Synergistic Antitumor Activity of Ixabepilone (BMS-247550)Plus Bevacizumab in Multiple in Vivo Tu M O R Mo D E L S Francis Y.F

Cancer Therapy: Preclinical

Synergistic Antitumor Activity of Ixabepilone (BMS-247550)Plus Bevacizumab in Multiple In vivo Tu m o r Mo d e l s Francis Y.F. Lee, Kelly L. Covello, Stephen Castaneda, Donald R. Hawken, David Kan, Anne Lewin, Mei-Li Wen, Rolf-Peter Ryseck, Craig R. Fairchild, Joseph Fargnoli, and Robert Kramer

Abstract Purpose: Angiogenesis is a critical step in the establishment, growth, and metastasis of solid tumors, and combination of antiangiogenic agents with chemotherapy is an attractive therapeutic option. We investigated the potential of ixabepilone, the first in a new class of antineoplastic agents known as epothilones, to synergize with antiangiogenic agents to inhibit tumor growth. Experimental Design: In vitro and in vivo cytotoxicity of ixabepilone as single agent and in combination with two targeted antiangiogenic agents, bevacizumab or sunitinib, were examined in preclinical tumor models. Direct effects of the agents against endothelial cells was also examined and compared with the effects of paclitaxel as single agent and in combination with bevacizumab. Results: Ixabepilone showed robust synergistic antitumor activity in combination with bevacizumab and sunitinib in preclinical in vivo models derived from breast, colon, lung, and kidney cancers.The synergistic antitumor effect was greater with ixabepilone compared with paclitaxel. Furthermore, ixabepilone was more effective than paclitaxel at killing endothelial cells expressing P-glycoprotein in vitro and inhibiting endothelial cell proliferation and tumor angiogenesis in vivo. Conclusions: Ixabepilone may enhance the antitumor effects of antiangiogenic therapy by direct cytotoxicity and also indirectly via the killing of tumor-associated endothelial cells. Given that ixabepilone has reduced susceptibility to drug efflux pumps compared with taxanes, these data may explain the increased antiangiogenic and antitumor activity of ixabepilone in combination with antiangiogenic agents. Phase II studies to assess the efficacy and safety of ixabepilone plus bevacizumab in locally recurrent or metastatic breast cancer are planned.

The epothilones and their analogues constitute a novel class multidrug resistance that limits the effectiveness of taxanes of antineoplastic agents derived from the myxobacterium and other chemotherapeutic agents. Sorangium cellulosum. Ixabepilone is the first epothilone B Ixabepilone is rationally designed for optimal in vivo efficacy, analogue in this new class, which potently bind and stabilize good metabolic stability, and low protein binding (5). microtubules in dividing tumor cells. These antimicrotubule Ixabepilone has broad antitumor activity in human preclinical agents act in a similar manner to taxanes by stabilizing models, with superior efficacy to taxanes in both taxane- microtubules, resulting in arrested tumor cell division and resistant and taxane-sensitive models (6). The clinical activity of apoptosis (1, 2). However, ixabepilone is structurally distinct ixabepilone has been shown in phase II trials in a broad range from the taxanes and therefore has unique properties. For of tumor types, including primary (7)and locally advanced or example, unlike the taxanes, which induce apoptosis via metastatic breast cancer (8), multidrug-resistant breast tumors activation of caspase 9, ixabepilone affects multiple apoptotic (9), metastatic or recurrent pancreatic cancer (10), prostate pathways via caspase 2 and p53-mediated activation of Bax cancer (11, 12), lymphoma (13, 14), non–small cell lung (3, 4). Importantly, ixabepilone has distinct tubulin-binding cancer (15), and renal cell cancer (16, 17). In addition, a recent sites and reduced susceptibility to the drug efflux transporter study to identify markers that predict response to ixabepilone P-glycoprotein (P-gp), which is frequently associated with in breast cancer has shown promising efficacy in the neo- adjuvant setting (7). Ixabepilone was efficacious in phase II trials of patients with metastatic breast cancer who failed frontline taxane-containing regimens (8, 18). A phase III study of ixabepilone in combination with capecitabine showed Authors’ Affiliation: Bristol-Myers Squibb Pharmaceutical Research Institute, improved efficacy versus capecitabine monotherapy with Princeton, NewJersey significant prolongation of median progression-free survival Received 1/3/08; revised 8/18/08; accepted 8/20/08. The costs of publication of this article were defrayed in part by the payment of page (5.8 versus 4.2 months; P < 0.001)and increased response rate charges. This article must therefore be hereby marked advertisement in accordance (35% versus 14%; P < 0.001; ref. 19). The activity seen in these with 18 U.S.C. Section 1734 solely to indicate this fact. patients is due, at least in part, to the reduced susceptibility Requests for reprints: Francis Y.F. Lee, Bristol-Myers Squibb Company, PO Box of ixabepilone to several key tumor resistance mechanisms 4000, K22-03, Princeton, NJ 08543. Phone: 609-252-3279; Fax: 609-252-6051; E-mail: [email protected]. (6, 19, 20). For many patients, intrinsic and acquired tumor F 2008 American Association for Cancer Research. resistance, e.g., through overexpression of efflux pump proteins doi:10.1158/1078-0432.CCR-08-0025 such as P-gp (21, 22)or alternative tubulin isoforms (23, 24),

www.aacrjournals.org 8123 Clin Cancer Res 2008;14(24)December 15, 2008 Downloaded from clincancerres.aacrjournals.org on September 30, 2021. © 2008 American Association for Cancer Research. Cancer Therapy: Preclinical

