Temporal Analysis of Alpha and Beta-Expansin Expression During ﬂoral Opening and Senescence

Plant Science 164 (2003) 769/781 www.elsevier.com/locate/plantsci

Temporal analysis of alpha and beta-expansin expression during ﬂoral opening and senescence

Timothy E. Gookin *, Donald A. Hunter, Michael S. Reid

Department of Environmental Horticulture, University of California, Davis, One Shields Ave., Davis, CA 95616, USA

Received 1 October 2002; received in revised form 21 January 2003; accepted 22 January 2003

Abstract

We have identified a family of expansin transcripts that include seven a-expansins (MjExp1 through MjExp7) and three b- expansins (MjExpB1 through MjExpB3) from Mirabilis jalapa (Nyctaginaceae) that show dramatic changes in transcript abundance during the rapid expansion and subsequent senescence of the ephemeral flowers. In general, a-expansin expression was low in small buds, high during maximal elongation of the floral tube, reduced during floral display, and upregulated during calyx infolding and collapse. Transcripts encoding auxin responsive proteins (Aux/IAA) showed a similar pattern of expression. Northern analysis using a set of overlapping probes designed to the MjExp2 transcript demonstrated a gradient of sequence conservation along its length (high to low, from the 5? to the 3? end of the coding region), and identified the presence of floral senescence-specific expansins. Beta expansin transcripts were found to be preferentially expressed during early floral development and sharply downregulated coincident with rapid growth. All three b-expansin transcripts are highly related, and cMjExpB2 is an intronless pseudogene derived from MjExpB1. MjExpB3 appears to have derived from MjExpB1 in a separate gene duplication event, and is predicted to encode a truncated protein. # 2003 Elsevier Science Ireland Ltd. All rights reserved.

Keywords: Cell wall loosening; Expansins; Flower development; Mirabilis jalapa; Pseudogene

1. Introduction requires modulation of cell size and shape, which is accomplished by regulated changes in wall plasticity. Plant cell walls are intricate structures that provide The plasticity of the cell wall is thought to be mediated both the mechanical strength and the plasticity neces- through the combined action of proteins such as sary for development of plant tissues and organs. At the pectinases, xyloglucan endotransglycoslyases, endo-1,4- organismal level, cell walls function cohesively as a b-D-glucanases, and expansins [1]. structural scaffold to counteract the force of gravity and Little over a decade ago, expansins were first identi- allow the creation of three-dimensional shapes such as fied in cell wall protein fractions able to restore acid- stems, leaves, and flowers. On a cellular scale, strength is induced extension of heat-inactivated cell walls [2]. The needed to counteract osmotic pressure, create a protec- exact mechanism by which expansins affect cell wall tiveenvironment for the protoplast, and enable cells to plasticity is still unknown though they are believed to remain in close contact. Growth and development disrupt hydrogen bonding between cellulose microfibrils and the matrix glucans [3]. Expansins are now known to belong to a multigene family of proteins, and havebeen Abbreviations: aa, amino acid(s); bp, base pair(s); C, carboxyl; demonstrated to have organ specific [4], tissue specific cDNA, complementary to RNA; Exp, expansin; ExpB, beta-expansin; [5], and cell specific [6] expression patterns. Although N, amine; PCR, polymerase chain reaction; PolyA , polyadenylated they are commonly identified in expanding and rapidly messenger RNA; RACE, rapid amplification of cDNA ends; RNA, growing tissues, expansins are also expressed in non- ribonucleic acid; RT, reverse transcription; SNP, single nucleotide polymorphism; UTR, untranslated region. expanding tissues such as ripening fruit [7,8].

* Corresponding author. Tel.: /1-530-752-7060. Our model system is Mirabilis jalapa (Nyctaginaceae), E-mail address: [email protected] (T.E. Gookin). a bushy perennial native to the warmer regions of

Tropical America that is more commonly known to Fold (onset of infolding), and Senesced (all sides of North American gardeners as Four O’clocks or Marvel flower collapsed). The calyx was approximately 4 cm of Peru. Flowers of this species have a fused calyx long on the day of anthesis prior to the onset of floral instead of true petals [9], and lend themselves well to tube elongation and attained a maximum length of 6 cm studies of floral development and senescence. The buds at Half Open. Additional stages, Flat Top (calyx tightly expand rapidly in the late afternoon, open early in the infolded) and 1 DAA (1 day after anthesis, distal end of evening, and coordinately collapse the following morn- calyx discolored) were also identified, but only used for ing giving a short, typical lifespan of 14 h. The fresh weight analysis. The petal-like calyces were excised predictability of this flower was noted by Cruden [10] by cutting just above the ovary and removing the who identified stages from Full Open through First Fold filaments, anthers, style, and stigma. Care was taken in a detailed study of Mirabilis pollination events. to ensure that pollen was not included in the samples, Cruden’s morphological study provides greater resolu- and pollen-contaminated flowers were discarded. Sam- tion of the Stigma Fall stage by describing three ples (1 g) of calyces from all of the stages shown in Fig. 2 sequential phases of stigma/anther proximity. were harvested directly into liquid N2, and stored at / The rapid expansion and wilting of M. jalapa flowers 80 8C until needed. suggests the involvement of two components commonly Additional tissues were collected from M. jalapa associated with the acid growth theory, auxin and plants; Cotyledons still emerging from beneath the expansins. Auxin has long been known to induce a seed coat (Cot), hairy radicals (RAD), young expanding growth response in many tissues, and has been shown by leaves (YL), mature leaves (ML), pre-expanding green many researchers to effect the expression of numerous fruit (PGF), and expanding green fruit (EGF) were all expansins. Although expansin genes have been shown to collected immediately into liquid nitrogen and stored at be expressed in floral primordia [11] and mature floral /80 8C until needed. Seeds were removed from the fruit tissue [12], there has been no comprehensive study of during sampling. temporal changes in expansin expression during flower opening and senescence. Our study examined the 2.2. Nucleic acid extractions hypothesis that changes in expression of specific expansin genes would be associated with different phases Total RNA was isolated from the stored tissue by the of floral ontogeny. Hot/Borate method of Wilkins and Smart [13] with the addition of a chloroform/isoamyl alcohol (24:1) extrac- tion step prior to precipitating the RNA in ethanol. 2. Materials and methods PolyA RNA was isolated from total RNA using the NucleoTrap system (Clontech, Palo Alto, CA). Geno- 2.1. Plant growth conditions and sample collection mic DNA was isolated using the Plant DNeasy mini kit (Qiagen, Valencia, CA) following the manufacturer’s M. jalapa plants were grown in 3-gallon containers directions. filled with UC Mix (1/3 fir bark, 1/3 sand, 1/3 peat) under standard greenhouse conditions with 16-h days (29 8C, 75% humidity) and 8-h nights (13 8C, 85% 2.3. PCR ampliﬁcation humidity). Early floral bud development was divided into four First strand cDNA for use in initial PCRs, 5?-RACE stages that correspond to 2, 4, 6, and 8 days before (Rapid Amplification of cDNA Ends), or 3?-RACE anthesis (DBA). At 8 DBA the calyx was 1 cm long and reactions¯ ¯ was made from¯ PolyA¯RNA using Super- just visible above the bract. At 6 DBA the calyx was Â/ script II (Gibco-BRL, Gaithersburg, MD) and the

