementary information. However, vate the peroxide. As discussed in detail elsewhere (Hall et al., it is important to understand the experimental conditions 2010; 2011), this involves formation of a transition state in of the assay so as to interpret correctly what parameter is which hydrogen bonding of the peroxide to conserved Arg and being measured.
    [Show full text]
  • Understanding the Structure and Function of Catalases: Clues from Molecular Evolution and in Vitro Mutagenesis
    PERGAMON Progress in Biophysics & Molecular Biology 72 (1999) 19±66 Understanding the structure and function of catalases: clues from molecular evolution and in vitro mutagenesis Marcel Za mocky *, Franz Koller Institut fuÈr Biochemie and Molekulare Zellbiologie and Ludwig Boltzmann Forschungsstelle fuÈr Biochemie, Vienna Biocenter, Dr. Bohr-Gasse 9, A-1030 Wien, Austria Abstract This review gives an overview about the structural organisation of dierent evolutionary lines of all enzymes capable of ecient dismutation of hydrogen peroxide. Major potential applications in biotechnology and clinical medicine justify further investigations. According to structural and functional similarities catalases can be divided in three subgroups. Typical catalases are homotetrameric haem proteins. The three-dimensional structure of six representatives has been resolved to atomic resolution. The central core of each subunit reveals a chracteristic ``catalase fold'', extremely well conserved among this group. In the native tetramer structure pairs of subunits tightly interact via exchange of their N- terminal arms. This pseudo-knot structures implies a highly ordered assembly pathway. A minor subgroup (``large catalases'') possesses an extra ¯avodoxin-like C-terminal domain. A r25AÊ long channel leads from the enzyme surface to the deeply buried active site. It enables rapid and selective diusion of the substrates to the active center. In several catalases NADPH is tightly bound close to the surface. This cofactor may prevent and reverse the formation of compound II, an inactive reaction intermediate. Bifunctional catalase-peroxidases are haem proteins which probably arose via gene duplication of an ancestral peroxidase gene. No detailed structural information is currently available. Even less is know about manganese catalases.
    [Show full text]
  • Lactoperoxidase Antibacterial System: Natural Occurrence, Biological Functions and Practical Applications
    724 Journal of Food Protection, Vol. 47. No. 9, Pages 724-732 (September 1984) Copyright®, International Association of Milk, Food, and Environmental Sanitarians Lactoperoxidase Antibacterial System: Natural Occurrence, Biological Functions and Practical Applications BRUNO REITER1 and GORAN HARNULV2* Downloaded from http://meridian.allenpress.com/jfp/article-pdf/47/9/724/1650811/0362-028x-47_9_724.pdf by guest on 29 September 2021 National Institute for Research in Dairying, Shinfield, Reading, RG2 9AT, England and Alfa-Laval Agri International AS, P.O. Box 39, S-I47 00 Tumba, Sweden (Received for publication January 30, 1984) ABSTRACT (37,80). The various biological functions of the LP sys­ tem, which have now been established, will be discussed In the present review dealing with the antibacterial lac­ below. toperoxidase (LP) system, it is shown that the two reactants In recent years, much work has been devoted to practi­ thiocyanate (SCN~) and hydrogen peroxide (H202) as well as cal applications of the LP system. The effect against oral the catalytic enzyme lactoperoxidase (LP) are widely distributed streptococci (5,19,33,101,105,107) has led to the de­ in nature and that evidence for the activity of the LP system velopment and marketing of a toothpaste containing nec­ in animals, including man, is accumulating. The in vitro effects on bacterial and animal cells are discussed and the unique ac­ essary ingredients to activate the LP system. Promising tion of the LP system on the bacterial cytoplasmic membrane results have also been obtained when including activating is pointed out. Some practical applications are also presented, components in the feed to calves (81,83,86) with the aim with particular emphses on the possibility of utilizing the LP of potentiating the LP system in the intestinal tract.