Materials and Methods Translational Relevance The experimental data presented in this article show Study drugs and reagents. Ixabepilone and paclitaxel were synthe- synergistic antitumor activity of ixabepilone, a microtubule sized in the Oncology Chemistry Department of Bristol-Myers Squibb inhibitor, and two antiangiogenic agents, bevacizumab and Pharmaceutical Research Institute. Clinical vials of bevacizumab, sunitinib, in a number of preclinical models. Moreover, sunitinib, and cisplatin were purchased. Sterile tissue cultures were ixabepilone showed potent activity against endothelial obtained from Corning. Unless specified, chemicals and solutions used cells, indicating that antiangiogenic activity of ixabepilone to maintain cell cultures were obtained from Life Technologies, Inc. All other reagents were obtained from Sigma Company at the highest grade may form a basis for the observed synergy with agents available. such as bevacizumab.The results suggest that ixabepilone, Cell lines and in vitro cytotoxic assays. In vitro cytotoxicity was in combination with bevacizumab and/or sunitinib, may assessed in a panel of cells (including tumor cells and primary provide efficacious regimens that maximize the antian- endothelial cells)by a tetrazolium-based colorimetric assay, which giogenic and cytotoxic effects of the individual agents. takes advantage of the metabolic conversion of 3-(4,5-dimethylthiazol- The potential utility of these combination regimens is 2-yl)-5-(3-carboxymethoxyphenyl)-2-[4-sulphenyl]-2H-tetrazolium particularly relevant to patients with drug resistant disease (MTS; inner salt)to a reduced form that absorbs light at 492 nm as ixabepilone has shown efficacy in tumors with overex- (31). Cells were seeded 24 h before drug addition. After a 72-h pression of drug efflux transporters and/or hIII-tubulin incubation at 37jC with serially diluted compound, MTS was added to isotype, two mechanisms that have been implicated in the cells, in combination with the electron-coupling agent phenazine development of resistance to commonly used chemothera- methosulfate. The incubation was continued for 3 h, after which the absorbance of the medium at 492 nm was measured with a peutic agents. spectrophotometer to obtain the number of surviving cells relative to control populations. The in vitro cytotoxicity of ixabepilone and paclitaxel was evaluated are major obstacles to successful cancer treatment. Ixabepilone in primary endothelial and established tumor cell lines of diverse histologic type by determining the concentration of drug required to could offer improved efficacy against drug-resistant tumors due kill 50% (IC50)of the cells. Aortic bovine endothelial cells (ABAE)were to its noncross resistance with other antineoplastic agents. used to investigate the cytotoxic activity of ixabepilone against Combination chemotherapy is the mainstay of current cancer endothelial cells in vitro. The tumor cell lines used in this study were treatment options. It is well-known that combining regimens as follows: human prostate (LNCAP and PC3); human squamous with nonoverlapping mechanisms of action and toxicity carcinoma (A431); human breast (MCF7, SKBR-3); human colon profiles can produce a synergistic effect. Ixabepilone has shown [parental HCT116, HCT116/VM46 (MDR1-expressing), HCT116/VP35 combinability with previously approved agents. Ixabepilone in (etoposide-resistant, CACO-2, macrophage inflammatory protein, combination with capecitabine showed synergistic antitumor LS147T)]; human ovarian [A2780/DDP-S (parental), A2780/DDP-R activity in patients with metastatic breast cancer pretreated with (cisplatin-resistant), A2780/Tax-S (parental), A2780/Tax-R (paclitaxel- taxanes and anthracyclines in phase I/II trials (25), leading to resistant due to tubulin mutation), OVCAR-3]; human lung (A549, phase II and III trials of this combination. LX-1); human leukemia (CCRF-CEM, HL60, K562); human foreskin fibroblast (HS27); mouse lung fibroblast; and mouse lung carcinoma Angiogenesis is a critical step in the establishment, growth, (M109). All of the cell lines used in this study were purchased from and metastasis of solid tumors by providing tumor cells with American Type Culture Collection except for the paclitaxel-resistant essential oxygen, nutrients, and growth factors required for lines that were developed and described previously (6). sustained growth and metastasis, and inhibition of tumor Antitumor in vivo models. Antitumor activity was evaluated in angiogenesis is a potential means of retarding tumor growth. human xenograft models, including colon (GEO, WiDr, HCT116/ In these studies, we determined if the robust antitumor activity VM46), breast (Pat-21 and KPL4), lung (L2987), and renal (151b) of ixabepilone could enhance approved targeted antiangio- carcinoma models. S.c. xenografts were purchased from American Type genic therapy. Bevacizumab (Avastin; Genentech)is an Culture Collection with the exception of Pat-21, which was derived antiangiogenic monoclonal antibody that inhibits vascular from a patient who failed paclitaxel, and was obtained from the Cancer endothelial growth factor (VEGF; ref. 26). VEGF promotes Institute of New Jersey. The human tumors were maintained in female BALB/c, nu/nu nude, or Beige-severe combined immunodeficient growth of vascular endothelial cells in vitro, as well as potent mice. 16/C and 16C/ADR tumors were maintained in C3H mice. All angiogenic responses in many in vivo models (27). Bevacizu- mice were purchased from Harlan Sprague-Dawley. Tumors were mab has been approved for treatment of metastatic colorectal propagated as s.c. transplants in the appropriate mouse strain using cancer by the US Food and Drug Administration (first and tumor fragments taken from donor mice. Eight female mice were used second line)and the European Medicines Association (first for each experimental test condition. line)in combination with 5-fluorouracil. Recent phase II/III Compounds were administered and evaluated at the maximum trials in metastatic breast cancer and non–small cell lung tolerated dose (MTD), which is defined as the dose level immediately cancer showed that the addition of bevacizumab to paclitaxel- below which excessive toxicity (i.e., more than one death)occurred. containing regimens improved outcomes while maintaining The MTDs in this study were determined to be as follows: ixabepilone tolerability (28, 29). Moreover, several studies have shown (6 mg/kg i.v. every 4 d for 3 doses), bevacizumab (4 mg/kg i.p. every 4 d for 3 doses), paclitaxel (24 mg/kg i.v. every other day for 5 doses), and that antimicrotubule agents can have direct antiangiogenic sunitinib (40 mg/kg i.v. every day for 14 doses). The compounds were effects, in addition to antitumor activity (30). These encour- evaluated for tumor response as single agent therapy or in combination aging results, coupled with the complementary mechanisms to assess synergy. of action of bevacizumab and ixabepilone, provided a strong, Tumor response was determined by measurement of tumors with a specific, biological rationale for further investigation of these caliper twice a week, until the tumors reached a predetermined ‘‘target’’ agents in combination. size. Tumor weights (mg)were estimated from the formula:

ClinCancerRes2008;14(24)December15,2008 8124 www.aacrjournals.org Downloaded from clincancerres.aacrjournals.org on September 30, 2021. © 2008 American Association for Cancer Research. Synergistic AntitumorActivity: Ixabepilone and Bevacizumab