1.3 cm long, at 4 DBA the calyx was Â/1.8 cm long, and SMART RACE cDNA Amplification Kit (Clontech) by 2 DBA the calyx had grown to slightly over 2 cm following the manufacturer’s directions except for long. The developing bud samples were collected by adjustments to annealing temperature or cycle number harvesting the intact bud after removal of the bracts and when necessary. PCR products were cloned prior to bi- ovary. directional sequencing with an automated DNA sequen- The development of the flower on the day of anthesis cer (model 377, PRISM, Applied Biosystems). Hybridi- was divided into eight phenotypically identifiable stages zation probes were amplified from purified plasmids, in (Fig. 2): Small Bud (onset of floral tube elongation), 50 ml reactions, following the standard HotStarTaqTM Long Bud (highest rate of elongation), Cracked Bud polymerase (Qiagen) protocol. The HotStarTaqTM pro- (onset of opening), Half Open (calyx unfolded, style and tocol was also followed for amplification of b-expansin filaments uncoiled), Full Open (flower diameter at genomic sequences. To ensure sequence quality, at least maximum, stigma exserted), Stigma Fall (flower dia- two clones from two independent PCRs were obtained meter at maximum, style coiled into tube opening), First for each transcript. T.E. Gookin et al. / Plant Science 164 (2003) 769/781 771

2.4. Oligonucleotides and PCR products 2.5. Sequence alignment and phylogenetic analysis

Initial amplification of a-expansin cDNA fragments We selected 71 expansin nucleotide sequences for was performed using degenerate primers known to which, after deduction of the protein sequence, a signal amplify expansin sequences from tomato [7]. After peptide could be predicted. Signal peptide cleavage sites obtaining initial fragments to which primers could be previously described were re-evaluated using both designed, all subsequent cDNA PCRs were performed methods provided in the SignalP [14] V2.0 program using a sense or antisense primer in conjunction with the (neural network, and hidden Markov method) with the UPM or NUP primers supplied in the SMART RACE ‘eukaryotic trained networks’ option checked. The cDNA Amplification Kit. Primer sequences are shown nucleotide data was trimmed to include only the region at the end of this section. corresponding to the mature protein, translated into The 5?-RACE antisense primer ExpR90 generated amino acid sequence using the universal genetic code, two similar sequences that diverged across the 5?UTR. and aligned using CLUSTALX [15]. The nucleotide Primers ExpF107 and ExpF46 were designed to non- sequences were then aligned to the alignment of the homologous regions of those sequences and used to deduced amino acid sequences, to prevent frameshift provide the complete full-length transcripts for MjExp1 artifacts, using DAMBE [16]. The third position of each and MjExp3, respectively. Initial ‘gene-specific’ reverse codon was excluded during evolutionary analysis. primers designed to the MjExp2 fragment amplified Phylogenetic and molecular evolutionary analyses transcripts for the 5? ends of MjExp4, MjExp6, and were conducted using MEGA version 2.1 [17]. Neigh- MjExp7 so the near full-length transcript for MjExp2 bor-joining (NJ) trees were derived from distance was obtained by 3-RACE with primer ExpF437 and matrices obtained using the Kimura two-parameter subsequent 5?-RACE with primer ExpR802. The full- distance method (pairwise gap deletion) with the ‘tran- length transcript for MjExp4 was obtained by using sitions/transversions’ option checked. Group support primer ExpF25. The full-length transcripts for MjExp6 was evaluated using 1000 bootstrap replicates. Molecu- lar distance comparisons were also performed using and 7 were obtained using ExpF01 and ExpF02, regions of cDNA corresponding to the two domains respectively. (EG45-like, similar to family 45 endo-glucanase; Trp- The b-expansin transcripts were obtained by design- rich, tryptophan rich) identified by Cosgrove [18]. ing primers to an EST found in a M. jalapa cDNA library. 5?-RACE was performed using primer BamR1, 2.6. Northern analysis prior to performing 3?-RACE with sense primers BamF132 and BamF143. Genomic PCRs were per- After heat denaturation in 2.7 M formaldehyde, total formed using the two BamF primers in combination or PolyA RNA was size fractionated by electrophor- with the antisense primers BamR724, BamR837, and esis at 110 V for 3/5 h in a 1% (w/v) agarose gel. Both BamR968. The transcript encoding the auxin responsive the gel and running buffer contained 0.22 M formalde- protein MjAux/IAA1 was a fortuitous isolate from a hyde. The separated RNA was transferred to a posi- floral RACE cDNA library. TM tively charged membrane (Hybond /N , Amersham In the following list an ‘F’ or ‘R’ before a number Pharmacia Biotech, Piscataway, NJ) by the alkaline indicates whether the primer is a forward (sense) or transfer method of Ingelbrecht et al. [19]. Only gels with reverse (antisense) primer: ExpR90 (5?CGGAA- the even loading exemplified by the ethidium bromide GGAAATGGGGACAATACCAGCACG), ExpR802 stained ribosomal RNA shown in Fig. 5 were used for (TGATCAATGTTTTCGTTCTAAAGCTGCCT), analysis. ExpF01 (5?GGCAGCGTAAGCAGTAACCAGAC- DNA probes were amplified from plasmids using the ATC), ExpF02 (5?CAACATAAGCAGTAACCA- appropriate sense or antisense primer and the NUP GACATCAC), ExpF25 (5?GGCGGCAATCACTTAT- primer supplied in the SMART RACE kit (Clontech). YTTATCTCT), ExpF46 (5?CCTCACTCCCTCAAAA- 25 ng of amplified plasmid insert was randomly labeled TTCCATCTACC), ExpF107 (5?TTCAAACAAT- with [a-32P] using the Strip EZTM DNA kit (Ambion, GGGGTTATCACTC), ExpF437 (5?GCACAGGATA- Austin, TX). The denatured, labeled probes were CGGCACAAACAC), BamR1, (5?TGGGCTTCCA- hybridized with membranes bathed either in Church TGAATTAACCTGACCAACA), BamF132 (5?CTT- Hybridization Solution [20] or in ULTRAhybTM Hybri- CATGCTTTTATCATCTCCAAGTGC), BamF143 dization Buffer (Ambion) at 65 8C for 16 h. Membranes (5?CATCTCCAAGTGCTGCTGCTGTTA), BamR724 were washed for 25 min in 20 mM sodium phosphate, (5?CTGATTGGACTTTGAATCGGAACTGT), pH 7.2, 0.5% (w/v) BSA, and 1 mM EDTA, pH 8.0, then

