DOCSLIB.ORG

The Pennsylvania State University the Graduate School Department

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Pennsylvania State University the Graduate School Department The Pennsylvania State University The Graduate School Department of Biology STUDIES OF GENE EXPRESSION EVOLUTION: GENES ON THE INACTIVE X CHROMOSOME AND DUPLICATE GENES A Dissertation in Biology by Chungoo Park © 2010 Chungoo Park Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy December 2010 The dissertation of Chungoo Park was reviewed and approved* by the following: Kateryna D. Makova Associate Professor of Biology Dissertation Co-Advisor Chair of Committee Laura Carrel Associate Professor of Biochemistry and Molecular Biology Dissertation Co-advisor Francesca Chiaromonte Professor of Statistics Webb Miller Professor of Biology and Computer Science and Engineering Claude dePamphilis Professor of Biology Douglas R. Cavener Professor of Biology Head of the Department of Biology *Signatures are on file in the Graduate School iii ABSTRACT Understanding the determinants of the rate of protein evolution is one of the major goals in molecular evolution. Among the potential variables, expression abundance is one of the most important factors for determining protein evolutionary rates; the variation in gene expression appears to contribute to the evolutionary divergence and phenotypic diversity among species and individuals. Here we perform studies to characterize variation in gene expression patterns on the inactive X chromosome, and across duplicate genes in mammals. Specifically, several questions are addressed in greater detail in this dissertation. First, what genomic signals determine the expression status of genes on the inactive X chromosome? Second, does selection operate differently on genes that escape inactivation vs. genes that are inactivated? Third, do genomic features and motifs predict candidate X-linked mental retardation (XLMR) genes? Fourth, what drives the rapid expression divergence observed between human paralogs? To investigate these issues, we use genome-scale gene expression data and bioinformatic analyses. We find that (1) the majority of the sequences enriched in the vicinity of inactivated genes are found within L1 repeats (indicating an involvement of L1 repeats in X chromosome inactivation), and these sequences capture most of the genomic signal determining inactivation; some unique or overrepresented motifs in boundary regions (indicating that they are candidates for the boundary elements separating genes with different X inactivation profiles) are also found; (2) escape genes experience stronger purifying selection than inactivated genes at both the protein-coding and gene expression levels, and this effect largely results from the importance of function and dosage of escape genes; (3) sequence motifs that are mutually exclusively overrepresented in either XLMR or non-XLMR genes effectively capture genomic signals to distinguish between them; and (4) turnover of transcription start sites, structural heterogeneity of coding sequences, and divergence of cis-regulatory regions between duplicate gene copies play a pivotal role in determining the iv expression divergence of duplicate genes. Results from these studies provide valuable insights into the regulation of inactive X expression and understanding the X chromosome inactivation mechanism, and will further aid in our understanding of long-range control of gene expression on the X chromosome. Moreover, they provide important information for understanding human transcriptome heterogeneity, complexity, and evolution. v TABLE OF CONTENTS LIST OF FIGURES.......................................................................................................................viii LIST OF TABLES ........................................................................................................................x ACKNOWLEDGEMENTS..........................................................................................................xi Chapter 1 Introduction .................................................................................................................1 X chromosome inactivation..................................................................................................2 Gene duplication ...................................................................................................................9 References .............................................................................................................................12 Chapter 2 Genomic Environment Predicts Expression Patterns on the Human Inactive X Chromosome..........................................................................................................................18 Abstract..................................................................................................................................18 Synopsis.................................................................................................................................19 Introduction ...........................................................................................................................20 Results....................................................................................................................................22 Description of the Escape and Inactivated Subgenomes Analyzed in Xp22 ............22 Analysis of Oligomers Enriched in Either E or I Subgenomes..................................24 Classification of Genes as Either Inactivated or Escaping Inactivation Based on Surrounding Oligomers ........................................................................................27 Genes Classified Correctly and Misclassified Genes .................................................31 Discussion..............................................................................................................................34 Methods .................................................................................................................................38 Transcripts .....................................................................................................................38 Oligomer enrichment analysis......................................................................................39 LDA ...............................................................................................................................40 References .............................................................................................................................42 Chapter 3 Strong Purifying Selection at Genes Escaping X Chromosome Inactivation .........45 Abstract..................................................................................................................................45 Introduction ...........................................................................................................................46 Results and Discussion .........................................................................................................47 Methods .................................................................................................................................53 References .............................................................................................................................57 Chapter 4 Studies of boundary elements model at the boundary region between escape and inactivated genes ............................................................................................................60 Introduction ...........................................................................................................................60 Results....................................................................................................................................62 A comprehensive computational analysis of boundary regions using chromosome-wide human XCI data ....................................................................62 vi A comprehensive computational analysis for boundary regions in USP9X gene cluster.....................................................................................................................66 Genomic factors examined are not sufficient to explain how genes escape XCI according to the boundary elements model.........................................................74 Caveats to our approaches ............................................................................................76 Conclusions ...........................................................................................................................77 Methods .................................................................................................................................78 Analysis using genome-wide human XCI data...........................................................78 Scanning the USP9X gene cluster for candidate elements controlling XCI .............83 Analysis using comparative XCI data in the USP9X gene cluster ............................85 References .............................................................................................................................87 Chapter 5 A Computational Approach to Candidate Gene Prioritization for X-Linked Mental Retardation using Clinically-Informed Binary Filtering and Motif-Based Linear Discriminatory Analysis ...........................................................................................91 Abstract..................................................................................................................................91 Background............................................................................................................................92
Load more

Recommended publications
  • ARMCX3 (NM 177948) Human Untagged Clone – SC124834
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC124834 ARMCX3 (NM_177948) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: ARMCX3 (NM_177948) Human Untagged Clone Tag: Tag Free Symbol: ARMCX3 Synonyms: ALEX3; dJ545K15.2; GASP6 Vector: pCMV6-XL4 E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: None Fully Sequenced ORF: >NCBI ORF sequence for NM_177948, the custom clone sequence may differ by one or more nucleotides ATGGGCTACGCCAGGAAAGTAGGCTGGGTGACCGCAGGCCTGGTGATTGGGGCTGGCGCCTGCTATTGCA TTTATAGACTGACTAGGGGAAGAAAACAGAACAAGGAAAAAATGGCTGAGGGTGGATCTGGGGATGTGGA TGATGCTGGGGACTGTTCTGGGGCCAGGTATAATGACTGGTCTGATGATGATGATGACAGCAATGAGAGC AAGAGTATAGTATGGTACCCACCTTGGGCTCGGATTGGGACTGAAGCTGGAACCAGAGCTAGGGCCAGGG CAAGGGCCAGGGCTACCCGGGCACGTCGGGCTGTCCAGAAACGGGCTTCCCCCAATTCAGATGATACCGT TTTGTCCCCTCAAGAGCTACAAAAGGTTCTTTGCTTGGTTGAGATGTCTGAAAAGCCTTATATTCTTGAA GCAGCTTTAATTGCTCTGGGTAACAATGCTGCTTATGCATTTAACAGAGATATTATTCGTGATCTGGGTG GTCTCCCAATTGTCGCAAAGATTCTCAATACTCGGGATCCCATAGTTAAGGAAAAGGCTTTAATTGTCCT GAATAACTTGAGTGTGAATGCTGAAAATCAGCGCAGGCTTAAAGTATACATGAATCAAGTGTGTGATGAC ACAATCACTTCTCGCTTGAACTCATCTGTGCAGCTTGCTGGACTGAGATTGCTTACAAATATGACTGTTA CTAATGAGTATCAGCACATGCTTGCTAATTCCATTTCTGACTTTTTTCGTTTATTTTCAGCGGGAAATGA AGAAACCAAACTTCAGGTTCTGAAACTCCTTTTGAATTTGGCTGAAAATCCAGCCATGACTAGGGAACTG CTCAGGGCCCAAGTACCATCTTCACTGGGCTCCCTCTTTAATAAGAAGGAGAACAAAGAAGTTATTCTTA AACTTCTGGTCATATTTGAGAACATAAATGATAATTTCAAATGGGAAGAAAATGAACCTACTCAGAATCA
    [Show full text]
  • Datasheet CST 98287
    C 0 2 - t CTPS1 Antibody a e r o t S Orders: 877-616-CELL (2355) [email protected] 7 Support: 877-678-TECH (8324) 8 2 Web: [email protected] 8 www.cellsignal.com 9 # 3 Trask Lane Danvers Massachusetts 01923 USA For Research Use Only. Not For Use In Diagnostic Procedures. Applications: Reactivity: Sensitivity: MW (kDa): Source: UniProt ID: Entrez-Gene Id: WB H Endogenous 78 Rabbit P17812 1503 Product Usage Information Application Dilution Western Blotting 1:1000 Storage Supplied in 10 mM sodium HEPES (pH 7.5), 150 mM NaCl, 100 µg/ml BSA and 50% glycerol. Store at –20°C. Do not aliquot the antibody. Specificity / Sensitivity CTPS1 Antibody recognizes endogenous levels of total CTPS1 protein. This antibody does not cross-react with CTPS2 protein. Species Reactivity: Human Source / Purification Polyclonal antibodies are produced by immunizing animals with a synthetic peptide corresponding to residues surrounding Ala340 of human CTPS1 protein. Antibodies are purified by peptide affinity chromatography. Background CTPS1 (cytidine triphosphate synthase 1 or CTP synthase 1) catalyzes the conversion of UTP to CTP through ATP-dependent amination (1). Research studies show that pyrimidine biosynthesis is upregulated in pancreatic cancer cell models of resistance to gemcitabine, a deoxycytidine analog. Increased pyrimidine biosynthesis leads to elevated levels of endogenous dCTP, which outcompetes gemcitabine from incorporating into DNA during replication and, therefore, reduces the anti-cancer effectiveness of gemcitabine. Induction of CTPS1 expression was observed in gemcitabine-resistant pancreatic cancer cell models. Gemcitabine resistance directly correlates with CTPS1 expression levels in various pancreatic cancer cell lines (2).
