Phylogenetic Systematics of the Supragenus Rasbora (Teleostei: Cyprinidae)

by Daniel Natanael Lumbantobing

B.S. in Biology, December 2004, Universitas Indonesia, Depok, Indonesia

A Dissertation submitted to

The Faculty of Columbian College of Arts and Sciences of The George Washington University in partial fulfillment of the requirements for the degree of Doctor of Philosophy

January 31, 2013

Dissertation directed by

John R. Burns Professor of Biology

Lynne R. Parenti Research Scientist, National Museum of Natural History, Smithsonian Institution

The Columbian College of Arts and Sciences of The George Washington University certifies that Daniel Natanael Lumbantobing has passed the Final Examination for the degree of Doctor of Philosophy as of November 29, 2012. This is the final and approved form of the dissertation.

Phylogenetic Systematics of the Supragenus Rasbora (Teleostei: Cyprinidae)

Daniel Natanael Lumbantobing

Dissertation Research Committee:

John R. Burns, Professor of Biology, Dissertation Co-Director

Lynne R. Parenti, Research Scientist, National Museum of Natural History,

Smithsonian Institution, Dissertation Co-Director

Guillermo Ortí, Louis Weintraub Associate Professor of Biology,

Committee Member

Richard P. Vari, Research Scientist, National Museum of Natural History,

Smithsonian Institution, Committee Member

iii

Dedication

To my home-archipelago, Indonesia, and its people…

To my loving parents: my late father Nukman Lumban Tobing, for his constant presence, despite being no longer with us, that constantly reverberates in my thought as a great person, and most importantly, his momentous encouragement, despite his non-scientific background, that helped me to set my life fixed on becoming a biologist; such a

“serendipitous path” that I had never thought of pursuing during my fledgling pre-college years (and neither had he then); and my mother, Siti Mariam Manoppo, whose passionate care, relentless patience, and devoted encouragement keep nourishing me with hope and optimism.

…Science is perhaps one gigantic jigsaw puzzle game with its countless

pieces; the puzzle that tells us about the nature of our own universe… I wish

to always just be a player of this stunning game... who can assemble a few

of its puzzling pieces into a bigger picture, thus, to contribute more to our

understanding about this universe… who, at the end of the day, may sip his

cup of tea while enjoying a portion of the universe’s masterpiece through

the everlasting scholarly records…

~Depok, Indonesia, 2004

Acknowledgments

The seven year process of making this dissertation would not have been possibly completed without the help, support, and encouragement of many great individuals, to whom I hereby wholeheartedly acknowledge.

I would like to thank my co-advisors, Lynne Parenti and John Burns, for their insightful knowledge and wisdom, let alone their unwavering patience in giving me the guidance to understand what and how science is, and also the encouragement through all ups and downs during these past seven years. It has been indeed an absolute privilege and a great pleasure to have both of them as my scientific supervisors. I would like to express my gratitude to the members of my dissertation committee for their time, perspectives, and constructive criticisms. I thank Richard Vari and Guillermo Ortí whose feedback has been very instrumental in shaping the final version of this dissertation as well as my training as an ichthyologist. I am grateful to Patricia Hernandez and Eric Hilton for their constructive criticisms in improving this dissertation. I am also grateful to all the professors in the Department of Biological Sciences at GWU, especially to Diana

Lipscomb, Gustavo Hormiga, and James Clark.

Also, a number of people to whom I am indebted for their expertise, technical supports and contributions, without which this dissertation would not have been finalized as it is. I deeply appreciate and acknowledge some people in the Fish Division,

Smithsonian Institution, for their help: Jeff Williams, Jeff Clayton, Sandra Raredon, Kris

Murphy, and Jerry Finan. For lengthy scientific discussion and insightful knowledge, I am indebted with Renny Hadiaty, Maurice Kottelat, Prosanta Chakrabarty, Ralf Britz,

Tan Heok Hui, Kevin Tang, Larry Page, Kevin Conway, Dave Johnson, John Sparks,

Peter Konstantinidis, and Nalani Schnell. For assistance during the field work, I thank

Renny Hadiaty, Deden Rudaya, Ni Made Rai, Archimedes Daely, and Heri Chin. For tissue samples and specimen loan, I thank Renny Hadiaty, Tan Heok Hui, Lukas Rüber,

Kevin Tang, Hendra Budianto, Mark Sabaj Perez, Rob Robbins, Kelvin Lim, Patrick

Campbell, Oliver Crimmen, Barbara Brown, Martin Van Oijen, Ronald de Ruiter, Ronald

Vonk, and Hielke Praagman. Lee Weigt kindly permitted access to the Laboratory of

Analytical Biology (LAB) of Smithsonian Institution. I thank people in LAB who kindly assisted me in solving problems of molecular labwork: Jeff Hunt, Gabe Johnson, Andrea

Ormos, and Maggie Halloran.

Many thanks to all my friends for all the supports, intellectual sharing and great friendship during the process of finishing this dissertation: Renny Widjojo, Vinita

Gowda, Maria Rosario Castañeda, Deden Rudaya, Rob Javonillo, Ryuji Machida, Heri

Chin, Cristiano Moreira, Ximo Mengual, Matthieu Leray, Jeffrey Sosa, Katie Staab,

Fiona Wilkinson, Dan Mulcahy, Amanda Windsor, Ligia Benavides, and Ehsan Kayal. I am grateful to my relatives in DC for the caring support: Anton Manoppo, Ifa Ishak,

Emmy Hoover, Bambang Suroso, Monalisa Bambang, Fari Nasution, Mayang Nasution,

Ira Istarina, and Bramanda Arioboma. Finally, last but not least, to my family who are always with me: my late father (Nukman Lumban Tobing), mother (Siti Mariam

Manoppo), my brothers and sister (Sinar Anton Lumbantobing, Anita Triani Tobing, and

M. Ery Syahruni).

This dissertation research was funded by the Herbert R. and Evelyn Axelrod Fund and the Leonard P. Schultz Funds from the Division of Fishes, Smithsonian Institution;

vi the Weintraub Fellowship in Biological Sciences of GWU; a fieldwork grant from All

Catfish Species Inventaory (ACSI); and the Student Exchange Program from the DeepFin

Project 2007.

vii

Abstract of Dissertation

Phylogenetic Systematics of the Supragenus Rasbora (Teleostei: Cyprinidae)

The fishes of the supragenus Rasbora, with 104 valid species, comprise among the most species-rich and widespread lineages of cyprinids that live throughout a vast expanse from the subcontinent India through Southeast Asia as far south as Sundaland. Despite its remarkable diversity, high abundance, and broad distribution, the systematics of Rasbora is highly problematic primarily due to the conflicting phylogenetic hypotheses among previous studies. A multifaceted systematic study incorporating more taxa and characters of Rasbora, which encompasses the alpha-taxonomic work of Rasbora as well as phylogenetic analyses using both morphology and molecules, was conducted to resolve the current systematic disagreement and taxonomic problems of the group.

The alpha-taxonomic study in the present study results in the description of eight new species of Rasbora from northern Sumatra: Rasbora api, R. kluetensis, R. nodulosa, R. truncata, Rasbora n. sp. 1, Rasbora n. sp. 2, Rasbora n. sp. 3, and Rasbora n. sp. 4. In addition, a new set of characters useful to diagnose for two rasborin groups, the Reticulata and Sumatrana groups, were described (i.e., the microstructure of the cephalic tubercles and the body pigmentations). Given the allopatric distribution of three of the aforementioned new species, three areas of endemism in northwestern Sumatra are recognized.

Cladistic analysis of Rasbora was performed using a dataset containing 274 morphological characters coded for 97 taxa (70 ingroups, 27 outgroups) under the maximum parsimony algorithm, which resulted in a total of 3,411 most parsimonious trees with 1,111 steps length (CI = 0.42; RI 0.57; RI = 0.88; RC = 0.37). The topology of the

viii consensus tree recovered the monophyly of the supragenus Rasbora with high nodal support and five unique synapomorphies. Twelve major monophyletic lineages corresponding to the previously recognized supraspecific groups of Rasbora were recovered in the topology, each of which with moderate to strong nodal support and with a set of unreversed synapomorphies. Moreover, the monophyly of several featured cyprinid taxa is supported with a series of novel unreversed synapomorphies: (1) the subfamily

Danioninae; (2) the clade Danionini+Rasborini; (3) the tribe Chedrini; (4) the tribe

Danionini; and (5) the tribe Rasborini.

Seven genetic markers, which are four nuclear genes (EPIC 55305, EPIC 35692,

RAG1, and Rhodopsin) and three mitochondrial regions (16S rRNA, COI, and cytochrome b) sequenced from 93 taxa (80 ingroups, 13 outgroups) were used in the present molecular analyses. The phylogenetic trees were reconstructed based on several different datasets

(i.e., individual markers, concatenated datamatrix with different partitioning scenarios) under three general phylogenetic algorithms (maximum parsimony, maximum likelihood, and Bayesian inference). Overall, the three different phylogenetic approaches result in trees with similar topologies of the backbone, in which two major clades of the tribe Rasborini are recovered consistently with high support values: (1) the Indian lineage (12 species), and

(2) the Sundaland-Indochinese lineage (92 species). Similar to results from previous molecular studies, Rasbora is inferred to be paraphyletic because the genus Pectenocypris is embedded in the large, Sundaland-Indochinese lineage.

The validity of five rasborin genera is corroborated: Boraras, Brevibora, Kottelatia,

Rasbosoma, and Trigonostigma. Two formerly monotypic genera, Kottelatia and

Rasbosoma, need to be expanded through species transfer and generic synonymization. The

ix validity of the genus Trigonopoma cannot be confirmed in this study due to the rejection of its monophyly as indicated by molecular data. Four major groups are still without valid taxonomic status: the Daniconius group; the Trifasciata group; the Reticulata group; and the Sumatrana group. Considering the inconsistent placement of R. cephalotaenia, the type species of Rasbora, either in the Einthovenii group or the Argyrotaenia group, the more exclusive definition of Rasbora s. s. is reserved to either of these two groups.

Table of Contents

Dedication………………………………………………………………………………...iv

Acknowledgments………………………………………………………………………...v

Abstract of Dissertation…………………………………………………………………viii

List of Figures……………………………………………………………………………xii

List of Tables………………………………………………………………………….....xv

Chapter 1: Introduction…………………………………………………………………...1

Chapter 2: Description of Eight New Species of the Supragenus Rasbora (Teleostei: Cyprinidae) from Northern Sumatra……………………………………….………17

Chapter 3: Morphological Phylogeny of the Supragenus Rasbora…………………….142

Chapter 4: Molecular Phylogeny of the Supragenus Rasbora……………….………...346

Chapter 5: Comparison of Phylogenetic Results Based on Morphological and Molecular Data for the Systematics of the Supragenus Rasbora..……………….399

Chapter 6: Conclusion………………………………………………………………….418

References………………………………………………………………….…………..422

Appendices……………………………………………………………….…………….449

List of Figures

Figure 1.1………………………………………………………………………………...12

Figure 1.2.………………………………………………………………………………..14

Figure 2.1.………………………………………………………………………………..98

Figure 2.2.………………………………………………………………………………100

Figure 2.3.………………………………………………………………………………102

Figure 2.4.………………………………………………………………………………104

Figure 2.5.………………………………………………………………………………106

Figure 2.6.………………………………………………………………………………108

Figure 2.7.………………………………………………………………………………110

Figure 2.8.………………………………………………………………………………112

Figure 2.9.………………………………………………………………………………114

Figure 2.10...……………………………………………………………………………116

Figure 2.11.…..…………………………………………………………………………118

Figure 2.12….,.…………………………………………………………………………120

Figure 2.13...……………………………………………………………………………122

Figure 2.14…...…………………………………………………………………………124

Figure 2.15……...………………………………………………………………………126

Figure 2.16.…..…………………………………………………………………………128

Figure 2.17...……………………………………………………………………………130

Figure 2.18.……..………………………………………………………………………132

xii

Figure 2.19...……………………………………………………………………………134

Figure 3.1.………………………………………………………………………………281

Figure 3.2.………………………………………………………………………………283

Figure 3.3.………………………………………………………………………………285

Figure 3.4.………………………………………………………………………………287

Figure 3.5.………………………………………………………………………………289

Figure 3.6.………………………………………………………………………………291

Figure 3.7.………………………………………………………………………………293

Figure 3.8.………………………………………………………………………………295

Figure 3.9.………………………………………………………………………………297

Figure 3.10...……………………………………………………………………………299

Figure 3.11...……………………………………………………………………………301

Figure 3.12...……………………………………………………………………………303

Figure 3.13.……………………………………………………………………………..305

Figure 3.14.……………………………………………………………………………..307

Figure 3.15.……………………………………………………………………………..309

Figure 3.16.……………………………………………………………………………..311

Figure 3.17.……………………………………………………………………………..313

Figure 3.18.……………………………………………………………………………..315

Figure 3.19.……………………………………………………………………………..317

Figure 3.20.……………………………………………………………………………..319

xiii

Figure 3.21.……………………………………………………………………………..321

Figure 3.22.……………………………………………………………………………..323

Figure 3.23.……………………………………………………………………………..325

Figure 3.24.……………………………………………………………………………..327

Figure 3.25.……………………………………………………………………………..329

Figure 3.26.……………………………………………………………………………..331

Figure 3.27.……………………………………………………………………………..333

Figure 3.28.……………………………………………………………………………..335

Figure 3.29.……………………………………………………………………………..337

Figure 4.1.………………………………………………………………………………368

Figure 4.2.………………………………………………………………………………370

Figure 4.3.………………………………………………………………………………372

Figure 4.4.………………………………………………………………………………374

Figure 4.5.………………………………………………………………………………376

Figure 4.6.………………………………………………………………………………378

Figure 4.7.………………………………………………………………………………380

Figure 4.8.………………………………………………………………………………382

Figure 4.9.………………………………………………………………………………384

Figure 4.10.……………………………………………………………………………..386

Figure 5.1.………………………………………………………………………………417

xiv

List of Tables

Table 1.1…………………………………………………………………………………16

Table 2.1………………………………………………………………………………..136

Table 2.2………………………………………………………………………………..138

Table 2.3………………………………………………………………………………..140

Table 3.1………………………………………………………………………………..339

Table 4.1………………………………………………………………………………..388

Table 4.2………………………………………………………………………………..394

Table 4.3..………………………………………………………………………………395

Table 4.4……..…………………………………………………………………………396

Table 4.5…………..……………………………………………………………………397

Table 4.6………………..………………………………………………………………398

Chapter 1: Introduction

Fishes of the supragenus Rasbora are small-to-moderate-sized fusiform minnows that comprise a remarkably species-rich assemblage of cyprinids widespread throughout a vast geographic region in South and Southeastern Asia, which comprises the Indian subcontinent, southern China, Indochina, Sundaland, and southwest islands of the

Philippines (Palawan and Mindanao), with the easternmost limit of its distribution just east of Wallace’s Line on the two westernmost Lesser Sunda Islands, Lombok and Sumbawa

(Weber and Beaufort, 1916; Brittan, 1954; Figure 1.2). Species of Rasbora play important trophic roles as both predator and prey, and are highly-pelagic omnivores that feed primarily on small animal matter (Weber and Beaufort, 1916; Brittan, 1954; Rainboth,

1991; Ward-Campbell et al., 2005). Rasbora lives in almost all types of freshwater habitats

(i.e., riverine habitats, lakes, and peat swamps) and predominantly occupies the river basins throughout the region, especially in Sundaland, where 76 species (73% of the total valid species) live (Johnson, 1967; Froese and Pauly, 2010; Eschmeyer, 2012).

Insofar as they are among the most abundant freshwater fishes in the region, many species of Rasbora are consumed by millions of local people as a main protein source

(Hardjamulia and Suwignyo, 1988; Kumar et al., 2005; Halwart, 2008; Muchlisin et al.

2010). Some species of Rasbora are also popular in the aquarium trade owing to their vibrant coloration, graceful appearance, non-aggressive schooling behavior and small size

(Brittan, 1954; Brittan, 2000). Perhaps because Rasbora is abundant, readily available, and has a close phylogenetic relationship with the model organism, the zebrafish (Danio rerio), it has received considerable scientific attention. Many biological studies have benefited from using select species of Rasbora for various objectives, including physiological and

1 anatomical descriptions (e.g., Tewari, 1973; Raizada et al., 1979; Braekevelt, 1980), developmental studies (e.g., Soni, et al. 1979; Frankel, 1994), ecological and behavioral investigations (e.g.,Thinés and Vandenbussche, 1966; Kumar, 1987; Priyadarshana and

Asaeda, 2007; Muchlisin et al., 2010), and environmental experimentation (e.g., Elizabeth et al., 1981; Kale et al., 2006; Wijeyaratne et al., 2006).

Despite its relatively uniform body shape, the supragenus Rasbora exhibits remarkable diversity in body size ranging broadly from 1.3 cm (Boraras micros) to almost

17 cm (R. tornieri) in approximate standard length of adults (Kottelat and Vidthayanon,

1993; Parenti and Lim, 2005). Sexual dimorphism is notable. Females tend to be larger and more deep-bodied than males, whereas only males possess a row or two of antrorse tubercles on the dorsoproximal surface of the pectoral fins; in some species, males are more brilliant in coloration than females (Breeder and Rosen, 1966; Brittan, 2000;

Lumbantobing, 2010). All species of the supragenus Rasbora are oviparous and most are egg-scatterers. Some species (i.e., Trigonostigma spp.) exhibit a unique behavior during mating, in which a pair spawns upside-down underneath a broad leaf of an aquatic plant prior to the female attaching her adhesive eggs to the underside of the leaf (Breeder and

Rosen, 1966; Innes, 1966; Kottelat and Witte, 1999).

The supragenus Rasbora (the genus Rasbora sensu Brittan, 1954; the genus

Rasbora sensu lato sensu Kottelat, 1984; Kottelat and Vidthayanon, 1993; Liao et al.,

2010; Tang et al., 2010; Table 1.1; Figure 1.1), with currently 104 valid species

(Appendices 1, 2), is the most species-rich group in the Danioninae sensu lato [Rasborinae sensu Nelson (2006); ~51 genera/~320 species], the most genus-rich subfamily in the largest family of vertebrates, the Cyprinidae (Nelson, 2006). The supragenus Rasbora is

2 considered as a ‘catch-all group’ and currently consists of nine valid genera: (1)

Horadandia Deraniyagala, 1943; (2) Rasboroides Brittan, 1954; (3) Boraras Kottelat and

Vidthayanon, 1993; (4) Trigonostigma Kottelat and Witte, 1999; (5) Brevibora Liao et al.,

2010; (6) Kottelatia Liao et al., 2010; (7) Rasbosoma Liao et al., 2010; (8) Trigonopoma

Liao et al., 2010; and (9) Rasbora sensu stricto (Kottelat and Vidthayanon, 1993; Kottelat and Witte, 1999; Liao et al., 2010; Table 1.1). The first species of the group known to science, Rasbora rasbora (Hamilton, 1822), was collected in the Ganges basin, India, and originally described as Cyprinus rasbora (Appendix 2). Rasbora was established as a generic name by Bleeker (1859) in his list of fish fauna of Bangka Island (now in

Indonesia) for four minnows previously classified in Leuciscus (i.e., R. bankanensis, R. cephalotaenia, R. einthovenii, and R. kalochroma; Appendix 2). Bleeker (1859) provided no diagnosis of the genus Rasbora. Subsequently, Bleeker (1860) fully diagnosed Rasbora and redescribed the 11 species he then recognized (Table 1.1). Soon thereafter, Bleeker

(1863) designated Rasbora cephalotaenia as the type species of the genus Rasbora.

In the period between Bleeker (1863) and the beginning of the Second World War, a series of workers added manifold nominal species to Rasbora (e.g., Steindachner, 1870;

Boulenger, 1895; Duncker, 1904; Weber and de Beaufort, 1916; Schreitmüller, 1935).

Fossil Rasbora reported from the Eocene of central Sumatra by Günther (1876) were later described by Sanders (1934) as Rasbora antiqua† and R. mohri†.

In the last and most comprehensive revision of Rasbora, Brittan (1954) classified the genus into three subgenera: Rasbora Bleeker, 1859; Rasboroides Brittan, 1954; and

Megarasbora Günther, 1868. However, he overlooked the fact that Megarasbora is a junior synonym of Bengala Gray, 1832 (Jordan, 1919). In his revision, Brittan also

3 classified 38 species of the subgenus Rasbora into eight species complexes (here termed species groups) and recognized four additional species of the subgenus as having “unclear systematic relationships” (Table 1.1).

Brittan (1954) designated R. rasbora as the type species of Rasbora on the basis of absolute tautonomy, rejecting Bleeker’s (1863) designation of R. cephalotaenia. Kottelat

(1999) endorsed Bleeker’s designation of R. cephalotaenia as the type species, in accordance with Article 67.2 of the International Code of Zoological Nomenclature (1999), which states that “A nominal species is only eligible to be fixed as the type species of a nominal genus or subgenus if it is an originally included nominal species”. Rasbora rasbora was not one of the four species included in that genus by Bleeker (1859); therefore, it cannot be the type species.

After Brittan (1954), numerous authors contributed major refinements to the alpha- taxonomy of the supragenus Rasbora through species resurrection and new species description, thereby more than doubling the number of valid species from 47 to the 104 species (e.g., Kottelat and Chu, 1987; Roberts, 1989; Kottelat and Vidthayanon, 1993;

Siebert and Guiry, 1996; Donoso-Büchner and Schmidt, 1997; Tan, 1999; Viswanath and

Laishram, 2004; Kottelat, 2005; Hadiaty and Kottelat, 2009; Tan, 2009; Lumbantobing,

2010; Silva et al., 2010; Kottelat and Tan, 2011; Kottelat, 2012; Kottelat and Tan, 2012;

Appendices 1 and 2).

Notwithstanding its remarkably high diversity and economic value, and the numerous alpha-taxonomic works on Rasbora, there have been scant study of the phylogenetic relationships of the genus. The species complexes of Brittan (1954) have been regarded as artificial in being established solely on superficial morphological similarities

4 outside of any phylogenetic framework. Nevertheless, Brittan’s artificial species complexes are still used as convenient working groups by many workers (Kottelat and Vidthayanon,

1993; Siebert and Guiry, 1996). A major revision of Brittan’s classification by Kottelat and

Vidthayanon (1993) included replacement of the term “species complexes” with “species groups”, transfers of species among groups, and addition of several new species described after Brittan (1954; Table 1.1). Furthermore, still outside a phylogenetic framework, six groups formerly classified in Rasbora have been elevated to six new genera: Rasboroides,

Horadandia; Boraras; Trigonostigma; Parluciosoma Howes, 1980; and Sundadanio

Kottelat and Witte, 1999. Subsequent authors treated Parluciosoma as a junior synonym of

Rasbora because of the limited taxon sampling used in its description (Roberts, 1989;

Kottelat and Vidthayanon, 1993). Prior to the description of Sundadanio by Kottelat and

Witte (1999) based on one distinctive species, Rasbora axelrodi, Roberts (1989) recognized several characters that suggest a closer relationship between the formerly monotypic Sundadanio (i.e., S. axelrodi) and danionins, rather than with rasborins. In fact, coupled with the peculiar sexual dimorphism and dichromatism unique to Sundadanio, the exclusion of this genus from Rasbora is warranted following subsequent detailed studies

(Conway and Britz, 2007; Conway et al., 2011)

The first phylogenetic analysis of the supragenus Rasbora based on morphological characters was conducted by Conway (2005). Among his results was the recognition of the miniature Boraras as monophyletic. The first molecular phylogenetic analysis of the family

Cyprinidae by Rüber et al. (2007), based on cytochrome b sequences and incorporating nine species of Rasbora, demonstrated the non-monophyly of the group for the first time: the Rasbora clade, recovered in the likelihood tree contained the genus Pectenocypris

5 embedded as the sister taxon of R. pauciperforata. Using more taxa (20 species of

Rasbora) and more molecular markers (two nuclear and four mitochondrial genes), yet omitting the genus Pectenocypris, Mayden et al. (2007) reconstructed a phylogenetic hypothesis in which Rasbora forms a clade with the polyphyletic Rasbora sensu stricto

(hereafter Rasbora s. s.) and two monophyletic genera (Boraras and Trigonostigma).

Liao et al. (2010) recently conducted a phylogenetic analysis of Rasbora based on

41 morphological characters surveyed among 29 species of Rasbora including at least one of each of Brittan’s species group. They apparently treat “rasborins” (the tribe Rasborini) as a synonym of the genus Rasbora sensu lato. The following eight synapomorphies were recognized by Liao et al. (2010) as supporting the monophyly of Rasbora sensu lato (the supragenus Rasbora of the present study): (1) the presence of supra-anal pigment and subpeduncular streak; (2) the presence of 5–6 branched anal-fin rays; (3) a dorsal-fin insertion 1–3 scales posterior to the pelvic-fin insertion; (4) the lateral process of second vertebra more-or-less straight; (5) the presence of 1–5 more abdominal than caudal vertebrae; (6) the absence of a foramen in the anterior wall of horizontal limb of the cleithrum; (7) the presence of the “rasborin process” on epibranchial 4; and (8) a well- ossified interhyal. These synapomorphies serve to support the monophyly of the supragenus Rasbora, therefore rejecting the long-and-widely-accepted view that the genus is a ‘catch-all group’ or a polyphyletic lineage (Howes, 1980; Roberts, 1989; Kottelat and

Vidthayanon, 1993; Kottelat, 1999). Nevertheless, despite the recognition of Rasbora as monophyletic, in order to avoid generic synonymies and to maintain the monophyly of several genera previously recognized within the supragenus Rasbora (i.e., Boraras,

Trigonostigma, Horadandia, Rasboroides, and Rasbora s. s.), Liao et al. (2010) classified

6 four of the clades resolved in the phylogeny as new genera: Kottelatia, Brevibora,

Rasbosoma, and Trigonopoma. That several other clades were embedded within Rasbora s. s. allowed the authors to modify Brittan’s classification on the basis of clade-based grouping, which resulted in the retention of six species groups (versus formerly eight) and the reassignment of species among species groups (Table 1.1).

In stark contrast to Liao et al. (2010), a subsequent molecular study of the subfamily Danioninae by Tang et al. (2010), which incorporated more taxa of the tribe

Rasborini (including 40 species of Rasbora), reiterated the non-monophyly of the supragenus Rasbora as previously proposed by Rüber et al. (2007), and the polyphyly of

Rasbora s. s. with regard to two genera, Boraras and Trigonostigma, nested in the clade of

Rasbora s. s. according to Mayden et al. (2007). The phylogeny of Tang et al. (2010) also recovered a polyphyletic Rasbora comprised of several genera (i.e., three monotypic genera: Brevibora, Kottelatia, and Rasbosoma; plus a paraphyletic Trigonopoma) embedded more exclusively within Rasbora s.s.. These nomenclatural problems prompted

Tang et al. (2010) to treat the aforementioned four genera, along with Boraras and

Trigonostigma, as junior synonyms of the genus Rasbora (Table 1.1).

The discrepancies between the morphological phylogeny of Liao et al. (2010) and the phylogenies from molecular studies (Mayden et al. 2007; Rüber et al., 2007; Fang et al.,

2009; Tang et al., 2010) can be attributed to three factors. First, Liao et al. (2010) used limited taxon sampling including a total of 29 species of Rasbora out of the 104 currently valid species. Poor taxon sampling is known to significantly reduce the accuracy of phylogenetic inference (Heath et al. 2008). Some of the species groups sensu Brittan

(1954) are underrepresented with only one representative species for each group included

7 in the analysis. Additionally, having excluded Pectenocypris from their analysis, Liao et al.

(2010) overlooked the importance of the genus for the systematics of Rasbora as it was previously hypothesized to be embedded within the clade Rasbora by Rüber et al. (2007).

The study of Liao et al. (2010) additionaly exemplifies the improper selection of outgroups in a phylogenetic analysis. They used just two taxa as outgroups, Danio dangila and Microrasbora rubescens, which were recovered as more derived sister taxa of the clade

Rasbora in the earlier molecular studies (Mayden et al. 2007; Fang et al. 2009). According to several morphological studies (Sanger and McCune, 2002; Fang, 2003; Conway et al.,

2008), Danio and Microrasbora possess many apomorphic characters relative to other cyprinid fishes. The presence of such apomorphies in the outgroups can supersede the underlying homologies, which will consequently recover an unsupported topology (Brooks and McLennan, 2002). Moreover Microrasbora rubescens, maturing at less than 20 mm standard length, is a diminutive species (Kottelat and Vidthayanon, 1993) that fits the criteria of miniature fishes sensu Weitzman and Vari (1988). The use of diminutive taxa as outgroups may mislead decisions of character polarity and optimization because homoplasy is often associated with miniaturization (Hanken and Wake, 1993).

Finally, Liao et al. (2010) incorporated a proportionally high number of body-size- related characters in their data matrix; nine out of a total of 41 characters can be categorized as either reductive or paedomorphic. Furthermore, their resulting phylogeny recovers two major clades that are supported solely by synapomorphies involving reductive features, which demonstrates the consequences of overdependence on truncated characters of their phylogenetic analysis. This factor, coupled with the use of a diminutive species as one of the outgroups, resulted in most miniature species of Rasbora being recovered as

8 relatively basal clades with low support on the tree. Therefore, a taxonomic revision and recognition of well-supported monophyletic groups within the supragenus Rasbora will be best accomplished with a more stable and densely sampled phylogenetic analysis.

The objectives of this study are fourfold: (1) to provide a set of new diagnostic characters to hypothesize species limits within the supragenus Rasbora as well as to be incorporated in the phylogenetic analysis of the group; (2) to reconstruct the phylogeny of the supragenus Rasbora in order to address questions of monophyly and relationships; (3) to offer a hypothesis of generic limits, which includes the descriptions of new genera and redescriptions of several problematic taxa; and (4) to examine biogeographical implications of the distribution of the supragenus Rasbora for reconstructing the historical biogeography of Sundaland.

Research Implications

This study will yield information on the problematic taxonomy of the supragenus

Rasbora and contribute new insights to the uncertain phylogeny of the subfamily

Danioninae. A robust phylogeny of Rasbora, the most species-rich group in Danioninae, is crucial to improve hypotheses of the higher-taxa relationships in the subfamily. Knowledge of character polarity acquired from this study will contribute more understanding of character optimization within danionine phylogeny. At a higher level, the knowledge of character evolution and systematics of this group will contribute to our understanding of the evolution of the Cyprinidae, the largest family of freshwater fishes. As for the molecular perspective, the assessment of several new EPIC markers (Li et al., 2010), which have been little used in phylogenetic studies of cyprinids, will provide more insights to

9 other molecular researchers on how these nuclear genes convey phylogenetic signal for the group.

Sundaland, the region where the species of Rasbora are concentrated, is a well- known biodiversity ‘hotspot’, with a high number of endemic taxa, yet is also one of the areas of the world most threatened by human development (Myers et al., 2000). This research on Rasbora will be especially valuable as it will reveal more of Sundaland’s biodiversity and shed light on the historical biogeography of the region. Moreover, areas of endemism in Sundaland identified in this study can be used to establish effective management units for conservation such as national parks and freshwater ecoregions (e.g.,

Abell et al., 2008).

Rasbora is a freshwater supragenus, but its distribution is limited by geology, not recent ecology: the southwestern portion of the Philippine island of Mindanao and the island of Palawan (yellow in Figure. 1.2) are part of an ancient island-arc system called the

Sumba block or terrane (Rangin et al.,1990). Further, given that each modern major island or region of Sundaland (Sumatra, Borneo, Java, the Philippines and the Malay Peninsula;

Figure 1.2) is a geological composite or ‘jig-saw puzzle’ formed by a multitude of tectonic events (Hamilton, 1979, 1988; Metcalfe, 1998; Hall, 2009), the historical biogeography of the region may be best explained by multiple, testable scenarios of vicariance.

Identifying biogeographic buildings blocks (e.g., areas of endemism) reflecting these geological composites is crucial to understanding the historical biogeography of

Rasbora and of Sundaland. Areas of endemism may be estimated using the distribution of species of Rasbora and related cyprinid taxa. The new species described from Sumatra reveal discrete areas of endemism that are largely allopatric. Data on the relationships of

10 these species when compared to their areas of endemism—area cladograms—will be used in future studies to understand the historical biogeographic distribution of Rasbora, its close relatives and the rest of the Sundaland biota.

Figure 1.1. Photographs of species of the supragenus Rasbora. From top to bottom:

Rasbora n. sp. 9, Kalimantan Selatan (southeast Borneo); Rasbora n. sp. 10, Kalimantan

Selatan (southeast Borneo); Rasbora api, northwestern Sumatra; Rasbora nodulosa, northwestern Sumatra.

Figure 1.2. Distribution of the supragenus Rasbora in yellow (modified from Brittan,

1954).

Table 1.1. Major Classifications of the supragenus Rasbora prior to the present study.

Kottelat and Vidthayanon Bleeker (1863) Brittan (1954) Liao et al. (2010) Tang et al. (2010) (1993)

Tribe Rasborini (= Genus Rasbora s. l.) Tribe Rasborini Genus Amblypharyngodon Genus Pectenocypris Genus Rasbora Genus Rasbora s. l. Genus Rasbora s. l. Genus Rasbora sensu stricto Genus Rasbora (= Rasbora s. l.) R. cephalotaenia Subgenus Rasbora R. einthovenii Species complexes of Rasbora Species groups of Rasbora Species groups of Rasbora All Species groups of Rasbora R. lateristriata R. lateristriata-complex R. lateristriata-group combined with R. argyrotaenia-group following Kottelat and R. kalochroma R. sumatrana-elegans-complex R. sumatrana-group R. sumatrana-group Vidthayanon (1993) R. dusonensis R. caudimaculata-complex R. caudimaculata-group combined with R. sumatrana-group R. leptosoma R. trifasciata-complex R. trifasciata-group R. trifasciata-group R. argyrotaenia R. argyrotaenia-complex R. argyrotaenia-group R. argyrotaenia-group R. borneensis R. daniconius-complex R. daniconius-group R. daniconius-group R. rasbora R. einthovenii-complex R. einthovenii-group R. einthovenii-group R. sumatrana R. pauciperforata-complex R. pauciperforata-group Genus Trigonopoma Junior synonym of Rasbora R. bankanensis. Trigonopoma pauciperforata Rasbora pauciperforata T. gracile R. gracilis R. heteromorpha-group Genus Trigonostigma Junior synonym of Rasbora Trigonostigma espei Rasbora espei T. heteromorpha R. heteromorpha T. hengeli R. hengeli T. somphongsi R. somphongsi Genus Boraras Genus Boraras Junior synonym of Rasbora Boraras brigittae Boraras brigittae Rasbora brigittae B. merah B. merah R. merah B. micros B. micros R. micros B. urophthalmoides B. urophthalmoides R. urophthalmoides Genus Kottelatia Junior synonym of Rasbora K. brittani Rasbora brittani Genus Brevibora Junior synonym of Rasbora Brevibora dorsiocellata Rasbora dorsiocellata Genus Rasbosoma Junior synonym of Rasbora Rasbosoma spilocerca Rasbora spilocerca Subgenus Rasboroides Genus Rasboroides Genus Rasboroides Genus Rasboroides Rasbora vaterifloris Rasboroides vaterifloris Rasboroides vaterifloris Rasboroides vaterifloris Genus Horadandia Genus Horadandia Genus Horadandia Horadandia atukorali Horadandia atukorali Horadandia atukorali

Subgenus Megarasbora Tribe Luciosomatini sensu Brittan (2000) Tribe Chedrini Rasbora elanga Genus Megarasbora (M. elanga) Genus Bengala (B. elanga)

Chapter 2: Description of Eight New Species of Rasbora (Teleostei: Cyprinidae) from Northern Sumatra*

*One half of this chapter including figures and tables was published in Copeia, 2010(4):

ABSTRACT

Eight new cyprinid species, four of the Reticulata group, Rasbora api, R. nodulosa, R. kluetensis, and R. truncata, as well as four of the Sumatrana group, Rasbora n. sp. 1,

Rasbora n. sp. 2, Rasbora n. sp. 3, and Rasbora n. sp. 4, are described from northern

Sumatra, Indonesia. Rasbora api is distinguished from its congeners in the Reticulata group by an anteriorly tapering black midlateral stripe extending posteriorly along the flank from the first lateral-line scale system and terminating at a slightly wider black basicaudal spot on the caudal-fin base, and stout conical cephalic tubercles with basal portion bearing microgranules (Type A tubercles). Rasbora nodulosa is distinguished from its congeners in the species group by having smaller nodular cephalic tubercles (Type D tubercles).

Rasbora kluetensis is distinguished from its congeners in the species group by the conical cephalic tubercles with a somewhat protruded base bearing microridges (Type E tubercles).

Rasbora truncata differs from its congeners in the species group by a combination of meristic, pigmentary and tuberculation features, and details of the lateral line system.

Rasbora n. sp. 1 is distinguished from all congeners in the Sumatrana group by the black midlateral stripe overall forming a saber-like profile. Rasbora n. sp. 2 is distinguished from all congeners in the Sumatrana group in having the black midlateral stripe overall forming

17 an elongate stamen-like profile. Rasbora n. sp. 3 is distinguished from all congeners in the

Sumatrana group in having a combination of the black midlateral stripe extending from midhumeral region of uniform width without the subdorsal band, the prominent acutely- triangular basicaudal blotch, and the oval supra-anal pigmentation. Rasbora n. sp. 4 is distinguished from all congeners in the Sumatrana group by a combination of the black rectangular subdorsal band, the absence of supra-anal pigmentation, and the somewhat oval basicaudal blotch, lacking the basicaudal triangular patch. Other members of the Reticulata group in the region, Rasbora meinkeni and R. tobana, are redescribed. Rasbora tobana is resurrected. Three new areas of endemism in northwestern Sumatra are proposed based on the distributions of three new endemic species of the Reticulata group: the Tripa District represented by R. nodulosa, the Kluet District represented by R. kluetensis, and the Alas

District represented by R. truncata. Three new species of the Sumatrana group, Rasbora n. sp. 1, Rasbora n. sp. 3, and Rasbora n. sp. 4 live allopatrically in the northwestern coast of

Sumatra, while Rasbora n. sp. 2 is presently known from northeastern coast of Sumatra.

INTRODUCTION

Northwestern Sumatra is characterized by a high level of endemism of its freshwater fishes in comparison with other regions in Sundaland, such as Western and

Eastern Borneo (Roberts, 1989; Kottelat, 1994). This has been confirmed by several ichthyofaunal expeditions to the region, which resulted in the descriptions of a considerable number of new endemic species (Hadiaty and Siebert, 1998; Ng et al., 2001a, b; Ng and

Hadiaty, 2005, 2008, 2009). A 2006 expedition to the region similarly revealed a series of undescribed species of freshwater fishes including the eight new species of Rasbora described herein.

The new species of Rasbora described in this dissertation are assignable to two artificial species groups initially proposed by Brittan (1954): (1) the Trifasciata group, with four new species as described in Lumbantobing (2010), and (2) the Sumatrana group, with four new species. The Trifasciata group sensu Brittan (1954), which was characterized by

Brittan (1954) and Siebert and Guiry (1996) as having a relatively small adult size of less than 70 mm SL, a dark blackish midlateral stripe reduced in intensity anteriorly in most species, a deeper body, and a decreased number of predorsal and lateral line scales. Prior to

Lumbantobing (2010), 17 valid species were recognized in the Trifasciata group sensu

Brittan (1954): R. amplistriga, R. bankanensis, R. dies, R. ennealepis, R. hubbsi, R. johannae, R. lacrimula, R. meinkeni, R. paucisqualis, R. reticulata, R. rutteni, R. sarawakensis, R. taytayensis, R. tobana, R. trifasciata, R. tuberculata and R. vulcanus

(Kottelat and Vidthayanon, 1993; Kottelat, 1995; Siebert and Guiry, 1996; Siebert, 1997;

Tan, 1999; Kottelat, 2001, 2008; Hadiaty and Kottelat, 2009; Liao et al., 2010). Three of

19 the 18 species live throughout the rivers in northern Sumatra and the adjacent island of

Nias: Rasbora meinkeni, R. reticulata and R. vulcanus (Weber and de Beaufort, 1916;

Kottelat and Vidthayanon, 1993; Tan, 1999). Rasbora tobana was described by Ahl (1934) from Lake Toba in northern Sumatra. Kottelat (1991) treated R. tobana as a synonym of R. meinkeni. Comparisons in the present study using type and other material, particularly fresh specimens from several tributaries of Lake Toba support recognition of R. tobana as distinct from R. meinkeni. Rasbora meinkeni and R. tobana are also both redescribed from abundant fresh specimens. According to the phylogeny proposed in the present study

(Chapters 3 and 4), several species previously classified in the Trifasciata group, including the four new species described in Lumbantobing (2010) and herein, form a newly- described monophyletic group (the Reticulata group hereafter), which are separate from the remainders of the group that form another clade (the Trifasciata group sensu stricto). This renders the traditional the Trifasciata group sensu Brittan (1954) polyphyletic; thus, the group should be splitted into two aforementioned monophyletic groups as described in details in the present study (see Chapter 3). Based on the present morphological study, the

Reticulata group comprises 9 valid species: R. api, R. kluetensis, R. meinkeni, R. nodulosa.

R. reticulata, R. rubrodorsalis, R. tobana, R. truncata and R. vulcanus (Appendix 1).

In addition to the four new species of the Reticulata group, three species diagnosable in the Sumatrana group were also collected during the 2006 ichthyological survey to Northwestern Sumatra,. The Sumatrana group, originally named the R. sumatrana-elegans-complex by Brittan (1954), is one of the most species-rich yet taxonomically problematic species groups of Rasbora. It is characterized by a black midlateral stripe replaced by other more pronounced elements of lateral pigmentation, such

20 as the supra-anal pigmentation and the blotch on caudal peduncle (Brittan, 1954; Kottelat and Vidthayanon, 1993). To date, 22 valid species have been recognized in this group: R. aprotaenia, R. atranus, R. atridorsalis, R. baliensis, R. bunguranensis, R. calliura, R. dorsinotata, R. elegans, R. hobelmani, R. hosii, R. lateristriata, R. leptosoma, R. nematotaenia, R. paviana, R. notura, R. rasbora, R. spilotaenia, R. steineri, R. sumatrana,

R. tawarensis, R.volzi and R. vulgaris (Brittan, 1954; Kottelat and Chu, 1987; Kottelat and

Vidthayanon, 1993; Kottelat, 2001, 2005, 2008; Liao et al., 2010; Tan and Kottelat, 2009;

Kottelat and Tan, 2011; Appendix 1). The three undescribed species of the Sumatrana group from Northwestern Sumatra were initially identified as R. sumatrana (Bleeker,

1852), R. elegans Volz, 1903, and R. lateristriata (Bleeker, 1854) respectively.

Nevertheless, intensive examination revealed that each of the three species has a distinct set of diagnostic characters, which warrant that each be recognized as a new species described herein. These three new species of R. sumatrana-group, together with four new species of

R. trifasciata-group and three other valid species of Rasbora (R. jacobsoni, R. reticulata, and R. vulcanus), bring the number of the genus endemic to the western coast of Sumatra and its adjacent islands to ten species. Their geographically restricted distribution highlights the high endemism of northern Sumatra. Yet another undescribed species of the

Sumatrana group from northern Sumatra was recognized after comparing a number of

Sumatran materials of the group available in several museum collections. Specimens of R. cf. sumatrana from northeastern Sumatra show unique characteristics, therefore are also described as a new species herein. In this study, the elegans-sumatrana complex sensu

Brittan (1954), or herein referred to the Sumatrana group, is recovered in a more inclusive

21 monophyletic group (Chapter 3) than previously circumscribed, in which the members of the lateristriata complex sensu Brittan (1954) are also nested.

MATERIALS AND METHODS

Fishes were collected between June to August 2006 during the dry season from several river systems and two lakes in northwestern Sumatra, in two administrative provinces of Indonesia, Nanggroe Aceh Darussalam and Sumatera Utara. Specimens were collected using a variety of standard methods including seining, cast-netting and dip- netting. Samples were initially fixed in 10% formalin for 3–4 days, then transferred to water and subsequently through a graded series of ethanol to 75% (specimens in ethanol abbreviated as ‘alc.’). Institutional abbreviations are as listed by Leviton et al. (1985),with the addition of the collection of Maurice Kottelat (CMK), Cornol, Switzerland.

Morphometric characters follow Kottelat (2001) and were recorded from the left side of a specimen when possible using digital calipers to the nearest 0.1 mm. Metric characters are expressed as a proportion of standard length. Standard length (Figure 2.1:

SL) is measured from the anteriormost point of snout to the end of the vertebral column or the hypural notch. In most species of Rasbora, the hypural notch is easily located by determining the posteriormost end of axial streak on the caudal base. Dorsohypural distance is defined as the distance from the dorsal-fin origin to the end of hypural complex

(Figure 2.1: DHyL). Methods of fin-ray and scale counts follow Kottelat (2001). Methods of vertebral counts follow Siebert and Richardson (1997) and were taken from radiographs.

Terminology for scale characters follows Lagler (1947), which emphasizes the position of

22 the scale focus. Osteological characters were examined using cleared-and-counterstained materials (cs) prepared according to procedure of Dingerkus and Uhler (1977) and specimens stained only using Alizarin Red (AZ). Terminology of cranial osteology follows

Weitzman (1962) and Conway (2005).

Terminology for body color patterns follows Brittan (1954) with some modifications and additions, which take into consideration aspects such as background pigmentation and reticulation pattern (Figures 2.1, 2.2, 2.3). Background pigmentation is generally restricted to the dorsolateral portion of the body and appears dusky. The pigmentation is dusky because the exposed area of each scale pocket bears a dense concentration of fine melanophores that end abruptly on the subperipheral region of the scale leaving a narrow submarginal unpigmented zone (Figure 2.2). Transition between the dorsolateral (DLR) and the midlateral (MLR) regions of body (Figures 2.1, 2.2) is marked by the abrupt ventral termination of this dusky background pigmentation more at the longitudinal light area (LLA). In life, this light area may appear as a reflective midlateral stripe with a metallic coloration in some species of Rasbora. The reticulate pattern on the lateral body is useful to identify species of Rasbora, particularly in the Reticulata group, and is here described as consisting of two types, peripheral reticulation (PR) and basal reticulation (BR), based on the distribution of melanophores on the scale (Figures 2.2, 2.3).

Peripheral reticulation is distributed throughout the dorsolateral region of the body and is formed by a loose arrangement of large-size melanophores lining the posterior portion of submarginal immaculate zone (Figure 2.2: IZ) of the scale pocket along the posterior margin of the scale. This pigmentation forms a rhomboid-network pattern on the dorsolateral portion of body. The peripheral reticulation is situated on the same longitudinal

23 scale rows as the dusky background pigmentation on the dorsolateral region. Basal reticulation is distributed throughout the midlateral region of the body and formed by a dense arrangement of fine melanophores on the more basal part of the scale pocket. The intensity of the chromatophore concentration is greatest axially and tapers distally, resulting in a chevron or parenthesis-shaped bar. Another feature of the reticulate pattern that has been proven most useful as a diagnostic character in this species group involves the maximum vertical coverage of both types of reticulation across the dorsolateral and midlateral regions of the body. The maximum vertical coverage of reticulation is expressed in terms of the maximum number of transverse scale rows along which the reticulate pigmentation distributed (Figure 2.1). On the ventralmost pigmented scale, the pigmentation is often limited to speckling on the dorsal half of the scale and this is counted

1 as a half scale (indicated by " /2”).

The lateral stripes on the flank are also useful to diagnose species in the Reticulata group. Stripes consist mainly of two types (Figures 2.1, 2.2): the dusky dorsolateral stripe

(DLS) and the black midlateral stripe (MLS). The dusky dorsolateral stripe extends in parallel with the black midlateral stripe from the posterior margin of the pectoral girdle to the anterior of caudal-fin base. The width of body stripes and pigmentation was compared with either the width of a dorsolateral scale below the dorsal fin or the actual number of chromatophores across the width of the stripe. The black spot on the caudal-fin base is referred here as the basicaudal spot, as opposed to the term ‘precaudal spot’ of Brittan

(1954), due to the location of the spot, which is posterior to the hypural notch. In most species of the Reticulata group, the ventral surface of body somewhat transparent in life, thus exposing the peritoneum (the membrane covering the body cavity) on the anterior half

24 and appearing more translucent on the posterior half. The peritoneum is whitish ventrally and may be juxtaposed dorsally with the black midlateral stripe, with its dorsal portion often covered longitudinally by reflective chromatophores. This feature seems to vary in color within the species group and is here referred as the “peritoneal reflective area”.

Several new terms for body pigmentation useful to diagnose the Sumatrana group are also described herein. These delineate the details of the three primary diagnostic characters of the group: (1) the black midlateral stripe, (2) the supra-anal pigmentation, and

(3) the basicaudal blotch (Figure 2.3: MLS, SAP, and BCB respectively). In general, the complete black midlateral stripe of the Sumatrana group may be divided into three elements: the midhumeral diffuse patch, the subdorsal band, and the posterior-portion stripe

(Figure 2.3: MDP, SDB, and PPS respectively). The midhumeral diffuse patch is formed by one or two rows of scales in the midlateral region between the gill opening and the horizontal through the dorsal-fin origin, the exposed portion of which is sparsely speckled by melanophores. The speckled scale rows overall appear as a diffuse pigmented swath.

The subdorsal band is the ventrally-widened portion of the midlateral stripe located just ventral to the dorsal fin and dorsal to the pelvic fin. The posterior-portion stripe is the portion of midlateral stripe which extends along the posterior half of the body and is dorsally bordered or traversed by the axial streak. Species of the Sumatrana group may possess all three elements of the black midlateral stripe, whereas some species only possess one or two elements, with other elements rudimentary or absent. The species of the

Sumatrana group show high variability in the black midlateral stripe due to the combination of variation in shape, size, intensity, position, presence, and completeness of elements, which vary across different species. The supra-anal pigmentation is the densely-pigmented

25 region dorsal to the anal fin. This pigmentation varies in shape, from an oval to roundish blotch to an elongated thin line along the anal-fin base. This pigmentation also varies by its position relative to the anal fin. The third primary diagnostic character of the Sumatrana group is the basicaudal blotch, which consists of two pigmentation elements: the basicaudal triangular patch and the basicaudal spot (Figure 2.3: BTP and BCS, respectively). Some species of the Sumatrana group can possess both elements, whereas others only possess either one element. Each element of the basicaudal blotch varies in size, shape, and intensity. The basicaudal triangular patch may also vary on the basis of its apex position relative to the axial streak, which is either parallel or more ventrally positioned.

All species in the Trifasciata group sensu Brittan (1954) except for R. amplistriga,

R. dies, and R. taytayensis were examined to determine the distribution of cephalic tubercles. The structural morphology of male cephalic tubercles was examined to assess their taxonomic significance at the species level. Testes of all male specimens examined were subjected to histological analyses to confirm their reproductive phase prior to morphological analyses of cephalic tubercles. Testes were dissected, transferred to 95% ethanol, infiltrated and embedded in glycol methacrylate, sectioned at 3.5 µm with a

Sorvall Type JB–4 microtome, and stained with toluidine blue. Testes of nuptial males were all shown to be reproductively active by the presence of a discontinuous germinal epithelium in the testicular tubules and high numbers of spermatozoa in the testicular ducts

(Grier, 1981; Walter et al., 2005). Structural morphology of cephalic tubercles from reproductively active males was examined via scanning electron microscopy (SEM) analysis. In addition to the cephalic tubercles, the cranial superficial neuromasts, which are scattered in areas adjacent to the tubercles, were also examined using SEM analysis. For

26 the SEM study, skin samples bearing cephalic tubercles and superficial neuromasts were excised under a dissecting microscope. To ensure the repeatability of characters, lachrymal and anterior frontal regions were chosen as the source of samples due to similar epidermal thickness in both regions. The samples were first dehydrated in a graded series of ethanol to

100%, then critical point dried in Bal-Tec CPD-030, mounted, and coated with gold- palladium (60:40) alloy in a sputter coater. Samples were viewed in a Leica Stereoscan 440

SEM at the National Museum of Natural History. Specimens subjected to histological analysis and examined via SEM analysis are abbreviated as HIS.

RESULTS

Osteological analysis of the Reticulata group

Several features of cranial osteology (Figure 2.4) useful to identify species of the

Reticulata group in northwestern Sumatra are: the size of supraorbital (LSo); the shape of first infraorbital or lachrymal (1IP); the frontal roof of the dilatator fossa (LDF); the dorsomedial branch of the supraorbital canal towards the frontal (DmC); and the exposure of the sphenotic dorsal to the supraorbital canal (SpE). These features are appeared even in specimens stained only by Alizarin Red, which is specific for bone.

SEM analysis of the Reticulata group

All breeding tubercles of nearly all examined males are multicellular, keratinized, and antrorse. These tubercle features are common in fishes, especially cyprinids (Wiley and

Collette, 1970; Roberts 1982; Chen and Arratia 1996). Of the 18 valid species examined in the Trifasciata group sensu Brittan (1954), prior to Lumbantobing (2010), only four species

27 possess cephalic tubercles: R. lacrimula, R. meinkeni, R. sarawakensis, R. tobana, and R. tuberculata. The structural morphology of cephalic tubercles from R. tuberculata was not examined via SEM analysis because only type specimens were available.

Five morphotypes of cephalic tubercles are identified (Figure 2.5: first three columns) in the species of the Reticulata group from Northwestern Sumatra, four of which are species-level diagnostic characters. Rasbora meinkeni and R. truncata share a morphotype. Variation among morphotypes involves tubercle topography, surface microstructure, shape, and size. In the case of topography, individual tubercles vary in position relative to the surrounding skin surface, being either situated at the level of the skin surface, lower than the surface in a depressed base or a shallow groove, or slightly elevated than the skin surface and appearing uplifted. Variation of surface microstructure is observable primarily on the basal portion of tubercle, with the surface of cells on the base of tubercle either relatively smooth or bearing micronodules or microridges. Tubercle shape is either conical (with pointed tip; e.g., Figure 2.5: B3) or nodular (with blunt tip;

Figure 2.5: D3). Tubercles also vary in height and diameter. In addition to these structural features, morphotypes differ in the arrangement of tubercles, tubercles are either well separated or aggregated to form a clumped plate (e.g., Figure 2.5: C1).

Following Chen and Arratia (1996), five morphotypes of cephalic tubercles are named Type A–E. In Type A (Figure 2.5: A1–A3), the tubercle is relatively stout and tall, with the base of the tubercle at the skin surface, and with epithelial cells on the basal surface bearing microgranules. Type B tubercles (Figure 2.5: B1–B3, F1–F3) are conical, distinctly pointed, with a shallow, wide depression basally. Type C tubercles (Figure 2.5:

C1–C3) are relatively slender and tall with the tubercle base relatively higher than the skin

28 surface and appearing protruded with the epithelial cells smooth (Figure 2.5: C2–C3), and with the tubercles aggregated in a clumped plate (Figure 2.5 C1). In Type D (Figure 2.5:

D1–D3), the tubercle is nodular with a blunt tip and its base is lower than the skin surface in a narrow pit. Type E tubercles (Figure 2.5: E1–E3) are conical, relatively slender and tall, with the tubercle base higher than the skin surface and the epithelial cells bearing microridges.

The morphology of cranial superficial neuromasts among the six species described here also varies topographically (Figure 2.5: fourth column). The basal plate of neuromast may be confluent with the skin surface or depressed. Also, there may be a peripheral groove (e.g., Figure 2.5: B4) or a peripheral ridge (e.g., Figure 2.5: D4) surrounding the base of the neuromast. Based on these characteristics, four morphotypes of cranial superficial neuromast are recognized among the six species of the Reticulata group present in northwestern Sumatra (Figure 2.5: B4–F4). Rasbora api and R. kluetensis share the same neuromast morphotype, and Rasbora meinkeni shares a morphotype with R. tobana. The two species described herein, Rasbora nodulosa and R. truncata, each have unique morphotypes.

The four morphotypes of cranial superficial neuromast are herein re-named Type I–

IV to differentiate them from the cephalic tubercle nomenclature. Type I (Figure 2.5: A4,

E4) has the basal plate confluent with the skin surface with no peripheral structure surrounding it. In Type II (Figure 2.5: B4, C4), the basal plate of the neuromast is confluent with the skin surface and surrounded by a peripheral groove. Type III (Figure 2.5: D4) has the basal plate confluent with the skin surface and surrounded by a peripheral ridge. In

Type IV (Figure 2.5: F4), the basal plate is lower than the skin surface and surrounded by peripheral ridge and groove respectively.

Common features of the new species of the Reticulata group

All species of the Reticulata group from northwestern Sumatra share several common characters as follows. Body slender, elongate, and laterally compressed (Figure

2.6, 2.7). Greatest body depth between pelvic-fin insertion and dorsal-fin origin. Dorsal profile of head overall posterodorsally slanted from margin of upper lip to rear of head.

Snout blunt. Dorsal profile of body slightly convex from supraoccipital to dorsal-fin origin, posteroventrally slanted from latter point to caudal-fin base. Ventral profile of body gently irregularly convex from margin of lower lip to posterior terminus of anal-fin base, straight and nearly horizontal along caudal peduncle.

Mouth oblique and slightly superior. Tip of dentary forming anterior terminus of head. Lateral surface of upper lip continuously exposed from symphyseal knob to rictus

(Figure 2.9). Rictus situated slightly posterior to, or at vertical through, anterior margin of eye. Scales cycloid, moderately large with regularly imbricate arrangement, focus located more basally. Long lancet-shaped axillary scale located dorsal to pelvic-fin base. Dorsal-fin profile pointed; subtriangular with posterior margin slightly falcate. First unbranched ray approximately one-third length of second ray. Pectoral-fin profile slightly falcate. Droplet- shaped fleshy axillary lobe situated dorsal to base of first unbranched ray. Pelvic-fin profile slightly falcate. Pelvic-fin inserted below tenth lateral-line scale and distinctly anterior to vertical through dorsal-fin origin. Tip of adpressed pelvic fin extending past anal opening barely to anal-fin origin. Anal-fin profile acutely subtriangular with concave posterior

30 margin. Caudal-fin deeply forked, with acutely pointed asymmetrical lobe and lower lobe longer.

Sexual dimorphism is observable in the species of the Reticulata group from

Northwestern Sumatra. Females are larger and more deep-bodied than males. Males are further distinguished externally by a row of antrorse tubercles on the anterodorsal surface of the pectoral-fin rays and by the pointed cephalic tubercles which are absent in females.

Nuptial males have a hypertrophied region of the interradial membrane on the portion proximal to the tuberculate pectoral-fin rays, which is more opaque than its adjacent non- hypertrophied region.

Rasbora api Lumbantobing, 2010

Figures 2.6.A, 2.8.A; Tables 2.1, 2.2

HOLOTYPE.---MZB 16457, female, 45.6 mm SL, Indonesia, Sumatra, Province of

Sumatera Utara (North Sumatra), Kabupaten Tapanuli Tengah, irrigation canal of Aek

Pinangsori River (tributary of Batang Lumut River) on road between Sibolga and

Batangtoru, 01°33’59’’N, 098°54’62’’E, approximately 46 m above sea level, 4 August

2006, D. N. Lumbantobing, D. Rudaya, N. M. Ray, and P. Simanjuntak.

PARATYPES.---All from Indonesia, Sumatra: collected with holotype: AMNH 248873, 5,

32.8–37.3 mm SL; ANSP 189274, 5, 28.4–34.5 mm SL; MZB 16458, 194, 20.3–46.1 mm

SL; USNM 391737, 20 (alc.), 6 (CS), 6 (AZ), 5 (HIS), 21.3–43.2 mm SL; ZRC 51791, 6,

31.5–36.7 mm SL. D. N. Lumbantobing et al.: Province of Sumatera Utara (North

Sumatra): Kabupaten Tapanuli Tengah: MZB 16459 (ex. USNM 390067), 10, 26.8–46.5 mm SL, UF 174133, 7, 27.1–41.1 mm SL; USNM 390067,88 (alc.), 2 (CS), 1 (AZ), 2

(HIS), 12.2–42.3 mm SL, Aek Sumuran River, 01°29’49’’N, 099°01’53’’E, 4 August

2006. Kabupaten Humbang-Hasundutan: Kecamatan Pakkat: MZB 16689 (ex. USNM

390227), 18, 11.9–43.1 mm SL; USNM 390227, 15 (alc.), 1 (CS), 1 (HIS), 12.7–40.8 mm

SL, Desa Purba Baringin, Road from Barus to Doloksanggul, tributary of Aek Batugarigis

River, 02°08’48N, 098°31’61”E, 23 July 2006; MZB 16690 (ex. USNM 390320), 6, 29.7–

44.0 mm SL; USNM 390320, 5 (alc.), 1 (CS), 29.4–42.8 mm SL, road from Barus to

Pakkat (near Hutaambobi), tributary of Alas River, 02°08’36”N, 098°27’57”E, 23 July

2006. Kabupaten Dairi: MZB 16692 (ex. USNM 390334), 10, 10.7–28.8 mm SL; USNM

390334, 10, 11.1–27.2 mm SL, Kecamatan Siempat Nempu Hilir, Desa Jambur, small river under the bridge, 02°52’31”N, 098°05’42”E, 30 July 2006. Province of Nanggroe Aceh

Darussalam: MZB 16687 (ex. 390035), 3, 17.6–41.1 mm SL; USNM 390035, 3 (alc.), 1

(CS), 15.5–32.9 mm SL, Road from Subulussalam to Singkil, Lae Petal River,

02°31’76”N, 098°02’64”E, 21 July 2006.

NON-TYPES.---All from Indonesia, Sumatra: Province of Nanggroe Aceh Darussalam:

Kabupaten Aceh Selatan: MZB 16460 (ex. USNM 390050), 3, 25.1–40.5 mm SL; USNM

390050, 4 (alc.), 1 (AZ), 10.6–28.8 mm SL, Lawe Mokap River, tributary of Kluet River,

03°09’96’’N, 097°23’90’’E. Kabupaten Aceh Singkil: MZB 16461 (ex. USNM 390670),

10, 10.7–26.6 mm SL; USNM 390670, 9 (alc.), 1 (AZ), 11.6–25.8 mm SL, Namo Buaya, tributary of Alas River, 02°44’96’’N, 097°57’57’’E; MZB 16677 12, 12.6–26.7 mm SL;

USNM 391733, 12, 12.5–20.4 mm SL, road between Rimo and Singkil, Laicuk Bridge,

32 tributary of Alas River, 02°19’29”N, 097°55’61”E; MZB 16685 (ex. USNM 390330), 100,

13.3–38.2 mm SL; USNM 390330, 106, 13.6–36.3 mm SL, Kecamatan Sultan Daulay,

Desa Namo Buaya, road of Gelombang–Subulussalam, 02°44’96”N, 097°24’88”E, 17 July

2006; MZB 16686, 15, 17.9–32.1 mm SL; USNM 391736, 14 (alc.), 2 (AZ), 2 (HIS), 14.8–

29.9 mm SL, Dano, road between Gelombang and Subulussalam, small river under bridge,

02°41’42”N, 097°59’70”E, 18 July 2006; MZB 16688, 70, 9.2– 34.0 mm SL; USNM

391735, 51 (alc.), 4 (CS), 11.2–32.3 mm SL, road between Lipat Kajang and Situbuh- tubuh, Lae Butar, tributary of Alas River, 02°25’42”N, 098°05’18”E. Province of Sumatera

Utara (North Sumatra): Kabupaten Tapanuli Selatan: MZB 16691, 4, 11.6–16.0 mm SL;

USNM 391734, 3, 11.1–15.0 mm SL, Kecamatan Batang Toru, Desa Garoga, Aek Garoga

River, 01°30’95”N, 098°59’39”E, 25 July 2006. Kabupaten Tapanuli Tengah: MZB 16695,

6, 20.2–28.2 mm SL; USNM 391732, 6, 22.2–27.4 mm SL, Sorkam, Aek Sibundung River

(Muara), 01°54’78”N, 098°35’33”E; MZB 16696 (ex. 390152), 6, 13.5–40.7 mm SL,

USNM 390152, 7, 20.0–33.8 mm SL, road between Sorkam and Simargarap, tributary of

Aek Sibundung River, 01°56’77”N, 098°35’65”E.

DIAGNOSIS.---Rasbora api is distinguished from all congeners in the Reticulata group by the following characters: the anteriorly tapering black midlateral stripe extends along the flank from the post-opercular region to the base of the caudal fin and terminates posteriorly at the black basicaudal spot on the base of the caudal fin; the Type A cephalic tubercles of males (Figure 2.5: A1–A4); and a vermilion coloration on the dorsal and caudal fins in life

(Figure 2.8.A). It can be further distinguished from other members of the Trifasciata group in northwestern Sumatra by the following combination of characters: the Type I cranial

33 superficial neuromasts (Figure 2.5: A4); the symphyseal knob of the dentary strongly developed; the conspicuous depression on the lateroventral margin of the upper jaw, which is notched by a deep lachrymal groove (Figure 2.9.A, B); the first infraorbital (lachrymal) with a posterodorsal process and a concave dorsal margin (Figure 2.4.A); the lachrymal region that is peripherally pigmented with an unpigmented central area (Figure 2.9.A); the dorsomedial branch of the supraorbital canal towards the posterior margin of frontal

(Figure 2.4.A); the sphenotic that is exposed dorsal to the supraorbital canal (Figure 2.4.A);

10 gill rakers on first arch; an axial streak reaching anteriorly to the pectoral girdle; the presence of cephalic tubercles on the ventral surface of lower jaw of both sexes; a transverse scale count anterior to the dorsal-fin origin and pelvic-fin insertion of ½4/1/3½; the 10 circumpeduncular scales; a basal reticulation pattern comprised of networks of well- developed chevron-shaped bars on the midlateral surface of the body; the maximum vertical coverage of the basal reticulation of four longitudinal scale rows; and the pelvic-fin formula i,7–8.

DESCRIPTION.---Morphometric data given in Table 2.1 and meristic data in Table 2.2.

Body slender, elongate, and laterally compressed (Figure 2.6.A). Dorsohypural distance equal to distance from dorsal-fin origin to area between anterior of nostril and anterior of eye. Symphyseal knob of dentary strongly developed, slightly upturned, and fitting into corresponding well-developed symphyseal indentation between premaxillae. Conspicuous depression on ventrolateral margin of upper jaw notched by deep lachrymal groove (Figure

2.9.A,B). Dentary articulation slightly projected ventrally and situated at vertical through anterior margin of pupil (Figure 2.9.A). Cephalic tubercles present on both sexes. Cephalic

34 tubercles of males conical and pointed contrary to being somewhat spherical and blunt in females. Tubercles in males distributed on dorsal surface of head from snout to occiput, on circumorbital region, and on ventral portion of head from anterior tip of dentary to isthmal projection. Tubercles limited to ventral dentary and snout in females. Male cephalic tubercles Type A (Figure 2.5: A1–A4). Cranial superficial neuromasts Type I (Figure 2.5:

A4). Lateral line complete (all scales perforated; 26–29 + 2–3) with anterior portion posteroventrally inclined. Dorsal-fin origin over 11th lateral-line scale. Tip of adpressed pectoral fin just reaching vertical through pelvic-fin insertion. Anal-fin origin below 16th lateral-line scale.

COLORATION IN ALCOHOL.---General body coloration in alcohol preservation shown in Figure 2.6.A. Lachrymal with concentration of large deep-lying melanophores overlain by surface layer of less dense and more peripherally-distributed melanophores, and central portion unpigmented (Figure 2.9.A). Dark gular pigmentation reaching posteriorly to vertical through rictus. Post-opercular streak distinct, situated posterior to and running along pectoral girdle and reaching ventrally to axillary lobe of pectoral fin. Peripheral reticulation distinct and covering vertically at maximum four longitudinal scale rows along dorsolateral portion of body. Basal reticulation pronounced and covering vertically at maximum four longitudinal scale rows, with network of independent chevron-shaped bars.

Black midlateral stripe prominent, more intense posteriorly, and of uniform width of approximately two-third scale height along posterior half of flank. Stripe tapering and slightly descending anteriorly, and less conspicuous anterior of vertical through pelvic-fin origin. Deeply embedded black basicaudal spot confluent with but wider and more intense

35 than black midlateral stripe. Spot originating posterior to hypural plate and terminating at posterior margin of interradial muscle of caudal fin. Axial streak posteriorly traversing dorsal portion of black midlateral stripe (Figure 2.10.A), but streak separate from stripe in area above 12th lateral-line scale. Streak decreasing in intensity anteriorly but reaching pectoral girdle.

COLORATION IN LIFE.---Ground coloration of dorsolateral surface of head and body pale brown (Figure 2.8.A). Dorsum of head largely dusky, with tip of snout, dorsal rim of eye, and posterior part of head above opercle appearing metallic orange-yellowish.

Operculum with reflective orange-yellowish band posterodorsally above dark midopercular band. Reflective orange-yellowish postopercular streak situated posterodorsal to opercular slit. Reflective midlateral stripe conspicuous, metallic orange-yellowish, juxtaposed ventrally with black midlateral stripe, and of uniform width comparable to black stripe.

Reflective stripe continuing anteriorly with postopercular streak and terminating posteriorly at basicaudal spot. Peritoneal reflective area appears metallic orange-yellowish. Dorsal fin with broad swath of vermillion chromatophores forms orange-reddish basicaudal triangular patch covering all, except for fin base and distal margin appearing hyaline. Caudal fin with broad swath of vermillion chromatophores covering all but distal portions of both lobes, with proximal and posterior margins hyaline. Medial portion appearing diffusely yellowish.

Pectoral, pelvic, and anal fins hyaline.

OSTEOLOGICAL REMARKS.---Schematic drawing of superficial lateral cranial osteology shown in Figure 2.4.A. Supraorbital moderate in size with posterior margin well

36 separated from anterior lamina of fifth infraorbital. First infraorbital (lachrymal) with prominent posterodorsal process extending towards supraorbital (1IP) and with concave dorsal margin. Roof of dilatator fossa in frontal relatively narrow. Dorsomedial branch of supraorbital canal extending towards posterior margin of frontal (DmC). Exposure of sphenotic dorsal to supraorbital canal relatively broad (SpE).

HABITAT AND DISTRIBUTION.---Specimens of Rasbora api were collected in gravel- bottomed mountain streams, moderate-flowing turbid rivers, and acidic blackwater peatswamps. The species is known from the Kluet, Alas, Aek Batugarigis, Aek Sibundung,

Batang Lumut, and Batang Toru Rivers that flow into the Indian Ocean in the southern part of northwestern Sumatra (Figure 2.11). The northernmost distribution recorded is Kluet drainage, the southernmost record is Batang Toru drainage. Rasbora api is endemic to southern northwestern Sumatra. It was collected sympatrically with Rasbora jacobsoni, R. truncata, and R. cf. sumatrana in the Kluet and Alas River basins.

ETYMOLOGY.---The species epithet, api, meaning fire in Bahasa Indonesia, refers to the vermillion coloration of the dorsal and caudal fins and the orange-yellowish parts of the species in life, a pigmentation pattern appearing like fire.

Rasbora meinkeni de Beaufort, 1931

Figures 2.6, 2.8.B; Tables 2.1, 2.2

SYNTYPES.---ZMA 100259, 2, 36.4 mm (male) and 45.6 mm (female), locality unknown, received from the aquarium trade, presumably from Sumatra, Indonesia.

NON-TYPES.---Indonesia, Sumatra: ZMA 112.586, 5, 26.4–42.1 mm SL, aquarium trade

(exact locality unknown); Province of Nanggroe Aceh Darussalam, Kabupaten Aceh

Tengah, Kecamatan Lut Tawar, Kampung One-one, Lake Laut Tawar, Hotel Ringgali,

04°36’72”N, 096°51’85”E: MZB 16689, 31 (alc.), 2 (CS), 17.3–30.2 mm SL; USNM

390212, 6 (alc.), 1 (CS), 22.5–34.5 mm SL; USNM 390223, 96 (alc), 2 (AZ), 3 (CS), 1

(HIS), 19.1–32.7 mm.

DIAGNOSIS.---Rasbora meinkeni is distinguished from all congeners in the Reticulata group by the presence of the Type B male cephalic tubercles (Figure 2.5: B1–B3), and an axial streak bordering the dorsal margin of the black midlateral stripe along its posterior portion, barely traversing the stripe (Figure 2.10.B). It can be further distinguished from other members of the Trifasciata group in northwestern Sumatra by the following combination of characters: the Type II cranial superficial neuromasts (Figure 2.5: B4); the first infraorbital (lachrymal) with a posterodorsal process and a concave dorsal margin

(Figure 2.4.B); the uniformly pigmented lachrymal region (Figure 2.9.C); a dorsomedial branch of the supraorbital canal extending towards the posterior margin of the frontal

(Figure 2.4.B); the cephalic tubercles, which are present only in males; a pigmented opercular flap; a basal reticulation pattern comprised of a network of well-developed parenthesis-shaped bars on the midlateral surface of the body; the maximum vertical coverage of the basal reticulation by four and a half longitudinal scale rows; all scales of

38 the lateral line series that are pigmented as a continuation of the basal reticulation; and the pelvic-fin formula i,7.

DESCRIPTION.---Morphometric data given in Table 1 and meristic data in Table 2. Body slender, elongate, and laterally compressed (Figure 2.6.B). Dorsohypural distance equal to distance from dorsal-fin origin to area posterior to nostril. Symphyseal knob of dentary moderately developed and fitting into corresponding indistinct symphyseal indentation between premaxillae. Indistinct depression on ventrolateral margin of upper jaw barely with deep lachrymal groove (Figure 2.9.D). Dentary articulation marked with conspicuous ventral projection situated at vertical through anterior margin of pupil and forming distinct obtuse angle along ventral profile of head (Figure 2.9.C). Cephalic Type B tubercles present only in males (Figure 2.5: B1–B3), densely distributed on dorsal surface of head from snout to occiput, on circumorbital region, and on ventral portion of head from anterior tip of dentary to branchiostegal flaps. Cranial superficial neuromast Type II (Figure 2.5:

B4). Lateral line complete (all scales perforated; 24–26 + 2–3) with anterior portion posteroventrally inclined. Dorsal-fin origin over 11th or 12th of lateral-line scale. Tip of adpressed pectoral fin falling one scale short of vertical through of pelvic-fin insertion.

Pelvic fin inserted below 10th lateral-line scale and distinctly anterior to vertical through dorsal-fin origin. Tip of adpressed pelvic fin extending past anal opening barely to anal-fin origin. Anal-fin origin below 16th lateral-line scale.

COLORATION IN ALCOHOL.---General body coloration in alcohol preservation shown in Figure 2.6.B. Lachrymal pigmentation distinct with deep-lying concentration of large

39 melanophores overlain by surface layer of less dense and more uniformly-scattered fine melanophores (Figure 2.9.C). Dark gular pigmentation reaching posteriorly to vertical through isthmus. Post-opercular streak distinct, situated posterior to and running along pectoral girdle, and reaching ventrally to cleithral region. Streak in some specimens reaching area posteroventral to branchiostegal rays. Peripheral reticulation distinct and covering vertically at maximum four longitudinal scale rows along dorsolateral portion of body. Reticulation extending to dorsal portion of ventrolateral region of body, but appearing as faint thin curve bordering posterior margin of scale. Basal reticulation pronounced, covering vertically at maximum four and half longitudinal scale rows, with network of independent parenthesis-shaped bars. Black midlateral stripe prominent, more intense posteriorly, and of uniform width approximately one-half scale throughout its length. Stripe extending from posterior of pectoral girdle to hypural-origin, becoming diffuse posteriorly, and terminating at anterior edge of interradial muscle of caudal fin.

Black basicaudal spot absent. Axial streak bordering dorsal margin of black midlateral stripe posteriorly without traversing stripe (Figure 2.10.B), but streak separate anteriorly from stripe. Streak becoming diffuse at vertical through dorsal-fin origin and terminating around area above pelvic-fin insertion. Dusky dorsolateral stripe weakly developed and diffusing posteriorly below dorsal-fin terminus. Longitudinal light area between black and dusky lateral stripes, uniform in width approximately one-third scale wide and traversing axial streak at area below dorsal-fin origin. Subpeduncular pigmentation reaching caudal- fin base, with melanophores decreasing in size posteriorly.

COLORATION IN LIFE.---Ground coloration of dorsolateral surface of head and body with pale brown background (Figure 2.8.B). Dorsum of head largely dusky, with tip of snout, dorsal rim of eye, and posterior part of head above opercle appearing metallic yellowish. Operculum with reflective metallic yellowish band posterodorsally above dark midopercular band. Reflective yellowish postopercular streak situated on area posterodorsal to opercular slit. Reflective midlateral stripe conspicuous, metallic yellowish, juxtaposed ventrally with black midlateral stripe, and of uniform width comparable to that of black stripe. Reflective stripe continuing anteriorly with reflective postopercular streak and terminating posteriorly at caudal-fin base. Peritoneal reflective area appearing metallic yellowish. All fins hyaline except for slight yellow coloration on basal sections of dorsal and caudal fin rays.

OSTEOLOGICAL REMARKS.---Schematic drawing of superficial lateral cranial osteology shown in Figure 2.4.B. Supraorbital moderately developed with posterior tip well separated from anterior lamina of fifth infraorbital. First infraorbital (lachrymal) with moderate posterodorsal process extending towards supraorbital (1IP). Dilatator fossa in frontal relatively broad (LDF). Dorsomedial branch of supraorbital canal extending towards posterior margin of frontal present (DmC). Exposure of sphenotic dorsal to supraorbital canal absent, resulting contact of frontal, parietal, and pterotic.

HABITAT AND DISTRIBUTION.---Rasbora meinkeni is at present known only from

Lake Laut Tawar and several of its tributary rivers (Figure 2.11).

Rasbora tobana Ahl, 1934

Figures 2.6.C, 2.8.C; Tables 2.1, 2.2

SYNTYPES.---CAS 68363, 4, 18.4–26.1 mm SL, Indonesia, Sumatra, Toba-See (Lake

Toba).

