Page 1 of 52 Diabetes

Oxidative stress inhibits healthy adipose expansion through suppression of

SREBF1-mediated lipogenic pathway

Short title: ROS inhibits healthy adipose expansion

Authors

Yosuke Okuno1, Atsunori Fukuhara1,2, Erika Hashimoto1, Hironori Kobayashi1, Sachiko

Kobayashi1,3, Michio Otsuki1, Iichiro Shimomura1

Affiliations

1Department of Metabolic Medicine, Osaka University Graduate School of Medicine, 22,

Yamadaoka, Suita, Osaka, Japan

2Department of Adipose Management, Osaka University Graduate School of Medicine, 22,

Yamadaoka, Suita, Osaka, Japan

3Department of Metabolism and Atherosclerosis, Osaka University Graduate School of

Medicine, 22, Yamadaoka, Suita, Osaka, Japan

Corresponding author

Atsunori Fukuhara; Department of Metabolic Medicine, Osaka University Graduate School

of Medicine, 22, Yamadaoka, Suita, Osaka 5650871, Japan. Phone: +81668793732;

Email: [email protected]u.ac.jp

Word count: 4453

Number of tables and figures: 8

Diabetes Publish Ahead of Print, published online April 4, 2018 Diabetes Page 2 of 52

Abstract

Recent studies have emphasized the association of adipose oxidative stress (Fat ROS) with the pathogenesis of metabolic disorders in obesity. However, the causal roles of Fat ROS in metabolic disturbances in vivo remain unclear because no mouse model has been available in which oxidative stress is manipulated targeting adipocytes. In this research, we generated two models of Fat ROSmanipulated mice and evaluated the metabolic features in dietinduced obesity. Fat ROSeliminated mice in which Cat and Sod1 were overexpressed in adipocytes exhibited adipose expansion with decreased ectopic lipid accumulation and improved insulin sensitivity. Conversely, Fat ROSaugmented mice, in which glutathione was depleted specifically in adipocytes, exhibited restricted adipose expansion associated with increased ectopic lipid accumulation and deteriorated insulin sensitivity. In the white adipose tissues of these mice, macrophage polarization, tissue fibrosis and de novo lipogenesis were significantly changed. In vitro approaches identified KDM1Amediated attenuation of

SREBF1 transcriptional activities as the underlying mechanism for the suppression of de novo lipogenesis by oxidative stress. Thus, our study uncovered the novel roles of Fat ROS in healthy adipose expansion, ectopic lipid accumulation and insulin resistance, providing the possibility for the adipocytetargeting antioxidant therapy.

Page 3 of 52 Diabetes

The prevalence of obesity and type 2 diabetes (T2DM) is increasing worldwide. T2DM is

characterized by peripheral insulin resistance and insufficient insulin release from pancreatic

beta cells. Among the drugs used for the treatment of T2DM, two agents, metformin and

PPARγ agonists, can clinically improve peripheral insulin resistance. For better treatment of

T2DM, it is important to elucidate the mechanisms of insulin resistance in obesity and to

develop insulinsensitizing drugs.

Under excess calorie intake or insufficient energy expenditure, the white adipose tissue

(WAT) stores lipids and becomes hypertrophic. Hypertrophic adipocytes impair insulin

signaling not only in these cells but also in other insulinsensitive organs through

dysregulated secretion of adipocytokines, such as ADIPOQ (1), TNF (2), IL6 (3) and RETN

(4). Recent works have demonstrated that such changes are preceded by various changes in

WAT, such as infiltration of inflammatory cells (5), endoplasmic reticulum stress (6), hypoxia

(7) and oxidative stress (8).

We reported that the presence of high levels of prooxidants, such as NADPH oxidases,

and low levels of antioxidant enzymes, such as Cat and Sod, in obese WAT resulted in high

oxidative stress, conceptualized as adipose oxidative stress (Fat reactive oxygen species

(ROS)), in mice (8) and humans (911). Many studies have suggested that Fat ROS is

involved in various pathways in metabolic syndrome, including adipocyte insulin signaling

(12), adipose inflammation (8), endoplasmic reticulum stress (13), mitochondrial function

(14), cellular senescence (15), gut microbiota (16), adiponectin (Adipoq) (8), adiponectin

receptor (AdipoR) (17) and angiotensin II signaling (18). Systemic or skeletal musclespecific

manipulation of oxidative stress in vivo, including administration of apocynin (8) or

MnTBAP (19), overexpression of Sod (19; 20) or Cat (21; 22) and glutathione depletion

(2325) showed various effects on insulin sensitivity. However, the causal role of Fat ROS in Diabetes Page 4 of 52

obesity in vivo still remains unclear because no mouse model has been available in which oxidative stress is manipulated targeting adipocytes.