BamR837 (5?GAGCAACCATGAGCAGCAACA- for 20 min in 2/SSPE, 20 min in 1/SSPE, and a final

TTAC), BamR968 (5?GCGTCTTGCATAGCAATA- 40/60 min in 0.1/SSPE. All washes were performed at CATGGTC). 68 8C and all wash solutions contained 0.1% (w/v) SDS. 772 T.E. Gookin et al. / Plant Science 164 (2003) 769/781

Membranes were sealed in plastic bags and imaged on a Analysis of the nucleotide region encoding the mature Molecular Dynamics STORM† Phosphorimager Sys- protein showed that MjExp1, MjExp3, and MjExp4 tem. Blots were prepared for reprobing with the Strip share 77/81% nucleotide and Â/85% aa identity with EZTM DNA kit (Ambion) following the manufacturer’s each other, and also showed that MjExp6 and MjExp7 directions. Each probe was independently hybridized to share /90% nucleotide and /94% aa identity with at least three replicate blots; one of which was a PolyA MjExp4. With the exception of a 60 bp in-frame blot. deletion, MjExp7 has the same nucleotide sequence as MjExp6. Database searches indicated this group of

closely related sequences to be most homologous (80/ 3. Results 83%) to the CanExp2 nucleotide sequence (AJ291817) isolated from etiolated chickpea epicotyls (BLASTN, [21]). One 5?-RACE clone of MjExp4 (clone 4067) 3.1. Dynamic growth of the M. jalapa ﬂower differs from the others in that it includes a 373bp intron and predictable donor/acceptor intron splice sites (Net- The timing of M. jalapa floral development on the Gene2, [22]). The intron occurs (phase/1) between the day of anthesis was studied using time-lapse videogra- aa residues DASGTM and GGACG of MjExp4,a phy. The time between each of the developmental stages position where the first intron in an a-expansin gene is (Fig. 2) is 1.7/2 h. During opening the floral tube typically found [18]. elongates, the calyx expands as the tip of the bud MjExp2 was more difficult to amplify; attempts to unfolds, and proceeds through a half open stage (where clone the 5? end of the transcript isolated the 5? ends of the style and stamen uncoil) to a full open stage MjExp4, MjExp6,andMjExp7. We employed the complete with exserted stigma. As previously described reverse procedure (first 3?-RACE, then 5?-RACE) to [10], the first event in flower senescence is the curling of clone MjExp2. This sequence is 1106 bp long, encodes a the style and filaments (Stigma Fall). Most frequently predicted protein of 258 aa, and is missing codons for the next event is a directional infolding (relative to the the first 1 to several aa of the signal peptide. There is a coiling style and filaments) of one side of the flower predicted signal peptide cleavage site between amino prior to a coordinated collapse of the entire calyx. acids 21 and 22 of the deduced protein. The nearly To quantify this morphological change we collected complete cDNA only shares Â/55% nucleotide identity flowers from the period of 8 DBA to 1 DAA and with the other M. jalapa expansins, and is not appre- measured the change in fresh weight (Fig. 4). Fresh 1 ciably homologous at the nucleotide level to any other weight of the floral bud increased linearly (0.5 mg h ) reported sequences. MjExp5 shares 68% nucleotide and until 1 DBA. After 1 DBA the rate of gain markedly 79% aa identity with MjExp2. increased, and the rate was linear and over 30 fold 1 higher (16.3 mg h ) between the Small Bud and Half 3.3. Phylogenetic analysis of the a-expansin gene family Open stages. The rate of gain decreased as the flower approached its maximum fresh weight at Full Open/ NJ trees constructed from the nucleotide data set Stigma Fall, and was linear and negative(/14.5 mg 1 strongly supported the separation of Group 1 (99% h ) between the Stigma Fall and Senesced stages. bootstrap) and Group 2 (93%), and to a lesser degree These experiments were repeated in three different supported the collection of many of the remaining environments (growth chamber, greenhouse, field), and sequences into Group 3 (89%) (Fig. 1). Our data show all three of the described linear segments of fresh weight 2 that MjExp1, 3, 4, 6, and 7 form a tight paralogous change reproducibly exhibited R values above 0.985. cluster (93%) in Group 3, and identifies MjExp2 as the Values for the standard error were negligible due to the most divergent member of Group 2. Our groupings collection of a large number (/50) of flowers at each of correlate well with established a-expansin clades [6,23], the specified phenotypic stages. but the presence of one previously identified subgroup, ‘C’, is only tentatively identified (83%) within Group 3, 3.2. Identiﬁcation of an a-expansin gene family and another subgroup, ‘B’, was not adequately resolved. This may be due to our inclusion of many newly We isolated seven a-expansin sequences from M. available expansin sequences. jalapa flowers. Full-length sequences (5?UTR, coding NJ trees constructed using the amino acid sequence region, and 3?UTR) of MjExp1, MjExp3, MjExp4, data (pairwise deletion, Poisson correction) provided MjExp6,andMjExp7 were obtained by the process of similar results, resolving Group 1 (93%) and Group 2 5?-RACE, design of forward primers, and subsequent 3?- (83%), but provided no support for Group 3 (50%) (data RACE. These transcripts are deduced to encode pro- not shown). The observed lower bootstrap values are teins of Â/252 aa residues with predictable signal most likely due to the loss of informative characters peptides (Table 1). during translation of the nucleotide sequence. Interest- T.E. Gookin et al. / Plant Science 164 (2003) 769/781 773

Table 1 Summary of transcripts isolated from calyx tissue

Gene ID cDNA 5?UTR 3?UTR Accession # Predicted protein Predicted signal peptide Notable feature (bp) (bp) (bp) (cDNA) (aa) (aa)