NON-TYPES.---Indonesia, Sumatra, Province of Sumatera Utara (North Sumatra),

Kabupaten Humbang-Hasundutan: MZB 16693 (ex. USNM 390345), 2, 25.3–30.6 mm SL;

USNM 390345, 2, 12.6–30.2 mm SL, near Doloksanggul, upstream of Aek Sibundung

River, 02°15’90”N, 098°43’75”E, 31 July 2006. Kabupaten Tapanuli Utara: MZB 16694

(ex. USNM 390071), 4, 26.8–33.6 mm SL; USNM 390071, 2 (alc.), 1 (CS), 24.8–28.1 mm

SL, same data as MZB 16694, Kecamatan Sipoholon, Aek Sigeaon (tributary of Batang

Toru River), on road from Tarutung to Siborong-borong, 02°05’62”N, 098°57’37”E, altitude 3519 ft., 1 August 2006. Kabupaten Toba-Samosir: on the road of Balige to

Parapat, 29 July 2006: USNM 390141, 1, 30.3 mm SL, Kecamatan Lumban Julu, Aek

Tongguran (inlet river of Lake Toba), 02°35’48”N, 099°02’11”E; USNM 390142, 2, 22.3–

32.1 mm SL, Desa Nauli, Aek Sibargot/Binanga Sun (inlet river of Lake Toba),

02°24’61”N, 099°10’25”E, Altitude 3080 ft.; USNM 390318, 1, 35.3 mm SL, Aek Naurio

(inlet river of Lake Toba), 02°31’15”N, 099°07’34”E, Lake Toba, Prapat, Smithsonian-

National Geographic Expedition, 1937: USNM 193001, approx. 30; USNM 193041, approx. 400.

DIAGNOSIS.---Rasbora tobana is distinguished from all congeners in the Reticulata group by the following characters: a black midlateral stripe extending along the flank from the post-opercular region to the caudal-fin base and tapering anteriorly and terminating posteriorly at the black basicaudal spot as wide as the black stripe, the possession of the

Type C male cephalic tubercles (Figure 2.5: C1–C3): and a relatively large supraorbital with the posterior margin almost reaching the anterior lamina of fifth infraorbital and exceeding opening of the dilatator fossa (Figure 2.4.C: LSo). Rasbora tobana can be distinguished further from the other members of the Trifasciata group in northwestern

Sumatra by the following combination of characters: the Type II cranial superficial neuromasts (Figure 2.5: C4); a conspicuous depression on the ventral margin of the maxilla notched by a deep lachrymal groove (Figure 2.9.A,B); the uniformly pigmented lachrymal region (Figure 2.9.C); the dorsomedial branch of the supraorbital canal extending towards the posterior margin of the frontal (Figure 2.4.C); the axial streak anteriorly terminating in the area between the vertical through the dorsal-fin origin and the pelvic-fin insertion; the presence of cephalic tubercles in both sexes; a basal reticulation pattern comprised of networks of well-developed parenthesis-shaped bars on the midlateral surface of the body; the maximum vertical coverage of basal reticulation of three longitudinal scale rows; and the pelvic-fin formula i,7.

DESCRIPTION.---Morphometric data given in Table 1 and meristic data in Table 2. Body slender, elongate, and laterally compressed (Figure 2.6.C). Dorsohypural distance equal to distance from dorsal-fin origin to area anterior to or at nostril. Symphyseal knob of dentary strongly developed, slightly upturned, and fitting into corresponding well-developed

43 symphyseal indentation between premaxillae. Conspicuous depression on ventral margin of upper jaw notched by deep lachrymal groove (Figure. 7A,B). Dentary articulation slightly projected ventrally and situated at vertical through anterior margin of pupil. Cephalic tubercles present on both sexes. Cephalic tubercles of males conical and pointed contrary to being somewhat spherical and blunt in females. Tubercles in males distributed on dorsal surface of head from snout to occiput, on circumorbital region, and on ventral portion of head from anterior tip of dentary to isthmal projection. Tubercles limited to ventral dentary in females. Male cephalic tubercles Type C (Figure. 3: C1–C3). Cranial superficial neuromasts Type II (Figure 2.5: C4). Lateral line complete (all scales perforated; 26–29 +

2–3) with anterior portion posteroventrally inclined. Dorsal-fin origin over 11th lateral-line scale. Tip of adpressed pelvic fin extending past anus to barely reach anal-fin origin. Anal- fin profile acutely subtriangular with concave posterior margin. Anal-fin origin below 16th lateral-line scale.

COLORATION IN ALCOHOL.---General body coloration in alcohol preservation shown in Figure 2.6.C. Lachrymal pigmentation distinct with concentrations of deep-lying large melanophores overlain by surface layer of less dense and uniformly-scattered fine melanophores (Figure 2.9.C). Dark gular pigmentation indistinct, appearing anteromedially as faint line. Post-opercular streak well developed, situated posterior to and running along pectoral girdle, terminating at point above horizontal through ventral margin of eye.

Peripheral reticulation appearing as distinct covering vertically at maximum four longitudinal scale rows on dorsolateral portion of body. Basal reticulation pronounced, covering vertically at maximum three longitudinal scale rows, with network of independent

44 parenthesis-shaped bars. Black midlateral stripe prominent, more intense posteriorly, and of uniform width of approximately one-half scale throughout its length. Stripe extending from posterior of pectoral girdle to hypural-origin, and terminating at black basicaudal spot on caudal-fin base. Spot deeply embedded, of same width as and continuing with black midlateral stripe. Axial streak posteriorly traversing dorsal portion of black midlateral stripe (Figure. 8A), but streak separate anteriorly from stripe. Streak becoming diffuse in area above 12th lateral-line scale, and terminating above 9th lateral-line scale. Dusky dorsolateral stripe weakly developed and diffusing posteriorly below dorsal-fin terminus.

Longitudinal light area between black and dusky lateral stripes, of uniform width of approximately one-third scale wide and traversing axial streak in area below dorsal-fin origin. Subpeduncular pigmentation decreasing in intensity posteriorly.

COLORATION IN LIFE.---Ground coloration of dorsolateral surface of head and body pale brown (Figure 2.8.C). Dorsum of head largely dusky, with tip of snout, dorsal rim of eye, and posterior part of head above opercle appearing metallic yellowish. Operculum with reflective metallic yellowish band posterodorsally above black midopercular band.

Reflective yellowish postopercular streak situated on area posterodorsal to opercular slit.

Reflective midlateral stripe conspicuous, metallic yellowish, juxtaposed ventrally with black midlateral stripe, and of uniform width comparable to that of black stripe. Reflective midlateral stripe continuing anteriorly with reflective postopercular streak anteriorly and terminating posteriorly at caudal-fin base. Peritoneal reflective area appearing metallic yellowish. All fins hyaline except for slight yellow coloration on basal portions of dorsal and caudal fin rays.

OSTEOLOGICAL REMARKS.---Schematic drawing of superficial lateral cranial osteology shown in Figure 2.4.C. Supraorbital relatively large with posterior margin almost reaching anterior lamina of fifth infraorbital and exceeding opening of dilatator fossa

(LSo). First infraorbital (lachrymal) with moderate posterodorsal process extending towards supraorbital (1IP). Frontal roof of dilatator fossa relatively broad (LDF).

Dorsomedial branch of supraorbital canal extending towards posterior margin of frontal

(DmC). Exposure of sphenotic dorsal to supraorbital canal absent resulting in contact of frontal, parietal, and pterotic.

DISTRIBUTION.---Rasbora tobana is at present known from Lake Toba and several tributary rivers feeding into the Lake (Figure 2.11).

Rasbora nodulosa Lumbantobing, 2010

Figures 2.7.A, 2.8.D; Tables 2.1, 2.1

HOLOTYPE.---MZB 16465, female, 34.6 mm SL, Indonesia, Sumatra, Province of

Nanggroe Aceh Darussalam, Kabupaten Aceh Barat Daya, Kecamatan Tangan-tangan,

Tangan-tangan River on road between Blang Pidie and Tapaktuan, 03º39’09’’N,

096º54’83’’E, approximately 4 m above sea level, 11 July 2006, D. N. Lumbantobing, R.

Hadiaty, D. Rudaya, and N. M. Ray.

PARATYPES.---All from Indonesia, Sumatra: collected with holotype: MZB 16466, 27,

12.6–51.7 mm SL; USNM 391743, 29 (alc.), 1 (AZ), 2 (CS), 4 (HIS), 16.4–34.9 mm SL.

Province of Aceh Nanggroe Darussalam, D. N. Lumbantobing et al.: ANSP 189275, 4,

21.1–28.3 mm SL; MZB 16468, 10, 19.5–34.0 mm SL, ZRC 51792, 5, 18.5–32.9 mm SL, unknown river in swamp area (Rawa) on road between Blang Pidie and Tapaktuan,

03º45’31’’N, 096º48’56’’E, 11 July 2006. Kabupaten Nagan Raya: MZB 16467, 97, 13.1–

43.1 mm SL; USNM 391731, 40 (alc.), 5 (cs), 3 (AZ), 3 (HIS), 15.4–36.5 mm SL,

Seumayam River, 03º58’15’’N, 096º39’13’’E, approximately 29 m. above sea level.

NON-TYPES.---Indonesia, Sumatra, Province of Nanggroe Aceh Darussalam: AMNH

220653, 2, 31.5–37.8 mm, Jantang, roadside ditch near coast, 37 km south of Lhoknga;

AMNH 220708, 8, 41.3–48.8 mm, Blangpidie market.

DIAGNOSIS.---Rasbora nodulosa is distinguished from all congeners in the Reticulata group by the presence of Type D male cephalic tubercles (Figure 2.5: D1–D3). It can be further distinguished from the other members of the Trifasciata group in northwestern

Sumatra by the following combination of characters: the Type I cranial superficial neuromasts (Figure 2.5: D4); the first infraorbital (lachrymal) with a posterodorsal process and a concave dorsal margin (Figure 2.4: 1IP); the lachrymal region peripherally pigmented with an unpigmented central area (Figure 2.9.A); the dorsomedial branch of the supraorbital canal extending towards the posterior margin of the frontal (Figure. 2.4:

DmC); an axial streak extending anteriorly and terminating between the verticals through the dorsal-fin origin and the pelvic-fin insertion; the presence of cephalic tubercles only in

47 males; the unpigmented opercular flap; a basal reticulation pattern comprised of networks of well-developed parenthesis-shaped bars on the midlateral surface of the body; a maximum vertical coverage of the basal reticulation by three and half longitudinal scale rows; and the pelvic-fin formula i,8.

DESCRIPTION.---Morphometric data given in Table 2.1 and meristic data in Table 2.2.

Dorsohypural distance equal to distance from dorsal-fin origin to area between posterior of nostril and anterior of eye. Symphyseal knob of dentary moderately developed and fitting into corresponding indistinct symphyseal indentation between premaxillae. Indistinct depression on ventrolateral margin of upper jaw barely with deep lachrymal groove (Figure

2.9.C,D). Dentary articulation slightly projected ventrally and situated at vertical through anterior margin of eye. Cephalic Type D tubercles present only in males (Figure 2.4: D1–

D3); distributed on dorsal surface of head from snout to occiput, on circumorbital portion, and on ventral portions of head from anterior tip of dentary to isthmal projection. Cranial superficial neuromast Type I (Figure 2.5: D4). Lateral line complete (all scales perforated;

24–26 + 2–3) with anterior portion posteroventrally inclined. Dorsal-fin origin over 11th lateral-line scale. Tip of adpressed pectoral fin falling 1 to 2 scales short of vertical through pelvic-fin insertion. Pelvic fin inserted below 10th lateral-line scale and distinctly anterior to vertical through dorsal-fin origin. Tip of adpressed pelvic fin extending past anal opening, barely to anal-fin origin, but in larger specimens (e.g., 50.7 mm), not reaching anus. Anal-fin origin below 17th lateral-line scale.

COLORATION IN ALCOHOL.---General body coloration in alcohol preservation shown in Figure 2.7.A. Lachrymal with concentration of large deep-lying melanophores overlain by surface layer of less dense, more peripherally-distributed melanophores, and central portion unpigmented (Figure 2.9.A). Dark gular pigmentation reaching posteriorly to vertical through rictus. Post-opercular streak distinct, situated posterior to and running along pectoral girdle and reaching ventrally to axillary lobe of pectoral fin. Peripheral reticulation and covering vertically at maximum three and half longitudinal scale rows on dorsolateral portion of body. Basal reticulation pronounced and covering vertically at maximum three and half longitudinal scale rows, with network of independent parenthesis- shaped bars. Black midlateral stripe prominent, more intense posteriorly, and of uniform width of approximately one-half scale throughout its length. Stripe extending from posterior of pectoral girdle to hypural-origin, becoming diffuse posterior to latter point, and terminating at anterior margin of interradial muscle of caudal fin. Black basicaudal spot absent. Axial streak posteriorly traversing dorsal portion of black midlateral stripe, but streak separate anteriorly from stripe (Figure 2.10.A). Streak become diffuse in area above

12th lateral-line scale, and terminating above 9th lateral-line scale. Dusky dorsolateral stripe weakly developed and diffusing posteriorly below dorsal-fin terminus. Longitudinal light area between black and dusky lateral stripes of uniform width of approximately one third scale and traversing axial streak in area below dorsal-fin origin. Subpeduncular pigmentation decreasing in intensity posteriorly.

COLORATION IN LIFE.---Ground coloration of dorsolateral surface of head and body pale brown (Figure 2.8.D). Dorsum of head largely dusky, with tip of snout, dorsal rim of

49 eye, and posterior part of head above opercle appearing metallic yellowish. Operculum with reflective metallic yellowish band posterodorsally above black midopercular band.

Reflective yellowish postopercular streak situated on area posterodorsal to opercular slit.

Reflective midlateral stripe conspicuous, metallic yellowish, juxtaposed ventrally with black midlateral stripe, and of uniform width comparable to that of black midlateral stripe.

Reflective stripe continuous anteriorly with reflective postopercular streak and posteriorly terminating at caudal-fin base. Peritoneal reflective area appearing metallic yellowish. All fins hyaline except for slight yellow coloration on basal sections of dorsal and caudal fin rays.

OSTEOLOGICAL REMARKS.---Schematic drawing of superficial lateral cranial osteology shown in Figure 2.4.D. Supraorbital moderate in size with posterior margin well separated from anterior lamina of fifth infraorbital. First infraorbital (lachrymal) with moderate posterodorsal process extending towards supraorbital (1IP). Frontal roof of dilatator fossa relatively narrow. Dorsomedial branch of supraorbital canal extending towards posterior margin of frontal (DmC). Exposure of sphenotic dorsal to supraorbital canal relatively small.

HABITAT AND DISTRIBUTION.---Rasbora nodulosa lives in Seumayam, Tangan- tangan, and two unnamed short coastal rivers in northwestern coast of Sumatra that flow into the Indian Ocean (Figure 2.11). This species was collected sympatrically with R. cf. sumatrana in the Seumayam River. The northernmost recorded location is from Jantang, a coastal village in Northern Aceh, 37 km south of Lhoknga, and the southernmost one is in

50 the Tangan-tangan drainage. Rasbora nodulosa is endemic to the northern part of northwestern Sumatra.

ETYMOLOGY.---The specific epithet, nodulosa, from the Latin refers to the shape of tubercles on this species suggesting nodules.

Rasbora kluetensis Lumbantobing, 2010

Figure 2.7.B; Tables 2.1, 2.2

HOLOTYPE.---MZB 16470, 30.9 mm SL, female, Indonesia, Sumatra, Province of

Nanggroe Aceh Darussalam, Kabupaten Aceh Selatan, irrigation canal of Kluet River,

03º09’14’’N, 097º24’43’’E, approximately 35 m above sea level, 13 July 2006, D. N.

Lumbantobing, R. K. Hadiaty, D. Rudaya, and N. M. Ray.

PARATYPES.---All from Indonesia, Sumatra, Province of Nanggroe Aceh Darussalam: collected with holotype: MZB 16674, 73, 16.6–40.9 mm SL; UF 174134, 10, 18.2–36.0 mm SL; USNM 391747, 50 (alc), 3(AZ), 4 (CS), 2 (HIS) 17.9–31.0 mm SL; ZRC 51793,

10, 18.0–35.6 mm SL. D. N. Lumbantobing, R. K. Hadiaty, D. Rudaya, and N. M. Ray,

Kabupaten Aceh Selatan: Kecamatan Pasie Jaya: MZB 16469, 1, 39.5 mm SL, swamp on road between Blang Pidie and Tapaktuan, 03º11’54’’N, 097º16’87’’E, approximately 9 m above sea level, 12 July 2006. Kecamatan Kluet Timur: MZB 16675 (ex. USNM 390218),

4, 28.6–43.5 mm SL, USNM 390218, 3 (alc), 1 (HIS) 28.9–31.0 mm SL, Lawe Sawah,

Kluet River, 03º08’62’’N, 097º24’49’’E, approximately 30 m above sea level, 13 July

2006.

NON-TYPES.---MZB 16676, 10, 12.1–33.9 mm SL, Kluet River, 03º09’77’’N,

097º24’11’’E, approximately 46 m above sea level.

DIAGNOSIS.---Rasbora kluetensis is distinguished from all congeners in the Reticulata group by the presence of Type E male cephalic tubercles (Figure 2.5.E1–E3). It can be further distinguished from other members of R. trifasciata-group in northwestern Sumatra by the following combination of characters: the Type I cranial superficial neuromasts

(Figure 2.6.E4); the first infraorbital (lachrymal) without a posterodorsal process and with a relatively straight dorsal margin (Figure 2.4.E); the uniformly pigmented lachrymal region

(Figure 2.9.C); the absence of a dorsomedial branch of the supraorbital canal (Figure

2.4.E); an axial streak extending forwards and terminating in the area between the verticals through the dorsal-fin origin and the pelvic-fin insertion; the cephalic tubercles present only in males; the pigmented opercular flap; a basal reticulation pattern comprised of a network of well-developed parenthesis-shaped bars on the midlateral surface of the body; a maximum vertical coverage of the basal reticulation by three and a half longitudinal scale rows; the posteriorly unpigmented lateral-line scale series; and the pelvic-fin formula i,7–8.

DESCRIPTION.---Morphometric data given in Table 2.1 and meristic data in Table 2.2.

Dorsohypural distance equal to distance from dorsal-fin origin to area between posterior of nostril and anterior of eye. Symphyseal knob of dentary moderately developed and fitting

52 into corresponding indistinct symphyseal indentation between premaxillae. Indistinct depression on ventrolateral margin of upper jaw barely with deep lachrymal groove (Figure

2.9.C, D). Dentary articulation slightly projected ventrally and situated at vertical through anterior margin of eye. Cephalic Type E tubercles present only in males (Figure 2.5.E1–

E3); distributed on dorsal surface of head from snout to occiput, on circumorbital portion, and on ventral portion of head from anterior tip of dentary to isthmal projection. Cranial superficial neuromasts Type I (Figure 2.6.E4). Lateral line complete (all scales perforated;

24–26 + 2–3) with anterior portion posteroventrally inclined. Dorsal-fin origin over 11th lateral-line scale. Tip of adpressed pectoral fin falling one to two scales short of vertical through pelvic-fin insertion. Pelvic fin inserted below 10th lateral-line scale and distinctly anterior to vertical through dorsal-fin origin. Tip of adpressed pelvic fin extending past anus barely to anal-fin origin. Anal-fin origin below 17th lateral-line scale.

COLORATION IN ALCOHOL.---General body coloration in alcohol preservation shown in Figure 2.7.B. Lachrymal pigmentation distinct with deep-lying concentration of large melanophores overlain by surface layer of less dense and more uniformly-scattered fine melanophores. Dark gular pigmentation reaching posteriorly to vertical through rictus.

Post-opercular streak distinct, situated posterior to and running along pectoral girdle and reaching ventrally to axillary lobe of pectoral fin. Peripheral reticulation distinct and covering vertically at maximum three and half longitudinal scale rows along dorsolateral portion of body. Basal reticulation pronounced, covering vertically at maximum three and half longitudinal scale rows, with network of independent parenthesis-shaped bars. Black midlateral stripe prominent, more intense posteriorly, and of uniform width of

53 approximately one-half scale throughout its length. Stripe extending from posterior of pectoral girdle to hypural-origin, becoming diffuse posterior to latter point, and terminating at anterior margin of interradial muscle of caudal fin. Black basicaudal spot absent. Axial streak posteriorly traversing dorsal portion of black midlateral stripe, but streak separate anteriorly from stripe (Figure 2.10.A). Streak becomes diffuse in area above 12th lateral- line scale, and terminating above eighth or ninth lateral-line scale. Dusky dorsolateral stripe weakly developed and diffusing posteriorly below dorsal-fin terminus. Longitudinal light area between black and dusky lateral stripes uniformly in width approximately one-third scale wide and traversing axial streak at area below dorsal-fin origin. Subpeduncular pigmentation decreases in intensity posteriorly.

COLORATION IN LIFE.---Ground coloration of dorsolateral surface of head and body pale brown. Dorsum of head largely dusky, with tip of snout, dorsal rim of eye, and posterior part of head above opercle appearing metallic yellowish. Operculum with reflective metallic yellowish band posterodorsally above black midopercular band.

Reflective yellowish postopercular streak situated on area posterodorsal to opercular slit.

Reflective midlateral stripe conspicuous, metallic yellowish, juxtaposed ventrally with black midlateral stripe, and of uniform width comparable to that of black midlateral stripe.

Reflective stripe continuing anteriorly with reflective postopercular streak anteriorly and posteriorly terminated at caudal-fin base. Peritoneal reflective area appearing metallic yellowish. All fins hyaline except for slight yellow coloration on basal sections of dorsal and caudal fin rays.

OSTEOLOGICAL REMARKS.---Schematic drawing of superficial lateral cranial osteology shown in Figure 2.4.E. Supraorbital moderate in size with posterior margin well separated from anterior lamina of fifth infraorbital. First infraorbital (lachrymal) with slight posterodorsal process extending towards supraorbital. Frontal roof of dilatator fossa relatively narrow. Dorsomedial branch of supraorbital canal towards posterior margin of frontal absent. Exposure of sphenotic dorsal to supraorbital canal relatively small.

HABITAT AND DISTRIBUTION.---Rasbora kluetensis is apparently endemic to the

Kluet River basin (Figure 2.11). This species was collected sympatrically with R. api, R. jacobsoni, and R. cf. sumatrana.

ETYMOLOGY.---The specific epithet, kluetensis, refers to the Kluet River basin where the species is endemic.

Rasbora truncata Lumbantobing, 2010

Figure 2.7.C; Tables 2.1, 2.2

HOLOTYPE.---MZB 16678, 26.6 mm SL, male, Indonesia, Sumatra, Province of

Nanggroe Aceh Darussalam, Kabupaten Aceh Tenggara, Kampung Air Kelabu, Alas River near road between Kutacane and Blangkejeren, 03º42’69’’N, 097º38’02’’E, 2 July 2006, D.

N. Lumbantobing, R. K. Hadiaty, D. Rudaya, and N. M. Ray.

PARATYPES.---All from Indonesia, Sumatra: collected with holotype: AMNH 248874, 5,

21.6–30.9 mm SL; ANSP 189276, 5, 21.5–32.9 mm SL; MZB 16680, 40, 14.6–37.9 mm

SL; UF 174135, 5, 21.4–27.8 mm SL; USNM 391744, 29 (alc), 6 (CS), 2 (HIS), 19.7–35.3 mm SL. Province of Nanggroe Aceh Darussalam, D. N. Lumbantobing et al.: Kabupaten

Aceh Tenggara: MZB 16679, 4, 12.5–29.7 mm SL, Ketambe, Alas River, 03º41’91’’N,

097º38’74’’E, 2 July 2006. Kabupaten Aceh Singkil: ANSP 189277, 5, 21.4–33.6 mm SL;

AMNH 248875, 5, 22.7–30.8 mm SL; MZB 16682, 37, 13.8–37.8 mm SL; USNM 391745,

25 (alc), 5 (AZ), 6 (CS), 3 (HIS), 17.2–35.5 mm SL; ZRC 51794, 10, 19.0–35.4 mm SL,

Dano, 02º41’42’’N, 097º59’70’’E, approximately 35 m above sea level, 18 July 2006;

MZB 16683, 17, 10.4–23.6 mm SL, Rundeng, swamp draining to Alas River, 02º40’10’’N,

097º52’34’’E, approximately 22 m above sea level, 18 July 2006.

NON-TYPES.---Indonesia, Sumatra, Province of Nanggroe Aceh Darussalam, Kabupaten

Aceh Singkil: Namo Buaya, near Subulussalam: MZB 16681 (ex. USNM 390326), 19,

13.9–25.0 mm SL; USNM 390326, 10, 15.2–25.1 mm SL; USNM 390664, 3, 19.1–20.1 mm SL, 02º44’96’’N, 097º57’57’’E. Laicuk bridge: MZB 16684, 25, 12.0–27.4 mm SL,

USNM 391746, 25, 11.5–25 mm SL, on road between Rimo and Singkil, 02º19’29’’N,

097º55’61’’E. Rawa Singgersing: MZB 16687, 72 (alc.), 4 (CS), 1 (HIS), 11.8–30.2 mm

SL, 02º45’67’’N, 097º56’61’’E. Lae Kumbi: MZB 16688 (ex. USNM 390660), 10, 12.5–

27.8 mm SL, USNM 390660, 10 15.9–27.7 mm SL, swamp draining to Lae Kumbi River

(tributary of Alas River), 02º39’05’’N, 097º51’55’’E.

DIAGNOSIS.---Rasbora truncata is distinguished from all congeners in the Reticulata group by a weakly-developed post-opercular streak, which extends ventrally to the horizontal through the ventral margin of pupil It can be further distinguished from other members of the Trifasciata group in northwestern Sumatra by the following combination of characters: the Type B male cephalic tubercles (Figure 2.5: F1–F3); the presence of type IV cranial superficial neuromasts (Figure 2.5: F4); the first infraorbital (lachrymal) with a relatively straight dorsal margin but without a posterodorsal process (Figure 2.4.F); the lachrymal region peripherally pigmented with an unpigmented central area (Figure 2.9.A); the absence of the dorsomedial branch of the supraorbital canal extending towards the posterior margin of the frontal (Figure 2.4.F); an axial streak extending forwards and terminating at the area between verticals through the dorsal-fin origin and the pelvic-fin insertion; the cephalic tubercles present only in males; an immaculate opercular flap; a basal reticulation pattern comprised of a network of well-developed parenthesis-shaped bars on the midlateral surface of the body; a maximum vertical coverage of the basal reticulation of two and a half longitudinal scale rows; the lateral line absent from one to six posterior scales (only 20–26 scales perforated); the lateral-line series unpigmented on the posterior portion; and the pelvic-fin formula i,7.

DESCRIPTION.---Morphometric data given in Table 2.1 and meristic data in Table 2.2.

57 articulation slightly projected and situated at vertical through anterior margin of eye.

Cephalic Type B tubercles present only in males (Figure 2.5: F1–F3), distributed on dorsal surface of head from snout to occiput, on circumorbital portion, and on ventral portion of head from anterior tip of dentary to isthmal projection. Cranial superficial neuromasts Type

IV (Figure 2.5: F4). Lateral line incomplete (20–26 anterior scales perforated) with anterior portion posteroventrally inclined. Dorsal-fin origin over 11th lateral-line scale. Tip of adpressed pectoral fin falling one to two scales short of vertical through pelvic-fin insertion. Pelvic-fin inserted below 10th lateral-line scale and distinctly anterior to vertical through dorsal-fin origin. Tip of adpressed pelvic fin extending past anus barely to anal-fin origin. Anal-fin origin below 17th lateral-line scale.

COLORATION IN ALCOHOL.---Lachrymal with concentration of large deep-lying melanophores overlain by surface layer of less dense, more peripherally-distributed melanophores, and central portion unpigmented (Figure 2.9.A). Dark gular pigmentation reaching posteriorly to vertical through rictus. Post-opercular streak weakly developed, situated posterior to and running along pectoral girdle, and reaching ventrally to horizontal through ventral margin of pupil. Peripheral reticulation distinct and covering vertically at maximum three and half longitudinal scale rows along dorsolateral portion of body. Basal reticulation pronounced, covering vertically at maximum two and half longitudinal scale rows, with network of independent parenthesis-shaped bars. Black midlateral stripe prominent, more intense posteriorly, and of uniform width of approximately one-half scale throughout its length. Stripe extending from posterior of pectoral girdle to hypural-origin, becoming diffuse posterior to latter point and terminating at anterior margin of interradial

58 muscle of caudal fin. Black basicaudal spot absent. Axial streak posteriorly traversing dorsal portion of black midlateral stripe, but streak and stripe separate anteriorly (Figure

2.10.A). Streak becoming diffuse anteriorly in area above 12th lateral-line scale and terminating above eighth or ninth lateral-line scale. Dusky dorsolateral stripe weakly developed and diffusing posteriorly below dorsal-fin terminus. Longitudinal light area present between black and dusky lateral stripes; light area uniform approximately one-third scale wide and traversing axial streak at area below dorsal-fin origin. Subpeduncular pigmentation decreasing in intensity posteriorly.

COLORATION IN LIFE.---Ground coloration of dorsolateral surface of head and body pale brown. Dorsum of head largely dusky with tip of snout, dorsal rim of eye, and posterior part of head above opercle appearing metallic yellowish. Operculum with reflective metallic yellowish band posterodorsally above black midopercular band.

Reflective yellowish postopercular streak situated on area posterodorsal to opercular slit.

Reflective midlateral stripe conspicuous, metallic yellowish, juxtaposed ventrally with black midlateral stripe, and of uniform width comparable to that of black midlateral stripe.

Reflective stripe continuous anteriorly with reflective postopercular streak and terminating posteriorly at caudal-fin base. Peritoneal reflective area appearing metallic yellowish. All fins hyaline except for slight yellow coloration on basal sections of dorsal and caudal-fin rays.

OSTEOLOGICAL REMARKS.---Schematic drawing of superficial lateral cranial osteology shown in Figure 2.4.F. Supraorbital moderate in size with posterior margin well

59 separated from anterior lamina of fifth infraorbital. First infraorbital (lachrymal) with slight posterodorsal process extending towards supraorbital, but with concave posterior margin

(1IC). Frontal roof of dilatator fossa relatively narrow. Dorsomedial branch of supraorbital canal extending towards posterior margin of frontal absent. Exposure of sphenotic dorsal to supraorbital canal absent, resulting contact of frontal, parietal, and pterotic.

HABITAT AND DISTRIBUTION.---Specimens of Rasbora truncata were collected mostly in the moderate-flowing turbid rivers. In fast-flowing streams, this species tends to congregate along the stream margins or in pools along the river banks. The species lives in the Alas River that drains a portion of the southern part of northwestern Sumatra (Figure

2.11). Rasbora truncata was collected sympatrically with R. api and R. cf. sumatrana.

ETYMOLOGY.---The specific epithet, truncata, from the Latin refers to the truncated lateral line system in this species, which has an incomplete lateral line and a truncated cephalic line.

Common features of the new species of the Sumatrana group

All species of the Sumatrana group from northern Sumatra share several characters as follows. Body slender, elongate, and laterally compressed (Figure 2.12, 2.13). Greatest body depth located between verticals through pelvic-fin insertion and dorsal-fin origin.

Dorsal profile of head overall posterodorsally slanted from margin of upper lip to rear of head. Snout convex, somewhat turned upwards, and slightly concave along supranasal profile. Dorsal profile of body overall slightly arched, convex from supraoccipital to dorsal-

60 fin origin, and slightly posteroventrally slanted from latter point to caudal-fin base. Ventral profile of body gently irregularly convex from margin of lower lip to posterior terminus of anal-fin base; straight and nearly horizontal along caudal peduncle. Mouth oblique and slightly superior. Tip of dentary forming anterior terminus of head. Symphyseal knob of dentary strongly developed, slightly upturned, and fitting into corresponding well- developed symphyseal indentation between premaxillae. Conspicuous obtuse depression on ventrolateral margin of upper jaw notched by deep lachrymal groove. Lateral surface of upper lip discontinuously exposed, with part of anterior portion well-exposed, submedial portion slightly covered due to contact point between maxilla and lower lip, and then exposed again posteriorly from lachrymal groove to rictus (Figure 2.14). Rictus situated slightly anterior to, or at vertical through, anterior margin of eye. Isthmus marked with indistinct projection, situated at vertical through anterior margin of pupil and forming indistinct obtuse angle along ventral profile of head.

Scales cycloid, moderately large with regularly imbricate arrangement, focus located more basally, and some specimens with semicircular flange on posterior margin.

Lateral line series with anterior portion posteroventrally steeply inclined, becoming somewhat straight from 9th to 17th scale, and somewhat posterodorsally ascending from

18th to last scale. All scales in lateral-line series pored. Long lancet-shaped axillary scale located dorsal to pelvic-fin base and separated dorsally by one scale from lateral-line series.

Several lanceolate sheath scales present along anal-fin base and medial portion of caudal- fin base. Dorsal-fin profile somewhat pointed, subtriangular and with posterior margin slightly convex. First unbranched ray approximately one-third length of second ray.

Pectoral-fin profile slightly falcate. Droplet-shaped fleshy axillary lobe situated dorsal to

61 base of first unbranched ray. Pelvic-fin profile slightly falcate. Anal-fin profile acutely subtriangular with concave posterior margin. Caudal fin deeply forked, with acutely pointed asymmetrical lobes and lower lobe longer.

All species of the Sumatrana group from northern Sumatra also share several features of coloration in alcohol as follows. Dorsolateral portion of body with dusky background and ventrolateral region lacking dusky pigmentation. Dorsum of head dusky with meningeal covering of brain most intensely pigmented. Opercle overall dusky due to somewhat sparse concentration of superficial melanophores. Submedial opercular canal marked with deeply-embedded dense melanophores forming obscure mid-opercular streak separating dorsal and ventral portions of opercle. Occipital region demarcated by transverse streak. Javelin-shaped mid-dorsal stripe about one-fourth scale wide extending from nape to dorsal part of caudal peduncle. Dorsolateral and midlateral region of body with reticulate pattern consisting of peripheral and basal reticulation. Reticulation most intense on anterior portion of mid-lateral region, and decreasing gradually in intensity posteriorly and ventrally. All fins with fin rays and interradial membranes bordered by lines of small melanophores resulting in fin rays with dark margins, except for unpigmented distal portions of paired fins and posteriormost anal-fin rays. Each caudal-fin lobe with last procurrent ray and five longest principal rays superficially pigmented with dense melanophores along approximately basal one-third of each fin ray. Superficial pigmentation overall resulting in obscure triangular dark patch on each caudal lobe. All species of the Sumatrana group from northern Sumatra share sexual dimorphism as follows. Females are more deep-bodied than males. Males are further distinguished

62 externally by the presence of 1–2 rows of antrorse tubercles on the dorsoproximal side of pectoral-fin rays.

Rasbora n. sp. 1

Figures 2.12.A, 2.13.A

Rasbora lateristriata var. sumatrana (non Bleeker, 1852): Weber and Beaufort, 1916.

Rasbora lateristriata (non Bleeker, 1852): Wirjoatmodjo, 1987; Kottelat and Vidthayanon,

1993.

Rasbora sumatrana (non Bleeker, 1852): Hadiaty, 2005.

Rasbora cf. sumatrana (non Bleeker, 1852): Lumbantobing, 2010.

HOLOTYPE.---MZB 17881 (ex. USNM 390034), female, 74.5 mm SL, Indonesia,

Sumatra, Province of Nanggroe Aceh Darussalam, Kabupaten Aceh Singkil: Road from

Subulussalam to Singkil, Lae Petal River, 02°31’76”N, 098°02’64”E, 21 July 2006, D. N.

Lumbantobing, D. Rudaya, and N. M. Ray.

PARATYPES.---All from Indonesia, Sumatra: collected with holotype: MZB 17882 (ex.

USNM 390034), 1, 67.8 mm SL; USNM 390034, 2, 64.5 and 68.5 mm SL. Province of

Aceh: Kabupaten Gayo Lues: MZB 17885 (ex. USNM 390069), 1, 64.7 mm SL; USNM

390069, 1, 47.5 mm SL, Kampung Lintoh, a tributary of Tripa River, on the road from

Takengon to Blangkejeren, 04°02’06”N, 097°20’33”E; D. N. Lumbantobing, R. K.

Hadiaty, D. Rudaya, and N. M. Ray, 7 July 2006. Kabupaten Aceh Selatan: Kecamatan

Kluet Timur: D. N. Lumbantobing, D. Rudaya and N. M. Ray: 15 July 2006: MZB 17884

(ex. USNM 390053), 8, 42.7–86 mm SL; USNM 390053, 7 (1 CS), 45.2–85.2 mm SL,

Lawe Mokap River, tributary of Kluet River, 03°09’96’’N, 097°23’90’’E; ZRC 53196 (ex.

USNM 390053), 3, 49.7–76.0 mm SL; USNM 401462, 4, 43.0–68.2 mm SL, Hari Pinem

River (a tributary of Kluet River), 03°09’62N, 097°24’89”E; ZRC53197, 2, 37.9–58.0 mm

SL, Hari Pinem River (tributary of Kluet River), 03°09’62N, 097°24’89”E. Kabupaten

Aceh Singkil: MZB 17886, 5, 22.7–40.3 mm SL, road between Rimo and Singkil, Laicuk

Bridge, tributary of Alas River, 02°19’29”N, 097°55’61”E, D. N. Lumbantobing, D.

Rudaya and N. M. Ray, 21 July 2006. Kabupaten Aceh Tenggara: USNM 391607, 2, 54,6–

62.8 mm SL, Ketambe, Alas River, 03º41’91’’N, 097º38’74’’E, D. N. Lumbantobing, R.

K. Hadiaty, D. Rudaya, and N. M. Ray, 2 July 2006. Province of Sumatera Utara (North

Sumatra): MZB 17883, 2, 47.9–71.6 mm SL, Kabupaten Tapanuli Tengah, irrigation canal of Aek Pinangsori River (tributary of Batang Lumut River) on road between Sibolga and

Batangtoru, 01°33’59’’N, 098°54’62’’E, approximately 46 m above sea level, D. N.

Lumbantobing, D. Rudaya, N. M. Ray, and P. Simanjuntak, 4 August 2006.

NON-TYPES.---All from Indonesia: Sumatra: Province of Aceh: Kabupaten Aceh Barat:

MZB 4646, 4, 71.1–85.9 mm SL, Krueng Ukam, Tadue, Kuala, A. Saim. Kabupaten Aceh

Selatan: MZB 5656, 5, 77.0–80.0 mm SL, Alur Serembaning, Ruding Lanak, Sungai Alas di hilir Sungai Gelombang, Soetikno W., 20 Feb 1984; MZB 5658, 4, 64.5–99.9 mm SL,

Sungai Alas, 5 km from hulu Gelombang, Soetikno W. and D. Hardjono, 3 Feb 1983.

Kabupaten Aceh Singkil: MZB 17887, 1, 42.7, Dano, road between Gelombang and

Subulussalam, small river under bridge, 02°41’42”N, 097°59’70”E; D. N. Lumbantobing et

64 al., 18 July 2006.; USNM 390145, 1, 26.9 mm SL, same data as MZB 17887; USNM uncataloged, 1, 69.3 mm SL, fish market in Gelombang, D. N. Lumbantobing, D. Rudaya, and N. M. Ray, 19 July 2006; USNM 401463, 20 (7 CS), 43.8–85.6 mm SL, swamp draining to Lae Kumbi River (tributary of Alas River), 02º39’05’’N, 097º51’55’’E, D. N.

Lumbantobing et al., 20 July 2006; ZMA 102.393, 10, 65.9–97.3 mm SL, Air Runding,

Padang Benedenlanden, E. Jacobson, Nov 1913. Kabupaten Aceh Tenggara: MZB 4505,

17, 39.7–78.7 mm SL, Ketambe, Sungai Jamur Geuleu (65 km from Kutacane), I.

Rachmatika, 7 Mar 1982; MZB 4516, 2, 47.5 and 50.2 mm SL, Ketambe, Sungai Alas,

Ninik. S., 3 Mar 1982; MZB 4518, 26, 31.6–77.2 mm SL, Ketambe, Sungai Alas, Soetikno and D. Hardjono, 9 Mar 1982; USNM 404352, 3, 51.7–62.7 mm SL, fish market in

Kutacane, D. N. Lumbantobing et al., 2 July 2006; USNM 401211, 1, 63.0 mm SL,

Kampung Air Kelabu, Alas River near road between Kutacane and Blangkejeren,

03º42’69’’N, 097º38’02’’E, D. N. Lumbantobing, R. K. Hadiaty, D. Rudaya, and N. M.

Ray, 2 July 2006. Kabupaten Aceh Tengah: MZB 5364, 4, 62.5–81.9 mm SL, Krueng

Owaq, Kecamatan Lingge, D. Wowor, 26 Jan 1984. Kabupaten Nagan Raya: USNM

401210, 1, 34.1 mm SL, Seumayam River, 03º58’15’’N, 096º39’13’’E, D. N.

Lumbantobing et al., 11 July 2006. Province of Sumatera Utara (North Sumatra): USNM

401209, 2, 16.2–20.7 mm SL, Kabupaten Tapanuli Selatan, Kecamatan Batang Toru, Desa

Garoga, Aek Garoga River, 01°30’95”N, 098°59’39”E, D. N. Lumbantobing, D. Rudaya, and N. M. Ray, 25 July 2006; ZMA 102.395, 5, 59.3–66.2 mm SL, West Nias (Nias

Island), Kleinoeg de Zwaan.

DIAGNOSIS.---Rasbora n. sp. 1 is distinguished from all congeners in having the black midlateral stripe consisting of a subdorsal band tapering anteriorly and reaching the midhumeral region via a long pointed tip and a posterior-portion stripe terminating posteriorly at the triangular basicaudal blotch and overall forming a saber-like profile.

DESCRIPTION.---General appearance shown in Figure 2.13.A. Morphometric data given in Table 2.3. Dorsohypural distance equal to distance from dorsal-fin origin to area between verticals through anterior and posterior margins of eye. Limit between head and trunk indistinct in lateral view. Cephalic tubercles absent. Lateral line complete (all scales perforated; 24–26 + 3–4). Dorsal-fin origin located over 13th lateral-line scale. Tip of adpressed pectoral fin barely reaching vertical through pelvic-fin insertion. Pelvic-fin inserted below 12th lateral line scale and distinctly anterior to vertical through dorsal-fin origin. Tip of adpressed pelvic fin extending past anus barely to anal-fin origin, but in larger specimens obviously reaching anal-fin origin. Anal-fin origin below 18th or 19th lateral-line scale.

COLORATION IN ALCOHOL.---General body coloration in alcohol preservation shown in Figure 2.13.A. Lachrymal region superficially pigmented with scattered small melanophores more concentrated peripherally. Dusky gular pigmentation reaching posteriorly to vertical through rictus. Occipital region with two superficial lines and one deeply-embedded solid line in between. Post-opercular streak thick and prominent with dense melanophores; situated posterior to and running along pectoral girdle and reaching ventrally to axillary lobe of pectoral fin. Axillary lobe pigmented with more sparsely-

66 distributed and stellate melanophores as far as subdistal portion. Middorsal stripe one- fourth scale wide and extending from nape to dorsal part of caudal peduncle.

Peripheral reticulation distinct and covering at maximum four longitudinal scale rows along dorsolateral portion of body. Basal reticulation distinct and covering up to five longitudinal scale rows and also dorsal scale row, with network of independent chevron- shaped bars. Peripheral and basal reticulation overlapping on first to fourth longitudinal scale rows and also on dorsal scale row. Black midlateral stripe prominent, more intense on central portion and forming somewhat wedge-shaped subdorsal band, and overall with saber-like profile. Stripe slightly angled anteroventrally and strongly tapering anteriorly until becoming obscure thin line reaching mid-humeral region. Stripe slightly attenuating posteriorly with ventral margin somewhat horizontal and extending to black basicaudal blotch. Axial streak posteriorly overlapping dorsal margin of black midlateral stripe, but streak separate from stripe in area above 12th or 13th lateral-line scale. Streak decreasing in intensity anteriorly until diffusing above 7th lateral-line scale. Longitudinal light area indistinct, most visible along area adjacent to posterodorsal portion of axial streak and black midlateral stripe, but covered with reticulation.

Deeply-embedded diamond-shaped black basicaudal blotch confluent anteromedially with black midlateral stripe. Blotch consisting of two elements; basicaudal triangular patch and basicaudal spot. Basicaudal triangular patch confluent anteriorly with black midlateral stripe, originating posterior to hypural notch, and flaring posteriorly. In some specimens, triangular expansion not well-developed. Basicaudal spot confluent anteriorly with and appearing darker than basicaudal triangular patch, and terminating anterior to medial sheath scale of caudal fin. Supra-anal pigmentation distinct, appearing as

67 a somewhat tear-shaped black patch smaller than pupil, originating slightly posterior to vertical through anal-fin origin, and terminating at vertical through base of third branched anal-fin ray. Subpeduncular pigmentation dusky, slightly decreasing in intensity anteriorly.

Distal edge of caudal fin pigmented with scattered melanophores resulting in narrow dusky striped margin.

COLORATION IN LIFE.---Ground coloration of dorsolateral surface of head and body pale brown with slightly silvery sheen, ventral surface barely pigmented with whitish reflective guanine (Figure 2.12.A–C). Dorsum of head largely dusky, with scattered yellowish reflective patches and streaks on snout, lateral-line canals, meningeal layer over brain, and supraorbital. Anterodorsomedial portions of operculum and upper end of gill slit with reflective yellowish patches (Figure 2.12.C). Reflective midlateral stripe metallic yellowish, juxtaposed ventrally with black midlateral stripe. Reflective stripe prominent on anterior portion of trunk, extending from humeral region, and slightly widening posteriorly until above 9th or 10th lateral-line scale, then tapering posteriorly until appearing as thin reflective line below dorsal fin, and terminating at hypural notch. Black peripheral reticulation bordered anteriorly by metallic yellowish sheen appearing overall as reticulated pattern of yellowish reflective crescents. All fins hyaline. Dorsal and caudal fins with yellowish sheen on subdistal portion of branched rays.

HABITAT AND DISTRIBUTION.---Specimens of Rasbora n. sp. 1 were collected in various habitat types, including gravel-bottomed mountain streams, moderate-flowing turbid rivers, and muddy pools. This species is at present known from the Tripa Jaya,

Kluet, and Alas Rivers that flow into the Indian Ocean in the southern part of northwestern

Sumatra (Figure 2.15). It is also noteworthy that the locality for one lot from an old collection (ZMA 102.395) is Nias, an island west of Sumatra, which may biogeographically suggest an historical connection between Nias and Sumatra. Rasbora n. sp. 1 was collected sympatrically with R. api, R. kluetensis (only in the Kluet River), R. jacobsoni, and R. truncata (only in the Alas River). The specimens from Nias Island might be sympatric with another rasborin species, R. reticulata, which was reported to be endemic to the island (Tan, 1999).

Rasbora n. sp. 2

Figures 2.12.D–F, 2.13.B; Table 2.3

Rasbora lateristriata var. sumatrana (non Bleeker, 1852): Weber and Beaufort, 1916.

Rasbora spilotaenia (non Hubbs and Bleeker, 1954): Kottelat and Vidthayanon, 1993; Ott,

2009.

HOLOTYPE.---MZB 17888 (ex. ZRC 51986), female, 65.4 mm SL, Indonesia, Sumatra,

Province of Sumatera Utara, Kabupaten Karo, Lau Kawar (catch from local anglers),

03º11.816’N, 98º23.420’E, 1441 m above sea level, T. Sim et al., 12 Apr. 2009.

PARATYPES.---All from Indonesia: collected with holotype: ZRC 51986, 4, 22.4–61.8 mm SL. Sumatra: ZMA 102.394, 25, 25.8–58.6 mm SL, Deli, de Bussy; ZMA 102.403, 2,

58.4 and 76.9 mm SL, Tandjong, Dec. 1984; ZMA 102.402, 1, 57.7, Battak hooglande by

Rampong Brastagei, de Bussy; ZMA 102.404, 2, 49.9–63.4 mm SL, Serdang, Sei Poetih,

V. Dedem, 10 Sept. 1909; ZMA 119.515, 13, 31.2–74.4 mm SL, Boven Langkat, Gloegoer

River, small creek with sandy clay bottom, upstream of Bohorok, J. E. A. den Doop, Aug

1917. Province of Sumatera Utara: Kabupaten Karo: Bianco and M. Kottelat: CMK 4429,

6, 49.4–56.1 mm SL, Lau Santam, about 1 km from Pernangenem (5–10 km South of

Penen), 17 Nov 1984; CMK 4447, 1, 103.3 mm SL, Sungai Bluei above Segugi, 18 Nov.

1984; CMK 4461, 14, 12.8–43.8 mm SL, Rindu River at Permandin, 30 km South of

Medan on the road to Kabanjahe, 19 Nov. 1984. Kabupaten Langkat: D. Wowor:

Sekundur: Sungai Besitang: MZB 4468, 7, 62.8–79.9 mm SL, Alur Sungai Tenang;, 25 Oct

1981; MZB 4476, 16, 25.8–74.2 mm SL, 26 Oct 1981; MZB 4535, 7, 58.1–87.2 mm SL,

23 Oct 1981. Sungai Bohorok: MZB 4494, 7, 42.7–92.5 mm SL, 6 Nov 1981. Kecamatan

Bohorok: Desa Bukit Lawang: Bohorok River: Haryono and Saptono: MZB 11848, 43,

36.6–63.6 mm SL, 16 Dec. 1999; MZB 11849, 21, 26.5–69.2 mm SL, 16 Dec. 1999;

USNM uncataloged (ex. MZB 11849), 10 (3 CS), 40.9–55.6 mm SL; ZRC 53198 (ex.

MZB 11849), 10, 31.7–54.2 mm SL; MZB 11850, 16, 33.0–56.9 mm SL, sewer nearby the rubber plantation, 12 Dec. 1999; MZB 11852, 22, 31.9–59.7 mm SL, sewer near Izumi, 16

Dec. 1999. Desa Timbang Lawan: Haryono: MZB 11851, 3, 54.3–63.6 mm SL, 15 Dec.

1999.

DIAGNOSIS.---Rasbora n. sp. 2 is distinguished from congeners by having the black midlateral stripe slightly descending anteriorly along its length until abruptly ending above the 6th or 7th lateral-line scale, and a posterior-portion stripe attenuating posteriorly and

70 barely reaching the black triangular basicaudal blotch, and overall forming a stamen-like or a wedge-shaped profile with a posterior apex slightly tapering.

DESCRIPTION.---Dorsohypural distance equal to distance from dorsal-fin origin to area between tip of snout and vertical through anterior margin of nostril. Profiles of head and trunk distinguishable by abrupt convexity of predorsal profile relative to slant of head profile. Cephalic tubercles observable from one specimen of male. Lateral line complete

(all scales perforated; 23–25 + 3–5). Dorsal-fin origin over 11th or 12th lateral-line scale.

Tip of adpressed pectoral fin extending beyond vertical through pelvic-fin insertion. Pelvic fin inserted below 9th or 10th lateral-line scale and distinctly anterior to vertical through dorsal-fin origin. Tip of adpressed pelvic fin reaching anal-fin origin. Anal-fin origin located below 17th or 18th lateral-line scale.

COLORATION IN ALCOHOL.---General body coloration in alcohol preservation shown in Figure 2.13.B. Lachrymal region superficially pigmented with dorsal portion more densely pigmented. Dusky gular pigmentation extending posteriorly to vertical through rictus. Fleshy opercular flap with scattered small melanophores. Background pigmentation of body overall dusky and reticulated. Peripheral reticulation relatively thick and distinct

1 and covering at maximum 4 /2 longitudinal scale rows along dorsolateral and midlateral portions of body, and also dorsal scale row. Basal reticulation relatively thick and prominent, covering up to 5 longitudinal scale rows and reaching to dorsal scale row, with network of continuous parenthesis-shaped bars. Peripheral and basal reticulations not overlapping along lateral-line scales.

Black midlateral stripe prominent, more intense on central portion, and overall appearing as stamen-like profile (Figures 2.13.B; 2.16.B). Stripe slightly narrowing anteriorly until abruptly ending over 6th or 7th lateral-line scale, attenuating posteriorly until appearing as thin line of melanophores and extending to form trace of scattered melanophores along caudal peduncle to reaching black basicaudal blotch. Black basicaudal blotch consisting of two elements: triangular expansion of rudimentary black midlateral stripe and deeply-embedded darker basicaudal spot. Triangular element originating posterior to hypural notch and flaring posteriorly at maximum to distance equal to one-half of caudal-peduncle depth until becoming confluent with basicaudal spot. Basicaudal spot terminating anterior to last sheath scale of caudal fin. Axial streak prominent and posteriorly bordering dorsal margin of black midlateral stripe, but streak separate from stripe below area between posterior terminus and mid-portion of dorsal-fin base. Streak decreasing in intensity anteriorly until disappearing above 7th lateral line scale. Dusky dorsolateral stripe faint, most visible along anterior half of trunk. Longitudinal light area indistinct, most visible along anterior half of trunk ventral to axial streak. Supra-anal pigmentation distinct, appearing as thin stripe originating slightly posterior to anal-fin origin and terminating at vertical through base of last branched anal-fin ray. Subpeduncular pigmentation barely visible. Distal border of caudal fin pigmented with scattered melanophores.

HABITAT AND DISTRIBUTION.---Rasbora n. sp. 2 is presently known from the

Bohorok River that flows into the Malacca Strait in the northeastern Sumatra (Figure 2.15).

Rasbora n. sp. 3

Figures 2.12.G–I, 2.13.D; Table 2.3

Rasbora lateristriata var. sumatrana (non Bleeker, 1852): Weber and Beaufort, 1916.

Rasbora lateristriata (non Bleeker, 1952): Kottelat and Vidthayanon, 1993.

HOLOTYPE.---MZB 17890, 66.9 mm SL, male, Indonesia, Province of Sumatera Barat

(West Sumatra), Kabupaten Agam, Kecamatan Tanjung Raya, by Hotel Danau Maninjau, 6

Aug. 2006.

PARATYPES.---Same data as holotype: MZB 21120, 1, 57.0 mm SL; USNM 406859, 1

(CS), 58.8 mm SL.

NON-TYPES.---ZMA 102.400, 8, 31.3–66.0 mm SL, Meer van Manindjau, M. Weber,

1888.

DIAGNOSIS.---Rasbora n. sp. 3 is distinguished from congeners by the combination of the following characters: the black midlateral stripe extending from the midhumeral region with a uniform width and lacking the subdorsal band, the prominent acutely-triangular basicaudal blotch, and the oval supra-anal pigmentation.

DESCRIPTION.---General appearance shown in Figure 2.13.C. Morphometric data given in Table 2.3. Dorsohypural distance equal to distance from dorsal-fin origin to nostril.

Limit between head and trunk distinguishable by abrupt convexity of anterior predorsal profile relative to angle of head profile. Cephalic tubercles present on males. No females examined. Tubercles relatively small, distributed almost all over head surface, extending onto nape region as far posteriorly as second predorsal scale and to several scales on anteroventral region of body. Lateral line complete (all scales perforated; 26–27 + 4).

Dorsal-fin origin over 13th lateral-line scale. Tip of adpressed pectoral fin barely reaching vertical through pelvic-fin insertion. Pelvic-fin inserted below 12th lateral-line scale and distinctly anterior to vertical through dorsal-fin origin. Tip of adpressed pelvic fin barely reaching vertical through anal opening. Anal-fin origin located below 18th lateral-line scale.

COLORATION IN ALCOHOL.---Lachrymal region superficially pigmented with peripheral portion more densely pigmented. Dusky gular pigmentation decreasing in intensity posteriorly until reaching to anterior portion of branchiostegal flaps. Peripheral

1 reticulation prominent and covering at maximum 5 /2 longitudinal scale rows along dorsolateral, midlateral, and ventrolateral portions of body. Basal reticulation prominent and covering at maximum 5 longitudinal scale rows, with network of continuous parenthesis-shaped bars. Peripheral and basal reticulation maximally overlapping on first to fifth longitudinal scale rows and also on dorsal scale row.

Black midlateral stripe prominent, more intense posteriorly, and uniformly approximately one-third scale wide along posterior of flank until reaching vertical through mid-point of dorsal-fin base. Stripe slightly tapering anteriorly below dorsal fin with ventral margin becoming diffuse with less concentrated melanophores until completely

74 replaced by swath of stellate melanophores reaching pectoral girdle along almost all of anterior half of flank. Dorsal edge of stripe bordered by axial streak from hypural notch to midhumeral region. Deeply-embedded diamond-shaped black basicaudal blotch confluent with black midlateral stripe anteromedially and terminating posteriorly at anterior sheath scales of caudal fin. Blotch consisting of two elements: triangular expansion of black midlateral stripe originating posterior to hypural notch and flaring posteriorly to maximum one-fourth of caudal-peduncle depth, and darker basicaudal spot terminating anterior to sheath scale of caudal fin. Axial streak posteriorly juxtaposed with dorsal margin of black midlateral stripe, but separating from stripe in area above 11th lateral-line scale. Streak decreasing in intensity anteriorly until disappearing on mid-humeral region. Dusky dorsolateral stripe somewhat distinct, most prominent and with maximum depth of almost one scale wide along anterior portion of trunk; slightly tapering posteriorly and bordered ventrally by longitudinal light area. Longitudinal light area somewhat obscure, masked by dusky pigmentation on anterior portion of each scale, extending longitudinally between dusky and black lateral stripes, and most prominent from mid-region of body to caudal peduncle. Supra-anal pigmentation originating posterior to anal-fin origin and terminating at base of 2nd branched anal-fin ray, appearing as distinct ellipsoidal blotch. Subpeduncular pigmentation distinct, most intense along mid-point of subpeduncular region. Longest ray of each caudal-fin lobe covered by dense melanophores along its length. Distal edge of caudal fin pigmented with scattered melanophores resulting in narrow dusky striped margin.

COLORATION IN LIFE.---Ground coloration of dorsolateral surface of head and body pale brown, and midlateral and ventral surfaces whitish to silvery due to presence of reflective guanine (Figure 2.12.G). Dorsum of head largely dusky, with several faint scattered yellowish patches and streaks on snout, lateral-line canals, meningeal layer, and occipital region (Figure 2.12.H–I). Black pigmentation on lateral surface of body somewhat obscure, most distinct posteriorly, with metallic greenish to bluish sheen. Reflective midlateral stripe metallic orange-reddish, of relatively constant width from humeral region to caudal peduncle, juxtaposed ventrally by obscure black midlateral stripe, and terminating at distinct black basicaudal blotch. Black reticulation pattern relatively distinct. All fins hyaline.

HABITAT AND DISTRIBUTION.---Specimens of Rasbora n. sp. 3 were collected in

Lake Maninjau, a crater lake in central western Sumatra draining to the Indian Ocean

(Figure 2.15).

Rasbora n. sp. 4

Figures 2.12.G–I, 2.13.C; Table 2.3

HOLOTYPE.---MZB 17889, female, 47.1 mm SL, Indonesia, Sumatra, Province of

Sumatera Utara (North Sumatra), Kabupaten Tapanuli Selatan, Batang Angkola River,

01°09’90”N, 099°24’83”E, D. N. Lumbantobing and D. Rudaya, 4 August 2006.

PARATYPES.---All from Indonesia: collected with holotype: MZB 21117, 7, 23.3–60.6 mm SL; USNM 404351, 7 (3 CS), 41.5–49.1 mm SL; ZRC 53199, 4, 25.2–46.6 mm SL.

Sumatra: Province of Sumatera Utara (North Sumatra): CMK 4528, 16, 21.0–67.6 mm SL, road from Porsea to Pulau Raya, 33 km before Pulau Raya, Bianco and M. Kottelat, 27

Nov. 1984; MZB 21118, 1, 57.6 mm SL, Kabupaten Tapanuli Utara, Aek Dahasan, on the road from Onanhasang to Sipirok, 01°52’25”N, 099°03’64”E, D. N. Lumbantobing, D.

Rudaya and N. M. Ray, 26 July 2006; MZB 21119, 1, 72.0 mm SL; Kabupaten Toba

Samosir, Aek Silang River (tributary of Lake Toba), PLTA Pandan, 02°18’50”N,

098°44’51”E, D. N. Lumbantobing, D. Rudaya and N. M. Ray, 31 July 2006; USNM

390346, 1, 29.5 mm SL, Kabupaten Humbang-Hasundutan, near Doloksanggul, upstream of Aek Sibundung River, 02º15.90’N/98º43.75’E, D. N. Lumbantobing, D. Rudaya and N.

M. Ray, 31 July 2006; USNM 401208, 1, 30.2 mm SL, Kabupaten Mandailing Natal, Aek

Siburiang River (tributary of Batang Gadis River), 00°41’13”N, 099°40’11”E, D. N.

Lumbantobing, D. Rudaya and N. M. Ray, 5 Aug. 2006.

DIAGNOSIS.---Rasbora n. sp. 4 is distinguished from congeners by the following combination of characters: the black midlateral stripe only represented by the rectangular subdorsal band without a midhumeral diffuse patch and the posterior-portion stripe, the absence of supra-anal pigmentation, and the basicaudal blotch appearing somewhat oval and lacking the basicaudal triangular patch.

DESCRIPTION.---General appearance shown in Figure 2.13.D. Morphometric data given in Table 1. Dorsohypural distance equal to distance from dorsal-fin origin to area between

77 anterior portion of snout and posterior margin of pupil. Limit between head and trunk indistinct in lateral view, but more visible in smaller specimens (~40 mm SL). Cephalic tubercles present on males, relatively small and few in number, distributed on dorsal surface of head especially on supraorbital area. Tubercles relatively small and distributed on dorsal surface of head from snout to occiput. Lateral line complete (all scales perforated;

24–26 + 3–4). Dorsal-fin origin located over 12th lateral-line scale. Tip of adpressed pectoral fin nearly reaching vertical through pelvic-fin insertion. Pelvic fin inserted below

11th lateral-line scale and distinctly anterior to vertical through dorsal-fin origin. Tip of adpressed pelvic fin extending past anus and in some specimens reaching to anal-fin origin.

Anal-fin origin situated below 17th lateral-line scale.

COLORATION IN ALCOHOL.---General body coloration in alcohol preservation shown in Figure 2.13.D. Lachrymal region superficially pigmented with more peripherally- distributed melanophores. Dusky gular pigmentation decreasing in intensity posteriorly as

1 far as vertical through rictus. Peripheral reticulation distinct and covering at maximum 4 /2 longitudinal scale rows along dorsolateral and midlateral portions of body. Basal reticulation prominent and covering up to 5 longitudinal scale rows and as far as dorsal scale row, with network of somewhat continuous chevron-shaped bars. Peripheral and basal reticulation overlapping at maximum on first to fifth longitudinal rows and also along dorsal scale row.

Black midlateral stripe in rudimentary form and replaced by black subdorsal band dorsally in contact with anterior portion of axial streak. Band rectangular or trapezoid,

1 deeply embedded and extending approximately 2 scales at its maximum length and 1 /2

78 scales at its maximum depth (Figures 2.13.D and 2.19.C). Distinct black axial streak extending from hypural notch to area above subdorsal blotch, anteriorly diffusing above anterior margin of blotch, and terminating above pelvic-fin insertion. Interspersed swath of melanophores extending along and bordered dorsally by axial streak resulting in faint dusky midlateral stripe. Deeply embedded black basicaudal blotch situated on medial

1 portion of posterior margin of hypural plate; blotch about 2 scales deep and 1 /2 scales long resulting in somewhat ovoid mark. Dusky dorsolateral stripe indistinct and visible along posterior portion of trunk bordered ventrally by axial streak. Longitudinal light area indistinct, most visible along its posterodorsal portion and interrupted by reticulated pigmentation. Supra-anal pigmentation absent. Subpeduncular pigmentation faint. Distal portion of caudal fin pigmented with scattered melanophores resulting in narrow dusky striped margin.

COLORATION IN LIFE.---Ground coloration of dorsal surface of head and body pale brown, ventrolateral surface of head and body grey to whitish with silvery sheen due to guanine (Figure 2.12.D–F). Dorsum of head largely dusky, with scattered yellowish to greenish reflective patches and streaks on snout, lateral-line canals, meningeal layer on brain, and supraorbital. Anterodorsomedial portions of operculum and upper region of gill slit with reflective yellowish patches (Figure 2.12.F). Black pigmentation on lateral body faint and appearing bluish grey, except for reticulated pattern and relatively distinct basicaudal blotch. Yellowish reflective middorsal stripe present and distinct on dorsum of body, extending from nape to dorsal caudal peduncle (Figure 2.12.E). Reflective midlateral

79 stripe absent. All fins hyaline. Dorsal, anal, and caudal fins with yellowish sheen on subdistal portions of branched rays.

HABITAT AND DISTRIBUTION.---Specimens of Rasbora n. sp. 4 were collected in gravel-bottomed mountain streams and moderate-flowing turbid rivers. This species is known from the Aek Sibundung, Batang Toru and Batang Gadis Rivers that flow into the

Indian Ocean in the southern part of northwestern Sumatra, and also from a tributary draining to Lake Toba (Figure 2.15). It was collected sympatrically with Rasbora api.

DISCUSSION

Tubercles are widely present throughout the Cyprinidae, particularly in the subfamily Rasborinae (Howes, 1980). In sexually dimorphic cyprinids, the primary function of tubercles is inferred to be related to breeding behavior, specifically to maintain body contact and stimulate females during spawning (Wiley and Collette, 1970). Species of

Rasbora representing nine species groups were examined in this study to determine the distribution of breeding tubercles. The results show that breeding tubercles in Rasbora are usually found only on males and are distributed on the pectoral-fin rays and head (i.e., cephalic tubercles). All adult males examined develop tubercles on the pectoral fin, and these are arranged antrorsely in a row on the basal portion of the anterior surface of the second through eighth fin rays. This character is clearly sexually dimorphic and useful for distinguishing the sexes. Moreover, based on the examination of several other rasborine genera (i.e., Barilius, Danio, Esomus, Luciosoma, Paedocypris, and Raiamas), it is evident

80 that such tuberculation on the male pectoral-fin rays is widely distributed throughout the subfamily Danioninae. Nevertheless, the actual function of tubercles on the pectoral fin remains undetermined.

Among the species groups of Rasbora examined, cephalic tubercles are most common in the Trifasciata group. Contrary to the general pattern in which only males bear cephalic tubercles, the cephalic tubercles are also present on female R. api and R. tobana.

In addition to developing tubercles on the head and pectoral-fin rays, some species of

Rasbora also develop tubercles on the dorsal surface of the body including the predorsal portion, the first dorsal-fin ray, the dorsal portion of the caudal peduncle, and the anterodorsal portion of the caudal fin. Species with this body tuberculation pattern include

R. lacrimula, R. tuberculata, R. sarawakensis, R. nodulosa, and R. kluetensis. In the last two species, the tubercles on the body scales and fin rays are relatively smaller and more nodular than are the cephalic tubercles.

This study demonstrates the utility of the morphological structure of cephalic tubercles and cranial superficial neuromasts to diagnose species of the Reticulata group in northwestern Sumatra. No other investigations have, however, thoroughly examined these characters in order to clarify the taxonomy of Rasbora. Further studies on the structural morphology of tubercles and superficial neuromasts across Rasbora, especially in the

Reticulata group, are, thus, necessary to clarify species taxonomy and to assess the phylogenetic significance of both of these epidermal characters.

Within the Trifasciata group sensu Brittan (1954), except for R. tobana, R. api is most similar to R. johannae in having a slightly curved black midlateral stripe terminating in a black basicaudal spot. The black midlateral stripe in R. johannae does not taper as it

81 does in R. api, but is diffuse anteriorly. Also, the black basicaudal spot in R. johannae is pear-shaped, due to its posterior extension over the bases of the caudal fin rays, as opposed to dot-shaped in R. api. In life, R. api also resembles R. rubrodorsalis of the R. semilineata- group sensu Liao et al. (2010) in possessing a reddish or vermilion swath on the dorsal and caudal fins. However, the reddish coloration of R. rubrodorsalis originates from the base of both fins and diffuses before reaching the central portion of the fin (Donoso-Büchner and

Schmidt, 1997), whereas in R. api this coloration originates subproximally on the fins and extends further distally to diffuse in the subdistal portion of the fins. Rasbora borapetensis, another species of the R. semilineata-group, also has the reddish coloration on the caudal but not on the dorsal fin as found in R. api and R. borapetensis. Rasbora api can be further distinguished from R. borapetensis and R. rubrodorsalis by the presence of a basicaudal spot.

In northwestern Sumatra, Rasbora api is most similar to R. tobana in having a black midlateral stripe terminating in a basicaudal spot and the same number of circumferential scales (18–20). Rasbora tobana can further be distinguished from R. api in having a basicaudal spot narrower than the width of the black midlateral stripe, 12 circumpeduncular scales, and lack of vermillion coloration on the dorsal and caudal fins in life. Rasbora api and R. tobana are parapatric; both species occur in two river drainages,

Aek Sibundung and Batang Toru. Nevertheless, R. tobana was collected only to the upper reaches of both drainages (MZB 16693, MZB 16694, USNM 390345, USNM 390071).

The specimens in those lots display a mixed set of the diagnostic characters of both species: the black pigmentation pattern and tuberculation as in R. tobana in preservation, but

82 vermillion coloration on dorsal and caudal fins as in R. api in life. This mixture of characters might be due to intogression between the species.

Rasbora meinkeni, R. nodulosa, R. kluetensis, and R. truncata appear superficially similar and are interpreted as cryptic species. Due to these similarities and their geographic affinity, a new artificial assemblage within the Reticulata group is proposed for these four species: the R. meinkeni-complex. The term “species complex’” is used here following the definition of Nelson (1999). In terms of body pigmentation and relatively small body size, the species of the R. meinkeni-complex particularly resemble R. borapetensis in having a black midlateral stripe juxtaposed dorsally with a metallic yellow light midlateral stripe in life. Species of the R. meinkeni-complex, however, lack the reddish coloration on the base of caudal fin present in R. borapetensis. Species of the R. meinkeni-complex are also superficially similar to R. api and R. tobana, but can be distinguished from both species based on the lack of the deep lachrymal groove and black basicaudal spot in those species, and via the possession of more gill rakers on the first gill arch (13–15 versus 11–12).

Rasbora api and the new species of the R. meinkeni-complex are sympatric in northwestern Sumatra with their two congeners, R. jacobsoni and Rasbora n. sp. 1, which belong to different species groups. These new species of the Trifasciata group are readily distinguishable from R. jacobsoni and Rasbora n. sp. 1 by the presence of black midlateral stripe extending from the post-opercular region to the caudal-fin base. In R. jacobsoni, the black midlateral stripe appears to be a continuum extending from the snout to the caudal-fin base, whereas in Rasbora n. sp. 1 the stripe extends from the area somewhat anterior of the vertical through dorsal-fin origin to the caudal peduncle (Figure 2.13.A). Two other species of the Trifasciata group, R. reticulata and R. vulcanus, live in the island of Nias and central

83 west Sumatra respectively, both adjacent to northern Sumatra. Rasbora reticulata and R. vulcanus are distinguished from the new species of the Trifasciata group from northwestern

Sumatra in having relatively pronounced lateral reticulated pattern and also by the absence of prominent black midlateral stripe.

The term “northwestern Sumatra” as used here refers to the northernmost region of

Sumatra on the west side of the Barisan Range and sloping towards the Indian Ocean. All major river drainages in northwestern Sumatra, Woyla, Tripa, Kluet, Alas, Batang Toru, and Batang Gadis, empty into the Indian Ocean. The description of four new endemic species of Rasbora from northwestern Sumatra underscores the high level of freshwater fish endemism in the region. The Barisan Range, which extends along the axis parallel to the coastline from northern to southern Sumatra, isolates the western coastal ichthyofauna from the eastern one and its formation may have been instrumental in the development of this endemism. Known endemic freshwater fishes of northwestern Sumatra are Betta rubra,

Glyptothorax plectilis, Rasbora api, R. jacobsoni, R. kluetensis, R. nodulosa, R. truncata,

Hemibagrus caveatus, Leiocassis aculeatus, Mystus alasensis, M. punctifer, Nemacheilus tuberigum, Puntius oligolepis, Osteochilus jeruk and O. serokan (Hadiaty and Siebert,

2001; Ng et al. 2001a; Ng et al., 2001b; Ng and Hadiaty, 2005, 2008). Due to its numerous endemic fish species, I propose northwestern Sumatra as a distinct ichthyofaunal province.

It is noteworthy that some of these endemic species are known only from a single river drainage among the various river drainages already explored to date. Thus, this may mean more restricted areas of endemism could be recognized within the northwestern Sumatra ichthyofaunal province. This can be clarified by incorporating the geographic distribution of the R. meinkeni-complex into consideration as discussed below (Figure 2.11).

All species of the R. meinkeni-complex are allopatric. The type locality of R. meinkeni is unknown because its syntypes originated in the aquarium trade without exact locality information. Nevertheless, it was assumed that the syntypes originated in Sumatra.

I examined specimens of the Trifasciata group collected during the 2006 expedition in

Northern Sumatra and compared them with the two syntypes of R. meinkeni. It appears that specimens collected from Lake Laut Tawar and its inlet rivers match the syntypes in all diagnostic characters of the body pigmentation as detailed in the diagnosis of R. meinkeni

(also in Table 2.5). Due to the destructive methodology needed for the examination of these systems, I was not able to confirm the presence of several diagnostic characters in the syntypes (the superficial lateral cranial osteology, the structural morphology of the male cephalic tubercles, and the cranial superficial neuromasts). However, comparison of the syntypes and the fresh specimens of R. meinkeni from Lake Laut Tawar with the two illustrations in the species original description by De Beaufort (1931) demonstrated that they match, except for one characteristic present in the illustrations, a black swath on the medial caudal fin as the posterior extension of the black midlateral stripe. No trace of melanophores on the medial portion of the caudal fins was apparent either on the syntypes or the fresh specimens. The medial black swath on the caudal fins in the illustrations is apparently an artefact. I identify specimens from Lake Laut Tawar and its inlet rivers as R. meinkeni. It is likely that R. meinkeni may have a more widespread distribution on the eastern coast of northern Sumatra because Lake Laut Tawar, together with its outlet, the

Peusangan River, is not geographically isolated by any uplands from neighboring river drainages of northeastern Sumatra, such as the Jamboaye and Peureulak.

Samples in different collections (CMK 4447 and ZRC 51992) from Peninsular

Malaysia (Pahang), which superficially resemble R. meinkeni, are important for comparison due to the adjacency of these localities to northeastern Sumatra, and to the vague site of origin of the species syntypes. Peninsular Malaysia could possibly be the type locality of R. meinkeni instead of Sumatra, because the former region was a major aquarium trading center in South East Asia in the early 1930s. Examinination of these Malaysian materials reveals they apparently represent an undescribed species, which differs from R. meinkeni in the absence of deep black midlateral stripe, the possession of i,8 pelvic-fin rays, and the absence of distinct basal reticulation. Because only materials from northeastern Sumatra match most with the syntypes, I hypothesize that the syntypes of R. meinkeni were collected in northeastern Sumatra.

The remaining three species of the R. meinkeni-complex, R. nodulosa, R. kluetensis, and R. truncata, are distributed on the western slope of the Barisan Range in northwestern

Sumatra. Rasbora nodulosa is known from the Tripa River and several short coastal rivers north of Tapaktuan in the northernmost portion of the region. To the south of Tapaktuan, alongside the Batee fault, the Barisan Range extends to the coastal area forming a stretch of coastal escarpment (Sieh and Natawidjaja, 2000), which is the southernmost boundary of the basin (approximately 3°14’N). On the south side of the Tapaktuan escarpment, lays the

Kluet River basin where R. kluetensis occurs. The southernmost boundary of the Kluet basin is another coastal escarpment located to the south of Bakongan (approximately

2°53’N). Rasbora truncata is known from the Alas River drainage located on the south side of the Bakongan escarpment and therefore separated from the Kluet basin. Those two intervening coastal escarpments, each located south of Tapaktuan and Bakongan

86 respectively, are hypothesized here to be significant geographical barriers and appear to have promoted the speciation of the three corresponding species of R. meinkeni-group in each basin. Thus, three areas of endemism can be recognized in the northwestern Sumatra ichthyofaunal province based on the distribution pattern of those three endemic species.

Following the International Code of Area Nomenclature (ICAN; Ebach et al., 2008), I assign “district” as the rank for these three areas of endemism because they can be grouped under a more inclusive area, the northwestern Sumatra Province. I propose the district name after the major river drainages in each area: Tripa District, Kluet District, and Alas

District, respectively, from north to south. Among the three districts, the Alas District is the only one that has been extensively explored ichthyologically (Hadiaty, 2005), whereas the other two were only once briefly surveyed in 2006. Future, more intensive surveys in these two districts would likely reveal more new endemic species.

The taxonomy of the Sumatrana group has been subjected to a high rate of synonymy among species within the group, primarily due to unclear species delineation and a lack of appreciation of highly variable characters potential for species diagnosis, which consequently lead to conflicting interpretations by different workers. Brittan (1954) considered several nominal species of Rasbora as ‘geographical races’ of R. sumatrana sensu stricto and synonymized them with this species. He, thus, only recognized three valid species in the group. Alternatively, subsequent authors highlighted the variation of lateral pigmentation patterns and propose them as useful diagnostic characters for delimiting species of the group. As a result, several junior synonyms of R. sumatrana according to

Brittan (1954), R. aurotaenia, R. calliura, R. paviana, R. hosii, and R. vulgaris, were resurrected as valid species (Kottelat, 1986; Kottelat and Lim, 1995; Kottelat, 2001, 2005;

Tan and Kottelat, 2009). Kottelat and Vidthayanon (1993), in their revision of the group, increased the number of species from only three to 13 species, due to the inclusion of some new species described after Brittan (1954), transfers of species from other groups, and revalidation of some junior synonyms.

Kottelat (2005) classified several members of the Sumatrana group into a new species group, the R. paviana group (the Paviana group hereafter), comprised of five species from mainland Asia (Indochina and the Malay Peninsula): R. paviana, R. vulgaris,

R. notura, R. hobelmani, and R. dorsinotata. This group is diagnosable based on the possession of a black midlateral stripe that terminates at a blotch at the caudal peduncle.

However, the definition of the term ‘blotch’ (here termed as basicaudal blotch, following

Lumbantobing, 2010) is not well circumscribed. Kottelat (2005) used this as the only diagnostic character for the new group, and merely emphasized the tendency for the members of the group to have a diamond-shaped basicaudal blotch (his “blotch”). Contrary to Kottelat (2005), who proposed that such a blotch is restricted to the species in mainland

Asia, I observed that this basicaudal blotch is distributed across nearly all the species of the

Sumatrana group, including the Sundaland species. These exhibit high variability in the shape of the blotch, its intensity, and its position relative to the black midlateral stripe.