    [Show full text]
  • Supporting Information
    Supporting Information Mulders et al. 10.1073/pnas.0905780106 SI Materials and Methods in Opti-MEM (Invitrogen) to myoblasts, in both cases at a final Animals. Hemizygous DM500 mice, derived from the DM300– oligo concentration of 200 nM. Fresh medium was supplemented 328 line (1), express a transgenic human DM1 locus, which bears after 4 hours. After 24 h, medium was changed. RNA was a repeat segment that has expanded to Ϸ500 CTG triplets, isolated 48 h after transfection. because of intergenerational triplet-repeat instability. For the isolation of immortal DM500 myoblasts, DM500 mice were RNA Isolation. Typically, RNA from cultured cells was isolated crossed with H-2Kb-tsA58 transgenic mice (2). Homozygous using the Aurum Total RNA mini kit (guanidine-HCl/ HSALR20b mice express a (CUG)250 segment in the context of mercaptoethanol-based lysis, silica membrane binding; Bio- a human skeletal actin transcript (3). All animal experiments Rad), according to the manufacturer’s protocol. RNA from were approved by the Institutional Animal Care and Use Com- muscle tissue was isolated using TRIzol reagent (Invitrogen). mittees of the Radboud University Nijmegen and the University Alternative methods to isolate RNA from cultured cells in- of Rochester Medical Center. volved: (i) use of the TRIzol reagent, according to the manu- facturer’s protocol; (ii) an oligo(dT) affinity column (Nucleo- Cell Culture. An immortal mouse myoblast cell culture expressing Trap mRNA mini kit; Macherey-Nagel) for the isolation of hDMPK (CUG)500 transcripts was derived from GPS tissue poly(A) RNA; or (iii) a TRIzol procedure preceded by a isolated from DM500 mice additionally expressing 1 copy of the proteinase K digestion of the whole cell lysate (7): in short, cells H-2Kb-tsA58 allele (4).
    [Show full text]
  • Harnessing Gene Expression Profiles for the Identification of Ex Vivo Drug
    cancers Article Harnessing Gene Expression Profiles for the Identification of Ex Vivo Drug Response Genes in Pediatric Acute Myeloid Leukemia David G.J. Cucchi 1 , Costa Bachas 1 , Marry M. van den Heuvel-Eibrink 2,3, Susan T.C.J.M. Arentsen-Peters 3, Zinia J. Kwidama 1, Gerrit J. Schuurhuis 1, Yehuda G. Assaraf 4, Valérie de Haas 3 , Gertjan J.L. Kaspers 3,5 and Jacqueline Cloos 1,* 1 Hematology, Cancer Center Amsterdam, Amsterdam UMC, Vrije Universiteit Amsterdam, 1081 HV Amsterdam, The Netherlands; [email protected] (D.G.J.C.); [email protected] (C.B.); [email protected] (Z.J.K.); [email protected] (G.J.S.) 2 Department of Pediatric Oncology/Hematology, Erasmus MC–Sophia Children’s Hospital, 3015 CN Rotterdam, The Netherlands; [email protected] 3 Princess Máxima Center for Pediatric Oncology, 3584 CS Utrecht, The Netherlands; [email protected] (S.T.C.J.M.A.-P.); [email protected] (V.d.H.); [email protected] (G.J.L.K.) 4 The Fred Wyszkowski Cancer Research, Laboratory, Department of Biology, Technion-Israel Institute of Technology, 3200003 Haifa, Israel; [email protected] 5 Emma’s Children’s Hospital, Amsterdam UMC, Vrije Universiteit Amsterdam, Pediatric Oncology, 1081 HV Amsterdam, The Netherlands * Correspondence: [email protected] Received: 21 April 2020; Accepted: 12 May 2020; Published: 15 May 2020 Abstract: Novel treatment strategies are of paramount importance to improve clinical outcomes in pediatric AML. Since chemotherapy is likely to remain the cornerstone of curative treatment of AML, insights in the molecular mechanisms that determine its cytotoxic effects could aid further treatment optimization.