MjExp1 1107 93 222 AY079208 252 25 MjExp2 1106 331 AY079204 258 21 MjExp3 1191 75 358 AY079205 253 25 MjExp4 1262 76 431 AY079206 252 24 Clone 4067 868 72 AF486287 252 24 373 bp intron MjExp5 517 AY079207 MjExp6 1198 119 320 AY079203 252 24 MjExp7 1120 91 330 AY147411 232 24 60 bp deletion MjExpB1 1181 73 301 AY147412 269 21 cMjExpB2 1084 AY147413 No Pseudogene MjExpB3 712 228 AY147414 209 bp deletion MjAux/IAA1 990 408 AY129669 ingly, this analysis of aa sequence did not support the 100% identical to MjExpB1 except for the presence of inclusion of MjExp2andCsExp4 in Group 2. MjExp2 one deletion, one A/G transition, and one C/T transi- was identified as the first diverging sequence (79%) while tion. These two transitions are 15 bp apart and identify CsExp4 was identified as the second (90%). CsExp4 was a single nucleotide polymorphism (SNP) region. One previously classified as being related to this group, but possible translation of cMjExpB2 exists in which a start not a member due to residue changes in key conserved codon is available and a 219 aa protein homologous to domains [24]. most of the mature protein of MjExpB1 could be Since MjExp2 also has the characteristic conserved produced. This translation does not allow the identifica- domains of Group 2, we attempted to determine why it tion of a signal peptide and eliminates the highly diverges from the group by performing distance analysis conserved GGACGY motif. It is highly unlikely that using the sequence regions that correspond to the two this transcript is capable of producing a functional well-described a-expansin domains (data not shown). A expansin protein. Further investigation using genomic pairwise distance matrix created using only the EG45- DNA indicated that cMjExpB2 was transcribed from a like domain showed the EG45-like domain of MjExp2 genomic sequence which does not contain any of the to be most similar to CsExp1 (Group 3), and more introns commonly associated with expansin genes [26]. similar to 16 other Group 3 members than to its closest The MjExpB3 transcript has the same nucleotide homolog in Group2 (LeExp1). The Trp-rich domain of sequence as MjExpB1, but has incurred one silent MjExp2 is most similar to PsExp1 and other taxa transition and a 209 bp deletion. The 5? border of this within Group2. None of the other Group2 members, deletion occurs within the residues VEYKR and leads to including CsExp4, exhibited this dichotomous relation- the formation of a truncated protein (Fig. 3A). An ship and all were most closely related in both domains to alignment of the nucleotide sequences shows the other members within the group. MjExpB3 deletion borders reside within an A4GG repeat and the 3? border of the deletion is near or within 3.4. Identiﬁcation of a b-expansin gene family the region containing the two cMjExpB2 transitions (Fig. 3B). We isolated three extremely closely related b-expansin transcripts from M. jalapa calyx tissue (Table 1); 3.5. Gene speciﬁc expansin expression MjExpB1 has unfaithfully replicated in the genome at least two independent times. The 1181 bp full-length Northern analysis showed different members of the transcript of MjExpB1 encodes a deduced protein of expansin family are appreciably expressed at all times 269 aa residues having a predicted signal peptide of 21 during the life of the flower with distinct temporal aa, and potential N-glycosylation sites present at patterns of regulation. MjExp1, MjExp3, and MjExp4 residues 110 and 154 (Fig. 3A). were expressed at a low or undetectable level at Small cMjExpB2 is a pseudogene derived from MjExpB1. Bud, expressed maximally at Long Bud, minimally The Greek symbol prefix is used to denote the pseudo- expressed during Stigma Fall, and variably up-regulated gene (reviewed in [25]). The first 120 bp of the during the infolding and collapse of the calyx (Fig. 2A). cMjExpB2 transcript has low sequence complexity Within this general pattern, expression of the individual

(75.0% A/T) and is entirely dissimilar to MjExpB1. genes varied. MjExp1 was not detectable at Small Bud, cMjExpB2 becomes homologous to MjExpB1 at 121 but was sharply up-regulated to show similar transcript bp, and for the remaining length of the transcript is abundance to that of MjExp3 and MjExp4 at the Long 774 T.E. Gookin et al. / Plant Science 164 (2003) 769/781

Bud stage. The three genes also differed in expression Senescence and MjExp3 remained at low transcript pattern during calyx wilting. All showed low expression abundance, MjExp4 was highly up-regulated. Probes at First Fold, but while MjExp1 was undetectable at designed to encompass the identified intron of MjExp4 (Clone 4067) did not provide any hybridization signal during Northern analysis, and presumably, this transcript represents a partially-processed RNA. Due to the high sequence similarity of MjExp4 and MjExp6, and the high similarity of the expression profiles generated by the three gene specific probes, an expression pattern for MjExp6 was not investigated using a gene specific probe. Since all three b-expansin transcripts have identical 3?UTRs, we used the region of non-homology present at

the 5? end of the transcripts (5?UTR/) to discriminate between the putatively functional MjExpB1 and the cMjExpB2 pseudogene. Hybridization of MjExpB1

5?UTR/ probes to blots prepared from pre-anthesis floral organs identified the presence of transcripts as early as 8 DBA and an increase in transcript abundance as early as 6 DBA. MjExpB1 expression was unchanged at 4 DBA, but by 2 DBA the level of transcripts identified by these probes had decreased to a level

Fig. 1. Phenogram constructed using the nucleotide sequences encoding the mature a-expansin protein and rooted using the b-expansin, Phlp1. Numbers indicate bootstrap percentages (1000 replicates). Sequences isolated in this study (Mj, M. jalapa) are shown with a ﬁlled triangle and a-expansins monocotyledonous taxa are indicated with a downward-pointing unﬁlled triangle. Capital Letters within parentheses indicate previously described clades [34]. GenBank accession numbers are as follows: AtExp2 (U30481), AtExp5 (U30478), AtExp6 (U30480), AtExp7 (AC025416, Locus At1g12560), AtExp10 (AF229437), and AtExp18 (AC011000, Locus At1g62980) from A. thaliana; BnExp1 (AJ000885) from Brassica napus; CanExp1 (AJ291816) and CanExp2 (AJ291817) from Cicer arietinum; CsExp1 (U30382), CsExp2 (U30460), CsExp3 (AF319469), CsExp4 (AF319470) and CsExp6 (AF319472) from Cucumis sativus; FaExp2 (AF159563) from Fragaria x ananassa, FpExp1 (AJ276006), FpExp2 (AJ276007), FpExp3 (AJ276008), FpExp4 (AJ276009), and FpExp5 (AJ276010) from Festuca pratensis; GhExp1 (AF043284) from Gossy- pium hirsutum; LeExp1 (U82123), LeExp2 (AF096776), LeExp3 (AF059487), LeExp4 (AF059488), LeExp5 (AF059489), LeExp8 (AF184232), LeExp9 (AJ243340), LeExp10 (AF184233), and LeExp18 (AJ004997) from Lycopersicon esculentum; MqExp1 (AF202119) from Marsilea quadrifolia; NtExp1 (AF049350), NtExp2 (AF049351), NtExp3 (AF049352), and NtExp4 (AF049353) from Nicotiana tabacum; OsExp1 (Y07782), OsExp2 (U30477), OsExp3 (U30479), OsExp4 (U85246), OsExp6 (AF247163), OsExp7 (AF247164), and OsExp10 (AF247165) from Oryza sativa; PaExp1 (U93167) and PaExp2 (AF038815) from Prunus armeniaca, PavExp1 (AF297521) and PavExp2 (AF297522) from Prunus avium; PcExp1 (AF350936), PcExp3 (AF350938), and PcExp4 (AF350939) from Prunus cerasus; Phlp1 (X78813) from Phleum pratense; PpExp1 (AB029083) from Prunus persica; PsExp1 (X85187) from Pisum sativum; PtExp (AF085330) from Pinus taeda; RdExp1 (AF202120) from Regnellidium diphyllum; RpExp1 (AF167360) from Rumex palustris; SaExp3 (AF291659) from Striga asiatica; TvExp1 (AF230278), TvExp2 (AF230277), and TvExp3 (AF230276) from Triphysaria versicolor; ZeExp2 (AF230332) and ZeExp3 (AF230333) from Zinnia elegans; ZmExp1 (AF332169), ZmExp2 (AF332170), Fig. 1 ZmExp3 (AF332171), and ZmExp5 (AF332173) from Zea mays. T.E. Gookin et al. / Plant Science 164 (2003) 769/781 775