Considering the broad distribution and variability of the basicaudal blotch across all species in the group and the limited knowledge as to the nature of this character, I classify all species of Rasbora with such caudal pigmentation, including the five species of the

Paviana group sensu Kottelat (2005), in the Sumatrana group. Future comparative studies focusing on the details of the basicaudal blotch as well as other details of lateral body pigmentation (e.g., black midlateral stripe and supra-anal pigmentation) will be critical in

88 solving the taxonomic problems in the Sumatrana group, and in delimiting potential subdivisions (e.g., species subgroups or complexes) within the group.

On the basis of their phylogenetic analysis, Liao et al. (2010) revised Brittan’s

(1954) species groups, including the Sumatrana group according to the tree-based or phylogenetic hierarchy. Given its placement together with species of the Sumatrana group on the phylogeny, albeit on the more exterior branch, the Caudimaculata group sensu

Brittan (1954) was combined with the Sumatrana group. At the same time, Liao et al.

(2010) excluded R. elegans from the Sumatrana group and transferred it to the Einthovenii group, because it is embedded in a clade together with R, einthovenii and R, cephalotaenia, the only two representatives of the Einthovenii group used in their analysis. I agree with the inclusion of the Caudmaculata group in the Sumatrana group by Liao et al. (2010), because

I observed that all species of the Caudimaculata group sensu Brittan (1954), except R. dorsiocellata, possess the three primary diagnostic characters of the Sumatrana group. The inclusion of R. elegans into the R. einthovenii-group is not well-supported as there is only one reversed synapomorphy supporting the pertinent clade in the phylogeny of Liao et al.

(2010). Moreover, Liao et al. (2010) overlooked the significance of the basicaudal blotch as a potential synapomorphy. They did not include it as a character in their phylogenetic analysis, despite the fact that Brittan (1954) and Kottelat (2005) considered the blotch to be one of the major diagnostic characters of the Sumatrana group. In fact, the topotypes collected from the type locality of R. sumatrana s. s. as featured in Kottelat et al. (1993) resemble R. elegans most closely in color pattern and body shape. Therefore, contrary to

Liao et al (2009), I retain R. elegans within the Sumatrana group according to the

89 phylogeny herein that takes into account the aforementioned diagnostic characters of the

Sumatrana group (Chapter 3).

The specimens of Rasbora n. sp. 1, Rasbora n. sp. 2, Rasbora n. sp. 3, and Rasbora n. sp. 4 were initially identified as R. sumatrana, a species of uncertain limits yet with pronounced polymorphisms across many different populations. The type locality of R. sumatrana s. s. is Solok (West Sumatra), in the Indragiri River drainage, from where a series of topotypes were recently collected and figured in Kottelat et al. (1993) and Tan and

Kottelat (2009). Tan and Kottelat (2009) reported that this species is restricted to the fast- flowing streams of the interior of Sumatra, and is most abdundant in the Batang Hari and

Indragiri River drainages. Nevertheless, because the number of examined specimens representing different populations, especially from Sumatra, was so limited, Tan and

Kottelat (2009) tentatively classified all morphs as R. sumatrana sensu lato. Based on additional specimens of Sumatran Rasbora from the 2006 expedition and various older museum collections, I confirmed the high variability across different populations of R. sumatrana s. l., each of which shows consistently distinct differences in the three primary diagnostic characters of the Sumatrana group. Thus, based on the representative specimens,

I classify those distinct populations as four new species.

All new species of the Sumatrana group living in northern Sumatra are distinguished from the members of other species groups of Rasbora in the region (R. api,

R. jacobsoni, R. kluetensis, R. meinkeni, R. nodulosa, R. reticulata, R. truncata, and R. vulcanus) by the following characters: the black midlateral stripe is barely confluent anteriorly with the post-opercular pigmentation; the basicaudal pigmentation is always present and larger than the pupil [“blotch” sensu Kottelat (2001); Figure 2.3]; and the

90 lateral surface of the upper lip is discontinuously exposed with the submedial portion slightly covered due to the contact between the maxilla and the lower lip (Figure 2.14). I discovered that this discontinuous exposure of the upper lip is consistently present in all examined specimens of the Sumatrana group. Therefore, in addition to the three aforementioned primary diagnostic characters of lateral pigmentation, I consider this another diagnostic character for the Sumatrana group.

Among the four new species from Northern Sumatra described herein, Rasbora n. sp. 1 and Rasbora n. sp. 2 resemble each other the most. Rasbora n. sp. 1 (Figures 2.13.A,

2.16.A) is distinguished from Rasbora n. sp. 2 (Figures 2.13.B, 2.16.B) in having: the black midlateral stripe tapering anteriorly to form a reed-leaf-like profile extending posteriorly as a uniformly wide stripe and broadly confluent with the triangular basicaudal patch (vs. terminated abruptly anteriorly forming a grass-flower profile attenuating posteriorly until disappearing on the hypural notch and barely confluent with the basicaudal triangular patch); and the supra-anal pigmentation in the form of a tear-shaped black patch (vs. appearing as a thin elongate streak). Rasbora n. sp. 3 (Figures 2.13.C, 2.18.B) is similar overall to Rasbora n. sp. 1 and Rasbora n. sp. 2, but readily distinguishable by having a thin black midlateral stripe of relatively uniform width or lacking a subdorsal band below dorsal fin (vs. with the subdorsal band present, respectively). Rasbora n. sp. 4 (Figures

2.13.D, 2.19.C) is the most distinct among all four new species and is distinguished from the other three species by having the rudimentary form of black midlateral stripe appearing solely as a black, somewhat rectangular subdorsal band, and also by lacking supra-anal pigmentation.

In comparison with the other valid species of the Sumatrana group, Rasbora n. sp. 1 is similar overall to R. bunguranensis from Natuna Island (Figure 2.16.C), R. notura from eastern peninsular Malaysia (Figure 2.16.D), R. hosii from Bornean Sarawak (Figure

2.17.A), and R. spilotaenia from southern Sumatra (Figure 2.17.B). It is distinguished from all four of those species in having an anteriorly-tapering black midlateral stripe, reaching the midhumeral region with a long pointed tip (vs. terminated anteriorly in a more or less blunt tip without reaching the midhumeral region) and an axial streak terminating above and barely confluent with apex of basicaudal triangular patch (vs. confluent and terminating at apex of basicaudal triangular patch). Rasbora n. sp. 1 is also distinguished from R. notura and R. hosii in having the supra-anal pigmentation in the form of a tear- shaped black patch (vs. appearing as a thin elongated streak). Rasbora n. sp. 1 differs from

R. spilotaenia by having a half-scale deep black midlateral stripe along the posterior half of the body (vs. a thin black line along posterior half of the body). Rasbora n. sp. 1 is distinguished from R. bunguranensis in having supra-anal pigmentation that is prominent black (vs. grey and inconspicuous).

Rasbora n. sp. 2 was also initially identified as R. lateristriata (Figure 2.18.A).

Nevertheless, the type locality of R. lateristriata is West Java, and after comparison with specimens from West Java, the specimens of Rasbora n. sp. 2 are readily distinguishable from R. lateristriata in having a subdorsal band deeper than the posterior-portion stripe (vs. lacking a subdorsal band) and the posterior tip of the black midlateral stripe discontinuous from the anterior tip of the basicaudal blotch (vs. confluent with the basicaudal blotch).

Rasbora n. sp. 2 also superficially resembles R. notura, R. spilotaenia, R. bunguranensis, and R. hosii, but is distinguishable from all four species in having the axial streak

92 terminating above and barely confluent with the apex of the basicaudal triangular patch (vs. confluent with and terminating at the apex of the basicaudal triangular patch) and the posterior tip of black midlateral stripe discontinuous from the anterior tip of the basicaudal blotch (vs. confluent with the basicaudal blotch). Rasbora n. sp. 2 is further distinguished from R. spilotaenia and R. bunguranensis by the presence of supra-anal pigmentation forming a thin, elongate streak (vs. an ellipsoidal blotch).

Rasbora n. sp. 3 appears most similar to R. vulgaris (Figure 2.18.C) from western peninsular Malaysia among the other valid species of the Sumatrana group, but is distinguished from R. vulgaris by the presence of a supra-anal pigmentation in the form of an ellipsoidal blotch (vs. a thin elongate streak) and a shallow, somewhat triangular basicaudal blotch (vs. a deep diamond-shaped blotch). Two other species that resemble

Rasbora n. sp. 3 are R. lateristriata from Western Java (Figure 2.18.A) and R. paviana from the Malay Peninsula (Figure 2.18.D). Rasbora n. sp. 3 can be differentiated from R. lateristriata by the possession of a black midlateral stripe terminating anteriorly on the midhumeral region (vs. terminating anteriorly on the postopercular pigmentation) and a dot-shaped supra-anal pigmentation smaller than the pupil (vs. a semicircular supra-anal pigmentation larger than the pupil).

The specimens of Rasbora n. sp. 4 were initially identified as R. elegans, a species widely distributed throughout Peninsular Malaysia and Sundaland (except Java). Rasbora n. sp. 4 (Figure 2.19.C) differs from R. elegans (Figure 2.19. A, B) in the lack of the supra- anal pigmentation (vs. present), the basicaudal triangular patch absent (vs. present), and the basicaudal spot somewhat diffuse (vs. prominent). Rasbora n. sp. 4 also appears similar overall to R. sumatrana s. s. [photograph in Tan and Kottelat (2009)] in color pattern, but is

93 readily distinguishable from this type species by the absence of the midhumeral diffuse patch (vs. present and continuous with the rectangular subdorsal band), the absence of the posterior-portion stripe (vs. present, but diffuse), and the absence of the supra-anal pigmentation (vs. present, as a thin, elongate line).

On the basis of similarity of the shape of the black midlateral stripe, I classify the species of the Sumatrana group in three artificial subgroups: (1) the R. hosii-subgroup

(Figures 2.16 and 2.17); (2) the R. lateristriata-subgroup (Figure 2.18); and (3) the R. elegans-subgroup (Figure 2.19). The R. hosii-subgroup is characterized by the black midlateral stripe with the subdorsal band always present. The R. lateristriata-subgroup is characterized by the black midlateral stripe tapering anteriorly and reaching the midhumeral region, but lacking any distinct subdorsal band as opposed to the one in the R. hosii-subgroup. In contrast, in the R. elegans-subgroup, the black midlateral stripe transforms into a rudimentary form lacking the posterior-portion stripe, which appears as a semirectangular subdorsal band.

KEY TO THE SPECIES OF THE RETICULATA GROUP AND THE

SUMATRANA GROUP IN NORTHERN SUMATRA

1a. Black midlateral stripe anteriorly confluent with post-opercular pigmentation;

basicaudal pigmentation, if present, always smaller than pupil; lateral surface of upper

lip continuously exposed from symphyseal knob to rictus (Figure 2.9); dorsohypural

distance equal to distance from dorsal-fin origin to area between nostril and anterior of

orbit……………………...... 2

1b. Black midlateral stripe anteriorly barely confluent with post-opercular pigmentation;

basicaudal pigmentation always present and larger than pupil; lateral surface of upper

lip discontinuously exposed, with submedial portion slightly covered due to contact

point between maxilla and lower lip (Figure 2.14); dorsohypural distance equal to

distance from dorsal-fin origin to area between anterior and posterior margins of

orbit……………………………………………………………………..7

2a. Black midlateral stripe tapering anteriorly; axial streak extending anteriorly to

posterior margin of pectoral girdle …………………...... Rasbora api

2b. Black midlateral stripe not tapering anteriorly; axial streak extending anteriorly to

terminate in area between verticals through dorsal-fin origin and pelvic-fin insertion

………..……………………………………………………………………………... 3

3a. Basicaudal spot present; distinct depression present on ventrolateral margin of upper

jaw notched with deep lachrymal groove (Figure 2.9.A,B); gill rakers on first arch 11–

12 ……………………………………………………………… Rasbora tobana

3b. Basicaudal spot absent; indistinct depression on ventrolateral margin of upper jaw

barely continuous with deep lachrymal groove (Figure 2.9.C,D); gill rakers on first

arch 13–15 ………………………………………………………………………..... 4

1 4a. Basal reticulation with maximum vertical coverage of 4 /2 longitudinal scale rows; all

scales of lateral line series with distinct pigmentation of basal reticulation; axial streak

bordering dorsal margin of black midlateral stripe posteriorly (Figure 2.10.B)

…………………………………………………………………… Rasbora meinkeni

1 1 4b. Basal reticulation with maximum vertical coverage in range of 2 /2–3 /2 longitudinal

scale rows; scales of lateral line series on caudal peduncle with barely any dark

pigmentation; axial streak traversing dorsal part of black midlateral stripe posteriorly

(Figure 2.10.A) ……………………………………...……………………………… 5

5a. Dorsomedial branch of supraorbital canal extending towards posterior margin of

frontal present (Figure 2.4.D: DmC); process on posterodorsal margin of first

infraorbital present (Figure 2.4.D: 1IP ) ………………………..... Rasbora nodulosa

5b. Dorsomedial branch of supraorbital canal extending towards posterior margin of

frontal absent; process on posterodorsal margin of first infraorbital absent (Figure

2.4.E, F) ………………...……..……………………………………………………..6

6a. Lachrymal region uniformly pigmented, no unpigmented central area (Figure 2.9.C);

1 basal reticulation with maximum vertical coverage of 3 /2 longitudinal scale rows;

lateral line complete…………………………………….….Rasbora kluetensis

6b. Lachrymal region pigmented peripherally with unpigmented central area (Figure

1 2.9.A); basal reticulation with maximum vertical coverage of 2 /2 longitudinal scale

rows; lateral line incomplete (absent from 1–6 posterior scales)……………………...

………..……………………………………………………….……Rasbora truncata

7a. Posterior-portion stripe and midhumeral diffuse patch of black midlateral stripe

absent; supra-anal pigmentation absent (Figures 2.13.D, 2.19.C) ……………………

.…………………………………..……………………………...Rasbora n. sp. 4

7b. Posterior-portion stripe and midhumeral diffuse patch of black midlateral stripe

present; supra-anal pigmentation present………..………………………………... 8

8a. Black midlateral stripe not reaching midhumeral region anteriorly; posterior-portion

stripe not confluent posteriorly with anterior tip of basicaudal blotch; supra-anal

pigmentation elongated (Figures 2.13.B, .16.B)…………………………..

…………………………………………………………………..…...Rasbora n. sp. 2

8b. Black midlateral stripe anteriorly reaching midhumeral region; posterior-portion stripe

posteriorly confluent with anterior tip of basicaudal blotch; supra-anal pigmentation

ovoid…...... 9

9a. Subdorsal band present; black midlateral stripe extending anteriorly and confluent

with subdorsal band (Figures 2.13 A, 2.16.A)……………………………………….

……………………………………….……………………………... Rasbora n. sp. 1

9b. Subdorsal band absent; black midlateral stripe tapering anteriorly reaching

midhumeral region and without subdorsal band (Figures 2.13.D, 2.18.B)…………..

…………………………………………………………….…………Rasbora n. sp. 3

Figure 2.1. Left lateral views of body of the Trifasciata group showing: (A) general body pigmentation; (B) morphometric measurements and schematic drawing of body squamation. Numbers on scales [1–5] refer to the order of longitudinal scale rows; ABL =

Anal Base Length; BCS = Basicaudal Spot; BR = Basal Reticulation; CPD = Caudal

Peduncle Depth; CPL = Caudal Peduncle Length; DBL = Dorsal Base Length; DD =

Dorsal Fin Depth; DHyL = Dorsohypural Distance; DLS = Dorsolateral Stripe; ED = Eye

Diameter, HD = Head Depth; HL = Head Length; LCL = Lower Caudal Lobe Length;

LLA = Light Longitudinal Area; MCL = Median Caudal Length; MLS = Midlateral Stripe;

MOS = Midopercular Stripe; PD = Predorsal length; POP = Postopercular Pigmentation;

PR = Peripheral Reticulation; PrA = Preanal Length; PrPv = Prepelvic Length; PtL =

Pectoral Fin Length; PvL = Pelvic Fin Length; SAP = Supra-anal Pigmentation; SL =

Standard Length; SnL = Snout Length; SPS = Subpeduncular Streak; TL = Total Length;

UCL = Upper Caudal Lobe Length.

Figure 2.2. Left lateral view of portion of body dorsal to posterior portion of pectoral fin of the Trifasciata group detailing types of body pigmentation: dusky dorsolateral background pigmentation, streak, stripes, and reticulated patterns. AS = Axial Streak; BR = Basal

Reticulation; DLR = Dorsolateral Region; DLS = Dorsolateral Stripe; IZ = Immaculate

Zone; LLA = Light Longitudinal Area; MLR = Midlateral Stripe; MLS = Midlateral Stripe;

PF = Pectoral Fin; PR = Peripheral Reticulation; VLR = Ventrolateral Stripe.

100

101

Figure 2.3. Left lateral views of body of the Sumatrana group showing: (A) general body pigmentation; (B) schematic drawing of lateral body pigmentation. AS = Axial Streak;

BCB = Basicaudal Blotch; BCS = Basicaudal Spot; BR = Basal Reticulation; BTP =

Basicaudal Triangular Patch; CP = Caudal Pigmentation; DLS = Dorsolateral Stripe; MDP

= Midhumeral Diffuse Patch; MLS = Midlateral Stripe; POP = Postopercular Pigmentation;

PPS = Posterior-Portion Stripe; PR = Peripheral Reticulation; SAP = Supra-anal

Pigmentation; SDB = Subdorsal Band.

102

103

Figure 2.4. Schematic drawing of left lateral view of cranium showing infraorbitals, supraorbitals, cephalic lateral line canals, and dermosphenotic region. (A) Rasbora api,

USNM 390330, 33.4 mm SL; (B) Rasbora meinkeni, USNM 390223, 30.4 mm SL; (C)

Rasbora tobana, USNM 193041, 33.5 mm SL; (D) Rasbora nodulosa, USNM 391743,

34.2 mm SL; (E) Rasbora kluetensis, USNM 391747, 31.7 mm SL; (F) Rasbora truncata,

USNM 391745, 32.2 mm SL. 1IC = First Infraorbital Concavity along its posterior margin;

1IP = First Infraorbital Process on dorsoposterior tip; DmC = Dorsomedial branching of supraorbital canal on posterior portion of frontal; LDF = Large Dilatator Fossa; LSo =

Large Supraorbital (with narrow gap between its posterior tip and 5th infraorbital); SpE =

Sphenotic Exposure (above supraorbital canal). Each bar equals 0.5 cm.

104

105

Figure 2.5. Scanning electron micrographs of cephalic tubercles and cranial superficial neuromasts. Rasbora api, USNM 391737, 34.1 mm SL, male: type A tubercles (A1-A4);

Rasbora meinkeni, USNM 390223, 25.5 mm SL, male: type B tubercles (B1-B3), type I cranial neuromasts (B4); Rasbora tobana, USNM 193001, 27.6 mm SL, male: type C tubercles (C1-C3), type I cranial neuromasts (C3); Rasbora nodulosa, MZB 16468, 26.9 mm SL, male: type D tubercles (D1-D3), type II cranial neuromasts (D4); Rasbora kluetensis, USNM 391747, 24.9 mm SL, male: type E tubercles (E1-E3), type III cranial neuromasts (E4); Rasbora truncata, USNM 391745, 25.5 mm SL, male: type B tubercles

(F1-F3), type IV cranial neuromasts (F4).

106

107

Figure 2.6. (A) Rasbora api, holotype, MZB 16457, 45.6 mm SL, female; (B) Rasbora meinkeni, USNM 390223, 26.2 mm SL, female; (C) Rasbora tobana, USNM 390141, 29.9 mm SL, female. Each bar equals 1 cm.

108

109

Figure 2.7. (A) Rasbora nodulosa, holotype, MZB 16465, 34.6 mm SL, female; (B)

Rasbora kluetensis, holotype, MZB 16470, 30.9 mm SL, female; (C) Rasbora truncata, holotype, MZB 16678, 26.6 mm SL, male. Each bar equals 1 cm.

110

111

Figure 2.8. Photographs of living specimen: (A) Rasbora api, MZB 16687; (B) Rasbora meinkeni, USNM 390223, photo by R. Hadiaty; (C) Rasbora tobana, USNM 390318 ; (D)

Rasbora nodulosa, MZB 16468.

112

113

Figure 2.9. Left lateral view of head showing close up of lachrymal pigmentation (A, C), ventrolateral margin of upper jaw (B, D), and ventral projection of dentary articulation (C: arrow). (A) Rasbora api, MZB 16458, 42.7 mm SL, with lachrymal peripherally pigmented and unpigmented central area, also present in R. nodulosa and R. truncata; (B) schematic drawing of ventrolateral margin of upper jaw with lachrymal groove in R. api and R. tobana; (C) R. meinkeni, MZB 16689, 25.9 mm SL, with lachrymal uniformly pigmented, also present in R. tobana and R. kluetensis; (D) schematic drawing of ventrolateral margin of upper jaw with shallow lachrymal groove in R. meinkeni, R. nodulosa, R. kluetensis, and

R. truncata. LG = Lachrymal Groove. Each bar equals 1 mm.

114

115

Figure 2.10. Left lateral view of caudal peduncle detailing position of axial streak relative to black midlateral stripe posteriorly. (A) axial streak traversing black midlateral stripe; (B) axial streak barely traversing black midlateral stripe, but bordering dorsal margin of stripe.

AS = Axial Streak.

116

117

Figure 2.11. Distribution of species of the Reticulata group in Northwestern Sumatra:

Rasbora api (diamonds), R. meinkeni (five-pointed stars), R. tobana (ten-pointed stars), R. nodulosa (squares), R. kluetensis (hexagrams), and R. truncata (circles). Filled symbols are the locality of holotype. One symbol may represent more than one locality.

118

119

Figure 2.12. Photographs of living specimens: (A–C) Rasbora n. sp. 1, USNM 391607

(paratype); (D–F) Rasbora n. sp. 4, MZB 21117 (paratype); (G–I) Rasbora n. sp. 3, MZB

17890 (holotype).

120

121

Figure 2.13. (A) Rasbora n. sp. 1, holotype, MZB17881, 74.5 mm SL, female; (B) Rasbora n. sp. 2, holotype, MZB 17888, 65.4 mm SL, female; (C) Rasbora n. sp. 3, holotype, MZB

17890, 66.9 mm SL, male; (D) Rasbora n. sp. 4, holotype, MZB 17889, 47.1 mm SL, female. Bars equal 1 cm.

122

123

Figure 2.14. Left lateral view showing close up of lip arrangement of the Sumatrana group.

Bar equals 2 mm.

124

125

Figure 2.15. Distribution of species of the Sumatrana group in northwestern Sumatra and adjacent regions: Rasbora n. sp. 1 (diamonds), Rasbora n. sp. 2 (circles), Rasbora n. sp. 3

(five-pointed star), Rasbora n. sp. 4 (fifteen-pointed stars), and R. vulgaris (squares). White outlined symbols are the localities of holotypes. One filled symbol may represent more than one locality.

126

127

Figure 2.16. Schematic drawing of left lateral view of three primary diagnostic lateral pigmentations of members of the Rasbora hosii-subgroup: (A) Rasbora n. sp. 1; (B)

Rasbora n. sp. 2; (C) R. bunguranensis; (D) R. notura.

128

129

Figure 2.17. Schematic drawing of left lateral view of three primary diagnostic lateral pigmentations of members of the Rasbora hosii-subgroup: (A) R. hosii; (B) R. spilotaenia;

130

131

Figure 2.18. Schematic drawing of left lateral view of three primary diagnostic lateral pigmentations of members of the Rasbora lateristriata-subgroup: (A) R. lateristriata; (B)

Rasbora n. sp. 3; (C) R. vulgaris; (D) R. paviana.

132

133

Figure 2.19. Schematic drawing of left lateral view of three primary diagnostic lateral pigmentations of members of the Rasbora elegans-subgroup: (A) R. elegans from West

Johor, Peninsular Malaysia; (B) R. elegans from East Johor, Peninsular Malaysia; (C)

Rasbora n. sp. 4.

134

135

Table 2.1. Morphometric data for species of the Reticulata group in northwestern Sumatra. See Figure 1.

Rasbora api Rasbora meinkeni Rasbora tobana n=40 n = 30 n = 10 mean ± Range Range Range mean ± SD mean ± SD SD

Standard length (SL) 22.5 - 43.7 31.2 ± 5.1 20.9 - 45.6 28.5 ± 6.7 25.7 - 47.7 38.6 ± 7.2 Percentage of SL 136.9 ± 126.5 - 138.3 Total length (TL) 134.7 - 142.5 137.9 ± 1.9 135.1 ± 18.6 134.1 - 139.7 2.1 Head length (HL) 27.4 - 31.6 29.6 ± 1.1 27.5 - 31.6 29.8 ± 1.0 26.6 - 29.9 28.0 ± 0.9 Predorsal length (PD) 52.7 - 57.5 55.1 ± 1.1 52.4 - 58.5 55.7 ± 1.4 52.2 - 55.8 53.7 ± 1.3 Preanal length (PrA) 65.2 - 71.7 68.5 ± 1.3 66.7 - 74.9 70.6 ± 1.8 65.3 - 69.6 68.1 ± 1.3 Prepelvic length (PrPv) 47.5 - 55.9 50.7 ± 1.6 49.2 - 53.9 51.5 ± 1.2 49.3 - 52.1 50.6 ± 0.9 Dorsal depth (DD) 23.7 - 29.3 26.9 ± 1.3 21.1 - 29.2 26.1 ± 1.7 23.3 - 28.1 25.8 ± 1.4 Body Depth (BD) 22.3 - 27.6 25.3 ± 1.3 23.6 - 31.0 26.8 ± 1.9 24.6 - 28.7 26.3 ± 1.6 Caudal peduncle depth (CdD) 10.1 - 13.7 12.3 ± 0.8 11.1 - 13.2 12.1 ± 0.6 10.9 - 13.5 12.1 ± 0.9 Caudal peduncle length (CdL) 17.2 - 20.9 18.9 ± 0.9 15.5 - 21.9 19.0 ± 1.6 17.6 - 21.7 19.8 ± 1.1 Dorsal-fin base length (DbsL) 9.7 - 15.1 12.4 ± 1.1 10.1 - 15.0 12.4 ± 1.0 10.1 -13.9 11.8 ± 1.2 Anal-fin base length (AbsL) 10.9 -14.6 12.6 ± 0.9 10.1 - 13.4 11.6 ± 0.7 11.2 - 13.9 12.2 ± 0.9 Pelvic-fin length (PvL) 15.3 - 20.4 18.4 ± 1.2 15.9 - 20.1 17.8 ± 1.0 16.1 - 19.1 17.6 ± 1.1 Pectoral-fin length (PtL) 20.1 - 24.7 22.5 ± 0.9 19.8 - 25.2 22.8 ± 1.6 20.7 - 23.6 22.0 ± 1.0 Upper caudal lobe length (UpCdL) 32.8 -43.2 37.3 ± 2.2 28.1 - 36.5 33.8 ± 2.1 33.4 - 39.5 36.7 ± 2.1 Median caudal length (MdCdL) 11.8 - 18.5 14.4 ± 1.5 11.4 - 17.3 13.7 ± 1.2 11.5 - 17.0 13.9 ± 1.8 Lower caudal lobe length (LwCdL) 35.6 - 43.8 38.6 ± 1.8 27.6 - 39.0 34.9 ± 2.1 33.7 - 41.8 38.4 ± 2.8 Dorsohypural distance (DD) 48.1 - 56.0 51.5 ± 1.7 47.1 - 54.5 50.8 ± 1.7 50.1 - 55.2 52.7 ± 1.4 Percentage of HL Eye diameter (ED) 29.6 - 39.0 34.1 ± 2.0 26.0 - 35.3 30.8 ± 2.6 30.6 - 33.7 31.8 ± 1.2 Snout length (SnL) 24.6 - 31.2 27.3 ± 1.7 22.7 - 31.3 26.1 ± 2.0 24.7 - 28.7 27.0 ± 1.5 Head width (HW) 43.7 - 52.9 48.3 ± 2.3 42.0 -52.2 45.2 ± 2.4 45.7 - 52.1 48.8 ± 2.1 Head depth (HD) 61.5 - 72.7 67.7 ± 2.7 60.6 -71.4 66.2 ± 3.0 64.3 - 76.5 69.9 ± 3.9 Interorbital width (IO) 31.4 - 39.0 35.7 ± 1.8 31.0 - 40.0 34.3 ± 2.1 32.7 - 40 36.7 ± 2.2

136

Table 2.1. Continued.

Rasbora nodulosa Rasbora kluetensis Rasbora truncata n = 26 n=20 n=20 Range mean ± SD Range mean ± SD Range mean ± SD

Standard length (SL) 23.5 - 51.7 35.3 ± 7.7 24.7 - 43.5 31.8 ± 5.1 22.8 - 37.8 28.9 ± 4.5 Percentage of SL Total length (TL) 128.5 - 138.7 134.6 ± 2.5 133.1 - 140.8 133.1 ± 2.1 133.3 -142.1 137.4 ± 2.1 Head length (HL) 26.0 - 31.0 28.5 ± 1.4 28.1 - 32.0 29.7 ± 1.2 26.7 - 31.1 29.1 ±1.4 Predorsal length (PD) 53.4 - 57.9 55.1 ± 1.2 53.8 - 58.9 55.8 ± 1.5 53.1 - 58.0 55.5 ± 1.4 Preanal length (PrA) 66.4 - 73.6 69.7 ± 1.9 66.7 - 73.2 70.3 ± 2.1 68.1 -72.0 69.5 ± 0.9 Prepelvic length (PrPv) 47.4 - 52.9 50.2 ± 1.6 50.1 - 52.9 51.6 ± 0.8 49.5 - 53.0 51.2 ± 1.1 Dorsal depth (DD) 23.4 - 28.1 26.1 ± 1.2 24.6 - 30.6 26.7 ± 1.2 23.4 - 29.9 26.9 ± 1.7 Body Depth (BD) 24.8 - 29.3 27.2 ± 1.2 24.1 - 29.9 27.5 ± 1.9 23.6 - 28.6 25.8 ± 1.6 Caudal peduncle depth (CdD) 12.2 - 14.1 13.1 ± 0.5 11.9 - 13.6 12.7 ± 0.5 10.1 - 12.9 11.5 ± 0.8 Caudal peduncle length (CdL) 16.2 -22.3 19.6 ± 1.7 14.7 - 22.8 18.7 ± 1.5 16.2 - 20.6 18.3 ± 1.2 Dorsal-fin base length (DbsL) 10.8 - 14.7 12.4 ± 1.0 11.5 - 14.6 12.7 ± 0.8 10.3 - 14.4 12.4 ± 1.1 Anal-fin base length (AbsL) 10.6 - 13.6 12.0 ± 0.8 11.2 - 13.9 12.5 ± 0.9 10.5 - 13.6 12.3 ± 0.9 Pelvic-fin length (PvL) 17.0 - 19.8 18.4 ± 0.7 17.6 -22.1 18.8 ± 1.1 17.7 - 20.5 19.1 ± 0.9 Pectoral-fin length (PtL) 21.0 - 24.0 22.7 ± 0.8 21.1 - 25.7 23.7 ± 1.3 20.5 - 25.2 22.8 ± 1.2 Upper caudal lobe length (UpCdL) 26.8 - 38.5 33.6 ± 2.9 33.6 - 39.9 36.3 ± 2.0 32.5 - 38.5 36.2 ± 1.6 Median caudal length (MdCdL) 12.6 - 16.0 14.2 ± 0.9 10.5 - 18.1 14.8 ± 1.9 13.2 - 18.0 15.4 ± 1.4 Lower caudal lobe length (LwCdL) 27.5 - 38.5 34.4 ± 2.8 33.0 - 39.9 37.2 ± 2.1 33.3 - 40.6 37.5 ± 2.3 Dorsohypural distance (DD) 48.6 - 54.6 51.5 ± 1.8 47.0 - 52.9 50.4 ± 1.6 45.2 - 54.1 51.2 ± 2.1 Percentage of HL Eye diameter (ED) 27.0 - 32.9 30.1 ± 1.5 27.8 - 33.3 30.5 ± 1.6 30.0 - 35.4 32.5 ± 1.6 Snout length (SnL) 24.3 - 31.6 27.6 ± 1.8 25.3 - 32.0 27.9 ± 2.0 21.4 - 30.6 27.2 ± 2.2 Head width (HW) 40.4 - 48.2 45.1 ± 1.8 41.8 - 49.4 45.8 ± 2.1 41.1 - 51.4 46.0 ± 2.9 Head depth (HD) 58.8 -74.3 65.1 ± 3.8 62.0 - 74.0 66.9 ± 3.2 62.0 - 72.2 65.9 ± 2.8 Interorbital width (IO) 32.5 - 38.8 35.4 ± 1.7 30.4 - 39.3 35.6 ± 2.4 31.5 - 38.6 34.3 ± 1.9

137

Table 2.2. Meristic data for species of the Reticulata group in northwestern Sumatra.

R. api R. meinkeni R. tobana Range Mode (n) Range Mode (n) Range Mode (n) Gill rakers on first gill 11–12 11 (5) 13–15 14 (3) 11–12 11 (3) arch Pharyngeal teeth formula 5,3,2 5,3,2 (5) 5,3,2 5,3,2 (3) 5,3,2 5,3,2 (3) Dorsal-fin rays ii,7 ii,7 (16) ii,7 ii,7 (10) ii,7 ii,7 (7) Pectoral-fin rays i,11–13 i,12 (16) i,13 i,13 (10) i,13 i,12 (7) Pelvic-fin rays i,7–8 i,7 (16) i,7 i,8 (10) i,7 i,7 (7) Anal-fin rays ii,5 ii,5 (16) ii,5 ii,5 (10) ii,5 ii,5 (7) Dorsal procurrent caudal- 8–9 8 (9) 7 7 (5) 7 7 (5) fin rays Dorsal principal caudal-fin 10 10 (9) 10 10 (5) 10 10 (5) rays Ventral procurrent caudal- 9 9 (9) 9 9 (5) 9 9 (5) fin rays Ventral principal caudal- 7–8 7 (9) 7 7 (5) 7 7 (5) fin rays Scale of lateral line series 29–32 31 (10) 27–29 28 (5) 29–32 29 (10) Predorsal scales 11–13 12 (10) 11–12 12 (5) 12–13 12 (10) Transverse scales count 16, 18, 20 18 (10) 16 16 (5) 18, 20 18 (10) 1 1 1 1 1 1 1 1 1 1 1 1 Circumferential formula /24-5,1,2-3 /2 /24,1,3 /2 (10) /24,1,2 /2 /24,1,2 /2 (5) /24-5,1,3 /2 /24,1,3 /2 (10) Circumpeduncular scales 10, 12 10 (10) 12 12 (5) 10, 12 10 (10) Vertebrae (total) 31–32 32 (32) 31–32 32 (20) 31–32 32 (12) Prehaemal vertebrae 15–16 16 (32) 15–16 16 (20) 15–16 16 (12) Haemal vertebrae 15–16 16 (32) 15–16 16 (20) 15–16 16 (12) Peduncular vertebrae 8–9 8 (32) 8–9 8 (20) 8–9 8 (12)

138

Table 2.2. Continued.

R. nodulosa R. kluetensis R. truncata Range Mode (n) Range Mode (n) Range Mode (n) Gill rakers on first gill 13–15 14 (3) 13–15 13 (3) 13–15 14 (3) arch Pharyngeal teeth formula 4–5,3–4,2 5,3,2 (3) 4–5,3–4,2 5,3,2 (3) 5,3,2 5,3,2 (3) Dorsal-fin rays ii,7 ii,7 (17) ii,7 ii,7 (10) ii,7 ii,7 (10) Pectoral-fin rays i,11–13 i,13 (17) i,11–13 i,13 (10) i,12–13 i,13 (10) Pelvic-fin rays i,8 i,8 (17) i,8 i,8 (10) i,7 i,8 (10) Anal-fin rays ii,5 ii,5 (17) ii,5 ii,5 (10) ii,5 ii,5 (10) Dorsal procurrent caudal- 8 8 (7) 8–9 8 (10) 8 8 (5) fin rays Dorsal principal caudal- 10 10 (7) 10 10 (10) 10 10 (5) fin rays Ventral procurrent caudal- 9–10 9 (7) 9 9 (10) 9 9 (5) fin rays Ventral principal caudal- 7–8 7 (7) 7–8 7 (10) 7 7 (5) fin rays 20–26 Scale of lateral line series 27–29 29 (8) 27–29 29 (7) 25 (7) (perforated) Predorsal scales 12–13 12 (8) 11–13 12 (7) 11–14 13 (7) Transverse scale count 16, 18 16 (8) 16 16 (7) 16, 18, 20 16 (7) 1 1 1 1 1 1 1 1 1 1 1 1 Circumferential formula /24-5, 1,2 /2 /24,1,2 /2 (8) /24,1,2 /2 /24,1,2 /2 (7) /24-5,1,2-3 /2 /24,1,2 /2 (7) Circumpeduncular scales 12 12 (8) 12 12 (7) 12 12 (7) Vertebrae (total) 31–32 31 (23) 31–32 32 (15) 31–32 32 (20) Prehaemal vertebrae 15–16 16 (23) 15–16 16 (15) 15–16 16 (20) Haemal vertebrae 15–16 16 (23) 15–16 16 (15) 15–16 16 (20) Peduncular vertebrae 8–9 8 (23) 8–9 8 (15) 8–9 8 (20)

139

Table 2.3. Morphometric and meristic data for species of the Sumatrana group in northern Sumatra.

Rasbora sp. 1 Rasbora sp. 2 n = 31 n = 25 Range Mean ± SD Range Mean ± SD Standard length (mm) 42.7–86.3 68.8 ± 14.2 26.5–80.3 56.7 ± 13.8 Percentage of standard length Total length 135.0–142.7 139.2 ± 1.7 136.6–144.3 140.0 ± 1.7 Head length 24.7–28.3 26.3 ± 1.0 26.2–31.7 28.5 ± 1.3 Predorsal length 53.7–60.0 56.9 ± 1.4 52.0–60.1 56.4 ± 1.6 Preanal length 69.4–75.6 72.1 ± 1.5 68.8–76.5 73.6 ± 1.9 Prepelvic length 48.0–54.4 50.6 ± 1.4 47.7–54.7 51.7 ± 1.6 Dorsal depth 21.9–27.6 24.8 ± 1.3 24.6–30.5 27.1 ± 1.5 Body depth 22.1–28.9 26.3 ± 1.5 25.5–32.4 29.7 ± 1.6 Caudal peduncle depth 12.8–15.3 13.9 ± 0.7 13.3–16.1 14.9 ± 0.7 Caudal peduncle length 15.0–18.9 16.9 ± 1.0 12.9–17.8 15.2 ± 1.3 Dorsal-fin base length 10.9–12.6 11.7 ± 0.6 11.1–15.1 13.1 ± 0.9 Anal-fin base length 10.6–13.1 11.8 ± 0.6 10.8–14.1 12.5 ± 0.8 Pelvic-fin length 19.3–23.6 21.6 ± 1.2 19.0–25.3 21.7 ± 1.4 Pectoral-fin length 23.1–29.5 25.2 ± 1.3 22.1–28.7 26.1 ± 1.4 Upper caudal lobe length 30.4–40.6 35.0 ± 2.0 33.4–40.0 36.7 ± 1.8 Median caudal length 14.3–19.7 16.3 ± 1.4 14.1–20.0 17.7 ± 1.4 Lower caudal lobe length 32.2–40.5 37.3 ± 1.9 34.6–41.6 38.4 ± 1.9 Dorsohypural distance 44.8–52.1 47.5 ± 1.6 47.8–54.5 50.4 ± 1.6 Percentage of head length Eye diameter 26.6–35.0 29.7 ± 1.9 26.5–37.1 30.4 ± 2.5 Snout length 28.3–33.7 30.7 ± 1.3 25.0–32.5 28.9 ± 1.6 Head width 47.9–58.0 29.3 ± 1.8 45.2–55.2 52.2 ± 2.7 Head depth 59.7–72.9 66.4 ± 3.3 64.2–71.8 68.4 ± 1.9 Interorbital width 25.5–33.8 23.7–33.6 29.3 ± 2.7 Range Mode (n) Range Mode (n) Meristics Gill rakers on 1st gill arch 11–12 12 (6) 10–11 10 (3) Pharyngeal teeth formula 5,4,2 5,4,2 (6) 5,4,2 5,4,2 (3) Dorsal-fin rays i, 7½ i, 7½ (12) i, 7½ i, 7½ (10) Pectoral-fin rays i, 11–13 i, 12 (12) i, 12–13 i, 12 (10) Pelvic-fin rays i, 7–9 i, 8 (12) i, 8 i, 8 (10) Anal-fin rays ii, 5½ ii, 5½ (12) ii, 5½ ii, 5½ (10) Dorsal procurrent rays of caudal fin 7–8 8 (12) 7–8 8 (10) Dorsal principal rays of caudal fin 9 9 (12) 8–9 9 (10) Ventral procurrent rays of caudal fin 8 8 (12) 8 8 (10) Ventral principal rays of caudal fin 6–8 8 (12) 8 8 (10) Scale of lateral line series 24–26 + 3–4 25 + 4 (15) 23–25 + 3–5 24 + 4 (15) Predorsal scale 12–13 12 (15) 10–12 11 (15) Circumferential formula ½4, 1, 2½ ½4, 1, 2½ (15) ½4, 1, 2½ ½4, 1, 2½ (15) Circumpeduncular scales 12 12 (15) 12 12 (15) Vertebrae (total) 33–34 33 (10) 32–33 33 (10) Prehaemal vertebrae 16–17 16 (10) 16 16 (10) Haemal vertebrae 17 17 (10) 16–17 17 (10) Peduncular vertebrae 8–9 9 (10) 8 8 (10)

140

Table 2.3. Continued.

Rasbora sp. 3 Rasbora sp. 4 n = 7 n = 22 Range Mean ± SD Range Mean ± SD Standard length (mm) 57.3–82.7 23.3–72.0 Percentage of standard length Total length 130–136.3 134.5 ± 2.1 137.1–141.9 139.0 ±1.3 Head length 24.3–26.0 24.9 ± 0.7 24.1–31.3 27.7 ± 1.5 Predorsal length 52.7–56.2 54.2 ± 1.1 51.6–57.0 54.3 ± 1.3 Preanal length 68.9–73.7 71.0 ± 1.5 68.7–74.1 71.9 ± 1.5 Prepelvic length 47.1–52.7 49.6 ± 2.2 47.7–72.5 51.7 ± 4.9 Dorsal depth 21.4–24.1 23.0 ± 1.0 23.1–28.6 26.0 ± 1.7 Body depth 21.3–26.5 24.1 ± 1.6 25.0–29.9 27.3 ± 1.3 Caudal peduncle depth 11.0–12.6 11.9 ± 0.5 12.0–15.1 14.0 ± 0.7 Caudal peduncle length 16.5–19.4 18.3 ± 1.1 14.5–17.9 16.3 ± 0.9 Dorsal-fin base length 11.1–12.6 11.9 ± 0.5 11.4–15.0 12.9 ± 0.9 Anal-fin base length 11.0–12.6 12.0 ± 0.6 11.0–13.1 12.3 ± 0.6 Pelvic-fin length 17.1–20.3 18.7 ± 1.5 17.6–22.0 19.9 ± 1.1 Pectoral-fin length 21.0–22.5 21.7 ± 0.5 22.2–25.7 24.3 ± 1.0 Upper caudal lobe length 30.2–34.0 32.5 ± 1.5 32.8–40.1 36.7 ± 2.0 Median caudal length 14.0–16.3 15.5 ± 0.9 16.1–21.0 18.3 ± 1.2 Lower caudal lobe length 30.7–36.8 34.1 ± 2.5 35.4–42.8 37.4 ± 1.8 Dorsohypural distance 48.0–51.3 50.0 ± 1.3 48.1–54.7 50.8 ± 1.7 Percentage of head length Eye diameter 27.1–32.2 29.2 ± 2.0 23.9–33.1 30.5 ± 2.0 Snout length 26.7–30.5 29.2 ± 2.0 26.8–31.3 29.0 ± 1.4 Head width 47.1–52.1 50.5 ± 1.8 49.0–58.2 54.1 ± 2.6 Head depth 63.4–69.2 65.2 ± 1.9 63.3–74.1 68.1 ± 3.0 Interorbital width 25.3–28.7 26.7 ± 1.2 25.7–32.6 29.7 ± 2.1 Range Mode (n) Range Mode (n) Meristics Gill rakers on 1st gill arch 13 13 (1) 11–12 11 (4) Pharyngeal teeth formula 5,4,1 5,4,1 (1) 5,4,2 5,4,2 (4) Dorsal-fin rays i, 7½ i, 7½ (7) i, 7½ i, 7½ (10) Pectoral-fin rays i, 11–13 i, 12 (7) i, 11–13 i, 12 (10) Pelvic-fin rays i, 8 i, 8 (7) i, 8 i, 8 (10) Anal-fin rays ii, 5½ ii, 5½ (7) ii, 5½ ii, 5½ (10) Dorsal procurrent rays of caudal fin 7 7 (7) 7–8 8 (10) Dorsal principal rays of caudal fin 9 9 (7) 9 9 (10) Ventral procurrent rays of caudal fin 8 8 (7) 8 8 (10) Ventral principal rays of caudal fin 7 7 (7) 7–8 8 (10) Scale of lateral line series 26–27 + 3–4 27 + 4 (7) 24–25 + 3–4 24 + 4 (15) Predorsal scale 12–13 12 (3) 11–12 12 (15) Circumferential formula ½4, 1, 2½ ½4, 1, 2½ (7) ½4, 1, 2½ ½4, 1, 2½ (15) Circumpeduncular scales 12 12 (7) 12 12 (15) Vertebrae (total) 34 34 (3) 32–33 33 (10) Prehaemal vertebrae 17 17 (3) 16 16 (10) Haemal vertebrae 17 17 (3) 16–17 17 (10) Peduncular vertebrae 9 9 (3) 8 8 (10)

141

Chapter 3: Morphological Phylogeny of the Supragenus Rasbora

ABSTRACT

Rasbora is a supragenus of relatively small-sized pelagic minnows with currently 104 valid species. It is one of the most species-rich genera in the family Cyprinidae, the largest family of freshwater fishes in the world. Systematics of this diverse supragenus is complex, as indicated by the disagreement among previous phylogenetic studies, especially the discrepancies between molecular and morphological hypotheses. Accordingly, the objectives of this study are: (1) to discover a series of morphological characters that are phylogenetically informative and to document them with detailed descriptions and illustrations; (2) to assess the monophyly of the supragenus; (3) to resolve the phylogenetic placement of Rasbora within the subfamily Danioninae; and (4) to hypothesize phylogenetic relationships among the major lineages within the supragenus. A phylogenetic analysis was conducted based on the 274 morphological characters (177 of which are newly discovered and described), coded for 97 taxa, comprising 27 outgroup and 70 ingroup taxa. Analysis of this data matrix resulted in 2,685 most parsimonious trees (each

1,103 steps long; consistency index, CI = 0.425; retention index, RI = 0.877; RC = 0.373).

The supragenus Rasbora is recovered as a monophyletic group supported by four synapomorphies and is sister to the clade comprised of the genera Amblyharyngodon and

Pectenocypris. Twelve major monophyletic groups were recovered in this study: (1)

Horadandia+Rasboroides; (2) the Daniconius group; (3) the Einthovenii group; (4)

Kottelatia; (5) Trigonopoma; (6) Boraras; (7) Brevibora; (8) Trigonostigma; (9) the

142

Trifasciata group; (10) the Argyrotaenia group; (11) the Reticulata group; and (12) the

Sumatrana group.

INTRODUCTION

Our knowledge of the phylogenetic systematics of the supragenus Rasbora has been complicated by disagreement among the previous phylogenetic studies, especially that stemming from the discrepancy between the two major approaches using different sets of characters: morphology (Conway, 2005; Liao et al., 2010; Liao et al., 2011) and molecules (Rüber et al., 2007; Fang et al., 2009; Tang et al., 2010). In the first comprehensive phylogenetic study using morphological characters (Liao et al., 2010), the supragenus Rasbora is resolved as monophyletic and treated as synonymous with the tribe Rasborini. Nevertheless, that morphological study suffers from poor taxon sampling: only 33 out of the 104 currently valid species of the supragenus were examined in their analysis. In contrast, the most recent molecular study by Tang et al. (2010) recovered Rasbora as paraphyletic; and similar to Rüber et al., 2007, the genus

Pectenocypris was resolved as embedded in the more exclusive group sister to the clade of Indian Rasbora. Moreover, the morphological phylogeny of Liao et al. (2010) and the molecular phylogeny of Tang et al. (2010) disagree on resolution of the intrarelationships within Rasbora, especially on the relationships of the the miniature species in this supragenus.

A more robust phylogenetic study using more morphological characters and greater taxon sampling is necessary to confidently resolve the systematics of the supragenus

143

Rasbora. Therefore, the objectives of this study are: (1) to discover a new series of phylogenetically informative morphological characters documented with detailed descriptions and illustrations; (2) to assess the monophyly of the supragenus Rasbora; (3) to resolve the phylogenetic placement of Rasbora within the subfamily Danioninae; and (4) to discover and determine the relationships among the major lineages within the supragenus.

MATERIAL AND METHODS

Taxonomic sampling

In total, 97 taxa were examined and scored in the data matrix (Appendix 3.1). These comprise 27 outgroup taxa and 70 species of Rasbora (Table 3.1), just over twice the number of species of Rasbora examined by Liao et al. (2010). Chanos chanos (Forsskål,

1775), the extant sister species of all gonorynchiform fishes, was selected as an outgroup taxon to represent this most basal order of ostariophysans (Rosen and Greenwood, 1970;

Fink and Fink, 1981; 1996; Johnson and Patterson, 1997; Grande and Poyato-Ariza, 1999;

Poyato-Ariza et al., 2010). A basal characiform, Xenocharax spilurus Günther, 1867, was also chosen as another non-cypriniform outgroup in this analysis. Three non-cyprinid cypriniforms representing three different families were selected for outgroups: (1)

Gyrinocheilidae [Gyrinocheilus aymonieri (Tirant, 1883)]; (2) Catostomidae [Catostomus commersoni (Lacepéde, 1803)]; (3) Balitoridae [Homaloptera gymnogaster Bleeker, 1853.

The choice of outgroup taxa for non-rasborin cyprinids follows the phylogeny of Tang et al. (2010); these outgroups are herein represented by five subfamilies: (1) Cyprininae [i.e.,

144

Osteochilus spilurus (Bleeker, 1851); Systomus anchisporus (Vaillant, 1922); and Tor cf. tambroides]; (2) Leptobarbinae [Leptobarbus hoevenii (Bleeker, 1851)]; (3) Danioninae as represented by the tribe Chedrini [i.e., Luciosoma setigerum (Valenciennes, 1842);

Nematabramis steindachneri Popta, 1905; Malayochela maasi (Weber and de Beaufort,

1912)] and the tribe Danionini [i.e., Danio rerio (Hamilton, 1922); Devario aequipinnatus

(McClelland, 1832); Sundadanio cf. axelrodi]; (4) Cultrinae [i.e., Chanodichthys erythropterus (Basilewsky, 1855), Parachela cf. hypophthalmus], and (5) Leuciscinae

[Campostoma anomalum (Rafinesque, 1820) and Cyprinella chloristia (Jordan and

Brayton, 1878)] (Table 3.1).

The supragenus Rasbora as referred to herein, is a group equivalent to the former taxonomical concepts: (1) the genus Rasbora originally recognized by Brittan (1954); (2) the genus Rasbora sensu lato (Kottelat, 1984; Kottelat and Vidthayanon, 1993; Liao et al.,

2010; Tang et al., 2010); and (3) the tribe Rasborini (rasborins) sensu Liao et al. (2010)

[Table 1.1]. When I refer to the tribe Rasborini in particular, it is to the concept in the more inclusive classification of Tang et al. (2010), which incorporated Amblypharyngodon and

Pectenocypris in addition to the supragenus Rasbora rather than the more restricted

Rasborini sensu Liao et al. (2010) [Table 1.1]. Therefore, contrary to Liao et al., (2009), I distinguish the supragenus Rasbora from the concept of the tribe Rasborini by excluding

Amblypharyngodon and Pectenocypris from the supragenus.

Species groups of Rasbora sensu Brittan (1954) [reclassified by Kottelat and

Vidthayanon (1993); Table 1.1] are used herein to name several major clades recovered in the resulting topology, each of which largely corresponds to a particular former species group with respect to its species composition. For the species groups, I use the

145 nomenclature convention applied by Springer and Allen (2004), in which a capitalized and non-italicized species epithet is given for each group (e.g., the Daniconius group, the

Einthovenii group, the Trifasciata group) because it distinguishes group names clearly from the Linnaean binomial nomenclature of the species names. This contrasts with the somewhat contradictory and confusing systems of other authors (e.g., Kottelat and

Vidthayanon, 1993; Siebert and Guiry, 1996; Liao et al., 2010).

External morphology and meristics

Terminology for body color patterns follows Brittan (1954) with modifications by

Lumbantobing (2010) [Chapter 2]. The character states for the elements of body color patterns were evaluated on the basis of the shapes and the intensity of pigmentation as well as the position relative to particular body landmarks. Methods of fin ray and scale counts follow Lagler (1947) and Kottelat (2001), and vertebral counts follow Siebert and

Richardson (1997), and were recorded from radiographs and cleared and stained specimens.

Osteology

Osteological terminology follows Harrington (1955), Weitzman (1962), and

Conway et al. (2008) with the following modification. The ethmoid block as defined by

Howes (1979) is used here to represent a compound bony structure, which is formed by the supraethmoid, the mesethmoid, and the paired preethmoids. For comparative study of cartilages and bones, specimens were cleared and counterstained according to the method of Dingerkus and Uhler (1977). When an ample number of specimens were available, two or more adult individuals of each species, at least one male and one female, were prepared

146 in order to assess the consistency of characters as well as sexual dimorphism. Juveniles, when available, were also cleared and counterstained to examine characters for which the homology was assessed using the ontogenetic criterion (Nelson, 1973; 1978). Cleared and counterstained specimens were then dissected following Weitzman (1974). Terminology of scale characters follows Lagler (1947), which highlights the position of scale focus and the pattern of radii.

Soft anatomy

Characters of the soft anatomy used in this study encompass four general types: muscles, tendons, ligaments, and epithelial cells. Ligaments are described with their corresponding bones in the descriptive osteology section in order to maintain the coherence of each bone/soft anatomy connection as an integrated system. Myological characters used in the analysis were recorded from the adductor mandibulae and caudal musculature, following the terminology of Winterbottom (1974). Scanning Electron Microscope (SEM) analysis was conducted to examine the epithelial characters, which consist of epithelial modifications on the floor of the mouth (the internal surface of the lower jaw).

Phylogenetic analysis

Phylogenetic relationships of the supragenus Rasbora in this study were reconstructed using the methodology of Phylogenetic Systematics, or cladistics, originally proposed by Hennig (1966), which recognizes monophyletic groups as the only natural evolutionary units supported by synapomorphies, a series of corroborated homologous characters hypothesized using the principle of maximum parsimony. Prior to the parsimony analysis, to determine the most corroborated set of homologies, the homology of each

147 character was assessed based on the criteria of similarity (Patterson, 1982). The initial assessment of homology is also referred to as the primary hypothesis of homology, whereas the subsequent analysis of character corroboration using maximum parsimony is thus called the secondary hypothesis of homology (de Pinna, 1991). A phylogenetic analysis was conducted based on the 274 morphological characters (180 of which are newly discovered and described), coded for 97 taxa, comprising 27 outgroup and ingroup taxa. All morphological characters are coded as in the data matrix (Appendix 3), which were compiled with the program Mesquite 2.74 (Maddison and Maddison, 2010) and described below. Inapplicabilty of a character is represented by a dash symbol (-). The data matrix should be consulted for the distribution of character states among all taxa coded here. The phylogeny was reconstructed using the phylogenetics program PAUP* 4.0 (Swofford,

2002). All characters were treated as unordered and with equal weight. Character optimization was investigated using the ACCTRAN mode of optimization. Character state transformations were examined using MacClade 4.08 (Maddison and Maddison, 2005).

CHARACTER ANALYSIS

SKULL ROOF AND BRAINCASE (NEUROCRANIUM) [FIGURES 3.1–3.9]

1. Width of ethmoid block: (0) moderate; (1) narrow; (2) wide, without lateral flange;

(3) wide, with lateral flange (ci = 0.23; ri = 0.58).

The ethmoid block in Rasbora (Figure 3.1: EB) is subrectangular in dorsal view and proportionally wider than the one in most of the outgroup taxa, except for Leptobarbus hoeveni, Devario aequipinnatus, Esomus metallicus, and Nematabramis steindachneri. The

148 relative width of the ethmoid block may be assessed by comparing the intersupraethmoidal distance (the distance between the lateralmost tips of supraethmoid; Figure 3.1: InSE) with the interpreethmoidal distance (the distance between the lateralmost tips of preethmoid;

Figure 3.1: InPE), and also with the interorbitosphenoidal distance (the distance between the medialmost edges of the frontal canal system; Figure 3.1: InOSp). In observed species of the Einthovenii group, the ethmoid block is relatively wide (the intersupraethmoidal distance is longer than both interpreethmoidal and interorbitosphenoidal distances), but somewhat shorter than that in all members of the other species group of Rasbora, in which the width of the ethmoid block is relatively moderate (the intersupraethmoidal distance is as long as both interpreethmoidal and interorbitosphenoidal distances) [state 0; Figure

3.1.A]. In Leptobarbus hoeveni and Pectenocypris, the ethmoid block is wide, similar to the condition found in the Einthovenii group. In observed species of the subfamily

Cultrinae (Chanodichthys erythropterus, Parachela sp., and Rasborichthys helfrichti), the ethmoid block is narrow (the intersupraethmoidal distance is shorter than both interpreethmoidal and interorbitosphenoidal distances; state 1). In species of the tribe

Danionini (Chela laubuca, Danio rerio, Devario aequipinnatus, Esomus metallicus,

Malayochela maasi and Nematabramis steindachneri) and some cyprinine outgroups

(Osteochilus spilurus and Tor cf. tambroides), the supraethmoid develops a broad anterolaterally-pointed flange on each side resulting in a wide trapezoidal appearance of the supraethmoid (state 3). Chanos chanos, the most basal outgroup, possesses an ethmoid block with a relatively moderate width, coded here as state 0.

149

2. Anterior surface of ethmoid block: (0) gently sloping; (1) abruptly descending; (2)

abruptly curved due to anteromedial indentation; (3) posteroventrally slanted (ci =

0.43; ri = 0.85).

The ethmoid block in ostariophysans typically has a gently anteroventrally sloping profile of its anterior surface in lateral view (state 0; Fink and Fink, 1981; 1996) as in

Chanos chanos and Xenocharax spilurus. Some species of Rasbora also have such a gently sloping ethmoid block, which is present in members of the Einthovenii group. In species of the Trifasciata group, the anterior surface of the ethmoid block is abruptly descending along its exposed portion (state 1). In two rasborin species (Kottelatia brittani and Rasbora kalbarensis), the surface is abruptly curved as a result of an anteromedial indentation (state

2); a condition also found in some cyprinine outgroups (all examined danionins,

Luciosoma, Opsarius, Sundadanio, Systomus, and Tor). Boraras exhibits an abruptly descending anterior ethmoid block, in which the anterior surface tends to slant posteroventrally (state 3). This feature of the Trifasciata group and Boraras contributes to the more terminal mouth position rather than the superior position as in other rasborins.

3. Anteromedial process of ethmoid block: (0) present; (1) absent (ci = 0.33; ri = 0.75).

The supraethmoid portion of the ethmoid block in many ostariophysans bears an anteriorly directed process anteromedially. In all species of Rasbora the process is present

(state 0; Figure 3.2: D and F [EP]). The non-cypriniform outgroups examined in this study,

Chanos chanos and Xenocharax spilurus, possess this anteromedial process of the supraethmoid, which I therefore interpret as plesiomorphic. The process is absent (state 1;

Figure 3.2: B) in some members of the cypriniform outgroups examined in this study:

Gyrinocheilidae (Gyrinocheilus aymonieri), Catostomidae (Catostomus commersoni),

150

Cultrinae (Chanodichthys erythropterus, Parachela hypophthalmus), Cyprinidae

(Osteochilus spilurus [Figure 3.2: A and B]), and Leuciscinae (Campostoma anomalum,

Cyprinella chloristia).

4. Form of anteromedial process of ethmoid block: (0) deep and wide; (1) deep and

slender; (2) thin and flat [“thin ethmoid shelf” sensu Howes (1979)] (ci = 1.00; ri =

1.00).

The anteromedial process of the ethmoid block in ostariophysans varies in morphology across taxa. Both Chanos chanos and Xenocharax spilurus possess an ethmoid block with a relatively deep and wide anteromedial process (state 0; plesiomorphic). In

Catostomus commersoni and Homaloptera gymnogaster, the anteromedial process is deep and much more slender, appearing as a rod-like protrusion in a dorsal view. The process is relatively deep in state 0 and state 1 because the ethmoid block extends anteriorly with no abrupt attenuation in lateral view. In contrast, in the species of the subfamily Danioninae sensu Tang et al. (2010) observed in this study (including all species of Rasbora), except for Opsarius barna, the supraethmoid is expanded anteriorly to form a flat process, or “a thin ethmoid shelf” sensu Howes (1979; page 155), on its anteromedial edge directed towards the posterior surface of the kinethmoid (character 2; Figure 3.2: D and F). The ethmoid shelf barely touches the kinethmoid when the latter is retracted. No ligament is attached to this anteromedial shelf. In some members of cypriniforms (e.g., gyrinocheilids, cultrines, cyprinines, and leuciscines), the anteromedial process is absent, therefore the character is inapplicable in these taxa.

5. Shape of thin ethmoid shelf: (0) trapezoidal with somewhat straight anterior

margin; (1) subtriangular with convex anterior margin; (2) subtriangular with

151

attenuated anterior margin; (3) trapezoidal with slightly concave anterior margin;

(4) subtriangular with somewhat u-shaped anterior margin (ci = 0.40; ri = 0.88).

The thin ethmoid shelf sensu Howes (1979) [Figure 3.2: EP] is resolved as one of the synapomorphies of the subfamily Danioninae in this study. Howes (1979) reported this character for the first time as present in two genera: Chela and some Rasbora species. The general shape of the ethmoid shelf in dorsal view shows variation across danionine taxa.

The species of the tribe Chedrini examined in this study, Luciosoma setigerum, Opsarius barna, Raiamas guttatus, and Sundadanio cf. axelrodi, and some species groups of

Rasbora (i. e., Kottelatia brittani, Trigonopoma gracile, T. pauciperforatum, R. daniconius,

R. wilpitta, and some species of the Trifasciata group) have an ethmoid shelf with a trapezoidal profile in dorsal view with a somewhat straight anterior margin (state 0; Figure

3.2: D). In all danionin outgroups, except for Chela and Esomus, and the two immediate outgroups (Amblypharyngodon and Pectenocypris), the profile of the anterior margin of the anteromedial process of supraethmoid is convex in dorsal view with a subtriangular profile

(state 1; Figure 3.2: F). The type species of Rasbora, R. cephalotaenia, plus R. tubbi and all species of the Argyrotaenia group, possess an ethmoid shelf with a slightly concave anterior margin with a trapezoidal profile (state 3). Two danionin outgroups, Chela and

Esomus, also possess an ethmoid shelf of state 3. In Horadandia atukorali, Rasbora caverii, and Rasboroides vaterifloris, the process has a u-shaped anteromedial margin (state

4) forming a medial notch sensu Howes (1981) between two nubs. In all non-danionine outgroup taxa, the process is absent, therefore it is coded as inapplicable.

6. Position of anteromedial process of supraethmoid relative to anterodorsal ridge of

vomer in dorsal view: (0) touching, more posterior; (1) overlapping, more

152

anterior; (2) abutting dorsally; (3) not overlapping, more posterior (ci = 0.25; ri =

0.81).

The relative position of the anteromedial process of the ethmoid block (character 3) varies throughout ostariophysans. The plesiomorphic condition of this character is shown in Chanos chanos: the anteromedial process of the more posterior supraethmoid abuts the dorsomedial margin of vomer (state 0). In some danionines examined herein, such as

Amblypharyngodon and Pectenocypris, as well as some species of Rasbora the anteromedial process of the supraethmoid overlaps the anterodorsal ridge of the vomer and extends further anteriorly, therefore the process is located more anteriorly than the ridge

(state 1; Figure 3.2: D). The type species of Rasbora, R. cephalotaenia, and all the

Argyrotaenia group, the Sumatrana group, as well as some species in the Trifasciata group, possess an ethmoid block with its anteromedial process dorsally abutting the dorsomedial edge of vomer and barely extending further anteriorly (state 2). In the remaining species of the Trifasciata group and all species of Boraras examined, the anteromedial process of the supraethmoid is located more posterior relative to the anterodorsal ridge of the vomer with no anteromedial contact between either structure, or no overlap (state 3).

7. Foramen between anterodorsal ridge of vomer and anterior margin of

supraethmoid: (0) absent; (1) present (ci = 0.25; ri = 0.70).

In most cyprinids examined herein, the articulation between the anterodorsal margin of the vomer and the anteriomedial margin of the supraethmoid is incomplete resulting in a relatively small foramen (state 1; Figure 3.2, 3.3: FEV). This character is absent (state 0) in all non-cyprinid outgroups, four danionine outgroups (Chela laubuca,

153

Esomus metallicus, Malayochela maasi, and Nematabramis steindachneri), and two chedrine outgroups (Opsarius barna and Sundadanio cf. axelrodi).

8. Orientation of foramen between anterodorsal ridge of vomer and anterior margin

of supraethmoid: (0) foramen oriented anteriorly; (1) foramen oriented dorsally (ci

= 1.00; ri = 1.00).

The orientation of the foramen formed by the gap between the anterodorsal ridge of the vomer and the anterior margin of the supraethmoid (character 7; Figure 3.2 and 3.3) has two conditions across cyprinids: foramen exposed anteriorly (state 0), and the foramen exposed towards the dorsal direction (state 1). The anteriorly exposed foramen (state 0) is the typical condition of cyprinids examined herein. This foramen is absent in all non- cyprinid outgroups, four examined danionins (Chela laubuca, Esomus metallicus,

Malayochela maasi, and Nematabramis steindachneri), and two examined chedrins

(Opsarius barna and Sundadanio cf. axelrodi), are thus coded as inapplicable.

9. Depression on anteromedial surface of supraethmoid: (0) absent or indistinct; (1)

distinct (ci = 0.13; ri = 0.85).

In the more basal taxa of Rasbora (i.e., the Daniconius group and the Einthovenii group) as well as other Sundaland rasborin taxa (the Argyrotaenia, Trifasciata, and

Sumatrana groups), the ethmoid block (the supraethmoid region) forms a rostrally-oblique plate that is relatively straight or slightly depressed anteromedially (state 0; Figure 3.3: B).

In many members of Cyprinidae, including several species groups of Rasbora, the supraethmoid bears a depression or indentation on the anteromedial surface of the supraethmoid (state 1; Figure 3.3: A). In non-rasborin outgroups examined herein, a

154 distinct indentation of the supraethmoid is present in the subfamilies Cultrinae

(Chanodichthys erythroperus and Parachela hypophthalmus), Cyprininae (Osteochilus spilurus, Systomus anchisporus, and Tor cf. tambroides), and Leuscicinae (Campostoma anomalum and Cyprinella chloristus). The ethmoid block of Chanos chanos and

Xenocharax spilurus lack such an indentation (state 0).

10. Form of depression on supraethmoid (modified from Liao et al. 2010: character

26): (0) shallow groove; (1) relatively wide u-shaped; (2) bowl-shaped; (3) forming

deep narrow crevice (ci = 0.50; ri = 0.79).

The anteromedial depression on the supraethmoid varies in its depth throughout the major groups of the Cyprinidae. In the basal groups of Rasbora (the Daniconius group) and some species of the Argyrotaenia group (Rasbora argyrotaenia, R. aurotaenia, R. borapetensis, R. dusonensis, R. laticlavia, and R. myersi), the supraethmoid is generally slightly depressed on its subanteromedial portion, producing a shallow groove (state 0;

Figure 3.3: A). The subfamily Cultrinae typically exhibits the deep and narrow depression or deep crevice (state 3), which is represented by Chanodichthys erythropterus and

Parachela sp. in this study. Two species of the subfamily Cyprininae examined in this study, Systomus anchisporus and Tor cf. tambroides, also possess state 3. Three danionines

(Luciosoma setigerum, Kottelatia brittani, and Rasbora kalbarensis) have a supraethmoid region with a bowl-shaped indentation (state 2), which was erroneously inferred by Howes

(1980) as a synapomorphy of Luciosoma and Rasbora. In some other cyprinine outgroups, the depression is moderately deep and wide resulting in a wide u-shaped profile in dorsal view (state 1). In the remaining rasborins and outgroups, such depression is lacking, therefore inapplicable.

155

11. Palatine indentation on anterolateral margin of supraethmoid: (0) absent; (1)

present (ci = 1.00; ri = 1.00).

In the genus Pectenocypris, the dorsolateral flange of the supraethmoid forms a small indentation that accommodates the dorsal tip of the spine-like ethmoid process of the palatine (state 1). This character is absent (state 0) in all taxa other than the two species of

Pectenocypris (P. korthausae and P. micromysticetus) examined here.

12. Shape of ventral surface of ethmoid block: (0) plate-like; (1) somewhat concave;

(2) dome-like (ci = 0.50; ri =0.91).

The ventral surface of the ethmoid block in ostariophysans is generally composed of the vomer, the anterior portion of the parasphenoid, and in some taxa, the ventral surface of the mesethmoid. In all species of Rasbora the ventral portion of the ethmoid block bears a somewhat concave surface (state 1); a condition also found in two chedrin outgroups

(Luciosoma and Raiamas). In the two immediate outgroups (Amblypharyngodon and

Pectenocypris), and also the characiform Xenocharax spilurus, the ventral surface of the ethmoid block is dorsally highly depressed forming a dorsomedially raised dome-like concavity (state 2). In the basal outgroup, Chanos chanos, the ethmoid block exhibits a plate-like ventral surface (state 0).

13. Form of anterior margin of vomer in ventral view: (0) indented with concave

profile; (1) indented with trapezoidal profile; (2) projected with rectangular

profile (ci = 0.40; ri = 0.67).

In Kottelatia, Trigonopoma and members of the Einthovenii group, the anterior margin of the vomer exhibits an indentation with a relatively wide trapezoidal profile (with

156 distinct angles) in ventral view (state 1; Figure 3.4.A: Vo). Two cyprinid outgroups

(Leptobarbus and Osteochilus) have a vomer with a rectangular process in its anteromedial margin (state 2; Figure 3.2.B: VoP). In all other taxa examined, the anterior margin of the vomer is smoothly concave (without any angles) in ventral view (state 0; Figure 3.4.B: Vo).

14. Anteromedial projection of vomer: (0) absent; (1) present (ci = 0.50; ri = 0.00)

In some cyprinids, the anterior margin of the vomer bears a small anteromedial projection on which a ligament connecting to the posteroventral portion of the kinethmoid is attached (state 1; Figure 3.2: B [VoP]). This process of the vomer is present in two outgroup cyprinines, Leptobarbus hoeveni and Osteochilus spilurus, but absent in the other outgroup taxa and the species of Rasbora (state 0; Figure 3.2: D and F; 3.3: A and B).

15. Degree of posterior extension of vomer: (0) covering anterior half of the ethmoid

or less; (1) covering more than anterior half of the ethmoid (ci = 0.17; ri = 0.86).

In several species groups of Rasbora (Boraras, Kottelatia, the Einthovenii group, the Argyrotaenia group, the Trifasciata group, and Rasbora kalbarensis) and the two immediate outgroups (Amblypharyngodon and Pectenocypris), the vomer does not extend further posteriorly than the ventromedial portion of the supraethmoid, therefore it covers only one-half of the anterior portion of the ventral side of the ethmoid block (state 0); a condition also found in the most basal outgroup, Chanos chanos. In contrast, the other groups of Rasbora and the remainder of the outgroups have a vomer that extends further posteriorly past the ventromedial portion of the supraethmoid, which results in its coverage of more than the anterior half of the ventral side of the ethmoid (state 1).

157

16. Position of anterodorsal margin of vomer relative to anteromedial margin of

supraethmoid: (0) horizontally in parallel; (1) inferior (ci = 0.33; ri = 0.00).

The vertical position of the vomer relative to the ethmoid block may differ among ostariophysans due to the variation in the dorsal extension of the anterodorsal margin of the vomer. To assess the relative position of the vomer, the anteromedial margin of the supraethmoid is treated as the landmark. In Chanos chanos, the anterodorsal margin of the vomer dorsally extends to abut the anteromedial process of the supraethmoid. This results in both margins of the vomer and supraethmoid being approximately horizontally parallel

(state 0; plesiomorphic; Fink and Fink, 1981; 1996). This relationship is also found in two cyprinine outgroups examined herein, Leptobarbus hoevenii and Osteochilus spilurus

(Figure 3.2: B). The other outgroups and all species of Rasbora have a vomer with its anterodorsal margin inferior to the anteromedial margin of the supraethmoid (state 1;

Figure 3.3: A and B).

17. Anterodorsal ridge of vomer: (0) deep; (1) moderate; (2) shallow; (3) invisible

from dorsal view (ci = 0.33; ri =0.79).

The relative depth of the anterodorsal ridge of the vomer (Figure 3.3: Vo) in cypriniforms is assessed by comparing the height of the ridge with the height of the preethmoid. A relatively deep anterodorsal ridge (state 0) of the vomer in cypriniforms is associated with the dorsalmost margin of the vomer being situated higher than the dorsal margin of the pre-ethmoid as is characteristic of the Argyrotaenia group, the Trifasciata group, and the two immediate outgroups (Amblypharyngodon and Pectenocypris). Because the non-cypriniform outgroups used in this analysis (Chanos chanos and Xenocharax spilurus) lack a pre-ethmoid, the depth in those two taxa is assessed based on the presence

158 or absence of the anterodorsal ridge of vomer. Chanos chanos has a vomer that anteriorly extends past a vertical through the anterior margin of ethmoid block, a condition which was suggested by Grande and Poyato-Ariza (2010) as typical for gonorynchiforms. The vomer in this outgroup species also dorsally ascends to reach the anteromedial tip of the ethmoid block. In the remaining groups of Rasbora, the dorsalmost margin of the vomer is typically situated lower than the dorsal margin of the pre-ethmoid (state 1); a condition found in most of the cypriniform outgroups. Some danionin outgroups (Chela laubuca, Esomus metallicus, Malayochela maasi, and Nematabramis steindachnerii) possess a vomer with a minimal anterodorsal ridge (state 2). In two examined chedrins (Opsarius and Sundadanio) and the non-cypriniform outgroup Xenocharax spilurus, the anterodorsal portion of the vomer is invisible in dorsal view because it is dorsally covered by the anteroventral extension of the ethmoid block (state 3).

18. Pre-ethmoid (Fink and Fink, 1981; 1996: character 4): (0) absent; (1) present (ci =

1.00; ri = 1.00).

The pre-ethmoid, the possession of which is one of the synapomorphies of the order

Cypriniformes, is an endochondral ossification partially embedded in a socket-like groove situated in each anterolateral tip of the ethmoid block, between the vomer and the mesethmoid region (Fink and Fink, 1981; 1996). The groove is formed by the anterolateral articulation of the vomer and the supraethmoid region. All cypriniforms examined in this study have a pair of pre-ethmoids (state 1; Figures 3.3.A, B and 3.4: PE). The non- cypriniform outgroups, Chanos chanos and Xenocharax spilurus, lack the pre-ethmoid

(state 0).

159

19. Profile of anterolateral edge of vomer encapsulates the pre-ethmoid in ventral

view: (0) slightly protruded; (1) not protruded; (2) greatly protruded (ci = 0.33; ri

= 0.82).

In the basal groups of Rasbora (Horadandia, Kottelatia, Rasboroides,

Trigonopoma, the Daniconius group, the Einthovenii group, and R. kalbarensis), the anterolateral margin of the vomer that partially encapsulates the pre-ethmoid is slightly protruded laterally in ventral view, in which a half of the cartilaginous pre-ethmoid is situated more lateral than the lateral margin of vomer (state 0; Figure 3.4.A: PE). In members of terminal groups of Rasbora (i.e., Brevibora, the Trifasciata group, the

Argyrotaenia group, the Sumatrana group, and the Reticulata group), the articulation between the vomer and the pre-ethmoid is not protruded (state 1; Figure 3.4.B: PE). The rasborin genus Amblypharyngodon exhibits the utmost lateral protrusion of the vomer encapsulation of the pre-ethmoid, in which nearly the entire cartilaginous pre-ethmoid is situated more lateral to the lateral margin of the vomer (state 2). This character is inapplicable in the two most basal outgroups (Chanos chanos and Xenocharax spilurus), which lack the pre-ethmoid.

20. Margins of olfactory foramen: (0) equally formed by ethmoid block and lateral

ethmoid in similar proportion; (1) bordered primarily by lateral ethmoid; (2)

present in lateral ethmoid only (ci = 0.50; ri = 0.96).

The olfactory foramen in ostariophysans is typically situated in the ethmoid region and is bordered by the posteromedial mesethmoid region of the ethmoid block and the anteromedial portion of the lateral ethmoid. Some terminal rasborin groups (Brevibora,

Trigonostigma, the Trifasciata, the Reticulata group, and the Sumatrana group) have such a

160 foramen situated more posteriorly such that it is only slightly bordered by the more anterior mesethmoid region and the remainder of its posterior margin is formed by the lateral ethmoid (state 1; Figure 3.7: of). In the Argyrotaenia group, the olfactory foramen is formed solely by the lateral ethmoid; therefore it is restricted to this bone (state 2). The other species groups of Rasbora and the outgroup taxa, except for the basal Chanos chanos, have the olfactory foramen rimmed by both the ethmoid block (mesethmoid region) and the lateral ethmoid in comparable proportions (state 0). The olfactory foramen is absent in the ethmoid region in Chanos chanos, therefore it is scored as inapplicable.

21. Anteromedial process of lateral ethmoid abuts posterolateral vomer: (0) absent;

(1) present (0.50; ri = 0.90).

All examined danionine and cultrine taxa have a lateral ethmoid which bears a small anteromedial process medially that abuts the posterolateral cartilaginous margin of the vomer (state 1; Figures 3.4 and 3.7: pLE). This character is absent in all non-danionine and non-cultrine outgroups, including the basal gonorynchiform, Chanos chanos; a condition which therefore is coded as plesiomorphic (state 0).