We describe here the generation of mice with genetically manipulated ROS specifically in adipocytes. Elimination of Fat ROS potentiated healthy adipose expansion with decreased ectopic lipid deposition and improved insulin sensitivity. Conversely, augmented Fat ROS inhibited healthy adipose expansion with ectopic lipid accumulation and deteriorated insulin sensitivity. As a mechanism, Fat ROS accelerated adipose inflammation and adipose tissue fibrosis and inhibited de novo lipogenesis with the suppression of SREBF1 transcriptional activity through a reduction in KDM1A protein expression.

Page 5 of 52 Diabetes

Research Design and Methods

Animal models. To generate aP2Cat/SOD1 double transgenic mice, the rat Cat gene and

human SOD1 gene were amplified by PCR and were inserted into an aP2 promoter cassette.

These plasmids were microinjected into fertilized eggs from C57BL/6J mice, generating an

aP2Cat transgenic mouse and aP2SOD1 transgenic mouse. The expression of transgenes

was checked in several lines of aP2Cat transgenic and aP2SOD1 transgenic mice, and the

line with the highest expression of each transgene in WAT was selected. In the next step, the

aP2Cat transgenic and aP2SOD1 transgenic mice were crossed, and the resultant wildtype

mice and aP2Cat/SOD1 double transgenic mice were analyzed as littermates.

AdipoqCre mice were kindly provided by Dr. Rosen (26). The LacZNeo cassette was

removed from Gclc mutant mice (05085, The European Mouse Mutant Archive) by crossing

them with CAGFLPe mice (Riken). The resultant Gclc floxed mice were crossed with

AdipoqCre mice to generate AdipoqGclcknockout mice. AdipoqGclcknockout mice and

Gclc floxed mice were crossed, and the resultant AdipoqGclcknockout mice and Gclc

floxed mice were analyzed as littermates. To distinguish the floxed allele from the wildtype

allele, the following primers were used: 5’AGGAGGAGGGTGGGAAATTAC3’ and

5’GCATAACATCAAAGCCTGCAG. To distinguish null alleles from floxed alleles, the

following primers were used: 5’GTCAGCATCTCTGCTGTGGATC3’ and

5’AGGAGGAGGGTGGGAAATTAC3’.

In experiments with a high fat/high sucrose diet, the mice were fed F2HFHSD (Oriental

Yeast) from 6 weeks of age. All mice were maintained under specific pathogenfree

conditions and had free access to water and chow.

Tissue collection. The mice were anesthetized, and blood samples were collected from the

inferior vena cava. Tissues were carefully removed and snap frozen in nitrogen. Diabetes Page 6 of 52

mRNA analysis. Total RNA was isolated with SepasolRNA I Super G (Nacalai Tesque,

Kyoto, Japan) or TRI Reagent (Sigma), according to the protocol provided by the manufacturer. Firststrand cDNA was synthesized from total RNA using a Transcriptor First

Strand cDNA Synthesis Kit (Roche) and was subjected to realtime RTPCR using a Light

Cycler (Roche) according to the instructions provided by the manufacturer. Values were expressed relative to the mRNA level of Rplp0. The primers used were shown in

Supplementary Table.

Fractionation of adipose tissue and isolation of ATMs. Adipose tissues were fractionated, and adipose tissue macrophages (ATMs) were collected by FACS Aria II (BD Biosciences) as described previously (27). M1 and M2 macrophages were analyzed by FACS Aria II as described previously (28).

Measurement of enzymatic activity. Catalase and Sod activities in WAT were measured using a Catalase Assay Kit (Cayman) and a Superoxide Dismutase Assay Kit (Cayman), respectively, according to the instructions supplied by the manufacturer. Values were adjusted to the level of protein measured by a Pierce BCA Protein Assay Kit (Thermo Fisher

Scientific).

Measurement of hydrogen peroxide. Tissue hydrogen peroxide was measured using a

Hydrogen Peroxide Assay Kit (Abcam), according to the instructions supplied by the manufacturer. Values were adjusted to the level of protein measured by a Pierce BCA Protein

Assay Kit (Thermo Fisher Scientific).