    [Show full text]
  • Seq2pathway Vignette
    seq2pathway Vignette Bin Wang, Xinan Holly Yang, Arjun Kinstlick May 19, 2021 Contents 1 Abstract 1 2 Package Installation 2 3 runseq2pathway 2 4 Two main functions 3 4.1 seq2gene . .3 4.1.1 seq2gene flowchart . .3 4.1.2 runseq2gene inputs/parameters . .5 4.1.3 runseq2gene outputs . .8 4.2 gene2pathway . 10 4.2.1 gene2pathway flowchart . 11 4.2.2 gene2pathway test inputs/parameters . 11 4.2.3 gene2pathway test outputs . 12 5 Examples 13 5.1 ChIP-seq data analysis . 13 5.1.1 Map ChIP-seq enriched peaks to genes using runseq2gene .................... 13 5.1.2 Discover enriched GO terms using gene2pathway_test with gene scores . 15 5.1.3 Discover enriched GO terms using Fisher's Exact test without gene scores . 17 5.1.4 Add description for genes . 20 5.2 RNA-seq data analysis . 20 6 R environment session 23 1 Abstract Seq2pathway is a novel computational tool to analyze functional gene-sets (including signaling pathways) using variable next-generation sequencing data[1]. Integral to this tool are the \seq2gene" and \gene2pathway" components in series that infer a quantitative pathway-level profile for each sample. The seq2gene function assigns phenotype-associated significance of genomic regions to gene-level scores, where the significance could be p-values of SNPs or point mutations, protein-binding affinity, or transcriptional expression level. The seq2gene function has the feasibility to assign non-exon regions to a range of neighboring genes besides the nearest one, thus facilitating the study of functional non-coding elements[2]. Then the gene2pathway summarizes gene-level measurements to pathway-level scores, comparing the quantity of significance for gene members within a pathway with those outside a pathway.
    [Show full text]
  • Ankrd9 Is a Metabolically-Controlled Regulator of Impdh2 Abundance and Macro-Assembly
    ANKRD9 IS A METABOLICALLY-CONTROLLED REGULATOR OF IMPDH2 ABUNDANCE AND MACRO-ASSEMBLY by Dawn Hayward A dissertation submitted to The Johns Hopkins University in conformity with the requirements of the degree of Doctor of Philosophy Baltimore, Maryland April 2019 ABSTRACT Members of a large family of Ankyrin Repeat Domains proteins (ANKRD) regulate numerous cellular processes by binding and changing properties of specific protein targets. We show that interactions with a target protein and the functional outcomes can be markedly altered by cells’ metabolic state. ANKRD9 facilitates degradation of inosine monophosphate dehydrogenase 2 (IMPDH2), the rate-limiting enzyme in GTP biosynthesis. Under basal conditions ANKRD9 is largely segregated from the cytosolic IMPDH2 by binding to vesicles. Upon nutrient limitation, ANKRD9 loses association with vesicles and assembles with IMPDH2 into rod-like structures, in which IMPDH2 is stable. Inhibition of IMPDH2 with Ribavirin favors ANKRD9 binding to rods. The IMPDH2/ANKRD9 assembly is reversed by guanosine, which restores association of ANKRD9 with vesicles. The conserved Cys109Cys110 motif in ANKRD9 is required for the vesicles-to-rods transition as well as binding and regulation of IMPDH2. ANKRD9 knockdown increases IMPDH2 levels and prevents formation of IMPDH2 rods upon nutrient limitation. Thus, the status of guanosine pools affects the mode of ANKRD9 action towards IMPDH2. Advisor: Dr. Svetlana Lutsenko, Department of Physiology, Johns Hopkins University School of Medicine Second reader:
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • The Inactive X Chromosome Is Epigenetically Unstable and Transcriptionally Labile in Breast Cancer