Fig. 2. The eight identified stages of M. jalapa floral development are shown at top with the corresponding Northern lanes shown below. (A) Temporal expression of expansin transcripts using gene specific probes show each gene has a distinct profile. (B) Comparison of general a-expansin, b-expansin, and Aux/IAA gene expression patterns using non-specific probes suggests the presence of multiple molecular programs. The top panel allows the reader to easily compare the expression patterns for specific a-expansin and b-expansin genes. The non-specific probe information in the lower panel allows the reader to see how each expansin gene in the top panel may contribute to the general expansin expression profiles seen in the bottom panel.

similar to that observed at 8 DBA (Fig. 5). Northern decreased, and by Half Open the hybridization signal analysis using the isolated calyx tissue indicated this became undetectable (Fig. 2A). MjExpB1 is not floral decreasing trend continues, and showed the transcripts specific, and transcript abundance in the young stem are sharply downregulated as the calyx begins the was similar to that in the 8 DBA floral organs. The elongation phase. Probes identified a high abundance probes also identified expression in pre-expanding green of transcripts at Small Bud and a drastically reduced fruit, and a decreased amount in rapidly expanding amount at Long Bud. Transcript abundance further green fruit (Fig. 5). 776 T.E. Gookin et al. / Plant Science 164 (2003) 769/781

Fig. 3. Sequence analysis of M. jalapa b-expansins. (A) MjExpB1 is compared with Ath-Expb-2.1 (AAM63819). Signal peptides are underlined, identical residues are shown with black backgrounds, and similar residues are shown with grey backgrounds. MjExpB1 N-glycosylation sequons (NXS/T) are shown with stars, and the MjExpB3 region of non-homology caused by the deletion is boxed. Ath-Expg-1.2 (AAD08935) is shown as a representative‘g-expansin’ (Â/p12-like protein) and its truncation aligns with the deletion region of MjExpB3. (B) Demonstration of the placement of the A4GG repeats, the MjExpB3 deletion, and the two silent SNPs. The aa sequence of MjExpB1 is shown in bold and sequence discontinuity is indicated by the slash.

3.6. Senescence speciﬁc expansin expression

Three overlapping probes designed to the coding region of MjExp2 showed a gradient of specificity (increasing from the 5? to the 3? end) exists along the length of this sequence (Fig. 6). A probe designed to encompass the entire N-terminus of the coding region (ending with the 1st codon for the highly conserved HFD residues) identified low abundance of transcripts at Small Bud, high abundance at Long Bud, and reduced, but substantial, amounts at Cracked Bud and Half Open. During floral display and collapse the probes identified very low abundance of transcripts at Full Open, high abundance at Stigma Fall, low abun- Fig. 4. Fresh weight change of the intact ﬂoral organ (subtending dance at First Fold, and an increased abundance at the ovary and bracts not included). Straight lines segments indicate linear change. Abbreviations: DBA, Days before anthesis; SB, Small Bud; Senesced stage. A probe generated from a 512 bp region FO, Full Open. centered on the HFD site did not identify transcripts in T.E. Gookin et al. / Plant Science 164 (2003) 769/781 777

Fig. 5. Transcript abundance identiﬁed by the 5?UTR/ of MjExpB1 and the 3?UTR of MjAux/IAA1 in various plant tissues and pre-anthesis ﬂowers. Cot, cotyledon; Rad, radical; YS, young stem; YL, young leaf; SL, senescing leaf; PGF, pre-expanding fruit; EGF, expanding green fruit. The image of ethidium bromide stained ribosomal bands demonstrates equal loading, and is typical of all presented Northern analysis. all the floral stages. It indicated substantial transcript throughout development and both probes identified a abundance at Long Bud, slight abundance at Stigma similar pattern during flower opening. In contrast, the Fall, and high abundance at the Senesced stage. A third profiles differed after the Half Open stage and the probe made to the C-terminus of the coding region MjExp6 probe identified a completely opposite pattern (starting with the 2nd codon for HFD) hybridized only to that generated by the MjExp2 probe (Fig. 2B). to transcripts present at the Senesced stage. During floral display and collapse, the MjExp6 N- Although MjExp2 was repeatedly amplified from the terminal probe identified high abundance at Full Open, Senesced stage, probing with the 3?UTR of this sequence low to undetectable abundance at Stigma Fall, high did not produce any signal in six independent hybridiza- abundance at First Fold, and a slightly reduced amount tions (4 PolyA blots, 2 total RNA blots) using either at Senesced. method described in Section 2.2. This lack of signal may Probes were prepared to the N-terminal region of be due the high degree of secondary structure in this MjExpB1 in an attempt to visualize the combined region (predicted using RNAdraw [27]), or an extremely expression of MjExpB1, cMjExpB2, and MjExpB3, low expression level. Though it is clear that a subset of and any other closely related b-expansins during floral expansin transcripts are expressed only at the Senesced opening and senescence. The N-terminal probe provided stage, our inability to obtain expression information the same expression pattern as the 5?UTR/ probe (Fig. from the 3?UTR prevents us from concluding that this 2B). gene is a floral senescence-specific a-expansin. 3.8. Expression of MjAux/IAA1 3.7. General expansin expression patterns The expression pattern for the auxin responsive gene In order to determine if the MjExp2 N-terminal probe MjAux/IAA1 was examined using probes made to the expression profile represents a general expression pat- coding region and 3?UTR of the transcript. MjAux/ tern for all a-expansins, we utilized probes made to the IAA1 expression gradually increased between 8 DBA N-terminal half of MjExp6. Similar to the MjExp2 and 2 DBA in the developing flower bud (Fig. 5). On the probe, the MjExp6 probe suggested high abundance day of anthesis, MjAux/IAA1 transcripts were present at

