© 2014 Nature America, Inc. All rights reserved. For instance, although genome editing technologies For based on instance, genome technologies editing tar although methods. alternative from MAGE distinguishes that feature a is site target at each mutations or degenerate discrete either specify to and mutations combinatorial generate rapidly to ability The combinations of independent single-site and multisite mutations. genome ( the into recombination simultaneous for pool (oligo) oligonucleotide complex a into combined be can loci mosomal cells live of population a in modifications genome combinatorial or genome. the in sites many across or pathway many in of the of effects one mutations analysis gene, one genetic permit would tools Such others. excluding while modifications to many loci and to by certain genetic permit mutagenesis tuning mutations by targeting knowledge existing for leverage that tools targeted, multisite mutagenesis. In all three cases, there is demand by pathway engineered the of branch each through flow alibrate rec to necessary be will it biosynthesis, engineered of efficiency biotechnology and industrial in research basic growing rapidly are compounds desired of biosynthesis neered engi for metabolism native alter to efforts elucidated, are cells networks controlling metabolic the flow through of biomolecules complex as Finally, pocket. binding ligand’s a of structure the to permitting targeted mutagenesis of the genetic loci that contribute specificities binding new with able valu resources for researchers provide seeking to engineer macromolecules databases structure RNA and protein the expanding elucidate systematically Similarly, phenotypes. to important causative mutations underlying technologies editing genome high-throughput of phenotype development and the motivate genotype advances These between associations detection potential permits of sequencing parallel massively sets by data sequence generated whole-genome of availability growing The I by two people, allows ~10 continuous cycles of M allelic replacement. methods. In recent advances,technological M introduce precise mutant alleles at many loci for genome-wide editing or for recoding projects that are not possible with other ssD recombination proteins mediate annealing of ssD process that involves transformation of ssD single-stranded D Multiplex automated genome engineering (M Published online 4 September 2014; work. Correspondence should be addressed to F.J.I. ( Connecticut, USA. 1 Ryan R Gallagher using libraries of synthetic DNA Rapid editing and evolution of bacterial genomes multiplexing capability and require provision of separate repair repair separate of provision require and capability multiplexing have limited they in many species, are functional nucleases geted Department of Molecular,of Department Cellular and Developmental Biology, Yale University, New Haven, Connecticut, USA. Fig. NTRO MAGE allows an investigator to generate many independent independent many generate to investigator an allows MAGE NA 4 1 . Chemically synthesized ssDNAs targeting different chro different targeting ssDNAs synthesized Chemically . s s targeting multiple sites, M ). The resulting population contains different cells carrying D UCT I ON 3 Department of Molecular of BiophysicsDepartment and Biochemistry, Yale University, New Haven, Connecticut, USA. NA 1 T (ssD , his his protocol describes the manual execution of M 2 , 4 , Zhe Li NA ) ) to introduce targeted directlymodifications into the doi:10.1038/npr 2 . This application demands tools tools demands application This . 1 , A 2 , G 4 , Aaron O Lewis E can generate genetic combinatorial diversity in a cell population. [email protected] ot.2014.08 NA A A 3 (by electroporation) followed by outgrowth, during which homologous bacteriophage G . To the maximize G E E ) ) is a powerful technology for A has been improved by strain and modifications selection techniques that enhance NA 2 G E s s to their genomic targets. By iteratively introducing libraries of mutagenic -based -based mutagenesis per day. 1 , 3 & Farren J Isaacs ). 1 - - - - - . site-specific incorporation of nonstandard amino acids only 63 with ‘active’ codons and a 64th ‘blank’ codon for available of strain a yielded project ssDNAs. This discrete 321 using 321 all TAGthe of recode instances TAA stop codon for synonymous the to codon used been has MAGE class, first the In tions. genetic mutations; and (iii) many target sites, many genetic muta many site, target single (ii) mutations; genetic single sites, target characterized by varying degrees of scale and complexity: (i) many ( respectively insertion, or a mismatch deletion, to causing region, the target respect with bases add or this mispair bases, skip can In ssDNA synthetic the region, mutation. specified the to corresponding sequence the replication of round during replication, and then they are stably inherited after another strands lagging and leading into separates it as chromosome rial bacte the on targets strand lagging are their to anneal oligos to cell, proposed the in Once genome. the in sequences target to 5 with designed are oligos These electroporation. by to population cell introduced a (oligos) ssDNA synthetic on act MAGE in used loci genomic many across somes create targeted, chromo rapid, of bacterial modifications scarless to proteins recombination homologous phage harnesses MAGE MAGEof Overview network genetic large a in sites many mutagenize to used be cannot they but mutations, targeted and methods provide the useful feature of incorporating both random mutations discrete for templates class, MAGE has been used to construct diverse cell populations populations cell diverse construct to used been has MAGE class, cleotide could give all possible amino acid substitutions. In the third ssDNA containing the NNN triplet at its center—such an oligonu degenerate single a purchase to possible be would it experiment, an such In locus. target single a at substitutions acid amino sible second class, MAGE could be used to explore the effects of all pos In general, MAGE experiments can be divided into three classes, A G E ′ wherein each cycle takes ~2.5 h, which, if carried out - - and 3 1 , in in vivo 2 ′ -terminal homology arms that are complementary that arms are complementary homology -terminal Escherichia Escherichia coli genome editing that uses synthetic 2 Systems Institute,Biology Yale University, West Haven, 9 natureprotocols ( Fig. 2 Fig. Fig. 2 Fig. 4 These These authors contributed equally to this b a ). 5 ). ). chromosome. M 7, 5 ′ 8 and 3 and . Directed enzyme evolution evolution enzyme Directed . . The recombination proteins proteins .recombination The 6 A . lternatively, M

| VOL.9 NO.10VOL.9 ′ homology arms flank flank arms homology A protocol G E is a cyclical | 2014 A 10,1 G

E 1 can . In the | E. coli E.

2301

- - - - -

© 2014 Nature America, Inc. All rights reserved. fields, each of which has progressed immensely over recent years. immensely has progressed which each of fields, years to months take that approaches engineering metabolic over conventional improvement a cycles), striking (35 cycling MAGE continuous of d 4 in generated variants genomic >10 from isolated were production lycopene enhanced of ble production lycopene enhance to pathway biosynthesis (DXP) deoxyxylulose-5-phosphate the evolving by loci genetic many across diversity drive to ability its highlighted MAGE of mutations. As such, degenerate the demonstration first loci for multiple targeting by mutagenesis cell across populations ing recod for whole-genome codon reassignments targeted forming per of goal the with developed originally was MAGE Although MAGEDevelopment of experiments. day-to-day their in technology MAGE to the seek adopt who for scientists process manual the describes ~10 cycles per day sustaining mutagenesis tinuous molecule). or small a metabolite of overproduction (e.g., phenotype a prescribed with mutants for or select to screen lation resulting from a MAGE experiment can be used downstream regions of key pathway enzymes ( to randomize target positions in the coding sequence or regulatory pathways by deletion can be mixed with degenerate oligos designed to knockout designed oligos discrete competing implementation, translation rates, mRNA stability, enzyme activity can be used to modify transcription rates, regulatory or intergenic regions, these mutations or mismatch mutations. By targeting coding, is capable of introducing insertion, deletion and a fully mutant (mut) chromosome. ( chimeric chromosome segregate into a fully WT second round of replication, two strands of the and one chimeric chromosome exist. During the of replication, one wild-type (WT) chromosome discontinuous Okazaki fragments. At the end lagging strand of the replication fork, between oligo is bound by of MAGE-based mutagenesis. ( Figure 2 lycopene of biosynthesis the in involved loci many across alleles of combinations containing diversification or recoding is achieved. can be cycled iteratively until the desired level of targets. Populations undergoing MAGE mutagenesis incorporated different mutations (red) at different be explored in a population of cells that have (>1 oligo per locus). Combinatorial diversity can locus) or to generate combinatorial diversity to edit the bacterial chromosome (one oligo per ssDNAs targeted to each locus, MAGE can be used (targets in blue). Depending on the number of in green, orange and purple) or full genomes genes (targets in orange), gene networks (targets MAGE can be used to generate many mutations in engineering (MAGE) processes and applications. Figure 1 2302 and so on. RBS, ribosome binding sites. protocol MAGE was inspired and has been enabled by three main research con enable to built been has device automated an Although 10,1

| VOL.9 NO.10VOL.9 1

, early experiments revealed the ease of generating diversity

| | Multiplex automated genome Proposed mechanism and categories β -protein and anneals to the | 2014 | natureprotocols a ) ) The mutagenesis 4 or aromatic amino acids amino aromatic or Fig. b ) ) MAGE 2 ). The highly diverse popu 4 . Several clones capa clones Several . Chimera a mutagenic oligos Whole genome Recoding genome:TAG ssDNA poolof 1 oligopertarget 321 targetloci 4 4 , this protocol . Mu fragment Okazaki 3 5 3 5 t ′ ′ ′ ′ 1

2 Lagging this In . WT Leading → 10 MAGE TAA - - - - - cycle

WT replication After first Mutagenesis oligo β protein unique genotypes—for unique <$1,000 >>10 worth genotypes—for of DNA ($37.5 per 90-mer engendering mutations—potentially degenerate or gle sin for targeted be can loci >25 that means synthesis Low-cost synthesis. chemical ssDNA during inherited errors than rather design, oligo during specified are ones the introduced mutations cost low and racy accu high at produced be can nt) (~90 ssDNAs long relatively First, advances in extraordinary • ( stages six involve projects MAGE Workflow MAGE a typical of project gene of evolution genomes. or networks directed continuous or parallel bacteria, living permitting of chromosomes the to lessons its applying by activity enhanced with directed biomolecules isolate of to or combined be can technologies selection screening field and mutagenesis the how on light Third, shed has evolution degradation. avoid to synthetic modifying ssDNAs or background genetic strain’s target the rational enabled has efforts to improve the efficiency knowledge of the MAGE process Such by changing levels. biochemical molecular and genetic, at understood well is recombination ogous bacteriophage yeast in recombination homologous of nisms MAGE technology is based on decades of research into the mecha at a oligo 100- phosphorothioated ecie h dsrd hntp o genotype. or phenotype full or enzyme an of relateperformance tothe might phenotype desired the Describe WT replication After second WT 5 3 ′ ′ Structural changes Allosteric domains Catalytic domain Codon changes 1 Protein tags b 8 Coding Target strand MAGE oligos . As a result of this research, the process of homol 13–1 Gene 5 s 19–2 . High-fidelity synthesis ensures that the the that ensures synthesis High-fidelity . ncRNA binding mRNA stability Riboswitches Noncoding Attenuators T-boxes sRNAs 3 . MAGE extends the work that of field Insertion Gene network Gene N- de de novo MAGE mutagenesi Orthogonal 16S Pyrimidine rich Purine rich µ AT Fig. Fig. RB mol synthesis scale). Second, scale). synthesis mol N- A T G Regulator S arget DNA synthesis mean that 3 Mismatc ): B