Tumor weight ¼ðlength Â width2ÞÄ2ð6Þ Biosystems)using SYBR green–based detection (Eurogentec).Sequences for oligonucleotides used in quantitative PCR were MDR1: GGGACA- GAAAGCTCAGTTC AGAA, ACTGAGAATGCTGGTTGCAGAG and Tumor response end points were reported in terms of tumor volume GAPDH: AGCCGAGCCACATCGCT, GTGACCAGGCGCCCAATAC. change [i.e., partial regression, 50% tumor volume reduction; or Relative quantities of cDNA were determined using DDCt analysis. complete regression = disappearance of measurable tumor] and in Samples were normalized to glyceraldehyde-3-phosphate dehydroge- terms of delay of tumor growth or progression (T-C value), which is nase unless otherwise stated. defined as the difference in time (days)required for the treated tumors Immunocytochemistry of ABAE cells. ABAE cells in 24-well plates (T)to reach a predetermined target size compared with those of the were fixed in methanol for 10 min, blocked with 0.3% hydrogen control group (C). Because different tumor types can have vastly peroxide in PBS, and rinsed with IHC Wash buffer (Dako). Cells were different exponential growth rates, delays in tumor growth were incubated at room temperature with primary anti P-gp antibody (rabbit ‘‘normalized’’ by converting them to gross log cell kill values (LCK), polyclonal SC-8313; Santa Cruz Biotechnology)diluted 1:100 in which was accomplished by dividing the T-C value by the tumor blocking solution (Dako)for 1 h, then with biotinylated anti-rabbit volume doubling time multiplied by the exponential function 3.32 secondary antibody (BA1000; Vector Laboratories), diluted 1:200 in [i.e., T-C value/(tumor volume doubling time) Â 3.32]. Compounds PBS, for 30 min. Cells were then rinsed and incubated with avidin- were considered active and tumor models were deemed sensitive if the biotin complex (ABC Elite; Vector Labs)for 30 min at room LCK was >1. Conversely, if the LCK value was <1, compounds were temperature. The chromagen 3,3¶-diaminobenzidine (Biocare Medical) considered inactive and tumor models deemed resistant. was used to visualize the staining. All image analyses in this study Potential drug toxicity interaction affecting treatment tolerability is used a 5CCD camera attached to an Olympus BX-60 microscope and an important consideration in combination chemotherapy trials. Image-Pro Plus software. Therefore, interpretation of combination therapeutic results must be Matrigel plug assays. The in vivo effects of each drug on based on comparison of antitumor activity of the best possible response angiogenesis were analyzed in mice using a VEGF/basic fibroblast for the single agents versus the combination at comparably tolerated growth factor–driven endothelial cell infiltration and proliferation doses. Therefore, therapeutic synergism was defined as a therapeutic Matrigel (BD Biosciences)plug assay. Matrigel was mixed with effect achieved with a tolerated regimen of the combined agents that 75 ng/mL VEGF (recombinant human VEGF165; PeproTech, Inc.)and exceeded the optimal effect achieved at any tolerated dose of 200 ng/mL basic fibroblast growth factor (recombinant human basic monotherapy (32–34). Statistical evaluations of data were done using fibroblast growth factor; Peprotech, Inc.). Because cisplatin belongs Gehan’s generalized Wilcoxon test, and P values of <0.05 were to a class of drugs with a different mechanism of action than taxanes considered statistically significant (35). and epothilones, its antiangiogenic activity was also evaluated in this Determination of MDR1 mRNA levels by quantitative PCR. Bovine model. LX1-0 tumor fragments with Matrigel were implanted s.c. into tissue RNAs were obtained commercially (Rockland Immunochem- nude mice on day 0 (n = 8 for each experimental condition). Effects icals). Total RNA for other samples was isolated directly from cells using were assessed at various dose levels up to the MTD for each agent. the RNeasy system (Qiagen). cDNA templates for real-time PCR were Ixabepilone was administered i.v. at 6.3, 3.15, 1.58, or 0.79 mg/kg generated using a SuperScript First-Strand Synthesis kit (Invitrogen). every 4 d for 3 doses. Paclitaxel was administered i.v. at 36, 18, 9.0, or Real-time PCR was done on a 7900HT real-time PCR machine (Applied 4.5 mg/kg every other day for 5 doses. Cisplatin was administered i.p.

Table 1. Ixabepilone synergizes with bevacizumab and sunitinib

Tumor types Ixabepilone* Bevacizumabc Combinationb Antitumor activityx LCK PR (%)CR (%)LCK PR (%)CR (%) LCK PR (%)CR (%)

Lung k L2987 3 38 0 2 0 0 >5.9 88 50 Breast { KPL4 0.5 29 0 2.2 58 14 >3.2 100 86 k Pat-21 1.6 88 25 0.3 0 0 2.3 100 63 Kidney k 151b 0.5 0 0 0.6 10 10 1.5 30 20 Colon k GEO 0.4 0 0 1.1 0 0 5.1 00 k WiDr 1.9 38 0 0.2 0 0 >2.2 100 63 k HCT116/VM46 1.2 25 13 0.6 0 0 2.6 88 25 Ixabepilone* Sunitinib** Combinationb Kidney k 151b 0.6 0 0 0.5 10 10 1.33 20 20

Abbreviations: PR, partial regression; CR, complete regression. *MTD of 6 mg/kg, i.v., every 4 d for 3 doses. cOptimal dose, 4 mg/kg, i.p. every 4 d for 3 doses. bSynergy is statistically superior efficacy shown in combination compared with single agents alone. xAntitumor activity is reported as LCK, a value that is proportional to the delay of tumor growth to a predetermined target tumor size (1000 mg for GEO and 500 mg for KPL4, Pat-21, 151b, WiDR and HCTVM46); LCK>1 is active. k P < 0.01. { P < 0.05. **MTD, 40 mg/kg, PO every day for 14 doses.