Page 7 of 52 Diabetes

Measurement of tissue 8-isoprostane. Tissue 8isoprostane was extracted and measured

using an 8Isoprostane EIA Kit (Cayman) according to the protocol recommended by the

manufacturer. Briefly, tissue was lysed, incubated with potassium hydroxide, trapped with

C18 SepPak (Waters), washed with water and hexane, eluted with ethyl acetate, evaporated

and reconstituted with EIA buffer. Values were adjusted to the DNA amounts measured by the

CellTox Green Cytotoxicity Assay (Promega).

Measurement of tissue glutathione. Tissue total glutathione was measured using a

GSSG/GSH Quantification Kit (Dojindo Laboratories, Kumamoto, Japan) according to the

protocol recommended by the manufacturer. Values were adjusted to the level of protein

measured by Pierce BCA Protein Assay Kit (Thermo Fisher Scientific).

Measurement of protein carbonylation. Tissue carbonylated protein was detected using an

OxyBlot Protein Oxidation Detection Kit (Millipore) according to the protocol recommended

by the manufacturer. Blots were quantified using an ImageQuant LAS 4000 (GE Healthcare).

Morphometric analysis. Paraffin sections of WAT or brown adipose tissue (BAT) were

processed for hematoxylineosin (HE) staining and were examined under a light microscope.

Adipocyte areas were measured using a BZII Analyzer (Keyence). Paraffin sections of liver

were processed for Oil RedO staining. Paraffin sections of WAT were stained using

PicroSirius Red Stain Kit (ScyTek Laboratories) according to the protocol recommended by

the manufacturer. Stained signals were measured using a BZX Analyzer (Keyence).

Measurement of liver triglycerides and glycogen. Liver triglycerides and glycogen were

extracted and measured using a Triglyceride Etest (Wako Pure Chemical Industries) and Diabetes Page 8 of 52

Glycogen Assay Kit (Cayman), respectively, using the procedures recommended by the manufacturers. Values were adjusted to the DNA amounts measured by the CellTox Green

Cytotoxicity Assay (Promega).

Measurements of parameters in plasma. Plasma insulin, triglycerides and nonesterified fatty acids were measured using the insulin enzymelinked immunoassay kit (Morinaga),

Triglyceride Etest (Wako Pure Chemical Industries) and nonesterified fatty acids (NEFA)

Ctest (Wako Pure Chemical Industries), respectively, according to the protocols supplied by the manufacturers.

Glucose and insulin tolerance tests. Food was withheld for 4 h before glucose (1 g/kg) or insulin (1.3 units/kg) was administered intraperitoneally. Blood samples were collected from the tail vein at the indicated time intervals after injection. Blood glucose was immediately determined using the Glutest Sensor (Sanwa Kagaku Kenkyusho, Nagoya, Japan).

Measurement of tissue insulin signaling. Food was withheld for 6 h before insulin (2.6 units/kg) was administered by intraperitoneal injection. Ten minutes after the injection, the mice were sacrificed, and tissues were rapidly removed and frozen in nitrogen. Protein levels were determined by blotting with antiAkt antibody (Cell Signaling) and antiphosphoAkt antibody (Ser 473) (Cell Signaling) and, then were quantified using an ImageQuant LAS

4000 (GE Healthcare).

Cell culture. 3T3L1 mouse fibroblasts were maintained in DMEM (high glucose)/10 % FBS and were differentiated into adipocytes by treatment with dexamethasone, insulin and

3isobutyl1methylxanthine for 2 days. Page 9 of 52 Diabetes

Reagents. Doxycycline hydrochloride was purchased from Nacalai Tesque (Kyoto, Japan).

TertButyl hydroperoxide solution in water and NacetylLcysteine were purchased from

Sigma.

Retroviral infection. PlatinumE cells were transfected with pRetroXTetOn Advanced

(TaKaRa), pRetroXTightHyg (TaKaRa) harboring the mouse Cat gene and

pRetroXTightPur (TaKaRa) harboring the mouse Sod1 gene. Fortyeight hours after

transfection, the media containing the retroviruses were harvested, filtered, and transferred to

3T3L1 cells. Infected cells were selected with 200 g/ml G418, 400 g/ml hygromycin and

1 g/ml puromycin.