T 1

Operator site Activator site Promoter Ligand –35 site –10 site y s D h arget C 1 -C 6 s s 2 , bacteria , A prescribed prescribed A s s Output STOP Genome minimizatio Genome refactoring -C eletio Intergeni IS element Barcoding protein Folded polypeptide Nascent sequenc Coding Mutant Mutant Mutant n 1 7 c s and and

e n 2 1 n 12 - - - -

© 2014 Nature America, Inc. All rights reserved. • selecting for the desired genotype or phenotype. (5) performing MAGE cycling; and (6) screening or cycles to accomplish genome editing goals; MAGE oligos; (4) predicting the number of MAGE loci for mutagenesis; (3) designing mutagenic genome editing goals; (2) identifying target project involves six steps: (1) determining Figure 3 ence genome file. refer annotated an and scripts bioinformatic using located be recoding project, all instances of the sequence to be modified can ( activity enzyme modify totargeted protein be can a expression. of gene sites substrate-binding modulate and to Moreover,catalytic regulatory, down or up tuned be can sites control translational and transcriptional these, of each For loci. Flux Balance Analysis pathway as such algorithms computational identified. Existing be a should in participating genes all production, biomolecule loci. target Choose codons TAA to reassigned are codons TAGstop all which in recoding genome (e.g., tions ol rqie 10 require could to product. Moreover, a designed genome substrate convertingthe in network gene cycles byadegenerate poolhas itsasymptoteabovezero and may evenapproach itsmaximum. with mutants withARF The simplestdegenerate casewouldhaveeach locustargeted byanoligo encoding the WTallelewithARF that include oligos encoding the WT, thus preventing the decrease indiversitythatwouldaccompany vanishing WTalleles. at of replacements per clone valuable as the adaptive diversity that it generates. In our binomially distributed example, we can calculate the variance in the number from 3to15%perlocus). lines). Coselection cansignificantly speedupthe evolution of thistopclone ( which a screen would reliably (i.e., with 95% confidence given a 96-colony screen) render the desired genotype ( probability line, for reliably obtainaclone withalllocimodified ( is then function From thatdistribution, valuesimportant toparticular experiments canbeobtained, such asthe cumulative distribution a binomial distribution population’s evolution tobecompletelydescribed bythe distribution of the number of allelic replacements perclone of cyclenumber determined formulae can beassumed tooccurindependently and withafixed ARFpercycle. ARF loci targeted for mutagenesis A population undergoing MAGE canbetreated asacollection of binary events, representing allelic replacements atthe Box 1 For experiments targeting aparticular phenotype, acriterion for cycletime isnot aseasilydefined; eachadditional cycleisas For example, inthe simplestcase, all p = p

| 10,1 2 1 The MAGE workflow. Each MAGE − = 1 n ( 1 k F + − =10;ARF3%,red, or15%,blue).Ascreen of 1 Figs. 4c ; ( ). | k F r if ; ( Σ Modelingapopulationundergoing multiplexed genomeengineering p n i   ) , = N r f p n 0 N / ) , − > m For example, before using MAGE to optimizeMAGE to example,Forusing before 2 ( 2 = ,   ; inthiscase, the distribution of the number of allelic replacements perclone isstillbinomial, –10 d 1 1 Fig. ) ( Σ , for ARF=3and 15%), butdiversification experiments typically use degenerate pools 4 2 N 6 2 i i k ormeasured directly, and then usedinacombinatorial model topredict the population’s evolution asafunction 4 = k f ) ( 3+ ) ( or Optknock , ( 0 k f 4 A specific muta specific , ( − i f ); after RF np , ( p n w ) , p n (1 − p n 1 s 3 ) , . Neglecting off-target recombination, linkages betweenlociand effectsonfitness, allelic replacements 2 ) , . Because i ( ) ( 1 Fig. 4 = p . Interms of these common distributions, the prevalence of clones withatleast N − ) as a measure of overall diversity ( cycles, replacement withagivenARFwillhaveoccurred withprobability ) (

AR k n

2

5 ( ( F a can help identify relevant 1 1 m ; for n f − − increases with cycle number, this condition determines the minimum number of cycles after - lociare targeted bynondegenerate oligos, allwiththe same ARF, allowing the i N − 2 k k =1).Inexperiments targeting aparticular genotype (e.g., recoding), the goal isto ( = AR Fig. 4 1 -Goal 4 -Predictcycletim

Prevalence in Genome recoding n A F ), the prevalence of which isjust ) ) population N optimization 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1.0 Fig. Pathway 0 d Number ofMAGEcycles N k 5 0

, for ARF ) ( 1 2 − ).Fora s 10 clones willfind aclone thathasprevalence RF mutagenesis 15 e Protein w 20 - =ARF ) ( k n 25 ID causal − variants Fig. 4c • • 30 (

Predict the required cycle time. cycle required the Predict steric feedback sites promoters target that oligos degenerate using made be can substitutions possible all recodedby discreteoligos.substitution or deletion Alternatively, Design ssDNAs to modify target sites. ouain a b wtdan n asyd ewe cce to cycles between mutagenesis. theprogresstrack of assayed and withdrawn be can population ( number matical models can guide the investigator’s initial choice cycle of Mathe diversity. population and replacements allelic of lence # loci m Fig. 4 =3%and Diversit 10 9 8 7 6 5 4 3 2 1 0 s , canbeestimated for MAGE oligos using empirically d , y b Fig. 4 f ; for , black line). Diversity attains its maximum 9 Box 8 n n 7 2 -IDtargetloci e n =10).Thus, the diversitygenerated aftermany k f ; shown for afivefold increase inARfrequency, =10or30,ARF3%,and , ( 5 -MAGEcycling 1 and = = 6 1 n n 2 7 natureprotocols andsoon ( 1 Fig. ) , 5 2 A p , ribosome-binding sites ribosome-binding , 2 3 4 4 ( ( , n smls f h mutagenized the of samples and ), 1 1 − − More cycles increase the preva the increase cycles More Discrete synonymousmutation(TAG->TAA) Degenerate nonsynonymousmutation Degenerate RBSmutations f inthe population with Fig. w and oligos encoding Genes can be knocked out or p RF =1−(1–ARF) 3 -Designoligos 2

). | ) ) 6 -Screen/selection VOL.9 NO.10VOL.9 Fig. 4 n N N k f =5through 90). mutations (

k mut (

, wt k Fig. 4 n e , which is mut n , ; dashed protocol wt genomic 2

p

6 mut ), but , enzyme allo enzyme , wt

e

| mut ; solid 2014 N

wt .

|

2303 - ­ ­

© 2014 Nature America, Inc. All rights reserved. grown to mid-log phase and then fed into another round of MAGE, or it to be fixed. After outgrowth, the mutagenized population can be diluted, to transform. An outgrowth period allows cells to recover and mutations washed to remove salts and then mixed with ssDNA and electroporated at mid-log phase. Cells are heat shocked to induce recombination proteins, Figure 5 • • converts to all mutant alleles. See cosMAGE, multisite mutations accumulate more rapidly than without (compare with targeted alleles in half the population at an ARF of 3% each, but only five cycles if that frequency were increased fivefold by coselection, ( to 15%. ( unless the oligo pool is degenerate ( population diversity (here, variance in number of replacements per clone; black line) will decrease as wild-type alleles are lost from thepopulation populationwill carry( at least 0.6 × 10 = 6 replacements after 30 cycles, if targeted with a 3% ARF at each of ten loci (solid red performedline). ( with a pool targeting many loci, the mean fraction of all targeted ARs that have been acquired per clone increases. (AR) For risesexample, more steeplyhalf forthe highercells in ARFsa (colored lines), regardless of the number of loci targeted (curves shown are for ten loci).Figure ( 4 2304 phenotypes. can be subjected to a screen or selection to isolate desirable genotypes or d a c protocol ~10 to up of analysis allows screen visual A phenotype. selectable requiresa assayed—but be can screening. population analysis—in entire PCR the high-throughput principle, by extremely for or allows screening Selection visual by media, selective of use the by assayed be can mutagenesis MAGE from arising cells Recombinantdetermined. is genotype their before MAGE clones must be isolated from the diverse desirable population generated projects,by phenotype-oriented For achieved. been has methodscanusedbe to determine whether thedesired genotype type is known ahead of time and either sequencing or PCR-based desirableclones.Identify ssDNAs thechromosome. with of recombination permit to outgrowth then and ssDNA genic muta with cells transform to electroporation competence, ing Conduct MAGE cycling. ), cosMAGE ( Expected prevalence in population Prevalence of clones with ≥1 mutation 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1.0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1.0 0 0

4 0 | 0 –10 VOL.9 NO.10VOL.9

| | Model-guided MAGE experimental design. ( The MAGE cycle. Each cycle begins with a cell population growing 5 6 independent clones but requires a visible phenotype. visible a requires but clones independent 5 10 Number ofMAGEcycles e Number ofMAGEcycles , f ) reduces the number of cycles required to achieve multisite mutations. For example, it would take 15 cycles to replace five out of ten 10 15 | 2014 20 15 25 | The MAGE cycle ( For recoding projects, the desired genodesiredrecodingprojects,Forthe

20 natureprotocols 30 Box 25 35 d ) and includes oligos encoding the wild-type allele (plots for 3% ARF at each of ten loci). ( 1 for model description and predictions. 40 30 No. ofloci AR frequency Diversity 10 9 8 7 6 5 4 3 2 1 0 0.05 0.01 0.5 0.3 0.2 0.15 0.1 Fig. a ) As more MAGE cycles are performed, the prevalence of clones containing any allelic replacement b 5 e Expected prevalence in population ) involves induc

Expected fraction of ARs per clone 0.1 0.2 0.3 0.4 0.5 0.1 0.2 0.3 0.4 0.5 0.6 0.7 0.8 0.9 1.0 0 0 0 5 0 0.1 0.2 CosMAGE MAGE Fraction ofARsperclone 0.3 10 Number ofcycles 0.4 - - -

0. 15 5 Top clone Average 0. mutagenic oligos r idtp (T alls a b dsge t itroae any interrogate to mutation designed in up to ~10 mutant be can to alleles complementary (WT) primers wild-type or on based screen PCR A 6 ssDNA poolof c ). However, diversity (black line) falls faster as the population rapidly 20 0. 7 0. 8 25 Starter colony 0. 9 Electroporation 30 1 No. ofloc ~1 mi cycles No. of n 30 10 90 50 30 15 5 4 ~5 mi i ° Wash C c f

2 Prevalence in population Prevalence in population independent clones. n 0. 0. 0. 0. 0. 0. 0. 0. 0. 1. 0. 0. 0. 0. 0. 0. 0. 0. 0. 1. 1 2 3 4 5 6 7 8 9 0 0 0 1 2 3 4 5 6 7 8 9 0 0 5 0 The MAGEcycle 1 5 Number ofCosMAGEcycles Number ofMAGEcycles 2 min–3 30–34 Cell growth Cool 10 1 0 ~2 c ° h , b C h 15 e ) As more MAGE cycles are 2 5 , f ) Compared with MAGE c , d 20 2 0 ) After many cycles, 25 3 5 f 30 42 c ) By using 0 ), No. ofloci No. ofloci Induction ° C 15 min