www.aacrjournals.org 8125 Clin Cancer Res 2008;14(24)December 15, 2008 Downloaded from clincancerres.aacrjournals.org on September 30, 2021. © 2008 American Association for Cancer Research. Cancer Therapy: Preclinical at 8.0, 4.0, or 2.0 mg/kg every 4 d for 3 doses. After 30 d, or when the combination of ixabepilone and bevacizumab resulted in 3 tumor reached 1,000 mm , Matrigel plugs were fixed overnight in 10% significantly greater antitumor activity compared with the neutral-buffered formalin. Plugs were paraffin-embedded, sectioned at single agents (Table 1). Of interest, synergy was observed A 5 m, and stained with H&E. regardless of the tumor model sensitivity or resistance to the Migrating endothelial cell counts and images were obtained for single-agent therapy of ixabepilone or bevacizumab. The L2987 50 fields per mouse. Antiangiogenic efficacy of each dose was expressed as the percentage of inhibition relative to untreated control. Student’s lung model was sensitive to both ixabepilone and bevacizumab t tests to detect differences between means were done using SAS JMP single-agent therapy (Table 1). The 151b renal model was software. resistant to both ixabepilone and bevacizumab alone (Table 1). Immunohistochemistry. The following antibodies were used for The Pat-21 breast, GEO, WiDr, and HCT/VM46 colon models immunohistochemistry: MDR (goat polyclonal SC-1517; Santa Cruz were sensitive to ixabepilone but resistant to bevacizumab Biotechnology), von Willebrand Factor (goat polyclonal SC-8068; Santa (Table 1). The KPL4 breast model was resistant to ixabepilone Cruz Biotechnology), and CD34 (rat monoclonal 553731; Pharmin- but sensitive to bevacizumab (Table 1). However, in all of these gen). Excised tumors were fixed, paraffin-embedded, and sectioned to models, the combination of ixabepilone and bevacizumab A 5 m. After blocking, heat-induced antigen retrieval was done using a resulted in greater antitumor effects and synergy. It is interesting Biocare Neducak decloaking chamber and Citra Plus (BioGenex) to note that the improved antitumor activity of the combina- solution at 95jC. Sections were incubated overnight at 4jC with Factor VIII primary antibody (SC-8068; Santa Cruz Biotechnology)diluted tion applied to both the growth delay (LCK)and tumor volume 1:100 in blocking solution, then incubated with biotinylated anti-goat reduction measures (Table 1). secondary antibody (BA5000; Vector Laboratories), diluted 1:200 in Ixabepilone synergizes withantiangiogenic therapysunitinib PBS for 30 min at room temperature. Sections were rinsed and (Sutent) in vivo. We next wanted to determine if ixabepilone incubated with avidin-biotin complex for 30 min at room temperature, enhancement of antitumor activity was specific to the and vascular staining were visualized with 3,3¶-diaminobenzidine. monoclonal antibody bevacizumab or if ixabepilone could Sections were counterstained with Gill 2 hematoxylin and dehydrated enhance the antitumor effects of other antiangiogenic therapy, through graded ethanol to xylene. Image analysis was done for 50 fields including the small molecular inhibitor sunitinib (Sutent; per slide. Pfizer). The ability of these agents to synergize was assessed in the 151b renal lung carcinoma model. Both single-agent Results ixabepilone and sunitinib were inactive in delaying tumor growth in this model, with respective LCK values of 0.6 and 0.5 Ixabepilone synergizes withantiangiogenic therapybevacizumab (Table 1; Fig. 1B). However, the combination of ixabepilone (Avastin) in vivo. The ability of ixabepilone to synergize with bevacizumab in vivo was assessed in a range of human tumor xenograft models, including colon, breast, lung, and renal carcinoma models. Compounds were always evaluated at a range of doses including the MTD and/or optimal dose as single-agent therapy and in combination. Activity was assessed as tumor growth delay quantified as LCK value. For LCK values of >1, compounds were considered active and tumor models were deemed sensitive. Conversely, for LCK values of <1, compounds were considered inactive and tumor models resistant. Synergism was defined as the combination treatment attaining statistically significant better antitumor activity than the best response attained by the single agent administered at its MTD or optimal dose. Among the 7 tumors tested, single-agent ixabepilone was active in terms of LCK in 4 of 7 models, whereas bevacizumab was active in 3 of 7 (Table 1). Ixabepilone achieved more tumor regression (6 of 7)than bevacizumab (2 of 7).In the L2987 lung carcinoma model, single-agent ixabepilone and bevacizumab were active with LCK values of 3 (P = 0.005)and 2 (P = 0.002), respectively (Table 1; Fig. 1A). However, the combination of ixabepilone with bevacizumab resulted in even greater antitumor activity (LCK > 5.9)and, most impressively, resulted in cures, which was defined as the absence of any tumor over a period of 10 tumor volume doublings (Fig. 1A). The combination was significantly more effective than single agent ixabepilone (P = 0.003)and bevacizumab (P = 0.0008) alone, thus demonstrating synergy between the two agents (Table 1; Fig. 1A). The ability of ixabepilone to synergize with bevacizumab was then tested in six other tumor models, including the KPL4 Fig. 1. Synergistic antitumor efficacy by combined chemotherapy with ixabepilone plus the antiangiogenic agent bevacizumab in the L2987 lung model (A)orplus breast, Pat-21 breast, GEO colon, WiDr colon, HCT116/VM46 sunitinibinthe151brenalmodel(B). BEV, bevacizumab; IXA, ixabepilone; SUT: colon, and 151b renal carcinoma models. In all 6 models, the sunitinib.

ClinCancerRes2008;14(24)December15,2008 8126 www.aacrjournals.org Downloaded from clincancerres.aacrjournals.org on September 30, 2021. © 2008 American Association for Cancer Research. Synergistic AntitumorActivity: Ixabepilone and Bevacizumab

Fig. 2. Compared with paclitaxel, ixabepilone is more cytotoxic to endothelial cells in vitro and in vivo. In vitro cytotoxicity (measured by IC50) of ixabepilone (A)and paclitaxel (B) against tumor and normal cell lines. Note that different scales have been used for the ixabepilone and paclitaxel graphs to accommodate all IC50 values. C and D, in vivo antiangiogenic activity of ixabepilone, paclitaxel, and cisplatin in theVEGF/basic fibroblast growth factor ^ driven endothelial cell infiltration and proliferation Matrigel plug assay in mice represented graphically and by immunohistochemical staining. Paclitaxel was administered i.v. every other day for 5 doses and ixabepilone and cisplatin were administered every 4 d for 3 doses at a range of doses up to and including the MTD. MTDs for ixabepilone, paclitaxel, and cisplatin were 6.3, 36, and 8 mg/kg, respectively. Magnification, Â10 0. E and F, effects of ixabepilone and paclitaxel, alone and in combination with bevacizumab on tumor vascular density with representative microscopy images. Magnification, Â200. MTDs for ixabepilone and paclitaxel were 6.3 and 36 mg/kg, respectively. Columns, mean; bars, SD. CPT, cisplatin; PTX, paclitaxel; *, P < 0.05; **, P < 0.01; ***, P < 0.001. with sunitinib resulted in significant tumor delay (LCK 1.33). directly affecting the endothelial cells. In vitro MTS cytotoxic The combination of ixabepilone and sunitinib was significantly assays were conducted to assess the cytotoxic effects of more effective than single-agent ixabepilone (P = 0.003)and ixabepilone against tumor cell lines of various origin as well bevacizumab (P = 0.002)alone, thus demonstrating synergy as primary cell lines, including ABAE. Ixabepilone showed between the two agents (Table 1; Fig. 1B). Taken together, potent cytotoxic activity in a wide variety of tumor cell lines these data suggest that ixabepilone can enhance the ability of in vitro with IC50 values of 1.3 to 42 nmol/L (Fig. 2A). 2 antiangiogenic therapies to inhibit tumor progression in vivo. Ixabepilone was extremely cytotoxic to primary endothelial Ixabepilone is directly cytotoxic to endothelial cells in vitro and cell lines (IC50, 4.5 nmol/L; Fig. 2A). Given the distinct in vivo. Several studies have shown that antimicrotubule differences between ixabepilone and paclitaxel that have agents can have direct antiangiogenic effects in addition to been described previously, a head to head comparison of the antitumor activity (30). We next addressed potential mecha- compounds were done. Of interest, ABAEs were 3-fold more nisms of synergy between ixabepilone and antiangiogenic sensitive to ixabepilone (IC50, 4.5 nmol/L)than to paclitaxel therapy and did experiments to determine if ixabepilone was (IC50, 12.9 nmol/L; Fig. 2B).