22. Profile of anteromedial process of lateral ethmoid in ventral view: (0)

subtriangular; (1) small rounded knob; (2) elongate and rod-like; (3) elongate and

bud-like, with small medial flange (ci = 0.43; ri = 0.93).

The anteromedial process of the lateral ethmoid varies in length and shape across danionines resulting in different profiles in ventral view. The process tends to be relatively uniform in the examined cultrine taxa. In the cultrine outgroups (Chanodichthys and

Parachela) and several examined danionine genera (Danio, Devario, Esomus,

161

Malayochela, and Nematabramis), the process is subtriangular (state 0). In the basal groups of Rasbora (Horadandia, Rasboroides, and the Daniconius group), the process has the form of a small rounded knob (state 1; Figure 3.4.A: pLE); a condition found in all chedrin groups. Most of the terminal rasborin groups (Boraras, Kottelatia, Trigonopoma,

Trigonostigma, Brevibora, the Einthovenii group, the Trifasciata group, and most of the

Argyrotaenia group) have an elongate and rod-like process (state 2; Figure 3.4.B: pLE).

Two species of the Argyrotaenia group (Rasbora argyrotaenia and R. laticlavia) and the most terminal groups (the Sumatrana group and the Reticulata group) have an elongate process with a small medial flange, which entirely forms a bud-like profile (state 3).

23. Process on dorsal anterolateral margin of lateral ethmoid: (0) absent; (1) present,

strongly-developed; (2) present, weakly-developed (ci = 0.25; ri = 0.89).

In some members of the subfamily Danioninae (all danionins), including the

Daniconius group and the Argyrotaenia group, the lateral ethmoid bears a relatively small process on its dorsal anterolateral edge (state 1), which is strongly-developed (state 1;

Figure 3.3.B: dal) and may contact the ventral edge of the adjacent ventrolateral margin of the frontal (character 30). Some groups of Rasbora (the Einthovenii, species of larger size of the Trifasciata group, the Reticulata group, and the Sumatrana group) have such a process that is weakly developed (state 2). The diminutive rasborin taxa (Boraras,

Brevibora, Horadandia, Kottelatia, Rasboroides, Trigonopoma, Trigonostigma, smaller- sized species of the Trifasciata group, and R. kalbarensis) lack such a process (state 0).

This process is absent in all non-danionine outgroups and its absence resolved as plesiomorphic (state 0).

162

24. Length of ventral flange or splint of lateral ethmoid: (0) short, not reaching

ventrally horizontal through longitudinal axis of lachrymal; (1) long, extending

beyond horizontal through longitudinal axis of lachrymal (ci = 1.00; ri = 1.00).

The lateral ethmoid in ostariophysans typically exhibits a ventrolaterally-directed expansion (“the ventral flange or splint”; Figure 3.7: vsLE), which varies in length across taxa. The relative length of the ventral splint of lateral ethmoid is herein assessed by comparing the position of ventralmost tip of the splint with the horizontal through longitudinal axis of lachrymal. The ventral splint is scored as short (state 0) if its ventralmost tip falls short of the horizontal through the longitudinal axis of the lachrymal.

This condition is present in the more basal groups of Rasbora (i.e., the Daniconius group and the Einthovenii group). The ventral splint is scored as long (state 1; derived) if its tip ventrally surpasses the horizontal through the longitudinal axis of the lachrymal. This derived feature is present in the terminal groups of Rasbora. (i.e., Boraras, Horadandia,

Kottelatia, Trigonopoma, the Argyrotaenia group, the Trifasciata group, the Reticulata group, the Sumatrana group, R. kalbarensis, and R. cephalotaenia).

25. Width of ventromedial margin of lateral ethmoid adjacent to base of ventral

splint of lateral ethmoid: (0) wide, relatively horizontal, angular; (1) narrow,

somewhat oblique, continuously concave (ci = 0.25; ri = 0.89).

The ventromedial edge of the lateral ethmoid medially adjacent to the base of its ventral splint differs in its length, orientation, and form across different rasborin groups

(Figure 3.3: vmLE). The basal groups of Rasbora (Horadandia, Rasboroides, the

Daniconius group, and the Einthovenii group) have a relatively wide ventromedial margin of the lateral ethmoid with a horizontally straight profile that is slightly angled as viewed

163 anteriorly (state 0; Figure 3.3.A: vmLE). Whereas, the more terminal groups of Rasbora

(Boraras, Brevibora, Kottelatia, Trigonopoma, Trigonostigma, the Argyrotaenia group, the

Trifasciata group, the Reticulata group, the Sumatrana group, R. kalbarensis, and R. cephalotaenia) have the margin relatively narrow with a somewhat oblique and continuously concave profile in anterior view (state 1; Figure 3.3.B: vmLE).

26. Dorsal articulation between supraethmoid and frontal (modified from Howes,

1979: anterior cranial vault): (0) supraethmoid articulates with the anterior

margin of frontals in tight suture; (1) anterior margin of frontals overlaps

posterodorsal edge of supraethmoid (ci = 1.00; ri = 1.00).

The posterior margin of the ethmoid block (the supraethmoid region) articulating with the anterior margin of the frontal typically exhibits either a tight or loose suture in ostariophysans (state 0), except for all examined members of the subfamily Danioninae including all species of Rasbora s.l., which possess the frontal with its anteroventral edge overlapping the posterodorsal edge of the supraethmoid region (state 1; Figure 3.2.E: acV;

Howes, 1979; page 153).

27. Nasal bone: (0) present; (1) absent (ci = 0.25; ri = 0.57).

Ostariophysans typically possess a pair of nasal bones situated anteriorly adjacent to the anterior margin of frontal and parallel to the lateral margin of ethmoid block (state 0;

Figure 3.1: Ns). The nasals are absent in some diminutive rasborine taxa, such as Boraras and R. kalbarensis (state 1), in which the absence is inferred to be due to secondary loss; a condition also found in the chedrin genus Sundadanio.

164

28. Posterior tip of nasal: (0) not attached to anterolateral edge of frontal; (1)

ventrally abuts the anterolateral edge of frontal; (2) slightly in contact with

anterolateral edge of frontal (ci = 1.00; ri = 1.00).

In Rasbora the articulation between the nasal with the frontal varies in whether or not the posterior tip of nasal is connected with the anterior margin of frontal. In non-rasborin taxa as well as more basal species groups (i.e., Horadandia, Kottelatia, Rasboroides,

Trigonopoma, the Daniconius group, and the Einthovenii group), the posterior tip of nasal is separate from the frontal (state 0; Figure 3.1.A: Ns). Some terminal groups of Rasbora

(Brevibora, Trigonostigma, the Argyrotaenia group, the Trifasciata group, and R. cephalotaenia) have the posterior tip of the nasal abutting the short flange protruding from the anterolateral edge of frontal (state 1; Figure 3.1.B: Ns). The most derived rasborin groups, the Reticulata group and the Sumatrana group, lack such an extensive overlap between the nasal and the frontal, however the nasal still slightly contacts the anterior edge of the frontal (state 2). The nasal is absent in the diminutive rasborin genus Boraras, therefore it is scored as inapplicable.

29. Anterolateral margin of frontal: (0) not expanded laterally, exposing relatively

large portion of lateral ethmoid from dorsal view; (1) expanded laterally,

concealing lateral ethmoid from dorsal view; (2) slightly expanded laterally,

exposing relatively small portion of lateral ethmoid in dorsal view (ci = 0.50; ri =

0.82).

In ostariophysans, including some rasborin groups, the dorsolateral portion of the

lateral ethmoid is typically exposed with a relatively large portion visible from a dorsal

view (plesiomorphic; state 0). In contrast, some basal groups of Rasbora possess a frontal

165 with the anterolateral margin laterally expanded to such an extent that it completely obstructs the lateral ethmoid from a dorsal view (state 1; Figure 3.1.A). The species of

Rasbora exhibiting state 1 are: two species of the Daniconius group (R. dandia and R. wilpita), some species of the Argyrotaenia group (R. borneensis and R. tornieri), R. cephalotaenia, and R. tubbi. In contrast, in the Einthovenii group, the lateral expansion of the frontal is slight, which results in a less extensive dorsal exposure of the lateral ethmoid

(state 2). The other Rasbora species lack a lateral expansion of the frontal (state 0; Figure

3.1.B). State 0 is also present in the most basal outgroup, Chanos chanos, which renders this feature as plesiomorphic.

30. Ventral edge of anterolateral margin of frontal: (0) separate from

dorsoanterolateral spine of lateral ethmoid; (1) attaching with dorsoanterolateral

spine of lateral ethmoid (ci = 0.25; ri = 0.57).

The anterolateral margin of frontal varies in terms of whether its ventral edge attaches to the dorsal surface of the anterolateral spine of the lateral ethmoid (character 23).

In some species of Rasbora (R. borneensis, R. cephalotaenia, R. dandia, R. tornieri, R. tubbi, and R. wilpita), the ventral edge of frontal abuts the dorsal surface of the anterolateral spine of the lateral ethmoid (state 1). The other species of Rasbora as well as the outgroups, lack contact between the frontal and the spine (state 0), except for some chedrins (Opsarius barna and Raiamas guttatus).

31. Anterior cranial vault: (0) not penetrating the ethmoid region; (1) exceeding the

anterior margin of frontal and penetrating the ethmoid region (ci = 0.50; ri =

0.94).

166

In Boraras and all the species of the Trifasciata group, the anterior border of the cranial cavity (cranial vault) is located anterior to the boundaries between the frontal and the ethmoid block. The vault, thus, anteriorly penetrates the ethmoid block (state 1; Figure

3.2.E). In the other species of Rasbora and all the outgroups examined herein, the cranial vault does not extend anteriorly to penetrate the ethmoid region (state 0).

32. Anterior opening of supraorbital laterosensory canal: (0) narrow and pipe-like;

(1) flared and horn-like (ci = 1.00; ri = 1.00).

The anterior opening of each supraorbital laterosensory canal of the frontal bone adjacent to the more posterior limit of the nasal bone varies in size and shape in cyprinids.

In the inferred primitive condition (state 0), the relatively narrow canal appears tubular in dorsal view (Figure 3.1.A). An alternative condition (state 1) is present in rasborins, in which the canal fans out anterolaterally in the form of the chamber of a horn (Figure 3.1.B) and is relatively almost twice as wide as the posterior opening of the nasal bone. The horn- shaped opening (state 1), interpreted as derived, is limited to all the non-Indian terminal rasborin groups (Brevibora, Trigonostigma, the Argyrotaenia group, the Trifasciata group. the Reticulata group, the Sumatrana group, and R. cephalotaenia).

33. Frontoparietal fontanelle (Liao et al., 2010; character 25): (0) absent; (1) present

(ci = 0.20 ; ri = 0.43).

The frontoparietal fontanelle is present in some diminutive species of Rasbora such as Trigonopoma agile, Horadandia atukorali, and Rasboroides vaterifloris (state 1). This fontanelle is also present in the cyprinine Osteochilus spilurus, which is also a relatively miniaturized species in the genus. The presence of this character seems to be related to the

167 body miniaturization in cyprinids. Some non-miniaturized cypriniforms (Catostomus,

Gyrinocheilus, and Homaloptera) as well as the basal characiform Xenocharax spilurus have a fontanelle. The remaining taxa, including all species of Rasbora lack a fontanelle

(state 0).

34. Dilatator fossa (modified from Conway, 2005: character 13): (0) roofed by frontal

with deep recess; (1) open and unroofed; (2) expanded anteromedially (ci = 0.50;

ri = 0.89).

The dilatator fossa in the subfamily Danioninae varies in the medial expansion of the bony roof. In Rasbora, the deeply-recessed dilatator fossa is typically roofed by the frontal (state 0; Figures 3.4.A, B: df; 3.5.C: df), as in most of its groups, except for

Boraras, Horadandia atukorali, Kottelatia brittani, Trigonopoma, Rasboroides vaterifloris, and Rasbora kalbarensis, which have an open and unroofed dilatator fossa (state 1). In contrast, in Amblyphryngodon, Pectenocypris, and the tribe Danionini, the dilatator fossa become expanded anteromedially and somewhat open anteriorly portion (state 2; Figure

3.5.A, B: df).

35. Fenestration of dilatator fossa (Howes, 1987; Stiassny and Getahun, 2007:

character 4): (0) absent; (1) present (ci = 1.00; ri =1.00).

The dilatator fossa in some members of the subfamily Cyprininae exhibits fenestration as in the cyprinine outgroups examined herein: Osteochilus spilurus, Systomus anchisporus, and Tor cf. tambroides (state 1). The other non-cyprinine outgroups and also all species of Rasbora lack such fenestration on the dilatator fossa (state 0).

168

36. Autopterotic (Conway, 2005: character 15): (0) in contact with frontal anteriorly;

(1) not in contact with frontal (ci = 0.33; ri = 0.82).

In ostariophysans, the anterior portion of pterotic typically abuts the posterolateral portion of frontal (state 0; Figure 3.5.A–C: APt, Fr). In some diminutive species of

Rasbora the contact is absent (state 1) as in Boraras, Horadandia, Kottelatia, Rasboroides,

Rasbora kalbarensis, and Trigonopoma.

37. Lateral portion of autopterotic: (0) not expanded nor roofing dermosphenotic

region; (1) slightly expanded laterally and roofing dermosphenotic region; (2)

broadly expanded and covering dermosphenotic region (ci = 0.18; ri = 0.65).

The lateral portion of the pterotic may be expanded along the ventral margin of the pterotic lateral canal in some danionines. In members of the more derived rasborin taxa (the

Sumatrana group, the Trifasciata group, and the Reticulata group), the lateral portion of the pterotic is not expanded, and therefore, it does not roof the dermosphenotic region (state 0).

In some rasborin species (all species of the Argyrotaenia group, Rasbora caverii, R. einthovenii, and R. jacobsoni), the lateral portion of the pterotic is slightly expanded laterally and roofs the more ventral adjacent area (the dermosphenotic region and the posterior portion of the dilatator fossa; state 1; Figure 3.4.B: df). In another alternate condition (state 2), the increased expansion abuts the dorsal margin of the fifth infraorbital and both ossifications together cover the dermosphenotic region and the dilatator fossa

(Figure 3.4.A: df); which is present in all species of the Daniconius group (except R. caverii) and some species of the Einthovenii group (Rasbora kalochroma and R. kottelati).

169

38. Supraoccipital crest (Conway, 2005: character 14): (0) falls short of exoccipital;

(1) reaches exoccipital (ci = 0.50; ri = 0.50).

The supraoccipital in ostariophysans typically bears a distinctly-ascending posteromedial lamellar ridge also known as the supraoccipital crest (Howes, 1980; Grande and Poyato-Ariza, 2010) or supraoccipital process (in catfishes; Mo, 1991). The most basal outgroup, Chanos chanos, has a unique supraoccipital crest that extends posteriorly forming a pectinate structure, separate from the exoccipital (state 0). In the characiform

Xenocharax spilurus and the cypriniforms examined herein, including most species of

Rasbora the supraoccipital crest typically extends posteroventrally with its posterior border reaching the dorsal margin of the exoccipital (state 1; derived). In contrast, Boraras micros and B. urophthalmoides have a relatively short supraoccipital crest with its posteriormost tip not in contact with exoccipital, as in Chanos chanos (state 0).

39. Lateral canal on autopterotic: (0) posteriormost opening oriented overall toward

dorsal; (1) posteriormost opening relatively horizontal in parallel with the

horizontal semicircular canal (ci = 1.00; ri = 1.00).

In Rasbora the posterior portion of the lateral canal on the autopterotic, especially its posteriormost opening, varies in its orientation relative to the horizontal semicircular canal. The typical orientation of such a posterior canal and its opening in Rasbora is slightly oblique posterodorsally (state 0; Figure 3.8: polc). In contrast, the species of the

Trifasciata group have a portion that horizontally parallels the exterior semicircular canal

(state 1).

170

40. Anterior ventromedial fenestra between lateral ethmoid and orbitosphenoid: (0)

small; (1) moderate; (2) large (ci = 0.50; ri = 0.94).

The articulation between the posterior portion of lateral ethmoid and the anterior portion of orbitosphenoid includes a fenestra that in lateral view varies in size across the subfamily Danioninae. The basal groups of Rasbora (Boraras, Horadandia, Kottelatia,

Rasboroides, Trigonopoma, the Daniconius group, the Einthovenii group, and R. kalbarensis) have a relatively small fenestra (state 0; Figure 3.7: feLE). The derived condition, which a relatively moderate-sized fenestra (state 1), is present in the more terminal groups of Rasbora (Brevibora, Trigonostigma, the Argyrotaenia group, the

Trifasciata group, the Reticulata group, the Sumatrana group, and R. cephalotaenia). In all the chedrin outgroups examined (Luciosoma, Opsarius, Raiamas, and Sundadanio), such a fenestra is remarkably large in lateral view (state 2).

41. Interorbital septum (Cavender and Coburn, 1992: character 8): (0) interorbital

septum formed only by orbitosphenoid; (1) interorbital septum formed by

orbitosphenoid plus dorsal component of parasphenoid (ci = 0.50; ri = 0.75).

In Rasbora, the interorbital septum is formed by the ventromedial extension of the orbitosphenoid (state 0). This condition is also present in some cyprinid subfamilies examined here (Cultrinae, Danioninae, and Leuciscinae) and all the non-cyprinid outgroups. In contrast, cyprinins, leptobarbins, and the rasborin genus Amblypharyngodon have an interorbital septum that is composed of the ventromedial extension of the orbitosphenoid plus the dorsal ridge of the parasphenoid (state 1). The interorbital septum is absent in Chanos chanos, which is thus scored as inapplicable.

171

42. Depth of interorbital septum: (0) shallow; (1) moderate; (2) deep (ci = 0.40; ri =

0.82).

The interorbital septum varies in depth across cyprinid taxa. In the basal group of

Rasbora (Boraras, Horadandia, Kottelatia, Rasboroides, Trigonopoma, the Daniconius group, the Einthovenii group, and R. kalbarensis), the interorbital septum is relatively shallow (state 0; Figure 3.7). The terminal rasborin taxa (Brevibora, Trigonostigma, the

Argyrotaenia group, the Trifasciata group, the Reticulata group, the Sumatrana group, and

R. cephalotaenia) have a relatively moderate interorbital septum (state 1). In the chedrin outgroups (Luciosoma setigerum, Opsarius barna, Raiamas guttatus, and Sundadanio cf. axelrodi), the interorbital septum is relatively deep (state 2).

43. Length of interorbital septum: (0) wide; (1) narrow (ci = 0.50; ri = 0.00).

The interorbital septum varies in length as assessed by comparing the length (the distance between the anterior margin of the orbitosphenoid and its posterior margin) with the depth of the septum (the distance between the dorsal margin of the ventral lamina of orbitosphenoid and its ventral margin). Species of Rasbora usually have a relatively wide interobital septum; its width longer than the depth (state 0; Figure 3.7: sio). In the chedrin outgroups (Opsarius barna and Sundadanio cf. axelrodi), the septum is relatively narrow, as demonstrated by its longer depth relative to the length (state 1).

44. Anterior margin of optic foramen: (0) formed only by pterosphenoid; (1) formed

by orbitosphenoid and pterosphenoid (ci = 0.50; ri = 0.75).

The optic foramen in cyprinids is typically rimmed by the posteromedial margin of the orbitosphenoid anteriorly and by the anteromedial margin of the pterosphenoid

172 posteriorly (state 1; Figures 3.4 and 3.5: opf). In the chedrine outgroups (Luciosoma setigerum, Opsarius barna, Raiamas guttatus, and Sundadanio cf. axelrodi), the margin of the foramen is formed only by the pterosphenoid (state 0).

45. Profile of lateral margin of optic foramen in ventral view: (0) semicircular; (1)

medially convex and notched; (2) relatively straight and slightly curved anteriorly

(ci = 0.50; ri = 0.96).

The lateral margin of the optic foramen varies in ventral view among some groups of Rasbora and also other cyprinid taxa. The chedrine outgroup taxa (Luciosoma,

Opsarius, Raiamas, and Sundadanio) have an optic foramen that is semicircular (state 0).

In the basal groups (the Daniconius group and Einthovenii group), the optic foramen is bordered by a lateral margin that is medially convex and anteriorly notched (state 1; Figure

3.4.A: opf). The terminal groups (Boraras, Brevibora, Kottelatia, Trigonopoma,

Trigonostigma, the Argyrotaenia group, the Trifasciata group, the Reticulata group, the

Sumatrana group, and R. cephalotaenia) possess an optic foramen of which the lateral margin is relatively straight and slightly curved anteriorly (state 2; Figure 3.4.B: opf).

46. Contact between pterosphenoid and parasphenoid (Howes, 1980: page 150): (0)

absent; (1) present (ci = 0.33; ri = 0.60).

Howes (1980) described two general conditions of the relative position of the pterosphenoid and parasphenoid in some Asian and African cyprinids: the bones may be separate (state 0) or in contact (state 1). In species of Rasbora the pterosphenoid and the parasphenoid are separate (state 0; Figure 3.5: PaS, PtO). The pterosphenoid is posteriorly in contact with the parasphenoid (state 1) in some examined cypriniform outgroups

173

(Cultrinae [Chanodichthys and Parachela], Leuciscinae [Campostoma and Notropis],

Gyrinocheilus, and Homaloptera).

47. Extent of enclosure of ventral oculomotor nerve through pterosphenoid: (0)

indistinct; (1) distinct, one-sided, ridge like; (2) distinct, two-sided, gutter like (ci =

0.50; ri = 0.92).

The oculomotor nerve in some groups of Rasbora is partially enclosed by bony ventral projections of the pterosphenoid. Some rasborin species (R. armitagei, R. cephalotaenia, R. dandia, R. kalochroma, R. kottelati, R. tornieri, R. tubbi, and R. wilpitta) have a distinct bony wall only the lateral side of the oculomotor nerve thereby forming a ridge (state 1; Figure 3.5: pom). In species of the Sumatrana group, the pterosphenoid ventrally bears an incomplete canal structure encapsulating the oculomotor nerve, which forms a gutter-like groove in ventral view (state 2). In the other groups of Rasbora such an encapsulation of the nerve is indistinct (state 0).

48. Profile of ventral margin of parasphenoid shaft in lateral view: (0) relatively

straight; (1) ventrally convex; (2) ventrally oblique; (3) gently sinuous with

posterior portion slightly concave; (4) strongly sinuous (ci = 0.44; ri = 0.78).

The ventral margin of parasphenoid shaft view in lateral differs across Rasbora with the most basal groups of Rasbora (the Daniconius group, the Einthovenii group) exhibiting relatively straight profile (state 0; pleisomorphic). In Kottelatia, the smaller species of the Trifasciata group (R. rutteni, R. trifasciata, some of the Reticulata group R. api, R. tobana, and R. vulcanus), and R. kalbarensis, the parasphenoid shaft has a gently sinuous profile with its posterior portion forms a slight ventral concavity in lateral view

174

(state 3; Figure 3.7: PaS). Whereas, in Brevibora, Trigonostigma, and the larger species of the Trifasciata group (R. bankanensis, R. ennealepis, and R. paucisqualis), the parasphenoid exhibits a strongly sinuous profile in lateral view (state 4). In some danionines (Opsarius, Pectenocypris, and Sundadanio), the parasphenoid shaft has a ventrally convex profile in lateral view (state 1). The rasborin genus Amblypharyngodon has a parasphenoid with an oblique profile (state 2).

49. Profile of anterior margin of parasphenoid wing: (0) slants posteriorly; (1)

relatively straight; (2) slightly concave anteriorly; (3) strongly concave anteriorly

(ci = 0.75; ri = 0.98).

The lateromedial flange of the parasphenoid or the “parasphenoid wing” exhibits variations in cyprinids. In some members of the tribe Danionini (Danio, Devario, Esomus,

Malayochela, and Nematabramis), the anterior margin of the parasphenoid wing slants posteroventrally (state 0). In basal groups of Rasbora (Boraras, Kottelatia, Trigonopoma, the Daniconius group, the Einthovenii group, and R. kalbarensis), the margin exhibits a slightly concave profile (state 2; Figure 3.4.A: PaS). Whereas, the terminal rasborin groups

(Brevibora, Trigonostigma, the Argyrotaenia group, the Trifasciata group, the Reticulata group, the Sumatrana group, and R. cephalotaenia) have such a margin with a strong concave profile in ventral view (state 3; Figure 3.4.B: PaS). In species of the tribe Chedrini

(Luciosoma, Opsarius, Raiamas, and Sundadanio) and the rasborin outgroup genus

Amblypharyngodon, the anterior margin of parasphenoid wing is relatively straight (state 1;

Figure 3.6.A: PaS).

175

50. Position of parasphenoid along its posterior half relative to ventral surface of otic

bulla: (0) distinctly more ventral; (1) moderately more ventral (ci = 0.25; ri =

0.40).

The position of the posterior half of the parasphenoid relative to the ventral surface of the bulla prootica varies across cyprinid taxa. The variation is primarily due to the difference in how far the medial portion of the prootic overlapped by the parasphenoid protrudes ventrally. All species of Rasbora have a parasphenoid that is positioned moderately more ventrally than the bulla prootica (state 1; Figure 3.6.C: bP, PaS). In contrast, the other rasborin genera Amblypharyngodon and Pectenocypris have a parasphenoid that is situated disticntly more ventral than the bulla prootica (state 0; Figure

3.6.A, B: bP, PaS); a condition also found in the non-cypriniform outgroups: Chanos chanos and Xenocharax spilurus.

51. Ventromedial process near base of parasphenoid wing: (0) absent; (1) present,

keel-shaped; (2) present, expanded ventrally (ci = 0.67; ri = 0.92).

The ventromedial process of the parasphenoid is a process along the sagital axis of the base of the parasphenoid wing. This process is present in the tribe Danionini and the rasborin genus Pectenocypris, in which it forms a keel (state 1; Figure 3.6.B; vPaS). In species of Rasbora the ventromedial keel of the parasphenoid is absent (state 0). In contrast, in the rasborin genus Amblypharyngodon, the process is extensive with a laterally subspherical form and a relatively flat ventral surface (state 2; Figure 3.6.A: vPaS).

176

52. Medial contact between pterosphenoid and prootic: (0) medial process absent; (1)

with small medial process; (2) with hook-shaped medial process (ci = 0.40; ri =

0.93).

The articulation between the pterosphenoid and the prootic in the tribe Rasborini is commonly marked by a medially-directed small cleft on the prootic (Figures 3.4 and 3.5: mdP). In three chedrin outgroups (Luciosoma, Opsarius, and Raiamas) and the basal group of Rasbora (the Daniconius group and the Einthovenii group), the medial process forms a hook-shaped projection (state 2; Figure 3.4.A: mdP). In some terminal groups of Rasbora

(Brevibora, Kottelatia, Trigonopoma, Trigonostigma, the Argyrotaenia group, the

Trifasciata group, the Reticulata group, the Sumatrana group, R. kalbarensis, and R. cephalotaenia), the medial process is relatively small and slightly attenuated (state 1;

Figures 3.4.B and 3.5: mdP). In the remaining groups of Rasbora (Boraras, Horadandia, and Rasboroides), the medial process is absent (state 0).

53. Carotid foramen: (0) large; (1) moderate; (2) small (ci = 0.40; ri = 0.90).

The carotid foramen is located lateral to the base of the parasphenoid wing and is bordered anteriorly by the lateral margin of the posterior lamina of the parasphenoid and posteriorly by the anterodorsal margin of the prootic (Figures 3.4, 3.5 and 3.6: cf). In cyprinids, the carotid foramen varies in size. The danionine tribe Chedrini typically has a relatively large carotid foramen relative to the other cyprinids (state 0). In Rasbora the foramen is usually moderate in size (state 1; Figures 3.4, 3.5 and 3.6.C: cf); nevertheless, in the Trifasciata group, the foramen is relatively small (state 2).

177

54. Anterior foramen of trigeminal-facial chamber (Howes, 1980: page 150; Chen et

al., 1984; Cavender and Coburn, 1992: character 13): (0) contained within

prootic; (1) slightly bordered anteriorly by pterosphenoid; (2) positioned between

pterosphenoid and prootic (ci = 0.33; ri = 0.87).

The position of the anterior foramen of the trigeminal-facial chamber in cyprinids is typically bordered anteriorly by the pterosphenoid and posteriorly by the prootic; a condition deemed derived for the Teleostei (state 2). In the danionine tribes Chedrini and

Danionini as well as the basal Indian groups of Rasbora (Horadandia, Rasboroides, the

Daniconius group, and R. tubbi), such a foramen is typically contained only within prootic

(state 0). In contrast, the more terminal groups of Rasbora have a pterosphenoid that slightly borders the anterior margin of the foramen (state 1; Figures 3.4, 3.5 and 3.6.C: v- viia). The non-cypriniform outgroups, Chanos chanos and Xenocharax spilurus, also exhibits the plesiomorphic condition (state 0).

55. Lateral commisure width (sensu Howes, 1980) on prootic: (0) wide; (1) moderate;

(2) narrow (ci = 0.40; ri = 0.94).

The lateral commisure on the prootic varies in width across some rasborin groups

(Figures 3.5, 3.6: lc). The basal groups of Rasbora (Boraras, Horadandia, Kottelatia,

Rasboroides, Trigonopoma, the Daniconius group, and the Einthovenii group) have a prootic with a wide lateral commisure wider than the diameter of the anterior foramen of the trigeminofacialis (state 0). In contrast, in the more terminal groups of Rasbora (the

Argyrotaenia group, the Reticulata group, and the Sumatrana group), the prootic has a moderate-sized lateral commisure, slightly narrower than the width of the anterior foramen of the trigeminofacialis (state 1). The remaining groups (Brevibora, Trigonostigma, and the

178

Trifasciata group) have a lateral commisure that appears strongly attenuated, therefore relatively narrow in width, much narrower than the width of the anterior foramen of the trigeminofacialis (state 2). The other danionine outgroups (Amblypharyngodon, Esomus, and Pectenocypris) also have a relatively wide lateral commisure (state 0).

56. Bridge connecting anterior margin of anterior foramen of trigemino-facial

chamber with posterior margin of its posterior foramen: (0) absent; (1) present (ci

= 0.50; ri = 0.97).

In Rasbora the anterior margin of the anterior foramen of the trigemino-facialis nerve on the prootic typically bears a narrow bridge-like structure that is connected with the posterior margin of the posterior foramen for the nerve (state 1), except for the basal Indian taxa (Horadandia, Rasboroides, and the Daniconius group). The bridge is also found in some danionine taxa, such as Danio and Devario. The bridge is absent in the immediate outgroups (Amblypharyngodon and Pectenocypris) and the other remaining outgroup taxa

(state 0).

57. Prootic pad: (0) absent; (1) present (ci = 1.00; ri = 1.00).

In Rasbora, the ventroanterior portion of the prootic located posteriorly from the posterior rim of carotid foramen and laterally adjacent to the posterior region of parasphenoid bears a ventrally projected structure with a flat ventral surface, which overall resembles a pad, termed here for the first time as the prootic pad (state 1; Figures 3.5 and

3.6: pPrO). The prootic pad is also present in all danionine outgroups. The other outgroups lack this structure (state 0).

179

58. Form of prootic pad: (0) somewhat circular, relatively expanded in size, slightly

oblique mediolaterally in contour; (1) kidney-like shape, relatively small,

somewhat horizontally-flat in contour; (2) somewhat ovoid, relatively moderate

in size, slightly concave in contour; (3) irregular, relatively moderate in size,

vertically oriented (ci = 0.60; ri = 0.93).

Throughout species of Rasbora the prootic pad (character 57) varies in terms of the

size and the orientation of its ventral surface. The basal groups of Rasbora (Boraras,

Horadandia, Kottelatia, Trigonopoma, the Daniconius group, the Einthovenii group, the

Argyrotaenia group) possess a prootic pad with its ventral surface is relatively wide and

slightly oblique mediolaterally in contour (state 0; Figure 3.6.C: pPrO). In the remaining

rasborin groups, Brevibora, Trigonostigma, the Reticulata group, the Sumatrana group, the

Trifasciata group, and R. cephalotaenia, the prootic pad is relatively small, with its ventral

surface is somewhat horizontally flat in contour (state 1). Some danionines (Chela,

Esomus, Malayochela, and Nematabramis) have a moderate-sized prootic pad that is with

somewhat ovoid outline and slightly concave surface (state 2). In contrast, the immediate

outgroups, Amblypharyngodon and Pectenocypris, have a relatively irregular prootic pad

due to indistinct outline, also oriented vertically (state 3; Figure 3.6.A, B: pPrO).

59. Indentation on ventral surface of prootic: (0) absent; (1) present (ci = 0.25; ri =

0.85).

In all species of Rasbora, the submedial portion of the ventral surface of the

prootic, an area posterior to the posterior opening of the trigeminal-facial chamber (Figure

3.5: v-viip), is longitudinally indented (state 1; Figures 3.5 and 3.6.C: iPrO). The

indentation is also present in some danionine outgroups (chedrins: Opsarius and

180

Sundadanio; danionins: Chela, Danio, Devario, and Esomus). All the remaining outgroups lack such an indentation (state 0).

60. Form of prootic indentation: (0) shallowly indented; (1) deeply indented and

continuous from lateral commisure to posterior portion of prootic; (2) deeply

indented on posterior portion of prootic; (3) deeply indented on anterior

portion of prootic (ci = 0.43; ri = 0.83).

In members of danionines, the prootic indentation (character 59) differs in the extent of its depth. The Daniconius group and Rasbora tubbi have a prootic that is deeply and continuously indented from the posterior margin of the lateral commisure to the foramen of the glossopharyngeal nerve (state 1). In Kottelatia, Trigonopoma, the

Einthovenii group, and R. kalbarensis, the prootic indentation is strongly developed along the posterior portion of the prootic (state 2). In contrast, the terminal groups of Rasbora

(Brevibora, Trigonostigma, the Argyrotaenia group, the Trifasciata group, the Reticulata group, the Sumatrana group, and R. cephalotaenia) have a deeply indented anterior region of the prootic (state 3; Figure 3.6.C: iPrO). This character is inapplicable to the taxa that lack such an indentation of the prootic.

61. Subtemporal fossa: (0) posteromedial wall largely formed by exoccipital; (1)

posteromedial wall moderately formed by exoccipital (ci = 0.50; ri = 0.75).

The posteromedial wall of the subtemporal fossa in cyprinids, including Rasbora is typically formed approximately equally by the posteroventral portion of the exoccipital and the posteromedial portion of the autopterotic (state 0; Figure 3.4: EOc, APt). Alternatively, in some danionines (Amblypharyngodon, Esomus, and Pectenocypris), the posteromedial wall of the subtemporal fossa is largely formed by the exoccipital (state 1: Figure 3.6.A, B).

181

62. Posterodorsal extension of exoccipital: (0) absent; (1) present (ci = 0.50; ri = 0.75).

In some cyprinid taxa, the exoccipital extends further posteroventrally to form an oblique plate-like extension, herein termed “exoccipital lamina”. The lamina is absent in all species of Rasbora (state 0). In Esomus and the immediate outgroups (Amblypharyngodon and Pectenocypris), the lamina is present (state 1).

63. Basioccipital process (Conway, 2011: character 23): (0) absent; (1) present,

relatively small, without canal; (2) present, expanded, with canal (ci = 0.67; ri =

0.50).

The basioccipital in cypriniforms typically has a posteriorly-projected structure termed the basioccipital process. In a gyrinocheilid genus Gyrinocheilus and balitorid

Homaloptera, the basioccipital bears a pair of posterior processes, which are slightly merged to form a ventral canal (state 1). All catostomids and cyprinids have a basioccipital process that is posteroventrally expanded forming ventrally a canal for the dorsal aorta and a large posterior process (state 2; Figures 3.4 and 3.6: pBOc). The basioccipital process is absent in all non-cypriniform outgroups (state 0).

64. Anterior process of basioccipital process: (0) absent; (1) present, small; (2)

present, elongate (ci = 0.50; ri = 0.67).

In several danionine genera, Amblypharyngodon, Chela, Esomus, and

Pectenocypris, the basioccipital process has an extension on its anteromedial margin. In two danionin genera (Chela and Esomus) and the two diminutive Indian Rasbora

(Horadandia and Rasboroides), the extension appears as a small flange projected from the anterior portion of the basioccipital process (state 1). The rasborin genera

182

Amblypharyngodon and Pectenocypris possess an elongate anterior projection on its basioccipital process (state 2; Figure 3.6.A and B: apBOc). Such an extension is absent in all Rasbora (except Horadandia and Rasboroides) and the remaining outgroups (state 0;

Figure 3.6.C).

65. Pharyngeal process of basioccipital process (Stiassny and Getahun, 2007:

character 3; Britz and Conway, 2009; Conway, 2011: character 25): (0) absent;

(1) present, vertically flat in cross section; (2) present, terete in cross section; (3)

present, posterior margin with extension directed laterally (ci = 0.60; ri = 0.78).

In cyprinids, the basioccipital process bears a posterior-directed process termed the pharyngeal process, which shows variation in form across some taxa. Such a process is absent in all the non-cyprinid outgroups (state 0). Danionine taxa including Rasbora generally have a pharyngeal process that is vertically flat in cross section (state 1). In contrast, several danionines, Amblypharyngodon, Esomus, and Pectenocypris, have such a process with a laterally-directed extension (state 3; Figure 3.6.A and B: apBOc). The pharyngeal process in the cyprinine genera Osteochilus and Systomus is terete in cross section (state 2).

66. Masticatory plate (Conway, 2011: character 26): (0) absent; (1) present (ci = 1.00;

ri =1.00).

A masticatory plate sensu Howes (1980) projected from the anteroventral portion of the basioccipital process is unique to the families Psylorhynchidae and Cyprinidae

(Conway, 2011). In Rasbora the masticatory plate is present (state 1; Figures 3.4 and 3.6: mp). All the non-cyprinid outgroups (Chanos chanos, Xenocharax spilurus, Gyrinocheilus

183 aymonieri, Catostomus commersoni, and Homaloptera gymnogaster) lack this structure

(state 0).

67. Profile of masticatory plate in ventral view: (0) ovoid; (1) subtriangular; (2)

trapezoidal; (3) spade-like; (4) subhexagonal; (5) shield-like; (6) subrectangular;

(7) subpentagonal; (8) three-pointed-crown-like (ci = 1.00; ri =1.00).

The masticatory plate exhibits remarkable variation across cyprinids in terms of its profile in ventral view. In Rasbora, the masticatory plate generally appears subpentagonal with a somewhat curved pointed lateral flange (state 7; Figure 3.4: MP). Nevertheless, the

Trifasciata group has a masticatory plate that exhibits a three-pointed-crown-like profile

(state 8). The rasborin genus Amblypharyngodon has a shield-like trapezoidal plate in ventral view (state 5), whereas another rasborin, Pectenocypris, has a rectangular one (state

6). The genera Danio and Devario possess a masticatory plate that appears as a spade-like structure (state 3). The remaining danionin genera (Chela, Esomus, Malayochela, and

Nematabramis) exhibit a somewhat hexagonal profile of the masticatory plate (state 4).

Some of the outgroup taxa (chedrins, a leptobarbine, and leuciscines) have a masticatory plate that shows trapezoidal profile (state 2). In contrast, a subtriangular masticatory plate

(state 1) is present in the cyprinine outgroups. Whereas, the masticatory plate of the cultrine taxa exhibits an ovoid profile in ventral view (state 0). This character is coded as inapplicable for the outgroup taxa that lack a masticatory plate.

68. Post-temporal fossa: (0) with foramen; (1) lacks foramen (ci = 0.50; ri = 0.98).

In some basal groups of Rasbora (Boraras, Horadandia, Kottelatia, Rasboroides,

Trigonopoma, the Daniconius group, the Einthovenii group, and R. kalbarensis), the post-

184 temporal fossa bears a foramen (state 0). Such a foramen is absent in some terminal rasborin groups: Brevibora, Trigonostigma, the Trifasciata group, the Reticulata group, the

Sumatrana group, and R. cephalotaenia (state 1).

INFRAORBITAL BONES

69. Posterolateral surface of first infraorbital: (0) somewhat convex; (1) with concave

posteromedial portion; (2) with posterodorsal notch (ci = 0.33; ri = 0.83).

The first infraorbital or the lachrymal exhibits variation across danionine taxa with respect to the contour of its posterolateral surface. In the basal groups of Rasbora

(Kottelatia, Trigonopoma, the Daniconius group, the Einthovenii group, and Rasbora kalbarensis), the infraorbital generally have a slightly convex posterolateral surface (state

0). In contrast, the more terminal groups of Rasbora (Brevibora, Trigonostigma, the

Trifasciata group, the Sumatrana group, the Reticulata group, and R. cephalotaenia) typically have a first infraorbital that is medially curved or concave posteromedially (state

1). In some danionine taxa (Horadandia, Opsarius, Rasboroides, and Sundadanio), the posterodorsal portion of the lateral surface of this bone bears a small notch (state 2). The two non-cypriniform outgroups, Chanos chanos and Xenocharax spilurus, possess a first infraorbital with a slightly convex lateral surface (state 0).

70. Lamina of second infraorbital size (modified from Fang, 2003: character 17): (0)

not reduced or only slightly reduced in size; (1) ventrally expanded, in contact

with dentary; (2) greatly reduced (ci = 0.27; ri = 0.68).

185

The ventral lamina of the second infraorbital varies in size across danionine taxa.

The typical condition found in species of Rasbora is a moderate size with a lateral canal dorsally and a lamina ventrally (state 0). However, in three Sri Lankan species of the

Daniconius group (R. armitagei, R. dandia, and R. wilipitta), two species of the

Argyrotaenia group (R. borneensis and R, tornieri), R, cephalotaenia, and R. tubbi, the lamina of the bone expands further ventrally and almost covers the entire anteroventral portion of the cheek muscle (state 1). In contrast, in the small-sized groups (Boraras,

Kottelatia, Trigonopoma, and R. kalbarensis), the second infraorbital is greatly reduced that its lamina portion is relatively narrow (state 2). The two non-cypriniform outgroups,

Chanos chanos and Xenocharax spilurus, possess a second infraorbital that is not reduced or shows the condition in state 0.

71. Fourth infraorbital size: (0) relatively moderate in size, not expanded posteriorly;

(1) highly reduced and narrow, appears rod-like; (2) slightly expanded

posteriorly; (3) large, extensively expanded posteriorly just reaching operculum

(ci = 0.18; ri = 0.64).

The fourth infraorbital exhibits variation in size among danionine taxa. The typical condition in Rasbora is relatively moderate in width, of which the posterior margin of the bone falls short of the vertical arm of the opercle, therefore the cheek muscle is exposed on its posterior portion (state 0). Nevertheless, some diminutive rasborin groups (Boraras and

Trigonopoma) exhibit a posteriorly-reduced form of the fourth infraorbital, which appears relatively small and rod-like, therefore the cheek muscle is only slightly covered by the bone anteriorly (state 1). In contrast, two species of the Einthovenii group (R. einthovenii and R. jacobsoni), R. daniconius, R. borneensis, R. cephalotaenia, and R. tornieri have a

186 fourth infraorbital that extends slightly posteriorly to expose a small posterior portion of the cheek muscle (state 2); a condition also present in some danionins (Malayochela and

Nematabramis). In contrast, in some species in the basal groups of Rasbora (some species of the Daniconius group [R. armitagei, R. dandia, R. wilpitta], and some species of the

Einthovenii group [R. kalochroma, R. kottelati, and R. tubbi]) possess a fourth infraorbital which posteriorly extends to reach the vertical arm of the preopercle to cover the whole cheek muscle (state 3); a condition also found in some danionine outgroups (chedrins

[Luciosoma, Opsarius, and Raiamas] and danionins [Devarios, Esomus, and Chela]).

72. Fourth infraorbital shape: (0) short, somewhat lunate;(1) not elongate,

trapezoidal; (2) short; subrectangular; (3) vertically elongated, bean-shaped (ci =

0.23; ri = 0.60).

The shape of the fourth infraorbital of some species of Rasbora (R. daniconius, R. borneensis, R. cephalotaenia, and R. tornieri) is relatively short and trapezoidal (state 1). In contrast, some species of Rasbora (three species of the Daniconius group [R. armitagei, R. dandia, and R. wilpitta] and all the Einthovenii group) have a relatively short subrectangular fourth infraorbital (state 2); a condition also found in some danionine outgroups (chedrins [Luciosoma, Opsarius, and Raiamas] and danionins [Devarios,

Esomus, and Chela]. In the rasborin genera Amblypharyngodon and Pectenocypris, the fourth infraorbital is vertically elongate and bean-shaped (state 3). The remaining taxa have a relatively short ovoid fourth infraorbital (state 0).

187

73. Posterior lamella of fifth infraorbital: (0) reduced, not in contact with

autopterotic; (1) broad, dorsally in contact with autopterotic, covering

dermosphenotic region (ci = 0.25; ri = 0.63).

The posterior lamella of fifth infraorbital varies in size across cyprinids. In basal groups of Rasbora (two species of the Daniconius group [R. dandia and R. wilpitta] and three species of the Einthovenii group [R. tubbi, R. kalochroma, and R. kottelati]), the posterior portion of the fifth infraorbital forms a lamella whose dorsal margin reaches the ventral margin of the autopterotic (state 1). In the remaining rasborin taxa, the posterior lamella of the bone is reduced or absent, therefore the bone does not contact the autopterotic (state 0), a condition present in the most basal outgroup, Chanos chanos.

74. Spatial arrangement of fifth infraorbital and supraorbital (Gosline, 1975; Chen et

al., 1984; Cavender and Coburn, 1992: character 14; Conway, 2011: character

34): (0) widely separate; (1) in contact; (2) separated only by short distance (ci =

0.18; ri = 0.81).

Many danionine taxa have a fifth infraorbital with a wide anterior lamella whose anterior tip almost reaches or contacts the posterior edge of the supraorbital. In Rasbora some more basal groups typically demonstrate an extensive development of the fifth infraorbital that contacts the posterior edge of the supraorbital (state 1; Figure 3.8: IO5 and

SO): Brevibora, Kottelatia, Trigonostigma, the Daniconius group, the Einthovenii group, the Argyrotaenia group, large species of the Trifasciata group (R. bankanensis, R. ennealepis, R. hubbsi, R. paucisqualis, and R. sarawakensis), and R. cephalotaenia. The remaining rasborin taxa (exhibit a somewhat reduced form of such a lamella, in which it is separated from the supraorbital by a short distance (state 2). In the non-danionine outgroup

188 taxa, except Xenocharax spilurus, the fifth infraorbital and the supraorbital, are widely separated (state 0).

75. Anteromedial margin of supraorbital: (0) smooth; (1) indented (ci = 1.00; ri =

1.00).

In the Sumatrana group, the supraorbital bears a small indentation on its anteromedial margin (state 1). In the outgroup taxa and the other species of Rasbora the anteromedial margin of supraorbital is smooth, without an indentation (state 0; Figure 3.4:

SO).

JAWS (FIGURES 3.9–3.14)

76. Kinethmoid (Fink and Fink, 1981; 1996): (0) absent; (1) present (ci = 1.00; ri =

1.00).

The possession of kinethmoid (Figures 3.2: KE; 3.9), an ossification between the ethmoid region and the upper jaws, is a synapomorphy of the Cypriniformes sensu Fink and Fink (1981). The kinethmoid is present in all cypriniforms (state 1), as far as known, except for some diminutive taxa, such as Paedocypris and Danionella (Conway, 2011).

The non-cypriniform outgroups, Chanos chanos and Xenocharax spilurus, lack a kinethmoid (state 0).

77. Kinethmoid shape (modified from Fang, 2003: character 28): (0) narrow, rod-

like; (1) T-shaped; (2) U-shaped; (3) shield-like, triangular; (4) vase-shaped; (5)

somewhat circular; (6) manta-ray-like; (7) diamond-like and pentagonal, with

distinct ventral process; (8) diamond-like, hexagonal, with indistinct ventral

189

process; (9) diamond-like, hexagonal, with concave ventral margin (10) wide,

anchor-shaped; (11) narrow, hexagonal (ci = 0.69; ri = 0.92).

The kinethmoid bone greatly varies in shape across cypriniform taxa. The diminutive Indian rasborin genera, Horadandia and Rasboroides, possess a kinethmoid that is relatively narrow and rod-like (state 0); a condition which is also found in Pectenocypris,

Opsarius, Sundadanio, and non-danionine outgroup taxa. In some of the chedrine outgroups (Luciosoma, Opsarius, and Raiamas), the kinethmoid appears as a T-shaped bone, in which the dorsal portion is laterally expanded to form its widest part (state 1;

Figure 3.9.I). Two danionin genera, Chela and Devario, have a kinethmoid that is wide and somewhat u-shaped (state 2; Figure 3.9.K). Other danionins (Danio, Esomus, Malayochela, and Nematabramis) have a kinethmoid that is wide and somewhat shield-like triangular

(state 3). In the rasborin outgroup (Amblypharyngodon), the kinethmoid has distinct dorsal and ventral portions, each of which is separated from its laterally-expanding middle portion by a constrictive area; overall appearing as a vase-shaped profile (state 4; Figure 3.9.J). In the Daniconius group, the kinethmoid has a somewhat circular shape (state 5; Figure

3.9.A). The Einthovenii group has a kinethmoid that resembles the profile of a manta ray, with the widest lateral expansions relative to the other rasborins (state 6). Two species in the Argyrotaenia group (Rasbora tornieri and R. borneensis) have a somewhat pentagonal diamond-like kinethmoid with indistinct ventral process (state 7; Figure 3.9.F); a condition also found in the diminutive groups (Boraras, Kottelatia, Trigonopoma, and Rasbora kalbarensis). The other constituent species of the Argyrotaenia group (Rasbora argyrotaenia, R. aurotaenia, R. dusonensis, R. laticlavia, and R. myersi), the

Caudimaculata group, the Sumatrana group (except R. tawarensis), and Rasbora

190 cephalotaenia have a kinethmoid in the form of a hexagonal diamond with a distinct ventral process (state 8; Figure 3.9.B, C). Some terminal groups (Brevibora, The

Trifasciata group and the Reticulata group) have a kinethmoid that appears as a diamond- like hexagon with a slightly concave ventral margin (state 9; Figure 3.9.D). The genus

Trigonostigma has a relatively wide anchor-shaped kinethmoid (state 10; Figure 3.9.G). In

Rasbora borapetensis and R. tawarensis, the kinethmoid is relatively narrow, somewhat hexagonal, and with a relatively short ventral process (state 11; Figure 3.9.E, H).

78. Kinethmoid position (Fang, 2003: character 29): (0) vertical; (1) oblique; (2)

horizontal (ci = 0.33; ri = 0.86).

The position of the retracted kinethmoid varies across cyprinid taxa. In Rasbora, the kinethmoid is typically oblique posteroventrally when it is retracted (state 1), except for

Boraras and the Trifasciata group, in which the kinethmoid is relatively vertical during such phase (state 0). In contrast, the kinethmoid in Kottelatia and R. kalbarensis is nearly horizontal when retracted (state 2).

79. Number of lateral processes on either side of kinethmoid (Liao et al., 2010:

character 28): (0) 0; (1) 1; (2) 2 (ci = 0.67; ri = 0.93).

The kinethmoid in most members of Rasbora bears two processes on each lateral margin (state 2; Figure 3.2.F); a condition also found in danionin outgroups. In contrast, the kinethmoid of the Indian diminutive genera of Rasbora (Horadandia and Rasboroides) only has one lateral process (state 1); a condition also found in cultrines and leuciscines.

All chedrin taxa and the remaining outgroups have a kinethmoid that barely bears a lateral process (state 1).

191

80. Ligament between kinethmoid and mesethmoid (Liao et al., 2011: character 1):

(0) forked and Y-shaped; (1) straight and ribbon-like (ci = 1.00; ri = 1.00).

Liao et al. (2011) described the Y-shaped ligament which is typically present in cyprinids and connects the ventral portion of the kinethmoid with the ethmoid block (state

0). Alternatively, in tribes Danionini and Rasborini, the kinethmoid-ethmoid ligament is straight and rather ribbon-like in dorsal view (state 1). This character is inapplicable for the two non-cypriniform outgroups, Chanos chanos and Xenocharax spilurus, which lack the kinethmoid.

81. Distance between medial rami of maxilla (modified from Conway, 2005:

character 1): (0) widely separated; (1) moderately separated; (2) closely

associated (ci = 0.67; ri = 0.98).

In cypriniforms, the anterior portion of the maxilla typically bears two medially- projected rami, which are termed herein the anteromedial ramus [Figure 3.2: arM; or the anterior extension/arm sensu Conway (1995)] and the posteromedial ramus [Figure 3.2: prM; or the posterior extension/arm sensu Conway (1995)]. The distance between the two rami varies throughout the rasborin taxa. Such a distance is relatively moderate in the basal groups of Rasbora (state 1). Whereas, in other groups (the Argyrotaenia group, the

Reticulata group, and the Sumatrana group), the rami are closely associated (state 2). All non-danionine outgroup taxa typically have a maxilla with widely-separated medial rami

(state 0).

82. Relative lengths of anteromedial and posteromedial rami of maxilla (modified

from Conway, 2005: character 2; Liao et al., 2010: character 16): (0)

192

posteromedial ramus longer than anteromedial ramus; (1) both rami of almost

same length; (2) anteromedial ramus longer than posteromedial ramus (ci = 0.33;

ri = 0.93).

In Rasbora, the medial rami of the maxilla vary in their relative lengths. Some basal rasborin groups (the Daniconius group and R. tubbi) and some terminal groups

(Trigonostigma, Brevibora, the Trifasciata group, and the Reticulata group) have a maxilla with medial rami of relatively the same length (state 1). In some other basal groups

(Horadandia, Boraras, Kottelatia, Rasboroides, Trigonopoma, the Einthovenii group, and

R. kalbarensis), the posteromedial ramus is longer than the anteromedial ramus (state 0). In contrast, the anteromedial ramus is relatively longer than the posteromedial one (state 2) in some terminal rasborin taxa (the Argyrotaenia group, the Sumatrana group, and R. cephalotaenia).

83. Form of posteromedial ramus of maxilla: (0) straight, and club-like with

somewhat rounded tip; (1) straight, and spine-like with pointed tip; (2) angled

and finger-like; (3) curved and spine-like; (4) angled and lancet-like (ci = 1.00; ri

= 1.00).

In Rasbora, the posteromedial ramus of the maxilla exhibits an array of forms in dorsal view. The basal groups of Rasbora (Horadandia, Rasboroides, and the Daniconius group) have a posteromedial maxillary ramus with an angled base and a finger-like stem

(state 2). In contrast, Boraras, Trigonostigma, Brevibora, the Einthovenii group, and the

Trifasciata group have such a club-like ramus, with a straight stem and a somewhat rounded tip (state 0; Figure 3.2.E: prM); a condition that is also present in the cyprinid outgroups (Figure 3.2.A: prM). In contrast, some species (R. borneensis, R. cephalotaenia,

193 and R. tornieri) exhibit a curved-spine-like form of the ramus (state 3). The other terminal rasborin groups (the Argyrotaenia group, the Reticulata group, and the Sumatrana group) typically have a posteromedial maxillary ramus with an angled-lancet-like form, in which the stem is angular and the tip is pointed (state 4; Figure 3.2.C). The rasborin outgroup genera, Amblypharyngodon and Pectenocypris, have a ramus with a relatively-straight stem and a pointed tip (state 1).

84. Ventral margin of maxilla (modified from Liao et al., 2010: character 17): (0)

continuously smooth, without angle; (1) somewhat sigmoidal, with concavity; (2)

angular, without process; (3) angular, with posteroventral process; (4) somewhat

sigmoidal, with posteroventral process (ci = 0.50; ri = 0.89).

The ventral margin of the maxilla varies in form across cyprinids, particulary rasborin taxa (Figure 3.11). The danionine outgroups have such a margin that is continuously smooth without angle (state 0; Figure 3.11.L); a condition also present in some groups of Rasbora (Horadandia, Kottelatia, Rasboroides, Trigonopoma, the

Argyrotaenia group, and Rasbora kalbarensis) [Figure 3.11: B, C, D]. Some terminal groups of Rasbora (the Trifasciata group, the Reticulata group, and the Sumatrana group) and two species of the Einthovenii group (R. einthovenii and R. jacobsoni) have a maxilla with a sigmoidal ventral margin that is marked by a pronounced concavity in the middle and without a process (state 1; Figure 3.11: F, G). In some species of the most basal group of Rasbora, the Daniconius group, the margin is angular due to the presence of a posteroventral process or a downward projection sensu Liao et al. (2010) [state 3]. In contrast, two Indian ingroup species (R. armitagei and R. caverii) and also two basal

Sundaland ingroup species (R. kalochroma and R. kottelati) have such a margin that is

194 angular and without process (state 2; Figure 3.11: E). Alternatively, other Sundaland rasborins (Brevibora, Trigonostigma, R. bankanensis, R. ennealepis, and R. paucisqualis) have a maxilla with a somewhat sigmoidal margin and posteroventral process (state 4;

Figure 3.11: H, I).

85. Length of base of palatine process of maxilla: (0) shorter than posterior shaft of

maxilla; (1) longer than posterior shaft of maxilla (ci = 0.33; ri = 0.90).

The base of the palatine process of the maxilla (Figure 3.10: ppal) varies in length across some rasborin groups. The length variation is measured relative to the length of the posterior shaft of the maxilla (Figure 3.10: sMx). The majority of rasborin taxa have a palatine process that is relatively shorter than the posterior shaft of the maxilla (state 0). In the Trifasciata group, however, the base of the palatine process is longer than the maxillary posterior shaft of the maxilla (state 1).

86. Height of palatine process of maxilla: (0) high; (1) moderate; (2) short (ci = 1.00;

ri = 1.00).

The palatine process of the maxilla varies in relative height within the rasborin groups. In the basal rasborin groups (the Daniconius group), the process is relatively high

(state 0). The typical condition of the palatine process in the more terminal groups of

Rasbora is moderately high (state 1). Nevertheless, the Einthovenii group, the maxillary palatine process is relatively short (state 2).

87. Form of palatine process of maxilla (modified from Liao et al., 2010): (0) obtuse-

triangular with blunt tip; (1) subtriangular with anterodorsal horn-like process;

(2) highly-elevated trapezoidal with strongly-hooked tip; (3) subrectangular with

195

hooked anterior tip; (4) triangular with obtuse blunt dorsal tip; (5) slender hook-

shaped; (6) trapezoidal with blunt edges; (7) subrectangular with slightly concave

posterior margin; (8) triangular with wide base and hooked anterior tip; (9)

shallow trapezoidal with weakly-hooked tip (ci = 0.75; ri = 0.94).

In the subfamily Danioninae, the maxilla typically has a relatively large somewhat laminate dorsal extension on its central portion, termed the palatine process, which is projected towards the lateroproximal portion of the palatine, yet without being in contact.

The palatine process exhibits a wide array of forms in lateral view across the danionine taxa, particularly within the tribe Rasborini (Figure 3.11). In the Daniconius group, the palatine process exhibits a highly-elevated trapezoidal form with a strongly-hooked anterior tip (state 2; Figure 3.11.A). The two diminutive Indian rasborins, Horadandia and

Rasboroides, have such a process in a subrectangular form with an anteriorly-hooked tip

(state 3). In the Einthovenii group, the process appears as triangular with a blunt obtuse dorsal tip (state 4; Figure 3.11.E). In Kottelatia and Rasbora kalbarensis, the process exhibits a slender hook-shaped form with a concave posterior margin (state 5). In Boraras and Trigonopoma, the process has a trapezoidal form with blunt edges (state 6; Figure

3.11.D). The Argyrotaenia group, the Sumatrana group, and Rasbora cephalotaenia have such a process that appears subrectangular with a slightly concave posterior margin (state

7; Figure 3.11.B, C). In the Trifasciata group, the process appears as triangular with a wide base and a hooked tip facing anteriorly (state 8; Figure 3.11.G, I). Some terminal rasborins

(Brevibora, Trigonostigma, and the Reticulata group) have such a process that appears as a relatively small trapezoidal form with a weakly hooked anterior tip (state 9; Figure 3.11.F,

H). In all examined danionin outgroups and Raiamas guttatus, the process exhibits a

196 subtriangular form with a horn-like anterodorsal process (state 1; Figure 3.11.J, L). In immediate outgroups (Amblypharyngodon and Pectenocypris), other chedrins (Luciosoma,

Opsarius, and Sundadanio), and some other cyprinid outgroups, the process appears as an obtuse triangle with a blunt anterodorsal tip and wide base (state 0; Figure 3.11.K).

88. Form of lateral process for attachment of palatine-maxilla ligament: (0) small

knob; (1) ridge; (2) distinctly pointed apophysis (ci = 0.67; ri = 0.97).

In Rasbora, the maxilla bears a relatively small process along the midway portion of its lateral surface, onto which the palatine-maxilla ligament attaches (Figure 3.10: lpM).

In some basal rasborin groups (Amblypharyngodon, Horadandia, Pectenocypris,

Rasboroides, and the Daniconius group), the process is a relatively small knob (state 0); a condition also found in some outgroup taxa. Some of the more terminal groups of Rasbora

(the Einthovenii group, the Argyrotaenia group, the Trifasciata group) have a ridge-like process (state 1; Figure 3.10: lpM). Alternatively, in some other Sundaland rasborin groups

(Boraras, Kottelatia, Trigonopoma, the Reticulata group, the Sumatrana group, and

Rasbora kalbarensis), the process is distinctly pointed (state 2).

89. Anterodorsal process of premaxilla or ascending process of premaxilla: (0)

absent; (1) present (ci = 1.00; ri = 1.00).

In cypriniforms, the premaxilla typically bears a lamellar process anterodorsally that projects posteriorly towards the maxilla (state 1). The non-cypriniforms outgroups,

Chanos chanos and Xenocharax spilurus, lack this process (state 0).

90. Overall form of ascending process of premaxilla (modified from Fang, 2003:

character 19): (0) short and wide, without prominent posterior prolongation; (1)

197

moderate in length and width; (2) narrow and long with prominent posterior

elongation (ci = 0.33; ri = 0. 67).

The ascending process of the premaxilla (character 89) varies in form across danionine taxa. All species of Rasbora and some danionine outgroups (Chela, Devario,

Luciosoma, and Raiamas) have a premaxilla with an ascending process with a relatively moderate size (state 1; Figures 3.12 and 3.13: apP). In several other danionines (Danio,

Esomus) and two basal Indian Rasbora (Horadandia and Rasboroides), however, the ascending process is relatively narrow with prominent prolongation posteriorly (state 2;

Figure 3.12.B: apP). The process in some outgroups (Gyrinocheilus and cyprinins) is alternatively short and wide, without prominent posterior prolongation (state 0). This character is inapplicable for the non-cypriniform outgroups (Chanos chanos and

Xenocharax spilurus), which lack the ascending process of the premaxilla.

91. Profile of lateral margin of ascending process of premaxilla: (0) semicircular; (1)

attenuated, long and narrow; (2) curved, smooth; (3) somewhat sinuous, jagged

with small convexity along posterior margin; (4) edged, jagged with marked

apophysis and nearly straight posterior margin (ci = 0.44; ri = 0.88).

The profile of the lateral margin of the ascending process of the premaxilla is primitively circular among cypriniforms (state 0). Some danionines (Amblypharyngodon,

Danio, Horadandia, Rasboroides, Pectenocypris, and Sundadanio) have a premaxillary ascending process that is attenuated, long, and narrow (state 1). The typical condition for the lateral margin of the premaxillary ascending process in Rasbora is smoothly curved

(state 2). In Brevibora, Trigonostigma, and the Trifasciata group, the lateral margin of the ascending process of the premaxilla contrarily appears somewhat sinuous in profile from

198 dorsal view due to the presence of a small convex expansion located midway on the posterior margin of the process (state 3). In Chela, Devario, and some groups of Rasbora

(the Einthovenii group and the Argyrotaenia group), the lateral margin is jagged with a marked apophysis of the kinethmoid and with a somewhat straight posterior margin (state

4).

92. Fenestrated posteroventral flange of premaxilla: (0) absent; (1) present (ci = 1.00;

ri = 1.00).

In the two immediate outgroups, Amblypharyngodon and Pectenocypris, the premaxilla bears a broad extension along its posteroventral margin, termed the posteroventral flange, which is fenestrated (state 1). Such a flange is absent in all species of

Rasbora as well as the remaining outgroups (state 0).

93. Kinethmoid apophysis of premaxilla (Fang, 2003: character 20): (0) absent; (1)

present (ci = 0.25; ri = 0.93).

The premaxilla may bear an apophysis on the posterolateral tip of its ascending process that is connected to the kinethmoid by a ligament (state 1), a typical condition for rasborin species. Some rasborin groups, however, lack such an apophysis on the premaxilla

(i.e., Brevibora, Trigonostigma, the Trifasciata, and the Reticulata group) [state 0].

94. Anteroventral lamina of premaxilla: (0) absent; (1) present (ci = 0.25; ri = 0.86).

In danionines, the premaxilla typically bears a lamina along its anteroventral margin, termed anteroventral lamina. The basal group of Rasbora have such a lamina (state

1). Whereas, such a lamina is absent in more terminal rasborin group (i.e., the Trifasciata group, the Reticulata group and the Sumatrana group) [state 0].

199

95. Ventral margin of premaxilla: (0) slightly curved; (1) slightly sigmoid; (2)

relatively straight (ci = 0.33; ri = 0.87).

The typical outline of the ventral margin of the premaxilla in the terminal groups of

Rasbora (Boraras, Brevibora, Trigonopoma, Trigonostigma, the Argyrotaenia group, the

Trifasciata group, and the Reticulata group) is slightly curved (state 0; Figure 3.13: A); a condition also present in the danionin outgroups (Figure 3.12: B). In contrast, the basal groups of Rasbora (some of the Daniconius group, the Einthovenii group, and R. cephalotaenia) typically have a premaxilla with a slightly sigmoid ventral margin (state 1;

Figure 3.12: A). In the Sumatrana group and Rasbora caverii (the Daniconius group), the ventral margin of premaxilla is relatively straight (Figure 3.13: B).

96. Anterolateral extension of dentary (modified from Fang, 2003: character 23): (0)

absent; (1) present (ci = 0.33; ri = 0.82).

In some danionine taxa, the anterolateral portion of the dentary is laterally extended to form a projection, termed the dentary projection by Fang (2003). Such a projection is absent, in contrast, in all examined species of Rasbora (state 0). The absence of the dentary projection is also evident all non-danionine outgroups.

97. Form of anterolateral projection of dentary: (0) plate-like; (1) spine-like (ci =

1.00; ri = 1.00).

The anterolateral projection of the dentary (character 96) varies across some danionine taxa. In Amblypharyngodon and Pectenocypris, the projection extends longitudinally and appears plate-like (state 0). In contrast, species in the danionin outgroups

(Danio, Devario, and Esomus) have such a spine-shaped projection (state 1). This character

200 is inapplicable in all examined species of Rasbora and all non-danionine outgroups due to the absence of the anterolateral projection of the dentary.

98. Distance across dentary symphysis: (0) wide; (1) narrow due to thick medial

portion of anterior rami; (2) narrow without thick medial portion of anterior

rami (ci = 1.00; ri = 1.00).

In Rasbora, the distance between the anteromedial borders of the paired dentaries varies among its different groups. In general, most rasborin groups have distinctly separated dentaries at the symphysis (state 0). Species of the Einthovenii group have paired dentaries that are in close proximity owing to the thick medial flange of each anterior ramus (state 1). In other groups of Rasbora (Kottelatia, Trigonopoma, and

Rasbora kalbarensis), the distance between the anterior portion of the paired dentaries is relatively close without any thick medial flange on each anterior ramus (state 2).

99. Anterodorsal indentation of dentary: (0) absent; (1) present, moderately-

developed; (2) present, strongly-developed; (3) present, weakly-developed (ci =

0.43; ri = 0.88).

The anterodorsal edge of the dentary posteriorly adjacent to its symphyseal knob (character

263) is typically indented in Rasbora s. l (state 1). In contrast, some rasborin taxa

(Amblypharyngodon, Kottelatia, Pectenocypris, and R. kalbarensis) lack such an indentation (state 0); a condition also found in danionin outgroups and the subfamily

Cyprininae. In Boraras, the indentation is weakly-developed.

100. Anteromedial indentation of dentary or the ‘danionin notch’ (Fang, 2003:

character 9): (0) absent; (1) present (ci = 0.33; ri = 0.75).

201

A semicircular indentation on the anteromedial margin of the dentary, termed ‘the danionin notch’, is present in danionins and considered as a synapomorphy of the group

(state 1; Howes, 1979; Roberts, 1986). This notch is absent in Rasbora and other outgroups

(state 0).

101. Coronoid process of dentary: (0) distantly separated from anterodorsal margin

of anguloarticular, semicircular; (1) close, barely abuts anterodorsal margin of

anguloarticular, semicircular; (2) abuts anterodorsal margin of anguloarticular,

subtriangular (ci = 0.50; ri = 0.93).

The position of the coronoid process of the dentary relative to the anguloarticular shows variation across cyprinid taxa. The typical condition found in Rasbora is that the coronoid process barely abuts the anterodorsal margin of the anguloarticular (state 1). In

Kottelatia brittani and Rasbora kalbarensis, the coronoid process of dentary abuts the anterodorsal margin of the anguloarticular (state 2).

102. Articulation between anguloarticular and quadrate: (0) moderately developed

laterally; (1) strongly developed laterally forming distinct bulbous structure (ci =

0.50; ri = 0.96).

In danionine taxa, the articulation between the articular and the quadrate shows variations in form. In rasborin taxa (i.e., Amblypharyngodon, Pectenocypris, and Rasbora), the articular section of the quadrate forms a prominent dome-like or bulbous structure (state

1). In the danionin outgroups, the articulation is only moderately developed and relatively less prominent (state 0).

103. Height of anguloarticular: (0) low; (1) moderate; (2) high (ci = 0.33; ri = 0.87).

202

The height of the anguloarticular varies among different danionine taxa. The basal groups of Rasbora (the Daniconius group and R. tubbi) typically have an anguloarticular that is relatively high (state 2). In the more terminal rasborin groups (the Trifasciata group, the Reticulata group, and the Sumatrana), the anguloarticular is relatively moderate in height (state 1). In contrast, the danionin outgroups have a relatively low anguloarticular

(state 0).

104. Form of retroarticular: (0) tubular, elongated; (1) subtriangular; (2)

subtrapezoidal (ci = 0.33; ri = 0.89).

The shape of the retroarticular varies in ventral view across rasborin groups. The basal groups of Rasbora typically have a tubular retroarticular form when viewed ventrally

(state 0). In contrast, the other groups of the genus recovered more terminally exhibit a subtrapezoidal profile from that perspective (state 1); whereas, in some groups (Brevibora,

Trigonostigma, and the Trifasciata group), the retroarticular is subtrapezoidal (state 2).

SUSPENSOriUM (FIGURES 3.12–3.13)

105. Width of palatine: (0) narrow; (1) wide (ci = 0.33; ri = 0.92).

The width of palatine varies in dorsal view in danionines. The species of Rasbora generally have a relatively narrow palatine (state 0; Figures 3.12.A; 3.13.A, B: Pal). The species of Brevibora, Trigonostigma, and the Trifasciata group alternatively possess a relatively wide palatine (state 1). The danionins as well as the immediate outgroups

(Amblypharyngodon and Pectenocypris) also have a relatively wide palatine when viewed dorsally (state 1).

203

106. Ethmoid process of palatine: (0) indistinct; (1) relatively short, blunt; (2)

moderate in length but falling short of ethmoid block, spine-like; (3) relatively

long, spine-like, and reaching anteroventral surface of ethmoid block (ci = 1.00;

ri = 1.00).

The ethmoid process on the dorsal portion of the palatine varies in form across danionine taxa. Species of Rasbora typically have a relatively short blunt ethmoid process on the palatine (state 1). In the immediate outgroups (Amblypharyngodon and

Pectenocypris), the palatine has a relatively long spine-like ethmoid process that just reaches the anteroventral surface of ethmoid block (state 3). Alternatively, the process is pointed and relatively moderate in length in all danionin outgroups. It does not contact the ethmoid block (state 2). Such a process is indistinct in the non-cypriniform outgroups,

Chanos chanos and Xenocharax spilurus (state 0).

107. Relative position of lachrymal process of palatine: (0) lateral to ethmoid process;

(1) posteroventral to ethmoid process; (2) posterolateral to ethmoid process (ci =

1.00; ri = 1.00).

The typical position of the lachrymal process on the anterolateral edge of the palatine in Rasbora is lateral to its ethmoid process (state 0). In contrast, two species in the

Einthovenii group, R. kalochroma and R. kottelati, have such a process that is located laterally more posterior to its ethmoid process (state 2). In all the danionin outgroups, the lachrymal process of the palatine is located ventrally more posterior to its ethmoid process

(state 1).

204

108. Palatine-maxilla ligament: (0) narrow and rope-like; (1) wide and band-like (ci =

0.25; ri = 0.86).

In Rasbora the palatine-maxilla ligament varies in width. The Trifasciata group exhibits a derived condition in which the palatine-maxilla ligament is relatively wide with a band-like structure (state 1). The remaining groups of Rasbora have a narrow and rope-like palatine-maxilla ligament (state 0).

109. Fossa of adductor arcus palatini on metapterygoid: (0) exposed laterally; (1)

covered by shallow lateral ridge (ci = 0.50; ri = 0.75).

The fossa of the muscle adductor arcus palatini on the metapterygoid is exposed laterally in Rasbora and some other cyprinids (state 0; Figures 3.12; 3.13: foap). In

Amblypharyngodon and Pectenocypris, the fossa is covered by a shallow lateral ridge (state

1).

110. Lateral ridge on subdorsal region of hyomandibula: (0) present; (1) absent (ci =

0.25; ri = 0.92).

The hyomandibula in some basal groups of Rasbora bears a distinct laterally projected ridge on its subdorsal region (state 0; Figure 3.12.A: lrH); a condition also present in all danionine outgroups, except for Danio, Pectenocypris, and Sundadanio. The terminal groups of Rasbora (Brevibora, Trigonostigma, the Argyrotaenia, the Trifasciata, the Reticulata, and the Sumatrana groups), lack this hyomandibular ridge (state 1; Figure

3.13.A, B).

111. Hyomandibula articulation with otic region of skull: (0) single condyle; (1) two

distinctly separated condyles (ci = 0.33; ri = 0.86).

205

Cyprinid taxa generally have a hyomandibula that articulates along its dorsal margin to the otic region of the skull with a single condyle (state 0); a typical condition found in cyprinines, including Osteochilus spilurus, Systomus anchisporus, and Tor cf. tambra, examined herein. All species of Rasbora have a hyomandibula that attaches to the prootic region of the neurocranium with two distinctly separated condyles (state 1; Figures

3.12; 3.13: cHm).

112. Dorsolateral groove near to dorsal margin of hyomandibula: (0) absent; (1)

present (ci = 0.50; ri = 0.86).

The dorsal portion of the hyomandibula in some terminal groups of Rasbora exhibits a distinct concavity along its dorsolateral surface between two condyles that articulate dorsally with the otic region, termed dorsolateral groove (state 1). Conversely, such a groove is absent in some more basal rasborin groups (state 0).

113. Ventral portion of ventral shaft of hyomandibula: (0) exposed laterally; (1)

covered laterally by preopercule (ci = 1.00; ri = 1.00).

In Amblypharyngodon and Pectenocypris, the ventral shaft of the hyomandibula is covered laterally by the preopercle (state 1). In the remaining examined taxa here, the anterior portion of the hyomandibular ventral shaft is exposed laterally (state 0; Figures

3.12; 3.13: Hm).

114. Preopercular laterosensory canal (Conway, 2005: character 7): (0) extends along

entire length of preopercle; (1) greatly reduced, restricted to horizontal portion

of preopercle (ci = 0.50; ri = 0.80).

206

The preopercular laterosensory canal typically extends along the length of the preopercle in Rasbora and other danionines (state 0). Some diminutive taxa, such as

Boraras, have the canal is greatly reduced and restricted to the horizontal portion of the preopercle (state 1).

115. Opercular canal (Conway, 2005: character 8; Liao et al., 2010: character 23): (0)

absent; (1) present (ci = 0.25; ri = 0.81).

The typical cyprinid opercle has a canal within its anterodorsal section (state 1); a condition found in all examined cyprinids, except for several diminutive taxa: Boraras,

Kottelatia, Trigonopoma, Trigonostigma, and R. kalbarensis (state 0). The opercular canal is also absent in all non-cypriniform outgroups.

116. Anterodorsal tip of opercle where dilatator operculi attaches: (0) blunt

process; (1) attenuated process (ci = 1.00; ri =1.00).

In cyprinids, the opercle typically has a blunt process on its anterodorsal tip, on to which the dilatators operculi muscle attaches (state 0). Amblypharyngodon and

Pectenocypris have the anterodorsal tip of the opercle anterodorsally projected and more attenuated (state 1).

117. Dorsal margin of opercle (compared with Liao et al., 2010: character 24): (0)

convex, without process; (1) convex, with blunt posterodorsal margin; (2)

concave, with distinct posterodorsal process (ci = 1.00; ri = 1.00).

The outline of the dorsal portion of the opercle varies among some rasborin taxa.

The dorsal margin of the opercle in Rasbora is typically convex and lacks a process (state

0). In contrast, in some basal diminutive groups of Rasbora (Boraras, Kottelatia,

207

Trigonopoma, and R. kalbarensis), the dorsal margin is anterodorsally concave and somewhat projected posterodorsally. In Trigonopoma, the projected posterodorsal margin forms a pointed posterodorsal process (state 2). The margin is blunt in the other diminutive groups (Boraras, Kottelatia, and R. kalbarensis) [state 1].

118. Canalized ridge on medial side of opercle: (0) absent; (1) present, short; (2)

present, long (ci = 0.67; ri = 0.86).

In Trigonopoma, Kottelatia, and Rasbora kalbarensis, the medial surface of opercle bears an elongate ridge with an included long canal (state 2); whereas, in the other groups of Rasbora the canalized ridge is short (state 1). The opercle of rasborin outgroup taxa

(Amblypharyngodon and Pectenocypris) lacks such a elongate ridge (state 0).

119. Slightly curved anterodorsal process on subopercle: (0) absent; (1) present (ci =

1.00; ri = 1.00).