Measurement of intracellular ROS. Intracellular ROS were measured using a DCFDA

Cellular ROS Detection Assay Kit (Abcam) with the instructions provided by the

manufacturer.

Luciferase assay. 3xSRELuc, CMV7, CMVnuclear Srebp1a, CMVnuclear Srebp1c and

CMVnuclear Srebp2 were kindly provided by Dr. Shimano (29). 3xChoRELuc, CMVS,

CMVSChREBP and CMVSMlxγ were kindly provided by Dr. Towle (30). 3T3L1

adipocytes were transfected with these plasmids together with pRLCMV vector (Promega)

as an internal control. Twentyfour hours later, the cells were harvested and subjected to a

luciferase assay using a DualLuciferase Reporter Assay System (Promega) according to the

manufacturer’s instruction.

Diabetes Page 10 of 52

siRNA transfection. Mature 3T3L1 adipocytes were harvested and siRNA (Qiagen) were introduced by reverse transfection using Lipofectamine RNAiMAX Reagent (Thermo Fisher

Scientific) according to the instructions provided by manufacturer.

Measurement of KDM1A protein. Cells or adipose tissues were lysed with TNE buffer, and the lysates were subjected to western blotting with antibodies to KDM1A (ab17721, Abcam) and ACTB (A5441, Sigma).

Statistics. Data are presented as the mean ± SEM. Differences between groups were analyzed by Student’s twotailed t tests. Statistical significance was set at P<0.05.

Study Approval. The experimental protocol was approved by the Ethics Review Committee for Animal Experimentation of Osaka University, Graduate School of Medicine. All animal experiments were carried out in accordance with the Institutional Animal Care and Use

Committee Guidelines of Osaka University.

Page 11 of 52 Diabetes

Results

Generation of Fat ROS-eliminated mice. To establish the Fat ROSeliminated mice, we

generated aP2Cat/SOD1 double transgenic mice (aP2dTg), which expressed rat Cat and

human SOD1 under control of the aP2 promoter. SOD1 and CAT act synergistically in

scavenging ROS; SOD1 converts the superoxide radical into hydrogen peroxide, which is

then catalyzed into water and oxygen by CAT (Figure 1A). In accordance with the known

expression of aP2 gene (31), these mice expressed transgenes abundantly in the WAT, BAT

(Figure 1B) and ATMs (Figure 1C). In the gonadal WAT of aP2dTg mice fed a high fat/high

sucrose (HF/HS) diet, the activities of CAT and SOD were 1.7 and 7.7fold higher,

respectively, than those in their wildtype littermates (Figure 1D). Tissue hydrogen peroxide

was significantly reduced in subcutaneous and gonadal WAT, but not in mesenteric WAT of

obese aP2dTg mice (Figure 1E). 8Isoprostane, a welldefined marker of tissue oxidative

damage (20; 32), was also decreased in gonadal WAT but not in the liver of obese aP2dTg

mice (Figure 1F). Fractionation of adipose tissue showed reduced 8isoprostane in adipocyte

fraction, but not in stromal vascular cells (SVC) (Figure 1F). Based on these data, we

established the aP2dTg mice as Fat ROSeliminated mice.

Generation of Fat ROS-augmented mice. Generation of Fat ROSaugmented mice was

achieved by depleting glutathione specifically in adipocytes, which reduced oxygen radicals

to hydrogen peroxide or hydrogen peroxide to water and oxygen, together with glutathione

peroxidase (GPX) (Figure 1A). For this aim, floxed mice of the catalytic subunit of

glutamatecysteine ligase (Gclc), which is a ratelimiting enzyme for glutathione synthesis

(Figure 1A), were bred with adipocytespecific AdipoqCre mice to generate

AdipoqGclcknockout mice (AKO mice). As expected, DNA (see Supplementary Fig. 1) and

mRNA expression levels (Figure 2A) of the Gclc gene were knocked out specifically in WAT Diabetes Page 12 of 52

and BAT. As expected, tissue total glutathione was significantly decreased in the WAT of

AKO mice (Figure 2B) and tissue hydrogen peroxide was significantly increased in WAT of

AKO mice (Figure 2C). Tissue 8isoprostane was increased in subcutaneous and gonadal

WAT, but not in the liver (Figure 2D). Tissue 8isoprostane did not change in BAT (Figure

2D) despite reduction of Gclc gene expression (Figure 2A), the reason of which is currently unclear, but glutathione might not play major roles in antioxidant system of BAT or whitening of BAT (presented later) attenuated generation of ROS. Protein oxidation was also increased in the WAT of AKO mice (Figure 2E). Based on these data, we established AKO mice as Fat ROSaugmented mice.