Diversity 10 9 8 7 6 5 4 3 2 1 0 Diversity 10 9 8 7 6 5 4 3 2 1 0

© 2014 Nature America, Inc. All rights reserved. To mutate genes on the replichore 1 (−) strand or replichore 2 (+) strand, the oligo sequence should be the same as the gene sequence. ( To mutate genes on the replichore 1 (+) strand or replichore 2 (−) strand, the oligo sequence should be the reverse complement of the target gene sequence. ( Figure 7 • • MAGE: of utility the to contribute features main Five Advantages MAGEof 1-ml and 1-liter cultures. horizontal lines show the maximum achievable population complexity for is inefficient because it requires a larger population to sample. Dotted nonsynonymous mutations are made (green). Greater genotypic diversity results in at least 1,000× more possible genotypes (diversity) than if only Therefore, targeting seven codons for all possible substitutions (red) while restricting the genetic diversity to 20 codons rather than 64 codons. mutations. MAGE enables complete randomization of amino acid sequence are more efficient, in that fewer cells are needed to explore all possible (nonsynonymous degeneracy, 20 possibilities). Nonsynonymous mutations (NNK degeneracy, 32 possibilities) or only nonsynonymous substitutions 64 possibilities), all nonsynonymous and some synonymous substitutions introduce all possible substitutions at a target codon (NNN degeneracy, protein-coding sequences. Depending on its design, a MAGE oligo can Figure 6 lagging strand of DNA synthesis. Bold letters indicate targeted bases. sequences alongside mutagenic oligos provide explicit examples of four common scenarios depicted in a a oprd ih rdtoa tree mtgnss techniques, fordiversity investigatorfunctional morethe toaccess gives this mutagenesis targeted traditional with Compared for targeted are mutagenesis (~4 bases more as rapidly increases population a scalable Highly mutants. genetic tolead accumulation of and diversity population more mutagenesis—yield oligo-based population from one round proceeds into a subsequent round of be designed to site-specifically introduce substitutions for a substitutions acids (e.g., amino nonpolar all residues). class specific of introduce site-specifically to designed be ( diversity sequence sample fully to needed population cell the of size the increasing without randomization complete for targeted be to residues of sequence space. This featureMAGE of a permits greater number amino of acid sequence space while minimizing the coding DNA diversity full the exhaustivelyresearcherssample toallow would mutations nonsynonymous only introduce to designed pool go population.cell Forinstance,the oli an diversity of the and esis MAGE affords a great deal of control over the extent of mutagen bench.the at time more requiring without analysis downstream exceed 30% (refs. can site specific a at replacement allelic of frequency the which efficient. and Fast Gene onreplichore2+strand Gene onreplichore2–strand ) ) MAGE allelic replacement frequency is highest when oligos anneal to the lagging strand of the replication fork as it passes through the target loci.

| | Mathematical calculations for functional diversity of mutagenized Oligo design guidelines for target loci on different strands and different replichores (chromosome halves that are bidirectionally replicated).

ATC TAG CTA GAT TA

A T TA + . The space of possible sequences represented in represented sequences possible of space The . – – + n where ah on o MG rqie ~. h after h, ~2.5 requires MAGE of round Each 4,10,2 Fig. 3.9 Mb OriC 8 n 6 ). Repeated MAGE cycles—wherein the is the number of targeted bases; ). Similarly, a MAGE oligo pool could pool oligo MAGE Similarly,a ). Replichore Replication direction 0 Replichore + – 2 1 Term 1.6 Mb Gene onreplichore1+stran Gene onreplichore1–strand Fig.

6 AT ).

– + +

–

- - A

T TA AT

GAT CTA ATC G • • • limitations: main four possesses technology MAGE The MAGEof Limitations • dropping precipitously is price whose DNA, synthetic and media growth for are costs recurring only the and incuba equipment), and laboratory (standard equipment tors electroporation for are costs capital Cheap duce degenerate mutations atmultiple loci. genetic intro to ability its in unique MAGEboth.is not mutations,but multisite random or sites single at mutagenesis targeted enable multiplexed and Targeted throughout all domains of life, and given recent reports reports recent recombinases given NA and life, identified conserved of that are domains replication) all DNA throughout at during hybridize strand that lagging oligos the mutagenic (i.e., MAGE underlying in only described in technology portability. Limited mutations. deleterious of cellviability,maintain that thereby preventing accumulationthe pressures evolutionary normal the of context the in proceed to Operates continuously immediate inexpensive source of mutagenic oligos . No expensive enzymes or buffers are required; the only the required; are buffers or enzymes expensive No . d b

3 5 3 5 3 5 3 5 Maximum genotypic diversity ′ ′ ′ ′ ′ ′ ′ ′ 10 10 10 Corynebacterium glutamicum Corynebacterium 10 10 + + + + – – – – 10 15 20 bet 0 5 a 0 to guide the design of mutagenic oligos at the E. coli E. 2 Genome target 9 xet o a eet eot f similar of report recent a for Except ooos ht r fntoa a ssD as functional are that homologs n oh rkroe ad eukaryotes and prokaryotes both in natureprotocols Nonsynonymous degeneracy(20) NNK degeneracy(32) NNN degeneracy(64)

1 ml=10 1 liter=10 in vivo 1 4 . Moreover, DNA microchips provide an . Given that the proposed mechanisms proposed the that Given . 8 6 4 2 . Mutagenesis technologies generally generally technologies Mutagenesis . 9 . This allows for MAGE experiments cells 12 Codons targeted cells 5 3 5 3 5 3 5 3 ′ ′ ′ ′ ′ ′ ′ ′

| VOL.9 NO.10VOL.9 5 5 5 5 ′ ′ ′ ′ Mutagenic oligosequence N N N N 2 40 40 40 40 7 , MAGE has been been has MAGE , b protocol ) ) Target genome 1 10 5 | . 2014 N N N N |

40 40 40 40

2305 3 3 3 3 3 0 ′ ′ ′ ′ - - - ,

© 2014 Nature America, Inc. All rights reserved. a single protein whose crystal structure is known, mutagenic mutagenic known, is structure crystal of whose protein diversification single a MAGE-based For design. dur sites experimental ing important prioritize to necessary is it space, genetic the To cell. reduce single a by represented was genotype each if confluent ten of at mutation degeneracy >10 gives codons full instance, For handle. could assays downstream than larger far space a genetic sites engender can many too targeting populations, cell diverse extremely of selection. Target design Experimental • • • Error bars indicate s.d. predicted folding energy ( bonds at the 5 two phosphorothioate (PO, indicated by *) or 0.5–10 use 90 mer oligos delivered at 1 marker—is plotted on the scored either by a selectable or a screenable parameter is plotted on the and mismatches ( modifications ( folding energy ( allelic replacement frequency. ( Figure 8 2306 are that acids amino encoding bases to targeted be can oligos fied populations. fied MAGE-diversi explore fully to required are populations cell complex analyzing of ways high-throughput new and pled, exper MAGE a in generated diversity the of much result, the gen examine to methods current of ity abil the outstrips diversity genetic vast containing populations cell generate to Undersampling. be could MAGE developed indiverse organisms. via editing genome protocol cumulates multisite mutations. ac MAGE undergoing population a which at rate the increase help would ARF. This aggregate improve could all mechanisms oligosbridization of to targets or avoid the cell’s error correction hy facilitate cell, the in oligos mutagenic of concentration the increase that low. Strategies be can site single any for frequency replacement the sites, many targeting pools pool large For complexoligos. of a by targeted loci multiple by shared fre is that quency high, is loci single for (ARF) frequency replacement mutants. multisite of frequency Low organisms tionprescribed with of phenotypes. mutagenesisMAGErandomcould expedite methodswith isola are poorly understood. In such instances, strategies that combine MAGEprocessesdesignfor oligosto that difficult is it Therefore, systems. logical on dependent Target selection for MAGE mutagenesis is knowledge. prior detailed for Requirement

o | VOL.9 NO.10VOL.9 ye r hntp o coe. s a As clones. of phenotype or type

| Oligo design parameters affecting µ M (multiplex) final concentration with ′ end and with a minimum of c b E. coli E. ); concentration ( ); phosphorothioate backbone e a priori a ); and deletions ( h cpct o MAGE of capacity The 18 | Although MAGE enables the construction construction the enables MAGE Although 2014 possible genotypes (i.e., (4 (i.e., genotypes possible (10 i et s ee sam never is ment ≥ y –12 kcal/mol). knowledge of bio of knowledge axis. In general, we x 9 | axis, and ARF— cells per ml × 10 × ml per cells natureprotocols a – µ f d M (singleplex) ) Length ( ); insertions f ). Each

Although the MAGE allelic allelic MAGE the Although a ); - - - -

3 ml/liter × 10 × ml/liter 3 ) a e c

10 ARF (%) ARF (%) ARF (%) ) ) or >10 10 20 30 10 20 30 30 10 20 0 0 0 30 5 0 no Phosphothiol modifications

IN MM * 6 liters) liters) 6 Mismatch/insertion length(bps)

liters liters 3 ′ * 50 Oligo length(bps) 10 - - - - - 5 ′ *

3 Other important parameters in oligo design ( design oligo in parameters important Other chosen. be should oligo’s strandedness the how guides therefore and coordinate genome the to according changes strand target locus. each at strands lagging or leading and origin single proceeds bidirectionally, it is possible to identify the of As oligos. ing replication design when to strandedness consider it Therefore, is important on between Okazaki fragments the increase strand lagging ARF ARF reduced markedly display strand leading the to anneal that gos ( fork replication strand the lagging of the at ssDNA of hybridization involves MAGE design. oligo MAGE function. network’s in the role major a have that loci identify help can regulation gene of models computational network, a gene of diversification For function. or structure enzyme’s the with associated closely most • • 70 15 ′ ** Structure prevents oligo binding atitsgenomic that ( target formation structure secondary of likelihood DNAs increased synthetic or in errors to owing either decreases, nt then 90 and to up increases frequency The chromosome. the to ogy the to well bind not do Below 40 nt, the ARF falls rapidly probably because short ssDNAs Length

3 5 ′

1 ** 20 . Moreover, strain modifications that increase the distance distance the increase that . Moreover,modifications strain 5 . Optimal mutagenic oligo length is 90 nt (ref.nt .90 mutagenicis length oligo Optimal ′ *, 90 3 . ssDNAs with higher predicted higher with ssDNAs . ′ *

25 5 ′ **, 3 ′ ** 110 30 The mechanism hypothesized to underlie underlie to hypothesized mechanism The d b ARF (%) f ARF (%) ARF (%) β 12 24 36 30 10 20 20 40 60 Fig. 2 Fig. 0 0.001 0 -protein 1.E+00 0 –25 E. E. coli a 1.E+01 0.01 . uprig hs oe, oli model, this Supporting ). –20 9 and possess re possess and Folding energy(kcal/mol) Oligo concentration Deletion length(bps) chromosome starts from a from starts chromosome 1.E+02 0.1 –15 Figure Figure ∆ G score G 1.E+03 Fig. 8 –10 Fig. Fig. 1 1 7 shows how the the how shows ( µ d 8 M) a 3 1.E+04 uced homol uced ) include: ) ). 3 –5 recombine 4 0 ; Table 1.E+05 100 0 1 3 ). 2 - - - .