The anterodorsal tip of the subopercle in the subfamily Danioninae, including all

Rasbora, typically bears a slightly curved pointed process (state 1); a condition also found in the examined leuciscines (Campostoma and Notropis) and cultrines (Chanodichthys and

Parachela). All other outgroups lack such a process (state 0).

GILL ARCHES (FIGURES 3.15–3.18)

120. Second basibranchial shape (modified from Mabee et al., 2011: character 9): (0)

hourglass-shaped; (1) rod-like; (2) spatulate; (3) anvil-shaped; (4) modified

hourglass-shaped with membranous flange (ci = 0.50; ri = 0.57).

208

The second basibranchial in cyprinids varies in shape. The typical shape of the second basibranchial in Rasbora is rod-like (state 1). In contrast, an hourglass-shaped second basibranchial is present in danionine genera such as Amblypharyngodon, Esomus, and Pectenocypris (state 0). In two cypriniform outgroups (Homaloptera and Leptobarbus), the second basibranchial is anvil-shaped (state 3). Whereas in the other two cypriniform outgroups (Catostomus and Gyrinocheilus), the bone is hourglass-shaped with a membranous flange (state 4).

121. Fourth basibranchial (Conway, 2005: character 9): (0) moderate-sized and not

in contact with third basibranchial; (1) short and in contact with third

basibranchial; (2) elongate and overlapping with third basibranchial (ci = 0.40;

ri = 0.86).

The fourth basibranchial of Rasbora is typically moderate-sized and not in contact with the third basibranchial (state 0); a condition also found in the cyprinine outgroups. In contrast, in some diminutive groups of Rasbora (Boraras, Kottelatia, Trigonopoma, and R. kalbarensis), the fourth basibranchial is elongate and overlaps the third basibranchial (state

2). The Indian rasborins (Horadandia, Rasboroides, and the Daniconius group) have a fourth basibranchial that is short and in contact with the third basibranchial (state 1).

122. Posterior copula: (0) present, one element; (1) present, two elements (ci = 1.00; ri

= 1.00).

In Rasbora, a posterior copula is present at the posteriormost portion of the basibranchial series, and represents the fourth basibranchial (state 0). In contrast,

209

Amblypharyngodon and Pectenocypris have two elements of posterior copula, which are presumably homologous with the fourth and fifth basibranchial (state 1).

123. Orientation of posterior copula from lateral view: (0) relatively horizontal; (1)

oblique; (2) relatively vertical (ci = 0.33; ri = 0.71).

The orientation of the last cartilaginous element in the basibranchial series, or posterior copula, varies across rasborin taxa. In the basal group of Rasbora the Daniconius group, the posterior copula is vertically oriented in a lateral view (state 2). In more terminal groups, the posterior copula is typically oblique anteroventrally (state 1). In contrast, in some rasborin group (Amblypharyngodon, Boraras, Horadandia, Kottelatia,

Pectenocypris, Trigonopoma, and R. kalbarensis), the posterior copula is approximately horizontal (state 0), a condition also found in Esomus.

124. Anterior portion of first ceratobranchial: (0) same shape as posterior portion;

(1) narrow shaft with medial margin slightly concave; (2) narrow elongate shaft

with curved posteromedial margin abruptly ended by widened pointed edge; (3)

narrow and elongate marked with anterolateral convexity; (4) short somewhat

square head wider than posterior portion (ci = 0.50; ri = 0.93).

The anterior portion of the first ceratobranchial, when dorsally viewed, shows a pronounced diversity of forms across cyprinids, especially in rasborins. Particularly noticeable is the variation in the concavity and the discrepancy between the widths of the anterior and posterior portions of the bone. In some basal groups of Rasbora (Boraras,

Kottelatia, Trigonopoma, the Daniconius group, and R. kalbarensis), the first ceratobranchial has an anterior portion with an outline that medially attenuates in a slightly

210 concave fashion (state 1). In some more terminal groups (the Argyrotaenia group, the

Reticulata group, the Sumatrana group, R. cephalotaenia, and R. tubbi), such a portion forms a short shaft with a medial concavity, which posteromedially terminates at a slightly- pointed margin (state 2). Among other terminal groups (Brevibora, Trigonostigma, and the

Trifasciata group), this portion forms a long relatively straight shaft, which terminates posteromedially at a distinct pointed margin (state 3). The first ceratobranchial in

Amblypharyngodon, Horadandia and Rasboroides in contrast has an anterior portion of the same width as the posterior portion (state 4). In Pectenocypris, the anterior portion does not show a distinct attenuation (state 0), a condition also present in all the non-cypriniform outgroups.

125. Anterior portion of second ceratobranchial: (0) continuous with posterior

portion; (1) short shaft with convex anterolateral margin and widened posterior

portion; (2) narrow and sigmoidal elongate shaft marked with more posterior

widening; (3) short shaft marked with slightly concave medial margin; (4) short

squarish anterior portion terminated at concavity on posteromedial margin (ci =

0.57; ri = 0.93).

The anterior portion of the second ceratobranchial varies remarkably in dorsal profile across rasborin groups. In some basal taxa (Boraras, Kottelatia, Trigonopoma, the

Daniconius group, the Argyrotaenia group, the Sumatrana group, R. cephalotaenia, R. tubbi and R. kalbarensis), the anterior portion has a short shaft and is further marked by abrupt convexity on the anterolateral margin and a more widened posterior portion (state 1). Some terminal groups (Brevibora, Trigonostigma, and The Trifasciata group) have a second ceratobranchial with its anterior shaft is long and distinctly sigmoidal and a more widened

211 posterior portion (state 2). In the Reticulata group, the anterior portion of the second ceratobranchial is marked with a short shaft that is slightly concave along its medial margin

(state 3). Two diminutive Indian genera of the supragenus Rasbora (Horadandia and

Rasboroides) and also the immediate outgroups, Amblypharyngodon, have a short squarish anterior portion of the second ceratobranchial, which is posteromedially marked by a concavity and a tapering (state 4). In the genus Pectenocypris, the anterior portion does not show a distinct attenuation (state 0), a condition also present in all the non-cypriniform outgroups.

126. Form of anterior portion of third ceratobranchial: (0) no pronounced difference

from posterior portion; (1) moderate trapezoid head ending at concavity on

posteromedial margin; (2) short shaft abruptly bent laterally; (3) long sigmoidal

shaft with distinct posterior widening (ci = 0.43; ri = 0.90).

As in the second ceratobranchial, the anterior portion of the third ceratobranchial in rasborin groups exhibits an array of variation in shape when viewed dorsally. In some basal rasborin groups (i.e., Amblypharyngodon, Horadandia, Rasboroides, Rasbora armitagei, and R. caverii), such a portion appears trapezoidal due to the concavity on its posteromedial margin (state 1). The species in Rasbora typically have this portion of the second ceratobranchial with a short shaft marked by a medial convexity and a laterally-curved angle (state 2). In Brevibora, Trigonostigma, and the Trifasciata group, this portion in contrast appears as a sinuous elongate shaft that widens posteriorly (state 3). The remaining examined taxa lack a distinct difference between the anterior and posterior portion of the third ceratobranchial (state 0).

212

127. Post-ceratobranchial cartilage (Mabee et al., 2011: character 14): (0) absent; (1)

present (ci = 0.33; ri = 0.60).

The lower portion of the gill arches in some cypriniforms bears a post- ceratobranchial cartilage, posterior to the medial tip of the fourth ceratobranchial. In danionines, the post-ceratobranchial cartilage was found in only two rasborin genera,

Amblypharyngodon and Pectenocypris, and one danionin outgroup, Esomus (state 1). This character is absent in Rasbora as well as in all remaining outgroups (state 0), except for

Homaloptera.

128. Anterior cartilage of fourth ceratobranchial: (0) single; (1) bifid (ci = 0.50; ri =

0.94).

In cyprinids, the anterior cartilage of the fourth ceratobranchial varies in shape among taxa. The danionine species, including all species of Rasbora typically have a bifid anterior cartilage on ceratobranchial four (state 1). In contrast, the fourth ceratobranchial in the immediate outgroups, Amblypharyngodon and Pectenocypris, is tipped anteriorly by a single undivided cartilage (state 0).

129. Ligament connecting anteromedial first epibranchial with hyomandibula: (0)

absent; (1) present (ci = 1.00; ri = 1.00).

Rasbora and other species of danionines have a ligament connecting the anteromedial portion of the first epibranchial with the ventral edge of the hyomandibula flange (state 1). This ligament is absent in non-danionine outgroups (state 0).

130. Uncinate process of first epibranchial bone (modified from: Cavender and

Coburn, 1992: character 1; Mabee et al., 2011: character 33): (0) present,

213

dorsally articulated with uncinate process of second pharyngobranchial, rod-

like; (1) present, rudimentary; (2) absent (ci = 0.40; ri = 0.70).

Springer and Johnson (2004) defined the uncinate processes on the epibranchial series as cartilage-tipped processes. Nevertheless, in cyprinids, the second epibranchial typically bears a relatively small non-cartilage-tipped pointed process, which is herein described as rudimentary (state 1). The uncinate process of the first epibranchial is typically absent in some subfamilies of cyprinids (state 2); a condition found in most basal species of the supragenus Rasbora and some examined danionines (e.g., Opsarius and Sundadanio).

In contrast, the uncinate process is present as a rudimentary structure in a few basal species of Rasbora (Horadandia, Rasboroides, Rasbora armitagei, and R. caverii) and some danionine taxa (chedrins: Luciosoma and Raiamas guttatus; danionins: Esomus metallicus,

Malayochela, and Nematabramis steindachneri). The non-cyprinid Gyrinocheilus and the non-cypriniform outgroups, Chanos chanos and Xenocharax spilurus, possess a first epibranchial with an uncinate process that articulates with the uncinate process of the second pharyngobranchial, an overall rod-like bony structure (state 0; also see Johnson and

Patterson, 1997; Springer and Johnson, 2004).

131. Uncinate process of second epibranchial bone (modified from Mabee et al., 2011:

character 34): (0) present; (1) rudimentary; (2) absent (ci = 0.50; ri = 0.88).

The second epibranchial in cyprinids typically lacks an uncinate process (state 0). In cyprinids, the second epibranchial typically bears a relatively small pointed non-cartilage- tipped process, which is herein described as rudimentary (state 1). In Rasbora the second epibranchial typically bears such a rudimentary process (Figure 3.15: EB2). Some rasborin groups (Boraras; some species of the Argyrotaenia group: Rasbora aurotaenia, R.

214 dusonensis, and R. myersi; and the Reticulata group), however, lack such a process (state

2). The non-cyprinid Gyrinocheilus and the basal non-cypriniform outgroups¸ Chanos chanos and Xenocharax spilurus, have a cartilage-tipped uncinate process on the second epibranchial (state 0).

132. Uncinate process of third epibranchial (modified from Mabee et al., 2011:

character 35): (0) present, cartilage-tipped; (1) rudimentary, abutting uncinate

process of third epibranchial; (2) rudimentary, not abutting uncinate process of

third epibranchial; (3) absent (ci = 1.00; ri = 1.00).

Similar to the second epibranchial, the third epibranchial in Rasbora typically bears a rudimentary uncinate process (non-cartilage-tipped). Two conditions are recognized for such a rudimentary process: abutting the uncinate process of third epibranchial (state 1) versus separate from the uncinate process of the third epibranchial (state 2). Species of

Rasbora and other danionine taxa typically exhibit state 1 (Figure 3.15: EB3). State 2 is found in some cyprinines: Systomus and Tor. Contrastingly, some non-cyprinid outgroups

(Catastomus, Gyrinocheilus, and Homaloptera) lack such a process (state 3). The basal non-cypriniform outgroups¸ Chanos chanos and Xenocharax spilurus, have a cartilage- tipped uncinate process on the third epibranchial (state 0).

133. Uncinate process of fourth epibranchial (modified from Mabee et al., 2011:

character 36): (0) present, abutting third epibranchial; (1) present, not abutting

third epibranchial; (2) absent (ci = 1.00; ri = 1.00).

In cypriniforms, the fourth epibranchial typically bears an uncinate process subdistally on its dorsal surface (state 0). In all the danionines (including Rasbora), this process is in

215 contact with the uncinate process of the third epibranchial (state 0; Figure 3.15: EB4).

Despite the presence of uncinate processes on these epibranchial, these processes are separate in two cyprinin outgroups (Systomus and Tor) [state 1]. The process is absent in

Catastomus and Homaloptera (state 2).

134. Levator process of fourth epibranchial (Mabee et al., 2011: character: 39): (0)

present; (1) absent (ci = 0.50; ri = 0.00).

In cypriniforms, the fourth epibranchial typically bears a levator process (state 0;

Figure 3.15: EB4). The presence of a levator process is also evident in Chanos chanos.

Such a process is absent in two non-cyprinid outgroups, Gyrinocheilus and Homaloptera

(state 1).

135. Orientation of levator process of fourth epibranchial: (0) perpendicular to main

body and posteriorly oriented; (1) ventrally oriented relative to main body of

bone (ci = 1.00; ri = 1.00).

The levator process of the epibranchial four varies in orientation among cyprinid major groups. In Rasbora the levator process is approximately perpendicular with the main body of the bone and posteriorly oriented (state 0; Figure 3.15: EB4). In leuciscines, the process is slanted ventrad relative to the main body of the fourth epibranchial (state 1).

136. Rasborin process on fourth epibranchial (Liao et al., 2010: character 37): (0)

absent; (1) present (ci = 1.00; ri = 1.00).

Liao et al. (2010) first described an anteriorly-projecting small extension of the anterior margin of the fourth epibranchial. The process is located more posteriorly from, but parallels the uncinate process, both of which anteriorly articulate with the uncinate

216 process of the third epibranchial (Figure 3.15: pr). Recovered on the phylogeny as one of the synapomorphies of Rasbora, this extension is termed the rasborin process (Liao et al.,

2010; 2011). This study confirms that the rasborin process is present in all examined species of the supragenus Rasbora as well as the two immediate outgroups:

Amblypharyngodon and Pectenocypris (state 1). The rasborin process is absent in all non- rasborin outgroups (state 0).

137. Form of rasborin process: (0) small process or spinule; (1) flange with convex

margin; (2) bump; (3) triangular spine; (4) elongate spine (ci = 0.36; ri = 0.83).

The rasborin process (character 136; Figure 3.15: pr) exhibits a diversity of forms among the rasborin species. In the genera Boraras, Pectenocypris, and Trigonopoma the rasborin process appears as a relatively indistinct, small pointed extension or spinule (state

0). Horadandia, Rasboroides, and the immediate outgroup genus Amblypharyngodon have a process in the form of a flange with a convex edge (state 1). In contrast, other groups within Rasbora (Brevibora, Trigonostigma, the Trifasciata group, the Reticulata group, R. caverii, R. cephalotaenia, R. tubbi) have a rasborin process in the form of a slightly developed bump (state 2; Figure 3.15: pr); whereas, some groups (Kottelatia, the

Daniconius group [except R. caverii], the Einthovenii group, and Rasbora kalbarensis) have a rasborin process in the form of a triangular spine (state 3). The most extensive development of the rasborin process, which extends further anteriorly to form an elongate spine (state 4), is present in the Sumatrana group, R. argyrotaenia, and R. laticlavia. Given that all non-rasborin outgroups lack the rasborin process, this character is scored as inapplicable for them.

217

138. Extra row of gill rakers medial to fourth epibranchial: (0) absent; (1) present (ci

= 1.00; ri = 1.00).

Some danionine taxa (Amblypharyngodon and Pectenocypris) have an extra row of gill rakers medial to the fourth epibranchial (state 1). This extra row of the gill rakers is absent in all species of Rasbora and the remaining outgroups (state 0).

139. Extra curved bony filament ventral to extra gill rakers medial to fourth

epibranchial: (0) absent; (1) present (ci = 1.00; ri = 1.00).

An extra curved bony filament located posteromedial to the epibranchial four is present in the rasborin genus Pectenocypris (state 1). This bony filament is apparently the posterior half of the fourth epibranchial that becomes separated during ontogeny. This character is absent in all the species of Rasbora as well as all the remaining outgroup taxa

(state 0).

140. Articulation of ventral tip of cartilaginous fifth epibranchial: (0) with dorsal

cartilaginous tip of fourth ceratobranchial; (1) with posteroventral margin of

fourth epibranchial (ci = 1.00; ri = 1.00).

The majority of cyprinid taxa have a cartilaginous fifth epibranchial that articulates ventrally with the dorsal cartilaginous tip of the fourth ceratobranchial (state 0; Figure

3.16.A). In contrast, the ventral tip of cartilaginous fifth epibranchial in the subfamily

Danioninae articulates with the posteroventral margin of the fourth epibranchial (state 1;

Figure 3.16.B-D).

141. Form of posterodorsal arm of pharyngeal tooth in lateral view: (0) relatively

straight; (1) somewhat curved (ci = 0.17; ri = 0.74).

218

The orientation of the posterodorsal arm of the fifth ceratobranchial varies across danionine taxa. The basal groups of Rasbora (i.e., the Daniconius group and the

Einthovenii group) exhibit a relatively straight posterodorsal arm of the fifth ceratobranchial in lateral view (state 0). The other remaining rasborin taxa have a somewhat curved form of the posterodorsal arm (state 1).

142. Third pharyngobranchial (Siebert, 1987: character 9): (0) does not overlap

second pharyngobranchial; (1) overlaps second pharyngobranchial (ci = 1.00; ri

= 1.00).

In the Cyprinidae, the posterodorsal surface of the second pharyngobranchial is overlapped by the anteroventral portion of the third pharyngobranchial (state 1; Figure

3.15: PB2, PB3). This was hypothesized as one of the synapomorphies of the family

(Siebert, 1987; Cavender and Coburn, 1992; Conway, 2011). All the examined non- cyprinid outgroups lack this overlap (state 0).

143. Position of anterior portion of second pharyngobranchial relative to third

pharyngobranchial: (0) more ventral; (1) horizontally in parallel (ci = 1.00; ri

=1.00).

In species of the Trifasciata group, the anterodorsal surface of second pharyngobranchial is elevated and horizontally juxtaposed with and parallel to the anterior margin of the third pharyngobranchial, together dorsally form a pad-like structure (state 1).

This contrasts with the more ventral position of the anterior portion of the second pharyngobranchial relative to the third pharyngobranchial in all other taxa (state 0; Figure

3.15: PB2, PB3).

219

144. Position of ceratobranchial five relative to cleithrum: (0) more anterior; (1)

more posterior; (2) horizontally in parallel (ci = 1.00; ri =1.00).

The relative position of the fifth ceratobranchial compared to the position of the cleithrum is assessed by comparing the position of the anteriormost tip of the fifth ceratobranchial with the anteriormost edge of the cleithrum. The anteriormost tip of the fifth ceratobranchial is relatively more anterior (state 1) when it is located more anterior than the anteriormost edge of the cleithrum, a condition found in Amblypharyngodon and

Pectenocypris. Alternatively, the fifth ceratobranchial is more posterior (state 0) when its anteriormost tip is located posterior of the anteriormost margin of the cleithrum; a condition found in the basal groups of Rasbora (Horadandia, Rasboroides, the Daniconius group, and the Einthovenii group) and in most of the cyprinid outgroups. Moreover, the fifth ceratobranchial is in parallel with the cleithrum if the anteriormost tip of the fifth ceratobranchial is somewhat transversally aligned with the anteriormost edge of the cleithrum (state 2), a condition found in some of the terminal groups of Rasbora (Boraras,

Brevibora, Kottelatia, Rasbosoma, Trigonopoma, Trigonostigma, the Argyrotaenia group, the Trifasciata group, the Reticulata group, the Sumatrana group, and Rasbora kalbarensis).

145. Dorsalmost portion of fifth ceratobranchial: (0) relatively straight dorsally; (1)

slightly bent; (2) sharply angled medially (ci = 1.00; ri =1.00).

A slightly bent dorsalmost portion of the fifth ceratobranchial is typical in Rasbora

(state 1). Alternatively, the basal groups (Horadandia, Rasboroides, the Daniconius group,

220 and R. tubbi), this region is straight (state 0). In Amblypharyngodon and Pectenocypris, the dorsalmost tip of fifth ceratobranchial is sharply angled medially (state 2).

146. Posteroventral margin of fifth ceratobranchial: (0) smoothly curved; (1)

angular; (2) slightly pointed; (3) distinctly pointed to form spine-like process; (4)

enlarged and medially curved; (5) ventrally protruded (ci = 0.63; ri = 0.88).

The posteroventral tip of the cyprinid fifth ceratobranchial exhibits differences in contour. In Rasbora, the posteroventral tip is typically slightly pointed (state 2). Two other shapes are present in some species of the Daniconius group: a relatively smooth curve along the posteroventral margin of the bone (Rasbora armitagei and R. wilpita; state 0), and an angular margin in the form of a flange (R. dandia and R. daniconius; state 1). This region in the rasborin genera Amblypharyngodon and Pectenocypris is remarkably protruded ventrally and medially curved distally (state 4). The danionine outgroups have a fifth ceratobranchial that bears a spine-like process along its posteroventral margin (state

3). In cyprinine outgroups, the portion is ventrally protruded but without being medially curved (state 5).

147. Arrangement of fifth ceratobranchial teeth (modified from Mabee et al., 2011:

character 23): (0) no fifth ceratobranchial teeth; (1) single row; (2) two rows;

(3) three rows (ci = 0.30; ri = 0.65).

The teeth ankylosed along the fifth ceratobranchial are arranged in variable numbers of longitudinal row across cyprinid taxa. The fifth ceratobranchial of the danionine taxa, including Rasbora typically bears three rows of teeth (state 3). In contrast, some diminutive rasborins have a fifth ceratobranchial that bears two rows of

221 teeth (state 2). The immediate outgroups (Amblypharyngodon and Pectenocypris), a danionin outgroup (Esomus), and the examined cyprinine outgroups have a fifth ceratobranchial that bears one rows of teeth (state 1). In the three most basal outgroups

(Chanos chanos, Xenocharax spilurus and Gyrinocheilus aymonieri), the fifth ceratobranchial is not found (state 0).

148. Fifth ceratobranchial teeth shape (modified from Mabee et al., 2011: character

25): (0) narrow conical; (1) molariform (ci = 0.50; ri = 0.83).

The tooth shape on the fifth ceratobranchial varies throughout the cyprinid taxa.

All examined danionine taxa, including all Rasbora have narrow conical teeth (state 0).

In contrast, the benthic cyprinine outgroups examined here (Osteochilus, Puntius, and

Tor), Amblypharyngodon, and Pectenocypris have molariform pharyngeal teeth (state 1).

149. Profile of basihyal in dorsal view: (0) elongate, narrow, and rod-like; (1)

moderate in length, slightly flares anteriorly and club like; (2) moderate in

length and width, somewhat cylindrical; (3) moderate in length, remarkably

broad, square; (4) elongate, hourglass; (5) moderate in length, ovoid; (6)

moderate in length, paddle-like, half cartilaginous. (ci = 0.60; ri = 0.89).

The profile of the basihyal from dorsal view varies across cyprinid taxa and particularly among rasborin taxa as well. In the basal Indian groups of Rasbora

(Horadandia, Rasboroides, and the Daniconius group) and also in a more terminal group,

(the Argyrotaenia group) the relatively elongate and narrow basihyal appears as a rod (state

0), a condition also found in Amblypharyngodon. In the Einthovenii group, the basihyal is moderate in length, gently flares anteriorly and resembles a club (state 1). The more terminal groups of Rasbora typically have a nearly cylindrical basihyal with a relatively

222 moderate length and width (state 2). In contrast, Brevibora and Trigonostigma have a basihyal that is of moderate length, remarkably broad and relatively square (state 3). In some cypriniform outgroups (Catostomus, Gyrinocheilus, and Homaloptera), the basihyal is in the form of hourglass (state 4). In some danionin outgroups (Danio, Esomus,

Malayochela, and Nematabramis), the basihyal is moderate in length and ovoid (state 5). In

Pectenocypris, the basihyal is moderate in length, forming in half a cartilaginous paddle- like structure (state 6).

150. Hypohyal process on basihyal (modified from Liao et al., 2010: character 38): (0)

absent; (1) present, bulge-like, more posterior; (2) present, spine-like, more

anterior (ci = 0.40; ri = 0.67).

The ventrolateral surface of the basihyal has a pair of lateral processes in several species group of Rasbora that serve as the attachment point of the anterior portion of the basihyal-hypohyal ligament (Liao et al., 2010). The processes differ in shape and position among examined taxa. In Kottelatia, Trigonopoma and Rasbora kalbarensis, the processes are inconspicuous, rounded, and located on the posteroventralmost point of the basihyal

(state 1). In contrast, Liao et al. (2011) reported that the condition of state 1 is only present in Kottelatia. All species of the Caudimaculata group sensu Brittan 1954 (R. caudimaculata, R. subtilis, and R. trilineata) and some species of the Sumatrana group have processes that are long, spine-like, and located more anterolaterally, approximately midway along the length of the basihyal (state 2). Non Rasbora species lack the process

(state 0).

151. Length of anterior shaft of urohyal: (0) short; (1) long (ci = 1.00; ri = 1.00).

223

Cyprinids typically possess a urohyal that anteriorly attenuates and bears a shaft- like portion anteriorly. Species of Rasbora exhibit variation in the length of the urohyal shaft. In the basal groups of Rasbora (Horadandia, Rasboroides, the Daniconius group and the Einthovenii group), the urohyal shaft is relatively short; the length is relatively comparable with the widest part of the urohyal (state 1; Figure 3.17.A: sha). The shaft is relatively long in the more terminal groups of Rasbora; its length is longer than the width of the widest part of the urohyal (state 1; Figure 3.18.B: sha).

152. Posterior tip of urohyal (Conway, 2005: character 11): (0) forked, two-pointed;

(1) forked, three-pointed or w-shaped; (2) single-pointed (ci = 0.67; ri = 0.88).

The posterior tip of the urohyal in Rasbora is generally forked with two pointed tips

(state 0; Figure 3.17.B). In addition to being forked, the Daniconius group has a urohyal with three posterior tips resulting in a w-shaped profile of its most posteroventral margin

(state 1; Figure 3.17.A). In contrast, Boraras has a urohyal that bears a single pointed posterior tip (state 2).

153. Curved lateral edges on ventral flanges of urohyal appearing ‘boatshaped’ in

cross section (modified from Conway, 2005: character 12): (0) absent; (1)

present (ci = 1.00; ri = 1.00).

The lateral edges on the ventral flanges of the urohyal in Trigonostigma are somewhat curved, therefore appearing ‘boatshaped’ in cross section (state 1). The other groups of Rasbora as well as all the outgroup taxa lack such a form of the urohyal (state 0).

154. Indentation of ventral plate of urohyal along medial axis: (0) absent; (1) present

(ci = 0.50; ri = 0.83).

224

In the basal groups of Rasbora (Horadandia, Rasboroides, and the Daniconius group), the ventral plate of the urohyal is indented medially along its axis (state 1). Such an indentation on the urohyal is absent in the other rasborin groups and all the outgroup taxa

(state 0).

155. Anterior portion of first branchiostegal ray: (0) with short narrow shaft; (1)

with elongate narrow shaft [acinaciform] (ci = 0.33; ri = 0.33).

The anterior portion of the first branchiostegal ray attaching to the ceratohyal varies in shape throughout cyprinid taxa. In Rasbora, this portion has the form of a short narrow shaft (state 0; Figure 3.18: ). In contrast, in Horadandia, Rasboroides, and two chedrin genera, Sundadanio and Opsarius, this region forms an elongate narrow shaft or acinaciform (state 1).

156. Third branchiostegal ray connection (Liao et al., 2010: character 39): (0)

posterior ceratohyal; (1) anterior ceratohyal (ci = 0.33; ri = 0.67).

The anterior tip of the third branchiostegal ray in most species of Rasbora is generally connected with the ventral margin of the posterior ceratohyal (state 0; Figure 3.8:

CHp). Nevertheless, some rasborin taxa (Trigonopoma, Boraras brigittae, B. merah, R. caudimaculata, R. trilineata, and R. subtilis) have a third branchiostegal ray that connects with the anterior ceratohyal (state 1).

157. Interhyal (Liao et al., 2010: character 41): (0) ossified; (1) cartilaginous (ci =

1.00; ri = 1.00).

Liao et al. (2010) reported that the interhyal in rasborins is well-ossified (state 1;

Figure 3.18: IH), in contrast to being completely cartilaginous in other danionines (state 0;

225

Liao et al., 2011). Nevertheless, in the present study, the ossified interhyal is found to be present in the examined chedrin outgroups. Therefore, the cartilaginous interhyal is considered to be the synapomorphy of the tribe Danionini.

AXIAL SKELETON

158. Cranial intermuscular bones (modified from Howes, 1979): (0) present; (1)

absent (ci = 0.50; ri = 0.50).

Howes (1979) reported that several species of the subfamily Cultrinae (i.e.,

Macrochirichthys macrochirus) have cranial intermuscular bones (state 0). I observed this condition in Chanos chanos and the examined cultrins (Chanodichthys eryhtropterus and

Parachela hypophthalmus). Cranial intermuscular bones are absent in the remaining examined taxa, including all species of Rasbora (state 1).

159. Lateral process of first vertebra: (0) absent; (1) present (ci = 0.50; ri 0.50).

In cypriniforms, the first vertebra typically bears a laterally-directed process (state

1). This process is absent in Homaloptera and also the two non-cypriniform outgroups,

Chanos chanos and Xenocharax spilurus (state 0).

160. Form of lateral process of first vertebra: (0) relatively long and spine-like; (1)

short and blunt; (2) short with somewhat attenuated tip (ci = 0.50; ri 0.91).

The lateral process of the first vertebra (character 159) varies in form across cypriniform taxa. Species in Rasbora typically have a first vertebra that bears a short and blunt process (state 1). Some species (the Einthovenii group, R. borneensis, R. cephalotaenia, and R. tornieri) have a process that is short and with a somewhat attenuated

226 tip (state 2). In examined members of the tribe Chedrini (Luciosoma setigerum, Opsarius barna, Raiamas guttatus, and Sundadanio), the lateral process of the first vertebra is relatively long a spine like in dorsal or ventral view (state 0).

161. Lateral process of second vertebra: (0) absent; (1) present (ci = 1.00; ri = 1.00).

The second vertebra in the order Cypriniformes bears a long process on each lateral side, which extends further transversally into the axial musculature (state 1); a synapomorphy of this highly diverse taxon. This lateral process is absent in Chanos chanos and Xenocharax spilurus (state 0).

162. Lateral process of second vertebra from dorsal view (Liao et al., 2010: character

29): (0) arched with distal end pointing distinctly posteriorly; (1) straight and

posteriorly slanted; (2) more or less straight, with distal end slightly pointing

posteriorly (ci = 1.00; ri = 1.00).

The lateral process of the second vertebra (character 161) varies in shape across cypriniforms. The typical condition found in Rasbora is a more or less straight process with its distal end being bent, pointing slightly posteriorly (state 2). In contrast, in two immediate outgroups (Amblypharyngodon and Pectenocypris), the process is straight and slanted posteriorly (state 1). The lateral process of the second vertebra in the remaining outgroup taxa is arched with its distal end pointing distinctly posteriorly (state 0).

163. Crest of neural complex (Cavender and Coburn, 1992: character 5): (0) simple,

not dorsally divided; (1) dorsally divided (ci = 0.25; ri = 0.80).

The dorsal section of the neural complex in the subfamilies Danioninae (including

Rasbora), Cultrinae, and Leuciscinae generally bears a dorsally divided dorsal crest (state

227

1). Such a division is absent in some diminutive Rasbora (Boraras and R. kalbarensis) and also other outgroup taxa (state 0).

164. Form of tripus (Liao et al., 2010: character 30): (0) outermost anterior tip with

process, anterior outline oblique, axe-head-shaped in dorsal view; (1) outermost

anterior tip with tiny apophysis, anterior outline rather straight (ci = 0.33; ri =

0.91).

The shape of the tripus varies throughout cyprinids, particularly among rasborins.

When viewed dorsally, the typical profile of the tripus in most groups of Rasbora is relatively straight and with a tiny apophysis at its anterolateral tip (state 1). In contrast, other examined taxa have an outermost anterior tip with an additional process and an anterior outline oblique, resulting in an axe-head shape from dorsal view (state 0).

165. Location of dorsomedial crest of tripus: (0) in center of concavity on

dorsomedial surface of tripus; (1) more posterior (ci = 1.00; ri = 1.00).

In cyprinids, the dorsomedial surface of the tripus typically bears a wide concavity, from which a crest projects dorsally. Such a crest in most of the species of

Rasbora is located in the middle base of the tripus or somewhat centralized (state 0). In the two terminal groups (the Reticulata group and the Sumatrana group), the crest, in contrast, is situated more posteriorly (state 1).

166. Profile of fourth pleural rib from dorsal view: (0) smoothly curved; (1) slightly

notched on midway (ci = 1.00; ri = 1.00).

The fourth pleural rib in Rasbora typically exhibits a smooth curvature in a dorsal view (state 0). In contrast, the danionin outgroups and the rasborin genera

228

Amblypharyngodon and Pectenocypris exhibit a slightly notched fourth pleural rib in dorsal view (state 1).

167. Fossa on dorsoproximal surface of fourth pleural rib: (0) absent; (1) present (ci

= 0.50; ri = 0.89).

In most species of Rasbora, the fourth pleural rib is pierced on its dorsoproximal surface to form a fossa (state 1). In contrast, such a fossa is absent in the Reticulata group

(state 0); a condition also found in the non-cypriniform outgroups, Chanos chanos and

Xenocharax spilurus.

168. Length of fourth pleural rib (modified from Conway, 2005: character 16): (0)

short; (1) moderate; (2) long, almost reaching cleithrum (ci = 0.67; ri = 0.87).

The fourth pleural rib shows variations in length across danionine taxa. The typical condition of the fourth pleural rib found in Rasbora is relatively short and falls distinctly short of a horizontal through the ventralmost limit of the supracleithrum (state 0). In contrast, the diminutive genus Boraras has a moderately long fourth pleural rib that extends ventral to the horizontal through the ventralmost limit of the supracleithrum (state

1). The immediate outgroups, Amblypharyngodon and Pectenocypris, exhibit a relatively long fourth pleural rib that almost reaches the posteroventral portion of the cleithrum (state

2).

169. Distalmost portion of fourth pleural rib: (0) blunt, without spoon-like process;

(1) with spoon-like process (ci = 1.00; ri = 1.00).

The ventral portion of the fourth pleural rib in Rasbora varies in shape. The miniaturized rasborin groups (Boraras, Kottelatia, Trigonopoma, and Rasbora kalbarensis)

229 possess a fourth pleural rib that terminates ventrally in a spoon-like process (state 1). Other rasborin groups lack such an elaboration of the distal portion of the fourth pleural rib (state

0).

170. First fully developed pleural rib (rib of fifth vertebra; Cavender and Coburn,

1992: character 6): (0) without modified head and parapophysis; (1) with head

and parapophysis modified for greater mobility (ci = 0.50; ri = 0.90).

In the subfamily Danioninae, including Rasbora, the head of the fifth vertebra and its adjacent parapophysis are modified to allow for greater mobility in which the parapophysis articulates more perpendicularly with the fifth vertebra resulting in a more anteroventrally-oriented fifth rib (state 1). In contrast, all non-danionine outgroups have a fifth vertebra and its adjacent parapophysis that are unmodified, in which the parapophysis articulates rather slanted posteroventrally resulting in a more posteroventrally-oriented fifth rib (state 0).

171. Neural and haemal spines along caudal peduncle: (0) somewhat curved and

steeply inclined; (1) relatively straight and fairly inclined (ci = 1.00; ri = 1.00).

In Trigonopoma, Kottelatia, and Rasbora kalbarensis, neural and haemal spines are overall relatively straight and moderately posteriorly angled along the caudal peduncle

(state 1). In the remaining species of Rasbora as well as the outgroups, the spines are slightly curved posteriorly distally, and steeply inclined along the caudal peduncle (state 0).

172. Relative numbers of abdominal and canal vertebrae (Liao et al., 2010: character

31): (0) number of abdominal vertebrae equal to or less than number of caudal

230

vertebrae; (1) 1 to 5 more abdominal vertebrae than caudal vertebrae (ci = 0.50;

ri = 0.90).

The proportion between the number of abdominal vertebrae and the number of the caudal vertebrae varies throughout some rasborins. Rasbora typically has a number of abdominal vertebrae equal to the number of caudal vertebrae (state 0). In Boraras, the number of the abdominal vertebrae is one to five greater than the number of the caudal vertebrae (state 1).

PAIRED FINS (FIGURE 3.19)

173. Relative position of dorsalmost tip of postcleithrum and margin of

supracleithrum (Conway, 2005: character 17): (0) large gap between

supracleithrum and dorsalmost tip of postcleithrum; (1) dorsalmost limit of

postcleithrum reaches or extends beyond horizontal through supracleithrum (ci

= 1.00; ri = 1.00).

The species of Rasbora typically have a large gap between the dorsalmost tip of the postcleithrum and the supracleithrum (state 0). In Boraras, the dorsalmost tip of the postcleithrum is reaches or extends beyond the horizontal through the dorsal limit of the supracleithrum (state 1).

174. Shape of supracleithrum from ventral view (Liao et al., 2010: character 32): (0)

flat or slightly arched; (1) L-shaped (ci = 1.00; ri = 1.00).

231

In Rasbora the shape of the supracleithrum is typically flat or slightly arched (state

0). In contrast, in Horadandia and Rasboroides, the supracleithrum is L-shaped from a ventral view (state 1).

175. Vertical ridge on internal surface of cleithrum: (0) reaching lateroventral edge

of cleithrum; (1) not reaching lateroventral edge of cleithrum (ci = 0.25; ri =

0.93).

In some cyprinids, the lateral surface of the lamina on the posterior of the cleithrum bears a vertical ridge, herein termed a laterovertical cleithral ridge. This varies in extension across the examined taxa. In some basal groups (the Daniconius, the Einthovenii, the

Argyrotaenia, and R. cephalotaenia), the ridge extends the ventrolateral edge of the cleithrum (state 0). In contrast, in the other rasborins, the ridge does not reach the ventrolateral edge of the cleithrum (state 1).

176. Profile of anterior portion of horizontal limb of cleithrum (modified from Liao et

al., 2010: character 33): (0) strongly curved with deeply-notched symphysis; (1)

slightly convex with slightly notched symphysis; (2) slightly convex with pointed

symphyseal apophysis; (3) slightly concave with pointed symphyseal apophysis

and angular lateral margin (ci = 0.30; ri = 0.68).

Members of the subfamily Danioninae have a highly variable anterior margin of the horizontal limb of cleithrum from a ventral view. In Rasbora, the anterior margin is typically slightly convex with a slightly-notched symphysis (state 1). Nevertheless, in the

Argyrotaenia group and R. tubbi, the margin is strongly curved with a deeply-notched symphysis (state 0). The anterior margin of the limb in the rasborin outgroup,

232

Amblypharyngodon, is slightly convex with a pointed symphyseal apophysis (state 2). In contrast, in Pectenocypris and Trigonostigma, that margin bears a slightly concave outline, which is interspersed between an angular lateral edge and a pointed symphyseal apophysis

(state 3).

177. Profile of horizontal limb of cleithrum in lateral view: (0) somewhat straight;

(1) gently curved (ci = 0.33; ri = 0.92).

In the basal groups of Rasbora (the Daniconius group and the Einthovenii group), the horizontal limb of the cleithrum is nearly straight from a lateral view (state 0). In contrast, in the more terminal non-Indian groups of Rasbora, this limb appears as gently curved in a lateral view (state 1).

178. Concavity on anteroventral margin of lateral cleithral lamina: (0) present; (1)

absent (ci = 0.33; ri = 0.94).

The anteroventral margin of the lateral cleithral lamina in some groups of Rasbora

(the Daniconius group, the Einthovenii group, and the Argyrotaenia group) exhibits a slightly concave profile (state 0). The remaining rasborin groups have a cleithral lamina with a slightly convex profile (state 1).

179. Foramen on anterior wall of horizontal limb of cleithrum (Liao et al., 2010:

character 34): (0) absent; (1) present (ci = 1.00; ri = 1.00).

Some danionin outgroups (Danio and Devario) have a foramen on the anterior wall of the horizontal limb of the cleithrum (state 1). This foramen is absent in the remaining taxa examined herein, including Rasbora (state 0).

233

180. Foramen on symphyseal lamina of cleithrum: (0) present; (1) absent (ci = 1.00; ri

= 1.00).

The symphyseal lamina along the medial portion of the cleithrum in cyprinids typically bears a foramen, which is present in all rasborin ingroup taxa (state 0). Such a foramen is absent in the danionin genera Danio and Devario (state 1).

181. Anterior fenestra of horizontal limb of pectoral girdle (sensu Brousseau, 1976):

(0) small; (1) large (ci = 1.00; ri = 1.00).

The anterior fenestra of the horizontal limb of the pectoral girdle in rasborin species is relatively large (state 1) compared to that of the other cyprinids. In the danionin outgroups (Danio, Devario, Esomus, Malayochela, and Nematabramis), such a fenestra is relatively small (state 0).

182. Posterior cleithral lamina: (0) narrow; (1) broad (ci = 1.00; ri = 1.00).

In the basal groups of the Rasbora (Horadandia, Rasboroides, and the Daniconius group), the cleithrum bears a relatively broad lamina posteriorly (state 1). The more terminal groups of non-Indian species of Rasbora have a cleithrum with a relatively narrow posterior lamina (state 0). The most basal non-cypriniform outgroups, Chanos chanos and

Xenocharax spilurus, also exhibit the condition of state 0.

183. Cleithral-occipital ligament: (0) absent; (1) present (ci = 1.00; ri = 1.00).

In all danionine taxa examined, a ligament connecting the medial exoccipital region of the neurocranium with the anterodorsal portion of the cleithrum is present (state

1). In contrast, all non-danionine outgroups lack the cleithral-occipital ligament (state 0).

234

184. Form of cleithral-occipital ligament: (0) rope-like; (1) membranous (ci = 1.00;

ri = 1.00).

In danionins and also species of Rasbora the cleithral-occipital ligament

(character 183) has a membranous form (state 1). In contrast, a rope-like form of the ligament is found in all chedrin outgroups (state 0).

185. Cleithral-exoccipital ligament: (0) absent; (1) present (ci = 1.00; ri = 1.00).

In addition to the cleithral-occipital ligament originating from a more medially relatively close to basioccipital, another ligament originating from that region and connecting the more lateral exoccipital with the anterodorsal portion of the cleithrum is present in Rasbora and also both immediate outgroups [Amblypharyngodon and

Pectenocypris] (state 1). This ligament is absent in all non-rasborin outgroups (state 0).

186. Baudelot’s ligament connecting cleithrum and supracleithrum with lateral

process of first vertebra: (0) absent; (1) present (ci = 0.50; ri = 0.91).

In cyprinids, a ligament connecting the lateral process of the first vertebra with the pectoral girdle (i.e., the cleithrum and the supracleithrum), assigned as the Baudelot’s ligament of the cyprinids by Conway (2011), is typically present (state 1). In contrast, such a ligament is absent in all danionines examined, including Rasbora (state 0), except for all the chedrins (Luciosoma, Opsarius, Raiamas, and Sundadanio).

187. Ligament connecting cleithrum with lateral process of second vertebra: (0)

absent; (1) present (ci = 1.00; ri = 1.00).

235

In some danionin outgroups (Chela, Esomus, Malayochela and Nematabramis), the lateral process of the second vertebra is connected with the cleithrum by a ligament

(state 1). This ligament is absent in Rasbora and other outgroups (state 0).

188. Form of cleithrum-second vertebra ligament: (0) weakly-developed; (1)

strongly-developed (ci = 1.00; ri = 1.00).

The cleithrum-second vertebra ligament (character 187) in Malayochela and

Nematabramis is relatively stout (state 1), whereas it is weakly-developed in Chela and

Esomus (state 0). Lacking the ligament, in the other examined taxa, this character was coded inapplicable.

189. Dorsomedial flange of cleithrum: (0) present; (1) absent (ci = 1.00; ri = 1.00).

In the species of Rasbora, the cleithrum bears a flange along the dorsomedial margin (state 0); a condition also found in most of the outgroups. However, this flange is absent in some diminutive rasborin (Boraras, Trigonopoma, and R. kalbarensis; state 1).

190. Lateral coracoid ridge: (0) absent; (1) present (ci = 1.00; ri = 1.00).

In the Argyrotaenia group, the coracoid bears a distinct ridge, which is termed lateral coracoid ridge along its lateral margin (state 1). In contrast, the other rasborin groups lack such a ridge (state 0).

191. Dorsal articulation of the basal coracoid lamina with ventral tip of

mesocoracoid: (0) highly elevated forming fissure; (1) highly elevated forming

subtriangular or subsectorial ridge; (2) rudimentary, forming minute canal (ci =

0.50; ri = 0.91)

236

At the articulation between the coracoid and mesocoracoid, the coracoid bears a dorsally-elevated structure on the coracoid called the basal coracoid lamina (sensu

Brousseau, 1976). In some basal rasborins (Amblypharyngodon, Pectenocypris,

Horadandia, Rasboroides, Rasbora dandia, R. daniconius, R. wilpitta, and Rasbora tubbi), the articulation is highly elevated to form a fissure (state 0). In some diminutive rasborins

(Boraras, Kottelatia, Trigonopoma, and Rasbora kalbarensis), the articulation is rudimentary forming a minute canal (state 2). The remaining taxa have such an articulation that is highly elevated to form a subtriangular or subsectorial ridge (state 1).

192. Posteromedial margin of coracoid: (0) highly concave; (1) relatively straight (ci =

1.00; ri = 1.00).

The posteromedial margin of the coracoids in the basal group of Rasbora

(Horadandia, Rasboroides, the Daniconius group, and the Einthovenii group) is highly concave (state 0). In contrast, the margin is relatively straight in the more terminal groups

(state 1).

193. Posterior distance of coracoids: (0) relatively distant; (1) relatively close (ci =

0.20; ri = 0.87).

The distance between the corresponding posteromedial edges of the paired coracoids varies throughout some different groups of Rasbora of which the basal groups

(Boraras, Horadandia, Kottelatia, Rasboroides, Trigonopoma, Trigonostigma, the

Daniconius group, and the Einthovenii group) typically have coracoids that are separated relatively distantly (state 0). The more terminal groups of Rasbora have a pair of coracoids that are relatively close to each other (state 1).

237

194. Postcleithrum: (0) present, well-developed; (1) present, diminutive; (2) absent (ci

= 0.67; ri = 0.80).

The postcleithrum in some danionines, especially in the tribe Chedrini, is diminutive (state 1). In Esomus, Malayochela, and Nematabramis, the postcleithrum is absent (state 2). Rasborin taxa, including Rasbora typically have a well-developed postcleithrum (state 0).

195. Relationship of dorsal tip of pelvic splint and ventral tip of 9th rib: (0) vertically

not aligned, not connected; (1) vertically in parallel, connected (ci = 1.00; ri =

1.00).

In some groups of Rasbora (Brevibora, Trigonostigma, and the Trifasciata group), the dorsal tip of the pelvic splint may be vertically aligned and connected with the ventral tip of the 9th rib via a distinct ligament (state 1). The other groups of Rasbora have a pelvic splint distantly situated more posteriorly than the 9th rib without a distinct ligamentous connection between those bones (state 0).

196. Distance between contralateral ischiac process: (0) relatively distant; (1) small

(ci = 0.33; ri = 0.96).

In the supragenus Rasbora, the relative distance between the ischiac processes of the pelvic fin demonstrates two conditions. The contralateral ischiac processes are relatively distant in some more basal groups of Rasbora such as Boraras, Horadandia,

Trigonopoma, the Daniconius group, the Einthovenii group, Rasbora borneensis, R. cephalotaenia, and R. tornieri (state 0). In other more terminal groups of Rasbora the distance between the pairing process is relatively small (state 1).

238

197. Apophysis on anterior tip of ischiac process of pelvic girdle: (0) present; (1)

absent (ci = 1.00; ri = 1.00).

A small anteriorly-projected apophysis on the anterior tip of the ischiac process is present in some cyprinids (Figure 3.19: ap) and occurs in most species of Rasbora (state 0).

In contrast, the species of the Sumatrana group lack such an apophysis on the ischiac process (state 1).

198. Form of posterior portion of ischiac process: (0) distinctly bent outwards; (1)

gradually curved outwards (ci = 0.50; ri = 0.98).

Cyprinids have a pelvic ischiac process that terminates posteriorly in a cartilaginous lamina, which varies in form across the taxa. In basal groups of Rasbora, such a posterior portion is distinctly bent laterally resulting in a distinct angular configuration (state 0). In more terminal groups of Rasbora (Brevibora, Trigonostigma, the Argyrotaenia group, the

Trifasciata group, the Reticulata group, and the Sumatrana group), it is more gradually curved laterally (state 1; Figure 3.17.B: pi).

199. Cartilaginous lamina on posterior tip of ischiac process of pelvic girdle: (0)

originates from posteromedial margin of bony ischiac process; (1) originates

from posterior tip of bony ischiac process (ci = 1.00; ri = 1.00).

Cyprinids have a pelvic ischiac process that is terminated posteriorly in a cartilaginous lamina, which is variable in form within the family, especially across rasborin taxa. The basal Indian groups of Rasbora (Horadandia, Rasboroides, and the Daniconius group) and a Bornean species Rasbora tubbi have such a lamina that originates from the posteromedial margin of the bony ischiac process (state 0). In contrast, the lamina

239 originates from the posterior tip of the process in the more terminal rasborin groups (state

1; Figure 3.17: ic).

MEDIAN FINS

200. Origin of dorsal fin (Cavender and Coburn, 1992: character 12): (0) anterior to

vertical through pelvic-fin insertion; (1) posterior to vertical through pelvic-fin

insertion (ci = 0.25; ri = 0.80).

The dorsal-fin origin in all examined species of Rasbora is typically posterior to the pelvic-fin insertion (state 1), a condition also found in some examined cyprinid outgroups

(cyprinins and leuciscins). The non-cypriniform outgroups, Chanos chanos and

Xenocharax spilurus, and some non-cyprinid cypriniforms have a dorsal fin with its origin located anterior to the pelvic-fin insertion (state 0).

201. Approximate length of first unbranched ray of dorsal fin relative to length of

second ray: (0) one-third; (1) one half or more (ci = 1.00; ri = 1.00).

The length of the first unbranched ray of dorsal fin compared to the length of the second ray may vary across different groups in Rasbora. Species of Rasbora typically have a first unbranched ray approximately one-third the length of the second ray (state 0). In contrast, Brevibora and Trigonostigma possess a dorsal fin with its first unbranched ray is approximately one half or more the length of the second ray (state 1).

202. Extra anterior pterygiophore on dorsal fin: (0) absent; (1) present (ci = 1.00; ri =

1.00).

240

Some rasborin groups (Kottelatia, Trigonopoma, and Rasbora kalbarensis) have an extra, small pterygiophore situated anterior to the first unbranched dorsal-fin ray (state 1).

The remaining groups of Rasbora as well as all the outgroup taxa lack an extra anterior pterygiophore (state 0).

203. Medioventral process on base of first dorsal-fin ray: (0) absent; (1) present (ci

= 0.50; ri = 0.92).

The first anteriormost dorsal-fin ray of danionines is typically equipped with a rounded process on its medioventral tip (state 1). Such a process is absent in non- danionine outgroup taxa (state 0).

204. Form of medioventral process of first dorsal-fin ray: (0) small, bump; (1) large,

knob-like (ci = 1.00; ri = 1.00).

The medioventral process of the first dorsal-fin ray (character 203) in Brevibora and Trigonostigma is relatively large, forming a knob-like element (state 1). In other species of Rasbora the process is rather small appearing as a bump (state 0). This process is absent in Chanos chanos and Xenocharax spilurus, and is therefore coded as inapplicable.

205. Large foramen on dorsomedial ramus of first proximal-middle radial of dorsal

fin: (0) absent; (1) present (ci = 1.00; ri = 1.00).

In Brevibora and Trigonostigma, the first proximal-middle radial of dorsal fin is pierced medially by a relatively large foramen (state 1). This aperture is absent in all remaining species of Rasbora and also all outgroup taxa (state 0).

206. Lateral flange of dorsomedial ramus of first proximal-middle radial of dorsal

fin: (0) relatively narrow; (1) laterally expanded (ci = 1.00; ri = 1.00).

241

The first proximal-middle radial of the dorsal fin typically has a dorsomedial ramus that bears a lateral flange on each side. In the terminal groups of Rasbora,

Brevibora and Trigonostigma, this flange is relatively broad (state 1). In contrast, all the remaining rasborin taxa lack such a lateral flange (state 0).

207. Dorsal apophysis of distal radial of dorsal fin: (0) absent; (1) present (ci = 1.00;

ri = 1.00).

The distal radial of the dorsal fin in Brevibora and Trigonostigma bears a dorsal apophysis (state 1). Such an apophysis is absent from the other rasborin taxa and all the outgroups (state 0).

208. Branched anal-fin rays (Fang, 2003: character 4; Liao et al., 2010: character 10):

(0) 10 or more; (1) 5 to 6 (ci = 0.25; ri = 0.83).

The anal fin of the subfamily Danioninae exhibits a considerable range in the number of the branched rays. Nevertheless, within Rasbora, the number of the branched anal-fin rays is relatively consistent with only 5 or 6 rays (state 1). In non rasborin danionines, the number of the branched anal-fin rays is 10 or more, with high variation across taxa (state 0), except for two cyprinine outgroups, Systomus and Tor.

209. Hypural six (Conway, 2005: character 18): (0) present; (1) absent (ci = 0.33; ri =

0.71).

Hypural six is typically present in species of Rasbora (state 0) and outgroup taxa.

The bone is absent in Boraras, Horadandia, and Rasbora kalbarensis (state 1).

242

210. Free uroneural (Conway, 2005: character 19): (0) present; (1) absent (ci = 0.25;

ri = 0.67).

The pleurostyle of Rasbora typically bears free uroneurals (state 0). In Boraras,

Trigonostigma, R. johannae, Rasbora sp. 5, and Rasbora sp. 6, the free neural is absent from pleurostyle (state 1).

211. Association of parhypural with first hypural (Conway, 2005: character 20): (0)

separate from first hypural; (1) fused with first hypural posteriorly (ci = 1.00; ri

= 1.00).

The parhypural in Rasbora typically does not fuse with its adjacent bones (state 0). In two diminutive Indian genera Horadandia and Rasboroides, the posterior portion of the parhypural is dorsally fused with the first hypural (state 1).

212. Length of last epineural: (0) reaching base of hypural 3; (1) posteriorly

extending as far as middle of hypural 3 (ci = 1.00; ri = 1.00).

In the subfamily Danioninae, the last epineural may vary in length, as assessed by comparing the location of its posterior tip with the parallel point on its medially adjacent bone. All species of Rasbora examined here have a last epineural that posteriorly extends as far as the horizontal through the mid-section area of the hypural 3 (state 1).

In all non-rasborin outgroups and also the rasborin genera Amblypharyngodon and

Pectenocypris, the last epineural terminates at the area close to the base of the hypural 3

(state 0).

213. Length of last epipleural: (0) reaching base of hypural 1 or 2; (1) posteriorly

extending as far as mid-section of hypural 2 (ci = 1.00; ri = 1.00).

243

All examined species of Rasbora have a last epipleural that posteriorly extends as far as the middle of the second hypural (state 1). In Amblypharyngodon, Pectenocypris, and also all the remaining outgroups, the last epipleural is shorter, which does not extend beyond the area around the base of the hypural 1 or 2 (state 0).

SCALES AND SQUAMATION (FIGURE 3.20)

214. Form of scales: (0) smoothly rounded; (1) angular (ci = 0.33; ri = 0.93).

The scales of Rasbora are typically rounded in profile with barely any edges or concavities along their exposed border (state 0; Figure 3.20.A). However, some rasborin taxa exhibit an angular outline, with two or more angles or concavities present along the outline of its exposed margin (state 1; Figure 3.20B) as in the Argyrotaenia group, the

Reticulata group, and the Sumatrana group (except R. elegans).

215. Scale focus: (0) basal; (1) central (ci = 0.20; ri = 0.82).

The scale focus in the supragenus Rasbora is typically situated in the basal area of the scale (state 0; Figure 3.20.B: F). In contrast, some species of the Daniconius group (R. daniconius, R. dandia, and R. wilpitta) have the focus situated more centrally on the scale

(state 1; Figure 3.20.A: F)..

216. Basal radii arrangement: (0) relatively sparse; (1) relatively dense (ci = 0.25; ri

= 0.85).

The basal radii of several groups of Rasbora (Horadandia, Rasboroides,

Brevibora, Trigonostigma, the Daniconius group, and the Trifasciata group) are arranged

244 relatively sparsely (state 0; Figure 3.20.A, B). The remaining groups of Rasbora possess scales that exhibit basal radii with a relatively more dense arrangement (state 1).

217. Apical radii arrangement: (0) relatively more sparse; (1) relatively more dense

(ci = 0.25; ri = 0.85).

The scales of some members of Rasbora (Horadandia, Rasboroides, Brevibora,

Trigonostigma, the Daniconius group, and the Trifasciata group) have apical radii that are arranged relatively sparsely (state 0; Figure 3.20.A: pr). In the other groups of Rasbora, the scales have a more relatively dense arrangement of the apical radii (state 1; Figure

3.20.B: R).

218. Apical flange on scales: (0) absent; (1) present (ci = 0.33; ri 0.93).

In basal groups of Rasbora (i.e., Brevibora, Horadandia, Kottelatia, Rasboroides,

Trigonopoma, Trigonostigma, the Daniconius group, the Einthovenii group, R. cephalotaenia, and R. elegans), the apical margin of scales has a continuous semicircular outline, without a projecting flange (state 0; Figure 3.20). In contrast, the more terminal groups of Rasbora (the Argyrotaenia group, the Trifasciata group, the Reticulata group, and the Sumatrana) have scales that bear an apical flange, which overall forms a more sinuous apical margin (state 1).

219. Predorsal scale number: (0) more than 30; (1) 18 to 29; (2) 14 to 17; (3) 12 to 13;

(4) fewer than 11 (ci = 0.40; ri = 0.82).

The number of serial scales along the area anterior to the dorsal fin, the predorsal scales, varies across cyprinids. In Rasbora the number also varies but never exceeds 18

245 scales. The Indian rasborin taxa (Horadandia, Rasboroides, and the Daniconius group) have ranges of 14 to 17 scales (state 2). The species of the Sundaland Rasbora typically have a predorsal scale number that ranges from 12 to 13 (state 3), except for some species, which have fewer than 11 predorsal scales (state 4). The outgroup cyprinids (danionins, chedrins, and leuciscines) have a predorsal scale that ranges from 18 to 29 (state 1). Some other outgroup taxa (Chanos chanos and a balitorid Homaloptera) have more than 30 predorsal scales (state 0).

220. Number of lateral line row scales: (0) more than 40; (1) 36 to 40; (2) 31 to 35; (3)

28 to 30; (4) 25 to 27; (5) fewer than 25 (ci = 0.29; ri = 0.81).

In Rasbora, the number of scales along the lateral line row sensu Kottelat (2001) varies among some groups. Some species of the Daniconius group (R. caverii, R. dandia and R. daniconius) have the highest range number of lateral line row scales, with 31 to 35

(state 2). Species of the Argyrotaenia group have a lateral line row with 28 to 30 scales

(state 3). In some species groups of Rasbora (The Trifasciata group, some of the Sumatrana group, and some of the Reticulata group), the range of the scale number falls between 25 to

27 scales (state 4). The remaining species of the Sumatrana group and the Reticulata group have a lateral line row with 23 to 24 scales (fewer than 25; state 5).

221. Lateral line canal (Conway, 2005: character 24): (0) complete; (1) incomplete;

(2) absent (ci = 0.17; ri = 0.50).

The perforated scales of the lateral-line canal on the body in ostariophysans are typically arranged in a continuous series starting from the first scale on the pectoral girdle to terminate at the hypural notch, a condition also defined as “complete lateral line scales”

246

(state 0; Kottelat, 2001). In some small-sized species of Rasbora the series of perforated scales does not extend posteriorly to reach the hypural notch, a condition defined as incomplete lateral line scales (state 1). In some miniaturized Rasbora (Boraras,

Horadandia, and R. kalbarensis), the lateral-line scales are not perforated (state 2).

222. Squamation anterior to pectoral-fin base: (0) present; (1) absent (ci = 0.17; ri =

0.72).

The ventrolateral portion of the pectoral girdle situated anterior to the base of the first pectoral-fin ray is typically scaled in the basal groups of Rasbora, the Daniconius group and the Einthovenii group (state 0). The more derived rasborins lack such a scaled area (state 1). The squamation anterior to the pectoral-fin base is also present in Chanos chanos, the most basal outgroup.

223. Circumpeduncular scale rows: (0) more than 14; (1) 14; (2) 12; (3) fewer than 12

(ci = 0.25; ri = 0.80).

The number of the scale rows surrounding the caudal peduncle (circumpeduncular scales rows) varies among rasborins. The Daniconius group, the Argyrotaenia group,

Rasbora hubbsi, and R. tubbi have 14 circumpeduncular scales (state 1). The Trifasciata group, the Sumatrana group, and the Reticulata group have 12 circumpeduncular scales

(state 2). In members of miniaturized groups of Rasbora (Horadandia, Rasboroides,

Trigonostigma, Rasbora api, R. tobana, and R. vulcanus), there are fewer than 12 scales surrounding the caudal peduncle (state 3). The basal outgroups, such as Chanos chanos and

Xenocharax spilurus, possess more than 14 circumpeduncular scales (state 0).

247

MYOLOGY (FIGURES 3.21–3.23)

224. Division of adductor mandibulae A1 into two portions (modified from Takahasi,

1925): (0) absent; (1) present (ci = 0.33; ri = 0.75).

The adductor mandibulae A1 muscle or the maxillaris in cypriniforms typically may be completely or bipartially divided (Takahasi, 1925; Wood, 1992). In the subfamily

Danioninae, including Rasbora, the adductor mandibulae type A1 muscle is typically divided anteriorly into two parts (state 1; Figure 3.21). The subdivision of this muscle is even more pronounced in cyprinine members, in which the type A1 muscle is divided from a point located relatively more posteriorly. The muscle is not subdivided in leuciscines and cultrines (state 0).

225. Form of division of adductor mandibulae type A1: (0) completely divided; (1)

partially divided only on anterior half (ci = 1.00; ri = 1.00).

In cyprinids, the division of adductor mandibulae type A1 (character 224) varies in the degree to which it is divided. In Rasbora, the partial division commences anteriorly from the midway portion of the muscle to yield two tendonous branches (state 1; Figure

3.21: apo and vtA1); a condition also present in other danionines (danionins and cultrins, except for Luciosoma). In members of the subfamilies Cyprininae and Leptobarbinae, the division results in a complete partition of the muscle (state 0).

226. Anterior split between medial aponeurosis of A1 division of adductor

mandibulae and its tendon: (0) absent; (1) present (ci = 0.50; ri = 0.93).

In members of the tribes Danionini and Rasborini, the posterior portion of the A1 division of adductor mandibulae is attached medially to an aponeurosis (Figure 3.21: apo),

248 which has the same size and shape as this fibrous bundle of the muscle. This unified muscular structure originates from the dorsal surface of the preopercle and runs anteriorly towards the maxilla. As the A1 muscle tapers anteroventrally to become tendonous, it starts to be separated from the aponeurosis so that both tissues branch out anteriorly to insert in different regions of the maxilla. The rope-like anterior tendon of the A1 muscle is generally inserted to the midventral margin of the maxilla (Figure 3.21: vtA1), whereas the aponeurosis extends anterodorsally towards the dorsal portion of this bone (Figure 3.21: apo). In the subfamily Danioninae, the sister group of the tribes Danionini and Rasborini, the tribe Chedrini sensu Tang et al. (2010), apparently lack this split of A1 muscle (Figure

3.22.A, B), except in Opsarius (Figure 3.22.C) and Sundadanio.

227. Attachment position of medial aponeurosis of A1 division of adductor

mandibulae: (0) to dorsal tip of palatine process of maxilla; (1) to anterior

portion of maxilla; (2) along mid-dorsal portion of maxilla (ci = 1.00; ri = 1.00).

In the Danioninae, the anterior limit of the medial aponeurosis of the A1 muscle typically inserts onto the dorsal margin of the maxillary (state 0; Figure 3.22.B). The point of insertion on the maxilla varies across danionine taxa. In Rasbora, the medial aponeurosis of the A1 muscle inserts along a wide portion of the dorsomedial margin of the maxilla, stretching from the anterior margin of the maxillary palatine process to the dorsomedial body of the maxilla (state 2; Figure 3.23). In the immediate outgroups (Amblypharyngodon and Pectenocypris) such an aponeurosis inserts further anteriorly on the anterior portion of the maxilla (state 1). In contrast, all examined danionin taxa have such an aponeurosis that attaches to the dorsal tip of the palatine process of the maxilla (state 0). This character is inapplicable to all chedrin and non-danionine outgroup taxa.

249

228. Branch of anterodorsal tendon of A1 division of adductor mandibulae: (0)

absent; (1) present (ci = 1.00; ri = 1.00).

The A1 division of adductor mandibulae in all the non-Indian groups of Rasbora typically has a branch of the anterodorsal tendon that originates from the medial portion of the A1 fibers (state 1; Figure 3.23.C, D: dtA1) and inserts either on the medial surface of the first infraorbital (the lachrymal) or on the anteromedial portion of the maxilla. This tendonous branch is absent in all the Indian taxa of Rasbora (Horadandia atukorali,

Rasbora dandia, R. daniconius, R. wilpitta, and Rasboroides vaterifloris), the Bornean

Rasbora tubbi, and all outgroup taxa (state 0; Figures 3.22; 3.23.A, B).

229. Anterodorsal tendon of A1 division of adductor mandibulae: (0) attaching to

anteromedial portion of lachrymal; (1) attaching to anteromedial portion of

maxilla (ci = 1.00; ri = 1.00).

The tip of the anterodorsal tendon of the A1 division of the adductor mandibulae

(character 228; Figure 3.23.C, D: dtA1) may attach at different points in different rasborin groups. In the more terminal groups, all non-Indian groups of Rasbora except

Rasbora tubbi, have the tendon attached to the anteromedial portion of the lachrymal or the first infraorbital (state 0; Figure 3.23.C, D: dtA1). In the diminutive species of

Rasbora, Kottelatia brittani and Rasbora kalbarensis, the anterodorsal tendon of the A1 division of the adductor mandibulae inserts onto the anteromedial portion of the maxilla

(state 1). All outgroup taxa lacking such a tendon are coded inapplicable.

250

230. Fibrous cotton-like system of connective tissue covering palatine process of

maxilla: (0) absent; (1) present, but very thin; (2); present, distinct (ci = 1.00; ri

= 1.00).

In Rasbora, the palatine process of the maxilla is typically covered by a thick fibrous cotton-like system of connective tissue, which is inferred to have a cushioning function (state 2; Figure 3.23.B, C, D: cus). However, this indistinct connective tissue appears as an opaque connective tissue in some species of the basal group of Rasbora:

Horadandia, Rasboroides, four species of the Daniconius group (Rasbora armitagei, R. daniconius, and R. wilpita), and in a Bornean species, R. tubbi (state 1; Figures 3.22.D;

3.23.A: cus). All the outgroup taxa lack this connective tissue (state 0; Figure 3.22.A, B,

C).

231. Anterior attenuation of A2 division of adductor mandibulae into rope-like

tendon posterior to point where it crosses ramus of mandibularis trigeminus: (0)

absent; (1) present (ci = 1.00; ri = 1.00).

The anterior portion of the A2 division of the adductor mandibulae of Rasbora typically attenuates anteriorly. In some diminutive groups of Rasbora (Boraras, Kottelatia,

Trigonopoma, and R. kalbarensis), the attenuation of the muscle commences relatively more posterior, thereby forming a rope-like tendon to a point where it crosses the ramus of the mandibularis trigeminus (state 1). In the remaining rasborin taxa, such an attenuation of the muscle is absent (state 0).

232. Flexor dorsalis superior: (0) not expanded; (1) expanded dorsally (ci = 1.00; ri

= 1.00).

251

In the Caudimaculata group sensu Brittan (1954) [i.e., R. caudimaculata, R. subtilis, and R. trilineata], a dorsolateral muscle on the caudal peduncle, the flexor dorsalis superior, is expanded due to the dorsal expansion of the body of the muscle (state

1). This muscle expansion is absent in the remaining species groups of Rasbora and the outgroup taxa (state 0).

233. Flexor ventralis inferior: (0) not expanded; (1) expanded ventrally (ci = 1.00; ri

= 1.00).

In the Caudimaculata group sensu Brittan (1954), a ventrolateral muscle on the caudal peduncle, the flexor ventralis superior, is expanded due to the ventral expansion of the body of the muscle (state 1). This muscle expansion is absent in the remaining species groups of Rasbora as well as all the outgroup taxa (state 0).

PIGMENTATION (FIGURES 2.2; 2.10; 3.24)

234. Black midlateral bar: (0) absent; (1) present, more than one along lateral body;

(2) present as one midhumeral bar (ci = 0.33; ri = 0.43).

The black midlateral bar is defined as a pigmentation pattern of melanophores on the midlateral surface of the body, which is much deeper vertically and narrower horizontally that laterally stretches along the trunk as a repeated discontinuous series (state

1). This pattern is common in the members of the tribe Chedrini as represented by

Luciosoma setigerum, Opsarius barna, and Raiamas guttatus in this study. Based on this midlateral bar as one of the diagnostic features, the genus Luciosoma was hypothesized by

Roberts (1989) to be more closely related to Barilius sensu lato (including Opsarius) than to any other cyprinids, as opposed to the hypothesis by Howes (1980) who asserted that

252

Rasbora is the sister to Luciosoma. The pigmentation of the black midlateral bar is also present in some danionins (Chela, Malayochela, and Nematabramis), however, there is only one bar on the midhumeral portion of the body (state 2). All members of Rasbora lack this type of lateral pigmentation. A black midlateral bar is also absent in the most basal outgroups in this study, Chanos chanos and Xenocharax spilurus, which renders the coding of the absence of the character as plesiomorphic (state 0).

235. Black midlateral stripe: (0) absent; (1) present (ci = 0.08; ri = 0.52).

The black midlateral stripe is defined as a longitudinal pattern of melanophores along the midlateral surface of the body that forms a continuous stripe (Figures 2.2; 2.3;

3.24: mls). This pigmentation is typically present in Rasbora (state 1), albeit with some degree of variation in shape, intensity, and size. This stripe, however, is absent in some species of Rasbora such as: Brevibora dorsiocellata, Kottelatia brittani, Horadandia atukorali, Rasbora kalbarensis, and Rasboroides vaterifloris (state 0). The absence of this stripe within Rasbora is inferred to be a secondary loss. The black midlateral stripe is quite prevalent throughout cyprinids, which is demonstrated by the presence of this pigmentation in many species of every cyprinid subfamily, especially in danionines. The most basal outgroups, Chanos chanos and Xenocharax spilurus, also lacks this midlateral stripe.

236. Extent of black midlateral stripe: (0) from snout to caudal peduncle; (1) from

operculum to caudal peduncle; (2) from area between midhumeral and

subdorsal region to caudal peduncle; (3) indistinct deep trace of black lateral

swath with two squarish blotches; (4) reduced to one distinct lateral blotch; (5)

relatively short linear midlateral stripe along posterior half of body; (6)

253

relatively short midlateral stripe along posterior half of body with extensively

depth distinctly increasing progressively; (7) rudimentary in form of subdorsal

squarish blotch (ci = 0.44; ri = 0.76).

In Rasbora, the black midlateral stripe varies in its form along the body. The stripe extends from the snout to the caudal peduncle in some basal groups of Rasbora

(Trigonopoma, the Daniconius group, the Einthovenii group, and R. cephalotaenia). In some species of the Trifasciata group (R. hubbsi, R. sarawakensis, and Rasbora sp. 11) and the entire Reticulata group, the stripe extends from the operculum to the caudal peduncle

(state 1). The species in the Sumatrana group (except R. elegans and Rasbora sp. 4) exhibit a midlateral stripe that runs along an area between a point on the midhumeral or subdorsal region to terminate on the caudal peduncle (state 2; Figure 2.3). Some other groups of

Rasbora exhibit other distinct forms of the black midlateral stripe, which are varyingly not strictly linear. Two species of the Einthovenii group (R. kalochroma and R. kottelati) exhibit a rudimentary form of the stripe represented by an indistinct midlateral linear trace of melanophores and two separate distinct large black blotches (state 3). In two species of

Boraras (B. maculata and B. micros), another rudimentary form of the stripe consists of a black blotch on the midhumeral region (state 4). In some species of the Trifasciata group

(Rasbora lacrimula, R. rutteni, Rasbora sp. 9, and Rasbora sp. 10), the stripe takes the form of a modified semilinear pigmentation along the posterior half of the trunk (state 5).

The genus Trigonostigma, in contrast, also has a modified form of the stripe located posteriorly, but it becomes progressively higher anteriorly (state 6). Two species of the

Sumatrana group (R. elegans and Rasbora sp. 4) exhibit another rudimentary form of the

254 stripe that appears as a subdorsal blotch (state 7). The non-cypriniform outgroups, Chanos chanos and Xenocharax lack the stripe and the character is scored as inapplicable.

237. Axial streak (Brittan, 1954): (0) absent; (1) present (ci = 1.00; ri = 1.00).

In Rasbora, the axial septum along the midlongitudinal axis of the trunk is superficially speckled by a line of melanophores which forms a pigmentation pattern termed the axial streak (Figures 2.10; 3.24: as; Brittan, 1954). Such a streak is present in all members of Rasbora (state 1), the immediate outgroups (Amblypharyngodon and

Pectenocypris), and all the examined danionins. The remaining outgroups lack the axial streak (state 0).

238. Position of axial streak relative to black midlateral stripe: (0) no horizontal

parallel; (1) dorsally overlapping posterodorsal portion of stripe; (2) medially

traversing posterior portion of stripe; (3) dorsally bordering posterior portion

of stripe (ci = 0.37; ri = 0.87).

The position of the axial streak (character 237; Figure 3.24) relative to the black midlateral stripe varies in different modes across the species of Rasbora, particularly with respect to how the streak traverses the stripe. In some rasborin species (Brevibora,

Horadandia, Kottelatia, Rasboroides, and Rasbora kalbarensis), the black midlateral stripe is absent or highly reduced, therefore the axial streak runs anteriorly without contacting any parallel horizontal black pigmentation (state 0). In the more basal groups, the axial streak typically runs anteriorly from the hypural notch to traverse the posterodorsal portion of the stripe in overlapping fashion (state 1; Figure 3.24.A and B).

In other rasborin groups (Trigonostigma; the Argyrotaenia group: Rasbora dusonensis, R.

255 myersi, and R. aurotaenia; the Trifasciata group: R. bankanensis, R. ennealepis, and R. paucisqualis), the axial streak runs forward along the middle of the posterior half of the stripe towards the anterior (state 2; Figure 3.24.C). In contrast, the more terminal rasborin groups (the Reticulata group and the Sumatrana group) typically have a relatively thinner black midlateral stripe with the axial streak extending anteriorly along the dorsal periphery of the posterior portion of the stripe (state 3; Figures 2.10: AS; 3.24.D). This character is coded as inapplicable for those taxa that lack the axial streak.

239. Midhumeral diffuse patch of black midlateral stripe: (0) absent; (1) present (ci

= 0.33; ri = 0.60).

In some species of the Sumatrana group, the midhumeral region is pigmented by one of the elements of the black midlateral stripe, a diffuse patch (state 1; Figure 2.3:

MDP). In the remaining species of Rasbora and outgroups, the midhumeral diffuse patch is absent (state 0).

240. Subdorsal blotch of black midlateral stripe: (0) absent; (1) present (ci = 0.50; ri

= 0.88).

In some species of the Sumatrana group, the black midlateral stripe is composed of another subelement called a subdorsal blotch (state 1; Figure 2.3: SDB). This blotch is also present in two members of the Einthovenii group: R. kalochroma, and R. kottelati. In the remaining ingroups as well as outgroups, the subdorsal blotch is absent (state 0).

241. Shape and position of subdorsal blotch of black midlateral stripe: (0)

subrectangular, with anterior margin situated more posterior than vertical

through dorsal-fin origin; (1) subrectangular, with anterior margin in contact

256

with vertical through dorsal-fin origin; (2) ellipsoidal, with anterior margin

situated anterior to dorsal-fin origin (ci = 1.00; ri = 1.00).

The subdorsal blotch of the black midlateral stripe (character 240; Figure 2.3:

SDB) varies throughout the species of the Sumatrana group. Some species (R. cf. hosii,

Rasbora sp. 1, and Rasbora sp. 2) have such a blotch with an elongate ellipsoidal profile, with its anterior margin situated more anterior than the vertical through the dorsal-fin origin (state 2). In contrast, other species (R. aprotaenia, R. elegans, R. spilotaenia, and

Rasbora sp. 4) have such a subrectangular blotch with its anterior margin contacting the vertical through the dorsal-fin origin (state 1). The subdorsal blotch in R. kalochroma and

R. kottelati is also subrectangular, but it is somewhat larger and located more posteriorly than state 1 (state 0). All taxa that lack the blotch are scored as inapplicable.

242. Dusky dorsolateral stripe: (0) absent; (1) present (ci = 0.33; ri = 0.95).

The dusky dorsolateral stripe sensu Lumbantobing (2010) is present in several groups of Rasbora: the Argyrotaenia group (except R. aurotaenia, R. dusonensis, and R. myersi), the Trifasciata group, the Reticulata group, and the Sumatrana group (state 1). It is absent in all other species of the supragenus Rasbora and outgroups (state 0).

243. Black ventrolateral stripe: (0) absent; (1) present (ci = 0.33; ri = 0.60).

Several species of Rasbora have a longitudinal pigmentation along the ventrolateral region of the body (state 1): R. borneensis, R. cephalotaenia, R. tornieri, and R. tubbi. The remaining groups of Rasbora as well as all the outgroups, except Danio and Devario, lack such a stripe (state 0).

244. Light longitudinal area: (0) absent; (1) present (ci = 0.09; ri = 0.74).

257

In Rasbora, a linear area barely speckled by melanophores is typically present along the lateral surface of the body, termed the light longitudinal area (state 1). Several rasborin taxa lack such a stripe (i.e., Brevibora, Kottelatia, R. elegans, R. kalochroma, R. kottelati, and R, kalbarensis) [state 0]. Both basal outgroups, Chanos chanos and

Xenocharax spilurus, also lack this character.