Altered lipid distribution in Fat ROS-eliminated mice. Under a HF/HS diet, aP2dTg mice gained similar body weights to their wildtype littermates (Figure 3A). However, after loading with the HF/HS diet for 24 weeks, these mice exhibited significant changes in tissue weight. While the weights of subcutaneous and gonadal WAT increased, those of mesenteric

WAT and the liver decreased with no changes in skeletal muscle or BAT weight (Figure 3B).

Histological analyses showed significantly larger adipocytes in subcutaneous (Figure 3C) and gonadal WAT (see Supplementary Fig. 2A) and smaller adipocytes in mesenteric WAT of aP2dTg mice (see Supplementary Fig. 2B), indicating that the alteration of WAT weight in each depots resulted from the alteration of lipid accumulation in adipocytes. The expansion of subcutaneous WAT was associated with increased expression levels of Acly, Scd1, Fasn and

Acaca, which catalyze key steps in de novo lipogenesis, in aP2dTg mice compared with those in their wildtype littermates (Figure 3D). Gene expression of Srebf1 was not changed

(Figure 3D). The gene expression levels of these lipogenic genes were not induced in mesenteric WAT of aP2dTg mice (see Supplementary Fig. 3A), possibly explaining the distinct tendency toward lipid accumulation between the subcutaneous/gonadal and Page 13 of 52 Diabetes

mesenteric WAT in Fat ROSeliminated mice (Figure 3B). The expression levels of

lipolysisrelated genes Lpl, Lipe and Pnpla2 in subcutaneous WAT of aP2dTg mice were

similar to those in wildtype mice (see Supplementary Fig. 3B). Oil red O staining revealed

improved steatosis in the liver of aP2dTg mice compared with that of wildtype littermates

(Figure 3E), which was further confirmed by decreased triglyceride content, reduced

glycogen content and downregulated expression levels of Pparg, a marker of steatosis (Figure

3F). The expression levels of lipogenic genes, Fasn and Scd1, were significantly lower in the

liver, possibly explaining the improved steatosis in aP2dTg mice (see Supplementary Fig.

3C). Based on the above data, we speculated that removal of Fat ROS shifted the lipid

accumulation toward subcutaneous and gonadal WAT from mesenteric WAT and the liver in

aP2dTg mice.

Enhanced insulin sensitivity and healthy adipose expansion in Fat ROS-eliminated mice.

Next, we investigated the metabolic phenotypes of Fat ROSeliminated mice on a HF/HS diet

for 24 weeks. aP2dTg mice showed similar profiles of fasting plasma glucose, insulin,

triglyceride, nonesterified fatty acids and glucose tolerance (see Supplementary Fig. 4) to

their wildtype littermates. Whole body insulin sensitivity was significantly improved in

aP2dTg mice compared with that in their wildtype littermates (Figure 4A), and aP2dTg

mice exhibited enhanced insulindependent AKT (Ser473) phosphorylation in the liver but

not in WAT or skeletal muscle (Figure 4B and see Supplementary Fig. 5), consistent with

improved steatosis. These data indicated that subcutaneous/gonadal WAT in these mice

underwent adipose expansion associated with improved systemic and hepatic insulin

sensitivity.

Recently, two types of adipose expansion have begun to be recognized; healthy

expansion and pathological expansion (33). Adipose healthy expansion has reportedly been Diabetes Page 14 of 52

associated with less adipose fibrosis (3437) or enhanced de novo lipogenesis (38). In addition to enhanced de novo lipogenesis in WAT of aP2dTg mice (Figure 3D), we analyzed tissue fibrosis and macrophage polarization in these mice. Picrosirius staining showed less adipose tissue fibrosis in subcutaneous and gonadal WATs of aP2dTg mice compared with wildtype littermates (Figure 4C). Some of the fibrosisrelated genes (Col1a1 and Timp1) were downregulated and angiogenesisrelated genes (Vegfa and Fgf2) were upregulated in the subcutaneous WAT of aP2dTg mice (Figure 4D). The population of M2 macrophage was decreased, whereas M1 macrophage was increased in the WAT of Fat ROSeliminated mice

(Figure 4E). Taken together, these data suggested that beneficial changes in tissue fibrosis, macrophage polarization and angiogenesis, as well as increased de novo lipogenesis, might contribute to the healthy adipose expansion in Fat ROSeliminated mice.

