Type I Collagen During Lung Fibrosis Fibrocytes Are Not an Essential

Home , Fibrosis

Fibrocytes Are Not an Essential Source of Type I Collagen during Lung Fibrosis Kathryn R. Kleaveland, Miranda Velikoff, Jibing Yang, Manisha Agarwal, Richard A. Rippe, Bethany B. Moore and This information is current as Kevin K. Kim of September 23, 2021. J Immunol 2014; 193:5229-5239; Prepublished online 3 October 2014; doi: 10.4049/jimmunol.1400753

http://www.jimmunol.org/content/193/10/5229 Downloaded from

Supplementary http://www.jimmunol.org/content/suppl/2014/10/02/jimmunol.140075 Material 3.DCSupplemental http://www.jimmunol.org/ References This article cites 59 articles, 9 of which you can access for free at: http://www.jimmunol.org/content/193/10/5229.full#ref-list-1

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

by guest on September 23, 2021 • No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2014 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

Fibrocytes Are Not an Essential Source of Type I Collagen during Lung Fibrosis

Kathryn R. Kleaveland,* Miranda Velikoff,* Jibing Yang,* Manisha Agarwal,* Richard A. Rippe,† Bethany B. Moore,* and Kevin K. Kim*

Progressive fibrosis involves accumulation of activated collagen-producing mesenchymal cells. Fibrocytes are hematopoietic- derived cells with mesenchymal features that potentially have a unique and critical function during fibrosis. Fibrocytes have been proposed as an important direct contributor of type I collagen deposition during fibrosis based largely on fate-mapping studies. To determine the functional contribution of hematopoietic cell-derived type I collagen to fibrogenesis, we use a double-transgenic system to specifically delete the type I collagen gene across a broad population of hematopoietic cells. These mice develop a robust fibrotic response similar to littermate genotype control mice injured with bleomycin indicating that fibrocytes are not a necessary source of type I collagen. Using collagen–promoter GFP mice, we find that fibrocytes express type I collagen. However, fibrocytes Downloaded from with confirmed deletion of the type I collagen gene have readily detectable intracellular type I collagen indicating that uptake of collagen from neighboring cells account for much of the fibrocyte collagen. Collectively, these results clarify several seemingly conflicting reports regarding the direct contribution of fibrocytes to collagen deposition. The Journal of Immunology, 2014, 193: 5229–5239.

ibrosis is a common feature of many systemic inflamma- matrix proteins and eventual replacement with fibrillar collagens http://www.jimmunol.org/ tory conditions and can also occur as a primary progres- derived from activated fibrogenic cells. Initiation of these events F sive disease. Fibrosis can lead to organ dysfunction and can occur through recruitment of circulating cells with fibrogenic significant morbidity. Collectively, fibrosis is the leading cause of potential into the microenvironment, proliferation and activation death in developed countries. Idiopathic pulmonary fibrosis is the of quiescent fibroblasts, and transdifferentiation of structural cells most common primary fibrotic lung disorder, affecting .5 million into fibroblast-like cells. The original paradigm assumed that the people worldwide. The median survival of patients with this con- accumulated activated fibroblasts were derived from proliferation dition is 3–5 y from the time of diagnosis and current medical and activation of quiescent resident tissue fibroblasts. However, therapy is largely ineffective (1–5). Unfortunately, despite intense recently other possibilities for the origin of collagen producing by guest on September 23, 2021 investigation, we still have a poor understanding of the pathogenesis cells have been proposed including epithelial cells, endothelial of tissue fibrosis and fibrotic diseases are difficult to treat. Recent cells, pericytes, mesenchymal stem cells, and fibrocytes (7–14). evidence suggests that fibrogenesis is more complex than originally Differentiating among these possibilities is important because thought and involves activation of and coordination of many cells pathways leading to their activation may be distinct. There is sig- types that contribute directly and indirectly to fibrogenesis. A more nificant overlap in mechanisms of activation of fibroblasts, epi- thorough delineation of the processes that underlie fibrogenesis thelial cells, endothelial cells, and pericytes. For example, TGF-b requires the investigation of novel pathways and cell types. is the most well established cytokine leading to fibroblast to Fibrosis is characterized by accumulation of activated fibroblasts myofibroblast transition and epithelial to mesenchymal transition and excessive deposition of fibrotic extracellular matrix proteins, (15, 16). Most, if not all, factors promoting mesenchymal transition especially type I collagen. Extensive research has focused on of epithelial and endothelial cells have also been studied in models mechanisms of type I collagen synthesis by fibroblasts. However, of fibroblast activation. Fibrocyte recruitment may be unique in the origin of type I collagen secreting cells remains unclear and their ability to respond to a number of cytokines and chemokines controversial (6). Injury leads to sequential remodeling of the typically associated with activation of inflammatory cells (17). extracellular matrix with rapid replacement by plasma derived Fibrocytes are hematopoietic bone marrow–derived cells that express both fibroblast and leukocyte markers. They circulate in *Division of Pulmonary and Critical Care Medicine, Department of Internal Medi- peripheral blood and can be isolated from many tissues including cine, University of Michigan, Ann Arbor, MI 48109; and †National Institute on Alcohol Abuse and Alcoholism, National Institutes of Health, Bethesda, MD 20892 the lung. Cultured fibrocytes have been shown to express a number of fibrotic extracellular matrix proteins including collagen I, col- ORCID: 0000-0003-3051-745X (B.B.M.). lagen III, and fibronectin (17–21). In addition, fibrocytes maintain Received for publication March 24, 2014. Accepted for publication September 8, 2014. expression of common leukocyte markers including CD45, CD13, This work was supported by National Institutes of Health Grants R01 HL108904 (to and CD34. Fibrocytes have been shown to secrete a number of K.K.K.) and R01 HL115618 (to B.B.M.). profibrotic cytokines that could potentially help orchestrate fibro- Address correspondence and reprint requests to Dr. Kevin K. Kim, 109 Zina Pitcher genesis. Importantly, fibrocytes express a number of chemokine Place, BSRB 4061, Ann Arbor, MI 48109. E-mail address: [email protected] receptors, including CXCR4, CCR7, and CCR2, which likely The online version of this article contains supplemental material. mediate recruitment and activation of fibrocytes to areas of tissue Abbreviations used in this article: Col-GFP, collagen-GFP; MSC, mesenchymal damage (22–24). Thus, recruitment of fibrocytes to sites of injury stem/stromal cell. suggests an important transition from inflammation to fibrogenesis Copyright Ó 2014 by The American Association of Immunologists, Inc. 0022-1767/14/$16.00 with the ability of fibrocytes to respond to inflammatory cytokines, www.jimmunol.org/cgi/doi/10.4049/jimmunol.1400753 5230 FIBROCYTE-DERIVED COLLAGEN I DOES NOT PROMOTE LUNG FIBROSIS