© 2014 Nature America, Inc. All rights reserved. The lacZ_off oligo canbeusedasapositive control toverifyproper execution of the MAGE protocol; the mutS_on oligo canbeused to restore MMRin T • • • T Capitalized, boldface lettersindicate mutation sites. a a kan_off N mutS_off mutS_on lacZ_off tolC_off Mistarget score Folding energy Phosphorothioate bonds Concentration Length P lacZ_on tolC_on kan_on cat_off cat_on bla_off bla_on <600 bp of off-target homology of <600 bp with those to relative ARF in the decrease 32% a genome—showed against search a BLAST by identified regions gous homolo all of lengths the summing by determined are which ssDNA. Specifically,the oligoswith >600anneal bp of off-target homology– to sites target with compete sites off-target because presumably frequency, lower with recombine will loci genetic score Off-target structure. secondary limited with designed been has oligonucleotide the that vided pro exonucleases, to susceptible least and arms homology by stabilized be tolikely most is ssDNA,mutation the the centerof introduced is >10 nt from the oligo’s 5 position Mismatch exonuclease-mediated ssDNA of degradation 5 two the modifications Backbone easily hybridize genomic target loci with can ssDNAs unstructured because likely frequencies higher at arameter b b ame le le le 2 2 1 1 | |

Some commonly used mutagenesis oligos. Optimal range of MAGE oligo design parameters. ′ ms bss nrae R, rbby y preventing by probably ARF, increase bases -most . ssDNAs with significant homology to multiple to homology significant with ssDNAs . . ARF is highest when the modification to be to modification the when highest is ARF . Popoohot bns connecting bonds Phosphorothioate . atcacaccccatttaatatcagggaaccggacataaccccat atcacaccccatttaatatcagggaaccggacataaccccat atgattacggattcactggccgtcgttttacaacgtcgtgactg atgattacggattcactggccgtcgttttacaacgtcgtgactg tgggttcagttcgttgagccaggccgagaacctgatgcaagttta tgggttcagttcgttgagccaggccgagaacctgatgcaagttta cgcgattaaattccaacatggatgctgatttatatgggtataaat cgcgattaaattccaacatggatgctgatttatatgggtataaat gcatcgtaaagaacattttgaggcatttcagtcagttgctcaatg gcatcgtaaagaacattttgaggcatttcagtcagttgctcaatg gcgaaaactctcaaggatcttaccgctgttgagatccagttcgat gcgaaaactctcaaggatcttaccgctgttgagatccagttcgat 1 0 . ′ 2 2 at 5 and 3 ≥ −12 −12 kcal/mol 4 O 0.5–1 0.5–1 ( ≤ ptimum Fig. 8 90 90 nt 600 600 nt ′ ′ terminus termini. Nearer the 4 ( µ Fig. 8 b M ). c ). . coli E. - -

S equence (5 to allow recovery and segregation of the mutation ( mutation the of segregation outgrowth and recovery and allow to ssDNA introduce to electroporation proteins, recombination of induction entails MAGE of cycle Each tions. modifica desired of frequency the or to increase population cell a of diversity the increase to iteratively applied be can it nature, cycle. MAGE The • • Table grow isogenic starter cultures and to characterize mutations, mutations, characterize to and cultures starter isogenic grow to cycling of end and beginning the at required time additional h, 2.5 with is roughly time cycle The PROCEDURE). the of 1–12 confirmed oligo with a screenable phenotype, e.g phenotype, a with screenable oligo confirmed a of (addition positive and added) ssDNA (no Negative cycling. parallel enable to synchronized be can experiments MAGE independ ent time, cycle total of fraction time small a is hands-on cycle the each for Because day. full a in MAGE of cycles ous continu ten perform can Two people tasks. other for time ing leav cycles between incubation with workday a in typical cycles MAGE five perform to person one for possible is It respectively. a as b aodd y nldn a tig f synonymous of string a including by mismatches nearthedesired nonsynonymous mismatch avoided be also can Repair mismatches. recognized weakly selecting by avoided be recog readily nized is mismatch G-G bound the are whereas MutS, mismatches by C-C poorly and A-G T-T, the example, For sensitive to certain mismatches and relatively insensitive to others. identities Mismatch cost of such modifications costbe could prohibitive of ARF increase mi a of can bp 5 within placed when fluoro-uridine and 5-methyl-C instance, MMR in detection escape to mismatches nearby modifications Base C G agtgcaatagaaaatttcgacgcccatacgcccatgatgcagcagta agtgcaatagaaaatttcgacgcccatacgcccatgatgcagcagta A G A G A T gaaaaccctggcgttacccaacttaatcgccttgcagcacatccc gaaaaccctggcgttacccaacttaatcgccttgcagcacatccc G T A T acctataaccagaccgttcagctggatattacggcctttttaaa ggctcgcgataatgtcgggcaatcaggtgcgacaatctatcgct ggctcgcgataatgtcgggcaatcaggtgcgacaatctatcgct 2 taacccactcgtgcacccaactgatcttcagcatcttttacttt acctataaccagaccgttcagctggatattacggcctttttaaa 3 taacccactcgtgcacccaactgatcttcagcatcttttacttt cagcaagcacgccttagtaacccggaattgcgtaagtctgccgc cagcaagcacgccttagtaacccggaattgcgtaagtctgccgc 4 ) controls can be included to aid in troubleshooting. in aid to included be can controls ) . In a methyl mismatch repair (MMR mismatchrepairmethyl. a In ′ –3 ′ ) Given that the MAGE process is cyclical in in cyclical is process MAGE the that Given . cause ssDNAs can bases containingmodified . The mismatch repair pathways are highly highly are pathways repair mismatch The . natureprotocols ∆ mutS strains atthe end of MAGE mutagenesis. s match position, although the although position, match

| VOL.9 NO.10VOL.9 + ) strain, repair can repairstrain, ) 3 protocol 6 . . , lacZ_off from , lacZ_off + tan. For strains. Fig. Fig. | 2014 3 5 5 ; Steps ; Steps

. |

2307 - - - - -

© 2014 Nature America, Inc. All rights reserved. colonies are unmodified at all ten target the other with reactions: one with screened colony is interrogated by two multiplex ( primer is an exact match for its target site. optimal or the wild-type allele (respectively). At the base—which can either anneal to the mutant and are identical, except for the 3 ( Figure 9 requires it DNA delivery, but of method efficient extremely an is remove electrolytes (Steps 6–8 of PROCEDURE). Electroporation to water distilled chilled with twice be must washed Second, cells of pulse a in results bet bath water shaking °C 42 a in shock heat the of transcription strong ing bind to ability its losing °C, 42 at repressor mutant sensitive pL recombination ssDNA in dispensable be to shown been have they but bination, inhibitor RecBCD the and fork replication the at hybridization sequence target facilitate and self-folding prevent degradation, coats ssDNAs introduced by electroporation to protect them from ssDNA-binding and a recombinase functions. The is three—it the of important most the MAGE, is For host. its with exchange genetic and replication λ overexpress bet strains MAGE Instead, MAGE. for low too is teria possess some activity toward ssDNA be to toxic many of proteins repair bac The endogenous PROCEDURE). of too are induced be (Steps 1–5 expressed transiently constitutively—must proteins—which recombination First, is transformed, the target cell population must be made competent. Preparation of MAGE-competent cells. T 2308 corresponds to a primer set that interrogates a specific locus and that is designed to produce amplicons of a characteristic length. sites (wild-type colony), modified at all ten target sites (mutant colony 1) or modified at some but not other target sites (mutant colony 2). Each band b a a E E E N E E MG1655 N protocol -prophage ) ) ) ) Examples of binary MASC-PCR results. Each ctMM cM2.1 c c c b ame uc5 rmtr wih n un s euae b te temperature- the by regulated is turn in which promoter, and and expression sufficient for high-frequency allelic replacement. replacement. allelic high-frequency for sufficient expression f NR NR NR le le mut

| VOL.9 NO.10VOL.9 3 2 1 - and 3 3 (ref. T

(ref. R | m gam (ref. | 3 Genotype assays by MASC-PCR. , , extension occurs only if the forward

9 Strains used in MAGE. f WT 4,10,3 4 genes from an integrated and heat shock–inducible shock–inducible heat and integrated an from genes f 3 primers share a common mut 0 4 2 ) 3 3 ) 8 / ) . These three genes are under control of the phage 8 r f pairs for ten sites. Screened . The WT WT .The WT | 2014 / MG1655 MG1655 EcNR3 1255700:: Nuc5- EcNR2 EcNR1 EcNR1 MG1655 F r pairs for ten sites, and –

λ – |

ilvG natureprotocols dnaG ∆ ∆ gam λ [ mutS cI857 mutS ∆ ′ - - xonA -phage uses these genes to facilitate facilitate to genes these uses -phage -terminal ( .Q576A rfb ybhB are required for dsDNA recom dsDNA for required are :: -50 -50 exo (A134V) (A134V) , , . This repressor is destabilized destabilized is repressor This . cat r recJ - primer pL

bioAB - tolQRA rph bet 1 operator sites and allow and sites operator , , 8

. The 5 The . Before mutagenic ssDNA -1 xseA - 3 gam 7 )::[ mutL Genotype , but this basal capacity , , λ recA exoX operon. A 15-min 15-min A operon. cI857 cI857 N( (G62S) ′ a Mutant allele Wild-type allele exonuclease exonuclease bet homolog with with homolog , , red recombinase α cro ] - ea59 f f f f mut mut wt wt exo exo bet ):: - - - , tetR

- be collected for electroporation at mid-log phase (OD phase mid-log at electroporation for collected be cells that requires replacement allelic efficient dependent, cation repli is process MAGE the because Third, death). cell cause and low-conductivity cell slurry (otherwise, electrical arcing will occur tion without influencing the stability of mismatches. Knockouts Knockouts mismatches. of stability the influencing without tion recombina of the frequency increase modifications strain Other effectively less mismatches some detects MMR as oligo, genic can be overcome by careful selection of modifications in the muta mutation off-target of rate reduced a with MAGE high-efficiency permits MMR of expression machinery temperature-sensitive with strain ssDNAs—is (refs.~50-fold increased by not targeted at positions rate—i.e., mutation The background oligo-mediated allelic replacement is roughly 100-fold (refs. them for repair. In in the strain, improvement an MMR-deficient to identify positions mismatched binds that protein the produce ( used is commonly strain deficient a MMR, avoiding by ARF MAGE To increase replication. of round subsequent a before it correct to allowed is machinery MMR cell’s the if inherited be not will the mutation The site. at target exists mismatch a target, chromosomal its to hybridizes to MAGE.enhance modifications Strain replication markedly. down slows which of during phase stages later stationary a in enter and cells forks. low, growth too is replication density active cell growth, with early fastest In growing are cells when bla ] repair only during MAGE cycling Temperature-sensitive MMR alleles to interrupt mismatch to prevent dual colicin E1 and SDS resistance Nuclease deletions, primase allele and extra tolQRA operon Primase allele increases Okazaki fragment size Markerless nuclease deletions prevent oligo degradation Deletion of Insertion of mutant prophage with recombination genes Unmodified ancestor strain, approximates wild type 3 9 . Alternatively, the reduced ARF seen in MMR in seen ARF reduced the .Alternatively, mutS r r r r with cat Description b marker impairs MMR Wild Wild-type type colony Table Mutant 10,1 Wild type colony After a mutagenic oligo Mutant 1 3 ). A recently described ). This strain does not does ). strain This Mutant 1 colony Wild type Mutant Mutant 2 Ladder 600 ~0.5) ~0.5) mutS + 100 bp 500 bp 1 kb 4,3 cells cells 8 3 ). 4 - - - - .