www.aacrjournals.org 8127 Clin Cancer Res 2008;14(24)December 15, 2008 Downloaded from clincancerres.aacrjournals.org on September 30, 2021. © 2008 American Association for Cancer Research. Cancer Therapy: Preclinical

The direct effect of ixabepilone on endothelial cells was If so, this could provide a potential explanation of why tested in vivo. In these experiments, Matrigel plugs supple- ixabepilone showed superior effects compared with paclitaxel mented with VEGF/FGF were implanted s.c. into mice. Animals as paclitaxel is more susceptible to these drug efflux pumps. were treated with ixabepilone, paclitaxel, or cisplatin at their In vitro, endothelial cells express high levels of MDR1 mRNA, respective MTD and proportional fractions (1/2, 1/4, and 1/8) which encodes for P-gp as determined by quantitative real-time of each MTD. After 30 days of allowing host endothelial cells PCR (Fig. 3A), and they also express P-gp protein as shown to migrate, proliferate, and form vascular-like tubes within the by immunocytochemistry (Fig. 3B). Importantly, we confirmed Matrigel, the plugs were collected and stained to visualize the this in tumor-associated endothelial cells in vivo. P-gp was surviving endothelial cells after treatment with ixabepilone or expressed on endothelial cells of tumor-associated vessels in the paclitaxel. There was a marked reduction (up to 85%)in the L2987 lung tumor model (Fig. 3C). Taken together, these data number of endothelial cells that migrated into and survived suggest that the reduced susceptibility of ixabepilone to P-gp– within the Matrigel plugs from mice treated with ixabepilone mediated efflux could allow ixabepilone to show better activity (Fig. 2C and D). The reduction in endothelial cell number was against endothelial cells compared with paclitaxel. dose dependent and still exhibited f60% less endothelial cells Compared withpaclitaxel, ixabepilone produces greater thera- at a relatively low dose (1/8 of the MTD), suggesting that peutic synergism withbevacizumab. Thus far, our data suggested ixabepilone does exhibit antiangiogenic effects (Fig. 2C and D). that ixabepilone was able to synergize with antiangiogenic Furthermore, ixabepilone was significantly more active than paclitaxel at inhibiting endothelial cell infiltration and proliferation in this assay. At 1/8 of the MTD, compared with ixabepilone, which led to 57% reduction in endothelial cells, paclitaxel treatment only caused 27% reduction of endothelial cells (P < 0.0001; Fig. 2C and D). The unrelated heavy metal alkylating–like chemotherapy agent cisplatin was used as a negative control and was significantly less effective at inhibiting endothelial cell infiltration and proliferation than either ixabepilone or paclitaxel at all dose levels evaluated (Fig. 2C and D). Taken together with the cytotoxic in vitro assays, these data suggest that ixabepilone has some intrinsic antiangiogenic activity and can potently and directly affect the endothelial cells. Combination of ixabepilone withbevacizumab results in reduced tumor vessel density. Next, we examined if ixabepilone alone and in combination with bevacizumab showed inhibitory effects on endothelial cells and tumor vessel density in the context of a tumor. Immunohistochemistry using von Wille- brand Factor to stain tumor-associated endothelial cells was done on size-matched GEO colon carcinoma tumors treated with bevacizumab, ixabepilone, or the combination of the two agents. Both ixabepilone and bevacizumab as single agents decreased the overall tumor vascular density f50% compared with untreated controls (P < 0.05; Fig. 2E and F). This supports the in vitro finding that ixabepilone was cytotoxic to ABAE cells, and further suggests that ixabepilone may have intrinsic antiangiogenic effects in tumors. Moreover, ixabepilone combined with bevacizumab produced an f75% reduction in tumor vessel density that was significantly greater than either single-agent ixabepilone or bevacizumab (P < 0.05; Fig. 2E and F). Unlike ixabepilone, paclitaxel at its MTD did not significantly reduce vessel density (P = 0.61). Furthermore, the combination of ixabepilone and bevacizumab had a much more inhibitory effect (f75%)on tumor vessel density compared with the combination of paclitaxel and bevacizumab (f15%; P < 0.001; Fig. 2E and F). Ixabepilone may be more effective against endothelial cells due to expression of P-gp. A number of studies suggest that endothelial cells express P-gp and multidrug resistance protein Fig. 3. Tumor-associated endothelial cells express P-gp. A, MDR1gene expression (36–42). Because ixabepilone has reduced susceptibility to levels in ABAE cells and bovine tissues as determined by quantitative real-time PCR. ABAE cells expressed high levels of MDR1mRNA relative to other bovine tissues. drug transporters frequently associated with multidrug resis- Data were normalized to total input of RNA and expressed as the total amount of tance to taxanes and other chemotherapy, we next investigated mRNA; MDR1, multidrug resistant protein 1; B, P-gp protein expression in ABAE cells, as assessed by immunocytochemistry. Magnification, Â100. if the models in which ixabepilone exhibited antiangiogenic C, immunohistochemical staining of P-gp protein in tumor-associated blood vessel activity also expressed drug efflux pump proteins such as P-gp. endothelial cells in the L2987 lung carcinoma model. Magnification, Â200.

ClinCancerRes2008;14(24)December15,2008 8128 www.aacrjournals.org Downloaded from clincancerres.aacrjournals.org on September 30, 2021. © 2008 American Association for Cancer Research. Synergistic AntitumorActivity: Ixabepilone and Bevacizumab

Table 2. Ixabepilone produces greater therapeutic synergism with bevacizumab compared with paclitaxel

Treatment Antitumor activity. LCK (PR)[CR] * Ixabepilonec Bevacizumabb Paclitaxelx Ixa + bev combinationk PTX + bev combinationk

Colon { { GEO 0.4 (25) [25] 1.1 (0) [0] 0.9 (0) [0] 5.1 (0) [0] 2.3 (0) [0] { HCT116/VM46 1.2 (25) [13] 0.6 (0) [0] 0.4 (13) [0] 2.6 (88) [25] 0.8 (13) [0]

Abbreviations: Ixa, ixabepilone; bev, bevacizumab; PTX, paclitaxel. *Antitumor activity is reported as LCK, a value that is proportional to the delay of tumor growth to a predetermined target. cMTD of 6 mg/kg, i.v., every 4 d for 3 doses. bOptimal dose, 4 mg/kg, i.p. every 4 d for 3 doses. xMTD, 24 mg/kg, i.v. every other d for 5 doses. kSynergy is statistically superior efficacy shown in combination compared with single agents alone. {P < 0.01.