produce fibrotic extracellular matrix proteins, and foster further plemented with 10% FBS in a 37˚C, 5% CO2 incubator allowing primary activation of fibroblasts and other cell types (17). Although several lung mesenchymal cell outgrowth over 2–4 wk. Primary mesenchymal reports indicate that fibrocytes express type I collagen, others have cells were analyzed between passages 2-4 and within 4 wk of isolation. In some experiments, primary lung mesenchymal cells from col1a1fl/fl mice suggested that uptake of secreted type I collagen by hematopoietic were treated with adenovirus encoding Cre (50 PFU/cell) (37). cells accounts for the fibrocyte population (25, 26). Thus, whether fibrocytes contribute to matrix accumulation via direct or indirect Isolation of whole lung single cell suspension mechanisms remains unclear. Whole-lung single-cell suspensions were prepared as described previously Prior studies on the origin of fibrogenic effector cells have relied (22, 40, 41). In brief, mice were euthanized at the time points indicated. primarily on generation of fate-mapping chimeric mice by either Lungs were perfused with PBS, excised, and minced as above. Minced lungs were incubated in digestion solution containing collagenase (1 mg/ml) transplanting bone marrow from a transgenic reporter mouse into and DNase (25 U/ml) in RPMI 1640 medium at 37˚C for 30 min. Samples a wild-type mice or by crossing cell type–specific Cre mice with were dispersed by passing up and down 20 times with a 10-ml syringe. transgenic lox-stop-lox reporter mice. Following induction of fi- After pelleting, supernatants were decanted, and hypotonic shock was brosis, the genetically labeled cells are then costained for mark- performed to remove RBCs. Samples were washed once with RPMI 1640 ers of activated fibroblasts, such as a-smooth muscle actin. medium. Cells were isolated from the crude digest by passing through a 40-mm cell strainer. The cells were washed in 40% percoll and then However, fate-mapping studies have only led to further controversy. resuspended in RPMI 1640 medium. Immediately after isolation, purified For example, there are contrasting reports on occurrence of the whole lung single cell suspensions were used for further analysis. fibrocyte–myofibroblast transition, epithelial–mesenchymal and Flow cytometry and cell sorting pericyte–myofibroblast transition in models of fibrosis (12–14,

27–35). Furthermore, myofibroblasts are unlikely to be the only Primary lung mesenchymal cells and whole-lung single-cell suspensions Downloaded from collagen-producing cells during fibrogenesis (36). Finally al- were analyzed by flow cytometry as described previously (22, 23). Resuspended cells were incubated in blocking buffer containing 1% BSA though fate-mapping and costaining for extracellular matrix pro- and anti-CD16/32 Ab in PBS for 30 min. Cells were then incubated with tein markers demonstrate some capacity of the labeled cell type to fluorescent-conjugated CD45 and CD11b Abs in blocking buffer for express fibrotic matrix proteins, fate-mapping studies have a lim- 30 min. In some experiments, cells were fixed and permeabilized with ited ability to determine the quantitative and functional contri- Cytofix/Cytoperm, according to the manufacturer’s protocol. Cells were then stained with rabbit anti-collagen I Ab or rabbit IgG isotype control in bution of different cell types to accumulation of fibrotic matrix http://www.jimmunol.org/ Perm wash buffer for at least one hour. After washing cells were stained proteins. An alternative approach is to delete genes important for with fluorescent-conjugated anti-rabbit secondary Ab and analyzed by flow the function of fibrogenic cells within specific cell populations. cytometry using an Attune Flow Cytometer (Life Technologies). Cells In this study, we investigate the possibility that hematopoietic were sorted using a MoFlo Astrios (Beckman Coulter) or using anti-CD45 cells are a major contributor to type I collagen deposition during magnetic beads and the MACS Cell Separation system as previously described (22). Flow data were analyzed using FloJo (Treestar) software. lung fibrogenesis using mice in which the col1a1 gene has been specifically deleted within hematopoietic cells. Collagen uptake assay Equal numbers of wild-type primary murine lung mesenchymal cells were Materials and Methods plated on 6-well plates (42). After 24 h, cells were treated with FITC- Mice conjugated type I collagen (50 mg/ml). After 0, 10, 30, or 90 min, cells by guest on September 23, 2021 were washed with PBS to remove free collagen-FITC. Resuspended cells The floxed col1a1 mice in a C57BL/6 background are described previ- were then stained with PE-conjugated anti-CD45 and analyzed for CD45 ously (37). Vav-iCre mice are from The Jackson Laboratory (38). Type I and FITC by flow cytometry as above. In some experiments, cell surface collagen-GFP (Col-GFP) reporter mice are described previously (39). collagen-FITC was quenched with trypan blue (200 mg/ml) prior to flow Mice were genotyped by PCR. Six- to 8-wk-old mice were given 50 ml cytometry analysis as described previously (42–44). intratracheal injections of saline or bleomycin (2 U/kg) dissolved in saline via surgical tracheotomy (37). At various time points after injection, mice H&E staining and Masson’s trichrome assay were euthanized, and samples were collected for analysis. All mice were bred and maintained in a specific pathogen-free environment, and all an- Lungs from sacrificed mice were inflated to 25 cm H2O pressure and fixed imal experiments were approved by the University Animal Care and Use with formaldehyde. Lungs were embedded in paraffin, sectioned and Committee at University of Michigan. stained with H&E and Masson’s trichrome by the McClinchey Histology Lab (Stockbridge, MI). Lung sections were visualized on an Olympus BX-51 Reagents microscope, and images were captured with an Olympus DP-70 camera (37). Bleomycin was purchased from Millipore (Billerica, MA). Biotin-con- Immunofluorescence staining jugated rat anti-mouse CD16/32 and CD45 Abs, PE- and Cy7-conjugated anti-mouse CD45 Ab, FITC-conjugated anti-mouse CD11b Ab, Primary lung mesenchymal cells from wild-type mice were seeded on and Cytofix/Cytoperm and Perm wash were from BD Biosciences (San Jose, chamber slides (27, 37, 45, 46). After 24 h, cells were fixed, permeabilized, CA). Anti-mouse CD45 magnetic beads and MACS Cell Separation columns and stained for the proteins indicated as described previously. Stained were purchased from Miltenyi Biotec (San Diego, CA). Collagen I Ab was slides were visualized as above. purchased from Rockland (Gilbertsville, PA). HRP-conjugated secondary Abs were obtained from Santa Cruz Biotechnologies (Santa Cruz, CA). Colla- Hydroxyproline assay and bronchoalveolar lavage genase A was purchased from Roche (Indianapolis, IN). Alexa Fluor–con- Bronchoalveolar lavage samples were obtained and quantified on a hemo- jugated secondary Abs and fluorescein-conjugated type I collagen were cytometer as described previously. Hydroxyproline was measured by methods obtained from Life Technologies (Grand Island, NY). Rabbit IgG isotype described previously (37, 46, 47). Briefly, homogenates from both lungs were control Ab was purchased from Southern Biotechnology Associates incubated in 12 N HCl for at least 16 h at 120˚C. After addition of citrate (Birmingham, AL). Collagen III Ab was from Abcam (Cambridge, MA). buffer and chloramine T solutions, samples were incubated for 20 min. Then, LAMP1 Ab was from the University of Iowa Developmental Studies Erlich’s solution was added to the mixture and incubated for an additional Hybridoma Bank. Adenoviruses expressing Cre was from the University of 15 min at 65˚C. The absorbance at 540 nm was measured, and the hydroxy- Iowa Gene Transfer Vector Core Facility. All other reagents were purchased proline concentration was determined against a hydroxyproline standard curve. from Sigma-Aldrich (St. Louis, MO). Isolation of primary mouse lung mesenchymal cells Gene expression analysis Primary lung mesenchymal cells were isolated as described previously (22). mRNA was isolated from cells and tissue with TRIzol (Invitrogen), Briefly, 6- to 10-wk-old uninjured or bleomycin-injured mice were sacri- according to the manufacturer’s protocol. Reverse transcription was per- ficed, and lungs were perfused with PBS. Lungs were removed and minced formed with SuperScript III First-strand synthesis kit (Invitrogen), and RT- to ∼1-mm cubed pieces. Minced lungs were maintained in DMEM sup- PCR was performed to using the POWER SYBR Green PCR MasterMix The Journal of Immunology 5231