© 2014 Nature America, Inc. All rights reserved. eliminates eliminates unmodified cells, leaving only cells enriched for multisite mutations. Inactive selectable marker is shown as a black rectangle with an ‘X’ inside; to mutagenize nearby target sites. Selection oligo are likely to incorporate oligos used Cells that incorporate the selectable marker a pool and introduced into the cell population. selectable marker oligo (black) are mixed into Target-site oligos (red, green and blue) and the Figure 10 produced by the be only will an amplicon allele, the mutant the colony If contains using genotype mutant the assay to other the each screen allele- to an required with colony: are one to assay the SNPs WT genotype MASC-PCRs using Two of PCR. specific discrimination for allowing 3 bases, their at differ only primers forward two The both. ( mutant the to ( WT the to specific primer forward a (i) designed: are primers three locus, targeted For each polymorphisms. single-nucleotide of mits the detection Box loci mutagenized many of genotypes the rogate inter allele-specific simultaneously to used be can multiplex (MASC-PCR) PCR colony phenotypes, selectable or screenable media tial differen or selective appropriate on them plating by identified be can phenotype or a visible markers selectable targeting ments MAGElection (cosMAGE; see ‘coselection MAGE’ below) experi and screening. Selection exposing by with ARF hybridization for strand oligos increase mutagenic lagging the of can stretches longer machinery cells the primosome entered have breakdown that preventing by oligos ARF of the increase can nucleases of different target loci are shown as red, green and blue empty rectangles. Mutated sites are shown as solid rectangles in corresponding colors. in the 3. Visualize 4 26 2–25 1 Cycle 2. Prepare eight reactions for each Sterile DIH 1:20 DIH Reverse primer (20 Forward primer (WTormut) (20 2× KAPA 2Gfast multiplex readymix Component dispense aliquots, accordingly): reactions eachfor 1. Runatemperature gradient PCRtoconfirmthe  amplification is expected. Confirm that the optimal Box 2

CR 2 ). MASC-PCR affords single base-pair resolution and per and resolution base-pair single affords ).MASC-PCR

I T f

I WT | CAL Mechanism for coselection MAGE. 4,1 - 2 r O dilution of anancestor strain (WTatalltargeted loci) | reaction. Amplicons should be absent from the

2 2 . However, because most mutations do not present present not do mutations most .However, because

O OptimizingPCRconditionsforMASC-PCR STEP

µ f l of each PCR product on a 1.5% (wt/vol) agarose gel. At optimal f mut 3 mut 2 Failure todetermine optimal . f f ) and (iii) a reverse primer ( primer reverse a (iii) and ) mut µ 95 °Cfor 30s 95 °Cfor 5min Denature and WT M)

- ) sequence, (ii) a forward primer specific specific primer forward a (ii) sequence, ) r

and Recombinant cells from MAGE or cose r primers but not primers the f WT

µ -

r M) pairs. Forasingle 20-

f

mut

- 72°Cfor 10min gradient (e.g., 62–67°C)for 30s Anneal 4 r 0 and . Modifications to the the to Modifications . f WT f WT f and f mut selectable T WT - m Inactive 10,1 r marker pair, and then runthe following PCRprogram: willprevent reliable genotyping of isolatedcolonies. T and and r and m ) common to to common ) r T primers, and for MASC-PCRprimers. Eachsetof three primers requires agradient of eight 1 m ( for each primer set in the pool is sufficiently close (±3 °C) to allow multiplexing. ′ Fig. Fig. r r -terminal -terminal primers. primers. µ primers. l reaction, mixthe following (for multiple PCRs, prepare amaster mixand Target loci f

mut 9 and and - r reaction at optimal

- - - - -

MAGE oligos MAGE 1 1 7 10 Volume ( marker (safe insertion regions for cosMAGE marker integration integration marker cosMAGE for regions insertion (safe marker by challenge an including oligo a that activates selectable silenced per locus. CosMAGE rate incorporation higher of overcomes this a or MAGE of cycles many either requires sites many across sity The generation of a population that samples combinatorial diver target site assume independence, 10% site; frequency at each target site: 0.1 per 10% = pool the for frequency aggregate after mutants one only round 0.1% MAGE triple of 30% (assume is used. three loci, For one would expect example, targeting when oligos of pool complex a when sites target genomic many across type. However, the aggregate replacement frequency is distributed geno desired for the to screen high by ARF MAGE is sufficiently MAGE. Coselection T the Conversely, above reactions. WT and mutant both in appear the below WT or temperatures at However, mutant clones. of identification unambiguous allowing result ( by determined PCR a pool be should primer gradient empirically same however,°C); ~62 optimal the perature, the with designed bp). are 850 primers and the 700 All 600, 500, 400, 300, 250, 200, 150, 100, (e.g., designing each primer set by to producereaction amplicons single of different a lengthin interrogated be can loci ten least At con. only For the WT allele, Box Box m 1

, amplicons are occasionally absent from both reactions. both from absent occasionally are , amplicons

2 ). At the pool’s precise precise pool’s the ). At µ 72 °Cfor 30s/kb–60s/kb Extend l)

T m , amplicons will appear at the expected length only T ● m , although at lower temperatures nonspecific

0.2 Final 0.2 Trace amount 4°C 1× Replication T IMI When a single or a few loci are targeted, the the targeted, are loci a few or a single When natureprotocols µ µ

f WT M M N and and G 1d T m r primers will produce an ampli produce will primers , MASC-PCR provides a binary binary a provides ,MASC-PCR Hold

| T VOL.9 NO.10VOL.9 m for each MASC-PCR MASC-PCR each for Selection T T m m protocol , amplicons can can amplicons , (melting tem (melting | 2014 3 = 0.1%). |

2309 - - - -

© 2014 Nature America, Inc. All rights reserved. eoe ( genome daughter same the into integration of probability the increases proximity at cosegregate high cosMAGE,frequency during which locus marker selectable the of kb 500 within oligos mutagenic of for incorporation enriched are highly clones selected that showed work recent Second, event. bination recom an oligo-mediated have that for undergone cells enriches selection First, ways. important two in oligos mutagenic the of mutate target loci in listed 2310 protocol (vii) Pick several colonies togrow eachinbothLBand LB-SDS liquid media in ashaking incubator at300 r.p.m. between 30and on LBplate). (vi) Count viable cellsfrom eachplatetodetermine positiveselection efficiency (number of cellsonLB-SDSplate/number of cells (v) Incubate the plates at30–34°Covernight until colonies appear. (iv) Make several 1:10serial dilutions inLBliquid medium and spread 50  subjected tothe next MAGE cycle(Step3of the main PROCEDURE)ormutants are isolated (next step). cultures havegrown tomid-log phase(OD0.4–0.6),butthe negative control strain remains suppressed. The selectedsamplesare (iii) Allowthe cellstogrow for 3–12hinashaking incubator at30–34°C. Stopthe experiment once itisclearthatmutagenized culture withthe inactive (ii) Inoculate 30 (i) Recovercellsinashaking incubator at300r.p.m. between30and 34°Cfor atleast3htopermit fullexpression of TolC. (B) 34 °Cfor 6–12h.These cultures canbefrozen, usedfor Sanger sequencing orusedfor downstream analysis. (viii) Pick several colonies togrow eachinboth LBand LB-SDSliquid media inashaking incubator at300r.p.m. between30and by the number of colonies onthe LBplate). (vii) Count the colonies from eachplatetodetermine negative selection efficiency (number of colonies onthe LB-SDSplatedivided (vi) Incubate the platesat30–34°Covernight until colonies appear. (v) Make 1:10serial dilutions inLBand spread 50 Once thisbegins tohappen,control wellscontaining isogenic activeTolC cellswillstarttogrow despite the presence of colicin E1.  to the next MAGE cycle(Step3of the main PROCEDURE)ormutants are isolated(step1A(v)of thisbox). (OD every 10mintomonitor cell growth. Stopthe experiment when samplesmutagenized bythe tolC_off oligo grow tomid-log (iv) Incubate the plateinashaking platereader for 6–12hat30–34°Cwith300r.p.m. orbitalshaking and OD volumes into a96-wellculture plate(~20wellspersample). (iii) Mix30 (ii) Dilutethe cells1:100and grow them toearly-logphase(OD negative selection.  membrane protein. Prepare cellculture of the ancestor strain withfunctional TolC asnegative control. (i) Outgrow cellsinashaking incubator at300r.p.m. between30and 34°Cfor atleast6hfor completeturnover of the TolC outer ( ?  of tolC_onoligo. Perform positiveselection (option B)toenrich cellsthathavereverted tothe active nonsense mutation. Foreven-numbered cyclesof MAGE, supplement the cell/DNAslurryatStep8with0.05 0.05 1. FollowSteps1–12of the main PROCEDURE.Forodd-numbered cyclesof MAGE, supplement the cell/DNAslurryatStep8with revert the nonsense mutation introduced during odd cycles. a nonsense mutation in should besensitive tothe protein. The oligo poolusedduring odd MAGE cycles(1,3,5…)willinclude anoligo designed tointroduce conferred onlybythe active(WT)allele. Acontrol strain withactiveTolC canalsobeusedtoverifystocksof colicin E1,asthisstrain optimized for repeated on-and off-selection To use 34 °Cfor 6–12 h.These cultures can befrozen, usedfor Sanger sequencing orusedfor downstream analysis. Box 3 A

) CR CR CR CR TROU

600 | P N VOL.9 NO.10VOL.9 µ I I I I ositive selectionfor even cycles of M egative selectionfor oddcycles of M T T T T 0.4–0.6),butthe control strain (containing active M final concentration of tolC_off oligo. Perform negative selection (option A)toenrich cellsthathaveacquired the tolC Supplementary Table 1 Supplementary I I I I CAL CAL CAL CAL B i. 1 Fig. LES asadual selectablemarker for cosMAGE, startfrom astrain withthe active | µ

CosMAGE cycling STEP STEP STEP STEP l of colicin E1,30 H 2 OOT 0 8 | µ 2014 Insufficient outgrowth will not eliminate residual TolC protein in mutant cells leading to failure of ). To enhance multiple incorporation of of incorporation multiple enhance To ). Longer selection time willcausedegradation of SDS,lossof selection and ahigh false-positive rate. Longer selection time willcausedegradation of colicin E1,lossof selection and ahigh false-positive rate. Donot change the normal 0.5–10 . The selection oligo enhances the incorporation l of eachmutagenized sampleinto 3mlof LBfor a1:100dilution. As anegative control, inoculate anisogenic I N | G

tolC natureprotocols tolC . Conversely, the oligo poolusedduring evenMAGE cycles(2,4,6…)willinclude anoligo designed to allele1:100into 3mlof LB. Supplement eachtubewith0.005%SDS(final concentration). µ ) among the pool of oligos that that oligos of pool the among ) l of recovered culture and 3mlof LBfor eachstrain; mixwellbypipetting, and then add 150- 2 8 . Multiple oligos in close close in oligos Multiple . ● 4 A A 3 G G

. The starting strain’s E E T

IMI ● ● µ

T l of eachdilutedculture onbothLBand LB-SDSplates. T µ IMI IMI M final concentration of target locioligos atStep8. N N N G G G tolC 2dtoweeks 1dtoweek 1dtoweek allele)remains suppressed. The selected samplesare subjected 600 -

~0.2).Thawcolicin E1onice before use. tolC required to isolate a desired genotype. Furthermore, by minimizing same result. This enhancement substantially reduces the screening ref. 15.6%; (to fold site) four target around by site target each per of ARF the improves CosMAGE (3.75% 30% of frequency replacement gate aggre pool oligo an given mutations, more or six contain would 10 × 1.5 in colony one only MAGE, conventional by sites eight required. is pool) oligo MAGE total the of 1% (i.e., oligo mutagenic oligos, only a low concentration of the selectable marker allelecanbeassessedbygrowth inSDS:resistance is CosMAGE greatly enhances the ARF of multiplex loci. To target µ l of eachdilutedculture onLBand LB-SDSplates. tolC 2 alleleand whose genotype hasbeen 8 ), so that one colony in 10 in colony one ), that so tolC allele. µ M final concentration 600 measurements

4 can achieve the the achieve can tolC

µ

l

2 8 - - 7 .