    Supplemental Information The inactive X chromosome is epigenetically unstable and transcriptionally labile in breast cancer Ronan Chaligné1,2,3,8, Tatiana Popova1,4, Marco-Antonio Mendoza-Parra5, Mohamed-Ashick M. Saleem5 , David Gentien1,6, Kristen Ban1,2,3,8, Tristan Piolot1,7, Olivier Leroy1,7, Odette Mariani6, Hinrich Gronemeyer*5, Anne Vincent-Salomon*1,4,6,8, Marc-Henri Stern*1,4,6 and Edith Heard*1,2,3,8 Extended Experimental Procedures Cell Culture Human Mammary Epithelial Cells (HMEC, Invitrogen) were grown in serum-free medium (HuMEC, Invitrogen). WI- 38, ZR-75-1, SK-BR-3 and MDA-MB-436 cells were grown in Dulbecco’s modified Eagle’s medium (DMEM; Invitrogen) containing 10% fetal bovine serum (FBS). DNA Methylation analysis. We bisulfite-treated 2 µg of genomic DNA using Epitect bisulfite kit (Qiagen). Bisulfite converted DNA was amplified with bisulfite primers listed in Table S3. All primers incorporated a T7 promoter tag, and PCR conditions are available upon request. We analyzed PCR products by MALDI-TOF mass spectrometry after in vitro transcription and specific cleavage (EpiTYPER by Sequenom®). For each amplicon, we analyzed two independent DNA samples and several CG sites in the CpG Island. Design of primers and selection of best promoter region to assess (approx. 500 bp) were done by a combination of UCSC Genome Browser (http://genome.ucsc.edu) and MethPrimer (http://www.urogene.org). All the primers used are listed (Table S3). NB: MAGEC2 CpG analysis have been done with a combination of two CpG island identified in the gene core. Analysis of RNA allelic expression profiles (based on Human SNP Array 6.0) DNA and RNA hybridizations were normalized by Genotyping console.
    [Show full text]
  • ABSTRACT MITCHELL III, ROBERT DRAKE. Global Human Health
    ABSTRACT MITCHELL III, ROBERT DRAKE. Global Human Health Risks for Arthropod Repellents or Insecticides and Alternative Control Strategies. (Under the direction of Dr. R. Michael Roe). Protein-coding genes and environmental chemicals. New paradigms for human health risk assessment of environmental chemicals emphasize the use of molecular methods and human-derived cell lines. In this study, we examined the effects of the insect repellent DEET (N, N-diethyl-m-toluamide) and the phenylpyrazole insecticide fipronil (fluocyanobenpyrazole) on transcript levels in primary human hepatocytes. These chemicals were tested individually and as a mixture. RNA-Seq showed that 100 µM DEET significantly increased transcript levels for 108 genes and lowered transcript levels for 64 genes and fipronil at 10 µM increased the levels of 2,246 transcripts and decreased the levels for 1,428 transcripts. Fipronil was 21-times more effective than DEET in eliciting changes, even though the treatment concentration was 10-fold lower for fipronil versus DEET. The mixture of DEET and fipronil produced a more than additive effect (levels increased for 3,017 transcripts and decreased for 2,087 transcripts). The transcripts affected in our treatments influenced various biological pathways and processes important to normal cellular functions. Long non-protein coding RNAs and environmental chemicals. While the synthesis and use of new chemical compounds is at an all-time high, the study of their potential impact on human health is quickly falling behind. We chose to examine the effects of two common environmental chemicals, the insect repellent DEET and the insecticide fipronil, on transcript levels of long non-protein coding RNAs (lncRNAs) in primary human hepatocytes.