Kit (Applied Biosystems) and Applied Biosystems 7000 sequence detec- cells (fibroblasts) and ∼25% (10–50%) CD45-positive fibrocytes. tion system. The relative expression levels of col1a1 in fold changes were We confirmed expression of type I collagen, a mesenchymal b calculated against -actin or GAPDH as described previously (37, 46). marker, within both populations by several techniques. The CD45- DNA analysis positive and -negative populations were sorted and analyzed by immunoblot and compared with alveolar macrophages as a nega- DNAwas isolated from cells by proteinase K digestion. PCR primers within the floxed portion of the floxed col1a1 gene (exon2 2-5) were as follows: tive control. As expected, both CD45-positive and -negative cells forward, 59-AGTCAGCTGCATACACAATGGCCT-39, and reverse, 59- had type I collagen protein compared with undetectable levels of ATACGATGCTTACCCTTGGGCCTT -39. Equal loading of DNA for PCR collagen I in alveolar macrophages (Fig. 1). There were greater was confirmed using primers from an adjacent region outside the floxed levels of type I collagen in the CD45-negative population com- portions (exon 6): forward, 59-AGAGACCGAGGAGCAGAATA-39, and reverse, 59-CAGTCCAGTGTTTCTCCCTAAA-39. PCR products were pared with the CD45-positive population consistent with prior separated on agarose gels and visualized using a UVP transilluminator observations (22). Type I collagen protein in fibroblasts and fibro- (UVP). Quantitative PCR analysis of the floxed col1a1 exons 2–5 was cytes was further verified by coimmunostaining for CD45 and determined using the POWER SYBR Green PCR MasterMix Kit (Applied type I collagen. Again, both populations stained for type I colla- Biosystems) and Applied Biosystems 7000 sequence detection system. gen but there was greater type I collagen within CD45-negative Relative amount of col1a1 exons 2–5 were calculated against col1a1 exon 6. fibroblasts. Finally, to ensure expression of type I collagen within Immunoblot CD45-positive fibrocytes, we used a previously described type I Immunoblot of protein lysate was performed as described previously (27, collagen promoter-GFP (Col-GFP) reporter mouse (39). Activa- 37, 45, 46). Scanned immunoblots are representative of at least three tion of the type I collagen promoter within fibroblasts and fibro- separate experiments. In some experiments, densitometry was quantified cytes was confirmed by isolating primary lung mesenchymal cells Downloaded from by ImageJ as described previously (37, 46). from wild-type and Col-GFP mice. After 2 wk in culture cells Statistical analysis were stained for CD45-expression and analyzed by flow cytometry. CD45-positive and CD45-negative lung mesenchymal cells Data are expressed as mean 6 SEM. The two-tailed Student t test was used to determine differences between groups. A p value , 0.05 was accepted from Col-GFP mice had significantly greater FL1 (GFP) signal as significant. compared with wild-type cells indicating type I collagen promoter

activity within cultured fibroblasts and fibrocytes (Fig. 2). Con- http://www.jimmunol.org/ Results sistent with the above results, CD45-negative cells had greater Primary lung mesenchymal cells contain CD45-positive, FL1 signal compared with CD45-positive population indicating collagen I expressing cells greater activation of the collagen I promoter within fibroblasts. Collectively, these results indicate that primary lung mesenchymal We and others have shown that primary fibroblast-like mesen- cells contain a mixture of CD45-negative/collagen I–positive fibro- chymal cells derived from outgrowth of minced lung tissue contain blasts and CD45-positive/collagen I–positive fibrocytes. a subpopulation of fibrocytes that have a mixed hematopoietic and Generation of mice with hematopoietic deletion of type I mesenchymal phenotype and protein expression (17, 22). To verify collagen these prior observations, primary murine lung mesenchymal cells by guest on September 23, 2021 were isolated and cultured for 2 wk. Cells were stained for CD45, To determine the direct contribution of hematopoietic cells to a leukocyte common Ag present on hematopoietic cells, and an- collagen production during fibrogenesis, we used the previously fl/fl alyzed by flow cytometry. The cultured primary lung mesenchy- described floxed col1a1 (col1a1 ) mouse in which loxP sites mal cells were found to contain ∼75% (50–90%) CD45-negative flank exons 2–5 enabling permanent deletion of type I collagen

FIGURE 1. In vitro–derived lung mesenchymal cells contain a CD45-positive/collagen I–positive population. (A) Primary lung mesenchymal cells from wild-type mice were stained for CD45 and analyzed by flow cytometry. The majority of cells are CD45 negative but a substantial subset are CD45 positive. (B) The CD45-negative and -positive populations were FACS sorted and analyzed by immunoblot and compared with alveolar macrophages as a negative control. Both CD45-positive and -negative cells contained type I collagen protein, but CD45-negative cells contained significantly more. Wild-type cells were costained for type I collagen (C), CD45 (D), and merged (E) demonstrating weak type I collagen staining within CD45-positive cells (original magnification 3200). 5232 FIBROCYTE-DERIVED COLLAGEN I DOES NOT PROMOTE LUNG FIBROSIS Downloaded from http://www.jimmunol.org/ by guest on September 23, 2021