Fig. 6. Northern analysis of a-expansin expression during the eight stages of floral development using overlapping probes. Equal length probes designed to the MjExp2 coding region show a gradient of specificity along the length of the sequence, and the more specific C-terminal probe identifies transcript abundance only at the Senesced stage. Lane order is Small Bud to Senesced, left to right, as described in Fig. 2. 778 T.E. Gookin et al. / Plant Science 164 (2003) 769/781 low levels at the Small Bud stage, and increased to high regulated gene expression. Aux/IAA genes belong to a abundance at Long Bud (Fig. 2B). Expression remained highly conserved family of short-lived nuclear proteins high through Half Open, was sequentially downregu- that are modulated by auxin (for review see [33]). lated to much lower levels at Full Open and Stigma Fall, Transcript abundance of MjAux/IAA1 between 8 and upregulated at First Fold, and again downregulated at 2 DBA mirrored the slow linear growth of the floral the Senesced stage. MjAux/IAA1 transcripts were also bud, while the expression profile observed during floral expressed in other tissues, and expression increased opening and senescence was very similar to the general during fruit maturation. A substantial abundance of a-expansin profile identified by MjExp6. Because transcript was also identified in young stems, young MjAux/IAA1 gene specific probes produced the same leaves and, at a much lower level, young emerging expression profile as probes designed to the highly cotyledons (Fig. 5). conserved AUX/IAA Domains III and IV, we conclude this pattern is characteristic of auxin-responsive gene expression. M. jalapa a-expansin and Aux/IAA gene 4. Discussion expression was highly associated with expansive growth, and upregulation of both was coincident with a 32 fold Our study is the first report of expansin expression increase in the rate of fresh weight gain. during floral morphogenesis, and is the first to describe Our phylogenetic analysis agrees with previous re- the inversely related regulation of alpha and beta- ports [23,34] and shows that the growth related, and expansins during flower opening. The M. jalapa flower putatively auxin induced, transcripts for MjExp1, 3, 4, provided an excellent opportunity to study expansin 6, and 7 align closely with the auxin induced LeExp2 expression, and we isolated a total of 11 distinct isolated from tomato [23]. Group 3 also contains other expansin transcripts. Our data show that a number of auxin responsive genes, such as PtExp [35], but it also different a-expansins are expressed during floral elonga- includes the ripening related FaExp2 [36] whose expres- tion, opening, and senescence, and report here the first sion is not greatly affected by auxin. Growth related demonstration of flower senescence-specific expansin genes are also found in Group 1 (LeExp4, [37])and expression. We identified a small family of highly similar Group 2 (OsExp7, [38]). Recently the AtExp7/AtExp18 b-expansins that presumably arose through two separate pair, which does not align with any of the groups, was gene duplication events. Unlike the a-expansins, b- reported to be root hair specific and auxin induced [31]. expansins were preferentially expressed during early Assigning functional significance to sequence based floral development and sharply downregulated at the groupings may only be possible through a comparative onset of rapid calyx growth. study detailing the regulation of closely related ortho- Cell walls are one of the key determinants of plant cell logs in analogous tissues. and organ shape [18], and cellular anatomy has been Previous research has shown that expansin expression shown to morphologically differentiate during floral is not solely associated with expansive growth [39],and ontogeny. Daylily (Hemerocallis sp.) petal cells are we also found evidence of expression at other time ordered and tightly packed prior to flower opening, points. Gene specific probes showed that MjExp1, but enlarge and separate during maturation to create a MjExp3, and MjExp4 were highly expressed during reticulate pattern [28]. Sandersonia aurantiaca tepal the growth phase and also upregulated at the onset of parenchymal cell layers loosen and become increasingly calyx infolding. The temporal trend shown by these disordered during opening, forming large intercellular probes was confirmed as a general expression pattern spaces before fully collapsing during senescence [29]. for a larger subset of a-expansins using non-specific Cell separation is thought to be hormonally controlled MjExp6 probes. These non-specific probes were de- by ethylene and auxin [30], and acidification of the cell signed to the more conserved N-terminal coding region wall by auxins is thought to enable wall proteins that and, like the MjExp2 N-terminal probes, undoubtedly function at low pH to effect wall relaxation. Applica- identified transcripts from a great number of expansin tions of auxins have been demonstrated to increase genes. Both the MjExp6 and MjExp2 N-terminal expansin expression [23], and it is well established that regions identified a similar abundance pattern during expansins can affect the rheological properties of the cell floral opening, but it was surprising to find that their wall. Expansin transcripts have been shown to be patterns were completely dissimilar after the Half Open expressed in many rapidly expanding tissues, such as stage (Fig. 2B). MjExp2 identified lower transcript root hairs [31] radicles [32], hypocotyls [6], and expand- abundance at Full Open and First Fold, and a greater ing fruit [23]. abundance at Stigma Fall and Senesced; the MjExp6 As our study focused on native expansin expression in probe identified the opposite pattern. untreated flowers, we used a M. jalapa gene known to The N-terminal expression profiles suggest that ex- be responsive to exogenous auxin (MjAux/IAA1)to pansin expression is coordinated by at least two estimate a temporal pattern for endogenous auxin different molecular programs during the later stages of T.E. Gookin et al. / Plant Science 164 (2003) 769/781 779 floral development, and the data produced by the gene b-expansin expression in general, is clearly inversely specific probes demonstrate that individual genes are related to expansive growth. differentially regulated within these larger frameworks. Gene duplication is a well-known phenomenon, and The diametrically opposing patterns of the two pro- our results show cMjExpB2 and MjExpB3 most likely posed programs suggest that each group of expansins derived from MjExpB1 in two independent gene dupli- play different roles during floral development; it may be cation events. Pairwise distance analysis indicated these that the two groups are localized in different cell types transcripts are most closely related to the Ath-Exp b-2 and/or cell layers. The majority of a-expansins upregu- cluster of intronless b-expansins (data not shown), and lated at First Fold may, for example, be produced in the genomic sequencing showed cMjExpB2 was transcribed outer circumferential cell layers of the calyx, and the from an intronless gene. Subsequently, it is unclear if activity of their encoded proteins may facilitate tissue cMjExpB2 arose through the retrotransposition of a infolding. It is more difficult to speculate about the processed MjExpB1 transcript, or by simple genomic function of the senescence-specific expansins. These duplication. Regardless of the duplication method, the senescence-specific transcripts may encode highly spe- absence of the highly conserved GGACGY motif and cialized proteins that function to modify components the lack of a cell wall localizing signal peptide are highly previously not present in the wall, or alternatively, they suggestive that the cMjExpB2 transcript yields a non- may be less specific, and function to indiscriminately functional protein. There is only limited information destroy the integrity of the cell wall. The second about plant pseudogenes in the literature, but recently explanation seems possible given that the calyx begins an Arabidopsis myrosinase pseudogene (TGG3) was to rapidly degrade after the Senesced stage, and the shown to be expressed only in flowers; not in leaves like flower quickly reaches the point of abscission. the functional TGG1 and TGG2 transcripts [43]. The near identity of the three b-expansin sequences The MjExpB3 transcript is predicted to encode a made it impossible to utilize their 3?UTRs to discrimi- truncated protein that still retains all of the conserved nate functional b-expansin gene expression from pseu- N-terminal region, as well as one undisturbed potential dogene expression. To determine if the 5 UTR / was a ? N-glycosylation site. This truncation is due to a 209 bp viable way to discern MjExpB1 from MjExpB3 (which deletion that has two remarkable features. The 5? border may have retained a faithful copy of the MjExpB1 of the deletion begins immediately after the VEYKR 5?UTR), we performed RT-PCR analysis using 3?- residues of the deduced amino acid sequence. Multiple¯ RACE. This analysis consistently identified MjExpB1 alignments with other expansins indicate these residues as the dominate reaction product, and the lower align with the residues IDYFP of Ath-Expg-1.1 molecular weight product of MjExpB3 was negligible ¯ (CAB79756) and VVYTP of Ath-Expg-1.2 to undetectable on ethidium bromide stained gels (data (AADO8935) described by¯ Li et al. [26] (otherwise not shown). We presume the contribution of MjExpB3 known as p12-like proteins to reflect their untested during Northern analysis is also negligible, and conclude functional characteristics [44]). This alignment is sig- the 5?UTR/ expression patterns reflect MjExpB1 expression. nificant in that both ‘g-expansin’ sequences are pre- MjExpB1 was found to be preferentially expressed in dicted to produce a truncated protein due to a the developing bud prior to anthesis during the slow premature termination of their open reading frames linear period of growth, and was not directly linked to one codon downstream of the proline [26]. This correla- any obvious morphological changes in the flower. This tion between the MjExpB3 truncation and the Arabi- expression of pattern is consistent with the observation dopsis thaliana ‘g-expansin’ truncations may be entirely that b-expansins are less effective than a-expansins in coincidental, but raises the intriguing possibility that all stress relaxation of dicotyledonous cell walls [40] and three of these genes are pseudogenes due to mutations in may indicate MjEXPB1 functions to effect subtle a distinct location. Interestingly, the 3? border of the changes in cell wall architecture. Although MjExpB1 MjExpB3 deletion occurs near or within the 15 bp SNP expression did not show any correlation with either of region identified using the MjExpB1 and cMjExpB2 the two expression profiles identified for a-expansins, or sequences. The exact position of the deletion is difficult with the Aux/IAA profile, its up-and-down expression to determine because the borders of the deletion fall does correlate with the reported endogenous levels of within A4GG repeats. The close proximity of the two gibberellins in M. jalapa flowers [41]. Gibberellins are SNPs to the downstream repeat and the deletion border known to induce plant growth and have previously been suggests this region may be a mutational hotspot. While shown to induce expansins [5,42]. MjExpB1 may be it is clear that cMjExpB2 is a pseudogene, the positively regulated by gibberellins, but the downregula- functionality of MjExpB3 is unclear, and as such, we tion observed in both the calyx and the developing fruit prefer to refrain from designating MjExpB3 as a demonstrate that MjExpB1, and possibly M. jalapa pseudogene. 780 T.E. Gookin et al. / Plant Science 164 (2003) 769/781