    [Show full text]
  • Protein Engineering of a Dye Decolorizing Peroxidase from Pleurotus Ostreatus for Efficient Lignocellulose Degradation
    Protein Engineering of a Dye Decolorizing Peroxidase from Pleurotus ostreatus For Efficient Lignocellulose Degradation Abdulrahman Hirab Ali Alessa A thesis submitted in partial fulfilment of the requirements for the degree of Doctor of Philosophy The University of Sheffield Faculty of Engineering Department of Chemical and Biological Engineering September 2018 ACKNOWLEDGEMENTS Firstly, I would like to express my profound gratitude to my parents, my wife, my sisters and brothers, for their continuous support and their unconditional love, without whom this would not be achieved. My thanks go to Tabuk University for sponsoring my PhD project. I would like to express my profound gratitude to Dr Wong for giving me the chance to undertake and complete my PhD project in his lab. Thank you for the continuous support and guidance throughout the past four years. I would also like to thank Dr Tee for invaluable scientific discussions and technical advices. Special thanks go to the former and current students in Wong’s research group without whom these four years would not be so special and exciting, Dr Pawel; Dr Hossam; Dr Zaki; Dr David Gonzales; Dr Inas,; Dr Yomi, Dr Miriam; Jose; Valeriane, Melvin, and Robert. ii SUMMARY Dye decolorizing peroxidases (DyPs) have received extensive attention due to their biotechnological importance and potential use in the biological treatment of lignocellulosic biomass. DyPs are haem-containing peroxidases which utilize hydrogen peroxide (H2O2) to catalyse the oxidation of a wide range of substrates. Similar to naturally occurring peroxidases, DyPs are not optimized for industrial utilization owing to their inactivation induced by excess amounts of H2O2.
    [Show full text]
  • Significance of Peroxidase in Eosinophils Margaret A
    University of Colorado, Boulder CU Scholar Series in Biology Ecology & Evolutionary Biology Spring 4-1-1958 Significance of peroxidase in eosinophils Margaret A. Kelsall Follow this and additional works at: http://scholar.colorado.edu/sbio Recommended Citation Kelsall, Margaret A., "Significance of peroxidase in eosinophils" (1958). Series in Biology. 14. http://scholar.colorado.edu/sbio/14 This Article is brought to you for free and open access by Ecology & Evolutionary Biology at CU Scholar. It has been accepted for inclusion in Series in Biology by an authorized administrator of CU Scholar. For more information, please contact [email protected]. SIGNIFICANCE OF PEROXIDASE IN EOSINOPHILS M a rg a ret A . K e lsa ll Peroxidase-bearing granules are the primary component and product of eosino­ phils. The physiological significance of eosinophils is, therefore, considered to be related to the ability of this cell to synthesize, store, and transport peroxidase and to release the peroxidase-positive granules into body fluids by a lytic process that is controlled by hormones, by variations in the histamine-epinephrine balance, and by several other stimuli. Peroxidase occurs not only in eosinophils, but also in neutrophils and blood platelets; but it is not present in most cells of animal tissues. The purpose of this work is to consider, as a working hypothesis, that the function of eosinophils is to produce, store, and transport peroxidase to catalyze oxidations. Many of the aerobic dehydrogenases that catalyze reactions in which hydrogen peroxide is produced are involved in protein catabolism. Therefore, relations between eosinophils and several normal and pathological conditions of increased protein catabolism are emphasized, and also the significance of peroxi­ dase in eosinophils and other leukocytes to H 20 2 produced by irradiation is considered.
    [Show full text]
  • Respiration Triggers Heme Transfer from Cytochrome C Peroxidase to Catalase in Yeast Mitochondria
    Respiration triggers heme transfer from cytochrome c peroxidase to catalase in yeast mitochondria Meena Kathiresan, Dorival Martins, and Ann M. English1 Quebec Network for Research on Protein Function, Structure, and Engineering and Department of Chemistry and Biochemistry, Concordia University, Montreal, QC, Canada, H4B 1R6 Edited by Harry B. Gray, California Institute of Technology, Pasadena, CA, and approved October 14, 2014 (received for review May 24, 2014) In exponentially growing yeast, the heme enzyme, cytochrome c per- Because Ccp1 production is not under O2/heme control (4, 5), oxidase (Ccp1) is targeted to the mitochondrial intermembrane space. CCP activity is assumed to be the frontline defense in the mito- When the fermentable source (glucose) is depleted, cells switch to chondria, a major source of reactive oxygen species (ROS) in respiration and mitochondrial H2O2 levels rise. It has long been as- respiring cells (7). Contrary to the time-honored assumption that sumed that CCP activity detoxifies mitochondrial H2O2 because of the Ccp1 catalytically consumes the H2O2 produced during aerobic efficiency of this activity in vitro. However, we find that a large pool respiration (8), recent studies in our group reveal that the per- of Ccp1 exits the mitochondria of respiring cells. We detect no extra- oxidase behaves more like a mitochondrial H2O2 sensor than mitochondrial CCP activity because Ccp1 crosses the outer mitochon- a catalytic H2O2 detoxifier (9–11). Notably, Ccp1 competes with drial membrane as the heme-free protein. In parallel with apoCcp1 complex IV for reducing equivalents from Cyc1, which shuttles export, cells exhibit increased activity of catalase A (Cta1), the mito- electrons from complex III (ubiquinol cytochrome c reductase) chondrial and peroxisomal catalase isoform in yeast.
    [Show full text]