therapy potentially due to its ability to affect the endothelial ixabepilone in combination with bevacizumab was shown cells directly. Compared with paclitaxel, ixabepilone showed in six different tumor xenograft models in this study, which greater activity against endothelial cells in all assays tested, so strongly supports the rationale to test combinations in clinical we compared the ability of ixabepilone and paclitaxel to trials. synergize with the antiangiogenic therapy bevacizumab in the There are many possible reasons for the synergy seen between GEO colon carcinoma model. In this model, bevacizumab was ixabepilone and bevacizumab. It is possible that bevacizumab not active (LCK, 0.4)and both ixabepilone and paclitaxel were is able to normalize tumor vasculature, increasing delivery of moderately active with LCK values of 1.1 and 0.9, respectively coadministered drugs. This is based on the hypothesis that (Table 2; Fig. 4). In support of previous clinical findings tumoral interstitial hypertension caused by irregular and leaky (28, 29), the combination of paclitaxel with bevacizumab did vasculature can limit drug delivery (44). It is possible that result in synergy compared with paclitaxel (P = 0.002)or normalization of tumor vasculature allows bevacizumab to bevacizumab (P = 0.002)alone. However, the effects of reduce tumoral interstitial hypertension enough to increase the paclitaxel and bevacizumab (LCK, 2.3)on tumor growth delay penetration of ixabepilone. An alternative (but not mutually were not nearly as great as the combination of ixabepilone exclusive)explanation is that ixabepilone complements the with bevacizumab (LCK, 5.1; Table 2; Fig. 4). The combination antiangiogenic activity of bevacizumab by killing both endo- of ixabepilone with bevacizumab was statistically superior to thelial and tumor cells directly possibly by interfering with paclitaxel with bevacizumab (P = 0.004). endothelial cell migration and invasion. Ixabepilone, therefore, A similar comparison was done in the multidrug-resistant might enhance the effects of bevacizumab, not only through its HCT116/VM46 colon carcinoma model. Again, the combina- complementary antitumor activity, but also through direct tion of ixabepilone plus bevacizumab (LCK, 2.6)had greater antiangiogenic effects on tumor-associated endothelial cells, antitumor activity than bevacizumab (LCK, 0.6)or ixabepilone which is consistent with the data presented in this report. alone (LCK, 1.2; Table 1). Conversely, the combination of Ixabepilone showed robust cytotoxic activity in a wide range of paclitaxel and bevacizumab (LCK, 0.8)had only a modest effect tumor cell lines in vitro but was also cytotoxic to endothelial on tumor growth compared with either agent alone, and was cells in this assay. Our in vitro observations are supported by significantly less effective (P = 0.004)compared with the in vivo data demonstrating significant reduction in endothelial ixabepilone and bevacizumab combination (LCK, 2.6; Table 2). cell infiltration and proliferation. The precedent for the antiangiogenic effect of a tubulin-targeting agent was set in a study Discussion

Angiogenesis is a critical step in the establishment, growth, and metastasis of solid tumors. Inhibition of angiogenesis with the biological agent bevacizumab in combination with chemotherapy is now approved for the treatment of metastatic colon cancer. Bevacizumab has shown preliminary clinical efficacy in breast, pancreatic, non–small cell lung cancer, pancreatic, renal, and head-and-neck cancers (43). Develop- ment of combination regimens with bevacizumab could enhance antitumor activity in a wide range of tumor types; this has been seen in recent clinical studies in which the outcomes of metastatic breast cancer and non–small cell lung cancer patients were improved by the addition of bevacizumab to paclitaxel-containing regimens (28, 29). The primary goal of our study was to test the ability of ixabepilone to synergize Fig. 4. Synergistic antitumor efficacy by combined chemotherapy with with bevacizumab. Robust synergistic antitumor activity of bevacizumab plus ixabepilone or paclitaxel in the colon carcinoma model GEO.

www.aacrjournals.org 8129 Clin Cancer Res 2008;14(24)December 15, 2008 Downloaded from clincancerres.aacrjournals.org on September 30, 2021. © 2008 American Association for Cancer Research. Cancer Therapy: Preclinical conducted by Pasquier and colleagues that showed the ability expression may contribute to the synergistic interaction of paclitaxel to inhibit endothelial cell proliferation through between paclitaxel and bevacizumab. It is not known whether G2-M arrest and apoptosis, as seen in tumor cells (45). A more ixabepilone also induces VEGF expression and if it does, recent study found that the antimicrotubule agents docetaxel, whether to a greater or lesser extent in comparison with epothilone B, and vinblastine significantly inhibited endothe- paclitaxel. Both paclitaxel and ixabepilone cause apoptosiss, lial cell migration, invasion, and tube formation, which during which reactive oxygen species are generated (48). reduced Rho GTPase activity and disturbances in the actin However the two agents differ in the pathway of apoptosis cytoskeleton (30). Our findings suggest that ixabepilone also induction—paclitaxel induces apoptosis through up-regulation has direct antiangiogenic activity, and that this activity is greater of caspase-9 activity and Bax (3), whereas ixabepilone affects than that seen with paclitaxel. multiple apoptotic pathways (4), including enhancement of It is noteworthy that bevacizumab had greater in vivo caspase-2 activity and causes p53 to activate the death effector antitumor activity in combination with ixabepilone than Bax through induction of expression of the BH3-only protein with paclitaxel in the two tumor models tested—GEO and PUMA (4). Based on these differences, the abilities of the two HCT116/VM46. The increased in vivo antitumor activity of agents to induce reactive oxygen species may also differ the bevacizumab-ixabepilone combination could be due to the resulting in varying extent of positive interaction with higher antiangiogenic activity of ixabepilone both in vitro and bevacizumab. Further evaluation of this mechanism is clearly in vivo compared with paclitaxel. Therefore, any direct effects warranted, as this has important implications for identifying on tumor-associated endothelial cells might have been greater the optimal cytotoxic combination partner for bevacizumab with the ixabepilone-containing combination. Additionally, therapy. the reduced susceptibility of ixabepilone to drug efflux pumps In summary, the data presented here support the rationale such as P-gp (19)could have allowed higher concentrations for combining ixabepilone and bevacizumab when adminis- of ixabepilone than paclitaxel to be maintained in the tumor tered at MTD. Clinical studies of this combination, including cells (e.g., MDR HCT116/VM46 model)and tumor-associated trials in drug-resistant populations, are warranted. A phase II endothelial cells (e.g., HCT116/VM46 and non-MDR GEO efficacy and safety study of ixabepilone plus bevacizumab models). P-gp and other drug efflux proteins are expressed on a versus paclitaxel plus bevacizumab as first-line therapy for wide range of tumors (21, 22), and a number of studies have locally recurrent or metastatic breast cancer is currently identified expression of P-gp and multidrug resistance protein recruiting patients.1 by tumor-associated vasculature (36–42). Consistent with other preclinical findings, our immunohistochemistry data suggest that P-gp is expressed on tumor vasculature associated 1A trial of 2 schedules of ixabepilone plus bevacizumab and paclitaxel plus with the human GEO xenograft used in this study (46). Thus, bevacizumab for breast cancer. Available at: http://clinicaltrials.gov/show/ NCT00370552. Accessed September12, 2008. the higher antiangiogenic activity of ixabepilone coupled with the expression of drug efflux proteins by tumors and their Disclosure of Potential Conflicts of Interest associated vasculature could contribute to an explanation of the greater antitumor efficacy of the ixabepilone plus bevacizumab All authors, Bristol-Myers Squibb, employees. C. R. Fairchild, Bristol-Myers combination. Squibb, ownership interest. Previous studies have shown that paclitaxel treatment can induce expression of VEGF in tumor cells in vitro through production of reactive oxygen species (47). Because VEGF is an Acknowledgments important survival factor, it has been postulated that this could We thank Christine Flefleh, Ivan Inigo, Kelly McGlinchey, Krista Menard, and Amy be a potential mechanism of paclitaxel resistance. Accordingly, Wiebesiek for their technical assistance with the in vivo efficacy studies and Kathy the ability of bevacizumab to counteract the effects of VEGF Johnston and Russ Peterson for their assistance with the in vitro cytotoxicity assay.