FIGURE 2. In vitro–derived lung fibrocytes express type I collagen. (A and B) Primary lung mesenchymal cells from wild-type (A) and Col-GFP (B) mice were isolated and analyzed for expression of GFP and CD45 by flow cytometry. (C) Histogram overlay of GFP expression by CD45-positive and -negative lung mesenchymal cells. (D) Quantification of GFP expression demonstrating greater GFP expression in CD45-negative fibroblasts (p , 0.01) but significant GFP within CD45-positive fibrocytes from Col-GFP mice compared with wild-type cells (p , 0.05) (n = 3). within cells expressing Cre recombinase (37). Primary lung mes- col1a1 exons compared with CD45-positive and -negative cells enchymal cells from col1a1fl/fl mice were treated in vitro with an from control mice (Fig. 4). Thus, Vav-Col mice have deletion of the adenovirus expressing Cre. After 2 wk, there was near complete col1a1 gene specifically within fibrocytes. Next, protein isolated deletion of type I collagen protein within CD45-positive and -neg- from the CD45-sorted cells were analyzed by immunoblot for type ative populations. Floxed collagen mice were then crossed with I collagen. As before, CD45-negative fibroblasts had more type I transgeneic Vav-cre mice, which have been previously reported to collagen than CD45-positive fibrocytes. Surprisingly, fibrocytes from delete floxed genes specifically within all hematopoietic cells (38). Vav-Col mice had similar amounts of type I collagen compared with Double-transgenic Vav-cre/col1a1fl/fl (Vav-Col) mice have normal fibrocytes from littermate control mice (Fig. 4), suggesting that much lung histology at baseline compared with littermate control mice of the type I collagen protein within these cells is not through lacking either the Vav-cre or the col1a1fl genes (Fig. 3). Primary transcription/translation of type I collagen but perhaps through lung mesenchymal cells were isolated from Vav-Col and littermate uptake of type I collagen secreted by the cocultured fibroblasts. control mice. After 2 wk in culture, cells were analyzed by flow Primary mesenchymal cells derived from outgrowth of minced cytometry. Vav-Col lung mesenchymal cells had similar proportions lung tissue 2 wk after intratracheal bleomycin administration of CD45-positive and -negative cells compared with lung mesen- demonstrate a similar pattern. CD45-positive fibrocytes from chymal cells from littermate control mice or wild-type mice. Cells bleomycin-injured Col-GFP mice demonstrate expression of GFP were then FACS sorted for CD45-positive and CD45-negative that is significantly less than GFP expression by CD45-negative populations and lysed for DNA and protein isolation. DNA was fibroblasts (Fig. 5A, 5B). CD45-positive fibrocytes from Vav- analyzed by PCR using primers within the floxed portion of the Col mice contain type I collagen protein despite absence of co- floxed col1a1 allele. CD45-positive cells from the Vav-Col mice l1a1 exons 2–5 DNA and col1a1 mRNA (Fig. 5C–E). demonstrated significant loss of the floxed col1a1 exons and loss of col1a1 mRNA expression indicating robust recombination/deletion Hematopoietic-deletion of collagen does not attenuate fibrosis of type I collagen within fibrocytes. In contrast, CD45-negative cells Next, Vav-Col mice and littermate genotype control mice were from Vav-Col mice demonstrated persistent levels of the floxed injured with intratracheal bleomycin or saline. After 2 wk, single- The Journal of Immunology 5233

FIGURE 3. Generation of mice with deletion of Col1a1 within hematopoietic cells. (A and B) Primary lung mesenchymal cells from floxed col1a1 (col1a1fl/fl) mice were treated with adenovirus expressing Cre recombinase in vitro leading to loss of type I collagen by flow cytometry (A) and immmunoblot (B). (C) He- matopoietic cell–specific and permanent deletion of col1a1 is achieved Downloaded from using double-transgenic mice carry- ing the Vav-Cre transgene crossed to col1a1fl/fl mice (Vav-Col). The Vav promoter yields Cre expression specifically within hematopoietic cells resulting in permanent deletion col1a1 within hematopoi- http://www.jimmunol.org/ etic cells and their derivatives. (D and E) Uninjured lungs from Vav- Col mice (E) have normal histology compared with littermate genotype control mice lacking either the Vav- Cre or floxed col1a1 allele (D). H&E (original magnification 3200). by guest on September 23, 2021

cell preparations from the injured lungs were analyzed by flow immunoblot (Fig. 7). Sorted cells were further characterized for cytometry for CD45 and intracellular type I collagen. As expected, CD11b, another common fibrocyte marker, indicating high ex- bleomycin leads to increased numbers of collagen positive cells. pression of CD11b within CD45-positive/collagen I–positive fibro- Surprisingly, Vav-Col mice and genotype control mice injured cytes from Vav-Col and littermate control mice but not within with bleomycin exhibit similar numbers of CD45/collagen I CD45-negative/collagen I–positive fibroblasts (Fig. 7F, 7G). Three double-positive cells (Fig. 6). There was a trend toward more weeks after bleomycin injury, the extent of fibrosis was deter- CD45-negative/collagen I–positive cells in Vav-Col mice, sug- mined by hydroxyproline assay and trichrome staining, and the gesting that other cell types might be compensating for loss of extent of injury was determined by bronchoalveolar lavage cell functional fibrocytes, but these differences were not statistically count. Bleomycin injury led to increased total collagen content in significant (p = 0.3). To ensure deletion of col1a1 within the CD45/ both Vav-Col mice and littermate genotype control mice. The extent collagen double-positive population, single-cell suspensions of of fibrosis and injury was similar in Vav-Col and genotype control bleomycin-injured mice were FACS sorted. DNA was immedi- mice after bleomycin injury (Fig. 8, Supplemental Fig. 1). ately isolated from the sorted cells and analyzed for recombination using primers within the floxed region. As with the in vitro Fibrocyte endocytosis of type I collagen experiments, CD45-positive/collagen I–positive cells from Vav- Our studies suggest that although hematopoietic cells have some Col mice had robust recombination/deletion of the col1a1gene capacity for activation of collagen genes, much of the type I compared with CD45-negative/collagen I–positive cells from Vav- collagen within these cells is not through production of type I Col mice and cells from genotype control mice. Furthermore, collagen but rather through uptake of collagen produced by protein and mRNA from CD45-positive and CD45-negative pop- neighboring cells. Many hematopoietic cells have a significant ulations demonstrate loss of col1a1 mRNA within Vav-Col fibro- capacity for uptake of particles and proteins through phagocytosis cytes but similar levels of collagen I and collagen III protein by and pinocytosis (25, 26). To determine the capacity of primary 5234 FIBROCYTE-DERIVED COLLAGEN I DOES NOT PROMOTE LUNG FIBROSIS

FIGURE 4. Fibrocytes from Vav-Col mice contain type I collagen protein even in the absence of type I collagen gene. (A and B) Primary lung mesenchymal cells from uninjured control (A) and Vav- Col (B) mice were FACS sorted for CD45-positive (pos) and -negative (neg) populations. The Vav-Col and littermate control mice had similar proportions of CD45-pos and -neg cells. (C) Immunoblot for type I collagen. CD45-neg cells have more type I collagen than CD45-pos cells. CD45-pos cells from control and Vav-Col mice have similar levels of type I collagen protein. (D) PCR of DNA isolated from control and Vav-Col CD45-pos and -neg cells. Pri-