245. Reflective midlateral stripe: (0) absent; (1) present (ci = 0.17; ri = 0.75).

In some groups of Rasbora, when alive, the light longitudinal area (character 244) along the lateral body typically exhibits a reflective stripe with a distinct metallic color

(state 1). However, in the Sumatrana group, the reflective midlateral stripe is absent in life, despite the presence of a light longitudinal area after preservation (state 0).

246. Peritoneal reflective area sensu Lumbantobing (2010): (0) indistinct; (1)

distinct (ci = 0.20; ri = 0.89).

In some relatively small to moderate species of Rasbora the ventrolateral region of the body look somewhat transparent, thereby exposing a peritoneum that generally has a reflective area appearing as a distinct metallic color (state 1). In large-sized species groups of Rasbora, such a reflective area is indistinct (state 0).

247. Dark black patch of pigmentation between maxilla and eye (Conway, 2005:

character 29): (0) absent; (1) present (ci = 1.00; ri = 1.00).

The area between the maxilla and the eye in Boraras micros and B. urophthalmoides bears a dark black patch due to dense concentration of melanophores

(state 1). Such a pigmentation is absent in the other species of Rasbora and all the outgroups (state 0).

258

248. Postcleithral streak: (0) absent; (1) present (ci = 0.50; ri = 0.97).

A pigmentation pattern composed of a somewhat vertical, thin swath of melanophores extends along the postcleithral area posterior to the gill opening, which is also known as a black postcleithral streak occurs in some terminal non-Indian groups of

Rasbora: Boraras, Brevibora, Kottelatia, Trigonopoma, Trigonostigma, the Argyrotaenia group, the Trifasciata group, the Caudimaculata group, the Sumatrana group, and the

Reticulata group, Rasbora cephalotaenia, and R. kalbarensis (state 1). The basal species groups of Rasbora (the Daniconius group and the Einthovenii group) and the outgroups lack this postcleithral pigmentation: (state 0).

249. Basicaudal triangular patch: (0) absent; (1) present (ci = 1.00; ri = 1.00).

In the species of the Sumatrana group, the melanophores on the base of the caudal fin form a diamond-shaped or triangular pattern of pigmentation which can be divided into two sub-elements due to their somewhat distinguishable boundaries and shapes: the basicaudal triangular patch and the basicaudal spot. The presence of a basicaudal triangular patch is unique to the Sumatrana group and varies among species in terms of shape and intensity (state 1). This type of pigmentation on the base of the caudal fin is absent in the other species of Rasbora and all the outgroup taxa (state 0).

250. Basicaudal spot: (0) absent; (1) present (ci =0.06; ri 0.62).

Pigmentation on the base of the caudal fin is widespread in cypriniforms, and indeed across ostariophysan fishes. Basicaudal pigmentation varies in shape and size and usually occurs on the outer surface of the hypural region of the caudal peduncle. In

259

Rasbora, some species have the black basicaudal spot (state 1). The spot is absent in

Chanos chanos (state 0).

251. Ventral black pigment between pelvic fins and surrounding vent (Conway, 2005:

character 28): (0) absent; (1) present (ci = 1.00; ri = 1.00).

The area between the pelvic fin and the surrounding vent in some miniaturized rasborin taxa (Boraras, Horadandia, Kottelatia, Rasboroides, Trigonopoma, and R. kalbarensis) bears numerous melanophores (state 1). Such a pigmentation pattern is absent in the other rasborin taxa and all the outgroups (state 0).

252. Subpeduncular streak (modified from Conway, 2005: character 26; Liao et al.,

2010: character 3): (0) absent; (1) present (ci = 0.50; ri = 0.96).

In the more terminal groups of Rasbora, the ventral portion of the caudal peduncle is typically streaked by melanophores, thereby forming a pigmentation pattern termed the subpeduncular streak. The basal rasborin group, the Daniconius group, lacks a subpeduncular streak (state 0); a condition also found in all non-rasborin outgroups.

253. Extension of subpeduncular streak (modified from Liao et al., 2010: character

3): (0) running along base of caudal peduncle and continuing along flank above

fin; (1) terminating posterior to base of anal fin; (2) anteriorly extending to reach

region above pelvic fin (ci = 0.67; ri = 0.89).

The subpeduncular streak (character 252) in most rasborins extends anteriorly along the flank above the anal fin (state 0). Some other rasborins (Amblypharyngodon and the

Argyrotaenia group) have a subpeduncular streak that terminates at the area posterior to the anal-fin base (state 1). In some species (Rasbora borneensis, R. cephalotaenia, and R.

260 tornieri), the streak extends further anteriorly to reach the ventrolateral portion of body above the pelvic fin, thereby appearing as a ventrolateral streak (state 2). Some rasborins

(the Daniconius group and Rasbora tubbi) and all non-rasborin outgroups lack such a streak, and therefore are coded as inapplicable.

254. Supraanal pigmentation (Conway, 2005: character 27): (0) absent; (1) present

(ci = 0.33; ri = 0.93).

The terminal groups of Rasbora commonly have a pigmented supraanal region characterized by melanophores along the base of the anal fin, which is termed the supraanal pigmentation (state 1). In contrast, the basal group of Rasbora (the Daniconius group) lacks such pigmentation (state 0); a condition also found in all outgroups.

255. Form of supraanal pigmentation: (0) irregular swath of melanophores; (1)

stripe; (2) ovoid; (3) blotch; (4) thin line; (5) rudimentary (ci = 0.42; ri = 0.71).

Shape of the supraanal pigmentation (character 254) varies interspecifically. In the

Sumatrana group, the pigmentation shows the highest variation among groups of Rasbora, within which four conditions are identified: (1) stripe, (2) ovoid, (3) blotch, and (5) rudimentary. In the Einthovenii group, the pigmentation takes the form of an irregular swath of melanophores above the anal fin (state 0). Stripe supraanal pigmentation (state 1) is also present in Brevibora, Trigonostigma, the Reticulata group, and some species of the

Trifasciata group. In some other species of the Trifasciata group (Rasbora bankanensis, R. ennealepis, and R. paucisqualis), the supraanal pigmentation has the form of a thin line

(state 4). The character is coded as inapplicable for the remaining species of Rasbora and all the outgroups, which lack this form of anal pigmentation.

261

256. Caudal-fin pigmentation (modified from Liao et al., 2010: character 4): (0)

hyaline; (1) medial portion with black longitudinal stripe; (2) caudal-fin margin

black; (3) caudal-fin margin and terminal half of caudal lobes black; (4)

subterminal crossed black stripes on caudal lobes (ci = 0.57; ri = 0.62).

In Rasbora, the caudal fin is pigmented by melanophores in different arrangements across taxa. The species of the Einthovenii group and Rasbora cephalotaenia have a caudal fin in which the medial portion is longitudinally pigmented to form a black longitudinal stripe (state 1). Some species in the Argyrotaenia group (R. aurotaenia, R. dusonensis, R. myersi, and R. tornieri) have a caudal fin with a posterior margin pigmented black (state 2).

Some species of the Sumatrana group (R. rasbora and Rasbora sp. 6) have a caudal fin with each terminal half of the caudal lobes appears black (state 3). Other species of the

Sumatrana group (R. caudimaculata, R. subtilis, and R. trilineata) have a caudal fin with subterminal crossed black stripes on the caudal lobes (state 4). Other ingroup taxa and all the outgroups have a hyaline caudal fin (state 0).

257. Pigmentation on anterior portion of dorsal fin: (0) absent; (1) present (ci = 0.13;

ri = 0.53).

The dorsal fin of some species of Rasbora may exhibit a trace of melanophores along its anterior margin, with the melanophores distally concentrated and proximally dissipated. This pigmentation pattern, which overall appears as a subdistal black lunate swath along the anterodorsal margin of the dorsal fin, is present (state 1) in the Einthovenii group. The pigmentation is absent in all other rasborin taxa and outgroups (state 0).

262

258. Red pigmentation on dorsal fin in live fish: (0) absent; (1) present (ci = 0.11; ri =

0.47).

Some species of Rasbora display red pigmentation on the dorsal fin in life (state 1)

[Boraras spp., Rasboroides vaterifloris, Trigonostigma spp., R. api, R. lacrimula, R. rubrodorsalis, R. sarawakensis, and R. vulcanus]. As far as known, this coloration is absent in the rest of the rasborin species and outgroupsexcept Leptobarbus, Osteochilus, Systomus, and Sundadanio (state 0).

259. Pigmentation on anterior portion of anal fin: (0) absent; (1) present (ci = 0.17; ri

= 0.71).

Similar to character 257, the anal fin of some rasborin taxa (Boraras,

Trigonostigma, the Einthovenii group, some of the Trifasciata group (Rasbora bankanensis, R. ennealepis, R. paucisqualis, R. sarawakensis) bears a subdistal black lunate pigmentation along the anterodorsal margin of the fin (state 1). The remaining rasborin taxa and all outgroups lack this pigmentation (state 0).

260. Red caudal-fin base in live fish (Liao et al., 2010: character 5): (0) absent; (1)

present (ci = 0.08; ri = 0.50).

The base of the caudal fin in some live Rasbora may display red coloration (state

1). A red caudal fin is present in Boraras, Horadandia, Trigonostigma, the Einthovenii group, Rasbora api, R. borapetensis, R. dandia, R. lacrimula, R. rubrodorsalis, R. sarawakensis, R. tobana, R. wilpitta, and R. vulcanus. Comparable live color pigmentation of the caudal fin is absent in the remaining species of Rasbora and other outgroups (state

0).

263

OTHER EXTERNAL MORPHOLOGY (FIGURES 3.25–3.27)

261. Position of mouth: (0) terminal; (1) superior; (2) inferior (ci = 0.40; ri = 0.84).

In cyprinids, the relative position between the upper and lower jaw varies among taxa. A superior mouth is typical of danionines, in which the anterior tip of the upper jaw is situated more posterior than the anterior tip of the lower jaw (state 1; Figure 3.25.B, C, D).

A superior mouth is found in all species groups of Rasbora except for the Trifasciata group. Species in that group have a mouth with an anterior tip of the upper jaw that dorsally covers the anterior tip of the dentary, resulting in the more posterior lower jaw with its anterior portion partially invisible in lateral view (terminal mouth; state 0; Figure 3.25.A).

In most benthic cypriniform species, the upper jaw dorsally covers the entire lower jaw, which is also usually situated somewhat horizontally in parallel with the ventral surface of the body, resulting in the lower jaw being invisible in lateral view (inferior mouth; state 2).

The condition of state 0 is also found in the most basal outgroup in this study, Chanos chanos.

262. Exposed portion of upper lip: (0) whole anterolateral region of upper lip covered

by maxilla; (1) whole upper lip situated ventrally in parallel with lower lip; (2)

central portion covered by maxilla; (3) whole upper lip exposed; (4) just small

section of anterior tip of upper lip exposed; (5) middle part covered by lower

jaw; (6) midway to posterior portion covered by maxilla (ci = 0.38; ri = 0..83).

The degree of lateral coverage of the upper lip in Rasbora is highly variable (Figure

3.25). The basal group, the Daniconius group, and Rasbora tubbi have an upper lip that is

264 predominantly covered laterally by the maxilla resulting in the exposure of only a small section of the anterior tip of the upper lip (state 4). In contrast, the Einthovenii group and R. cephalotaenia have an upper lip with its middle portion covered by the dorsolateral margin of the dentary; an arrangement that consequently exposes both the anterior and posterior portions of the lip, but not the middle region (state 5; Figure 3.25.B). In the diminutive groups and the Reticulata group, the upper lip is entirely exposed (state 3; Figures 2.9;

3.25.C). In contrast, in three large-sized Sundaland Rasbora (R. argyrotaenia, R. borneensis and R. tornieri), the posterior half of the upper lip is covered by maxilla (state 6;

Figure 3.25.D). The Trifasciata group has an upper lip with its anterolateral region entirely covered by the maxilla (state 0; Figure 3.25.A), which is also present in the basal outgroups, Chanos chanos and Xenocharax spilurus. In the Sumatrana group and the remaining species of the Argyrotaenia group, the middle portion covered by the maxilla

(state 2; Figure 2.14). In the benthic cypriniform outgroups (cyprinines and loaches), the entire upper lip situated ventrally in parallel with the lower lip (state 1).

263. Symphysial knob on lower jaw (modified from Conway, 2005: character 25;

Liao et al., 2010: character 20): (0) absent; (1) present (ci = 0.20; ri = 0.77).

In some cyprinids, a relatively small, pointed, knob-like protrusion is present on the anteromedial symphysis of the paired dentary bones, which is commonly known as the symphysial knob (state 1; Brittan, 1954; Conway, 2005; Liao et al., 2010; Figure 3.26: sk).

This bony process is typically present in the subfamilies Cultrinae and Danioninae. It is absent in some rasborins such as Boraras, Kottelatia, and Rasbora kalbarensis. In all outgroups, except for cultrins and danionins, the symphysial knob is absent (state 0).

265

264. Symphysial indentation on upper jaw in anterior view: (0) absent or invisible;

(1) present and visible (ci = 0.20; ri = 0.77).

Cultrins and danionins have the anteromedial symphysis of the paired maxillae typically strongly indented to accommodate the corresponding symphysial knob of the lower jaw (character 265). The indentation is typically visible in anterior view in some cultrins and danionins (state 1). However, some rasborin groups (Boraras, Kottelatia, the species of the Trifasciata group, and R. kalbarensis), have such an indentation, even though it may be weak or invisible in anterior view (state 0). The absence of this indentation is also scored as state 0; a condition found in all non-cultrine and non- danionine outgroups.

265. Epithelial modification on lower lip: (0) absent; (1) present (ci = 0.50; ri = 0.97).

Modification of the integument is marked along the dorsomedial surface of the lower lip in some Rasbora species (Figure 3.26: LL). The individual element of the topographical modification is somewhat uniform and continuously repetitive along a particular area of the pertinent surface, which consequently exhibits an overall labial pattern. In all members of Rasbora the labial epithelial modification is present (state 1).

This epithelial character is absent in all outgroup taxa (state 0).

266. Form of epithelial modification along lower lip: (0) all weakly crenated and

granulated with hook-shaped unculi; (1) not crenated; granulated with hook-

shaped unculi; (2) not crenated; granulated with low polygonal unculi; (3)

strongly crenated entirely; granulated with low polygonal unculi; (4) strongly

crenated only on symphyseal knob; granulated with low polygonal unculi (ci =

1.00; ri = 1.00).

266

The modified epithelial topography (character 265) varies in terms of its form, area of coverage, and intensity among species groups of Rasbora. In the basal Daniconius group and Rasbora tubbi, the inner surface of the lower lip is weakly crenated across its entire expanse and granulated with hook-shaped unculi (state 0). In contrast, the lower lip in the

Einthovenii group is granulated with more protruded hook-shaped unculi, but without crenation (state 1). Some other groups (Brevibora, Horadandia, Kottelatia, Rasboroides,

Trigonopoma, Trigonostigma, the Argyrotaenia group, the Trifasciata group, the Reticulata group, and Rasbora kalbarensis) have a lower lip that is granulated with low polygonal unculi and relatively smooth without crenation (state 2; Figure 3.27: C). Whereas, in three large-sized species, R. borneensis, R. cephalotaenia, and R. tornieri, the lower lip is entirely strongly crenated and granulated with low polygonal unculi (state 3; Figure 3.27:

A). Despite the presence of similar type of unculi (low and polygonal) in the Sumatrana group, such a strongly-indented crenation is limited only on the dorsal surface of the symphyseal knob (state 4; Figure 3.27: B).

267. Velum sensu Yashpal et al. (2009) on inner portion of lower jaw: (0) absent; (1)

present (ci = 0.50; ri = 0.94).

The anterior portion of the floor of the the oral cavity in some cyprinids may bear an overhanging integumentary layer or a labial flap, also known as “velum” (Yashpal et al.

2009) or the “semilunar valve” (Abbate et al. 2006; Stiassny and Getahun, 2007). Despite the presence of the velum on the upper jaw, many cyprinids lack this labial flap on their lower jaw (state 0). In stark contrast, all danionines examined including all Rasbora species, have a velum on their lower jaw (state 1; Figure 3.26: Ve) in addition to the one on their upper jaw. The immediate outgroups, Amblypharyngodon and Pectenocypris, and the

267 non-cypriniform outgroups, Chanos chanos and Xenocharax spilurus, lack a velum (state

0).

268. Epithelial modification on velum: (0) lumps; (1) nodules; (2) tooth-like papillae;

(3) irregular clefts (ci = 1.00; ri = 1.00).

Modification of the integumentary topography is marked along the mediodorsal surface of the lower lip in the species of the supragenus Rasbora. The topographical modification is somewhat repetitive and regular. The velum in basal groups of Rasbora

(Boraras, Horadandia, Kottelatia, Rasboroides, Trigonopoma, the Daniconius group, the

Einthovenii group, the Reticulata group, R. kalbarensis, and R. tubbi) bears a weakly- developed protuberance or lumps (state 0). Whereas, in members of the Argyrotaenia group and Rasbora cephalotaenia, the epithelial modification along the velum takes form of distinct rounded protuberance, herein termed a nodule (state 1). In some more terminal groups (Brevibora, Trigonostigma, and the Trifasciata group), the velum develops a distinctly pointed protuberance or tooth-like papillae (state 2). In contrast, the Sumatrana group bears a velum with a series of irregular clefts (state 3).

269. Palatal plicae on dorsomedial surface of lower jaw: (0) absent; (1) present (ci =

1.00; ri = 1.00).

In cyprinid fishes, the dorsomedial surface of the lower palate typically appears rugose or wrinkled owing to the presence of a series of transversal semilunar ridges or

“plicae” (state 1; Figure 3.26: Pl). The lower palate of Chanos chanos, Xenocharax spilurus, Gyrinocheilus aymonieri, Catostomus commersoni, and Homaloptera gymnogaster lacks the palatal plicae (state 0).

268

270. Form of epithelial modification along palatal plicae on surface of lower jaw: (0)

smooth; (1) papilla; (2) small nodule; (3) large nodule; (4) bulging (ci = 0.80; ri =

0.98).

The palatal plicae on the lower jaw (character 269; Figure 3.26: Pl) of cyprinids typically bear ample protuberances along the dorsal surface, which may vary in shape among taxa, especially among rasborin species groups. In the Reticulata and Sumatrana groups, the palatal plicae superficially appear rather smooth; SEM magnification reveals slight epithelial swelling or bulges (state 4; Figure 3.27.B). Some groups of Rasbora (the

Argyrotaenia group, the Trifasciata group, and R. cephalotaenia) have palatal plicae that dorsally develop large rounded knob-like epithelial protrusions termed here large nodules

(state 3; Figure 3.27.A and C). In the cyprinine outgroups, the palatal plicae dorsally form relatively long epithelial protrusions, termed here papillae (state 1).

271. Depth of caudal peduncle: (0) relatively deep; (1) relatively shallow (ci = 1.00; ri

= 1.00).

The depth of the caudal peduncle varies in rasborins. The caudal peduncle in most cyprinids, including Rasbora is relatively deep (state 0), a condition also found in all the outgroups. Boraras, Kottelatia, Trigonopoma, and R. kalbarensis have a relatively shallow caudal peduncle (state 1).

272. Depth of basicaudal triangular patch: (0) shallow; (1) moderate; (2) high (ci =

0.50; ri = 0.71)

In the Sumatrana group, the basicaudal triangular patch (character 249) varies in shape. In some species (Rasbora baliensis, R. caudimaculata, R. rasbora, R. subtilis, R.

269 trilineata, and Rasbora n. sp. 4), the triangular patch is relatively shallow in depth and comparable to the depth of the more anterior black midlateral stripe resulting in an indistinct overall appearance (state 0). Some other species (Rasbora aprotaenia, R. lateristriata, R. spilotaenia, R. tawarensis, Rasbora n. sp. 1, Rasbora n. sp. 2, and Rasbora n. sp. 3) have a triangular patch that of relatively moderate height (state 1; Figures 2.16: A–

D; 2.17: A–C; 2.18: A, B, D). In contrast, two species (R. elegans [Figure 2.19: A, B] and

R. paviana [Figure 2.18: C]) have such a patch with a relatively greater height (state 2).

Owing to the absence of the triangular patch in other rasborin groups and all outgroup taxa

(character 249), this character is inapplicable.

273. Size of basicaudal blotch: (0) larger than pupil of eye; (1) more or less same size

as pupil of eye; (2) smaller than pupil of eye (ci = 0.12; ri = 0.21)

The size of the basicaudal spot in rasborin fishes varies in size. In some species, the basicaudal spot is larger than the pupil of the eye (state 0; Figures 2.18: C; 2.19: A–C). This character state (0) is also present in some outgroup taxa, including the non-cypriniform basal characiform, Xenocharax spilurus. Some other rasborin species and outgroup taxa have a basicaudal spot that is more or less in the same size as the pupil (state 1; Figures

2.16: A–D; 2.17: A–C; 2.18: A, B, D). In some other species, the spot is smaller than the pupil (state 2). This character is inapplicable to some rasborins and outgroups that lack a basicaudal spot.

274. Form of basicaudal spot: (0) vertically elongated, ellipsoidal; (1) circular; (2)

biconvex; (3) horizontally ellipsoidal; (4) squarish; (5) diamond-shaped; (6)

somewhat rectangular (ci = 0.38; ri = 0.58)

270

In cypriniforms, especially rasborins, the basicaudal spot varies in shape. Two basal outgroup, Xenocharax spilurus (characiform) and Gyrinocheilus aymonieri (gyrinocheilid), have a vertically elongated ellipsoidal basicaudal spot (state 0). In some cypriniform taxa, including some rasborins, the basicaudal spot is circular (state 1). In some species of the

Sumatrana group, the basicaudal spot is biconvex (state 2; e.g., the Rasbora hosii-subgroup in Figure 2.16), whereas such a spot in a few other species of the same group appears as diamond-shaped (state 5; e.g., Rasbora paviana in Figure 2.18: C). In some rasborins (e.g.,

Rasbora lacrimula, R. trifasciata, R. baliensis, and R. rasbora), the spot is ellipsoidal and horizontally elongated (state 3). Two species of the Trifasciata group (R. rutteni and R. sarawakensis) have such a squarish spot (state 4). In two danionin outgroups (Malayochela maasi and Nematabramis steindachneri), the spot is somewhat rectangular in shape (state

6). This character is inapplicable to some rasborins and outgroups lacking a basicaudal spot.

RESULTS

Phylogenetic hypotheses

Phylogenetic analysis of the morphological dataset containing 274 characters coded from 97 taxa (27 outgroups; 70 ingroups) resulted in 3,411 most parsimonious trees (each

1,111 steps long; consistency index, CI = 0.42; retention index, RI= 0.88; rescaled consistency index, RC = 0.37). The bootstrap 50% majority-rule consensus tree is shown in

Figure 3.28. The interrelationships in the supragenus Rasbora based on morphology is shown in Figure 3.29.

271

DISCUSSION

Monophyly of higher taxa within the family Cyprinidae

In the phylogenetic analysis, three cyprinid taxa primarily targeted in this study were recovered as monophyletic groups: (1) the subfamily Danioninae; (2) the tribe

Rasborini; and (3) the supragenus Rasbora; each of these is recovered with a high nodal support (bootstrap value), and is supported by a unique set of unambiguous synapomorphies, some of which are described herein for the first time. Moreover, the monophyly of several major cyprinid taxa, such as the tribes Chedrini and Danionini as well as the clade comprising Danionini and Rasborini, was likewise recovered with support of a series of synapomorphies as below.

THE SUBFAMILY DANIONINAE.---The monophyly of the subfamily Danioninae is supported by a high bootstrap value (100%). This subfamily is defined by five unambiguous synapomorphies, which are: (1) the anteroventral edge of the frontal overlapping the posterodorsal edge of the supraethmoid region (character 26; state 1;

Figure 3.2.E: acV); (2) the presence of the prootic pad on the ventromedial area of the prootic (character 57; state 1; Figures 3.5–7: pPrO); (3) the presence of the ligament connecting anteromedial first epibranchial with the hyomandibula (character 129; state 1);

(4) the ventral tip of the cartilaginous fifth epibranchial articulating with the posteroventral cartilaginopus margin of the fourth epibranchial (character 140; state 1; Figure 3.16.B-D); and (5) the presence of the ligament connecting the medial region of the exoccipital with the anterodorsal portion of the cleithrum (character 183; state 1). The last four

272 synapomorphies are discovered for the first time in this study. In addition, given the presence of these two danionine synapomorphies in Sundadanio, this enigmatic-yet- problematic genus is herein classified in the subfamily Danioninae, in contrast to the conflicting and poorly-resolved topologies of the molecular trees of the previous studies

(Rüber et al., 2007; Mayden and Chen, 2010; Tang et al., 2010).

THE TRIBE RASBORINI.---The monophyly of the tribe Rasborini is strongly supported by a relatively high bootstrap value (83%) and also by two unambiguous synapomorphies:

(1) the presence of the rasborin process sensu Liao et al. (2010) on the fourth epibranchial

(character 136; state 1; Figure 3.15: pr); and (2) the presence of a cleithral-exoccipital ligament (character 185; state 1).

THE TRIBE DANIONINI.---The monophyly of the tribe Danionini is strongly supported by a high bootstrap value (99%) and also by five synapomorphies: (1) a moderately long ethmoid process of the palatine (character 106; state 2); (2) the lachrymal process of the palatine situated posteroventral to ethmoid process (character 107; state 1); (3) the cartilaginous interhyal (character 157; state 1); (4) a relatively small anterior fenestra of the horizontal limb of the pectoral girdle (character 181; state 0); and (5) the medial aponeurosis of the A1 division of adductor mandibulae attaches to the dorsal tip of the palatine process of the maxilla (character 227; state 0).

THE TRIBE CHEDRINI.---The monophyly of the tribe Chedrini is strongly supported by a relatively high bootstrap value (83 %) and two synapomorphies: (1) a relatively large

273 ventromedial fenestra of the lateral ethmoid and the orbitosphenoid (character 40; state 2); and (2) a relatively deep interorbital septum (character 42; state 2).

THE CLADE DANIONINI+RASBORINI.---The tribes Danionini and Rasborini are resolved herein to form a larger clade, which is the sister taxon of the tribe Chedrini. The clade Danionini+Rasborini is strongly supported by a high bootstrap value (100%) and is defined by two unambiguous synapomorphies: (1) a straight ribbon-like ligament between the kinethmoid and the mesethmoid (character 80; state 1); and (2) an axial streak

(character 237; state 1).

Monophyly of the supragenus Rasbora

Monophyly of the supragenus Rasbora was resolved in the phylogenetic analysis of this study as demonstrated on the consensus tree of all the most parsimonious trees (Figure

3.28), supported by five unambiguous, novel synapomorphies: (1) a relatively straight lateral process of the second vertebra with its distal end slightly pointing posteriorly

(character 162; state 1); (2) a long posterior-most epineural extending as far as the halfway of the hypural plate (character 212); (3) a long posterior-most epipleural extending as far as the halfway of the hypural plate (character 213); (4) a medial aponeurosis of the A1 division of adductor mandibulae attaching along the mid-dorsal portion of maxilla

(character 227; Figure 3.22.D; 3.23.A–D: apo); and (5) an epithelial modification on the lower lip (character 265; Figure 3.26: LL). In addition, the supragenus Rasbora is also supported by one reversed synapomorphy: the absence of the dentary projection (vs present in other danionine taxa; character 96).

274

Systematic accounts of the supragenus Rasbora

The classification based on the phylogenetic hypotheses of this study recognizes 12 major monophyletic groups, which correspond to some of the classification recognized by the previous authors in part (Brittan, 1954; Kottelat and Vidthayanon, 1993; Liao et al.,

2010). The relationships among the 12 major groups of Rasbora are shown in the cladogram in Figure 3.29.

THE CLADE HORADANDIA+RASBOROIDES.---Two diminutive Indian species of

Rasbora, Horadandia atukorali and Rasboroides vaterifloris, were recovered to form a monophyletic group. This clade is supported by one unambiguous synapomorphy first described by Liao et al. (2010): the presence of an L-shaped supracleithrum in ventral view (character 174; state 1).

THE DANICONIUS GROUP.---In the present morphological study, the relatively-large- sized and fully-striped Indian species in the supragenus Rasbora were recovered in a monophyletic group, composed of four Indian species (R. armitagei, R. dandia, R. daniconius, and R. wilpita) and one Sundaland species (R. tubbi). In previous studies, R. tubbi had been traditionally classified in the Einthovenii group (Brittan, 1954; Kottelat and Vidthayanon, 1994). Three synapomorphies define the clade of the Daniconius group: (1) a relatively high palatine process of the maxilla (character 86; state 0); (2) a trapezoidal maxillary palatine process with a strongly-hooked anterior tip (character 87; state 2); and (3) the indentation along the medial axis of the ventral lamina of the urohyal.

275

THE EINTHOVENII GROUP.---A clade of the relatively-stout and fully-striped

Sundaland species of Rasbora were recovered, composed of R. einthovenii, R. jacobsoni,

R. kalochroma, and R. kottelati. It is noteworthy that all species in this basal group live in the highly-acidic blackwater habitat throughout the lowland of Sundaland. The monophyly of the Einthovenii group is supported by two synapomorphies: (1) a triangular palatine process of the maxilla with a blunt obtuse dorsal tip (character 87; state 4); and (2) a granulated form of the epithelial modification with hook-shaped unculi

(character 266; state 1).

THE GENUS KOTTELATIA.---Recently described as a monotypic genus by Liao et al.

(2010), Kottelatia was diagnosed by three characters, two of which are recovered as the synapomorphies for this genus in this study: (1) a long slender palatine process of the maxilla with a narrow base (character 87; state 5); and (2) a relatively large coronoid process of the dentary, which abuts the anterodorsal margin of the anguloarticular

(character 101; state 2). Nevertheless, based on this study, the third diagnostic character described by Liao et al. (2010), a remarkably slender anterior portion of the dentary, is shared with the two immediate outgroups (Amblypharyngodon and Pectenocypris).

Moreover, the character coding in this study confirmed that all the diagnostic characters for the genus Kottelatia are present in Rasbora kalbarensis, a miniaturized species previously unsampled by Liao et al. (2009). Consequently, in the resulting phylogeny, R. kalbarensis was recovered as the sister taxon of Kottelatia brittani. This placement necessitates the addition of R. kalbarensis into the genus Kottelatia.

276

THE GENUS TRIGONOPOMA.---The genus Trigonopoma was described by Liao et al.

(2010) comprising two species (T. agile and T. pauciperforatum) is supported by one synapomorphy in the present morphological analysis: the presence of a posterodorsal process on the dorsal margin of the opercle (character 117; state 2).

THE GENUS BORARAS.---The monophyly of the genus Boraras has been resolved in the previous study by Conway (2005), which is supported by four synapomorphies: (1) the absence of a supraorbital canal on the frontal [character 6 of Conway (2005)]; (2) a pointed posterior tip of the urohyal [character 11 of Conway (2005); character 152 in this study (state 2)]; (3) a ventral elongation of the fourth pleural rib [character 16 of Conway

(2005); character 168 in this study (state 1)]; and (4) a more dorsal attachment of the postcleithrum to the cleithrum [character 17 of Conway (2005); character 173 in this study (state 1)].

THE ARGYROTAENIA GROUP.---The Argyrotaenia group was recovered as a monophyletic group that contains large-sized Sundaland species of Rasbora: R. argyrotaenia, R. aurotaenia, R. borneensis, R. dusonensis, R. laticlavia, R. myersi, R. tornieri, and the type species of Rasbora, R. cephalotaenia. The monophyly of this clade is supported by one unambiguous synapomorphy, which is the coracoid bears a distinct ridge along its lateral margin, termed the lateral coracoid ridge (character 190; state 1).

Contrary to the previous study by Liao et al. (2010), in which the type species of

Rasbora, R. cephalotaenia, was embedded in the Einthovenii group, this study recovered the species to be embedded in the Argyrotaenia group for the first time. Accordingly,

277 based on morphology, the Argyrotaenia group constitutes the genus Rasbora sensu stricto.

THE TRIFASCIATA GROUP.---The resulting topology recovered a clade that comprises some species previously classified in the former Trifasciata group (Brittan, 1954; Kottelat and Vidthayanon, 1993; Tan, 1999; Lumbantobing, 2010): Rasbora bankanensis, R. ennealepis, R. hubbsi, R. johannae, R. lacrimula, R. paucisqualis, R. rutteni R. sarawakensis, and R. trifasciata. Additionally, three undescribed rasborin species

(Rasbora n. sp. 8, Rasbora n. sp. 9, and Rasbora n. sp. 10) are also embedded in this clade, therefore adding up to a total of 12 species recovered in the Trifasciata group. The monophyly of the Trifasciata group is supported by three synapomorphies: (1) a relatively small carotid foramen (character 53; state 2); (2) a masticatory plate with a three-pointed-crown-like profile in ventral view (character 67; state 8); and (3) a second pharyngobranchial with the anterior portion horizontally paralleling the third pharyngobranchial (character 143; state 1).

THE GENUS BREVIBORA.---Brevibora is another monotypic genus recently described by Liao et al. (2010), and diagnosed by the following characters: a narrow rectangular palatine process with no projection, a black blotch in the middle of dorsal fin, and fewer predorsal vertebrae. Two species are currently valid in this genus, B. dorsiocellata and B. cheeya, of which only B. dorsiocellata was sampled in the present study.

THE GENUS TRIGONOSTIGMA.---Based on the analysis of this study, the genus

Trigonostigma evidently exhibits one unreversed synapomorphy as previously recovered

278 in Conway (2005; character 12): the lateral edges on the ventral flanges of the urohyal appearing boatshaped in cross section (character 153 of this study; state 1).

THE RETICULATA GROUP.---In this study, a clade comprising a number of moderately-sized rasborins is recovered and recognized as a new group of the supragenus

Rasbora: the Reticulata group. The species of this new group had been previously classified in the Trifasciata group sensu Brittan (1954). The Reticulata group is defined by two synapomorphies: (1) the lateral canal on the autopterotic with its posterior portion being horizontally parallel with the exterior semicircular canal (character 39; state 1); and

(2) a second ceratobranchial with an anterior portion bearing a short shaft with a concave medial margin (character 125: state 3). This monophyletic group is composed of R. api,

R. kluetensis, R. nodulosa, R. tobana, R. truncata, R. vulcanus, and Rasbora n. sp. 10.

THE SUMATRANA GROUP.---The monophyly of the Sumatrana group is supported by three unambiguous synapomorphies: (1) an indented anteromedial margin of the supraorbital (character 75; state 1); (2) a lower lip with a partially strongly crenated epithelial modification on the symphyseal knob (character 26; state 4; Figure 2.37: B); and (3) a basicaudal triangular patch (character 249; state 1). The Sumatrana group constitutes the most species-rich lineage of Rasbora, which herein comprises 17 examined species: R. aprotaenia, R. baliensis, R. caudimaculata, R. elegans, R. hosii, R. lateristriata, R. paviana, R. rasbora, R. spilotaenia, R. subtilis, R. tawarensis, R. trilineata, Rasbora n. sp. 1, Rasbora n. sp 2, Rasbora n. sp 3, Rasbora n. sp 4, and

Rasbora n. sp. 9. Three of the constituent species, R. caudimaculata, R. trilineata, and R. subtilis, had been formerly classified in a separate species group, the Caudimaculata

279 group. In fact, these three species were recovered to form a more exclusive clade branching from the basal node of the Sumatrana group as defined by two unambiguous synapomorphies. Regardless, the three species formerly recognized in the Caudimaculata group are tentatively classified herein as the members of the Sumatrana group because all the former constituent species of the Sumatrana group share the first three synapomorphies with these three species. At present, identifying the Caudimaculata group as a separate species group will cause the Sumatrana group to lack any defining unambiguous synapomorphies.

280

Figure 3.1. Dorsal view of schematized dorsal surface of neurocranium. (A) Rasbora tubbi,

ZRC 42685, 33.4 mm SL; (B) Rasbora paviana, UF 170284, 30.4 mm SL. Institutional abbreviation are defined in Table 3.1. 5IO = 5th Infraorbital; Apt = Autopterotic; EB =

Ethmoid Bloc (Supraethmoid); Fr = Frontal; InOSp = Inter-orbitosphenoidal Distance;

InPE = Interpre-ethmoidal Distance; InSE = Intersupraethmoidal Distance; LC = Lateral

Canal; LE = Lateral Ethmoid; Ns = Nasal; OpLCF = Opening of Lateral Canal of Frontal;

Pa = Parietal; and SO = Supraorbital. Each bar equals 1 mm.

281

282

Figure 3.2. Dorsal view of anteromedial portion of neurocranium showing upper jaw and ethmoid block. (A and B) Osteochilus spilurus, USNM uncataloged, 33.5 mm SL; (C and

D) Rasbora argyrotaenia, BMNH 1999.6.14.32–66, female, 59.5 mm SL; (E and F)

Rasbora sarawakensis, ZRC 39844, female, 33.8 mm SL. aCV = Anterior Cranial Vault; aMCV = Anterior Margin of Cranial Vault; aMF = Anterior Margin of Frontal; aRM =

Anteromedial Ramus of Maxilla; De = Dentary; EC = Ethmoid block (darker posterior area on B and D; yellowish area on F); EP = Anteromedial Process of Ethmoid block

(Supraethmoid); FEV = Anterior Foramen between Ethmoid block and Vomer; Fr =

Frontal; KE = Kinethmoid; LKV = Ligament of Kinethmoid-Vomer; Mx = Maxilla; Pa =

Palatine; Na = Nasal; PE = Pre-ethmoid; PM = Premaxilla; pRM = Posteromedial Ramus of Maxilla; Vo = Vomer; VoP = Anteromedial Process of Vomer; VoR = Anterodorsal

Ridge of Vomer. Yellow arrows (on F) point at lateral process of kinethmoid. Each bar equals 1 mm.

283

284

Figure 3.3. Anterior view of anterior portion of neurocranium showing ethmoid block and its adjacent bones. (A) Rasbora daniconius, USNM 390738, female, 48.5 mm SL; (B)

Rasbora cf. tornieri, USNM uncataloged, 64.7 mm SL. EC = Ethmoid block (shaded orange); FEV = Anterior Foramen between Ethmoid block and Vomer; LE = Lateral

Ethmoid; PE = Pre-ethmoid (shaded blue); vmLE = Ventromedial edge of Lateral Ethmoid;

Vo = Vomer (shaded green); Each bar equals 1 mm.

285

286

Figure 3.4. Ventral view of neurocranium. (A) Rasbora kottelati, USNM 328137, female,

52.9 mm SL; (B) Rasbora cephalotaenia, USNM 329327, female, 55.3 mm SL. APt =

Autopterotic; BOc = Basioccipital; cf = Carotid Foramen; df = Dilatator Fossa; EC =

Ethmoid block; EOc = Exoccipital; Fr = Frontal; LE = Lateral Ethmoid; MP = Masticatory

Plate; mpP = Medial Process of Prootic; Na = Nasal; OrS = Orbitosphenoid; opf = optic foramen: PaS = Parasphenoid; PE = Pre-ethmoid; pBOc = Basioccipital Process; pLE =

Lateral Ethmoid Process; PrO = Prootic; PtS = Pterosphenoid; SO = Supraorbital; stf =

Subtemporal Fossa; SpO = Sphenotic; v-viia = anterior opening of trigeminal-facial chamber; v-viip = posterior opening of trigeminal-facial chamber; Vo = Vomer; Each bar equals 1 mm.

287

288

Figure 3.5. Ventral view of anterolateral portion of prootic region in Rasbora cf. tornieri,

USNM uncataloged, 64.7 mm SL. APt = Autopterotic (shaded cyan green); bP = Bulla

Prootica; cf = Carotid Foramen; df = Dilatator Fossa; EOc = Exoccipital (shaded blue); fHm = Hyomandibula Fossa; Fr = Frontal (shaded purple); iPrO = Prootic Indentation; lC = lateral commisure; mpP = Medial Process of Prootic; OS = Orbitosphenoid (shaded yellow ochre); opf = optic foramen: PaS = Parasphenoid (shaded light green); pPrO = Prootic Pad;

PrO = Prootic (shaded red); PtS = Pterosphenoid (shaded dark green); stf = Subtemporal

Fossa; SpO = Sphenotic (shaded orange); v-viia = anterior opening of trigeminal-facial chamber; v-viip = posterior opening of trigeminal-facial chamber; x = foramen for vagus nerve.

289

290

Figure 3.6. Lateral view of inverted neurocranium (ventral side facing up). (A)

Amblypharyngodon mola, USNM 344648, 56.8 mm SL; (B) Pectenocypris micromysticetus, ZRC 51758, 32.5 mm SL; (C) Rasbora cf. tornieri, USNM uncataloged,

64.7 mm SL. apBOc = Anterior Process of Basioccipital Process; APt = Autopterotic; BOc

= Basioccipital; bP = Bulla Prootica; cf = carotid foramen; df = Dilatator Fossa; EOc =

Exoccipital; Fr = Frontal; kPaS = Parasphenoid Keel; mp = Masticatory Plate; OrS =

Orbitosphenoid; opf = optic foramen; Pa = Parietal; PaS = Parasphenoid; PE = Pre- ethmoid; pBOc = Basioccipital Process; pLE = Lateral Ethmoid Process; pPaS = Posterior

Portion of Parasphenoid; pPrO = Prootic Pad; PrO = Prootic; PtS = Pterosphenoid; SO =

Supraorbital; stf = Subtemporal Fossa; sPaS = Parasphenoid Shaft; SpO = Sphenotic; v-viia

= anterior opening of trigeminal-facial chamber; v-viip = posterior opening of trigeminal- facial chamber; vPaS = ventromedial process of Parasphenoid; wPaS = Parasphenoid

Wing; x = foramen for vagus nerve.

291

292

Figure 3.7. Lateral view of partially highlighted skull Rasbora lacrimula, MZB 19238, 27.6 mm SL. feLE = Anterior ventromedial fenestra of lateral ethmoid and orbitosphenoid; lLE

= Anterior Limit of Lateral Ethmoid; IO1 = First Infraorbital or Lachrymal; LE = Lateral

Ethmoid; of = olfactory foramen; PaS = Parasphenoid; pLE = Lateral Ethmoid Process; PtS

= Pterosphenoid; sio = Interorbital Septum; SO = Supraorbital; vsLE = Ventral Splint of

Lateral Ethmoid.

293

294

Figure 3.8. Lateral view of posterodorsal portion of skull in Rasbora argyrotaenia, BMNH

1999.6.14, 52.4 mm SL. APt = Autopterotic; ceca = Cephalic Lateral Line Canal; Cl =

Cleithrum; EOc = Exoccipital; EpOc = Epioccipital; Esc = Extrascapular; Fr = Frontal; IO4

= Fourth Infraorbital; IO5 = Fifth Infraorbital; ll = Lateral Line; Op = Operculum; Pa =

Parietal; Pop = Preoperculum; PTm = Post-temporal; Sc = Scapula; scca = Semicircular

Canal; SO = Supraorbital; SpO = Sphenotic.

295

296

Figure 3.9. Kinethmoid of selected rasborin groups and outgroup taxa in anterior view. (A)

Rasbora daniconius USNM 274794, 40.2 mm SL; (B) R. cf. cephalotaenia, USNM

329327, 59.8 mm SL; (C) R. cf. sumatrana, USNM 328033, 62.4 mm SL; (D) R. api,

USNM 390227, 42.2 mm SL; (E) R. borapetensis, USNM uncataloged, 36.4 mm SL; (F)

R. cf. tornieri, USNM uncataloged, 64.7 mm SL; (G) Trigonostigma heteromorpha,

USNM 229242, 24.5 mm SL; (H) R. tawarensis, USNM uncataloged, 74.2 mm SL; (I)

Raiamas guttatus, USNM 390744, 78.2 mm SL; (J) Amblypharyngodon mola, USNM

344648, 56.8 mm SL; (K) Devario aequipinnatus, USNM 271456, 53.1 mm SL. Images not to scale.

297

298

Figure 3.10. Lateral view of maxilla of R. bankanensis USNM uncataloged, 35.6 mm SL. aMx = Posteroventral Apophysis of Maxilla; arM = Anteromedial Ramus of Maxilla; lpM

= Lateral Process of Maxilla; pfM = posteroventral flange of Maxilla; ppal = Palatine

Process of Maxilla; prM = Posteromedial Ramus of Maxilla; sMx = Shaft of Maxilla.

299

300

Figure 3.11. Maxilla of select rasborin group and outgroup taxa. (A) Rasbora daniconius,

USNM 271651, 69.2 mm SL; (B) R. cf. cephalotaenia, USNM 329327, 59.8 mm SL; (C)

R. argyrotaenia, USNM 328021, 44.9 mm SL; (D) Trigonopoma pauciperforatum, USNM

330997, 34.2 mm SL; (E) R. kottelati, USNM 328137, 56.4mm SL; (F) R. truncata, USNM xxx, xx mm SL; (G) R. sarawakensis, USNM 230234, 33.8 mm SL; (H) Trigonostigma heteromorpha, uncataloged, 33.4 mm SL; (I) R. bankanensis, USNM uncataloged, 35.6 mm SL; (J) Raiamas guttatus, USNM 390744, 78.2 mm SL; (K) Luciosoma setigerum,

USNM 320972, 57.4 mm SL; (L) Devario aequipinnatus, USNM 271456, 53.1 mm SL.

Each bar equals 0.5 mm.

301

302

Figure 3.12. Lateral view of suspensorium bones (A) Rasbora cephalotaenia, USNM

329327, 59.8 mm SL; (B) Danio albolineatus, USNM 390070, 33.2 mm SL. aaq =

Articulation between Anguloarticular and Quadrate; aiD = Anterodorsal Indentation of

Dentary; alP = Anteroventral Lamina of Premaxilla; AnA = Anguloarticular; apP =

Ascending Process of Premaxilla; apS = Anterior Process of Suboperculum; arM =

Anterior Ramus of Maxillary; atO = Anterodorsal Tip of Operculum; cHm =

Hyomandibulary Condyles; cme = Coronomeckelian Cartilage; De = Dentary; EcP =

Ectopterygoid; EnP = Endopterygoid; fDe = Lateral Flange of Dentary; foap = Fossa of

Arcus Palatini; Hm = Hyomandibulary; IOp = Interoperculum; ksy = Symphyseal Knob; lrH = Lateral Ridge of Hyomandibulary; MPt = Metapterygoid; Mx = Maxillary; noD =

Anteromedial Notch of Dentary or ‘Danionin Notch’; Op = Operculum; pco = Coronoid

Process of Dentary; Pal = Palatine; pet = Ethmoid Process of Palatine; Pop =

Preoperculum; ppal = Palatine Process of Maxillary; prM = Posterior Ramus of Maxillary;

Qu = Quadrate; RA = Retroarticular; Sop = Suboperculum; Sym = Symplectic. Each bar equals 1 mm.

303

304

Figure 3.13. Lateral view of suspensorium bones (A) Rasbora cf. tornieri, USNM uncataloged, 64.7 mm SL; (B) Rasbora cf. sumatrana, USNM 401463, 85.9 mm SL. aaq =

Articulation between Anguloarticular and Quadrate; aiD = Anterodorsal Indentation of

Dentary; alP = Anteroventral Lamina of Premaxilla; AnA = Anguloarticular; apP =

Ascending Process of Premaxilla; apS = Anterior Process of Suboperculum; arM =

Anterior Ramus of Maxillary; atO = Anterodorsal Tip of Operculum; cHm =

Hyomandibulary Condyles; cme = Coronomeckelian Cartilage; De = Dentary; EcP =

Ectopterygoid; EnP = Endopterygoid; fDe = Lateral Flange of Dentary; foap = Fossa of

Arcus Palatini; Hm = Hyomandibulary; IH = Interhyal; IOp = Interoperculum; ksy =

Symphyseal Knob; lrH = Lateral Ridge of Hyomandibulary; MPt = Metapterygoid; Mx =

Maxillary; noD = Anteromedial Notch of Dentary or ‘Danionin Notch’; Op = Operculum; pco = Coronoid Process of Dentary; Pal = Palatine; pet = Ethmoid Process of Palatine; Pop

= Preoperculum; ppal = Palatine Process of Maxillary; prM = Posterior Ramus of

Maxillary; Qu = Quadrate; RA = Retroarticular; Sop = Suboperculum; Sym = Symplectic.

Each bar equals 1 mm.

305

306

Figure 3.14. Lateral view of posteroventral portion of lower jaw showing articulation between anguloarticular and quadrate. (A) Devario aequippinatus, USNM 271456, 53.1 mm SL; (B) Rasbora tubbi, ZRC 42685, 76.6 mm SL. AnA = Anguloarticular; IOp =

Interoperculum; pA = Posteroventral Process of Anguloarticular; RA = Retroarticular; Pop

= Preoperculum; Qu = Quadrate. Each bar equals 0.5 mm.

307

308

Figure 3.15. Posterodorsal view of upper gill arches. Rasbora cf. cephalotaenia, USNM

329327, 59.8 mm SL. EB2 = Second Epibranchial; EB3 = Third Epibranchial; EB4 =

Fourth Epibranchial; EB5 = Cartilaginous Fifth Epibranchial; rp = rasborin process; PB2 =

Second Pharyngobranchial; PB3 = Third Pharyngobranchial. Each bar equals 0.5 mm.

309

310

Figure 3.16. Lateral view of posterior upper gill arch showing variations of ventral articulation of cartilaginious fifth epibranchial. (A) Chanodichthys erythropterus, USNM

336724, 59.6 mm SL; (B) Devario aequipinnatus, USNM 271456, 67.2 mm SL; (C)

Rasbora kalochroma, ZRC 51751, 42.2 mm SL; (D) Esomus cf. metallicus, USNM uncataloged, 56.3 mm SL. CB3 = Third Ceratobranchial; CB4 = Fourth Ceratobranchial;

CB5 = Fifith Ceratobranchial or Pharyngeal Tooth; EB2 = Second Epibranchial; EB3 =

Third Epibranchial; EB4 = Fourth Epibranchial; EB5 = Cartilaginous Fifth Epibranchial; lp

= Levator Process. Yellow arrow indicating ventral articulation of cartilaginous fifth epibranchial. Images not to scale.

311

312

Figure 3.17. Ventral view of urohyal. (A) Rasbora daniconius, USNM 271651, 69.2 mm

SL; (B) Rasbora cf. cephalotaenia, USNM 329327, 59.8 mm SL. fvl = Ventrolateral

Flange of Urohyal; sha = Anterior Shaft of Urohyal. Each scale bar equals 0.5 mm.

313

314

Figure 3.18. Lateral view of hyoid bar of Rasbora cephalotaenia (USNM 329327, 59.8 mm

SL). BS1 = First Branchiostegal Ray; BS2 = Second Branchiostegal Ray; BS3 = Third

Branchiostegal Ray; Cha = Anterior Ceratohyal; CHp = Posterior Ceratohyal; IH =

Interhyal; HHd = Dorsal Hypohyal; HHv = Ventral Hypohyal.

315

316

Figure 3.19. Pelvic girdle of Rasbora (ventral view): (A) R. kottelati, USNM 328137,

56.4mm SL; (B) R. rasbora, USNM 372226, 36.9 mm SL. ap = apophysis of ischiac process; ic = cartilaginous lamina of ischiac process; pi =ischiac process. Each bar equals

0.5 mm.

317

318

Figure 3.20. Scales of: (A) Rasbora dandia, USNM 271643, 63.1 mm SL; (B) Rasbora caverii, USNM 271650, 56.3 m SL. F = Focus; pr = Primary Radius; sr = Secondary

Radius. Images not to scale.

319

320

Figure 3.21. Snout of Rasbora borapetensis (USNM uncataloged, 35.2 mm SL; lateral view of right side): upper panel = in situ photograph showing dissected upper jaw

(infraorbital being removed); lower panel = schematic illustration of myological arrangement of type A1 adductor mandibulae muscle. A1 = type A1 adductor mandibulae; apo = aponeurosis of type A1 adductor mandibulae; cus = connective tissue for cushioning; dtA1 = dorsal tendon of type A1 adductor mandibulae; lPM = palatine-maxillary ligament;

Mx = maxilla; Pal = palatine; pPal = palatine process of maxilla; vtA1 = ventral tendon of type A1 adductor mandibulae. Scale bar equals 0.5 mm.

321

322

Figure 3.22. . Schematic illustration of myological arrangement of type A1 adductor mandibulae muscle (lateral view of inverted right side) in danionins. (A) Raiamas nigeriensis, USNM 339723, 42.7 mm SL; (B) Luciosoma setigerum, USNM 320972, 57.4 mm SL; (C) Opsarius barna, USNM 274813, 46.9 mm SL; (D) Rasbora dandia, USNM

271643, 63.1 mm SL. A1 = type A1 adductor mandibulae; apo = aponeurosis of type A1 adductor mandibulae; A1a = anterior branch of A1 muscle; cus = connective tissue for cushioning; lPM = palatine-maxillary ligament; Mx = maxilla; Pal = palatine; pPal = palatine process of maxilla; vtA1 = ventral tendon of type A1 adductor mandibulae. Scale bar equals 0.5 mm.

323

324

Figure 3.23. Schematic illustration of myological arrangement of type A1 adductor mandibulae muscle (lateral view of inverted right side) in danionins. (A) Rasbora dandia,

USNM 271643, 63.1 mm SL; (B) Rasbora caverii, USNM 271639, 53.6 mm SL; (C)

Rasbora borapetensis, USNM uncataloged, 35.2 mm SL; (D) Rasbora sarawakensis,

USNM 230234, 44.9 mm SL. A1 = type A1 adductor mandibulae; apo = aponeurosis of type A1 adductor mandibulae; cus = connective tissue for cushioning; dtA1 = dorsal tendon of type A1 adductor mandibulae; lPM = palatine-maxillary ligament; Mx = maxilla; Pal = palatine; pPal = palatine process of maxilla; vtA1 = ventral tendon of type A1 adductor mandibulae. Scale bar equals 0.5 mm.

325

326

Figure 3.24. Lateral pigmentationon subdorsal region. (A) Rasbora jacobsoni, USNM

390148, 30.1 mm SL; (B) R. cf. tornieri, USNM 383419, 58.2 mm SL; (C) R. dusonensis,

USNM 325023, 87.4 m SL; (D) R. api, USNM 390227, 36.3 mm SL. as = axial streak; mls

= black midlateral stripe; Images not to scale.

327

328

Figure 3.25. Snout of Rasbora (lateral view of left side) showing the exposure of upper lip.

(A) R. bankanensis, USNM 230223, 33.63 mm SL; (B) R. kottelati, USNM 328137, 52.9 mm SL; (C) R. api, USNM 390227, 42.2 m SL; (D) R. cf. tornieri, USNM uncataloged,

65.7 mm SL.

329

330

Figure 3.26. SEM (Scanning Electron Microscope) image showing inner dorsal surface of lower jaw of Rasbora cf. tornieri (USNM uncataloged; 65.7 mm SL). LL = lower lip; Pl =

Plicae; sk = symphyseal knob; Ve = Velum.

331

332

Figure 3.27. SEM (Scanning Electron Microscope) image showing inner dorsal surface of lower jaw and magnification of epithelial modification along velum. (A) Rasbora cf. tornieri (USNM uncataloged; 56.8 mm SL); (B) R. cf. sumatrana (USNM 328033, 62.4 mm SL); (C) R. lacrimula (MZB 19238, 27.6 mm SL).

333

334

Figure 3.28. 50% majority rule consensus cladogram from 3,411 most parsimonious trees

(each 1,111 steps long) based on 274 morphological characters coded from 97 taxa (27 outgroups; 70 ingroups).

335

336

Figure 3.29. Cladogram of the supragenus Rasbora inferred using 274 morphological characters showing its 12 major clades and the relationships among them.

337

338

Table 3.1. List of specimens examined in the morphological analysis of this study with catalogue numbers, specimen counts, and localities.

Classification of rasborin clades and danionine tribes based on the morphological phylogeny of this study (see Figures 3.28 and 3.29). Institutional abbreviations as follows: ANSP = Academy of Natural Science of Drexel University (Philadelphia); BMNH = British Museum of Natural History

(London); MZB = Museum Zoologicum Bogoriense (Indonesia); UAIC = University of Alabama Ichthyological Collection (Tuscaloosa); UF =

Florida Museum of Natural History (Gainesville); USNM = National Museum of Natural History, Smithsonian Institution (Washington, DC);

ZRC = Zoological Reference Collection (the Raffles Museum, Singapore). For specimen count, number in bold corresponds to the total number of specimens, whereas number in parentheses corresponds to the number of specimens used for osteology and myology (stained or cleared-and- double-stained).

Clades Species Catalogue number Count Locality

Horadandia+ Horadandia atukorali USNM 271343 74 Srilanka, North of Colombo Rasboroides H. atukorali USNM 271483 26 (4) Srilanka, East of Colombo, Kelani River H. atukorali USNM uncataloged Aquarium trade Rasboroides vaterifloris USNM 271661 12 (2) Aquarium trade R. vaterifloris USNM uncataloged Aquarium trade

The Daniconius Rasbora armitagei USNM 271650 25 (6) Srilanka, South of Medagama, Kumbukkan Oya group R. caverii USNM 271639 28 (8) Srilanka, South of Anurajhapura, Savasthipura R. caverii USNM 271640 4 Srilanka, Trincomalee, Mahaweli River R. caverii USNM 271651 41 (6) Srilanka, Bibile District, Medagama, Gal Oya R. dandia USNM 271643 33 (2) Srilanka, East of Agalawatta, Kuda Ganga R. dandia USNM 271653 20 (4) Srilanka, North of Matugama, Bentota Ganga R. dandia USNM 271654 32 Srilanka, South of Pitigala, Talgasw Ela R. daniconius USNM 103280 3 Thailand, North Siam, Huey Metao, Salween

339

R. daniconius USNM 149679 6 India, Kerala, Travancore R. daniconius USNM 165081 2 India, Travancore R. daniconius USNM 274794 24 (3) Nepal, Royal Chitwan Park, Rapi River R. daniconius USNM 372521 29 (2) Myanmar, Kachin State, Hpa-Lap Stream R. daniconius USNM 390738 42 Myanmar, Nan-Kwe Chaung R. cf. daniconius USNM 276363 40 (6) Srilanka, Rakwana, Kula Ganga R. wilpita USNM 271649 11 (2) Srilanka, North of Morawaka, Nilwala Ganga R. tubbi ZRC 42685 11 (2) Brunei Darussalam, Borneo

The Einthovenii Rasbora einthovenii MZB uncataloged 161 (5) Indonesia, Borneo, Kalimantan Selatan, Asem-asem group R. einthovenii USNM 328027 110 (5) Brunei, Belait District, Sungai Bau R. einthovenii USNM 328028 150 (6) Brunei, Belait District, Sungai Kutang R. jacobsoni USNM 390148 17 (1) Indonesia, Sumatera Utara, Sungai Aek Sibundung R. jacobsoni USNM 390669 71 (2) Indonesia, Sumatra, Aceh Singkil, Namo Buaya R. kalochroma ZRC 51751 14 (1) Indonesia, Borneo, Kalimantan Tengah, Katingan R. kottelati USNM 328136 12 Brunei, Belait District, Ulu Ingei R. kottelati USNM 328137 21 (4) Brunei, Belait District, Sungai Melilas

Kottelatia Kottelatia brittani ZRC 44148 100(5) Indonesia, Sumatra, Jambi Rasbora kalbarensis MZB 13691 9 (1) Indonesia, Sumatra, Lampung R. kalbarensis USNM 230225 7 (2) Indonesia, West Kalimantan, Sungai Belentian

Trigonopoma Trigonopoma gracile UF 173539 1 Malaysia, Malay Peninsula, Pahang, Sengai Nangka T. gracile USNM 229039 14 (1) Malaysia, Malay Peninsula, Johor, Sungai Sedili T. gracile USNM 229233 22 (2) Malaysia, Malay Peninsula, Kuantan T. gracile USNM uncataloged 4 Indonesia, Borneo, Kalimantan Selatan, Jorong T. pauciperforatum USNM 330997 114 (4) Brunei, Borneo, Belait, Sungai Kutang T. pauciperforatum MZB uncataloged 198 (10) Indonesia, Sumatra, Riau

Boraras Boraras brigittae uncataloged 4 (2) Aquarium trade B. maculata UAIC uncataloged 2 (2) Aquarium trade

340

B. merah UAIC uncataloged 2 (2) Aquarium trade B. micros uncataloged (2) Aquarium trade B. micros UF 173267 10 (2) Thailand, Surathani, Mae Nam Ta Pi B. urophthalmoides uncataloged (2) Aquarium trade B. urophthalmoides UF 173258 24 (4) Thailand, Chachoengsao, Mae Nam Bang Pakong

Brevibora Brevibora dorsiocellata MZB 2362 33 (3) Indonesia B. dorsiocellata MZB 13653 17 (2) Indonesia B. dorsiocellata USNM 229235 1 (1) Malaysia, Malay Peninsula, Kuantan-Pekan B. dorsiocellata USNM uncataloged 10 (6) Aquarium trade

Trigonostigma Trigonostigma hengeli MZB uncataloged 8 (2) Aquarium trade T. heteromorpha USNM 229242 29 (2) Malaysia, Malay Peninsula, Johore, Sedili Besar T. heteromorpha USNM uncataloged 10 (2) Aquarium trade

The Trifasciata Rasbora bankanensis USNM 230222 5 (1) Indonesia, West Kalimantan, Nangapinoh, Melawi R. bankanensis USNM 230223 13 (3) Indonesia, West Kalimantan, Kapuas at Selimbau R. bankanensis USNM uncataloged 67 (8) Indonesia, Sumatra, Riau, Kerinci R. ennealepis USNM 230230 (paratypes) 4 (1) Indonesia, West Kalimantan, Sungai Tebelian R. hubbsi BMNH 1997.5.13.18-35 17 (3) Malaysia, Borneo, Sabah, Sungai Lonpodas R. johannae BMNH 2001.1.15.1954-1969 16 (3) Indonesia, Borneo, Kalimantan Tengah, Barito R. lacrimula MZB 19238 68 (5) Indonesia, Borneo, Kalimantan Timur R. paucisqualis MZB 13530 10 (2) Indonesia R. paucisqualis USNM 230222 5 (1) Indonesia, West Kalimantan, Sungai Melawi R. sarawakensis ZRC 39844 43 (4) Malaysia, Borneo, Sarawak, Serian. R. trifasciata ZRC 45536 20 (3) Indonesia, Borneo, Kalimantan Timur, Kayan Rasbora n. sp. 5 MZB uncataloged (3) Indonesia, Kalimantan Selatan, Sungai Jorong Rasbora n. sp. 6 MZB uncataloged (3) Indonesia, Kalimantan Selatan, Tanah Bumbu Rasbora n. sp. 7 MZB uncataloged Indonesia, Kalimantan Selatan, Tanah Bumbu

The Argyrotaenia Rasbora argyrotaenia BMNH 1999.6.14.32-66 35 (5) Indonesia, Central Java, Citandui Basin, Rawa Keris

341

group R. cf. argyrotaenia (ex. USNM 328021) 58 (2) Brunei, Borneo, Belait R. cf. argyrotaenia USNM 138371 46 (1) Philippines, Palawan Province, Busuanga Island R. aurotaenia ANSP 179925 55 (2) Thailand, Ubon, Mekong River, Khong Chiam. R. borapetensis USNM 229298 63 (1) Thailand, Klong Ta Pa, West of Bangkok R. borapetensis USNM uncataloged 5 (3) Aquarium trade R. borneensis BMNH 1982.3.29.68 1 (1) Indonesia, Borneo, Kapuas River. R. cephalotaenia USNM 101215 4 (1) Malaysia, Malay Peninsula, Penang, Ayer Hitam R. cephalotaenia USNM 229038 2 (1) Malaysia, Malay Peninsula, Johore, Sedili Besar R. cephalotaenia USNM 329327 100 (8) Brunei, Borneo, Belait R. dusonensis USNM 325023 4 (1) Malaysia, Borneo, Sarawak, Batang Balui, Long Paha R. dusonensis USNM 325393 11 (2) Malaysia, Borneo, Sarawak, Batang Balui R. dusonensis USNM uncataloged 12 (1) Indonesia, Sumatra, Pasar Ahad Maninjau (74SU) R. cf. dusonensis USNM uncataloged 8 (2) Indonesia, Sumatra, Riau, Siak River R. laticlavia USNM 393983 32 Indonesia, Borneo, Kalimantan Selatan, Aib River R. myersi USNM uncataloged 5 Indonesia, Sumatra, Riau R. tornieri USNM 383419 7 (1) Brunei, Borneo, Tutong R. tornieri USNM uncataloged 11 (3) Indonesia, Sumatra, Riau, Siak River

The Reticulata Rasbora api USNM 391737 (paratypes) 37 (12) Indonesia, Sumatra, Tapanuli Tengah, Pinangsori group R. api USNM 390067 (paratypes) 93 (3) Indonesia, Sumatra, Tapanuli Tengah, Sumuran R. api USNM 390227 (paratypes) 17 (1) Indonesia, Sumatra, Humbang Hasundutan, Pakkat R. kluetensis USNM 391747 (paratypes) 59 (8) Indonesia, Sumatra, Aceh Selatan, Kluet River R. meinkeni USNM 390212 7 (1) Indonesia, Sumatra, Aceh Tengah, Lake Laut Tawar R. meinkeni USNM 390223 102 (5) Indonesia, Sumatra, Aceh Tengah, Lake Laut Tawar R. nodulosa USNM 391743 (paratypes) 36 (3) Indonesia, Sumatra, Aceh Barat Daya, Tangan-tangan R. nodulosa USNM 391731 (paratypes) 51 (8) Indonesia, Sumatra, Aceh, Nagan Raya, Seumayam R. tobana USNM 193041 400 (4) Indonesia, Sumatra, Prapat, Lake Toba R. truncata USNM 391744 (paratypes) 37 (6) Indonesia, Sumatra, Aceh Tenggara, Alas River R. truncata USNM 391745 (paratypes) 39 (11) Indonesia, Sumatra, Aceh Singkil, Dano R. truncata MZB 16687 77 (4) Indonesia, Sumatra, Aceh Singkil, Rimo R. vulcanus USNM uncataloged 4 (1) Aquarium trade

342

The Sumatrana R. aprotaenia USNM uncataloged 3 (2) Indonesia, West Java, Rawa Danau group R. baliensis USNM uncataloged 11 (2) Indonesia, Bali R. caudimaculata USNM 328021 69 (2) Borneo, Brunei, Belait R. elegans USNM 393968 12 (2) Indonesia, Borneo, Kalimantan Selatan, Kusan R. elegans USNM 229248 16 (1) Malaysia, Johor, Sungai Sedili R. lateristriata USNM uncataloged 1 (1) Indonesia, West Java, Bodogol R. rasbora USNM 372226 14 (3) Myanmar, Kachin State, Hpa-Lap, Nan Kwe Chaung R. paviana UF 170284 4 (2) Thailand, Chonburi R. spilotaenia UF 161802 26 Indonesia, Sumatra, R. subtilis ZRC 38674 8 (2) Indonesia, Sumatra, Jambi R. cf. sumatrana 1 USNM 328033 14 (1) Brunei, Borneo, Belait, Sungai Arang R. cf. sumatrana 2 USNM uncataloged 19 (1) Indonesia, Borneo, Kalimantan Selatan R. tawarensis USNM uncataloged 25 (2) Indonesia, Sumatra, Aceh Tengah, Lake Laut Tawar R. trilineata USNM uncataloged 8 (5) Aquarium trade Rasbora n. sp. 1 USNM 390053 7 (1) Indonesia, Sumatra, Aceh, Kluet Rasbora n. sp. 1 USNM 401463 20 (7) Indonesia, Sumatra, Aceh, Singkil, Lae Kumbi Rasbora n. sp. 2 MZB 11849 41 (3) Indonesia, Sumatra Rasbora n. sp. 3 USNM 406859 (paratype) 1 (1) Indonesia, Sumatra, Sumatera Barat, Lake Maninjau Rasbora n. sp. 4 USNM 404351 7 (3) Indonesia, Sumatra, Batang Angkola

OUTGROUPS

Tribe Rasborini Amblypharyngodon USNM 390708 8 (2) Myanmar harengulus A. mola USNM 344648 72 (3) Myanmar, Bago, Sittaung River Pectenocypris USNM uncataloged 23 (7) Indonesia, Borneo, Kalimantan Selatan, Asem-asem korthausae P. micromysticetus ZRC 51758 (paratypes) 46 (5) Indonesia, Sumatra, Jambi, Pijoan

Tribe Danionini Chela laubuca USNM 372195 45 (2) Myanmar, Kachin State, Nam Chim Chaung Danio rerio CAS 94523 327 (3) India, Orissa Devario aequipinnatus USNM 271456 38 (13) Sri Lanka, Bibile District, Medagama, Gal Oya Esomus metallicus USNM uncataloged 16 (4) Indonesia, Sumatra, Jambi

343

Malayochela maasi MZB 13514 5 (1) Indonesia, Malayochela maasi MZB 13522 7 (1) Indonesia, Nematabramis USNM 329348 10 (1) Brunei, Borneo, Belait, Ulu Ingei steindachneri

Tribe Chedrini Luciosoma setigerum USNM 320972 18 (2) Malaysia, Borneo, Sarawak, Batang Balui Opsarius barna USNM 274813 31 (2) Nepal, Royal Chitwan Park, Rapi River Raiamas guttatus USNM 390744 7 (1) Myanmar, Chindwin, Sharpo Gyi Raiamas guttatus USNM 390745 14 (3) Myanmar, Kha Wan Stream, Hopin Market Raiamas nigeriensis USNM 339723 36 (1) Nigeria, Mayo Gamgam, River Benue Sundadanio cf. axelrodi UAIC 14180.99 2 (2) Aquarium trade

Subfamily Campostoma anomalum USNM 200733 105 (11) United States, Tennessee, Blount County Leuciscinae Notropis chloristius USNM 221041 13 (2) United States, South Carolina, Chesterfield County

Subfamily Osteochilus spilurus USNM uncataloged 23 (4) Indonesia, Sumatra, Riau Cyprininae Systomus tetrazona USNM uncataloged 34 (2) Indonesia, Sumatra, Riau Tor cf. tambra USNM uncagalogued 9 (2) Indonesia, Sumatra, Aceh

Subfamily Leptobarbus hoevenii ZRC 41947 10 (2) Indonesia, Sumatra, Jambi Leptobarbinae

Subfamily Chanodichthys USNM 336724 7 (1) China, Beijing, Huairou Cultrinae erythropterus Parachela oxygastroides USNM uncataloged 13 (2) Indonesia, Borneo, Southeast Kalimantan

Family Homaloptera cf. USNM 390065 19 (1) Indonesia, Sumatra, Sumatera Utara, Aek Mangiring Balitoridae gymnogaster

344

H. cf. gymnogaster USNM 390063 12 (1) Indonesia, Sumatra, Sumatera Utara, Pagaran Pisang H. cf. gymnogaster USNM uncataloged 28 (1) Indonesia, Sumatra, Sumatera Utara, Pasar Rao

Family Catostomus commersoni USNM 238111 55 (2) United States, West Virginia Catostomidae C. commersoni USNM 340759 16 (1) United States, Pennsylvania

Family Gyrinocheilus sp. USNM 272884 13 (1) Laos, Sithandone Province, Muang Khong Gyrinocheilidae Gyrinocheilus aymonieri USNM 117718 22 (1) Thailand, Meklong, Ban Pong

Order Xenocharax spilurus USNM 227693 3 (1) Gabon, Lac Ezanga, Allonha li Characiformes

Order Chanos chanos USNM 120812 5 (1) Philippines, Luzon, Rizal, Malabon Market Gonorynchifor- Chanos chanos USNM 401640 4 (1) Indonesia, Sulawesi Tenggara, Kendari mes

345

Chapter 4: Molecular Phylogeny of the Supragenus Rasbora (Teleostei: Cyprinidae)

ABSTRACT

Phylogenetic reconstruction of the species-rich Asian cyprinid Rasbora was analyzed using parsimony, likelihood, and Bayesian methods based on 6,547 aligned nucleotide characters concatenated from four nuclear genes (RAG1, Rhodopsin, and two EPIC markers) and three mitochondrial markers (16S rRNA, COI, and cytochrome b) for 93 taxa (including 12 outgroups and 81 species of Rasbora). Overall, the three different phylogenetic approaches result in trees with similar topologies, in which two major clades of the supragenus

Rasbora are recovered consistently with high support values: (1) the Indian lineage, and (2) the Sundaland-Indochinese lineage. Similar to previous molecular studies, Rasbora is inferred to be paraphyletic because the genus Pectenocypris is embedded in the large,

Sundaland-Indochinese lineage, a clade composed of two major subgroups: (1) Clade A:

Boraras, Trigonopoma, Kottelatia, and R. kalbarensis, and (2) Clade B. The type species of

Rasbora (R. cephalotaenia) is nested in the poorly resolved Clade B together with

Pectenocypris. The monophyly of each of the three valid non-monotypic genera, Boraras,

Brevibora, and Trigonostigma, is confirmed. The Argyrotaenia group is the only species group recovered as monophyletic out of at least six others recently reclassified in Rasbora sensu stricto by Liao et al. (2010).

346

INTRODUCTION

To date, there have only been a few molecular phylogenetic studies of Rasbora, with there incorporating just a handful of species of Rasbora as ingroup taxa (Mayden et al., 2007; Rüber et al., 2007; Fang et al., 2009; Tang et al., 2010; Liao et al., 2011). Despite the reciprocal congruence recovered in those studies, the molecular trees conflict with those reconstructed using morphology. In particular, morphology and molecules disagree on the monophyly of the supragenus Rasbora. Rüber et al. (2007) conducted a molecular analysis based on mitochondrial cytochrome b using a large sample of cyprinid taxa. Theirs was the first study that incorporated some members of Rasbora, which was recovered as a paraphyletic group. Paraphyly resulted because the genus Pectenocypris, a highly-derived outgroup, according to the morphological taxonomy, is embedded in a more exclusive clade within the larger clade of Rasbora (Rüber et al., 2007). The non-monophyly of

Rasbora due to the placement of Pectenocypris is congruent with the results from a more recent study by Tang et al. (2010), which sequenced more DNA markers (COI, cytochrome b, RAG1, and Rhodopsin) and incorporated broader representative taxon sampling than

Rüber et al. (2007).

Strikingly in contrast, morphological analyses support the monophyly of Rasbora

(Liao et al., 2010; Liao et al., 2011). The topology of Liao et al. (2010) recovered two major clades, which reflects a dichotomy based on body size: (1) Clade C containing small- sized rasborin genera, less than 30 mm SL (Boraras, Brevibora, Horadandia, Rasboroides,

Rasbosoma, Trigonopoma, and Trigonostigma); and (2) Clade Rasbora sensu stricto with a relatively large body, reaching over 40 mm SL, containing eight more terminal clades than

347 in Rasbora. The resulting topology that reflects size dichotomy of Liao et al. (2010) is in conflict with the molecular results of Tang et al. (2010) and the morphological tree of this study (chapter 3). According to the last two studies, miniaturization has evolved independently throughout different lineages of Rasbora.

MATERIALS AND METHODS

Taxonomic sampling

A total of 93 cyprinid taxa was examined representing 12 outgroup taxa and 81 species of Rasbora (Table 4.1). The outgroup taxa comprise representatives of four cyprinid subfamilies sensu Tang et al. (2010): one species of Cultrinae (Parachela oxygastroides), one species of Cyprininae (Puntius binotatus), ten species of Danioninae

[three tribes: Chedrini (Opsarius koratensis and Raiamas guttatus), Danionini (Danio rerio and Devario aequipinnatus), and Rasborini (Amblypharyngodon chulabornae, A. mola,

Pectenocypris korthausae, and P. micromysticetus)], and one species of Leptobarbinae

(Leptobarbus hoevenii). The ingroup taxa encompass all genera of Rasbora s. l. (sensu

Liao et al., 2010): Boraras, Brevibora, Horadandia, Kottelatia, Rasbora s. s., Rasboroides,

Rasbosoma, Trigonostigma, and Trigonopoma. Tissue sample codes and catalog numbers are listed in Table 4.1.

DNA amplification and sequencing

A total of seven molecular regions were selected as the phylogenetic markers in this study due to their potential in delivering informative phylogenetic signals at the intergeneric level among fishes as demonstrated by their efficacy in previous studies

348

(Kocher et al., 1989; Chen et al., 2003; López et al., 2004; Ward et al., 2005; Chen et al.,

2007; Mayden et al., 2007; Li et al., 2010; Tang et al., 2010). Of those seven markers targeted, three are mitochondrial: cytochrome c oxidase I (COI); cytochrome b; and 16S rRNA. The remaining four markers are nuclear: the recombination activation gene 1

(RAG1); the opsin gene (rhodopsin); and two exon-primed intron-crossing (EPIC) markers as developed by Li et al. (2010): EPIC 55305 and EPIC 35692. PCR primers used for amplification and sequencing these genetic markers are listed in Table 4.2.

The whole specimen, fin clips, or muscle tissue samples were preserved in 95% ethanol prior to DNA extraction. Total genomic DNA was extracted from approximately

20 mg of preserved muscle tissue via an automated phenol-chloroform extraction on

AutoGenPrep 965 (AutoGen Inc., Holliston, MA) using the mouse-tail tissue protocol or via a Qiagen DNeasy Tissue Extraction Kit following the manufacturer’s protocol. PCR was performed to amplify the targeted fragment of a marker for each individual sample in a total 10 μl reaction containing 3 μl of sterile water, 1μl of the genomic DNA, 5μl BIO-X-

ACT Short DNA Polymerase (BioLine; a mixture containing Taq polymerase, dNTPs, and buffers), and 0.5 μl of 10 μM of a primer. PCR and DNA sequencing for each selected genetic marker were performed using different sets of primers as listed in Table 4.2. The thermal cycler set-up for PCR is as follows: 1 cycle of initial denaturation at 95°C for 5 minutes; followed by 35 cycles of denaturation at 95°C for 30 s, annealing at 50°–53°C for

60 s, and extension at 72°C for 60 s; then ended by final extension 72°C for 5 minutes.

PCR products were cleaned up using ExoSAP-IT (USB, Cleveland, OH). Cycle sequencing reactions for both strands of amplified fragments were performed with BigDye Terminator

Cycle Sequencing Kit v.3.1 (PE Applied Biosystems, Foster City, CA) and the PCR

349 primers. Subsequent purification was conducted through gel filtration with Sephadex G-50

(Sigma-Aldrich Corp.). To obtain the sequence data, the purified products were run on an automated DNA sequencer (3730xl DNA analyzer, Applied Biosystem Inc.), which resulted in a series of DNA chromatograms.