Acknowledgements [16] X. Xia, Data Analysis in Molecular Biology and Evolution, Kluwer Academic Publishers, Boston/Dordrecht/London, 2000. [17] S. Kumar, K. Tamura, I.B. Jakobsen, M. Nei, MEGA2: molecular This study was supported by a grant from the evolutionary genetics analysis software, Bioinformatics 17 (2001)

American Floral Endowment. 1244/1245. [18] D.J. Cosgrove, Enzymes and other agents that enhance cell wall Note added in proof extensibility, In: Ann. Rev. Plant Physiol. Plant Mol. Biol. (1999) 391/417. In accordance with the nomenclature set forth by Li et [19] I.L. Ingelbrecht, C.I. Mandelbaum, T.E. Mirkov, Highly sensitive northern hybridization using a rapid protocol for downward al. [26], we have changed the annotation for MjExpB1, alkaline blotting of RNA, Biotechniques 25 (1998) 420/425. MjExpB2, and MjExpB3 to MjExpB-2.1, MjExpB-2.2, [20] G.M. Church, W. Gilbert, Genomic sequencing, Proc. Natl. and MjExpB-2.3 (respectively). This change in descrip- Acad. Sci. USA 81 (1984) 1991/1995. tor clariﬁes the phylogenetic relationship of the Mir- [21] S.F. Altschul, W. Gish, W. Miller, E.W. Myers, D.J. Lipman, abillis jalapa beta-expansin sequences to other sequences Basic local alignment search tool, J. Mol. Biol. 215 (1990) 403/ 410. in the expansin gene family. [22] S.M. Hebsgaard, P.G. Korning, N. Tolstrup, J. Engelbrecht, P. Rouze, S. Brunak, Splice site prediction in Arabidopsis thaliana pre-mRNA by combining local and global sequence information,

Nucl. Acids Res. 24 (1996) 3430/3452. [23] C. Catala, J.K.C. Rose, A.B. Bennett, Auxin-regulated genes References encoding cell wall-modifying proteins are expressed during early