mers within the floxed region of col1a1 demonstrate Downloaded from absence of exons 2–5 in Vav-Col CD45-pos cells and intact col1a1 in CD45-neg cells and cells from control mice. Primers outside of the floxed region (in exon 6) were used as a loading control. (E and F) CD45-pos cells from Vav-Col mice have less col1a1 exons 2–5 DNA (p , 0.01) by quantitative PCR (E) and less col1a1 mRNA by quantitative PCR (F) http://www.jimmunol.org/ (p , 0.05) compared with CD45-pos cells from control mice. n =4. by guest on September 23, 2021 lung mesenchymal cells to endocytose type I collagen in the space, identification of intracellular procollagen I also does not culture media, we used a purified type I collagen directly conju- necessarily indicate collagen I production by that cell (52). Notably, gated with FITC (Col-FITC) (42). Primary lung mesenchymal we find activation of the type I collagen promoter by fibrocytes cells were isolated from wild-type mice. After 2 wk in culture, using GFP-reporter mice. Collectively, our results suggest that cells were incubated with Col-FITC for 0, 10, 30, and 90 min. fibrocytes express some type I collagen, but a large portion of its After the indicated times, cells were thoroughly washed to remove intracellular collagen is through uptake from neighboring collagen- free Col-FITC, and then, cells were stained for CD45 and ana- secreting cells. lyzed by flow cytometry. Both the CD45-positive and -negative We confirm prior observations that a commonly used minced populations demonstrated increased FL1 (FITC) signaling that lung cell outgrowth protocol to generate primary lung fibroblasts increased over the 90 min indicating some capacity for Col-FITC produces a mixed population of collagen-positive lung mesen- uptake, consistent with prior reports of collagen uptake by dif- chymal cells made up of CD45-negative fibroblasts and C45-pos- ferent cell types (42, 48–51). There was significantly greater Col- itive fibrocytes (22). The resulting coculture system may crudely FITC within the CD45-positive fibrocyte population compared model the close approximation of activated fibroblasts and fibro- with the CD45-negative fibroblast population. Internalization of cytes that occurs in vivo during fibrogenesis. Both in vivo and Col-FITC was confirmed by colocalization with LAMP1, a lyso- in vitro we readily identify intracellular collagen within CD45- zomal marker, and by cell surface fluorescence quenching with positive cells despite deletion of the collagen I gene indicating trypan blue. This indicates that fibrocytes have a robust ability to uptake of fibroblast-derived type I collagen. endocytose extracellular collagen (Fig. 9, Supplemental Fig. 2). The contribution of fibrocytes to fibrogenesis remains controversial (17). Studies from fibrotic human tissue indicate that Discussion fibrocytes express some type I collagen protein and mRNA and These results demonstrate that cells of hematopoietic origin pro- that fibrocytes likely contribute to fibrogenesis (34, 53–56) Given duce type I collagen but are not a necessary source of type I col- the importance of type I collagen to fibrosis and the evidence that lagen during experimental lung fibrosis. Furthermore, using Vav-Cre fibrocytes express type I collagen, it is compelling to infer that transgenic mice to specifically delete type I collagen within collagen deposition is a major function of fibrocytes. However, the hematopoietic cells, we surprisingly find substantial intracellular importance of fibrocyte-derived type I collagen to fibrogenesis has type I collagen in fibrocytes despite confirming absence of the not been directly investigated. Several prior studies investigating col1a1 gene. As our studies clarify, identification of intracellular the contribution of fibrocytes to fibrogenesis have used reporter type I collagen does not necessarily indicate collagen I production gene chimera mice to quantify the fraction of collagen-positive by that cell. Furthermore, because procollagen I is secreted and cells of hematopoietic origin (14, 34, 35, 57). These prior studies matured into collagen I by proteolytic cleavage in the extracellular are limited in their ability to assess the functional contribution of The Journal of Immunology 5235

FIGURE 5. In vitro–derived fibrocytes from bleomycin-injured mice express type I collagen. (A and B) Two weeks after intratracheal bleomycin injury, minced lung outgrowth mesenchymal cells from wild-type and Col-GFP mice were isolated and analyzed by flow cytometry. (A) Histogram overlay of GFP expression by CD45-positive (CD45+) and CD45-negative (CD452) cells. (B) Quantification of GFP expression demonstrating greater GFP expression in CD452 fibroblasts (p , 0.01), but significant GFP within CD45+ fibrocytes from Col-GFP mice compared with wild-type cells (p , 0.05); n =4.(C–E) Two weeks after bleomycin, minced lung outgrowth mesenchymal cells from control and Vav-Col mice were sorted for CD45 and compared with alveolar macrophage

(AM) control. (C) Immunoblot for type I collagen Downloaded from demonstrating less type I collagen within CD45+ cells but similar amounts of type I collagen between CD45+ cells from control mice and Vav-Col mice. (D) DNA quantitative PCR for ﬂoxed col1a1 exons 2–5 DNA demonstrates CD45+ cells from Vav-Col mice have robust recombination compared with other samples (p , 0.01). n =4.(E) Vav-Col mice http://www.jimmunol.org/ have loss of col1a1 mRNA compared with CD45+ cells from control mice by qPCR (p , 0.05). n =4.

hematopoietic cells to collagen deposition, which involves mul- the collagen accumulation. Profibrotic cytokines released during tiple regulated steps after collagen promoter activation (translation, injury may lead to recruitment of diverse populations of potential by guest on September 23, 2021 secretion, maturation, fibrillogenesis, and so on) (52). Although fibrotic effector cells. In this model, loss of one source of type I our studies suggest that fibrocytes (and other hematopoietic cells) collagen may lead to augmented compensatory contribution of are not a necessary source of type I collagen during fibrosis, it other collagen-producing cells. Indeed, there is a suggestion of remains possible that hematopoietic cells do contribute to some of increased numbers of collagen-positive/CD45-negative cells in

FIGURE 6. Vav-Col mice have similar numbers of fibrocytes compared with genotype control mice after bleomycin. (A and B) Single-cell whole-lung preparation from control and Vav-Col mice were analyzed by flow cytometry for CD45 and type I collagen (B) or isotype control for collagen staining (A). (C) Bleomycin injury leads to increased numbers of collagen-positive cells. Bleomycin-injured Vav-Col mice have similar numbers of collagen- positive fibrocytes compared with littermate control mice (n = 4). 5236 FIBROCYTE-DERIVED COLLAGEN I DOES NOT PROMOTE LUNG FIBROSIS

FIGURE 7. Hematopoietic cell deletion of col1a1 does not affect fibrocyte type I collagen protein levels in vivo. (A) DNA was isolated from FACS-sorted CD45-positive (CD45+)/collagen I–positive and CD45-negative (CD452)/collagen I–positive cells from Vav-Col and control mice 2 wk after bleomycin injury. PCR demonstrates loss of col1a1 exons 2–5 in CD45+/collagen I–positive fibrocytes from Vav-Col mice compared with intact col1a1 in cells from genotype control mice and CD452 cells from Vav-Col mice. Primers outside the floxed region (exon 6) are Downloaded from used as a loading control. (B) Quantitative PCR DNA analysis for col1a1 exons 2–5 demonstrate significant recombination within CD45+ cells from Vav-Col mice; n =4.(C) Quantitative PCR analysis for col1a1 mRNA. CD45+ cells have less col1a1 mRNA than CD452 cells. CD45+ cells from Vav-Col mice have near complete absense of col1a1 mRNA compared http://www.jimmunol.org/ with CD45+ cells from genotype control mice (p , 0.05; n = 4). (D and E) Immunoblot (D) demonstrates similar levels of type I and type III collagen within CD45+ cells from littermate control and Vav-Col mice quantified by densitometry (E). n =4.(F and G) CD45+/collagen I–positive (CD45+/Col+) fibrocytes from littermate control (F) and Vav-Col (G) mice also coexpress CD11b compared with CD452/collagen 2 +