Sequence and dataset preparation

Complementary chromatograms were assembled and edited to produce the contiguous sequences of targeted molecular markers using the program Sequencher 4.8

(Gene Code Corp., Ann Arbor, MI). Sequences for each marker were aligned via the multiple alignment procedure using the multi-integrated software package SATé-II (Liu et al., 2012), which performs an iterative algorithm involving repeated alignment and tree searching operations using different softwares bundled within the package. For each alignment operation, MAFFT 6.717 (Katoh and Toh, 2008) was chosen. RAxML 7.2.6

(Stamatakis et al., 2005) was selected to run each tree search. To obtain one single multi- marker character matrix, datasets of aligned sequences from different markers were concatenated using SequenceMatrix (Vaidya et al., 2011).

Phylogenetic reconstruction

Phylogenetic relationships were inferred using three approaches --maximum parsimony (MP), maximum likelihood (ML), and Bayesian inference (BI)-- based on four types of data matrices: (1) each individual genetic marker; (2) a dataset composed of all three mitochondrial markers (16S rRNA, COI, and cytochrome b); (3) a dataset composed of all four nuclear markers (EPIC 35692, EPIC 55305, RAG1, and Rhodopsin); and (4) a concatenated dataset of all seven markers (both nuclear and mitochondrial). For the

350 concatenated dataset (seven markers), three different partitioning strategies were applied in the analyses of the two model-based approaches (ML and BI): (1) single partition with one model for the entire concatenated data matrix; (2) partitioning according to the genetic markers, resulting in seven partitions; and (3) partitioning with respect to codon positions of the highly-variable protein-coding markers (combined COI + cytochrome b, RAG1, and

Rhodopsin), resulting in 11 partitions (Table 4.3). The best substitution model for each dataset or each partition was inferred via the corrected version of Akaike Information

Criterion (AICc) using JModeltest (Posada, 2008). The computational tasks for searching the optimal trees (MP, ML, and BI) were carried out on a high-performance Topaz cluster at the Laboratory of Analytical Biology, National Museum of Natural History, Smithsonian

Institution.

For maximum parsimony (MP) analyses, phylogenetic trees were reconstructed using PAUP* 4.0b10 (Swofford, 2002) through a heuristic search in 1,000 random addition replicates with the tree-bisection-reconnection (TBR) chosen for the branch swapping algorithm. Each nucleotide site was analyzed independently as an equally-weighted unordered character. Gaps were treated as missing data. To assess the robustness of the tree, bootstrap supports of the nodes were calculated out of 1,000 pseudoreplicates in

PAUP* 4.0b10. For maximum likelihood (ML) analyses, phylogenetic trees were reconstructed using GARLI 2.0.1019 (Zwickl, 2006). The statistical robustness of each node was assessed by its bootstrap value calculated through a non-parametric bootstrap analysis using 100 pseudoreplicates.

Phylogenetic tree inference via Bayesian analyses was performed using MrBayes

3.2.1. For all datasets, two independent Metropolis-coupled MCMC (Markov Chain Monte

351

Carlo) processes with four simultaneous chains were run for 50 million generations and sampled every 1,000th generation. After the MCMC runs finished, convergence of the analysis was evaluated using Tracer v1.4.1 (Rambaut and Drummond, 2008) by examining the plots of generation number vs. log probability (-lnL) of the data as well as by assessing the potential scale reduction factors (PSRF) for each parameter. Information about PSRF was also retrieved by summarizing all the sampled parameter values using the sump command. To obtain the final Bayesian tree, the sumt command was executed to output a summarized consensus tree with posterior probabilities that express the nodal support

(strongly supported if higher than 0.95). The first twenty-five percent of the initial trees were discarded as the burn-in phase.

Three different partitioning strategies applied for the concatenated data matrix of all seven genetic markers (no partition, seven partitions, and 11 partitions; Table 4.3) were assessed for their performance relative to each other by employing the Bayes factor comparison (Kass and Raftery, 1995; Pagel and Meade, 2005). In comparing model x to model y, the Bayes factor of this comparison is the ratio of their marginal likelihoods. The marginal likelihood is the probability of the data under a particular model scaled by the prior probability of the models and subsequently integrated across all parameter values.

Because the converged MCMC yields the posterior probabilities rather than the prior probabilities, computing marginal likelihoods can be difficult in practice. One way to approximate marginal likelihoods from a MCMC method is to calculate the harmonic mean of the likelihoods of the data from the posterior distribution. The software TRACER 1.4

(Rambaut and Drummond, 2008) was used to obtain 2Ln Bayes factor based on the harmonic mean estimate under the “without-smoothing” option. 2Ln Bayes factor with

352 value above 10 is considered as very strong evidence to support the better partitioning strategy (Kass and Raftery, 1995).

To evaluate some alternative hypotheses of rasborin interrelationships, the

Shimodaira-Hasegawa test (SH test; Shimodaira and Hasegawa, 1999) and the Wilcoxon signed-ranks test (Templeton, 1983) were performed using PAUP* 4.0b10. Several alternative hypotheses based on the present morphological study (Chapter 3) were tested using topological constraints: (1) the constrained topologies of all clades strictly based on the present morphological phylogeny; (2) the sister group relationship of the genera

Pectenocypris and Amblypharyngodon; (3) the position of Rasbora cephalotaenia (type species) in the Argyrotaenia group; (4) the position of Rasbora cephalotaenia and R. tubbi in the Einthovenii group; (5) the hierarchical relationship among Brevibora, Trigonostigma and the Trifasciata group; (6) the sister group relationship of the Sumatrana group and the

Caudimaculata group (the Sumatrana group based on morphology); (7) the monophyly of the genus Trigonopoma; (8) the sister group relationship of the Kalimantan lineage and the

Western-Sundaland-Indochinese lineage of the Sumatrana group (see discussion); (9) the sister group relationship of the rubrodorsalis-steineri-assemblage and the Reticulata group

(see discussion). These constrained topologies were set up using MacClade 4.0 (Maddison and Maddison, 2000) and used to search the optimal trees to be subqsequently compared to the others.

In addition to the WS-R and SH tests, the constrained topology for the sister group relationship of Pectenocypris and Amblypharyngodon was also compared with the resultant molecular topology based on Bayes factor comparison using two methods for estimating marginal model likelihoods as implemented in MrBayes 3.2: (1) the harmonic mean

353 estimate of the likelihood values; and (2) the stepping stone method (Ronquist et al., 2011;

Ronquist et al, 2012). The harmonic mean estimate is practically the same method used in the present study for comparing which partition strategy is the best as explained above.

However, rather than using the software TRACER 1.4, MrBayes 3.2 was used for this particular alternative hypothesis test. In the stepping stone method, the marginal model likelihood calculated using the ss command is more accurate than the rough estimate of the harmonic mean calculated using the mcmc command followed by the sump command (i.e., the likelihood values from MCMC samples). Prior to comparing the two hypotheses, a hard constraint (allowing a certain topology to be forced as always present in the sampled trees) and a negative constraint (allowing to sample across all trees that do not contain a certain topology) should be specified. Then, the Bayes factors can be estimated based on the ratio of the marginal likelihoods of both constraints using the two methods (Ronquist et al.,

2011). The number of generation for MCMC analysis in the harmonic mean estimate was set to 400,000 generations. In the stepping stone method, the following settings were used:

50 steps with 5,000 generations each, for a total of 500,000 generations, and the diagnostics frequency for once every 2,500 generations.

RESULTS

Partitioning strategies

Results for assessing the relative performance of the three partitioning strategies [no partition (P0), seven partitions (P7), and eleven partitions (P11)] applied to the concatenated data matrix with all seven genetic markers using the Bayes factor comparison

354 are shown in Table 4.4. The eleven partitions strategy is favored over the other two partitioning strategies. The seven partitions strategy is favored over the no partition strategy.

Phylogenetic reconstruction

A dataset totalling 6,547 characters (including all nucleotides and gaps) was concatenated from multiply-aligned sequences of the seven different molecular markers.

The concatenated dataset contains 3,097 (47.3% of the 6,547) variable characters. Under the parsimony criterion, 2,334 (75.4%) of the total 3,097 variable sites are parsimony- informative characters (Table 4.3). The base composition across taxa was assessed based on the base-frequency information obtained using PAUP* 4.0b10. Accordingly, bias in the base composition across taxa is not evident here.

The parsimony analysis based on a concatenated dataset using PAUP* 4.0b resulted in one most parsimonious tree with a length of 18,083 steps, consistency index (CI) 0.28, retention index (RI) 0.50, and rescaled consistency index (RC) 0.14 (Figure 4.7). The MP bootstrapped majority-consensus tree is shown in Figure 4.8. All the trees reconstructed using GARLI 2.0 under likelihood methods based on the three different partitioning strategies yielded topologies reciprocally similar to each other (selected topology shown in

Figures 4.9). Bayesian analyses for the best partitioning strategies (eleven partitions) produced the tree as shown in Figure 4.10. Among the results of the three methods, the topology of the MP tree contradicts the most and is the least resolved, as reflected by a polytomy in the bootstrap 50% majority rule consensus (Figure 4.8). Although some major conflicts were evident, the topologies of ML and BI analyses correspond to the result of the parsimony analysis particularly in recovering some of the terminal clades, each of which

355 comprises the same constituent species. Some of these terminal clades correspond in part to species groups classified by previous authors (Brittan, 1954; Kottelat and Vidthayanon,

1993; Liao et al., 2010).

Phylogenetic relationships of Rasbora

Phylogenetic analyses using individual genetic markers recovered trees with different topologies relative to each other. Two markers, rhodopsin and COI, show the most conflicting topologies among others with respect to the backbone topology of the rasborin taxa (Figures 4.2 and 4.4). In the topology based on the nuclear rhodopsin gene

(Figure 4.4), the supragenus Rasbora was recovered as polyphyletic because the outgroup clade of chedrin+Leptobarbus+Parachela formed a sister group relationship with the

Indian lineage of Rasbora, whereas the more derived Sundaland lineage of Rasbora is sister to the genus Pectenocypris. Moreover, the genus Amblypharyngodon was resolved as the sister group of this clade composed of polyphyletic Rasbora, Pectenocypris,

Leptobarbus, and Parachela. In striking contrast, the topology based on the mitochondrial

COI recovered the genus Amblypharyngodon in a relatively more terminal clade together with all the non-Indian rasborin taxa (Figure 4.2). The other five genetic markers (16S rRNA, cytochrome b, EPIC 35692, EPIC 55305, and RAG1) produced trees with similar backbone topology, in which the supragenus Rasbora is recovered as paraphyletic due to the placement of the genus Pectenocypris in a clade together with all the non-Indian rasborin taxa (Figures 4.1 and 4.3). This backbone topology was also recovered in the analyses based on the dataset comprising all three mitochondrial markers (Figure 4.5) as well as the one composed of all the four nuclear markers (Figure 4.6).

356

The tree based on all mitochondrial markers (Figure 4.5) and the one based on all nuclear markers (Figure 4.6) primarily conflict in the position of the genus Pectenocypris and the sister group of the Einthovenii group. The genus Pectenocypris is recovered as sister to Clade A of the Sundaland-Indochinese lineage based on the analysis using all mitochondrial markers, whereas the genus is embedded more exclusively in Clade B based on the analysis using all nuclear markers. The Einthovenii group is recovered as sister to the Trifasciata group based on the analysis using all mitochondrial markers. In contrast, the analysis using all nuclear markers recovered the Einthovenii group as the sister clade to the rest of Clade B including the genus Pectenocypris.

All the trees that resulted from the three different phylogenetic methods (MP, ML, and BI) using the concatenated dataset (seven markers) consistently recovered the supragenus Rasbora as paraphyletic because the outgroup genus Pectenocypris is nested inside one of the two major lineages of Rasbora, the Sundaland-Indochinese lineage, the strongly-supported largest rasborin clade (Figures 4.1–4). In fact, in ML and BI analyses,

Pectenocypris was consistently nested inside Clade B, one of the two more exclusive clades forming the Sundaland-Indochinese lineage. Despite its poorly-resolved topology,

Clade B of the Sundaland-Indochinese lineage is recovered consistently and strongly supported in ML and BI analyses of all the datasets with bootstrap support (hereafter bs) =

100% and Bayesian posterior probability (hereafter pp) = 1.0]. More inclusively, in all analyses (MP, ML, and BI) using all the datasets, the Clade Rasbora + Pectenocypris was consistently resolved to be the sister group of the genus Amblypharyngodon, both of which reciprocally form a strongly supported monophyletic group: the tribe Rasborini (MP-bb =

97%; ML-bb = 100%; pp = 1.0).

357

Major monophyletic groups in Rasbora

Overall, all molecular trees inferred based on the concatenated dataset of all seven genetic markers using three phylogenetic approaches (MP, ML, and BI) show similar topologies towards the base of the tree (Figures 4.7–4.10). Two major clades of the supragenus Rasbora were consistently recovered in all the resulting trees with high support: (1) the Indian lineage (MP-bs = 100%; ML-bs = 98%; pp = 1.0); and (2) the

Sundaland-Indochinese lineage (bs = 100%; pp = 1.0). In the first clade, the Indian lineage, all three Indian species of the supragenus Rasbora sampled in this analysis were recovered:

R. daniconius, Horadandia atukorali, and Rasboroides vaterifloris. In all ML and BI trees, two major subgroups were resolved and together form the Sundaland-Indochinese lineage:

(1) Clade A comprising some of the miniaturized rasborins, Boraras, Trigonopoma,

Kottelatia, and Rasbora kalbarensis; and (2) Clade B composed of some major species groups of Rasbora recognized by previous authors (Brittan, 1954; Kottelat and

Vidthayanon, 1993; Liao et al., 2010), the Einthovenii group, the Trifasciata group, the

Argyrotaenia group, the genus Brevibora, the genus Trigonostigma, the Caudimaculata group, the Sumatrana group, and the rasborin outgroup, the genus Pectenocypris. In contrast, despite indicating the dichotomy of the Sundaland-Indochinese lineage, the topology of the most parsimonious tree does not reciprocally recover Clade A and Clade B because the Einthovenii group together with Clade A forms a sister group, herein termed

Clade A+E (Figure 4.7). Nevertheless, the backbone of the Sundaland-Indochinese lineage in the MP tree is poorly resolved as indicated by the polytomy of seven lineages in its bootstrap 50% majority rule consensus tree (Figure 4.8).

358

As noted above, all the analyses (MP, ML, and BI) of all concatenated datasets consistently recovered several strongly-supported terminal clades, which correspond in part to some species groups classified by previous authors (Brittan, 1954; Kottelat and

Vidthayanon, 1993; Liao et al., 2010). Taking into account the traditional classification and the morphological results of this study, 15 lineages are recognized based primarily on the molecular topologies.

The Indian lineage was consistently inferred with high nodal supports in all analyses (MP-bs = 97%; ML-bs = 100%; and BI-pp = 1.0). This clade comprises three species: Rasbora daniconius, Horadandia atukorali, and Rasboroides vaterifloris. Rasbora daniconius has been classified in the Daniconius group together with some other large

Indian Rasbora such as R. caverii, R. dandia, R. wilpitta, and R. armitagei, which were not sampled in the present molecular study. Nevertheless, the morphological study (Chapter 3) has recovered a clade comprising the constituent species of the Daniconius group.

Therefore, it is predicted that the other species of the Daniconius group unsampled herein may form a clade with R. daniconius. In light of morphology, two major groups within the

Indian lineage of Rasbora are identified: the Daniconius group and Clade

Horadandia+Rasboroides.

The Sundaland-Indochinese Clade A comprises three genera, Kottelatia,

Trigonopoma, Boraras, and a species incertae sedis, Rasbora kalbarensis. In nearly all analyses, the backbone of Clade A was not fully resolved primarily because of the low nodal supports of Kottelatia and Rasbora kalbarensis. All analyses poorly to strongly recovered Trigonopoma pauciperforatum as sister to the genus Boraras (MP-bs = 64%;

ML-bs = 92%; pp =0.73), whereas the strongly-supported monophyletic assemblage of

359

Trigonopoma gracile was inconsistently recovered as sister to R. kalbarensis. Therefore, the genus Trigonopoma is not monophyletic. Clade A is composed of three lineages: (1)

Kottelatia-R. kalbarensis, (2) Boraras-Trigonopoma pauciperforatum, and (3)

Trigonopoma gracile.

A clade branching from the most basal node of the Sundaland-Indochinese Clade B was recovered in ML and BI analyses. In contrast, MP analyses resulted in the Einthovenii group being placed as sister to Clade A with low nodal support (<50%). Two constituent species of this group, Rasbora cephalotaenia and R. tubbi, are considered the wild-card taxa of this study with regard to the different placement of these taxa depending on the analytical method employed.

A second major group in Clade B was consistently formed and strongly supported in all analyses (MP-bs = 98%; ML-bs = 100%; pp = 1.0). This monophyletic lineage comprises Rasbora bankanensis, R. paucisqualis, R. sarawakensis, R. lacrimula, R. trifasciata, R. rutteni, Rasbora sp. 8, Rasbora sp. 9, and Rasbora sp. 10, seven of which have been classified in the Trifasciata group. Given the placement of the type species of the

Trifasciata group, R. trifasciata, inside this terminal clade, it is called the Trifasciata group.

A third monophyletic group in Clade B is strongly supported in ML and BI analyses (ML-bs = 100%; pp = 1.0), but weakly in MP (<50%). This terminal clade comprises some large-sized species (Rasbora argyrotaenia, R. aurotaenia, R. borapetensis,

R. dusonensis, R. myersi, and R. tornieri) and a small-sized R. borapetensis. Except for R. borapetensis, all the constituent species were previously classified in the Argyrotaenia group.

360

A fourth major group in Clade B, comprising Rasbosoma spilocerca, R. subtilis, R. cf. caudimaculata, and R. trilineata, was consistently resolved in all analyses (MP-bs =

100%; ML-bs = 100%; pp = 1.0). All the members of this clade, including the monotypic genus Rasbosoma, have been classified in the Caudimaculata group.

A fifth small monophyletic group in Clade B comprising the genus Brevibora was consistently recovered in all analyses (MP-bs = 100%; ML-bs = 100%; pp = 1.0). Sister to

Brevibora, a sixth group in Clade B is consistently resolved with strong support (MP-bs =

100%; ML-bs = 100%; pp = 1.0), which is composed of all species of the genus

Trigonostigma: Trigonopoma heteromorpha, T. espei, and T. hengeli.

A seventh monophyletic group in Clade B comprising Rasbora calliura, R. volzifasicata, and R. cf. sumatrana is poorly supported in ML analyses (ML-bs = 67% ), but moderately to strongly supported in MP and BI analyses (MP-bs = 87%; pp = 1.0). The three Bornean species had been classified in the Sumatrana group and apparently placed as sister to a clade comprising the former constituent species of the Sumatrana group and the

Reticulata group (see below). Because the three constituent species live in Kalimantan, the group is informally called the Kalimantan lineage of the Sumatrana group (see discussion for details).

All analyses (MP, ML, and BI) consistently recovered the eighth major group in

Clade B (MP-bs = 100%; ML-bs = 100%; pp = 1.0), which comprises R. api, R. meinkeni,

R. tobana, R. vulcanus, R. nodulosa, R. truncata, and R. kluetensis. Two of these species,

R. meinkeni and R. tobana, were previously classified in the Trifasciata group. To acknowledge its more terminal placement apart from the remainder of the Trifasciata group, this major group is named, the Reticulata group (see discussion for details).

361

A ninth group in Clade B comprising two species, R. rubrodorsalis and R. steineri, was consistently inferred with high nodal support in MP and BI analyses (ML-bs = 100%; pp = 1.0), whereas moderately supported in MP analyses (MP-bs = 79%). The assemblage formed by R. rubrodorsalis and R. steineri (termed the rubrodorsalis-steineri-assemblage hereafter) is sister to the species-rich Sumatrana group.

A tenth major group in Clade B comprising the remainder of the constituent species of the Sumatrana group is consistently resolved and strongly supported in all analyses (MP- bs = 89%; ML-bs = 100%; pp = 1.0). This group is informally called the Western

Sundaland-Indochinese lineage of the Sumatrana group (see discussion).

Hypothesis testing

Results for testing alternative hypotheses of the rasborin relationships using WS-R test and SH test are shown in Table 4.5. The two tests resulted in the recognition of the

Bayesian tree based on the concatenated molecular dataset of all seven genetic markers

(Figure 4.10) as the best hypothesis of the total 10 constrained topologies being tested, in which the supergenus Rasbora is paraphyletic as the genus Pectenocypris is embedded in the Sundaland-Indochinese rasborin lineage. The morphological hypothesis, in which all clade topologies were constrained based on the most parsimonious morphological tree

(Figure 3.28), was strongly rejected by WS-R and SH tests (P < 0.01). The sister group relationship of the genera Pectenocypris and Amblypharyngodon is strongly rejected by

WS-R and SH tests (P ≤ 0.01). Out of six constrained topologies for the more exclusive rasborin clades being tested, four alternative hypotheses (the sister group of the

Caudimaculata and the Sumatrana groups; the inclusion of Rasbora cephalotaenia in the

Argyrotaenia group; the monophyly of the Sumatrana group; and the sister group of

362

Brevibora, Trigonostigma, and the Trifasciata group) are strongly rejected by both WS-R and SH tests (P ≤ 0.06). In contrast, the sister group relationship of the rubrodorsalis- steineri-assemblage and the Reticulata group is rejected only by WS-R test (P = 0.08). In contrast, both WS-R test (P = 0.799) and SH test (P = 0.730) did not reject the monophyly of the genus Trigonopoma.

Results of testing the sister group relationship of the genera Pectenocypris and

Amblypharyngodon using Bayes factor comparison as implemented in MrBayes 3.2 (via the harmonic mean estimate and the stepping stone method) are shown in table 4.6. Based on the harmonic mean estimate, the sister group relationship of the genera Pectenocypris and Amblypharyngodon is very strongly supported by Bayes factor comparison (about 559 log likelihood units). In striking contrast, the molecular topology (the genus Pectenocypris is embedded in the supergenus Rasbora) is very strongly supported in the stepping stone method via Bayes factor comparison (about 47 log likelihood units).

DISCUSSION

Monophyly of Rasbora

Given that Pectenocypris is consistently nested inside the strongly-supported

Sundaland-Indochinese Clade B as in all the resulting molecular trees (MP, ML, and BI), coupled with the results of alternative hypotheses testing (WS-R test, SH test, and the stepping stone method; Tables 4.5 and 4.6) favoring such topology, the monophyly of the supragenus Rasbora is rejected in the present molecular study. The paraphyly of Rasbora due to the recovery of Pectenocypris as its ingroup was also evident in the previous

363 molecular studies (Rüber et al., 2007; Tang et al., 2010), but the present study differs from the previous ones in the placement of Pectenocypris, particularly regarding its sister taxon relationship. In contrast, the ML tree of Rüber et al. (2007) recovered Pectenocypris as sister to Trigonopoma pauciperforatum, a miniaturized species presently placed in the

Sundaland-Indochinese Clade A,whereas, the topology of Tang et al. (2010) indicates that

Pectenocypris is nested more basally in the clade Rasborini, sister to Rasbora daniconius, altogether forming a weakly-supported clade. These inconsistencies on the phylogenetic placement of Pectenocypris may reflect long-branch attraction.

The present molecular results clearly conflict with the morphological topology

(Chapter 3), which strongly supports the monophyly of the supragenus Rasbora. According to the morphological tree (Figure 3.28), the genus Pectenocypris was recovered as the sister taxon of the genus Amblypharyngodon. Based on a series of hypothesis tests for different alternative topologies (WS-R test, SH test, and the stepping stone method), the sister group relationship between Pectenocypris and Amblypharyngodon was strongly rejected.

Nevertheless, the harmonic mean estimate indicates very strong evidence in favor of

Pectenocypris and Amblypharyngodon being each others closest relative and the supergenus Rasbora as the sister group. A discussion on the discrepancies between the morphological and molecular results, particularly on the subject of the monophyly of

Rasbora, is given in Chapter 5.

Taxonomic implications

The monophyly of each of three valid non-monotypic genera within the supragenus

Rasbora (Boraras, Brevibora, and Trigonostigma) is confirmed with high nodal supports in the present molecular study. This corroborates the results of the present and previous

364 morphological studies (Liao et al., 2010), which have provided a series of shared derived characters to diagnose the three taxa. Given the results of the alternative hypothesis testing as best hypothesis (Table 4.5), coupled with the support based on the partitioning strategies test (Table 4.4), I select the Bayesian tree based on the concatenated dataset of all seven markers with eleven partitions (Figure 4.10) as the preferred hypothesis in this molecular study.

A clade of mainly miniaturized rasborins (Boraras, Trigonopoma, Rasbora kalbarensis, and moderate-size Kottelatia) is recovered within the more inclusive

Sundaland-Indochinese lineage. Some other miniaturized rasborins, such as Horadandia atukorali and Rasboroides vaterifloris, were placed more basal in the topology. In fact, nested in the more terminal clades are the Sundaland diminutive rasborin genera:

Trigonostigma and Rasbosoma. The scattered placement of miniaturized Rasbora throughout the topology was corroborated in the morphological analysis of this dissertation

(Chapter 3). Therefore, the phylogenetic dichotomy based on body size as hypothesized by

Liao et al. (2010) is rejected in this study, which supports the hypothesis that miniaturization in Rasbora has evolved independently in different lineages.

The former Trifasciata group as classified by previous authors (e. g., Brittan, 1954;

Kottelat and Vidthayanon, 1993; Liao et al., 2010) is herein recovered as paraphyletic as two of its putative members (Rasbora meinkeni and R. tobana) are excluded and form another monophyletic assemblage, which is nested in a more terminal and larger clade together with species previously classified in the Caudimaculata group and the Sumatrana group. In this study, a clade was consistently resolved that contains the remaining species of the former Trifasciata group including its type species, Rasbora trifasciata.

365

The Caudimaculata group is consistently recovered as monophyletic with strong nodal supports in all molecular trees, placed as the sister to a larger terminal clade composed mostly of the Sumatrana group and the Reticulata group. Nested basally in the

Caudimaculata group is the monotypic genus recently elevated by Liao et al. (2010),

Rasbosoma. The other species composing the Caudimaculata group are Rasbora subtilis, R. cf. caudimaculata, and R. trilineata. Although the revision of the entire group as a new genus is necessary, the phylogenetic placement of the genus Rasbosoma in the

Caudimaculata group consequently makes its generic name available for this in accordance with the principle of priority of the International Code of Zoological Nomenclature (Article

23).

As noted above, Rasbora meinkeni and R. tobana, together with five other valid species sampled in this study (R. api, R. kluetensis, R. nodulosa, R. truncata, and R. vulcanus), and an undescribed species (Rasbora sp. 9), form a monophyletic group, which I call the Reticulata group, sister to the clade comprising the Sumatrana group in part. The

Reticulata group is recognized and classified as a species group for the first time in this study; it is named after the first species described in the group: R. reticulata. It is noteworthy that the distribution of this monophyletic group appears to be geographically constrained; it is endemic to Sumatra and its adjacent islands, particularly the northern and western portion of Sumatra.

All species formerly considered to be the members of the Sumatrana group as classified by Liao et al. (2010) were recovered as paraphyletic in this study. This is mainly due to the placement of the Reticulata group as well as two other species formerly classified in different species groups, R. rubrodorsalis and R. steineri, which are embedded

366 in the clade containing the former Sumatrana group. In comparison, the brilliantly-colored

Rasbora rubrodorsalis and R. steineri are morphologically distinct compared to the more bland, plain silverish species of the Sumatrana group. Interestingly, however, this paraphyly divides all the formerly constituent species of the Sumatrana group into two geographically distinct assemblages: (1) the Kalimantan lineage, which is more basal and less diverse, with the species distribution restricted to southern and eastern Borneo; and (2) the western-Sundaland-Indochinese lineage, which is more terminal and more species-rich, with its constituent species widely distributed throughout Indochina and western Sundaland

(except for the aforementioned parts of Borneo). The assemblage formed by R. rubrodorsalis and R. steineri (termed the rubrodorsalis-steineri-assemblage hereafter) is sister to the western-Sundaland-Indochinese lineage, which together form a larger clade that is sister to the Reticulata group. Sister to the Kalimantan lineage is the more inclusive clade comprising the Reticulata group, the rubrodorsalis-steineri-assemblage, and the western-Sundaland-Indochinese lineage. Three species that comprise the Kalimantan lineage (Rasbora calliura, R. volzifasciata, and Rasbora n. sp. 8) are distributed allopatrically in the eastern and southern parts of Borneo. Nevertheless, it is noteworthy that based on the SH test for alternative hypotheses using a constrained topology, the sister group relationship of the rubrodorsalis-steineri-assemblage and the Reticulata group was not rejected.

367

Figure 4.1. The Bayesian consensus phylogram inferred from mitochondrial 16S rRNA sequenced from 93 cyprinids. Nodal supports represented by posterior probabilities indicated by numbers above the branches. Major clades highlighted in colored squares.

More terminal assemblages corresponding to species groups are labeled on the right, with the branches and the constituent species differentiated by color.

368

369

Figure 4.2. The Bayesian consensus phylogram inferred from mitochondrial COI sequenced from 93 cyprinids. Nodal supports represented by posterior probabilities indicated by numbers above the branches. Major clades highlighted in colored squares.

More terminal assemblages corresponding to species groups are labeled on the right, with the branches and the constituent species differentiated by color.

370

371

Figure 4.3. The Bayesian consensus phylogram inferred from mitochondrial cytochrome b sequenced from 93 cyprinids. Nodal supports represented by posterior probabilities indicated by numbers above the branches. Major clades highlighted in colored squares.

More terminal assemblages corresponding to species groups are labeled on the right, with the branches and the constituent species differentiated by color.

372

373

Figure 4.4. The Bayesian consensus phylogram inferred from nuclear Rhodopsin gene sequenced from 93 cyprinids. Nodal supports represented by posterior probabilities indicated by numbers above the branches. Major clades highlighted in colored squares.

More terminal assemblages corresponding to species groups are labeled on the right, with the branches and the constituent species differentiated by color.

374

375

Figure 4.5. The Bayesian consensus phylogram inferred from a concatenated dataset of three mitochondrial markers (16S rRNA, COI, and cytochrome b) sequenced from 93 cyprinids. Nodal supports represented by posterior probabilities indicated by numbers above the branches. Major clades highlighted in colored squares. More terminal assemblages corresponding to species groups are labeled on the right, with the branches and the constituent species differentiated by color.

376

377

Figure 4.6. The Bayesian consensus phylogram inferred from a concatenated dataset of four nuclear markers (EPIC 55305, EPIC 35692, RAG1, and Rhodopsin) sequenced from

93 cyprinids. Nodal supports represented by posterior probabilities indicated by numbers above the branches. Major clades highlighted in colored squares. More terminal assemblages corresponding to species groups are labeled on the right, with the branches and the constituent species differentiated by color.

378

379

Figure 4.7. The most parsimonious tree (length = 18,983 steps; CI = 0.28; RI = 0.50; RC =

0.14) inferred from the dataset concatenated from seven phylogenetic markers sequenced from 93 cyprinids (12 outgroups, 81 ingroups). Major clades are highlighted in colored squares. More terminal assemblages corresponding to species groups are labeled on the right, with the branches and the constituent species differentiated by color

380

381

Figure 4.8. The 50% majority rule consensus tree of the 1,000 pseudoreplicates from the non-parametric bootstrap analyses under parsimony algorithm of the concatenated dataset

(a total of seven phylogenetic markers) from 93 cyprinids. Nodal supports represented by bootstrap values are indicated by numbers adjacent to the branches.

382

383

Figure 4.9. Maximum likelihood tree inferred from a concatenated dataset of seven phylogenetic markers sequenced from 93 cyprinids. Nodal supports represented by bootstrap values are indicated by numbers adjacent to the branches. Major clades highlighted in colored squares. More terminal assemblages corresponding to species groups are labeled on the right, with the branches and the constituent species differentiated by color.

384

385

Figure 4.10. The Bayesian consensus phylogram inferred from a concatenated dataset of seven phylogenetic markers sequenced from 93 cyprinids. Nodal supports represented by posterior probabilities indicated by numbers above the branches. Major clades highlighted in colored squares. More terminal assemblages corresponding to species groups are labeled on the right, with the branches and the constituent species differentiated by color.

386

387

Table 4.1. List of taxa used in the molecular analysis of this study with voucher numbers and localities. Classification of rasborin clades based on the preferred molecular phylogeny of this study (see Figure 4.10). Institutional abbreviations : ANSP = Academy of Natural

Sciences of Drexel University (Philadelphia); BMNH = The Natural History Museum (London, United Kingdom); CBM-ZF = Natural

History Museum and Insitute (Chiba, Japan); MZB = Museum Zoologicum Bogoriense (Cibinong, Indonesia); UAIC = University of

Alabama Ichthyological Collection (Tuscaloosa); UF = Florida Museum of Natural History (Gainesville); USNM = National Museum of

Natural History (Smithsonian Institution; Washington, DC); ZRC = Zoological Reference Collection (The Raffles Museum; Singapore).

Clades Species Voucher number Locality

Horadandia+ Horadandia atukorali uncatalogued Aquarium trade Rasboroides Rasboroides vaterifloris uncatalogued Aquarium trade

The Daniconius Rasbora daniconius BMNH uncatalogued Myanmar (LR2251) group

The Einthovenii Rasbora cephalotaenia ZRC uncatalogued Indonesia, Sumatra, Jambi (THH December 2003) group R. einthovenii UF 160953 Malaysia, Malay Peninsula, Johor, Kota Tinggi R. jacobsoni MZB uncataloged Indonesia, Aceh (BDS21) R. kalochroma ZRC uncatalogued Indonesia, Borneo, Kalimantan Tengah (THH 2007) R. kottelati ZRC uncatalogued Brunei, Merimbun (THH June 2002) R. tubbi ZRC uncatalogued Brunei, Borneo (THH01-88)

Kottelatia Kottelatia brittani ZRC uncatalogued Indonesia, Sumatra, Jambi (THH August 2006)

388

Rasbora kalbarensis ZRC uncatalogued Indonesia, Kalimantan Barat (THH)

Trigonopoma Trigonopoma cf. gracile MZB uncatalogued Indonesia, Borneo, Kalimantan Selatan (TGK) T. cf. gracile (TMS) MZB uncatalogued Indonesia, Sumatra, Riau T. cf. gracile (UF) UF 173539 Malaysia, Malay Peninsula, Pahang, Sengai Nangka Rasbora sp. 2 UF uncatalogued T. pauciperforatum MZB uncataloged Indonesia, Sumatra, Riau

Boraras Boraras brigittae uncatalogued Aquarium trade B. maculata uncatalogued Aquarium trade B. merah uncatalogued Aquarium trade B. micros UF 173267 Thailand, Surathani, Mae Nam Ta Pi B. urophthalmoides UF 173258 Thailand, Chachoengsao, Mae Nam Bang Pakong

The Trifasciata Rasbora bankanensis MZB uncataloged Indonesia, Sumatra, Riau group R. lacrimula MZB 19238 Indonesia, Borneo, Kalimantan Timur R. paucisqualis USNM 230222 Indonesia, West Kalimantan, Sungai Melawi R. sarawakensis ZRC uncatalogued Malaysia, Borneo, Sarawak, Serian. R. trifasciata ZRC uncagalogued Indonesia, Kalimantan Timur, Kayan, Bahau Rasbora n. sp. 5 MZB uncatalogued Indonesia, Borneo, Kalimantan Selatan (semburatungu) Rasbora n. sp. 6 MZB uncatalogued Indonesia, Borneo, Kalimantan Selatan (matadiekor) Rasbora n. sp. 7 (bagus) MZB uncatalogued Indonesia, Borneo, Kalimantan Selatan Rasbora n. sp. 8 (apioid) MZB uncatalogued Indonesia, Borneo, Kalimantan Timur

389

Brevibora Brevibora dorsiocellata MZB uncatalogued Indonesia, Sumatra, Riau, Pekanbaru B. cheeya MZB uncatalogued Indonesia, Sumatra, Riau, Kerinci

Trigonostigma Trigonostigma espei ZRC uncatalogued Thailand, Krabi (THH) T. hengeli MZB uncatalogued Aquarium trade T. heteromorpha MZB uncatalogued Aquarium trade

The Argyrotaenia Rasbora argyrotaenia MZB uncatalogued Indonesia, Java, Jawa Barat, Depok group R. aurotaenia ANSP 179925 Thailand, Ubon, Mekong River, Khong Chiam. R. borapetensis ANSP 179908 Thailand, Mae Nam Bang Pakong, Khlong Phra Prong R. dusonensis (TGK) USNM 393971 Indonesia, Borneo, Kalimantan Selatan (TGK 11) R. cf. dusonensis (TMS) MZB uncatalogued Indonesia, Sumatra, Riau, Siak River R. cf. dusonensis (UF) UF 173527 Malaysia, Malay Peninsula, Johor, Sungai Semberong R. myersi MZB uncatalogued Indonesia, Sumatra, Riau R. tornieri MZB uncatalogued Indonesia, Sumatra, Riau, Siak River Rasbora sp. (ANSP) ANSP 178878 Thailand, Mae Nam Chao Phraya, Bang Pa-In

Rasbosoma Rasbosoma spilocerca UAIC 14184.03 Thailand, Mekong River (The Rasbora caudimaculata ZRC uncatalogued Brunei, Borneo, Merimbun (THH June 2002) Caudimaculata Rasbora subtilis USNM 393736 Indonesia, Borneo, Kalimantan Selatan, Amuntai area group) Rasbora trilineata MZB uncatalogued Indonesia, Sumatra, Riau, Seberida (TMS 05)

The Sumatrana R. calliura ZRC uncatalogued Malaysia, Borneo, Sarawak, Lundu (THH March 2010) group R. cf. sumatrana 4 (TGK) MZB uncatalogued Indonesia, Borneo, Kalimantan Selatan, Kusan (the Kalimantan R. volzi (volzifasciata) ZRC uncatalogued Indonesia, Borneo, Kalimatan Timur, Kayan (THH 1999) lineage)

390

The Reticulata Rasbora api MZB uncatalogued Indonesia, Sumatra, Tapanuli Tengah (BDS 54) group R. cf. api MZB uncatalogued Indonesia, Sumatra, Pariaman R. kluetensis USNM uncatalogued Indonesia, Sumatra, Aceh, Kluet R. meinkeni MZB uncatalogued Indonesia, Sumatra, Aceh, Lake Laut Tawar R. nodulosa MZB uncatalogued Indonesia, Sumatra, Aceh, Tangan-tangan R. tobana MZB uncatalogued Indonesia, Sumatra, Toba-Samosir, Desa Nauli R. truncata MZB uncatalogued Indonesia, Sumatra, Aceh, Alas River R. vulcanus MZB uncatalogued Aquarium trade

The steineri- Rasbora rubrodorsalis MZB uncatalogued Aquarium trade rubrodorsalis R. steineri ZRC uncatalogued China, Hainan, Baoting (THH05-72) assemblage

The Sumatrana Rasbora aprotaenia MZB uncatalogued Indonesia, Java, Banten, Rawa Danau group R. baliensis MZB uncatalogued Indonesia, Bali (the Western- R. cf. caudimaculata ANSP 179822 Thailand, Kanchanaburi, Mae Nam Khwae Noi Sundaland- (ANSP) Indochinese R. elegans MZB uncatalogued Indonesia, Sumatra, Riau, Rengat lineage) R. hosii ZRC uncatalogued Malaysia, Borneo, Sarawak, Lindu Area R. lateristriata MZB uncatalogued Indonesia, Java, Jawa Barat, Bodogol R. rasbora BMNH LR2234 Myanmar R. spilotaenia UF (2005-0813) Indonesia, Sumatra R. paviana UF 170284 Thailand, Chonburi R. cf. sumatrana 1 (ANSP) ANSP 179980 Thailand, Mae Nam Tapi R. cf. sumatrana 2 (CTOL) UAIC 14166.40 Aquarium trade R. cf. sumatrana 3 MZB uncatalogued Indonesia, Sumatra, Pariaman (Pariaman) R. tawarensis MZB uncatalogued Indonesia, Sumatra, Aceh, Lake Laut Tawar

391

R. cf. tubbi UAIC 14285.01 Brunei Darussalam, Borneo R. vulgaris UAIC 14257.03 Thailand, Phang-nga Rasbora n. sp. 1 USNM 390053 Indonesia, Sumatra, Aceh, Kluet, Lawe Sawah (arundinata) Rasbora n. sp. 2 (haru) ZRC uncatalogued Indonesia, Sumatra, Karo, Lau Kawar (THH 09-35) Rasbora n. sp. 3 MZB 21120 Indonesia, Sumatra, Lake Maninjau (maninjau) Rasbora n. sp. 4 MZB uncatalogued Indonesia, Sumatra, Tapanuli Selatan, Aek Sarulla (bindumatogu)

OUTGROUP

Tribe Rasborini Amblypharyngodon UF 173215 Thailand, Ubon Ratchathani, Mun River chulabornae Amblypharyngodon mola CBM-ZF-11790 Nepal, Koshi Barrage Pectenocypris korthausae MZB uncatalogued Indonesia, Sumatra, Riau (TMS03) Pectenocypris ZRC uncatalogued Indonesia, Sumatra, Jambi (THH, July 2002) micromysticetus

Tribe Danionini Danio rerio Genbank Devario aequipinnatus UF 173254 Thailand, Kanchanaburi, Mae Nam Khwae Noi Esomus metallicus MZB uncatalogued Indonesia, Sumatra, Riau

Tribe Chedrini Opsarius koratensis UF 173135 Thailand, Kanchanaburi, Mae Nam Khwae Noi Raiamas guttatus ANSP 179928 Thailand, Mekong River, Khong Chiam Sundadanio cf. axelrodi ZRC uncatalogued Malaysia, Borneo, Sarawak, Nibung (THH 08-42)

Subfamily Puntius binotatus MZB uncatalogued Indonesia, Bali

392

Cyprininae

Subfamily Leptobarbus hoevenii ZRC 41947 Indonesia, Sumatra, Jambi Leptobarbinae

Subfamily Parachela oxygastroides MZB uncatalogued Indonesia, Borneo, Kalimantan Selatan Cultrinae

393

Table 4.2. List of primers used in PCR and sequencing reactions

Primer name Sequence (5' to 3') Reference

16S rRNA 16S ar-H CCGGTCTGAACTCAGATCACGT Kocher et al.(1989) 16s ar-L CGCCTGTTTATCAAAAACAT Kocher et al. (1989)

COI CO1LBC_F TCAACYAATCAYAAAGATATYGGCAC Ward et al.(2005) CO1HBC_R ACTTCYGGGTGRCCRAARAATCA Ward et al.(2005)

Cytochrome b LA-cyp ATGGCAAGCCTACGAAAAAC Tang et al.(2010) LA-danio GACTYGAARAACCACYGTTG Mayden et al.(2007) HA-cyp TCGGATTACAAGACCGATGCTT Tang et al.(2010) HA-danio CTCCGATCTTCGGATTACAAG Mayden et al.(2007)

EPIC 55305 55305E1-F CCTAGTGGACTGTARTAACGCCCCYCT Li et al.(2010) 55305E1-R AAGCCATCCAGTTTGCATAAACACTATC Li et al.(2010)

EPIC 35692 35692E1-F CCAAGAAGGACTGGTAYGATGTCAAG unpublished 35692E1-R ACTTCTTVACCATGGAGCACATCTTG unpublished

RAG1 (Recombination activating gene 1) R1 2914F ATGGGAGATGTCAGTGARAA Tang et al.(2010) R1 4061R AATACTTGGAGGTGTAGAGCCAGT Chen et al.(2003) RAG1F1 CTGAGCTGCAGTCAGTACCATAAGATGT López et al.(2004) RAG1R1 CTGAGTCCTTGTGAGCTTCCATRAAYTT López et al.(2004)

Rhodopsin Rh 193F CNTATGAATAYCCTCAGTACTACC Chen et al.(2003) Rh 1039R TGCTTGTTCATGCAGATGTAGA Chen et al.(2003)

394

Table 4.2. DNA fragments used as phylogenetic markers with subdivisions based on molecular characteristics (i.e., exon-intron, codon position). Quantitative descriptions of each fragment’s variability and parsimony informativeness are given in number of base pair and percentage. Three different partitioning strategies including the best-fit model for each partitioning are listed.

DNA fragments Total Constant Variable Parsimony Model length Informative 11 partitions 7 partitions single partition EPIC 35692 711 352 (49.50%) 359 (50.49%) 265 (37.27%) length exon 123 90 (73.17%) 33 (26.83%) 20 (16.26%) TPM2uf + Γ HKY + Γ intron 588 262 (44.56%) 326 (55.44%) 245 (41.67%) EPIC 55305 1,146 494 (43.11%) 652 (56.89%) 429 (37.43%) (2 EPICs comb.) exon 57 49 (85.97%) 8 (14.03%) 7 (12.28%) TIM3 + I + Γ intron 1,089 445 (40.86%) 644 (59.14%) 422 (38.75%) RAG1 1,497 905 (60.45%) 592 (39.55%) 441 (29.46%) 1st codon 499 399 (79.96%) 100 (20.04%) 61 (12.22%) TVM + I + Γ TPM2 2nd codon 499 452 (90.58%) 47 (94.19%) 23 (4.60%) HKY + I + Γ 3rd codon 499 54 (10.82%) 445 (89.18%) 357 (71.54%) TPM2uf + Γ Rhodopsin 819 527 (64.35%) 292 (35.65%) 210 (25.64%) 1st codon 273 208 (76.19%) 65 (23.81%) 41 (15.02%) TrNef + Γ GTR + I + Γ TIM2ef + I + Γ 2nd codon 273 241 (88.28%) 32 (11.72%) 17 (6.23%) JC + I 3rd codon 273 78 (28.57%) 195 (71.43%) 152 (55.68%) TPM3uf + Γ 16S rRNA 634 341 (53.78%) 293 (46.22%) 236 (37.22%) GTR + I + Γ GTR + I + Γ COI 657 353 (53.73%) 304 (46.27%) 265 (40.34%) 1st codon 219 153 (69.86%) 66 (30.14%) 43 (19.635%) GTR + I + Γ (COI+cytb TPM1 + Γ 2nd codon 219 199 (90.87%) 20 (9.13%) 7 (3.20%) 1st codon) 3rd codon 219 1 (0.46%) 218 (99.54%) 215 (98.17%) HKY + I + Γ (COI+cytb 2nd codon) Cytochrome b 1,083 475 (43.86%) 608 (56.14%) 553 (51.06%)

1st codon 361 201 (55.68%) 160 (44.32%) 141 (39.06%) TrN + Γ (COI+cytb TVM + I + Γ 2nd codon 361 272 (75.35%) 89 (24.65%) 65 (18.01%) 3rd codon) 3rd codon 361 2 (0.55%) 359 (95.45%) 347 (96.12%)

395

Table 4.4. Assessment of the relative performance of the different partitioning strategies for the concatenated dataset of all seven genetic markers in the Bayesian analyses using

Bayes factor comparison. Partitioning strategies are shown as P0 (no partition), P7 (seven partitions), and P11 (eleven partitions). Italic values along the diagonal are the harmonic mean likelihood for each partitioning strategy. Bold values below the diagonal are 2ln

Bayes factors with rows representing the H0 and columns the H1. Hypotheses with a value of 2 Ln Bayes factors > 10 are considered as very strongly supported (Kass and Raftery,

1995).

Partitioning P0 P7 P11 strategy

P0 -93308.39

P7 6513.02 -90051.88

P11 10727.96 4214.94 -87944.41

396

Table 4.5. Test of alternative hypotheses of rasborin interrelationships using parsimony- based Wilcoxon signed-ranks test (WS-R; Templeton, 1983) and likelihood-based

Shimodaira-Hasegawa test (SH; Shimodaira and Hasegawa, 1999). The following results are shown: the differences in tree lengths (ΔTL) and in likelihood scores (Δ-lnL) among topologically-unconstrained hypotheses and the best hypothesis; and the P-values for each test (WS-R and SH). Significant difference is indicated with an asterisk (*) at P<0.05.

Hypotheses ΔTL WS-R Δ-lnL SH

Bayesian tree (7 markers; 11 partitions) (best) (best)

ML tree (7 markers; 11 partitions) 7 0.281 3.643 0.976

Topology based on morphology 249 <0.001* 970.178 0.000*

Amblypharyngodon + Pectenocypris 67 <0.001* 243.408 0.001* (Pectenocyprinina)

Trigonopoma monophyly 8 0.799 24.819 0.730

R. cephalotaenia + the Argyrotaenia 61 <0.001* 210.908 0.005* group Brevibora + Trigonostigma + the 55 <0.001* 204.144 0.006* Trifasciata group

The Caudimaculata group + the 61 <0.001* 238.639 0.002* Sumatrana Group

The steineri-rubrodorsalis assemblage + 19 0.008* 52.696 0.462 the Reticulata group

The Sumatrana group monophyly 81 <0.001* 301.857 0.000*

397

Table 4.6. Test of alternative hypotheses of rasborin interrelationships using the harmonic mean estimate and the stepping stone method as implemented in MrBayes 3.2. Hypotheses with a value of Bayes factors > 5 are considered as very strongly supported (Kass and

Raftery, 1995).

Marginal likelihood Hypotheses Harmonic mean (stepping stone)

Pectenocypris+Rasbora -90824.06 -90477.19

Pectenocypris+Amblypharyngodon -90265.08 -90524.09

Bayes factors -558.98 46.9

398

Chapter 5: Comparison of phylogenetic results based on morphological and molecular data for the systematics of the supragenus Rasbora

Both morphological and molecular data agree in the recovery of major monophyletic groups that correspond, in part, with species groups recognized by previous authors (Brittan, 1954; Kottelat and Vidthayanon, 1993; Liao et al., 2010). Despite this agreement, the two data sets conflict particularly on three major systematic issues: (1) the monophyly of the supragenus Rasbora; (2) the phylogenetic position of the type species of

Rasbora, R. cephalotaenia; and (3) the interrelationships among the major clades.

Monophyly of the supragenus Rasbora

The monophyly of the supergenus Rasbora is recovered by the morphological phylogeny of this study (Figures 3.28; 3.29), which is corroborated by high support values

(97% bootstrap values) and also by four unambiguous synapomorphies, two of which are newly discovered herein. In striking contrast, all of the current molecular trees recover the supragenus Rasbora as paraphyletic because the genus Pectenocypris, a highly-derived outgroup, is deeply embedded in Clade B, the largest clade composed of Sundaland-

Indochinese lineage Rasbora (Figures 4.7–10).

The morphological phylogeny of this study strongly indicates that the genus

Pectenocypris is sister to the other highly derived filter-feeding taxon, the genus

Amblypharyngodon. The sister-group relationship of the two planktivorous genera is named here the Clade Pectenocyprinina, which, in turn, is sister to the monophyletic supragenus Rasbora. In addition to its high nodal support (100% bootstrap), Clade

Pectenocyprinina is supported by 11 unambiguous morphological synapomorphies which

399

corroborate this group as a distinct evolutionary lineage. These shared derived characters are: (1) a dome-like concavity of the ventral surface of the ethmoid complex (character 12; state 2); (2) an irregular, vertically-oriented prootic pad (character 58; state 3; Figure 3.6.A,

B: pPrO); (3) an elongate anterior process of the basioccipital (character 64; state 2; Figure

3.6.A, B: apBOc); (4) a fenestrated posteroventral flange of the premaxilla (character 92; state 1); (5) a long spine-like ethmoid process of the palatine reaching the anteroventral surface of the ethmoid block (character 106; state 3); (6) a ventral shaft of the hyomandibula laterally covered by the preopercle (character 113; state 1); (7) the anterodorsal tip of the opercle anterodorsally projected and more attenuated (character 116; state 1); (8) two elements of posterior copula (character 122; state 1); (9) an extra row of gill rakers medial to fourth epibranchial (character 138; state 1); (10) a slightly notched fourth pleural rib in dorsal view (character 166; state 1); and (11) a long fourth pleural rib almost reaching the cleithrum (character 168; state 2).

Given that both genera occupy a similar trophic niche, one could argue that the morphological similarity of Amblypharyngodon and Pectenocypris may be the result of convergent or parallel evolution. Independent evolution of similar phenotypes in response to similar ecological variables is considered quite common in fishes. For example, the pelagic cyprinid subfamilies Cultrinae and Danioninae mutually show convergence relative to each other, even to the extent that some cultrin genera (e. g., Oxygaster, Parachela) had been previously classified as danionine taxa (Tang et al., 2010). Interestingly, Parachela, which was included as an outgroup in the present morphological analysis, was recovered as a sister group to all danionine taxa. Thus, the morphological topology confirmed the hypothesis that superficial similarities in the external morphology shared by Parachela and

400

some danionines (e. g., Chela, Nematabramis) are convergent and consequently considered as homoplasy.

Taking into account the unreversed morphological synapomorphies as listed above, a notion of phenotypic convergence or parallelism between Amblypharyngodon and

Pectenocypris is deemed superficial. In comparison, a separate topologically-constrained analysis of the clade Pectenocyprinina under parsimony using the concatenated molecular dataset revealed 251 molecular synapomorphies that support this clade, while a non- constrained parsimony analysis recovered 171 molecular synapomorphies supporting the

Sundaland-Indochinese lineage, in which Pectenocypris is embedded as an ingroup taxon of Rasbora. The analysis with constrained topology has 67 extra steps longer than the most parsimonious tree. Out of 11 morphological synapomorphies, five (characters 12, 64, 92,

106, and 138; see Chapter 3 for details) are likely to be correlated with the feeding mechanism, whereas the remaining six (characters 58, 113, 116, 122, 166, and 168) may have no correlation with the functional mechanism of planktivory. In fact, apart from being functionally-uncorrelated with planktivorous behavior, two characters of the fourth pleural rib (characters 166 and 168) are relatively highly-derived in comparison to other cyprinid groups, and may have a different functional association with the adjacent Weberian apparatus, a complex structure unique to ostariophysans used primarily for transmitting sound vibration from the swimbladder to the inner ear (Rosen and Greenwood, 1970). To conclude that these pleural rib characteristics unique to Pectenocypris and

Amblypharyngodon have evolved independently requires acceptance of ad hoc hypotheses of convergence. Still, with respect to the considerably numerous non-planktivorous synapomorphies that diagnose the Clade Pectenocyprinina, invoking convergence or

401

parallelism in favor of classifying Pectenocypris as a Rasbora is not parsimonious.

Therefore, the sister group relationship between Amblypharyngodon and Pectenocypris is hereby supported, in line with the monophyly of the supragenus Rasbora.

Discordance between molecular and morphological data leading to the placement of

Pectenocypris in Rasbora by molecules may be explained by: (1) systematic error due to nucleotide base compositional bias (Li and Orti, 2007); (2) incomplete lineage sorting; or

(3) historical intergeneric hybridization. Based on the inference of the base composition among taxa using PAUP* in chapter four, the GC compositional bias among taxa, especially between Pectenocypris and the other rasborin taxa, is not evident. As for incomplete lineage sorting, discordance among gene genealogies is one indication of its signature. With regard to the position of Pectenocypris, no remarkable incongruence among genes as shown in trees reconstructed based on different genetic markers (Figures

4.1–4.7). Incomplete lineage sorting may also be due to a rapid speciation, in which intervals between successive branching events are too short for lineage sorting to be completed within each branch prior to the next branching (Takahashi et al., 2001;

McCracken and Sorenson, 2005). This rapid cladogenesis is not apparent as the internal branch lengths of Pectenocypris and its rasborin sister group shown in the present molecular trees are relatively long (Figures 4.8–4.10). Intergeneric hybridization in fishes has reported by many authors (e. g., Hubbs, 1955; West and Hester, 1966; Chevassus,

1979; DeMarais et al., 1992; Gilles et al., 1998; Rüber et al., 2001; Bostrom et al., 2002;

Seehausen et al., 2002; Freyhof et al., 2005). Among fishes, intergeneric hybridization appears to be relatively more common in cyprinids (Scribner et al., 2001). Incongruence between the phylogenetic trees reconstructed using mitochondrial DNA (mtDNA) and

402

those using nuclear markers or “cytonuclear discordance” (Seehausen, 2004) is treated as evidence of hybridization across taxa as an alternative to incomplete lineage sorting. This reflects an asymmetric introgression event in which the nuclear DNA of the invading species (i. e., introgressed species) was wiped out by the local species (i. e., introgressing species) within a few generations due to backcrossing, whereas the maternally-inherited introgressed mtDNA remained intact, unaffected by the backcrossing (Seehausen et al.,

2003; Freyhof et al., 2005; Currat et al., 2008). Such incongruence reflecting asymmetric introgression due to high frequency of immediate subsequent backcrosses is possible under several assumptions: continuous hybridization is rare; the fitness of the hybrids is not too low; genes are relatively neutral (no strong selection); the invading species is at lower densities than the local one (demographic imbalance); and mtDNA experiencing relatively little intraspecific gene flow (Chan and Levin, 2005; Currat et al., 2008; Du et al., 2009;

Excoffier et al., 2009; Petit and Excoffier, 2009; Toews and Brelsford, 2012). Using mitochondrial-nuclear incongruence as the yardstick, separate analyses based on mitochondrial and nuclear markers in this study (Figures 4.5 and 4.6) do not indicate that intergeneric hybridization in the past is the explanation for the inclusion of the genus

Pectenocypris in the supragenus Rasbora. Nevertheless, given some circumstances in which several aforementioned assumptions leading to asymmetric introgression were not met, molecules might fail to detect any historical hybridization between Pectenocypris and

Rasbora based solely on the presence of cytonuclear discordance. For instance, under a condition in which the intraspecific gene flow of mtDNA among populations of

Pectenocypris (i.e., invading taxa) was limited, introgressed mitochondrial haplotypes of

Rasbora (i.e., native taxa) were not diluted by the haplotypes of Pectenocypris, therefore

403

haplotypes of Rasbora can persist to introgress in Pectenocypris. If this particular condition was met, coupled with other factors impeding asymmetric introgression (e.g., higher densities of invading Pectenocypris than Rasbora, strong selection, frequent, continuous hybridization) in contrast to several assumptions mention above, the cytonuclear discordance might not be observable based solely on analyses using a few mitochondrial and nuclear markers. Although it might explain the conflict in the clade Pectenocyprinina, this speculative circumstance nonetheless begs for further rigorous examination.

Natural hybridization does not necessarily lead to distinct incongruence between mitochondrial and nuclear phylogenetic trees as indicated by several studies on different fish taxa. Phylogenetic analyses by Near et al. (2004) incorporating 12 species of the centrarchid genus Lepomis were unable to detect the relatively frequent occurrence of natural interspecific hybridization in this genus as previously reported (McAtee and Weed,

1915; Hubbs and Hubbs, 1932; Hubbs, 1955; Childers, 1967; Avise and Saunders, 1984;

Dawley, 1987); no significant incongruence between mitochondrial and nuclear genes was observed in the resulting topologies. Moreover, accepting the need to compare morphology and molecules, the topology of the molecular tree by Near et al. (2004) is in conflict with the morphological trees shown in Wainwright and Lauder (1992). In particular, the morphological analysis by Wainwright and Lauder (1992) recovered Lepomis gulosus

(senior synonym of Chaenobryttus sp.) as sister to the clade containing the genera

Enneacanthus and Lepomis, whereas the molecular analysis by Near et al. (2004) recovered the species as sister to the clade containing L. symmetricus and L. cyanellus.

Given the occurrence of hybrids between L. gulosus and L. cyanellus, as well as with other species of Lepomis as reported by McAtee and Weed (1915), the sister group relationship

404

between L. gulosus and the clade L. cyanellus+L. symmetricus is likely due to historical hybridization which led to the genetic introgression among species of Lepomis. Although having invoked convergence to explain the evolution of highly-specialized snail predation in L. gibbosus and L. microlophus in favor of paraphyly based on the molecular signature,

Near et al. (2004) did not address the specific conflicting morphological and molecular topologies of the relationship of the moderately-piscivorous L. gulosus with the other mostly non-piscivorous species of Lepomis. The incongruence between morphology and molecules with regard to the position of L. gulosus clearly resembles a similar pattern as that shown in the topological conflict of Pectenocypris in the present study.

Similar to the aforementioned patterns in the centrarchid genus Lepomis, the natural hybridization between the North American cyprinid species of Campostoma anomalum and several other sympatric minnows as reported by some authors (Goodfellow et al., 1986;

Grady and Cashner, 1988; Poly, 1997) was not detected based on the topologies resulting from the subsequent molecular phylogenetic analyses (Simons et al., 2003; Schönhuth et al., 2008; Bufalino and Mayden, 2010), which also indicate concordance between mitochondrial and nuclear markers. Despite the concordance between mitochondrial and nuclear markers, topologies based on molecules are in conflict with the morphological tree by Coburn and Cavender (1992), particularly with regard to the relationships of the genus

Campostoma. According to morphological analysis by Coburn and Cavender (1992), the genus Campostoma was recovered as sister to the genus Dionda, which altogether form a clade that is sister to the genus Hybognathus. In contrast, the molecular analyses using both nuclear and mitochondrial markers (Schönhuth et al., 2008; Bufalino and Mayden, 2010) recovered Campostoma as sister to Nocomis. Interestingly, Grady and Cashner (1988)

405

reported the presence of natural hybrid populations between Campostoma anomalum and

Nocomis leptocephalus, which may explain why molecular data recovered Campostoma as sister to Nocomis despite the congruence between mitochondrial and nuclear markers used in the analyses (Schönhuth et al., 2008; Bufalino and Mayden, 2010). Therefore, given the cases of hybrids in these two North American taxa, cytonuclear discordance cannot be used to falsify the occurrence of historical hybridization. In addition to the circumstances mentioned above, the absence of cytonuclear discordance in a phylogenetic study despite several reports on occurrence of hybrids may also be explained by taxon sampling in which the introgressed taxa were simply not included in the analyses. An example is the interconnected molecular studies of the primate genus Rungwecebus (Davenport et al.,

2006; Olson et al., 2008; Zinner et al., 2009). Molecular analyses by Davenport et al.

(2006) and Olson et al. (2008) recovered the genus as sister to the monophyetic genus

Papio. In contrast, the subsequent mitochondrial analyses by Zinner et al. (2009), with more populations of Rungwevebus sampled, recovered the genus Papio to be paraphyletic due to the inclusion of some populations of Rungwecebus in Papio. Therefore, interpreting morphological convergence in favor of molecular paraphyly, especially when numerous records of natural hybrids are available, necessitates omission of some alternative hypotheses to explain molecular phylogenetic noise due to historical hybridization.

In general, there are two evolutionary consequences of hybridization: (1) despeciation (sensu Turner, 2002), in which two species were fused through genomic swamping or homogenizing effect; or (2) hybrid speciation, in which hybridization of two parental species resulted in a new third species, either via allopolyploidy or via homoploid hybrid speciation, which remains distinct regardless being in contact with either parent

406

(Mallet, 2007). Accordingly, while despeciation eventually results in only a single extant taxon recognized, hybrid speciation contrastingly yields three taxa recognized: two parental taxa and one new hybrid taxon. In fishes, hybrid speciation is relatively more common than in other vertebrates as shown in the case of Gila seminuda, a valid cyprinid species, which is the hybrid between its two valid parental species, G. robusta and G. elegans (DeMarais et al., 1992). Although many studies have shown that hybrids tend to display intermediate forms of both parental taxa, some processes governing hybrid speciation (e.g., development of novel multi-gene complexes; asymmetrical selection upon different genomic regions or morphological characters) may nonetheless produce hybrid taxa with distinct phenotypes

(Scribner et al., 2001; Machado and Hey, 2003; Mallet 2005; Mallet 2008; Zinner et al.,

2011; The Heliconius Genome Consortium, 2012). In primates, for instance, an interesting case of ancient intergeneric hybridization between baboons and its related genera resulted in the genus Rungwecebus, which exhibits a series of unique ecological and vocal characteristics (Jones et al., 2005; Zinner et al., 2009).

Additionally, irrespective of all analyses using different molecular data sets in the present studies recovering Pectenocypris as embedded inside the supragenus Rasbora, it is noteworthy that phylogenetic analyses using individual genes in this study show conflicting topologies with regard to the position of the genus Amblypharyngodon. Analysis using COI sequence alone recovered the Indian lineage of rasborin taxa (Horadandia, Rasboroides, and the Daniconius group) as the basal branches, whereas the genus Amblypharyngodon is embedded more exclusively as sister to the Sundaland-Indochinese lineage (Figure 4.2).

Moreover, the resulting topology based on the nuclear rhodopsin sequence (Figure 4.4) recovered several non-rasborin cyprinines as sister to the Indian lineage of rasborin taxa.

407

These two discordances between Amblypharyngodon and the sympatric Indian clade

Rasbora, may reflect either incomplete lineage sorting or historical hybridization. The possibility of hybridization between Amblypharyngodon and the sympatric Indian Rasbora needs to be rigorously tested using more representatives from both taxa, an hypothesis that may evaluate the presence of ancient intergeneric hybridization in the tribe Rasborini.

The discordance among markers may be explained due to different rates of genetic introgression among genetic regions under certain conditions (e.g. strong selection, genetic linkage) as reported for other taxa (e.g., Wilding et al., 2001; Machado and Hey, 2003;

Emelianov et al., 2004; Kronforst et al., 2006).

Conflicts between morphology and molecules are commonplace in phylogenetic studies of various animal taxa, which often result in unstable taxonomic classifications of the pertinent taxa rather than resolving their relationships. In addition to the cases of two

North American taxa [centrarchids (Wainwright and Lauder, 1992; Mabee et al., 1993;

Near et al., 2004); and cyprinids (Coburn and Cavender, 1992; Schönhuth et al., 2008;

Bufalino and Mayden, 2010)] as above, several works among fish taxa also exemplify this issue: the interrelationships of the major cypriniform groups relative to the position of the diminutive Paedocypris (Britz and Conway, 2009; Mayden and Chen, 2010; Tang et al.,

2010; Britz and Conway, 2011); the recognition of the clade Smegmamorpha and the position of the enigmatic Ellasoma in Percomorpha (Wiley et al., 2000; Miya et al., 2001;

Chen et al., 2003; Springer and Orrell, 2004; Near et al., 2012); and the intrarelationships among scombroids (Graham and Dickson, 2000; Collette et al., 2006; Orrell et al., 2006).

Notwithstanding numerous studies that show significant discordance between morphological and molecular results, the present systematic study of the supragenus

408

Rasbora is unique in how relatively well-resolved is the morphological hypothesis. Given the remarkable number of novel unambiguous synapomorphies supporting the reciprocally monophyletic relationship between the clade Pectenocyprinina (diagnosed by11 morphological synapomorphies; with 251 molecular synapomorphies) and the supragenus

Rasbora (diagnosed by five morphological synapomorphies), the present study stands out as morphologically more well-supported than the aforementioned studies in which relatively much fewer morphological synapomorphies were proposed to support the relationships of problematic taxa.

The Smegmamorpha was named by Johnson and Patterson (1993) who proposed five acanthomorph lineages, the Atherinomorpha, Mugilomorpha, Gasterosteiformes,

Synbranchoidei, Mastacembeloidei and the enigmatic Elassoma as components of a distinct clade. The clade was diagnosed by one morphological synapomorphy-- the first epineural bone originates at the distal end of the transverse process of the first vertebra— and a series of characters that occur in some, but not all smegmamorphs (Johnson and

Patterson, 1993: table 2). The clade has found little or no support in subsequent phylogenetic studies using either morphological or molecular characters Parenti and Song,

1996; Miya et al., 2001; Chen et al., 2003; Springer and Orrell, 2004; Near et al., 2012).

Ironically, molecular analyses of Elassoma (e.g., Near et al., 2012) place it in the

Centrarchidae, the perciform family with which it had been classified traditionally based on morphology. Another smegmamorph clade, the Atherinomorpha, has been recovered as sister to the labroid fishes in molecular studies (e.g., Setiamarga, et al., 2008); whereas, morphological comparisons of these two clades has considered their similarities convergent

(e.g., Stiassny and Jensen, 1987). Thus, resolution of relationships of the clades included in

409

the Smegmamorpha does not pit molecules against morphology, but aims for a stable classification.

The debate over the interrelationships of cypriniforms has centered on the position of the “wild-card” genus Paedocypris (Britz and Conway, 2009; Mayden and Chen, 2010;

Tang et al., 2010; Britz and Conway, 2011). Despite a comparative osteological study of the three diminutive genera Danionella, Paedocypris, and Sundadanio by Britz and

Conway (2009) identifying a series of synapomorphies to support their close relationship, there have been no phylogenetic studies that sample Paedocypris along with other representative cypriniform taxa. Aside from the discordance between morphology and molecules, the debate was about the confusion that stems from the conflicting results of several molecular analyses in the Cypriniformes Tree of Life project (Britz and Conway,

2011). Also, the controversy on the systematic position of Paedocypris can be related to difficulties in studying miniature taxa that exhibit many truncated and paedomorphic characters (Britz and Conway, 2009), an issue that also plagues studies of the diminutive centrarchid Elassoma (Springer and Orrell, 2004; Near et al., 2012). Debate over scombroid interrelationships exemplifies the emphasis of the morphological analysis of characters, such as endothermy, that are likely to be convergent (Block et al., 1993). In the present study, given a series of morphological synapomorphies not related to planktivory supporting either the clade Pectenocyprinina or the supragenus Rasbora, the problem of overreliance on characters due to convergence is arguably not the case here.

Position of Rasbora cephalotaenia

The phylogenetic placement of R. cephalotaenia is necessary to define the taxonomic limit of Rasbora in the strict sense (i.e., Rasbora sensu stricto) because it is the

410

type species of Rasbora. According to the morphological tree of this study (Fig. 3.28), R. cephalotaenia is embedded in the Argyrotaenia group, a clade supported by a moderately high bootstrap (80%) and two unambiguous synapomorphies. In striking contrast, likelihood and Bayesian analyses in the present molecular study strongly support the placement of R. cephalotaenia in a more basal clade, the Einthovenii group, which confirms the traditional, non-phylogenetic classification (Brittan, 1954; Kottelat and

Vidthayanon, 1993). Unlike the two model-based methods, the parsimony analysis of molecular data weakly recovered R. cephalotaenia nested in “Clade A+E”, which comprises the diminutive rasborins of Clade A and the Einthovenii group (Figure 4.1).

None of these conflicting results is consistent with the low-supported topology hypothesized by Tang et al. (2010) in which R. cephalotaenia was sister to R. bankanensis.

The placement of R. cephalotaenia in this study cannot be confirmed with confidence.

Regardless, considering that R. cephalotaenia was consistently nested in the Sundaland-

Indochinese lineage in all analyses, this large clade is synonymized with Rasbora sensu stricto (Rasbora s. s. hereafter).

Relationships within the supragenus Rasbora

While 12 major clades are recognized in the morphological phylogeny of this study

(Figure 3.29), the topologies that resulted from the molecular analyses recovered 15 major monophyletic groups. Apart from the discrepancy in the number of major clades, regarding the intrarelationships of Rasbora, morphology and molecules differ in four aspects: (1) the clade of the Sundaland-Indochinese lineage; (2) the position of clade

Brevibora+Trigonostigma; (3) the position of the Caudimaculata group; and (4) the monophyly of the Sumatrana group.

411

Overall, depending on analytical methods, the clade composed of some miniaturized rasborins, Clade A, was variably placed within the Sundaland-Indochinese lineage. In likelihood and Bayesian molecular analyses using different datasets, Clade A was consistently resolved as a branch near the basal node of the Sundaland-Indochinese lineage, rendering this clade as sister to all the remaining non-Indian rasborins (Figure 4.8–

4.10). Topology of the most parsimonious tree using molecular data, however, indicates a larger clade at the basal part of the Sundaland-Indochinese lineage: Clade A+E, which in addition to Clade A, also includes the Einthovenii group. While the molecular analyses consistently recovered Clade A in a basal position, in contrast, the morphological topology placed this clade relatively more terminal. According to morphology, the Einthovenii group, not Clade A, was recovered at the basal node as being sister to all other non-Indian rasborins except Rasbora tubbi.

Morphological topology strongly resolved Clade Brevibora+Trigonostigma as sister to the Trifasciata group, a relationship supported by five synapomorphies. This sister- group relationship was never recovered in the molecular analyses. The Clade

Brevibora+Trigonostigma was always placed much more terminally as the sister group of a large clade comprising the Sumatrana group and the Reticulata group.

As suggested by the present molecular analyses (see discussion in Chapter 4), the paraphyly of the former Sumatrana group has led to the recognition of two additional major clades: the Kalimantan lineage of the Sumatrana group, and the rubrodorsalis-steineri- assemblage. Moreover, the constituent species of the former Caudimaculata group were recovered to form a more basal clade that is sister to a larger clade composed of Brevibora,

Trigonostigma, the Trifasciata group, and the Sumatrana group (Figures 4.8–10), in lieu of

412

forming a terminal clade together with the species of the former Sumatrana group as suggested by the present morphological hypothesis (Figures 3.28–29).

Taxonomic implications

Although morphology and molecules disagree significantly on several fundamental issues on the systematics of Rasbora, some taxonomic recommendations may be readily implemented on the basis of the present study. With the recognition of several monophyletic groups under the phylogenetic framework, a comprehensive revision of the supragenus Rasbora, which entails taxonomic re-evaluation of these monophyletic groups, is deemed necessary.

Both morphology and molecules strongly support the monophyly of the three rasborin genera: Boraras, Brevibora, and Trigonostigma. This corroborates the hypotheses of some authors (Kottelat and Witte, 1999; Conway, 2005; Tang et al., 2010). In addition, a series of shared derived characters were provided for each genus herein (see discussion in

Chapter 3). The taxonomic validity of the three genera is thus confirmed with confidence in the present study.

The monophyly of the genus Trigonopoma is resolved in the present morphological analyses with one synapomorphy and high nodal support (bootstrap 100%). The molecular topology, however, rejected the monophyly of the genus as indicated by the placement of

T. pauciperforatum and T. gracile in two separate clades, which reciprocally form the more inclusive Clade A. With only one synapomorphy, and an inconsistency between molecular and morphological topologies, the taxonomic validity of the genus Trigonopoma cannot be supported with confidence herein. The two species currently classified in Trigonopoma, T. pauciperforatum and T. gracile, may represent two distinct rasborin lineages. Considering

413

the highly derived phenotypes characterizing the miniaturized species of Clade A, detailed studies on the morphology of these two taxa are predicted to discover a series of new synapomorphies. Given the number of terminal taxa with remarkably long terminal branches composing the clade of T. gracile, discoveries and descriptions of new species are expected following comprehensive taxonomic review of these taxa.

Liao et al. (2009) recognized a monotypic genus Kottelatia. The present morphological analysis recovers Rasbora kalbarensis as the sister species of Kottelatia brittani; these two species could both be classified in Kottelatia. In contrast, the present molecular study does not corroborate such taxonomic placement because R. kalbarensis was not strongly recovered as sister to Kottelatia brittani. The sister group relationship of both species was recovered only in a parsimony analysis with a low bootstrap support (less than 50%; Figures 4.1, 4.2), a similar result to that of Tang et al. (2010). Notwithstanding the low confidence results of molecular analyses, the validity of the genus Kottelatia, including the addition of Rasbora kalbarensis, is maintained here with the support of four unique synapomorphies which corroborate the genus as an evolutionarily distinct lineage.

Rasbosoma is another new monotypic genus that Liao et al. (2010) recognized and diagnosed by just one character. The single species, Rasbosoma spilocerca, was not sampled in the current morphological analysis. Yet, both morphology and molecules consistently recover a clade comprising some of the species formerly classified in the

Caudimaculata group. The present morphological study recognized three unreversed synapomorphies of body pigmentation that support this monophyletic group. The presence of these three synapomorphies in Rasbosoma spilocerca was confirmed. Therefore, having incorporated Rasbosoma spilocerca in the morphological analysis, it was predicted to be

414

recovered in a clade comprising species of the former Caudimaculata group. Given the placement of Rasbosoma spilocerca in the group based on molecules, it is concluded that the Caudimaculata group be synonymized with the genus Rasbosoma.

In summary, the phylogenetic tree of Figure 5.1 demonstrates the preferred hypothesis for the systematic relationships of the supragenus Rasbora in the present study.

At least two alternatives are available to improve the alpha-taxonomy of the supragenus

Rasbora given the phylogenetic position of R. cephalotaenia as the type species: (1) a more inclusive classification, which entails synonymy of the Sundaland-Indochinese lineage as the genus Rasbora s. s., and classifying six genera (Boraras, Brevibora, Kottelatia,

Rasbosoma, Trigonopoma, and Trigonostigma) as junior synonyms of the genus Rasbora;

(2) a more exclusive classification, which entails assigning generic status to each of the major groups. Considering the remarkable diversity in the form of morphology, behavior, and ecology, as well as the distinctness of each major group, the more exclusive scenario is preferred here to recognize, rather than to underestimate, the extraordinary evolutionary diversification of the group.

As noted above, with respect to the placement of R. cephalotaenia either in the

Einthovenii group or in the Argyrotaenia group, a more exclusive definition of Rasbora s. s. should be applied to either one of these two groups. Accordingly, excluding the

Einthovenii group, the Argyrotaenia group, and the Caudimaculata group (=Rasbosoma), four morphologically-distinct monophyletic groups in the supragenus Rasbora are still without genus-group names, thus lack valid taxonomic status: (1) the Daniconius group, (2) the Trifasciata group, (3) the Reticulata group, and (4) the Sumatrana group.

415

Figure 5.1. Cladogram showing the preferred hypothesis for the systematic relationships of the supragenus Rasbora.

416

417

Chapter 6: Conclusions

With more than 100 species widespread throughout various freshwater habitats in

South and Southeast Asia, the cyprinid supragenus Rasbora is an ideal group of fishes that provides a rich opportunity to investigate the evolutionary processes by which the modern patterns of biodiversity and biogeography were established. Nevertheless, our current knowledge of the relationships of Rasbora is very limited, thus impeding future research in this complex group. While a few phylogenetic studies have incorporated some rasborin species in the analyses, the systematics of Rasbora has remained elusive primarily due to incongruence among results as well as inadequate data and taxon sampling. The present study has contributed several new findings based on a series of robust phylogenetic trees that should shed more light on our understanding of the evolution of this group as well as other members of the South and Southeast Asian biota.