References 1. Bode CJ, Gupta ML, Reiff EA, et al. Epothilone and 6. Lee FYF, Borzilleri R, Fairchild CR, et al. BMS- 11. Galsky MD, Small EJ, OhWK, et al. Multi-institutional paclitaxel: unexpected differences in promoting the 247550: a novel epothilone analog with a mode of ac- randomized phase II trial of the epothilone B analog assembly and stabilization of yeast microtubules. Bio- tion similar to paclitaxel but possessing superior anti- ixabepilone (BMS-247550) with or without estramus- chemistry 2002;41:3870 ^ 4. tumor activity. Clin Cancer Res 2001;7:1429^ 37. tine phosphate in patients with progressive castrate 2. Bollag DM, McQueney PA, Zhu J, et al. Epothilones, 7. Lee H, Xu L,Wu S, et al. Predictive biomarker discov- metastatic prostate cancer. J Clin Oncol 2005;23: a new class of microtubule-stabilizing agents with a ery and validation for the targeted chemotherapeutic 1439^ 46. Taxol-like mechanism of action. Cancer Res 1995;55: ixabepilone. J Clin Oncol 2006;24:Abstract 3011. 12 . HussainM,TangenCM,LaraPN,Jr.,etal.Ixabepi- 2325^ 33. 8. LowJA,Wedam SB, LeeJJ, et al. Phase IIclinical trial lone (epothilone B analogue BMS-247550) Is active 3. Rojas-Espaillat LA, Uyar D, Grabowski D, et al. Apo- of ixabepilone (BMS-247550), an epothilone B ana- in chemotherapy-naive patients with hormone- ptotic pathways induced by ixabepilone in paclitaxel- log, in metastatic and locally advanced breast cancer. refractory prostate cancer: A southwest oncology refractory ovarian carcinoma cells. Proc Am Assoc J Clin Oncol 2005;23:2726 ^ 34. grouptrialS0111.JClinOncol2005;23:8724^9. Cancer Res 2005;46:Abstract 5318. 9. Thomas E, Perez EA, Mukhopadhyay P, et al. Phase II 13 . O’Connor O, Straus D, Moskowitz C, et al. Targeting 4. YamaguchiH,ChenJ,BhallaK,WangH-G.Regula- trial of ixabepilone in patients with metastatic breast the microtubule apparatus in indolent and mantle cell tion of bax activation and apoptotic response to cancer (MBC) who are resistant to an anthracycline, lymphoma with the novel epothilone analog BMS microtubule-damaging agents by p53 transcription- a taxane and capecitabine. J Clin Oncol 2006;24:Ab- 247550 induces major and durable remissions in very dependent and -independent pathways. J Biol Chem stract 660. drug resistant disease. J Clin Oncol 2005;23:Abstract 2004;279:39431^7. 10. Whitehead RP, McCoy S, Rivkin SE, et al. A Phase II 6569. 5. Lee FYF, Borzilerri R, Fairchild C, et al. Preclinical trial of epothilone B analogue BMS-247550 (NSC 14. Smith SM, Pro B, Besien Kv, et al. A phase IIstudy of discovery of ixabepilone, a highly active antineoplastic #710428) ixabepilone, in patients with advanced epothilone B analog BMS-247550 (NSC 710428) in agent. Cancer Chemother Pharmacol 2008;63: pancreas cancer: A Southwest Oncology Group patients with relapsed aggressive non-Hodgkin’s lym- 157 ^ 6 6. study. Invest New Drugs 2006;24:512^ 20. phomas. J Clin Oncol 2005;23:Abstract 6625.

ClinCancerRes2008;14(24)December15,2008 8130 www.aacrjournals.org Downloaded from clincancerres.aacrjournals.org on September 30, 2021. © 2008 American Association for Cancer Research. Synergistic AntitumorActivity: Ixabepilone and Bevacizumab