I–positive (CD45 /Col ) ﬁbroblasts. by guest on September 23, 2021

bleomycin-injured Vav-Col mice compared with genotype control given the likely importance of collagen signaling and collagen- mice (Fig. 6). mediated cell migration. The cellular origin of type I collagen during fibrosis remains Fibrocytes do not encompass all bone marrow–derived mesen- controversial. We recently reported that mice with deletion of type chymal cells, which include mesenchymal stem/stromal cells I collagen within alveolar epithelial cells developed less fibrosis (MSCs), which are defined, in part, as CD45 negative (58). There but have more lung injury and death compared with genotype has been controversy on whether bone marrow–derived MSCs are control mice, implying type I collagen from different cellular derived from the hematopoietic lineage or from a separate lineage. sources could have unique functions during fibrogenesis perhaps Thus, the direct contribution of bone marrow–derived MSCs to because of the unique spatial niche or timing of the collagen fibrosis remains unclear. However, one recent report using Vav- deposition (37). Indeed, we found that epithelial cell–derived Cre mice in a fate-mapping strategy found evidence of labeled type I collagen activated collagen receptor–mediated signaling on CD45-negative cells during fibrogenesis suggesting a common neighbor fibroblasts, potentially leading to augmented fibroblast origin with hematopoietic cells (59). activation. Type I collagen itself has been well studied as an ini- We found that fibrocytes have a robust capacity for type I tiator of cell signaling through a number of cell surface receptors collagen uptake. Whether uptake of collagen occurs via collagen and could coordinate mesenchymal cross-talk. The importance of receptor-mediated process or by a less specific pinocytosis mech- type I collagen from other cell types such as pericytes and mes- anism is unclear. Inhibition of several type I collagen receptors did enchymal stem cells is currently being pursued, but we believe not affect type I collagen uptake in our system (data not shown). that the contribution of type I collagen by these different cell types Uptake of collagen by fibrocytes may result in transcriptional/ will be more complicated than simply quantifying the fractional phenotypic changes within fibrocytes with potential consequences contribution to the overall collagen accumulation during fibrosis for fibrosis. Finally, fibrocyte uptake of type I collagen may be an The Journal of Immunology 5237

FIGURE 8. Mice with hematopoietic cell deletion of col1a1 are not protected from bleomycin-induced lung fibrosis. (A and B) Trichrome-stained lung sections from littermate control (A) and Vav-Col (B) mice 3 wk after bleomycin injury demonstrate robust fibrosis in both (original magnification 3400). (C) Hydroxypro- line assay from lungs of control and Vav-Col mice 3 wk after intratracheal saline or bleomycin demonstrate

similar induction of ﬁbrosis (n = 4–10). Downloaded from http://www.jimmunol.org/

important mechanism for turnover of degraded collagen I or for traditional hematopoietic and mesenchymal proteins within clearance of abundantly secreted procollagen I (26). ﬁbrocytes including cell surface receptors and secreted proteins.

Although deletion of type I collagen within fibrocytes did not These studies suggest that fibrocytes may have unique and nec- by guest on September 23, 2021 attenuate fibrosis, we did find expression of type I collagen within essary functions during fibrogenesis through paracrine activation cultured fibrocytes. Several groups have found coexpression of of other collagen-producing cells. Indeed, adoptive transfer of

FIGURE 9. Lung ﬁbrocytes readily take up FITC- conjugated collagen in vitro. (A and B) Flow cytometry of primary mesenchymal cells for CD45 and FITC without addition of FITC-conjugated collagen I (t =0) (A) or 90 min after addition of FITC-conjugated (50 mg/ml) collagen I to the culture media (t = 90) (B). (C) Overlay of t = 0 and t = 90 plots demonstrating greater uptake of FITC-conjugated collagen I in CD45-positive cells. (D) Time course of FITC-conjugated collagen I uptake demonstrating greater uptake by CD45-positive cells compared with CD45-negative cells. *p , 0.01. 5238 FIBROCYTE-DERIVED COLLAGEN I DOES NOT PROMOTE LUNG FIBROSIS