© 2014 Nature America, Inc. All rights reserved. • • • • • • • • • • • • • • • EQUIPMENT • • • • • • • • • • • • • • • • • • • • • • REAGENTS M revert to used is tolC oligo tolC_on the cycle subsequent a in then tolC_off the cosMAGE, ( cycled oligo In resistance. E1 colicin gain of allele nonsense a with Strains peptide). toxic small (a E1 colicin to sensitivity but porin SDS to ance membrane outer the mutations. example, many For accumulate to ability the enhancing further and ∆ in mutations background of accumulation the limits cosMAGE the number cycles of required to cells, mutagenized highly obtain • • Agarose gel electrophoresis (Bio-Rad) apparatus Multichannel pipettes for 0.5–200- filtertips pipettes forSingle-channel 0.5–1,000- films Plastic for 96-wellPCRplates (Bio-Rad, cat. no. MSB-1001) Scientific,96-well PCRplates (Thermo cat. no. AB-0849) for (Bio-Rad, PCRtubes Cap strips cat. no. TCS-0801) PCR tubes, 0.2ml(Bio-Rad, cat. no. TLS0901) cyclerThermal (Bio-Rad, cat. no. 185-1196) or 2mm(Bio-Rad, cat. no. 165-2086)gaps cuvettesElectroporation 1mm(Bio-Rad, with cat. no. 165-2089) cat. no. 45–2006) Electroporator (Bio-Rad, cat. no. 1652662, or Harvard BTX, cat. no. 5424) Microcentrifuge kept atroom temperature (~25°C; Eppendorf, Microcentrifuge kept at4°C(Eppendorf, cat. no. 5415C) Insulated ice bucket (Fisher Scientific, cat. no. 1167673) Scientific, water at50°C(Thermo cat. bathset Stationary no. 18002AQ) Scientific,Shaking water at42°C(Thermo cat. bathset no. 4303) Scientific,Shaking incubator at30–34°C(Thermo cat. set no. 4359) Scientific, incubator at30–34°C(Thermo cat. set Stationary no. 4359) cat. no. 41004) SYBR Gold(Invitrogen, cat. no. S-11494)or GelGreen (Biotium, Nucleic stains: acid ethidiumbromide (Invitrogen, cat. no. 15585011), Glycerol Bioanalytical, (American cat. no. AB00751) papersforColicin preparation) previous E1(see Bioanalytical,SDS (American cat. no. AB01922) Gentamicin (MPBiomedicals, cat. no. 0219005705) (MPBiomedicals,Spectinomcyin cat. no. 0215206701) Zeocin (Life Technologies, cat. no. R25001) Tetracycline Bioanalytical, (American cat. no. AB02024) Bioanalytical, (American cat.Carbenicillin no. AB00285) Kanamycin Bioanalytical, (American cat. no. AB01100) DNA ladder (New BioLabs, England cat. no. N3200S) Agarose Bioanalytical, (American cat. no. AB00972) 2× Kapa 2Gfastmultiplex readymix (KAPA Biosystems, cat. no. KK2602) NaOH, 10M, made from Baker, NaOH (JT pellets cat. no. 3722) Agar Bioanalytical, (American cat. no. AB01185) chlorideSodium (NaCl; Bioanalytical,American cat. no. AB01915) Yeast Bioanalytical, (American cat. extract no. AB01208) Tryptone Bioanalytical, (American cat. no. AB02031) H Sterile distilled Integrated DNA Technologies) User-defined PCRforprimers MASC-PCR(standard purification; DNA Technologies) commonly mutagenesis used oligos (standard purification; Integrated User-defined ssDNA synthetic oligos for MAGE; see Appropriate mutS ATER Through the use of dual-selectable markers (e.g., (e.g., markers dual-selectable of use the Through to the WT ( WT the to galK strains. Table Table I ALS 4 2 ), cosMAGE can be extended to continuous cycling, cycling, continuous to extended be can cosMAGE ), E. coli 2 ) is used to introduce a nonsense mutation, and and mutation, nonsense a introduce to used is ) 2 O, chilledon ice strain (see Reagent (see strain and Setup Box Box 3 ). This cycle can be repeated for as many many as for repeated be can cycle This ). µ l volumes (Rainin) µ l volumes andsterile (Rainin) tolC lose SDS resistance but but resistance SDS lose 44,4 Table 5 tolC Table 3 ) confers resist confers 2 for some

tolC

4 - 1

• • • • • coselection. of the of function the preserving thereby clones, E1–resistant modifications colicin and SDS of protocol frequency the and decrease strain by avoided be can problems such that show we advances, recent In resistance. E1 colicin and SDS simultaneous cause that mutations acquire can during instance, For nonfunctional. gene selectable the render that mutations accumulating of the risk carries coselection for cycling positive/negative Long-term experi ment, proof-of-principle a In chromosome. single a in tions muta target-site several accumulate to necessary are as rounds a selectable markers. T the streaked to strain avoid contamination. (LB,Luria-Bertani Lennox) plate supplemented selective antibiotics with for colonies,single streak the that be strain will bacterial used for MAGE. Use a replication or nuclease genes can improve MAGE ARF ( mismatch repair recombination proteins and a knockout mutation in derivative that contains a modified E. coli REAGENT SETUP • • • • • • • • • • with 80 target loci mutations after only 18 cosMAGE cycles cosMAGE 18 only after mutations loci target 80 with Light sensitive. a SDS Gentamicin Zeocin Tetracycline Spectinomycin Kanamycin Chloramphenicol Carbenicillin Ampicillin A Sterile syringe filter units(Millipore,Sterile syringe cat. no. SLGP033RS) Sterile Petri dishes(Corning, cat. no. 351058) Sterile 14-mlculture (BDFalcon, tubes cat. no. 352059) Sterile 1.7-mlmicrocentrifuge (GeneMate, tubes cat. no. C-3620-4) documentationGel system (Bio-Rad, cat. no. 1708195) Plate reader for negative (optional; selections Bio-Tek, cat. no. 11120531) cuvettesSpectrophotometry (Brand-Tech Scientific, cat. no. 759086D) Spectrophotometer (Biochrom, cat. no. 80-5000-00) Sterile reservoirs (Corning, cat. no. 4870) Sterile 96-wellflat-bottom culture plates (Corning, cat. no. 3596) Glass beads, nonsterile (Sigma, cat. no. Z265942) Toothpicks, nonsterile (VWR, cat. no. 500029-808) (Corning,Sterile 2-mlcryotubes cat. no. 420917) filterSterile 50-mlvacuum units(Millipore, cat. no. SCGP00525) (BD,Sterile 10-mlsyringes cat. no. 309604) b ntibiotic le le strain 4 4 tolC a,b |

Antibiotic concentrations to use for genome integrated

b -based dual selection was used to isolate a colony colony a isolate to used was selection dual -based MAGE is in EcNR2,performed strain an Salt and pHsensitive. a 4 . related Strains to in EcNR2 modifications with natureprotocols λ -Red prophage to provide C oncentration ( tolC tolC

| 0.005% 0.005% (vol/vol) VOL.9 NO.10VOL.9 gene for more cycles cycles more for gene coselection, strains strains coselection, mutS E. coli Table 10 10 12 95 30 20 50 50 protocol to prevent MG1655 3

). To isolate | m 2014 g/ml)

4

3 |

that that 2311 2 8 - - . © 2014 Nature America, Inc. All rights reserved.   proteins and maintains a high ARF.  5| complete induction.   Induce the expression of 4| control (recovery tube). microcentrifuge tubesand chillitonice. Alsoprepare alabeledculture tubecontaining 3mlof LB for eachsampleor stock (lacZ_off oligo for the positivecontrol orwaterfor the negative control) toone of the prechilled labeled sample orcontrol, prepare oligo solution byadding 49 control. Eachsetof tubes should share acommon label identifying the sampleorcontrol itwillcontain. Foreach place them onice and prechill twomicrocentrifuge tubesand a0.1-cmelectroporation cuvettefor eachsampleand 3| are therefore conducive to high-frequency allelic replacement.  compatible with certain antibiotics (e.g., zeocin).  performed at low temperature (<36 °C) to avoid premature induction of recombination functions.   as measured byOD 2| indicating a30%ARF. a and recombination withalacZ_off oligo ( 30 positive control. Cultures canbeestablished byinoculating the liquid medium withasingle bacterial colony orbyadding appropriate antibiotics: 1mlwillbeusedfor the MAGE experiment, 1mlfor the negative control and 1mlfor the (optional) 1| P PROCE belowsolidifies 50°C, but aboveoccur. can antibiotics 50°C breakdown of toadded theautoclaved medium thathascooled to 50°C. LBagar are required inthemedium, must filter-sterilized be they andthen agar, andthenmolten pour medium into sterile Petri dishes. antibiotics If ~200 water,NaCl in1liter agar of and15gof thepHto andbring 7.5by adding plates LB agar See freshly shouldbe antibiotics prepared,with stored. cannotbe asthey after ithascooled to room temperature. LBmedium Mixtures of appropriate solvent, filter-sterilized andthenadded to autoclaved medium medium, suspended at1,000×concentration shouldbe they inan Antibiotic-supplemented LBbroth medium must autoclaved be for sterility. Store themedium atroom temperature for upto 3months. water,1 liter of andadjust thepHto 7.5by ~200 adding LB broth 2312 protocol reparation of electrocompetent cellsandM lacZ

PAUSE CR CR CR CR CR CR CR CR Table µ

µ l of aconfluent liquid culture (1:100dilution). We suggest a‘no DNA’ MAGE experiment asa negative control, After induction, quickly transfer the cultures from the shaking waterbath toice. Quickly transfer the culture tubesfrom Step2from the 30–34°Cincubator to the 42°Cshaking waterbath. In preparation for Steps6–11,chill10mlof DIH Grow the culture inashaking incubator at300r.p.m. at30–34°Cfor ~2–3horuntil the cellsreach mid-log phase, For eachMAGE experiment, setupa3-mlculture of the appropriate bacterial strain inLBsupplemented with | I I I I I I I I VOL.9 NO.10VOL.9 l of 0.1MNaOH.l of Autoclave andto themedium for the melt sterility + T T T T T T T T D strain byplating onX-Gal–and IPTG-containing media. Inourhands, thisoligo leadsto~30%whitecolonies,

I I I I I I I I 4 URE CAL CAL CAL CAL CAL CAL CAL CAL Combine 10 g of tryptone, 5 g of yeast extract and 5 g of NaCl and5gof yeast in extract 5gof tryptone, Combine 10gof for concentrations. antibiotic

PO

Combine 10 g of tryptone, 5 g of yeast extract, 5gof 5gof tryptone, Combine 10gof I STEP STEP STEP STEP STEP STEP STEP STEP NT Cultures can be kept on ice for at most 3 h. | 2014 Perform Steps 6–8 in a 4 °C cold room. Keeping induced cells at low temperature until electroporation prevents breakdown of recombination Vigorous shaking in a water bath is necessary to ensure adequate oxygenation, rapid heat transfer and Longer induction time results in cell death from toxicity of the Gam protein. Growth time varies with strains. Mid-log cultures contain a high proportion of actively replicating cells and Media with high salt concentration may lead to low ARF or to failure of electroporation and are not The Red genes are under the control of a temperature-sensitive repressor; therefore, incubation should be Shaking is necessary to ensure adequate oxygenation and rapid growth. 600 of 0.4–0.6(~10 | natureprotocols λ -Red genes byheat shock for 15minat250r.p.m.