tomato fruit growth, Plant Physiol. 122 (2000) 527/534. [1] D.J. Cosgrove, Wall structure and wall loosening. A look [24] B.M. Link, E.R. Wagner, D.J. Cosgrove, The effect of a backwards and forwards, Plant Physiol. 125 (2001) 131/134. microgravity (space) environment on the expression of expansins [2] S. McQueen-Mason, D.M. Durachko, D.J. Cosgrove, Two from the peg and root tissues of Cucumis sativus, Physiol. Plant endogenous proteins that induce cell wall extension in plants, 113 (2001) 292/300. Plant Cell 4 (1992) 1425/1433. [25] A.J. Mighell, N.R. Smith, P.A. Robinson, A.F. Markham, [3] D.J. Cosgrove, Expansive growth of plant cell walls, Plant Vertebrate pseudogenes, FEBS Lett. 468 (2000) 109/114. Physiol. Biochem. 38 (2000) 109/124. [26] Y. Li, C.P. Darley, V. Ongaro, A. Fleming, O. Schipper, S.L. [4] Y. Wu, R.B. Meeley, D.J. Cosgrove, Analysis and expression of Baldauf, S.J. McQueen-Mason, Plant expansins are a complex the alpha-expansin and beta-expansin gene families in maize, multigene family with an ancient evolutionary origin, Plant Plant Physiol. 126 (2001) 222/232. Physiol. 128 (2002) 854/864. [5] F. Chen, K.J. Bradford, Expression of an expansin is associated [27] O. Matzura, A. Wennborg, RNAdraw: an integrated program for with endosperm weakening during tomato seed germination, RNA secondary structure calculation and analysis under 32-bit Plant Physiol. 124 (2000) 1265/1274. MICROSOFT WINDOWS, Comput. Appl. Biosci. (CABIOS) 12 [6] K.-H. Im, D.J. Cosgrove, A.M. Jones, Subcellular localization of (1996) 247/249. expansin mRNA in xylem cells, Plant Physiol. 123 (2000) 463/ [28] T. Panavas, P.D. Reid, B. Rubinstein, Programmed cell death of 470. daylily petals: activities of wall-based enzymes and effects of heat [7] J.K.C. Rose, H.H. Lee, A.B. Bennett, Expression of a divergent shock, Plant Physiol. Biochem. 36 (1998) 379/388. expansin gene is fruit-specific and ripening-regulated, Proc. Natl. [29] E.M. O’Donoghue, S.D. Somerfield, J.A. Heyes, Organization of Acad. Sci. USA 94 (1997) 5955/5960. cell walls in Sandersonia aurantiaca floral tissue, J. Exp. Bot. 53 [8] J.K.C. Rose, D.J. Cosgrove, P. Albersheim, A.G. Darvill, A.B. (2002) 513/523. Bennett, Detection of expansin proteins and activity during [30] J.A. Roberts, C.A. Whitelaw, Z.H. Gonzalez-Carranza, M.T. tomato fruit ontogeny, Plant Physiol. 123 (2000) 1583/1592. McManus, Cell separation processes in plants: models, mechan- [9] A. Le Duc, A revision of Mirabilis section Mirabilis (Nyctagina- isms and manipulation, Ann. Bot. 86 (2000) 223/235. ceae), SIDA Contributions Bot. 16 (1995) 613/648. [10] R.W. Cruden, Reproductive biology of weedy and cultivated [31] H.T. Cho, D.J. Cosgrove, Regulation of root hair initiation and expansin gene expression in arabidopsis, Plant Cell 14 (2002) mirabilis nyctaginaceae, Am. J. Bot. 60 (1973) 802/809. [11] D. Reinhardt, F. Wittwer, T. Mandel, C. Kuhlemeier, Localized 3237/3253. upregulation of a new expansin gene predicts the site of leaf [32] F. Chen, P. Dahal, K.J. Bradford, Two tomato expansin genes show divergent expression and localization in embryos during formation in the tomato meristem, Plant Cell 10 (1998) 1427/ 1437. seed development and germination, Plant Physiol. 127 (2001) [12] A.J. Michael, A cDNA from pea petals with sequence similarity 928/936. to pollen allergen, cytokinin-induced and genetic tumour-specific [33] E. Liscum, J.W. Reed, Genetics of Aux/IAA and ARF action in genes: identification of a new family of related sequences, Plant plant growth and development, Plant Mol. Biol. 49 (2002) 387/

Mol. Biol. 30 (1996) 219/224. 400. [13] T.A. Wilkins, L.B. Smart, Isolation of RNA from plant tissue, In: [34] B.M. Link, D.J. Cosgrove, Acid-growth response and alpha- P.A. Kreig, (Ed.), A Laboratory Guide to RNA: Isolation, expansins in suspension cultures of bright yellow 2 tobacco, Plant

Analysis, and Synthesis, 1996, pp. 21/41. Physiol. 118 (1998) 907/916. [14] H. Nielsen, J. Engelbrecht, S. Brunak, G. von Heijne, Identiﬁca- [35] K.W. Hutchison, P.B. Singer, S. McInnis, C. Diaz-Sala, M.S. tion of prokaryotic and eukaryotic signal peptides and prediction Greenwood, Expansins are conserved in conifers and expressed in of their cleavage sites, Prot. Eng. 10 (1997) 1/6. hypocotyls in response to exogenous auxin, Plant Physiol. 120 [15] J.D. Thompson, T.J. Gibson, F. Plewniak, F. Jeanmougin, D.G. (1999) 827/831. Higgins, The CLUSTAL-X windows interface: ﬂexible strategies for [36] P.M. Civello, A.L.T. Powell, A. Sabehat, A.B. Bennett, An multiple sequence alignment aided by quality analysis tools, Nucl. expansin gene expressed in ripening strawberry fruit, Plant

Acids Res. 25 (1997) 4876/4882. Physiol. 121 (1999) 1273/1279. T.E. Gookin et al. / Plant Science 164 (2003) 769/781 781

[37] D.A. Brummell, M.H. Harpster, P. Dunsmuir, Differential [41] Y. Murakami, The role of gibberellins in the growth of ﬂoral

expression of expansin gene family members during growth organs of Mirabilis jalapa, Plant Cell Physiol. 16 (1975) 337/345. and ripening of tomato fruit, Plant Mol. Biol. 39 (1999) 161/ [42] Y. Lee, H. Kende, Expression of beta-expansins is correlated with 169. internodal elongation in deepwater rice, Plant Physiol. 127 (2001)

[38] Y. Lee, H. Kende, Expression of alpha-expansin and expansin- 645/654. like genes in deepwater rice, Plant Physiol. 130 (2002) 1396/1405. [43] J. Zhang, B. Pontoppidan, J. Xue, L. Rask, J. Meijer, The third [39] D. Caderas, M. Muster, H. Vogler, T. Mandel, J.K.C. Rose, S. myrosinase gene TGG3 in Arabidopsis thaliana is a pseudogene McQueen-Mason, C. Kuhlemeier, Limited correlation between speciﬁcally expressed in stamen and petal, Physiol. Plant 115

expansin gene expression and elongation growth rate, Plant (2002) 25/34. Physiol. 123 (2000) 1399/1413. [44] D.J. Cosgrove, L.C. Li, H.-T. Cho, S. Hoffmann-Benning, R.C. [40] D.J. Cosgrove, Cell wall loosening by expansins, Plant Physiol. Moore, D. Blecker, The growing world of expansins, Plant Cell

118 (1998) 333/339. Physiol. 43 (2002) 1436/1444.