fibrocytes leads to augmented fibrosis in mice and several studies 23. Moore, B. B., L. Murray, A. Das, C. A. Wilke, A. B. Herrygers, and G. B. Toews. 2006. The role of CCL12 in the recruitment of fibrocytes and lung fibrosis. Am. have found a correlation between increased numbers of fibrocytes J. Respir. Cell Mol. Biol. 35: 175–181. and worse disease progression (23). Future studies into the func- 24. Phillips, R. J., M. D. Burdick, K. Hong, M. A. Lutz, L. A. Murray, Y. Y. Xue, tion of fibrocytes during fibrogenesis could apply a similar strat- J. A. Belperio, M. P. Keane, and R. M. Strieter. 2004. Circulating fibrocytes traffic to the lungs in response to CXCL12 and mediate fibrosis. J. Clin. Invest. egy to the one used in this report with deletion of mesenchymal 114: 438–446. genes within a hematopoietic population. 25. Madsen, D. H., S. Ingvarsen, H. J. Jurgensen,€ M. C. Melander, L. Kjøller, A. Moyer, C. Honore´, C. A. Madsen, P. Garred, S. Burgdorf, et al. 2011. The non-phagocytic route of collagen uptake: a distinct degradation pathway. J. Biol. Acknowledgments Chem. 286: 26996–27010. We thank Kelly McDonough and Zhen Geng for technical assistance. 26. Bianchetti, L., M. Barczyk, J. Cardoso, M. Schmidt, A. Bellini, and S. Mattoli. 2012. Extracellular matrix remodelling properties of human fibrocytes. J. Cell. Mol. Med. 16: 483–495. Disclosures 27. Kim, K. K., M. C. Kugler, P. J. Wolters, L. Robillard, M. G. Galvez, A. N. Brumwell, D. Sheppard, and H. A. Chapman. 2006. Alveolar epithelial cell The authors have no financial conflicts of interest. mesenchymal transition develops in vivo during pulmonary fibrosis and is regulated by the extracellular matrix. Proc. Natl. Acad. Sci. USA 103: 13180–13185. 28. Zeisberg, M., and R. Kalluri. 2004. The role of epithelial-to-mesenchymal References transition in renal fibrosis. J. Mol. Med. 82: 175–181. 1. 2000. American Thoracic Society. Idiopathic pulmonary fibrosis: diagnosis and 29. Iwano, M., D. Plieth, T. M. Danoff, C. Xue, H. Okada, and E. G. Neilson. 2002. treatment. International consensus statement. American Thoracic Society (ATS), Evidence that fibroblasts derive from epithelium during tissue fibrosis. J. Clin. and the European Respiratory Society (ERS). Am. J. Respir. Crit. Care Med. 161: Invest. 110: 341–350. 646–664. 30. DeMaio, L., S. T. Buckley, M. S. Krishnaveni, P. Flodby, M. Dubourd, A. Banfalvi, Y. Xing, C. Ehrhardt, P. Minoo, B. Zhou, et al. 2012. Ligand- 2. American Thoracic Society, and European Respiratory Society. 2002. American Downloaded from b Thoracic Society/European Respiratory Society International Multidisciplinary independent transforming growth factor- type I receptor signalling mediates Consensus Classification of the Idiopathic Interstitial Pneumonias. This joint type I collagen-induced epithelial-mesenchymal transition. J. Pathol. 226: 633– statement of the American Thoracic Society (ATS), and the European Respira- 644. tory Society (ERS) was adopted by the ATS board of directors, June 2001 and by 31. Tanjore, H., X. C. Xu, V. V. Polosukhin, A. L. Degryse, B. Li, W. Han, the ERS Executive Committee, June 2001.[Published erratum appears in 2002 T. P. Sherrill, D. Plieth, E. G. Neilson, T. S. Blackwell, and W. E. Lawson. 2009. Am. J. Respir. Crit. Care Med. 166: 426.] Am. J. Respir. Crit. Care Med. 165: Contribution of epithelial-derived fibroblasts to bleomycin-induced lung fibrosis. 277–304. Am. J. Respir. Crit. Care Med. 180: 657–665. 3. Selman, M., T. E. King, and A. Pardo, American Thoracic Society, European 32. Rock, J. R., C. E. Barkauskas, M. J. Cronce, Y. Xue, J. R. Harris, J. Liang, Respiratory Society, American College of Chest Physicians. 2001. Idiopathic P. W. Noble, and B. L. Hogan. 2011. Multiple stromal populations contribute to http://www.jimmunol.org/ pulmonary fibrosis: prevailing and evolving hypotheses about its pathogenesis pulmonary fibrosis without evidence for epithelial to mesenchymal transition. and implications for therapy. Ann. Intern. Med. 134: 136–151. Proc. Natl. Acad. Sci. USA 108: E1475–E1483. 4. Thannickal, V. J., G. B. Toews, E. S. White, J. P. Lynch, III, and F. J. Martinez. 33. Phan, S. H. 2008. Biology of fibroblasts and myofibroblasts. Proc. Am. Thorac. 2004. Mechanisms of pulmonary fibrosis. Annu. Rev. Med. 55: 395–417. Soc. 5: 334–337. 5. Meltzer, E. B., and P. W. Noble. 2008. Idiopathic pulmonary fibrosis. Orphanet 34. Schmidt, M., G. Sun, M. A. Stacey, L. Mori, and S. Mattoli. 2003. Identification J. Rare Dis. 3: 8. of circulating fibrocytes as precursors of bronchial myofibroblasts in asthma. J. 6. Scotton, C. J., and R. C. Chambers. 2007. Molecular targets in pulmonary fi- Immunol. 171: 380–389. brosis: the myofibroblast in focus. Chest 132: 1311–1321. 35.Hashimoto,N.,H.Jin,T.Liu,S.W.Chensue,andS.H.Phan.2004.Bonemarrow- 7. Kalluri, R., and E. G. Neilson. 2003. Epithelial-mesenchymal transition and its derived progenitor cells in pulmonary fibrosis. J. Clin. Invest. 113: 243–252. implications for fibrosis. J. Clin. Invest. 112: 1776–1784. 36. Zhang, K., M. D. Rekhter, D. Gordon, and S. H. Phan. 1994. Myofibroblasts and 8. Kalluri, R., and R. A. Weinberg. 2009. The basics of epithelial-mesenchymal their role in lung collagen gene expression during pulmonary fibrosis: a com- transition. J. Clin. Invest. 119: 1420–1428. bined immunohistochemical and in situ hybridization study. Am. J. Pathol. 145: by guest on September 23, 2021 9. Zeisberg, E. M., O. Tarnavski, M. Zeisberg, A. L. Dorfman, J. R. McMullen, 114–125. E. Gustafsson, A. Chandraker, X. Yuan, W. T. Pu, A. B. Roberts, et al. 2007. 37. Yang, J., S. E. Wheeler, M. Velikoff, K. R. Kleaveland, M. J. LaFemina, Endothelial-to-mesenchymal transition contributes to cardiac fibrosis. Nat. Med. J. A. Frank, H. A. Chapman, P. J. Christensen, and K. K. Kim. 2013. Activated 13: 952–961. alveolar epithelial cells initiate fibrosis through secretion of mesenchymal pro- 10. Selman, M., and A. Pardo. 2006. Role of epithelial cells in idiopathic pulmonary teins. Am. J. Pathol. 183: 1559–1570. fibrosis: from innocent targets to serial killers. Proc. Am. Thorac. Soc. 3: 364–372. 38. de Boer, J., A. Williams, G. Skavdis, N. Harker, M. Coles, M. Tolaini, T. Norton, 11. Hashimoto, N., S. H. Phan, K. Imaizumi, M. Matsuo, H. Nakashima, T. Kawabe, K. Williams, K. Roderick, A. J. Potocnik, and D. Kioussis. 2003. Transgenic K. Shimokata, and Y. Hasegawa. 2010. Endothelial-mesenchymal transition in mice with hematopoietic and lymphoid specific expression of Cre. Eur. J. bleomycin-induced pulmonary fibrosis. Am. J. Respir. Cell Mol. Biol. 43: 161–172. Immunol. 33: 314–325. 12. Humphreys, B. D., S. L. Lin, A. Kobayashi, T. E. Hudson, B. T. Nowlin, 39. Yata, Y., A. Scanga, A. Gillan, L. Yang, S. Reif, M. Breindl, D. A. Brenner, and J. V. Bonventre, M. T. Valerius, A. P. McMahon, and J. S. Duffield. 2010. Fate R. A. Rippe. 2003. DNase I-hypersensitive sites enhance a1(I) collagen gene tracing reveals the pericyte and not epithelial origin of myofibroblasts in kidney expression in hepatic stellate cells. Hepatology 37: 267–276. fibrosis. Am. J. Pathol. 176: 85–97. 40. Bhan, U., G. Trujillo, K. Lyn-Kew, M. W. Newstead, X. Zeng, C. M. Hogaboam, 13. Hung, C., G. Linn, Y. H. Chow, A. Kobayashi, K. Mittelsteadt, W. A. Altemeier, A. M. Krieg, and T. J. Standiford. 2008. Toll-like receptor 9 regulates the lung S. A. Gharib, L. M. Schnapp, and J. S. Duffield. 2013. Role of lung pericytes and macrophage phenotype and host immunity in murine pneumonia caused by resident fibroblasts in the pathogenesis of pulmonary fibrosis. Am. J. Respir. Crit. Legionella pneumophila. Infect. Immun. 76: 2895–2904. Care Med. 188: 820–830. 41. Ballinger, M. N., R. Paine, III, C. H. Serezani, D. M. Aronoff, E. S. Choi, 14. LeBleu, V. S., G. Taduri, J. O’Connell, Y. Teng, V. G. Cooke, C. Woda, T. J. Standiford, G. B. Toews, and B. B. Moore. 2006. Role of granulocyte H. Sugimoto, and R. Kalluri. 2013. Origin and function of myofibroblasts in macrophage colony-stimulating factor during gram-negative lung infection with kidney fibrosis. Nat. Med. 19: 1047–1053. Pseudomonas aeruginosa. Am. J. Respir. Cell Mol. Biol. 34: 766–774. 15. Kasai, H., J. T. Allen, R. M. Mason, T. Kamimura, and Z. Zhang. 2005. TGF-b1 induces 42. Atabai, K., S. Jame, N. Azhar, A. Kuo, M. Lam, W. McKleroy, G. Dehart, human alveolar epithelial to mesenchymal cell transition (EMT). Respir. Res. 6: 56. S. Rahman, D. D. Xia, A. C. Melton, et al. 2009. Mfge8 diminishes the severity 16. Willis, B. C., and Z. Borok. 2007. TGF-b‑induced EMT: mechanisms and of tissue fibrosis in mice by binding and targeting collagen for uptake by mac- implications for fibrotic lung disease. Am. J. Physiol. Lung Cell. Mol. Physiol. rophages. J. Clin. Invest. 119: 3713–3722. 293: L525–L534. 43. Domingo-Gonzalez, R., S. Katz, C. H. Serezani, T. A. Moore, A. M. Levine, and 17. Kleaveland, K. R., B. B. Moore, and K. K. Kim. 2014. Paracrine functions of B. B. Moore. 2013. Prostaglandin E2-induced changes in alveolar macrophage fibrocytes to promote lung fibrosis. Expert Rev. Respir. Med. 8: 163–172. scavenger receptor profiles differentially alter phagocytosis of Pseudomonas 18. Bucala, R., L. A. Spiegel, J. Chesney, M. Hogan, and A. Cerami. 1994. Circu- aeruginosa and Staphylococcus aureus post-bone marrow transplant. J. Immu- lating fibrocytes define a new leukocyte subpopulation that mediates tissue re- nol. 190: 5809–5817. pair. Mol. Med. 1: 71–81. 44. Lee, T. H., W. McKleroy, A. Khalifeh-Soltani, S. Sakuma, S. Lazarev, K. Riento, 19. Chesney, J., M. Bacher, A. Bender, and R. Bucala. 1997. The peripheral blood S. L. Nishimura, B. J. Nichols, and K. Atabai. 2014. Functional genomic screen fibrocyte is a potent antigen-presenting cell capable of priming naive T cells in identifies novel mediators of collagen uptake. Mol. Biol. Cell 25: 583–593. situ. Proc. Natl. Acad. Sci. USA 94: 6307–6312. 45. Kim, K. K., Y. Wei, C. Szekeres, M. C. Kugler, P. J. Wolters, M. L. Hill, 20. Chesney, J., C. Metz, A. B. Stavitsky, M. Bacher, and R. Bucala. 1998. Regu- J. A. Frank, A. N. Brumwell, S. E. Wheeler, J. A. Kreidberg, and lated production of type I collagen and inflammatory cytokines by peripheral H. A. Chapman. 2009. Epithelial cell a3b1 integrin links b-catenin and Smad blood fibrocytes. J. Immunol. 160: 419–425. signaling to promote myofibroblast formation and pulmonary fibrosis. J. Clin. 21. Gomperts, B. N., and R. M. Strieter. 2007. Fibrocytes in lung disease. J. Leukoc. Invest. 119: 213–224. Biol. 82: 449–456. 46. Yang, J., M. Velikoff, E. Canalis, J. C. Horowitz, and K. K. Kim. 2014. Activated 22. Moore, B. B., J. E. Kolodsick, V. J. Thannickal, K. Cooke, T. A. Moore, alveolar epithelial cells initiate fibrosis through autocrine and paracrine secretion C. Hogaboam, C. A. Wilke, and G. B. Toews. 2005. CCR2-mediated recruitment of of connective tissue growth factor. Am. J. Physiol. Lung Cell. Mol. Physiol. 306: fibrocytes to the alveolar space after fibrotic injury. Am. J. Pathol. 166: 675–684. L786–L796. The Journal of Immunology 5239