If antibiotics are antibiotics requiredIf inthe 8 cellsperml). T able µ l of 0.1MNaOH.l of A  2 G

) asapositivecontrol. These controls allowMAGE ARF tobeassayedin CR E cycling

I

T

I CAL

2

µ O onice; thaw50 l of sterileDIH LB

●

T IMI be storedbe at−20°Cfor atleast1year; avoid frequent freeze/thaw cycles. (50/ a 50- 0.5–10 Generally, thefinal total oligo concentration ina complex at isheld pool complex iscreated oligo pool by mixingtheoligos separate thattarget loci. volume).electroporation For more mutagenesis thanone site, target of a theoligo is1 concentration of DNA 50 concentration of MAGE oligos strains. bacterial  Store 80%(vol/vol) glycerol atroom temperature for upto 1year. water; mixthecontents andthen filter throughfilter asterilevacuum unit. Glycerol, 80%(vol/vol) up to 1month. Once themedium issolid, plates agar stored shouldbe at4°Cfor

CR N n G µ I )- T l equimolar pool of of l equimolar pool 2dto1week µ µ I CAL M, each constituent with contributing anequal amount. To create l volumes of eachl volumes10 of 2 O and 1 µ Glycerol must kept be sterile to maintainfrozen stocks of M oligo stocks(seeReagent Setup)and

Suspend MAGE oligos indeionized water (DIH µ l of the appropriate 50

Combine 80 ml of glycerol with 20 ml of glycerolCombine 20mlof 80mlof with µ n M. For mutagenesis, single-site thefinal oligos at10 µ µ M stock would mixed. be can oligo The pool M (1 µ l of oligo ina50- l of µ M aggregate concentration,M aggregate µ M oligo µ l total

2

O) ata

© 2014 Nature America, Inc. All rights reserved. (D) ( (B) ( only after two complete rounds of replication. mismatches still exist at target loci. Mutations by MAGE introduced on the lagging strand are completely inherited in cells of genome replication. If the recovery period is too short, cells will contain chimeric chromosomes in which oligo-genome  follow option D. follow option B;toisolaterecombinant clones for screening, follow option C;and tofreeze asamplefor lateranalysis, different applications: to perform asubsequent MAGE cycle( 12| and then transfer itbacktothe recovery tubetoa final volume of 3ml. Pipette itupand down tomixelectroporated cells(~10%surviveelectroporation, i.e., 1×10 11| ? constant for an equal volume of DI H Well-washed cells with desalted DNA at an appropriate concentration exhibit time constants very close to the time concentration (either from DNA-salt complex or improperly washed cells) and lead to increased lethality and low ARF. at least 4.0 ms (this can vary for different electroporation instruments). Low time constants imply high electrolyte  10| Settings for a0.2-cmgapcuvetteare asfollows: 2.5kV, 25 9| prevent arcing during electroporation.   cells should beelectroporated withinanhour of preparation. a pipettetipand transfer ittothe corresponding prechilled electroporation cuvette. Keep itonice until use. Competent 8| mixture at maximum speed for (13,000 r.p.m. or 14,000 7| speed (13,000r.p.m. or14,000 there should beone tubefor the experimental sampleand one for eachassociated control. Centrifuge alltubesatmaximum 6| C A

TROU

)

(ii) (ii) To startanother round of MAGE the next day, proceed from Step1. (ii) ) CR CR CR CR (i) (i) (i) Incubate the cellsat30–34°Cwithshaking at300r.p.m. until they reach stationary phase(i.e., overnight). (i) Incubate the culture at 30–34°Cwithshaking at 300r.p.m. until the cellsreach anOD Incubate the recovery tubebyshaking itat300r.p.m. at30–34°C. Different recovery times are appropriate for Immediately afterelectroporation, add 1mlof LBfrom the recovery tube(from Step3)tothe electroporation cuvette. Wipethe outside of the cuvettedry. Delivervoltage totransform the cellswithMAGE oligos. T T T T Turn onthe electroporator and setitto1.8kV, 25 After the second wash,remove the supernatant. Resuspend the cellpelletin50 Add 1 ml of ice-cold sterile DI H Transfer 1mlof induced culture toeachof the corresponding emptyprechilled microcentrifuge tubes(from Step3); o isolaterecombinant clonesfor screening o pausebetween M o freeze therecovered M o recover cellsinpreparation for asubsequentM I I I I ? per day. at Step3.ForEcNR2,appropriate celldensity isachieved after~2hof recovery, permitting uptotenMAGE cycles large volume of culture medium (e.g., 1:100dilution). screw-top cryotube. Store itat−80°Cindefinitely. To recover the frozen sample, thawiton ice and grow itina Step 13toprepare atenfold serial dilution. T T T T Follow Step12Afor anadditional round of MAGE. Mix 700 Recover cellsbyincubating them at30–34°Cwithshaking at300r.p.m. for atleast3h,and then proceed to Once itisatthe appropriate density, portthe recovered culture directly into anadditional round of MAGE starting I I I I B

CAL CAL CAL CAL TROU LES

H STEP STEP STEP STEP B OOT µ LES l of the recovered culture with300 It is important to recover electroporated cultures long enough to allow at least two complete cycles After the electroporation shock has been delivered, ensure that the relaxation time (time constant) is The supernatant contains electrolytes from LB and must be completely removed at each wash step to Remove the supernatant carefully; otherwise, the cell pellet can be lost. I H N OOT G I N A G G E cycles g A ) for 30sat4°C.Remove the supernatant. G E culture for lateranalysis 2 O to the cell pellet, and resuspend the cells with a pipette tip. Do not vortex. Centrifuge the 2 O O (~5.2 ms in the Bio-Rad instrument used throughout this protocol). µ l of 80%(vol/vol)glycerol (final concentration 24%) ina2-ml g ) for 30 s at 4 °C, and remove the supernatant. Repeat this step once. µ

F capacitance and 200 A G E µ Fig. cycle F and 200 5 ), follow option A;topausebetweenMAGE cycles, ω . ω resistance for a0.1-cmgapcuvette. µ natureprotocols l of oligo solution (from Step3)with 600 of 0.4–0.6. 7 cellsperml)withLB,

| VOL.9 NO.10VOL.9 protocol | 2014

|

2313

© 2014 Nature America, Inc. All rights reserved. T Troubleshooting advice canbefound in ? Sanger sequencing. 21| ? If necessary, screen more colonies tofind the desired mutants. 20| step 3of 19| multichannel pipettesand sterilereservoirs greatly accelerates the process of aliquotting and adding templatetoPCRs. To supplytemplateDNA,add 1 18| mid-log phase, asmeasured bythe OD 17| 96-well plate. Include atleastone colony from the ‘no oligo’ negative control samplethatdid not undergo MAGE. 16| an appropriate antibiotic. 15| ? overnight until colonies appear. Usually 10 14| dilution steps. controls. Use atleast180 13| Isolation of mutants engendered by M 2314 a 12 10 S 14 protocol

TROU TROU TROU tep b le le Freeze and store the pure cultures (Step12D)for the colonies thatscreened correctly, and then confirm genotype with Visualize 4 Runthe PCRsusing the protocol specifiedinstep2 of SetuptwoPCRs(step1of Grow the picked colonies inashaking incubator at300r.p.m at30–34°Cfor ~2horuntil allwellshavereached Use steriletoothpicks topick 48–96colonies from eachsample, and then transfer eachcolony toone wellof the Byusing amultichannel pipette, filleachwell of a96-wellflat-bottomculture platewith~150 Spread 50 Prepare serial tenfold dilutions (from undiluted to10

| VOL.9 NO.10VOL.9 5 5 B B B | experiment or control plates No colonies on either recovery No outgrowth during electroporation Arcing during P LES LES LES

roblem Box Troubleshooting table. H H H OOT OOT OOT 2 µ . µ l of eachdilution onplatesselectivefor the mutagenized strain. Incubate the platesat30–34°C | l of eachPCRproduct onan~1.5%(wt/vol)agarose gel todetermine the genotype of eachcolony. 2014 I I I N N N G G G

| natureprotocols µ

l of water, LBorPBSasthe diluent for eachstep.Change the pipettetipsbetween

µ Box l from eachwellof the 96-wellplatetobothWTand mutant reactions. The useof 2 Residual salt in either the cell P Antibiotics are too strong Poor MAGE ARF Inadequate outgrowth time electroporation Too many cells are killed during at 42 °C Cultures are left for a long time pellet or the introduced DNA ) for eachisolatedcolony, one using ossible reason 600 T A . able G 4 E –10

● 5

6 T . -fold dilutions givesingle colonies. IMI N G 2 d to 1 week 6 -fold diluted)for eachMAGE sample, positiveand negative Box 2 and the optimal annealing temperature determined in of antibiotics as suggested in Prepare new agar plates, supplementing appropriate amount 0.4–0.6 Carry out more MAGE cycles; induce cells when OD Allow the cells to grow longer before plating Wash the cells one more time with chilled DI H 15-min induction Restart the cultures; place the cells on ice immediately after Drop-dialyze the DNA to reduce salt Wash the cells one more time with chilled DI H S olution f WT - r and the other using T able able µ f mut 4 l of amixof LBand - r primer sets. 2 2

O O 600

(continued)

reaches

© 2014 Nature America, Inc. All rights reserved. 3. 2. 1. com/reprints/index.htm at online available is information permissions and Reprints interests. CO contributions on mathematical modeling from A.O.L. AUT Foundation (F.J.I.). andN66001-12-C-4211), (N66001-12-C-4020, the Arnold and Mabel Beckman Energy Defense (DE-FG02-02ER63445), Advanced Research Projects Agency A online v Note: Any and Information Source Data Supplementary files are available in the for multiple target loci. predicted using the plotsin can bereplaced inasingle MAGE cyclein~2.5h.For>1target site, expected ARFsand totalpopulation complexity canbe MAGE isavaluable method toengineer bacterial genomes ANT Box 3 Box 2 Steps 13–21, isolation of mutants engendered by MAGE: 2 d to 1 week Steps 1–12, preparation of electrocompetent cells and MAGE cycling: 2 d to 1 week ● T 4. a 20 S Box cknowle

M tep b T H PET le le accelerated evolution. accelerated artemisinin. antimalarial specificity.cleavage and Genet. Wang, H.H. Wang, C.J. Paddon, J. Ashworth, generation.next technologies—the Sequencing Metzker,M.L. IMI I OR 3 C ersion of ersion the pape , , cosMAGE cycling: 2 d–2 weeks , optimizing PCR conditions for MASC-PCR: 1 d I I 5 5

N CONTR PATE N G G FI |

and negative control plates Colonies on both experiment P cultures grow and negative control Both the experimental generate clear bands PCRs: both Nonspecific results for MASC- wild type All PCR bands show the dgm 11 G

roblem Troubleshooting table (continued). , 31–46 (2010). 31–46 , NANC D IB ents et al. et et al. et UT et al. et RESULTS I I

AL Funding was provided by the US Department of ONS Programming cells by multiplex genome engineering and engineeringgenome multiplex by cells Programming High-level semi-synthetic production of the potent the ofproduction semi-synthetic High-level Computational redesign of endonuclease DNA binding DNA endonucleaseof redesignComputational l r I . f . wt NTERESTS