Opposite phenotypes in Fat ROS-augmented mice to Fat ROS-eliminated mice. On a

HF/HS diet, AKO mice showed trend to gain less body weight to their control littermates

(Figure 5A). After loading on the HF/HS diet for 6 weeks, these mice exhibited significant changes in tissue weights. While the weight of WAT decreased, the weights of BAT and the liver increased (Figure 5B). Histological analyses showed significantly smaller adipocytes in gonadal WAT of AKO mice (Figure 5C). Smaller adipocytes in AKO mice was associated with decreased expression levels of Acly, Scd1, Fasn, Acaca and Srebf1 compared with those in their wildtype littermates (Figure 5D). In the liver (Figure 5E) and BAT (Figure 5F), lipid accumulation was greater in AKO mice than in their control littermates. Consistent with the lipid accumulation in BAT, thermogenic function was impaired as assessed by diminished expressions of Ucp1 and Ppargc1a in the BAT of AKO mice (Figure 5G).

Insulin resistance was more prominent in AKO mice than that in their control littermates (Figure 6A). Picrosirius staining showed enhanced adipose tissue fibrosis in WAT Page 15 of 52 Diabetes

of AKO mice compared with control littermates (Figure 6B). Fibrosisrelated genes (Col1a1,

Tgfb1 and Timp1) were upregulated, whereas angiogenesisrelated genes (Vegfa, Vegfb and

Fgf2) were downregulated in WAT of AKO mice (Fig. 6C). The population of M1

macrophages was increased, whereas that of M2 macrophages were decreased (Figure 6D),

consistent with increased inflammatory genes in WAT of AKO mice (Figure 6E). These

phenotypes in AKO mice provided a sharp contrast to those in aP2dTg mice, further

supporting the roles of Fat ROS in healthy adipose expansion, insulin resistance and adipose

de novo lipogenesis.

Oxidative stress downregulates lipogenic genes with suppression of SREBF1

transcriptional activities. Next, we investigated whether oxidative stress altered the

expression of lipogenic genes in cultured adipocytes. Treatment of 3T3L1 adipocytes with

tertbutyl hydroperoxide (TBHP), a superoxide radical generator, resulted in significant

downregulation of Acly and Scd1 (Figure 7A). Conversely, treatment with Nacetylcysteine

(NAC), a ROS eliminating agent, resulted in significant upregulation of these genes (Figure

7B), indicating that oxidative stress suppressed the gene expression levels of lipogenic genes

in adipocytes. To genetically confirm this hypothesis, we introduced 3T3L1 cells with stable

expression of pRetroXTetOn, pRetroXTightPurCat and pRetroXTightHygSod1, and

thus established 3T3L1TetONCat/Sod1 cells. These cells conditionally expressed ectopic

Cat and Sod1 when treated with doxycycline (see Supplementary Fig. 6). As expected,

pretreatment with doxycycline eliminated TBHPinduced ROS (Figure 7C) and partially

reversed the suppression of lipogenic genes by TBHP in 3T3L1TetONCat/Sod1 cells

(Figure 7D). The gene expression levels of lipogenic genes are predominantly regulated by

sterolregulatory elementbinding transcription factors (Srebfs) and the

carbohydrateresponsive elementbinding protein (Chrebp)/MAXlike protein X (Mlx) Diabetes Page 16 of 52

complex. TBHP dosedependently suppressed the transcriptional activities of the nuclear forms of SREBF1A and 1C but not of SREBF2 in 3T3L1 adipocytes (Figure 7E). In contrast,

TBHP exerted no effects on the transcriptional activity of CHREBP/MLX complex (Figure

7F). These results suggested that ROS downregulated the expression of lipogenic genes through the suppression of SREBF1 transcriptional activities.