    [Show full text]
  • Browsing Genes and Genomes with Ensembl
    The Bioinformatics Roadshow Tórshavn, The Faroe Islands 28-29 November 2012 BROWSING GENES AND GENOMES WITH ENSEMBL EXERCISES AND ANSWERS 1 BROWSER 3 BIOMART 8 VARIATION 13 COMPARATIVE GENOMICS 18 2 Note: These exercises are based on Ensembl version 69 (October 2012). After in future a new version has gone live, version 69 will still be available at http://e69.ensembl.org/. If your answer doesn’t correspond with the given answer, please consult the instructor. ______________________________________________________________ BROWSER ______________________________________________________________ Exercise 1 – Exploring a gene (a) Find the human F9 (coagulation factor IX) gene. On which chromosome and which strand of the genome is this gene located? How many transcripts (splice variants) have been annotated for it? (b) What is the longest transcript? How long is the protein it encodes? Has this transcript been annotated automatically (by Ensembl) or manually (by Havana)? How many exons does it have? Are any of the exons completely or partially untranslated? (c) Have a look at the external references for ENST00000218099. What is the function of F9? (d) Is it possible to monitor expression of ENST00000218099 with the ILLUMINA HumanWG_6_V2 microarray? If so, can it also be used to monitor expression of the other two transcripts? (e) In which part (i.e. the N-terminal or C-terminal half) of the protein encoded by ENST00000218099 does its peptidase activity reside? (f) Have any missense variants been discovered for the protein encoded by ENST00000218099? (g) Is there a mouse orthologue predicted for the human F9 gene? (h) If you have yourself a gene of interest, explore what information Ensembl displays about it! ______________________________________________________________ Answer (a) 8 Go to the Ensembl homepage (http://www.ensembl.org/).
    [Show full text]
  • Downloaded from [266]
    Patterns of DNA methylation on the human X chromosome and use in analyzing X-chromosome inactivation by Allison Marie Cotton B.Sc., The University of Guelph, 2005 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in The Faculty of Graduate Studies (Medical Genetics) THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) January 2012 © Allison Marie Cotton, 2012 Abstract The process of X-chromosome inactivation achieves dosage compensation between mammalian males and females. In females one X chromosome is transcriptionally silenced through a variety of epigenetic modifications including DNA methylation. Most X-linked genes are subject to X-chromosome inactivation and only expressed from the active X chromosome. On the inactive X chromosome, the CpG island promoters of genes subject to X-chromosome inactivation are methylated in their promoter regions, while genes which escape from X- chromosome inactivation have unmethylated CpG island promoters on both the active and inactive X chromosomes. The first objective of this thesis was to determine if the DNA methylation of CpG island promoters could be used to accurately predict X chromosome inactivation status. The second objective was to use DNA methylation to predict X-chromosome inactivation status in a variety of tissues. A comparison of blood, muscle, kidney and neural tissues revealed tissue-specific X-chromosome inactivation, in which 12% of genes escaped from X-chromosome inactivation in some, but not all, tissues. X-linked DNA methylation analysis of placental tissues predicted four times higher escape from X-chromosome inactivation than in any other tissue. Despite the hypomethylation of repetitive elements on both the X chromosome and the autosomes, no changes were detected in the frequency or intensity of placental Cot-1 holes.
    [Show full text]
  • Aberrant Promoter Methylation and Tumor Suppressive Activity of the DFNA5 Gene in Colorectal Carcinoma
    Oncogene (2008) 27, 3624–3634 & 2008 Nature Publishing Group All rights reserved 0950-9232/08 $30.00 www.nature.com/onc ORIGINAL ARTICLE Aberrant promoter methylation and tumor suppressive activity of the DFNA5 gene in colorectal carcinoma MS Kim1, X Chang1, K Yamashita1, JK Nagpal1, JH Baek2,GWu3, B Trink1, EA Ratovitski1, M Mori4 and D Sidransky1 1Department of Otolaryngology, Head and Neck Cancer Research Division, Johns Hopkins University, Baltimore, MD, USA; 2Department of Genetic Medicine, Institute of Cell Engineering, Johns Hopkins University, Baltimore, MD, USA; 3Karmanos Cancer Institute, Department of Pathology, Wayne State University, Detroit, MI, USA and 4Department of Surgical Oncology, Medical Institute of Bioregulation, Kyushu University, Tsurumibaru, Beppu, Japan To identify novel methylated gene promoters, we com- Introduction pared differential RNA expression profiles of colorectal cancer (CRC) cell lines with or without treatment of Aberrant gene expression is a characteristic of human 5-aza-20-deoxycytidine (5-aza-dC). Out of 1776 genes cancers, and changes in DNA methylation status can that were initially ‘absent (that is, silenced)’ by gene have profound effects on the expression of genes. Tumor expression array analysis, we selected 163 genes that were suppressor genes (TSGs) display both genetic and increased after 5-aza-dC treatment in at least two of three epigenetic inactivation in human tumors, and the CRC cell lines. The microarray results were confirmed by transcriptional silencing of TSGs has established hy- Reverse Transcription–PCR, and CpG island of the gene permethylation as a common mechanism for loss of promoters were amplified and sequenced for examination TSG function in human cancer (Herman, 1999).
    [Show full text]