The alpha-taxonomic portion of this study (Chapter 2), which resulted in the description of eight new species of Rasbora from northern Sumatra, highlights the remarkable-yet-underexplored diversity of these fishes. There is much more diversity to be discovered to enrich our currently limited knowledge of the freshwater ichthyofauna of

Sundaland. Moreover, the allopatry of the new eight species has been key in identifying several new areas of endemism in northwestern Sumatra, the first critical step to understand the historical biogeography of the region. Furthermore, an array of newly-described diagnostic characters has been proven useful to distinguish cryptic species in the Reticulata group.

418

The morphological phylogenetic analysis of this study (Chapter 3) has uncovered a significant number of new shared derived characters or synapomorphies, principal among these is a list for the supragenus Rasbora, as well as for each of these featured cyprinid taxa: the subfamily Danioninae, the tribes Chedrini, Danionini, and Rasborini; a series of characters that serves as solid evidence to define a single natural taxonomic entity. Coupled with statistical interpretation, the recognition of several monophyletic groups primarily on the basis of a unique set of synapomorphies has ultimately shed light on improving the systematics of some problematic taxa. The genus Sundadanio, notorious for being a controversial “wild-card” taxon as highlighted in recent phylogenetic studies, is placed with high confidence in the subfamily Danioninae as defined by three unambiguous synapomorphies. All of this ultimately underscores the fundamental role of morphology as an irreplaceable unlimited resource to be explored in search of new phylogenetically- informative characters.

The molecular phylogenetic analyses of this study (Chapter 4) overall has provided a statistically well-supported topology, in which several monophyletic groups congruent with the morphological result have been identified. Relative to the morphological result, the topology for each major terminal group is more highly resolved in the molecular analyses.

As a result, a better understanding of the interrelationships among species within the major terminal groups might be achieved through consulting the molecular topologies. Moreover, information on terminal branch lengths as depicted in the molecular trees can be used for assessing the rate of divergence in certain taxa relative to the others, an approximation to assess the relative distinctness among species. Using this notion, the validity of eight new

419

species in the Reticulata group described here is supported by their considerably long terminal branches, comparable to the terminal branch length of other valid species.

Despite the agreement in recovering several major clades, morphology and molecules conflict, particularly on two highly-crucial issues: the monophyly of the supragenus Rasbora; and the phylogenetic position of the type species of Rasbora, R. cephalotaenia. The monophyly of the supragenus Rasbora, well-supported by morphology, is challenged by the present molecular analyses, which strongly support the inclusion of the outgroup genus Pectenocypris in the supragenus Rasbora. Given a unique set of unambiguous synapomorphies for each reciprocal clade, the monophyly of Rasbora is preferred in this study, hence supporting the sister group relationship of Pectenocypris and

Amblypharyngodon. Paraphyly of Rasbora could be the result of incomplete lineage sorting or intergeneric hybridization between Rasbora and Pectenocypris, a natural phenomenon understood to be commonplace among cyprinids. Despite the inconsistent placement of R. cephalotaenia in at least two major groups, this type species is consistently placed in a more inclusive clade, the Sundaland-Indochinese lineage. Therefore, this clade is tentatively synonymized as the genus Rasbora sensu stricto.

The validity of five rasborin genera is corroborated here: Boraras, Brevibora,

Kottelatia, Rasbosoma, and Trigonostigma. Two formerly monotypic genera, Kottelatia and Rasbosoma, need to be expanded through species transfer and synonymy. The validity of the genus Trigonopoma cannot be confirmed here; its monophyly is rejected by molecules. Four major groups still lack valid taxonomic status: the Daniconius group; the

Trifasciata group; the Reticulata group; and the Sumatrana group. Considering the inconsistent placement of R. cephalotaenia, either in the Einthovenii group or the

420

Argyrotaenia group, the more exclusive definition of Rasbora s. s. is reserved to either of these two groups.

Although several new findings are highlighted here, some major problems in the systematics of Rasbora are still without satisfactory solution. Detailed studies in the future need to address the problem of several rasborin “wild-card” taxa, especially the type species, R. cephalotaenia. Three rasborin species (Rasbosoma spilocerca, R. rubrodorsalis, and R. steineri) pivotal in molecular analyses, need to be sampled in morphological phylogenetic studies. To summarize, the use of more data obtained using multifaceted techniques as well as more dense taxon sampling is necessary to continue to improve the systematics of Rasbora and our understanding of its evolution and diversification.

421

REFERENCES

Abbate, F., G. P. Germana, F. De Carlos, G. Montalbano, R. Laura, M. B. Levanti, and

A. Germana. 2006. The oral cavity of the adult zebrafish (Danio rerio).

Anatomia, Histologia, Embryologia 35: 299–304.

Abell, R., M. L. Thieme, C. Revenga, M. Bryer, M. Kottelat, N. Bogutskaya, B. Coad, N.

Mandrak, S. C. Balderas, W. Bussing, M. L. J. Stiassny, P. Skelton, G. R. Allen,

P. Unmack, A. Naseka, R. Ng, N. Sindorf, J. Robertson, E. Armijo, J. V. Higgins,

T. J. Heibel, E. Wikramanayake, D. Olson, H. L. López, R. E. Reis, J. G.

Lundberg, M. H. Sabaj Pérez, and P. Petry. 2008. Freshwater ecoregions of the

world: a new map of biogeographic units for freshwater biodiversity conservation.

BioScience 58(5): 403–413.

Ahl, E. 1934. Weitere fische aus dem Toba-See in Sumatra. Sitzungsberichte der

Gesellschaft Naturforschender Freunde zu Berlin 1934: 235–238.

Avise, J. C., and N. C. Saunders. 1984. Hybridization and introgression among species of

sunfish (Lepomis): analysis by mitochondrial DNA and allozyme markers.

Genetics 108: 237–255.

Bleeker, P. 1859. Negende bijdrage tot de kennis der vischfauna van Banka.

Natuurkundig Tijdschrift voor Nederlandsch Indië 18: 359–378.

Bleeker, P. 1860. Tiende bijdrage tot de kennis der vischfaunca van Banka. Natuurkundig

Tijdschrift voor Nederlandsch Indië 21: 135–142.

Bleeker, P. 1863. Systema Cyprinoiderum revisum. Nederlandsch Tijdschrift voor de

Dierkunde 1: 187–218.

422

Block, B. A., J. R. Finnerty, A. F. R. Stewart, and J. Kidd. 1993. Evolution of

endothermy in fish: Mapping physiological traits on a molecular phylogeny.

Science 260: 210–214.

Bostrom, M. A., B. B. Collette, B. E. Luckhurst, K. S. Reece, and J. E. Graves. 2002.

Hybridization between two serranids, the coney (Cephalopolis fulva) and the

creole-fish (Paranthias furcifer), at Bermuda. Fishery Bulletin 100(4): 651–661.

Boulenger, G. A. 1895. List of the freshwater fishes collected by Mr. A. Everett on

Palawan and Balabac. Annals and Magazine of Natural History (Series 6) 15(86):

185–187.

Braekevelt, C. R. 1980. The fine structure of the retinal epithelium in the scissortail

(Rasbora trilineata) (Teleost). Anatomischer Anzeiger 148(3): 225–235.

Breder, C. M., and D. E. Rosen. 1966. Modes of Reproduction in Fishes. Natural History

Press, Garden City, New York. 941 pp.

Brittan, M. R. 1954. A revision of the Indo-Malayan fresh-water fish genus Rasbora.

Monographs of the Institute of Science and Technology, Manila 3: 1–224 + 3

maps.

Brittan, M. R. 2000. Rasbora: keeping and breeding them in captivity. T. F. H.

Publication, Neptune, New Jersey.

Britz, R., and K. W. Conway. 2009. Osteology of Paedocypris, a miniature and highly

developmentally truncated cyprinid fish (Teleostei: Ostariophysi: Cyprinidae).

Journal of Morphology 270: 389–412.

Britz, R., and K. W. Conway. 2011. The Cypriniformes tree of confusion. Zootaxa 2946:

73–78.

423

Brooks, D. R., and D. A. McLennan. 2002. The Nature of Biodiversity. An Evolutionary

Voyage of Discovery. University of Chicago Press, Chicago.

Brousseau, R. A. 1976. The pectoral anatomy of selected Ostariophysi: II. The

Cypriniformes and Siluriformes. Journal of Morphology 150: 79–116.

Bufalino, A. P., and R. L. Mayden. 2010. Phylogenetic evaluation of North American

Leuciscidae (Actinopterygii: Cypriniformes: Cyprinoidea) as inferred from

analyses of mitochondrial and nuclear DNA sequences. Systematics and

Biodiversity 8: 493–505.

Cavender, T. M., and M. Coburn. 1992. Phylogenetic relationships of North American

Cyprinidae. In: Mayden, R. (ed.), Systematics, historical ecology and North

American freshwater fishes. Pp. 293–327. Stanford University Press, Stanford.

Chan, K. M. A., and S. A. Levin. 2005. Leaky prezygotic isolation and porous genomes:

rapid introgression of maternally inherited DNA. Evolution 59(4): 720–729.

Chen, W. –J., C. Bonillo, and G. Lecointre. 2003. Repeatability of clades as a criterion of

reliability: a case study for molecular phylogeny of Acanthomorpha (Teleostei)

with larger number of taxa. Molecular Phylogenetics and Evolution 26: 262–288.

Chen, X. L., P. Q. Yue, and R. D. Lin. 1984. Major groups within the family Cyprinidae

and their phylogenetic relationships. Acta Zootaxonomica Sinica 9: 424–440.

Chen, X. Y., and G. Arratia. 1996. Breeding tubercles of Phoxinus (Teleostei:

Cyprinidae): Morphology, distribution, and phylogenetic implications. Journal of

Morphology 228: 127-144.

Chevassus, B. 1979. Hybridization in salmonids: Results and perspectives. Aquaculture

17(2): 113–128.

424

Childers, W. F. 1967. Hybridization of four species of sunfish (Centrarchidae). Illinois

Natural History Survey 29: 159–214.

Coburn, M. M., and T. M. Cavender. 1992. Interrelationships of North American cyprinid

fishes. In: Mayden, R. (ed.), Systematics, historical ecology and North American

freshwater fishes. Pp. 328–373. Stanford University Press, Stanford.

Collette, B. B., J. R. McDowell, and J. E. Graves. 2006. Phylogeny of recent billfishes

(Xiphioidei). Bulletin of Marine Science 79(3): 455–468.

Conway, K. W. 2005. Monophyly of the genus Boraras (Teleostei: Cyprinidae).

Ichthyological Exploration of Freshwaters 16: 249–264.

Conway, K. W. 2011. Osteology of the south Asian genus Psilorhynchus McClelland,

1839 (Teleostei: Ostariophysi: Psilorhynchidae), with investigation of its

phylogenetic relationships within the order Cypriniformes. Zoological Journal of

the Linnean Society 164: 1–105.

Conway, K. W., and R. Britz. 2007. Sexual dimorphism of the Weberian apparatus and

pectoral girdle in Sundadanio axelrodi (Ostariophysi: Cyprinidae). Journal of Fish

Biology 71: 1562–1570.

Conway, K. W., M. Kottelat, and H. H. Tan. 2011. Review of the southeast Asian

miniature cyprinid genus Sundadanio (Ostariophysi: Cyprinidae) with

descriptions of seven new species from Indonesia and Malaysia. Ichthyological

Exploration of Freshwaters 22(3): 251–288.

Conway, K. W., W. Chen, and R. L. Mayden. 2008. The “Celestial Pearl danio” is a

miniature Danio (s.s) (Ostariophysi: Cyprinidae): evidence from morphology and

molecules. Zootaxa 1686: 1–28.

425

Currat, M., M. Ruedi, R. J. Petit, and L. Excoffier. 2008. The hidden side of invasions:

massive introgression by local genes. Evolution 62(8): 1908–1920.

Davenport, T. R. B, W. T. Stanley, E. J. Sargis, D. W. De Luca, N. E. Mpunga, S. J.

Machaga, and L. E. Olson. 2006. A new genus of African monkey, Rungwecebus:

Morphology, ecology, and molecular phylogenetics. Science 312: 1378–1381.

Dawley, R. M. 1987. Hybridization and polyploidy in a community of three sunfish

species (Pisces: Centrarchidae). Copeia 1987(2): 326–335.

DeMarais, B. D., T. E. Dowling, M. E. Douglas, W. L. Minckley, and P. C. Marsh. 1992.

Origin of Gila seminuda (Teleostei: Cyprinidae) through introgressive

hybridization: Implications for evolution and conservation. Proceedings of the

National Academy of Sciences of the United States of America 89: 2747–2751.

Deraniyagala, P. 1943. A new cyprinoid fish from Ceylon. Journal of the Ceylon Branch

Royal Asiatic Society 35: 158–159.

Dingerkus, G., and L. D. Uhler. 1977. Enzyme clearing of alcian blue stained whole

small vertebrates for demonstration of cartilage. Stain Technology 52: 229–232.

Donoso-Büchner, R., and J. Schmidt. 1997. Rasbora rubrodorsalis n. sp., eine neue

Rasbora-Art aus Thailand (Teleostei: Cyprinidae: Rasborinae). Zeitschrift für

Fischkunde 4: 89–118.

Du, F. K., R. J. Petit, and J. Q. Liu. 2009. More introgression with less gene flow:

chloroplast vs. mitochondrial DNA in the Picea asperata complex in China, and

comparison with other Conifers. Molecular Ecology 18: 1396–1407.

Duncker, G. 1904. Die fische der malayischen halbinsel. Mitteilungen aus dem

Naturhistorischen (Zoologischen) Museum in Hamburg 21: 133–207.

426

Ebach, M. C., J. J. Morrone, L. R. Parenti, and A. L. Viloria. 2008. International Code of

Area Nomenclature. Journal of Biogeography 35: 1153–1157.

Elizabeth, T. K., N. K. Balasubramanian, and P. A. John. 1981. Effect of alkaline and

acidic fractions of industrial effluents on some lymphoid cells of the fish Rasbora

daniconius. Environmental Pollution Series A, Ecological and Biological 25(2):

135–138.

Emelianov, I., F. Marec, and J. Mallet. 2004. Genomic evidence for divergence with gene

flow in host races of the larch budmoth. Proceeding of the Royal Society of

London. Series B: Biological Sciences 271: 97–105.

Eschmeyer, W.N. (ed.). 2012. Catalog of fishes, electronic version (updated 2 October

2012). World Wide Web electronic publication,

http://research.calacademy.org/research/ichthyology/catalog/fishcatmain.asp

Excoffier, L., M. Foll, and R. J. Petit. 2009. Genetic consequences of range expansions.

The Annual Review of Ecology, Evolution, and Systematics 40: 481–501.

Fang, F. 2003. Phylogenetic analysis of the Asian cyprinid genus Danio (Teleostei,

Cyprinidae). Copeia 2003: 714–728.

Fang, F., M. Noren, T. Y. Liao, M. Källersjö, and S. O. Kullander. 2009. Molecular

phylogenetic interrelationships of the south Asian cyprinid genera Danio,

Devario, and Microrasbora (Teleostei, Cyprinidae, Danioninae). Zoologica

Scripta 38: 237–256.

Fink, S. V., and W. L. Fink. 1981. Interrelationships of the ostariophysan fishes

(Teleostei). Zoological Journal of the Linnean Society 72(4): 297–353.

427

Fink, S. V., and W. L. Fink. 1996. Interrelationships of ostariophysan fishes (Teleostei).

In: Stiassny, M. L. J, L. R. Parenti, G. D. Johnson (Eds.). Interrelationships of

Fishes. Pp. 209–249. Academic Press, Inc., San Diego.

Frankel, J. S. 1994. Patterns of lactate and sorbitol dehydrogenase gene expression during

the development of interspecific Rasbora hybrids. Comparative Biochemistry and

Physiology Part B: Comparative Biochemistry 108(4): 437–441.

Freyhof, J., D. Lieckfeldt, C. Pitra, and A. Ludwig. 2005. Molecules and morphology:

Evidence for introgression of mitochondrial DNA in Dalmatian cyprinids.

Molecular Phylogenetics and Evolution 37: 347–354.

Froese, R., and D. Pauly. (eds). 2010. Fishbase. World Wide Web electronic publication,

http://www.fishbase.org.

Gilles, A., G. Lecointre, E. Faure, R. Chappaz, and G. Brun. 1998. Mitochondrial

phylogeny of the European cyprinids: Implications for their systematics, reticulate

evolution, and colonization time. Molecular Phylogenetics and Evolution 10(1):

132–143.

Goodfellow, Jr. W. L., R. P. Morgan, J. R. Stauffer Jr., C. H. Hocutt. 1986. An

intergenetic hybrid, Campostoma anomalum x Rhinichthys atratulus, from the

Youghiogheny River drainage, West Virginia. Biochemical Systematics and

Ecology 14(2): 233–238.

Gosline, W. A. 1975. The cyprinid dermosphenotic and the subfamily Rasborinae.

Occasional Papers of the Museum of Zoology University of Michigan 673: 1–12.

428

Grady, J. M., and R. C. Cashner. 1988. Evidence of extensive intergeneric hybridization

among cyprinid fauna of Clark Creek, Wilkinson Co., Mississippi. Southwestern

Naturalist 33(2): 137–146.

Graham, J. B., and K. A. Dickson. 2000. The evolution of thunniform locomotion and

heat conservation in scombrid fishes: New insights based on the morphology of

Allothunnus fallai. Zoological Journal of the Linnean Society 129: 419–466.

Grande, T., and F. J. Poyato-Ariza. 1999. Phylogenetic relationships of fossil and recent

gonorynchiform fishes (Teleostei: Ostariophysi). Zoological Journal of the

Linnean Society 125: 197–238.

Grier, H. J. 1981. Cellular organization of the testis and spermatogenesis in fishes.

American Zoologist 21: 345–357.

Hadiaty, R. K. 2005. Keanekaragaman jenis ikan di Suaq Balimbing dan Ketambe,

Taman Nasional Gunung Leuser, Provinsi Nanggroe Aceh Darussalam. Jurnal

Biologi Indonesia 3: 379–388.

Hadiaty, R. K., and D. J. Siebert. 1998. A new species of loach, genus Nemacheilus

(Osteichthyes, Balitoridae) from Aceh, Sumatra, Indonesia. Bulletin of the

Natural History Museum of London (Zoology) 67: 183–189.

Hadiaty, R. K., and M. Kottelat. 2009. Rasbora lacrimula, a new species of cyprinid fish

from eastern Borneo (Teleostei: Cyprinidae). Ichthyological Exploration of

Freshwaters 20(2): 105–109.

Hall, R. 2009. Southeast Asia’s changing palaeogeography. Blumea 54: 148–161.

Halwart, M. 2008. Biodiversity, nutrition and livelihoods in aquatic rice-based

ecosystems. Biodiversity 9(1): 36–40.

429

Hamilton, W. B. 1979. Tectonics of the Indonesian region. Professional Paper U.S.

Geological Survey 1087: 1–338.

Hamilton, W. B. 1988. Plate tectonics and island arcs. Geological Society of American

Bulletin 100: 1503–1527.

Hanken, J., and D. B. Wake. 1993. Miniaturization of body size: organismal

consequences and evolutionary significance. Annual Review of Ecology and

Systematics 24: 501–519.

Hardjamulia, A., and P. Suwignjo. 1988. The present status of the reservoir fishery in

Indonesia. Pp. 8–13. In S. S. de Silva (ed), Reservoir Fishery Management and

Development in Asia. IDRC, Ottawa, Ontario.

Harrington, R.W. Jr. 1955. The osteocranium of the American cyprinid Fish, Notropis

bifrenatus, with an annotated synonymy of teleost skull bones. Copeia

1955(4):267-290.

Heath, T. A., S. M. Hedtke, and D. M. Hillis. 2008. Taxon sampling and the accuracy of

phylogenetic analyses. Journal of Systematics and Evolution 46(3): 229–257.

Hennig, W. 1966. Phylogenetic systematics. University of Illinois Press, Urbana, 263 pp.

Howes, G. 1979. Notes on the anatomy of Macrochirichthys macrochirus

(Valenciennes), 1844, with comments on the Cultrinae (Pisces, Cyprinidae).

Bulletin of the British Museum of Natural History (Zoology) 36(3): 147–200.

Howes, G. 1980. The anatomy, phylogeny, and classification of bariliine cyprinid fishes.

Bulletin of the British Museum of Natural History (Zoology) 37(3): 129–198.

430

Howes, G. 1981. Anatomy and phylogeny of the Chinese major carps Ctenopharyngodon

Steind., 1866 and Hypophthalmichthys Blkr., 1860. Bulletin of the British

Museum of Natural History (Zoology) 41(1): 1–52.

Hubbs, C. L. 1955. Hybridization between fish species in nature. Systematic Zoology

4(1): 1–20.

Hubbs, C. L., and L. C. Hubbs. 1932. Apparent parthenogenesis in nature, in a form of

fish hybrid origin. Science 76: 628–630.

Innes, W. T. 1966. Exotic aquarium fishes: a work of general reference. Metaframe

Corporation Publications, Maywood. 544 pp.

Johnson, D. S. 1967. Distributional patterns of Malayan freshwater fish. Ecology 48(5):

722–730.

Johnson, G. D., and C. Patterson. 1993. Percomorph phylogeny: A survey of

Acanthomorphs and a new proposal. Bulletin of Marine Science 52(1): 554–626.

Johnson, G. D., and C. Patterson. 1997. The gill-arches of gonorynchiform fishes. South

African Journal of Science 93: 594–600.

Jones, T., C. L. Ehardt, T. M. Butynski, T. R. B. Davenport, N. E. Mpunga, S. J.

Machaga, and D. W. De Luca. 2005. The highland Mangabey Lophocebus

kipunji: a new species of African Monkey. Science 308: 1161–1164.

Jordan, D. S. 1919. The genera of fishes, part III, from Guenther to Gill, 1859-1880,

twenty-two years, with the accepted type of each. A contribution to the stability of

scientific nomenclature. Leland Stanford Jr. University Publications, University

Series No. 39: i–xv + 285–410.

431

Kale, M. K., P. P. Joshi, and G. K. Kulkarni. 2006. Effect of cadmium toxicity on

biochemical composition of a freshwater fish Rasbora daniconius. Pp 271–278. In

B. N. Pandey and M. K. Joyti (eds), Ecology and Environment. APH Publication

Corporation, New Delhi.

Kass, R. E., and A. E. Raftery. 1995. Bayes factors. Journal of the American Statistical

Association 90: 773–795.

Katoh, K., and H. Toh. 2008. Recent developments in the MAFFT multiple sequence

alignment program. Briefings in Bioinformatics 9: 286–298.

Kocher, T. D., W. K. Thomas, A. Meyer, S. V. Edwards, S. Paabo, F. X. Villablanca, A.

C. Wilson. 1989. Dynamics of mitochondrial DNA evolution in animals:

Amplification and sequencing with conserved primers. Proceeding of the National

Academy of Sciences, USA 86: 6196–6200.

Kottelat, M. 1984. A new Rasbora s. l. (Pisces: Cyprinidae) from northern Thailand.

Revue Suisse de Zoologie 91(3): 717–723.

Kottelat, M. 1986. A review of the nominal species of fishes described by G. Tirant.

Nouvelles Archives du Muséum d'Histoire Naturelle, Lyon Fasc., 24, 5–24.

Kottelat, M., and X. –L. Chu. 1987. Two new species of Rasbora Bleeker, 1860 from

southern Yunnan and northern Thailand. Spixiana 10(3): 313–318.

Kottelat, M. 1991. Notes on the taxonomy of some Sundaic and Indochinese species of

Rasbora, with description of four new species (Pisces: Cyprinidae).

Ichthyological Exploration of Freshwaters 2: 177–191.

432

Kottelat, M. 1994. The fishes of the Mahakam River, East Borneo: an example of the

limitations of zoogeographic analyses and the need for extensive fish surveys in

Indonesia. Tropical Biodiversity 2: 401–426.

Kottelat, M. 1995. Four new species of fishes from the middle Kapuas Basin, Indonesian

Borneo (Osteichthyes: Cyprinidae and Belontiidae). The Raffles Bulletin of

Zoology 43: 51–64.

Kottelat, M. 2001. Fishes of Laos. Wildlife Heritage Trust, Colombo, 198 pp.

Kottelat, M. 2005. Rasbora notura, a new species of cyprinid fish from the Malay

Peninsula. Ichthyological Exploration of Freshwaters16: 265–270.

Kottelat, M. 2012. Rasbora rheophila, a new species of fish from northern Borneo

(Teleostei: Cyprinidae). Revue Suisse de Zoologie 119(1): 77–87.

Kottelat, M., and C. Vidthayanon. 1993. Boraras micros, a new genus and species of

minute freshwater fish from Thailand (Teleostei: Cyprinidae). Ichthyological

Exploration of Freshwaters 4: 161–176.

Kottelat, M., and H. H. Tan. 2011. Rasbora atranus, a new species of fish from central

Borneo (Teleostei: Cyprinidae). Ichthyological Exploration of Freshwaters 22(3):

215–220.

Kottelat, M., and H. H. Tan. 2012. Rasbora crypitca, a new species of fish from Sarawak,

Borneo (Teleostei: Cyprinidae). Ichthyological Exploration of Freshwaters 23:

37–44.

Kottelat, M., and K. K. Lim.1995. Freshwater fishes of Sarawak and Brunei Darussalam:

a preliminary annotated check-list. The Sarawak Museum Journal (New Series)

48: 227–256.

433

Kottelat, M. 1999. Nomenclature of the genera Barbodes, Cyclocheilichthys, Rasbora,

and Chonerhinos (Teleostei; Cyprinidae and Tetraodontidae), with comments on

the definition of the first reviser. The Raffles Bulletin of Zoology 47(2): 591–600.

Kottelat, M., and K. E. Witte. 1999. Two new species of Microrasbora from Thailand

and Myanmar, with two new generic names for small southeast Asian cyprinid

fishes (Teleostei: Cyprinidae). Journal of South Asian Natural History 4(1): 49–

56.

Kronforst, M. R., L. G. Young, L. M. Blume, and L. E. Gilbert. 2006. Multilocus analysis

of admixture and introgression among hybridizing Heliconius butterflies.

Evolution 60: 1254–1268.

Kumar, K. H., B. R. Kiran, R. Purushotham, E. T. Puttaiah, and S. Manjappa. 2005.

Length-weight relationship of cyprinid fish, Rasbora daniconius (Hamilton-

Buchanan) from Sharavathi Reservoir, Karnataka. Zoo’s Print Journal 21(1):

2140–2141.

Lagler, K. F. 1947. Lepidological studies 1. Scale characters of the families of Great

Lakes fishes. Transactions of the American Microscopical Society 66:149–171.

Leviton, A. E., R. H. Gibbs, Jr., E. Heal, and C. E. Dawson. 1985. Standards in

herpetology and ichthyology: part I. Standards symbolic codes for institutional

resource collections in herpetology and ichthyology. Copeia 1985: 802–832.

Li, C., J. M. Riethoven, and L. Ma. 2010. Exon-primed intron-crossing (EPIC) markers

for non-model teleost fishes. BMC Evolutionary Biology 10: 1–12.

434

Liu K., T. J. Warnow, M. T. Holder, S. M. Nelesen, J. Yu, A. P. Stamatakis, and C. R.

Linder. 2012. SATé-II: Fast and accurate simultaneous estimation of multiple

sequence alignments and phylogenetic trees. Systematic Biology 61(1):90–106.

Liao, T. Y., S. O. Kullander, and F. Fang. 2010. Phylogenetic analysis of the genus

Rasbora (Teleostei: Cyprinidae). Zoologica Scripta 39(2): 155–176.

Liao, T. Y., E. Ünlü, and S. O. Kullander. 2011. Western boundary of the subfamily

Danioninae in Asia (Teleostei, Cyprinidae): derived from the systematic position

of Barilius mesopotamicus based on molecular and morphological data. Zootaxa

2880: 31–40.

López, J. A., W. -J. Chen, and G. Orti. 2004. Esociform phylogeny. Copeia 2004: 449–

464.

Lumbantobing, D.N. 2010. Four new species of the Rasbora trifasciata-group (Teleostei:

Cyprinidae) from Northwestern Sumatra, Indonesia. Copeia, 2010, 644–670.

Mabee, P. M. 1993. Phylogenetic interpretation of ontogenetic change: sorting out the

actual and artefactual in an empirical case study of centrarchid fishes. Zoological

Journal of the Linnean Society 107: 175–291.

Mabee, P. M., E. A. Grey, G. Arratia, N. Bogutskaya, A. Boron, M. M. Coburn, K. W.

Conway, S. He, A. Naseka, N. Rios, A. Simons, J. Szlachciak, and X. Wang.

2011. Gill arch and hyoid arch diversity and cypriniform phylogeny: Distributed

integration of morphology and web-based tools. Zootaxa 2877: 1–40.

Machado, C. A., and J. Hey. 2003. The causes of phylogenetic conflict in a classic

Drosophila species group. Proceeding of the Royal Society of London. Series B:

Biological Sciences 270: 1193–1202.

435

Mallet, J. 2005. Hybridization as an invasion of the genome. Trends in Ecology and

Evolution 20(5): 229–237.

Mallet, J. 2007. Hybrid speciaton. Nature 446: 280–283.

Mallet, J. 2008. Hybridization, ecological races and the nature of species: empirical

evidence for the ease of speciation. Philosophical Transactions of the Royal

Society B 363: 2971–2986.

Mayden, R. L., K. L. Tang, K. W. Conway, J. Freyhof, S. Chamberlain, M. Haskins, L.

Schneider, M. Sudkamp, R. M. Wood, M. Agnew, A. Bufalino, Z. Sulaiman, M.

Miya, K. Saitoh, and S. He. 2007. Phylogenetic relationships of Danio within the

order Cypriniformes: a framework for comparative and evolutionary studies of a

model species. Journal of Experimental Zoology (Molecular and Developmental

Evolution) 308B: 642– 654.

Mayden, R. L., and W.-J. Chen. 2010. The world’s smallest vertebrate species of the

genus Paedocypris: A new family of freshwater fishes and the sister group to the

world’s most diverse clade of freshwater fishes (Teleostei: Cypriniformes).

Molecular Phylogenetics and Evolution 57: 152–175.

McAtee, W. L., and A. C. Weed. 1915. First list of the fishes of the vicinity of Plummer’s

Island, Maryland. Proceedings of the Biological Society of Washington 28: 1–14.

McCracken, K. G., and M. D. Sorenson. 2005. Is homoplasy or lineage sorting the source

of incongruent mtDNA and nuclear gene trees in the stiff-tailed ducks (Nomonyx-

Oxyura)?. Systematics Biology 54: 35–55.

Metcalfe, I. 1998. Palaeozoic and Mesozoic geological evolution of the SE Asian region,

multidisciplinary constraints and implications for biogeography. In: Hall, R., and

436

J. D. Holloway (Eds.). Biogeography and Geological Evolution of SE Asia. Pp.

25–41. Backhuys Publishers, Amsterdam.

Miya, M., A. Kawaguchi, and M. Nishida. 2001. Mitogenomic exploration of higher

teleostean phylogenies: a case study for moderate-scale evolutionary genomics

with 38 newly determined complete mitochondrial DNA sequences. Molecular

Biology and Evolution 18: 1993–2009.

Muchlisin, Z. A., M. Musman, and M. N. S. Azizah. 2010. Spawning seasons of Rasbora

tawarensis (Pisces: Cyprinidae) in Lake Laut Tawar, Aceh Province, Indonesia.

Reproductive Biology and Endocrinology 8: 49.

Myers, N., R. A. Mittermeier, C. G. Mittermeier, G. A. B. da Fonseca, and J. Kent. 2000.

Biodiversity hotspots for conservation priorities. Nature 403: 853–858.

Near, T. J., D. I. Bolnick, and P. C. Wainwright. 2004. Investigating phylogenetic

relationships of sunfishes and black basses (Actinopterygii: Centrarchidae) using

DNA sequences from mitochondrial and nuclear genes. Molecular Phylogenetics

and Evolution 32: 344–357.

Near, T. J., M. Sandel, K. L. Kuhn, P. J. Unmack, P. C. Wainwright, and W. L. Smith.

2012. Nuclear gene-inferred phylogenies resolve the relationships of the

enigmatic Pygmy Sunfihes, Elassoma (Teleostei: Percomorpha). Molecular

Phylogenetics and Evolution 63: 388–395.

Nelson, G. 1973. Classification as an expression of phylogenetic relationships.

Systematic Zoology 22(4): 344–359.

Nelson, G. 1978. Ontogeny, phylogeny, paleontology, and the biogenetic law. Systematic

Zoology 27(3): 324–345.

437

Nelson, J. S. 2006. Fishes of the World, 4th ed. John Wiley and Sons, New Jersey. 601

pp.

Ng, H. H., and R. K. Hadiaty. 2005. Two new bagrid catfishes (Teleostei: Bagridae) from

the Alas River drainage, northern Sumatra. Ichthyological Exploration of

Freshwaters 16: 83–92.

Ng, H. H., and R. K. Hadiaty. 2008. Glyptothorax plectilis, a new species of hillstream

catfish from northern Sumatra (Teleostei: Sisoridae). Proceeding of the Academy

of Natural Sciences of Philadelphia 157: 137–147.

Ng, H. H., and R. K. Hadiaty. 2009. Glyptothorax ketambe, a new catfish (Teleostei:

Sisoridae) from northern Sumatra. Zootaxa 2085: 61–68.

Ng, H. H., S. Wirjoatmodjo, and R. K. Hadiaty. 2001a. Mystus punctifer, a new species

of bagrid catfish (Teleostei: Siluriformes) from northern Sumatra. The Raffles

Bulletin of Zoology 49: 355–358.

Ng, H. H., S. Wirjoatmodjo, and R. K. Hadiaty. 2001b. Hemibagrus caveatus, a new

species of bagrid catfish (Teleostei: Siluriformes) from northern Sumatra. The

Raffles Bulletin of Zoology 49: 359–361.

Olson, L. E., E. J. Sargis, W. T. Stanley, K. B. P. Hildenbrandt, and T. R. B. Davenport.

2008. Additional molecular evidence strongly supports the distinction between the

recently described African primate Rungwecebus kipunji (Cercopithecidae,

Papionini) and Lophocebus. Molecular Phylogenetics and Evolution 48: 789–794.

Orrell, T. M., B. B. Collette, and G. D. Johnson. 2006. Molecular data support separate

scombroid and xiphioid clades. Bulletin of Marine Science 79: 505–519.

438

Pagel, M., and A. Meade. 2005. Mixture models in phylogenetic inference. In: O.

Gascuel (ed.), Mathematics of evolution and phylogeny. Pp. 121–139. Oxford

University Press, Oxford.

Parenti, L. R., and J. Song. 1996. Phlogenetic significance of the pectoral-pelvic fin

association in Acanthomorph fishes: A reassessment using comparative

neuroanatomy. In: Stiassny, M. L. J, L. R. Parenti, G. D. Johnson (Eds.).

Interrelationships of Fishes. Pp. 427–444. Academic Press, Inc., San Diego.

Parenti, L. R., and K. K. P. Lim. 2005. Fishes of the Rajang Basin, Sarawak, Malaysia.

The Raffles Bulletin of Zoology 2005 Supplement 13: 175–208.

Petit, R. J., and L. Excoffier. 2009. Gene flow and species delimitation. Trends in

Ecology and Evolution 24(7): 386–393.

Poly, W. J. 1997. Characteristics of an intergeneric cyprinid hybrid, Campostoma

anomalum x Luxilus sp. indet. (Pisces: Cyprinidae), from the Portage River, Ohio.

Ohio Journal of Science 97(3): 40–43.

Posada, D. 2008. jModelTest: Phylogenetic model averaging. Molecular Biology and

Evolution 25(7): 1253–1256.

Poyato-Ariza, F. J., T. Grande, and R. Diogo. 2010. Gonorynchiform interrelationships:

historic overview, analysis, and revised systematics of the group. Pp. 227–337. In

T. Grande, F. J. Poyato-Ariza, and R. Diogo (eds.), Gonorynchiformes and

Ostariophysan Relationships: A Comprehensive Review. Science Publishers,

Enfield, New Hampshire.

Priyadarshana, and Asaeda. 2007. Swimming restricted foraging behavior of two

zooplanktivorous fishes Pseudorasbora parva and Rasbora daniconius

439

(Cyprinidae) in a simulated structured environment. Environmental Biology of

Fishes 80: 473–486.

Raizada, A. K., A. K. Jain, and M. S. Dahiya. 1979. Free amino acids in various tissues

of a fresh-water teleost, Rasbora daniconius (Ham). I. Qualitative analysis.

Biochemistry and Experimental Biology 15(1): 53–55.

Rambaut, A., and A. J. Drummond. 2008. Tracer. Version 1.4. Available from:

http://beast.bio.ed.ac.uk/Tracer/.

Rangin, C., and The Tethys Pacific Working Group. 1990. The quest for Tethys in the

western Pacific. 8 paleogeodynamic maps for Cenozoic time. Bulletin de la

Societe Geologique de France 6: 907–913.

Roberts, T. R. 1982. Unculi (horny projections arising from single cells), an adaptive

feature of the epidermis of Ostariophysan fishes. Zoologica Scripta 11: 55–76.

Roberts, T. R. 1989. The freshwater fishes of western Borneo (Kalimantan Barat,

Indonesia). Memoirs of the California Academy of Sciences 14: 1–210.

Ronquist, F., J. Huelsenbeck, and M. Teslenko. 2011. Draft MrBayes version 3.2:

Tutorials and Model Summaries.

http://mrbayes.sourceforge.net/mb3.2_manual.pdf

Ronquist, F., M. Teslenko, P. van der Mark, D. L. Ayres, A. Darling, S. Höhna, B.

Larget, L. Liu, M. A. Suchard, and J. P. Huelsenbeck. 2012. MrBayes 3.2:

Efficient Bayesian phylogenetic inference and model choice across a large model

space. Systematic Biology 61(3): 539–542.

440

Rosen, D. E., and P. H. Greenwood. 1970. Origin of the weberian apparatus and the

relationships of the ostariophysan and gonorynchiform fishes. American Museum

Novitates 2428: 1–25.

Rüber, L., and D. C. Adams. 2001. Evolutionary convergence of body shape and trophic

morphology in cichlids from Lake Tanganyika. Journal of Evolutionary Biology

14: 325–332.

Rüber, L., M. Kottelat, H. H. Tan, P. K. L. Ng, and R. Britz. 2007. Evolution of

miniaturization and the phylogenetic position of Paedocypris, comprising the

world’s smallest vertebrate. BMC Evolutionary Biology 7: 1–10.

Sanders, M. 1934. Die fossilen fische der Alttertiaren Süsswasserablagerungen aus

Mittel-Sumatra. Verhandelingen van het Geologisch-Mijnbouwkundig

Genootschap voor Nederland en Kolonien, Geologische Serie 11: 1–143.

Sanger, T. J., and A. R. McCune. 2002. Comparative osteology of the Danio (Cyprinidae:

Ostariophysi) axial skeleton with comments on Danio relationships based on

molecules and morphology. Zoological Journal of the Linnean Society 135: 529–

546.

Schönhuth, S., I. Doadrio, O. Dominguez-Dominguez, D. M. Hillis, and R. L. Mayden.

2008. Molecular evolution of southern North American Cyprinidae

(Actinopterygii), with the description of the new genus Tampichthys from central

Mexico. Molecular Phylogenetics and Evolution 47: 729–756.

Schreitmüller, W. 1935. Neuimporte. Wochenschrift für Aquarien- und Terrarienkunde

32(7): 97–98.

441

Scribner, K. T., K. S. Page, amd M. L. Bartron. 2001. Hybridization in freshwater fishes:

a review of case studies and cytonuclear methods of biological inference. Reviews

in Fish Biology and Fisheries 10: 292–323.

Seehausen, O. 2004. Hybridization and adaptive radiation. Trends in Ecology and

Evolution 19(4): 198–207.

Seehausen, O., E. Koetsier, M. V. Schneider, L. J. Chapman, C. A. Chapman, M. E.

Knight, G. F. Turner, J. J. M. van Alphen, and R. Bills. 2003. Nuclear markers

reveal unexpected genetic variation and a Congolese-Nilotic origin of the Lake

Victoria cichlid species flock. Proceedings of the Royal Society of London. Series

B: Biological Sciences 270: 129–137.

Setiamarga, D. H. E., M. Miya, Y. Yamanoue, K. Mabuchi, T. P. Satoh, J. G. Inoue, and

M. Nishida. 2008. Interrelationships of Atherinomorpha (medakas, flyingfishes,

killifishes, silversides, and their relatives): The first evidence based on whole

mitogenome sequences. Molecular Phylogenetics and Evolution 49: 598–605.

Shimodaira, H., and M. Hasegawa. 1999. Multiple comparisons of log-likelihoods with

applications to phylogenetic inference. Molecular Biology and Evolution 16:

1114–1116.

Siebert, D. J. 1987. Interrelationships among families of the order Cypriniformes

(Teleostei). Unpublished Doctoral Dissertation. City University of New York.

Siebert, D. J. 1997. The identities of Rasbora paucisqualis Ahl in Schreitmϋller, 1935,

and Rasbora bankanensis (Bleeker, 1853), with the designation of a lectotype for

R. paucisqualis (Teleostei: Cyprinidae). The Raffles Bulletin of Zoology 45: 29–

37.

442

Siebert, D. J., and S. Guiry. 1996. Rasbora johannae (Teleostei: Cyprinidae), a new

species of the R. trifasciata-complex from Kalimantan, Indonesia. Cybium 20:

395–404.

Siebert, D. J., and P. J. Richardson. 1997. Rasbora laticlavia, a new cyprinid from

Kalimantan, Indonesia, and lectotype designation for R. vaillantii. Ichthyological

Exploration of Freshwaters 8: 89–95.

Sieh, K., and D. Natawidjaja. 2000. Neotectonics of the Sumatran fault, Indonesia.

Journal of Geophysical Research 105: 28,295–28,326.

Silva, A., K. Maduwage, and R. Pethiyagoda. 2010. A review of the genus Rasbora in Sri

Lanka, with description of two new species (Teleostei: Cyprinidae).

Ichthyological Exploration of Freshwaters 21(1): 27–50.

Simons, A. M., P. B. Berendzen, and R. L. Mayden. 2003. Molecular systematics of

North American phoxinin genera (Actinopterygii: Cyprinidae) inferred from

mitochondrial 12S and 16S ribosomal RNA sequences. Zoological Journal of the

Linnean Society 139: 63–80.

Soni, D. D., B. K. Srivastava, and V. Zargar. 1979. Morphology of the caudal fin

skeleton in 18 mm embryo of Rasbora daniconius (Ham. Buch.). Folia

Morphologica 27(4): 334–338.

Springer, V. G., and G. R. Allen. 2004. Ecsenius caeruliventris and E. shirleyae, two

species of bleniid fishes from Indonesia, and new distribution records for other

species of Ecsenius. Zootaxa 791: 1–12.

Springer, V. G., and T. M. Orrell. 2004. Appendix: phylogenetic analysis of 147 families

of acanthomorph fishes based primarily on dorsal gill-arch muscles and skeleton.

443

In: Springer, V. G., G. D. Johnson (Eds.). Study of the Dorsal Gill-Arch

Musculature of Teleostome Fishes, with Special Reference to the Actinopterygii.

Bulletin of the Biological Society of Washington 11: 236–260.

Stamatakis, A. 2006. RAxML-VI-HPC: maximum likelihood-based phylogenetic

analyses with thousands of taxa and mixed models. Bioinformatics 22: 2688–

2690.

Steindachner, F. 1870. Ichthyologische Notizen (X). (Schluss). Sitzungsberichte der

kaiserlichen akademie der wissenschaften. Mathematisch-Naturwissenschaftliche

Classe 61: 623–642, Pls. 1–5.

Stiassny, M. L J., and J. S. Jensen. 1987. Labroid intrarelationships revisited:

Morphological complexity, key innovations, and the study of comparative

diversity. Bulletin of the Museum of Comparative Zoology 151(5): 269–319.

Stiassny, M. L. J. S., and A. Getahun. 2007. An overview of labeonin relationships and

the phylogenetic placement of the Afro-Asian genus Garra Hamilton, 1992

(Teleostei: Cyprinidae), with the description of five new species of Garra from

Ethiopia, and a key to all African species. Zoological Journal of the Linnean

Society 150: 41–83.

Swofford, D. L. 2002. PAUP*. Phylogenetic Analysis Using Parsimony (*and Other

Methods), version 4. Sinauer Associates, Sunderland, Massachusetts.

Takahashi, K., Y. Terai, M. Nishida, and N. Okada. 2001. Phylogenetic relationships and

ancient incomplete lineage sorting among cichlid fishes in Lake Tanganyika as

revealed by analysis of the insertion of retroposons. Molecular Biology and

Evolution 18(11); 2057–2066.

444

Takahasi, N. 1925. On the homology of the cranial muscles of the cypriniform fishes.

Journal of Morphology and Physiology 40(1): 1–109.

Tan, H. H. 1999. Rasbora vulcanus, a new species of cyprinid fish from central Sumatra.

Journal of South Asian Natural History 4: 111–116.

Tan, H. H. 2009. Rasbora patrickyapi, a new species of cyprinid fish from Central

Kalimantan, Borneo. The Raffles Bulletin of Zoology 57(2): 505–509.

Tan, H. H., and Kottelat, M. 2009. The fishes of the Batang Hari drainage, Sumatra, with

description of six new species. Ichthyological Exploration of Freshwaters, 20, 13–

69.

Tang, K. L., M. K. Agnew, M. V. Hirt, T. Sado, L. M. Schneider, J. Freyhof, Z.

Sulaiman, E. Swartz, C. Vidthayanon, M. Miya, K. Saitoh, A. M. Simons, R. M.

Wood, and R. L. Mayden. 2010. Systematics of the subfamily Danioninae

(Teleostei: Cypriniformes: Cyprinidae). Molecular Phylogenetics and Evolution

57: 189–214.

Templeton, A. R. 1983. Phylogenetic inference from restriction endonuclease cleavage

site maps with particular reference to the evolution of humans and apes. Evolution

37: 221–244.

Tewari, S. K. 1973. The morphology of the chondrocranium of Rasbora daniconius

(Ham. Buch.). Gegenbaurs Morphologisches Jahrbuch 118(3): 448–460.

The Heliconius Genome Consortium. 2012. Butterfly genome reveals promiscuous

exchange of mimicry adapatations among species. Nature 487: 94–98.

445

Thinés, G., and E. Vandenbussche. 1966. The effects of alarm substance on the schooling

behavior of Rasbora heteromorpha Duncker in day and night conditions. Animal

Behaviour 14(2): 296–302.

Toews, D. P. L., and A. Brelsford. 2012. The biogeography of mitochondrial and nuclear

discordance in animals. Molecular Ecology 21: 3907–3930.

Turner, G. F. 2002. Parallel speciation, despeciation and respeciation: implications for

species definition. Fish and Fisheries 3: 225–229.

Vaidya, G., D. J. Lohman, and R. Meier. 2011. SequenceMatrix: concatenation software

for the fast assembly of multi-gene datasets with character set and codon

information. Cladistics 27: 171–180.

Vishwanath, W., and J. Laisram. 2005. A new species of Rasbora Bleeker

(Cypriniformes: Cyprinidae) from Manipur, India. Journal of the Bombay Natural

History Society 101(3): 429–432.

Wainwright, P. C., and G. V. Lauder. 1992. The evolution of feeding biology in sunfishes

(Centrarchidae). In: Mayden, R. (ed.), Systematics, historical ecology and North

American freshwater fishes. Pp. 472–491. Stanford University Press, Stanford.

Ward-Campbell, B. M. S., F. W. H. Beamish, and C. Kongchaiya. 2005. Morphological

characteristics in relation to diet in five coexisting Thai fish species. Journal of

Fish Biology 67: 1266–1279.

Ward, R.D., T.S. Zemlak, B.H. Innes, P.R. Last, and P.D.N. Hebert. 2005. Barcoding

Australia’s fish species. Philosophical Transactions of the Royal Society of

London B 360:1847–1857.

446

Walter, I., W. Tschulenk, M. Schabuss, I. Miller, and B. Grillitsch. 2005. Structure of the

seminal pathway in the European chub, Leuciscus cephalus (Cyprinidae):

Teleostei. Journal of Morphology 263: 375–391.

Weber, M., and L. F. de Beaufort. 1916. The fishes of the Indo-Australian Archipelago.

III. Ostariophysi: II Cyprinoidea, Apodes, Synbranchi. E. J. Brill, Leiden. i–xv +

1–455.

Weitzman, S. H. 1962. The osteology of Brycon meeki, a generalized characid fish, with

an osteological definition of the family. Stanford Ichthyological Bulletin 8: 1–77.

Weitzman, S. H. 1974. Osteology and evolutionary relationships of the Sternoptychidae

with a new classification of stomiatoid families. Bulletin of the American

Museum of Natural History 153(3): 331–478.

Weitzman, S. H., and R. P. Vari. 1988. Miniaturization in South American freshwater

fishes; an overview and discussion. Proc. Biol. Soc. Wash. 101: 444–465.

West, J. L., and F. E. Hester. 1966. Intergeneric hybridization of centrarchids.

Transaction of the American Fisheries Society 95(3): 280–288.

Wijeyaratne, W. M., and A. Pathiratne. 2006. Acetylcholinesterase inhibition and gill

lesions in Rasbora caverii, an indigenous fish inhabiting rice field associated

waterbodies in Sri Lanka. Ecotoxicology 15(7): 609–619.

Wilding, C. S., R. K. Butlin, and J. Grahame. 2001. Differential gene exchange between

parapatric morphs of Littorina saxatilis detected using AFLP markers. Journal of

Evolutionary Biology 14: 611–619.

447

Wiley, E. O., G. D. Johnson, and W. W. Dimmick. 2000. The interrelationships of

Acanthomorph fishes: A total evidence approach using molecular and

morphological data. Biochemical Systematics and Ecology 28: 319–350.

Wiley, M.L., and B. B. Collette. 1970. Breeding tubercles and contact organs in fishes:

Their occurrence, structure, and significance. Bulletin of American Museum of

Natural History 143: 147–417.

Winterbottom, R. 1974. A descriptive synonymy of the striated muscles of the Teleostei.

Proceedings of the Academy of Natural Sciences of Philadelphia 125: 225–317.

Wirjoatmodjo, S. 1987. The river ecosystem in the forest area at Ketambe, Gunung

Leuser National Park, Aceh, Indonesia. Archiv für Hydrobiologie-ergebnisse der

Limnologie, 28, 239 –246.

Yashpal, M., U. Kumari, S. Mittal, and A. K. Mittal. 2009. Morphological specializations

of the buccal cavity in relation to the food and feeding habit of a carp Cirrhinus

mrigala: A scanning electron microscopic investigation. Journal of Morphology

270: 714–728.

Zinner, D., M. L. Arnold, and C. Roos. 2009. Is the new primate genus Rungwecebus a

baboon?. PLoS One 4(3): e4859.

Zinner, D., M. L. Arnold, and C. Roos. 2011. The strange blood: Natural hybridization in

primates. Evolutionary Anthroplogy 20: 96–103.

Zwickl, D. J. 2006. Genetic algorithm approaches for the phylogenetic analysis of large

biological sequence datasets under the maximum likelihood criterion. Ph.D.

dissertation, The University of Texas at Austin.

448

Appendix 1. Valid species of the supragenus Rasbora and undescribed species with the classification based on the results of phylogenetic study of this dissertation (see chapter 3).

VALID TAXA NOMINAL TAXA/SYNONYMS

The Daniconius group

Rasbora daniconius (Hamilton, 1822) Cyprinus daniconius Hamilton, 1822 Cyprinus anjana Hamilton, 1822 Leuciscus lateralis McClelland, 1839 Rasbora neilgherriensis Day, 1867 Rasbora woolaree Day, 1867 Rasbora zanzibarensis Günther, 1867 Rasbora palustris Smith, 1945

Rasbora dandia (Valenciennes, 1844) Leuciscus dandia Valenciennes in Cuvier and Valenciennes, 1844 Leuciscus flavus Jerdon, 1849 Leuciscus malabaricus Jerdon, 1849 Leuciscus xanthogramme Jerdon, 1849

Rasbora caverii (Jerdon, 1849) Leuciscus caverii Jerdon, 1849

Rasbora microcephalus (Jerdon, 1849) Leuciscus microcephalus Jerdon, 1849

Rasbora kobonensis Chauduri, 1913 Rasbora kobonensis Chauduri, 1913

Rasbora labiosa Mukerji, 1935 Rasbora labiosa Mukerji, 1935

Rasbora wilpita Kottelat and Pethiyagoda, 1991 Rasbora wilpita Kottelat and Pethiyagoda, 1991

Rasbora armitagei Silva et al., 2010 Rasbora armitagei Silva et al., 2010

449

Rasbora naggsi Silva et al., 2010 Rasbora naggsi Silva et al., 2010

Rasbora ornata Viswanath and Laisram, 2005 Rasbora ornatus Viswanath and Laisram, 2005

Horadandia+ Rasboroides

Horadandia atukorali Deraniyagala, 1943 Horadandia atukorali Deraniyagala, 1943

Rasboroides vaterifloris (Deraniyagala, 1930) Rasbora vaterifloris Deraniyagala, 1930 Rasbora nigromarginata Meinken, 1957 Rasbora vaterifloris pallida Deraniyagala, 1958 Rasbora vaterifloris ruber Deraniyagala, 1958 Rasbora vaterifloris rubioculis Deraniyagala, 1958 Rasbora vaterifloris typical Deraniyagala, 1958

Kottelatia

Kottelatia brittani (Axelrod, 1976) Rasbora brittani Axelrod, 1976

Rasbora kalbarensis Kottelat, 1991 Rasbora kalbarensis Kottelat, 1991

Trigonopoma

Trigonopoma pauciperforatum (Weber and de Beaufort, 1916) Rasbora pauciperforata Weber and de Beaufort, 1916 Rasbora agilis Ahl, 1937

Trigonopoma gracile (Kottelat, 1991) Rasbora gracilis Kottelat, 1991

Trigonopoma n. sp. 1 “Kalimantan Selatan”

Trigonopoma n. sp. 2 “UF”

450

Trigonopoma n. sp. 3 “Riau”

Boraras

Boraras maculata (Duncker, 1904) Rasbora maculata Duncker, 1904

Boraras brigittae (Vogt, 1978) Rasbora urophthalma brigittae Vogt, 1978

Boraras merah (Kottelat, 1991) Rasbora merah Kottelat, 1991

Boraras urophthalmoides (Kottelat, 1991) Rasbora urophthalmoides Kottelat 1991

Boraras micros Kottelat and Vidthayanon, 1993 Boraras micros Kottelat and Vidthayanon, 1993

Boraras naevus Conway and Kottelat, 2011 Boraras naevus Conway and Kottelat, 2011

The Einthovenii group

Rasbora einthovenii (Bleeker, 1851) Leuciscus einthovenii Bleeker, 1851 Rasbora vegae Rendahl, 1926 Rasbora labuana Whitley, 1958

Rasbora kalochroma (Bleeker, 1851) Leuciscus kalochroma Bleeker, 1851

Rasbora jacobsoni Weber and de Beaufort, 1916 Rasbora jacobsoni Weber and de Beaufort, 1916

Rasbora tubbi Brittan, 1954 Rasbora tubbi Brittan, 1954

Rasbora kottelati Lim, 1995 Rasbora kottelati Lim, 1995

Rasbora patrickyapi Tan, 2009 Rasbora patrickyapi Tan, 2009

451

The Trifasciata group

Rasbora bankanensis (Bleeker, 1853) Leuciscus bankanensis Bleeker, 1853

Rasbora trifasciata Popta, 1905 Rasbora trifasciata Popta, 1905

Rasbora rutteni Weber and de Beaufort, 1916 Rasbora rutteni Weber and de Beaufort, 1916

Rasbora semilineata Weber and de Beaufort, 1916 Rasbora semilineata Weber and de Beaufort, 1916

Rasbora taytayensis Herre, 1924 Rasbora taytayensis Herre, 1924

Rasbora paucisqualis Ahl, 1935 Rasbora paucisqualis Ahl, 1935

Rasbora sarawakensis Brittan, 1951 Rasbora sarawakensis Brittan, 1951

Rasbora hubbsi Brittan, 1954 Rasbora hubbsi Brittan, 1954

Rasbora ennealepis Roberts, 1989 Rasbora ennealepis Roberts, 1989

Rasbora tuberculata Kottelat, 1995 Rasbora tuberculata Kottelat, 1995

Rasbora johannae Siebert and Guiry, 1996 Rasbora johannae Siebert and Guiry, 1996

Rasbora amplistriga Kottelat, 2000 Rasbora amplistriga Kottelat, 2000

Rasbora dies Kottelat, 2008 Rasbora dies Kottelat, 2008

Rasbora lacrimula Hadiaty and Kottelat, 2009 Rasbora lacrimula Hadiaty and Kottelat, 2009

Rasbora n. sp. 8 “Kalimantan Selatan”

452

Rasbora n. sp. 9 “Kalimantan Selatan”

Rasbora n. sp. 10 “Kalimantan Selatan”

The Argyrotaenia group

Rasbora argyrotaenia (Bleeker, 1849) Leuciscus argyrotaenia Bleeker, 1849 Leuciscus cyanotaenia Bleeker, 1849 Leuciscus schwenkii Bleeker, 1857 Rasbora everetti Boulenger, 1895 Rasbora vaillantii Popta, 1905

Rasbora dusonensis (Bleeker, 1850) Leuciscus dusonensis Bleeker, 1850 Rasbora myersi Brittan, 1954

Rasbora cephalotaenia (Bleeker, 1852) Leuciscus cephalotaenia Bleeker, 1852 Rasbora beauforti Hardenberg, 1937

Rasbora borneensis Bleeker, 1860 Rasbora borneensis Bleeker, 1860

Rasbora philippina Günther, 1880 Rasbora philippina Günther, 1880 Rasbora punctulatus Seale and Bean, 1907

Rasbora aurotaenia Tirant, 1885 Rasbora aurotaenia Tirant, 1885 Rasbora retrodorsalis Smith, 1945

Rasbora vaillanti Popta, 1905 Rasbora vaillanti Popta, 1905

Rasbora tornieri Ahl, 1922 Rasbora tornieri Ahl, 1922

Rasbora borapetensis Smith, 1934 Rasbora borapetensis Smith, 1934

Rasbora myersi Brittan, 1954 Rasbora myersi Brittan, 1954

453

Rasbora laticlavia Siebert and Richardson, 1997 Rasbora laticlavia Siebert and Richardson, 1997

Rasbora septentrionalis Kottelat, 2000 Rasbora septentrionalis Kottelat, 2000

Rasbora rheophila Kottelat, 2012 Rasbora rheophila Kottelat, 2012

Brevibora

Brevibora dorsiocellata (Duncker, 1904) Rasbora dorsiocellata Duncker, 1904 Rasbora dorsiocellata macrophthalma Meinken, 1951

Brevibora cheeya Liao and Tan, 2011 Brevibora cheeya Liao and Tan, 2011

Trigonostigma

Trigonostigma heteromorpha (Duncker, 1904) Rasbora heteromorpha Duncker, 1904

Trigonostigma hengeli (Meinken, 1956) Rasbora hengeli Meinken, 1956

Trigonostigma somphongsi (Meinken, 1958) Rasbora somphongsi Meinken, 1958

Trigonostigma espei (Meinken, 1967) Rasbora heteromorpha espei Meinken, 1967

The Reticulata group

Rasbora reticulata Weber and de Beaufort, 1915 Rasbora reticulatus Weber and de Beaufort, 1915

Rasbora meinkeni de Beaufort, 1931 Rasbora meinkeni de Beaufort, 1931

454

Rasbora tobana Ahl, 1934 Rasbora tobana Ahl, 1934

Rasbora rubrodorsalis Donoso-Büchner and Schmidt, 1997 Rasbora rubrodorsalis Donoso-Büchner and Schmidt, 1997

Rasbora vulcanus Tan, 1999 Rasbora vulcanus Tan, 1999

Rasbora api Lumbantobing, 2010 Rasbora api Lumbantobing, 2010

Rasbora kluetensis Lumbantobing, 2010 Rasbora kluetensis Lumbantobing, 2010

Rasbora nodulosa Lumbantobing, 2010 Rasbora nodulosa Lumbantobing, 2010

Rasbora truncata Lumbantobing, 2010 Rasbora truncata Lumbantobing, 2010

Rasbora n. sp. 11 “Sumatra”

The Caudimaculata group (Rasbosoma)

Rasbora trilineata Steindachner, 1870 Rasbora trilineata Steindachner, 1870 Rasbora stigmatura Fowler, 1934

Rasbora caudimaculata Volz, 1903 Rasbora caudimaculata Volz 1903 Rasbora layangi Fowler, 1939 Rasbora dorsimaculata Herre, 1940

Rasbora spilocerca Rainboth and Kottelat, 1987 Rasbora spilocerca Rainboth and Kottelat, 1987

Rasbora subtilis Roberts, 1989 Rasbora subtilis Roberts, 1989

455

The Sumatrana group

Rasbora rasbora (Hamilton, 1822) Cyprinus rasbora Hamilton, 1822 Leuciscus presbyter Valenciennes in Cuvier and Valenciennes, 1844 Rasbora buchanani Bleeker, 1860

Rasbora sumatrana (Bleeker, 1852) Leuciscus sumatrana Bleeker, 1852

Rasbora lateristriata (Bleeker, 1854) Leuciscus lateristriatus Bleeker, 1854

Rasbora leptosoma (Bleeker, 1855) Leuciscus leptosoma Bleeker, 1855

Rasbora macrocephalus Bleeker, 1863 Rasbora macrocephalus Bleeker, 1863

Rasbora paviana Tirant, 1885 Rasbora paviana Tirant, 1885 Rasbora paviei Chevey, 1932 Rasbora cheroni Fowler, 1937 Rasbora cromiei Fowler, 1937

Rasbora calliura Boulenger, 1894 Rasbora calliura Boulenger, 1894

Rasbora taeniata Vaillant, 1894 Rasbora taeniata Vaillant, 1894

Rasbora unicolor Vaillant, 1894 Rasbora unicolor Vaillant, 1894

Rasbora hosii Boulenger, 1895 Rasbora hosii Boulenger, 1895

Rasbora elegans Volz, 1903 Rasbora elegans Volz, 1903

Rasbora vulgaris Duncker, 1904 Rasbora vulgaris Duncker, 1904

Rasbora volzi Popta, 1905 Rasbora volzi Popta, 1905 Rasbora volzi fasciata Popta, 1905

456

Rasbora elberti Popta, 1911 Rasbora elberti Popta, 1911

Rasbora tawarensis Weber and de Beaufort, 1916 Rasbora tawarensis Weber and de Beaufort, 1916

Rasbora steineri Nichols and Pope, 1927 Rasbora cephalotaenia steineri Nichols and Pope, 1927 Rasbora lateristriata allos Lin, 1931 Rasbora volzi pallopinna Lin, 1932

Rasbora bunguranensis Brittan, 1951 Rasbora elegans bunguranensis Brittan, 1951

Rasbora aprotaenia Hubbs and Brittan, 1954 Rasbora aprotaenia Hubbs and Brittan, 1954

Rasbora baliensis Hubbs and Brittan, 1954 Rasbora baliensis Hubbs and Brittan, 1954

Rasbora nematotaenia Hubbs and Brittan, 1954 Rasbora elegans nematotaenia Hubbs and Brittan, 1954

Rasbora spilotaenia Hubbs and Brittan, 1954 Rasbora elegans spilotaenia Hubbs and Brittan, 1954

Rasbora hobelmani Kottelat, 1984 Rasbora hobelmani Kottelat, 1984

Rasbora atridorsalis Kottelat and Chu, 1987 Rasbora atridorsalis Kottelat and Chu, 1987

Rasbora dorsinotata Kottelat and Chu, 1987 Rasbora dorsinotata Kottelat and Chu, 1987

Rasbora notura Kottelat, 2005 Rasbora notura Kottelat, 2005

Rasbora atranus Kottelat and Tan, 2011 Rasbora atranus Kottelat and Tan, 2011

Rasbora cryptica Kottelat and Tan, 2012 Rasbora cryptica Kottelat and Tan, 2012

Rasbora n. sp. 1 “Sumatra”

Rasbora n. sp. 2 “Sumatra”

457

Rasbora n. sp. 3 “Sumatra”

Rasbora n. sp. 4 “Sumatra”

Rasbora n. sp. 5 “Sumatra”

Rasbora n. sp. 6 “Kalimantan Selatan”

Rasbora n. sp. 7 “Brunei”

Incertae sedis

Rasbora gerlachi Ahl, 1928 Rasbora gerlachi Ahl, 1928

Rasbora chrysotaenia Ahl, 1937 Rasbora chrysotaenia Ahl, 1937

Rasbora wijnbergi Meinken, 1963 Rasbora wijnbergi Meinken, 1963

458

Appendix 2. Nominal species and subspecies of Rasbora sensu lato (in chronological order of description) and recognized species according to the results of this dissertation.

Cyprinus anjana Hamilton, 1822 Rasbora daniconius (Hamilton, 1822)

Cyprinus daniconius Hamilton, 1822 Rasbora daniconius (Hamilton, 1822)

Cyprinus elanga Hamilton, 1822 Bengala elanga (Hamilton, 1822)

Cyprinus rasbora Hamilton, 1822 Rasbora rasbora (Hamilton, 1822)

Leuciscus dystomus McClelland, 1839 Bengala elanga (Hamilton, 1822)

Leuciscus lateralis McClelland, 1839 Rasbora daniconius (Hamilton, 1822)

Leuciscus dandia Valenciennes in Cuvier and Valenciennes, 1844 Rasbora dandia (Valenciennes, 1844)

Leuciscus presbyter Valenciennes in Cuvier and Valenciennes, 1844 Rasbora rasbora (Hamilton, 1822)

Leuciscus argyrotaenia Bleeker, 1849 Rasbora argyrotaenia (Bleeker, 1849)

Leuciscus cyanotaenia Bleeker, 1849 Rasbora argyrotaenia (Bleeker, 1849)

Leuciscus caverii Jerdon, 1849 Rasbora caverii (Jerdon, 1849)

Leuciscus flavus Jerdon, 1849 Rasbora dandia (Valenciennes, 1844)

Leuciscus malabaricus Jerdon, 1849 Rasbora dandia (Valenciennes, 1844)

Leuciscus microcephalus Jerdon, 1849 Rasbora microcephalus (Jerdon, 1849)

459

Leuciscus xanthogramme Jerdon, 1849 Rasbora dandia (Valenciennes, 1844)

Leuciscus dusonensis Bleeker, 1850 Rasbora dusonensis (Bleeker, 1850)

Leuciscus einthovenii Bleeker, 1851 Rasbora einthovenii (Bleeker, 1851)

Leuciscus kalochroma Bleeker, 1851 Rasbora kalochroma (Bleeker, 1851)

Leuciscus cephalotaenia Bleeker, 1852 Rasbora cephalotaenia (Bleeker, 1852)

Leuciscus sumatranus Bleeker, 1852 Rasbora sumatrana (Bleeker, 1852)

Leuciscus bankanensis Bleeker, 1853 Rasbora bankanensis (Bleeker, 1853)

Leuciscus lateristriatus Bleeker, 1854 Rasbora lateristriata (Bleeker, 1854)

Leuciscus leptosoma Bleeker, 1855 Rasbora leptosoma (Bleeker, 1855)

Leuciscus schwenkii Bleeker, 1857 Rasbora argyrotaenia (Bleeker, 1849)

Rasbora borneensis Bleeker, 1860 Rasbora borneensis Bleeker, 1860

Rasbora buchanani Bleeker, 1860 Rasbora rasbora (Hamilton, 1822)

Rasbora macrocephalus Bleeker, 1863 Rasbora macrocephalus Bleeker, 1863

Rasbora neilgherriensis Day, 1867 Rasbora daniconius (Hamilton, 1822)

Rasbora woolaree Day, 1867 Rasbora daniconius (Hamilton, 1822)

Rasbora zanzibarensis Günther, 1867 Rasbora daniconius (Hamilton, 1822)

Rasbora trilineata Steindachner, 1870 Rasbora trilineata Steindachner, 1870

460

Rasbora rasbora blanchardi Sauvage and Thiersant, 1874 Opsariichthys bidens Günther, 1873

Rasbora philippina Günther, 1880 Rasbora philippina Günther, 1880

Rasbora aurotaenia Tirant, 1885 Rasbora aurotaenia Tirant, 1885

Rasbora paviana Tirant, 1885 Rasbora paviana Tirant, 1885

Rasbora calliura Boulenger, 1894 Rasbora calliura Boulenger, 1894

Rasbora sumatrana taeniata Vaillant, 1894 Rasbora taeniata Vaillant, 1894

Rasbora sumatrana unicolor Vaillant, 1894 Rasbora sumatrana (Bleeker, 1852)

Rasbora everetti Boulenger, 1895 Rasbora everetti Boulenger, 1895

Rasbora hosii Boulenger, 1895 Rasbora hosii Boulenger, 1895

Rasbora caudimaculata Volz, 1903 Rasbora caudimaculata Volz, 1903

Rasbora elegans Volz, 1903 Rasbora elegans Volz, 1903

Rasbora dorsiocellata Duncker, 1904 Brevibora dorsiocellata (Duncker, 1904)

Rasbora heteromorpha Duncker, 1904 Trigonostigma heteromorpha (Duncker, 1904)

Rasbora maculata Duncker, 1904 Boraras maculata (Duncker, 1904)

Rasbora vulgaris Duncker, 1904 Rasbora vulgaris Duncker, 1904

Rasbora volzi Popta, 1905 Rasbora volzi Popta, 1905

Rasbora trifasciata Popta, 1905 Rasbora trifasciata Popta, 1905

461

Rasbora vaillantii Popta, 1905 Rasbora argyrotaenia (Bleeker, 1849)

Rasbora volzi fasciata Popta, 1905 Rasbora volzi Popta, 1905

Rasbora punctulatus Seale and Bean, 1907 Rasbora philippina Günther, 1880

Rasbora elberti Popta, 1911 Rasbora elberti Popta, 1911

Rasbora rasbora kobonensis Chaudhuri, 1913 Rasbora kobonensis Chaudhuri, 1913

Rasbora reticulatus Weber and de Beaufort, 1915 Rasbora reticulata Weber and de Beaufort, 1915

Rasbora jacobsoni Weber and de Beaufort, 1916 Rasbora jacobsoni Weber and de Beaufort, 1916

Rasbora pauciperforata Weber and de Beaufort, 1916 Trigonopoma pauciperforatum (Weber and de Beaufort, 1916)

Rasbora rutteni Weber and de Beaufort, 1916 Rasbora rutteni Weber and de Beaufort, 1916

Rasbora semilineata Weber and de Beaufort, 1916 Rasbora semilineata Weber and de Beaufort, 1916

Rasbora tawarensis Weber and de Beaufort, 1916 Rasbora tawarensis Weber and de Beaufort, 1916

Rasbora taeniata Ahl, 1922 cyprinodontiform (see Kottelat, 1991)

Rasbora tornieri Ahl, 1922 Rasbora tornieri Ahl, 1922

Rasbora urophthalma Ahl, 1922 Puntius sp. (see Rainboth and Kottelat, 1987)

Rasbora taytayensis Herre, 1924 Rasbora taytayensis Herre, 1924

Rasbora vegae Rendahl, 1926 Rasbora einthovenii (Bleeker, 1851)

Rasbora cephalotaenia steineri Nichols and Pope, 1927 Rasbora steineri Nichols and Pope, 1927

462

Rasbora gerlachi Ahl, 1928 Rasbora gerlachi Ahl, 1928

Rasbora vaterifloris Deraniyagala, 1930 Rasboroides vaterifloris (Deraniyagala 1930)

Rasbora lateristriata allos Lin, 1931 Rasbora steineri Nichols and Pope, 1927

Rasbora meinkeni de Beaufort, 1931 Rasbora meinkeni de Beaufort, 1931

Rasbora volzi pallopinna Lin, 1932 Rasbora steineri Nichols and Pope, 1927

Rasbora paviei Chevey, 1932 Rasbora paviana Tirant, 1885

Rasbora borapetensis Smith, 1934 Rasbora borapetensis Smith, 1934

Rasbora stigmatura Fowler, 1934 Rasbora trilineata Steindachner, 1870

Rasbora tobana Ahl, 1934 Rasbora tobana Ahl, 1934

Rasbora labiosa Mukerji, 1935 Rasbora labiosa Mukerji, 1935

Rasbora paucisqualis Ahl, 1935 Rasbora paucisqualis Ahl, 1935

Rasbora agilis Ahl, 1937 Trigonopoma pauciperforatum (Weber and de Beaufort, 1916)

Rasbora beauforti Hardenberg, 1937 Rasbora cephalotaenia (Bleeker, 1852)

Rasbora cheroni Fowler, 1937 Rasbora paviana Tirant, 1885

Rasbora chrysotaenia Ahl, 1937 Rasbora chrysotaenia Ahl, 1937

Rasbora cromiei Fowler, 1937 Rasbora paviana Tirant, 1885

Rasbora layangi Fowler, 1939 Rasbora caudimaculata Volz, 1903

463

Rasbora dorsimaculata Herre, 1940 Rasbora caudimaculata Volz, 1903

Rasbora palustris Smith, 1945 Rasbora daniconius (Hamilton, 1822)

Rasbora retrodorsalis Smith, 1945 Rasbora aurotaenia Tirant, 1885

Rasbora dorsiocellata macrophthalma Meinken, 1951 Brevibora dorsiocellata (Duncker, 1904)

Rasbora elegans bunguranensis Brittan, 1951 Rasbora bunguranensis Brittan, 1951

Rasbora sarawakensis Brittan, 1951 Rasbora sarawakensis Brittan, 1951

Rasbora aprotaenia Hubbs and Brittan, 1954 Rasbora aprotaenia Hubbs and Brittan, 1954

Rasbora baliensis Hubbs and Brittan, 1954 Rasbora baliensis Hubbs and Brittan, 1954

Rasbora hubbsi Brittan, 1954 Rasbora hubbsi Brittan, 1954

Rasbora myersi Brittan, 1954 Rasbora myersi Brittan, 1954

Rasbora elegans nematotaenia Hubbs and Brittan, 1954 Rasbora nematotaenia Hubbs and Brittan, 1954

Rasbora elegans spilotaenia Hubbs and Brittan, 1954 Rasbora spilotaenia Hubbs and Brittan, 1954

Rasbora tubbi Brittan, 1954 Rasbora tubbi Brittan, 1954

Rasbora hengeli Meinken, 1956 Trigonostigma hengeli (Meinken, 1956)

Rasbora nigromarginata Meinken, 1957 Rasboroides vaterifloris (Deraniyagala 1930)

Rasbora labuana Whitley, 1958 Rasbora einthovenii (Bleeker, 1851)

Rasbora vaterifloris pallida Deraniyagala, 1958 Rasboroides vaterifloris (Deraniyagala 1930)

464

Rasbora vaterifloris ruber Deraniyagala, 1958 Rasboroides vaterifloris (Deraniyagala 1930)

Rasbora vaterifloris rubioculis Deraniyagala, 1958 Rasboroides vaterifloris (Deraniyagala 1930)

Rasbora somphongsi Meinken, 1958 Trigonostigma somphongsi (Meinken, 1958)

Rasbora vaterifloris typica Deraniyagala, 1958 Rasboroides vaterifloris (Deraniyagala 1930)

Rasbora wijnbergi Meinkeni, 1963 Rasbora wijnbergi Meinkeni, 1963

Rasbora heteromorpha espei Meinken, 1967 Trigonostigma espei (Meinken, 1967)

Rasbora axelrodi Brittan, 1976 Sundadanio axelrodi (Brittan, 1976)

Rasbora brittani Axelrod, 1976 Kottelatia brittani (Axelrod, 1976)

Rasbora urophthalma brigittae Vogt, 1978 Boraras brigittae (Vogt, 1978)

Rasbora hobelmani Kottelat, 1984 Rasbora hobelmani Kottelat, 1984

Rasbora atridorsalis Kottelat and Chu, 1987 Rasbora atridorsalis Kottelat and Chu, 1987

Rasbora dorsinotata Kottelat and Chu, 1987 Rasbora dorsinotata Kottelat and Chu, 1987

Rasbora spilocerca Rainboth and Kottelat, 1987 Rasbora spilocerca Rainboth and Kottelat, 1987

Rasbora ennealepis Roberts, 1989 Rasbora ennealepis Roberts, 1989

Rasbora subtilis Roberts, 1989 Rasbora subtilis Roberts, 1989

Rasbora gracilis Kottelat, 1991 Trigonopoma gracile (Kottelat, 1991)

Rasbora kalbarensis Kottelat, 1991 Rasbora kalbarensis Kottelat, 1991

465

Rasbora merah Kottelat, 1991 Boraras merah (Kottelat, 1991)

Rasbora urophthalmoides Kottelat, 1991 Boraras urophthalmoides (Kottelat, 1991)

Rasbora wilpita Kottelat and Pethiyagoda, 1991 Rasbora wilpita Kottelat and Pethiyagoda, 1991

Rasbora kottelati Lim, 1995 Rasbora kottelati Lim, 1995

Rasbora tuberculata Kottelat, 1995 Rasbora tuberculata Kottelat, 1995

Rasbora johannae Siebert and Guiry, 1996 Rasbora johannae Siebert and Guiry, 1996

Rasbora laticlavia Siebert and Richardson, 1997 Rasbora laticlavia Siebert and Richardson, 1997

Rasbora rubrodorsalis Donoso-Büchner and Schmidt, 1997 Rasbora rubrodorsalis Donoso-Büchner and Schmidt, 1997

Rasbora vulcanus Tan, 1999 Rasbora vulcanus Tan, 1999

Rasbora amplistriga Kottelat, 2000 Rasbora amplistriga Kottelat, 2000

Rasbora septentrionalis Kottelat, 2000 Rasbora septentrionalis Kottelat, 2000

Rasbora notura Kottelat, 2005 Rasbora notura Kottelat, 2005

Rasbora ornatus Viswanath and Laisram, 2005 Rasbora ornata Viswanath and Laisram, 2005

Rasbora dies Kottelat, 2008 Rasbora dies Kottelat, 2008

Rasbora lacrimula Hadiaty and Kottelat, 2009 Rasbora lacrimula Hadiaty and Kottelat, 2009

Rasbora patrickyapi Tan, 2009 Rasbora patrickyapi Tan, 2009

Rasbora api Lumbantobing, 2010 Rasbora api Lumbantobing, 2010

466