R.R.G., R.R.G., Z.L. and F.J.I. wrote the manuscript with / Nature r and Nature Nature

460

f The authors declare no competing financial

mut 441 496 Figure

, 894–898 (2009). 894–898 ,

/ r , 656–659 (2006). 656–659 , , 528–532 (2013). 528–532 ,

4 Colicin E1 has degraded or isogenic Picked colonies are not clonal T Inadequate screen frequency Poor MAGE allelic replacement Strain contamination Antibiotics are too weak P . CosMAGE further enhances the ARFbyaboutfourfold, thus greatly improving the ARF m ossible reason is not optimal http://www.nature. Nat. Rev. Nat.

in vivo

7. 6. 5. 15. 14. 13. 12. 11. 10. 9. 8. using ssDNAs. Ingeneral, upto~30%of targeted alleles

engineering using recombination in recombination using engineering Biophys.Rev. Annu. Biochem. (2010). microchips.high-fidelity from pools (2009). 1151–1162 Science MAGE. functions. replacement. genome-widecodon oligonucleotides. single-strandedusing DNA chromosomal of engineering repair,and (2000). in engineering (1998). 123–128 Zhang, Y., Buchholz, F., Muyrers, J.P. & Stewart, A.F. A new logic for DNA for logic new A A.F. Stewart, J.P.& Muyrers,F., Buchholz,Y., Zhang, evolution. directed by design Protein D. Hilvert, P.& Kast, C., Jackel, nucleases.targetable with engineeringGenome D. Carroll, Kosuri, S. Kosuri, engineering.Genome G.M. Church, P.A.& Carr, uses. its and chemistry DNA machines: synthesis Gene M.H. Caruthers, H.H. Wang, M.J. Lajoie, F.J.Isaacs, mutagenesis,efficiency High D.L. Court, & T.DiTizio, D., Yu, H.M., Ellis, D. Yu, of antibiotics as suggested in Prepare new agar plates, supplementing appropriate amount S selection; selection; dilute fewer cells in each well Use freshly prepared colicin E1 to set up another negative for segregation of mutation Pick only easily resolved colonies; ensure sufficient recovery Optimal Screen more colonies 0.4–0.6 Carry out more MAGE cycles; induce cells when OD Re-streak strains; use sterile technique during MAGE olution et al. et Nat. Methods Nat.

230

83 et al. et Science T et al. et , 281–285 (1985). 281–285 , et al. et m An efficient recombination system for chromosome for system recombination efficient An , 409–439 (2014). 409–439 , et al. et should be determined by gradient PCR Escherichia coli Escherichia Scalable gene synthesis by selective amplification of DNA of amplification selective by synthesis gene Scalable Precise manipulation of chromosomes of manipulation Precise Genome-scale promoter engineering by coselection by engineeringpromoter Genome-scale Proc. Natl. Acad. Sci. USA Sci. Acad. Natl. Proc.

Genomically recoded organisms expand biological expand organisms recoded Genomically 342

37 9 , 591–593 (2012). 591–593 , natureprotocols , 357–360 (2013). 357–360 , , 153–173 (2008). 153–173 , . Proc. Natl. Acad. Sci. USA Sci. Acad. Natl. Proc. Science Escherichia coli Escherichia T Nat. Biotechnol. Nat. able able

333

4 98

| VOL.9 NO.10VOL.9 , 348–353 (2011). 348–353 , , 6742–6746 (2001). 6742–6746 , Nat. Biotechnol. Nat. .

Nat. Genet. Nat. 28 protocol , 1295–1299 , in vivo in

97 Annu. Rev. Annu. 600 | , 5978–5983 , 2014 reaches enables

27 20 , , |

2315

© 2014 Nature America, Inc. All rights reserved. 26. 25. 24. 23. 22. 21. 20. 19. 18. 17. 30. 29. 28. 27. 16. 2316 protocol

and mouse ES cells. ES mouse and oligonucleotide-directedin mutagenesispromote proteins (2008). 1626–1631 phages. their and bacteria Gram-positive and Gram-negative from functionsrecombineering of analysis and oligonucleotideco-selection. Res. Acids Nucleic generation.strain producer fast for strategy general a nanosensors: in Recombineering (2009). 946–950 expression. protein control to sites binding ribosome optimization. strain microbial for strategies knockout geneidentifying for frameworkprogramming Biotechnol. Nat. switches. ligands. specific bind 249 polymerase. DNA bacteriophage-T4 to ligands RNA enrichment: 91 vitro in (2007). evolution. directed with (1986). phage coli in recombinationhomologous of Rehrauer,W.M.Biochemistry 78 recombination. of study the for system model Salis, H.M., Mirsky, E.A. & Voigt, C.A. Automated design of synthetic of design Automated C.A. Voigt, & E.A. Mirsky, H.M., Salis, bilevel a Optknock: C.D. Maranas, P.& A.P.,Pharkya, Burgard, analysis? balance flux is B.O.What Palsson, & I. Thiele, J.D., Orth, molecular RNA precisionEngineering Breaker,R.R. & G.A. Soukup, J.W.Szostak, & A.D. Ellington, exponential by ligands of evolution Systematic L. Gold, & C. Tuerk, reassembly: and fragmentation random by Stemmer,W.P.shuffling DNA design circuits: geneSynthetic F.H. Arnold, & E.L. Haseltine, of system recombinationhomologous The C.M. Radding, & K. Muniyappa, & Lauder,S.D. A.K., Eggleston, D.A., Dixon, S.C., Kowalczykowski, Zhang, Y., Muyrers, J.P., Rientjes, J. & Stewart, A.F. Phage annealing PhageA.F. Stewart, & J. J.P.,Rientjes,Muyrers,Y., Zhang, Identification D.L. Court, & X. Zhou, N., Costantino, S., Datta, Carr,P.A. L. Eggeling, & M. Bott, J., Marienhagen, Siedler,S., Binder,S., transformation:a Yeast R.J. Rothstein, J.W.& Orr-Weaver,Szostak, T.L.,

| , 10747–10751 (1994). 10747–10751 , (1981). 6354–6358 , VOL.9 NO.10VOL.9 . , 505–510 (1990). 505–510 , Microbiol. Rev. Microbiol. λ recombination for molecular evolution. molecular for recombination . Pairing activities of activities Pairing . et al.et Proc. Natl. Acad. Sci. USA Sci. Acad. Natl. Proc. Enhanced multiplex genome engineering through co-operative

28

| 41 2014

Corynebacterium glutamicum Corynebacterium , 245–248 (2010). 245–248 , 58 BMC Mol. Biol. Mol. BMC , 6360–6369 (2013). 6360–6369 , Nature , 401–465 (1994). 401–465 , Annu. Rev. Biophys. Biomol. Struct. Biomol. Biophys.Rev. Annu. | natureprotocols

346 Nucleic Acids Res. Acids Nucleic β Biotechnol. Bioeng. Biotechnol. -protein. In vitro In , 818–822 (1990). 818–822 ,

4 96 , 1 (2003). 1 , , 3584–3589 (1999). 3584–3589 , selection of RNA molecules that molecules RNA of selection J. Biol. Chem. Biol. J. Proc. Natl. Acad. Sci. USA Sci. Acad. Natl. Proc. Proc. Natl. Acad. Sci. USA Sci. Acad. Natl. Proc.

combined with optical with combined 40 Proc. Natl. Acad. Sci. USA Sci. Acad. Natl. Proc.

84 , e132 (2012). e132 , , 647–657 (2003). 647–657 , Nat. Biotechnol. Nat.

261 Escherichia coli Escherichia

, 7472–7478 , 36

Escherichia , 1–19 ,

Science

105

27

,

, 41. 40. 39. 38. 37. 36. 35. 34. 33. 32. 31. 46. 45. 44. 43. 42.

of endogenous nucleases.endogenous of in engineeringgenome Red Improving engineering.genome mutants. repair mismatch in recombinants bacteria. evasion. repair mismatch via oligonucleotide-mediatedreplacement high-efficiency allelic recombineering. optimize to gained knowledge the using and recombination Res. Mutat. biosensor.optical by detected molecules DNA containing base alkylated prediction. engineering.genome enhance to dynamicsreplisome Manipulating Res. oligonucleotide-mediatedin recombination engineering. metabolic and biology synthetic for applicationsmethods genotyping E1. induction.colicin with 42 engineering.genome for marker dual-selectable Res. Acids Nucleic using recombineering BAC efficient highly and Simple 36 of operons rRNA theremodeling marker: 15748–15753 (2003). 15748–15753 DeVito, J.A. Recombineering with Recombineering J.A. DeVito, G.M. Church, & H.H. Wang, M.J., Lajoie, C.J., Gregg, J.A., Mosberg, A. Nyerges, Red–mediated of levels Enhanced D.L. Court, & N. Costantino, B.Swingle, enable bases Modified G. Church, & Vonner,A.J. G., Xu, H.H., Wang, J.A. Sawitzke, and mismatch with interaction MutSF.R. Jirik, & Andrew,S.E. I., Babic, hybridization and folding acid nucleic for server web Mfold Zuker,M. G.M. Church, & G.C. Washington, J.A., Mosberg, C.J., Gregg, M.J., Lajoie, X.T. Li, Wang, H.H. & Church, G.M. Multiplexed genome engineering and engineeringgenome Multiplexed G.M. Church, & H.H. Wang, colicin of characterization and Purification D.R. Helinski, & S.A. Schwartz, associated events of study Comparative D.R. Helinski, & H.R. Herschma, C.J. Gregg, N.G. Copeland, & N.A. Jenkins, D.L., Court, N., Costantino, S., Warming, , 4779–4790 (2014). 4779–4790 , (2008). e4 ,

J. Biol. Chem. Biol. J. 31 , 6674–6687 (2003). 6674–6687 , et al. et Mol. Microbiol. Mol.

Nucleic Acids Res. Acids Nucleic et al. et et al. et 372 et al. et Identification of factors influencing strand bias in bias strand influencing factors Identification of Methods Enzymol. Methods et al. et Nucleic Acids Res. Acids Nucleic , 87–96 (1996). 87–96 , J. Mol. Biol. Mol. J. Rational optimization of optimization Rational Oligonucleotide recombination in Gram-negative in Oligonucleotiderecombination

Conditional DNA repair mutants enable highly precise highly enable mutants repair DNA Conditional

33 246 Probing cellular processes with oligo-mediated with processes cellular Probing , e36 (2005). e36 , Nucleic Acids Res. Acids Nucleic Res. Acids Nucleic , 6318–6327 (1971). 6318–6327 , J. Bacteriol. J.

75 PLoS ONE PLoS , 138–148 (2010). 138–148 ,

407 31

498 , 3406–3415 (2003). 3406–3415 ,

, 45–59 (2011). 45–59 , 39 tolC

, 409–426 (2011). 409–426 , 94 7 , 7336–7347 (2011). 7336–7347 , , e44638 (2012). e44638 , as a selectable/counter-selectable a as , 691 (1967). 691 ,

Escherichia coli Escherichia 42 40 Escherichia coli Escherichia , e62 (2014). e62 , (2012). e170 , Proc. Natl. Acad. Sci. USA Sci. Acad. Natl. Proc. tolC Escherichia coli Escherichia λ as a powerful a as Red–mediated multiplex Red–mediated Nucleic Acids Res. Acids Nucleic via rational removalrational via galK . Nucleic Acids Res. Acids Nucleic . selection. Nucleic Acids Nucleic

100

,