47. Bauman, K. A., S. H. Wettlaufer, K. Okunishi, K. M. Vannella, J. S. Stoolman, 54. Nihlberg, K., K. Larsen, A. Hultga˚rdh-Nilsson, A. Malmstro¨m, L. Bjermer, and S. K. Huang, A. J. Courey, E. S. White, C. M. Hogaboam, R. H. Simon, et al. G. Westergren-Thorsson. 2006. Tissue fibrocytes in patients with mild asthma: 2010. The antifibrotic effects of plasminogen activation occur via prostaglandin a possible link to thickness of reticular basement membrane? Respir. Res. 7: 50. 55. Bellini, A., M. A. Marini, L. Bianchetti, M. Barczyk, M. Schmidt, and E2 synthesis in humans and mice. J. Clin. Invest. 120: 1950–1960. 48.Bundesmann,M.M.,T.E.Wagner,Y.H.Chow,W.A.Altemeier, S. Mattoli. 2012. Interleukin (IL)-4, IL-13, and IL-17A differentially affect the T. Steinbach, and L. M. Schnapp. 2012. Role of urokinase plasminogen ac- profibrotic and proinflammatory functions of fibrocytes from asthmatic patients. tivator receptor-associated protein in mouse lung. Am. J. Respir. Cell Mol. Mucosal Immunol. 5: 140–149. 56. Isgro`, M., L. Bianchetti, M. A. Marini, and S. Mattoli. 2013. Involvement of Biol. 46: 233–239. fibrocytes in allergen-induced T cell responses and rhinovirus infections in 49. Leitinger, B., and E. Hohenester. 2007. Mammalian collagen receptors. Matrix asthma. Biochem. Biophys. Res. Commun. 437: 446–451. Biol. 26: 146–155. 57. Kisseleva, T., H. Uchinami, N. Feirt, O. Quintana-Bustamante, J. C. Segovia, 50. Kjøller, L., L. H. Engelholm, M. Høyer-Hansen, K. Danø, T. H. Bugge, and R. F. Schwabe, and D. A. Brenner. 2006. Bone marrow-derived fibrocytes par- N. Behrendt. 2004. uPARAP/endo180 directs lysosomal delivery and degrada- ticipate in pathogenesis of liver fibrosis. J. Hepatol. 45: 429–438. tion of collagen IV. Exp. Cell Res. 293: 106–116. 58. Dominici, M., K. Le Blanc, I. Mueller, I. Slaper-Cortenbach, F. Marini, 51. McKleroy, W., T. H. Lee, and K. Atabai. 2013. Always cleave up your mess: D. Krause, R. Deans, A. Keating, Dj. Prockop, and E. Horwitz. 2006. Minimal targeting collagen degradation to treat tissue fibrosis. Am. J. Physiol. Lung Cell. criteria for defining multipotent mesenchymal stromal cells. The International Mol. Physiol. 304: L709–L721. Society for Cellular Therapy position statement. Cytotherapy 8: 315–317. 52. Myllyharju, J., and K. I. Kivirikko. 2004. Collagens, modifying enzymes and 59. Suga, H., R. C. Rennert, M. Rodrigues, M. Sorkin, J. P. Glotzbach, M. Januszyk, their mutations in humans, flies and worms. Trends Genet. 20: 33–43. T. Fujiwara, M. T. Longaker, and G. C. Gurtner. 2014. Tracking the elusive 53. Cowper, S. E., and R. Bucala. 2003. Nephrogenic fibrosing dermopathy: suspect fibrocyte: identification and characterization of collagen-producing hematopoi- identified, motive unclear. Am. J. Dermatopathol. 25: 358. etic lineage cells during murine wound healing. Stem Cells 32: 1347–1360. Downloaded from http://www.jimmunol.org/ by guest on September 23, 2021

Supplemental Figure 1. Mice with hematopoietic cell deletion of col1a1 have similar injury after bleomycin compared to control mice Bronchoalveolar lavage (BAL) cells from littermate control and Vav-Col mice were collected and counted 0 (uninjured), 14, and 21 days after intratracheal bleomycin injury. Control and Vav-Col mice have similar numbers of BAL macrophages (macs) (A), lymphocytes (Lymphs) (B) and neutrophils (PMNs) (C).

Supplemental Figure 2. Internalization of FITC-collagen I. A) 90 minutes with or without FITC-conjugated collagen I (Col I-FITC) primary lung mesnchymal cells were stained for lysomsomal marker, LAMP1, demonstrating co-localization of Col I-FITC and LAMP1. B) 90 minutes after Col I-FITC treatment primary lung mesenchymal cells were analyzed by flow cytometry with and without cell surface fluorescence quenching with trypan blue.