15. Vansteenkiste J, Lara PN, Jr., Le Chevalier T, et al. breast cancer (MBC) previously treated with a taxane 38. Bart J, Hollema H, Groen HJM, et al. The distribu- Phase IIclinical trial of the epothilone B analog, ixabe- and an anthracycline. Clin Oncol 2006;24:Abstract tion of drug-efflux pumps, P-gp, BCRP, MRP1 and pilone, in patients with non-small-cell lung cancer 10511. MRP2, in the normal blood-testis barrier and in pri- whose tumors have failed first-line platinum-based 26. Ferrara N, Hillan KJ, Gerber H-P, et al. Discovery mary testicular tumours. Eur J Cancer 2004;40: chemotherapy. J Clin Oncol 2007;25:3448 ^ 55. and development of bevacizumab, an anti-VEGF anti- 2064 ^ 70. 16. Fojo AT, Menefee ME, Poruchynsky M, et al. A body for treating cancer. Nat Rev Drug Discov 2004; 39. Tanaka Y, Abe Y,Tsugu A, et al. Ultrastructural lo- translational study of ixabepilone (BMS-247550) in 3:391^400. calization of P-glycoprotein on capillary endothelial renal cell cancer (RCC): assessment of its activity 27. Ferrara N. Vascular endothelial growth factor: asic cells in human gliomas. Virchows Arch 1994;425: and demonstration of target engagement in tumor science and clinical progress. Endocr Rev 2004;25: 13 3 ^ 8 . cells. Clin Oncol 2005;23:Abstract 4541. 581^611. 40. Toth K, Vaughan M, Peress N, et al. MDR1 17. Zhuang SH, Agrawal M, Edgerly M, et al. A phase I 28. Miller K, Wang M, Gralow J, et al. Paclitaxel plus P-glycoprotein is expressed by endothelial cells of clinical trial of ixabepilone (BMS-247550), an epothi- bevacizumab versus paclitaxel alone for metastatic newly formed capillaries in human gliomas but is not lone B analog, administered intravenously on a daily breast cancer. N Engl J Med 2007;357:2666 ^76. expressed in the neovasculature of other primary schedule for 3 days. Cancer 2005;103:1932 ^ 8. 29. Sandler A, Gray R, Brahmer J, et al. Paclitaxel-car- tumors. Am J Pathol 1996;149:853 ^ 8. 18. Conte P,Thomas E, Martin M, et al. Phase IIstudy of boplatin alone or with bevacizumab for non-small-cell 41. Camassei FD, Bosman C, Francalanci P, et al. ixabepilone in patients (pts) with taxane-resistant lung cancer. N Engl J Med 2006;355:2542 ^ 50. Nephroblastoma: multidrug-resistance P-glycopro- metastatic breast cancer (MBC): Final report. J Clin 30. Bijman MNA, van Nieuw Amerongen GP, Laurens tein expression in tumor cells and intratumoral capil- Oncol 2006;24:Abstract 10505. N, et al. Microtubule-targeting agents inhibit angio- lary endothelial cells. Am J Clin Pathol 2002;117: 19. Wartmann M, Altmann KH. The biology and medici- genesis at subtoxic concentrations, a process associ- 484^90. nal chemistry of epothilones. Curr Med Chem Anti- ated with inhibition of Rac1 and Cdc42 activity and 42. Gaumann A,Tews DS, MentzelT, et al. Expression of Canc Agents 2002;2:123^ 48. changes in the endothelial cytoskeleton. Mol Cancer drug resistance related proteins in sarcomas of the 20. Jordan M, Miller H, Ni L, et al. The Pat-21 breast Ther 2006;5:2348 ^57. pulmonary artery and poorly differentiated leiomyo- cancer model derived from a patient with primary 31. Riss TL, Moravec RA. Comparison of MTT, XTT, sarcomas of other origin. Virchows Archiv 2003;442: Ta x o l R resistance recapitulates the phenotype of its and a novel tetrazolium compound MTS for in vitro 529^ 37. origin, has altered h-tubulin expression and is sensi- proliferation and chemosensitivity assays. Mol Biol 43. Ranieri G, Patruno R, Ruggieri E, et al.Vascular en- tive to ixabepilone. Proc Am Assoc Cancer Res Cell 1992;3:184a. dothelial growth factor (VEGF) as a target of bevaci- 2006; 97th Annual ASCO Meeting. Abstract LB-280. 32.Venditti J, Goldin A. Drug synergism in antineoplstic zumab in cancer: From the biology to the clinic. Curr 21. Burger H, Foekens JA, Look MP, et al. RNA expres- chemotherapy. Adv Chemother 1964;13:397 ^ 498. Med Chem 2006;13:1845^57. sion of breast cancer resistance protein, lung 33. Carter S. Planning combined therapy - the interac- 44. Jain RK. Normalization of tumor vasculature: an resistance-related protein, multidrug resistance- tion of experimental and clinical studies. Cancer Che- emerging concept in antiangiogenic therapy. Science associated proteins 1and 2, and multidrug resistance mother Rep 2 1974;4:3 ^ 11. 2005;307:58 ^ 62. gene 1in breast cancer: correlation with chemothera- 34. CorbettTH, Griswold D, Jr.,Wolpert M, et al. Design 45. Pasquier E, Carre M, Pourroy B, et al. Antiangio- peutic response. Clin Cancer Res 2003;9:827 ^ 36. and evaluation of combination chemotherapy trials in genic activity of paclitaxel is associated with its cy- 22. Leonessa F, Clarke R. ATP binding cassette trans- experimental animal tumor systems. CancerTreat Rep tostatic effect, mediated by the initiation but not porters and drug resistance in breast cancer. Endocr 1979;63:799 ^ 801. completion of a mitochondrial apoptotic signaling RelatCancer2003;10:43^73. 35. Gehan EA. A generalizedWilcoxon test for compar- pathway. Mol Cancer Ther 2004;3:1301 ^ 10. 23. Kamath K, Wilson L, Cabral F, et al. h III-tubulin ing arbitrarily singly-censored samples. Biometrika 46. IwahanaM,UtoguchiN,MayumiT,etal.Drugre- induces paclitaxel resistance in association with re- 1965;52:203 ^ 23. sistance and p-glycoprotein expression in endothelial duced effects on microtubule dynamic instability. 36. Sawada T, Kato Y, Sakayori N, et al. Expression of cells of newly formed capillaries induced by tumors. J Biol Chem 2005;280:12902^7. the multidrug-resistance P-glycoprotein (Pgp, MDR- Anticancer Res 1998;18:2977 ^ 80. 24. Kavallaris M, Kuo DY-S, Burkhart CA, et al. Taxol-re- 1) by endothelial cells of the neovasculature in central 47. Kim HS, OhJM, Jin DH, et al. Paclitaxel induces vas- sistant epithelial ovarian tumors are associated with nervous system tumors. Brain Tumor Pathol 1999;16: cular endothelial growth factor expression through re- altered expression of specific h-tubulin isotypes. 23 ^ 7. active oxygen species production. Pharmacology J Clin Invest 1997;100:1282^ 93. 37. Billson A, Palmer J, Walker D, et al. Multidrug resis- 2008;81:317^ 24. 25. Bunnell CA, Klimovsky J,Thomas E. Final efficacy tance gene (MDR 1) expression in neuro-axial tumours 48. D’Alessio M, Cerella C, De Nicola M, et al. Apoptotic results of a phase I/II trial of ixabepilone in combina- of children and young adults. Br J Neurosurg 1994;8: GSH extrusion is associated with free radical genera- tion with capecitabine in patients with metastatic 585^91. tion. Ann N Y Acad Sci 2003;1010:449 ^ 52.

www.aacrjournals.org 8131 Clin Cancer Res 2008;14(24)December 15, 2008 Downloaded from clincancerres.aacrjournals.org on September 30, 2021. © 2008 American Association for Cancer Research. Synergistic Antitumor Activity of Ixabepilone (BMS-247550) Plus Bevacizumab in Multiple In vivo Tumor Models

Francis Y.F. Lee, Kelly L. Covello, Stephen Castaneda, et al.

Clin Cancer Res 2008;14:8123-8131.

Updated version Access the most recent version of this article at: http://clincancerres.aacrjournals.org/content/14/24/8123

Cited articles This article cites 46 articles, 13 of which you can access for free at: http://clincancerres.aacrjournals.org/content/14/24/8123.full#ref-list-1

Citing articles This article has been cited by 6 HighWire-hosted articles. Access the articles at: http://clincancerres.aacrjournals.org/content/14/24/8123.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://clincancerres.aacrjournals.org/content/14/24/8123. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.