Oxidative stress inhibits SREBF1 transcriptional activity through suppression of

KDM1A protein expression. To gain mechanistic insight into how oxidative stress inhibited

SREBF1 transcriptional activities, we focused on Kdm1a (also known as Lsd1), which was recently reported to be necessary for the transcriptional activity of SREBF1 in hepatocytes

(39). In 3T3L1 adipocytes, Kdm1a was also necessary for full activation of nuclear

SREBF1A (Figure 8A, B). We found that treatment with TBHP decreased KDM1A protein abundance (Figure 8C) with no change in the mRNA expression levels (see Supplementary

Fig. 7) in 3T3L1 adipocytes. Knockdown of Kdm1a dampened the suppressive effects of

TBHP on SREBF1A transcriptional activity (Figure 8D). KDM1A protein expression was significantly decreased in WAT of AKO mice (Figure 8E and see Supplementary Fig. 8A) and showed the trend to increase in WAT of aP2dTg mice (see Supplementary Fig. 8B, C) compared with those in their control littermates without any change in mRNA expression (see

Supplementary Fig. 9). Taken together, Fat ROS suppressed SREBF1A transcriptional activities, at least in part, through the reduction of KDM1A protein abundance.

Page 17 of 52 Diabetes

Discussion

In the present study, we established Fat ROSeliminated and augmented mice through the

genetic manipulation of antioxidantrelated genes. Under dietinduced obesity, these models

showed highly consistent phenotypes with each other. Fat ROSeliminated mice exhibited

white adipose expansion with beneficial macrophage polarization, fibrosis and de novo

lipogenesis, accompanied by decreased ectopic lipid deposition and improved insulin

sensitivity. Conversely, Fat ROSaugmented mice exhibited restricted adipose expansion with

unfavorable adipose inflammation, fibrosis and de novo lipogenesis, accompanied by

increased ectopic lipid accumulation and accelerated insulin resistance.

There is sufficient evidence demonstrating that adipocyte hypertrophy with adipose

inflammation is a cause of metabolic disease. On the other hand, the adipose tissue can act as

a buffer to store excess energy, preventing ectopic lipid deposition and insulin resistance. For

example, lipodystrophic mice, which have little adipose tissue, exhibit severe insulin

resistance with lipid accumulation in the liver (40; 41). In agreement with these beneficial

roles of adipose tissue, several recent reports have documented adipose expansion associated

with improvement in insulin sensitivity and decreased ectopic lipid accumulation, which is

conceptualized as healthy adipose expansion (14; 3438). Adipose expansion in Fat

ROSeliminated mice could be regarded as healthy expansion, while restricted adipose

expansion in Fat ROSaugmented mice indicated the inhibition of healthy expansion.

Several reports have documented adipose tissue fibrosis as an underlying mechanism of

healthy adipose expansion. Collagen VI deficiency in adipose tissues (35) and Irf5 (34) or

Mincle (36) deficiency in macrophages have been associated with healthy adipose expansion

through decreased adipose fibrosis. Adipose tissue inflammation was associated with

restricted adipose expansion and insulin resistance through altered adipose fibrosis (37). In

this study, adipose expansion in Fat ROSeliminated mice was associated with altered Diabetes Page 18 of 52

macrophage polarization from M1 to M2, and attenuated adipose fibrosis, while adipose restriction in Fat ROSaugmented mice was associated with increased adipose inflammation and accelerated fibrosis. Oxidative stress is known to activate proinflammatory transcription factors, such as NFκB, STAT3, HIF1α, AP1 and Nrf2 (42). Oxidative stress also induces inflammatoryrelated gene expressions in adipocytes in vitro, such as Il6, Ccl2, and Serpine1

(PAI-1) (8). So, it seemed reasonable that removal of Fat ROS prevented adipose inflammation and associated adipose fibrosis, whereas augmented Fat ROS potentiated inflammatory changes and resulting fibrosis in adipose tissues.

Another study reported the involvement of de novo lipogenesis in adipose healthy expansion (38). Likewise, in Fat ROSmodified mice, altered adipose expansion was associated with altered de novo lipogenesis as expressions of lipogenic genes were upregulated in Fat ROSeliminated mice and were downregulated in Fat ROSaugmented mice. These suggested that oxidative stress might directly inhibit de novo lipogenesis in adipocytes. However, few studies have examined the relationships between oxidative stress and de novo lipogenesis in adipocytes. Guo et al. reported that octanoate inhibited adipocyte lipogenesis through oxidative stress (43), although the underlying mechanism was unclear. In the present study, we confirmed that oxidative stress directly suppressed the expression of lipogenic genes in 3T3L1 adipocytes, which was accompanied by the suppression of the transcriptional activities of SREBF1. We further identified Kdm1a as responsible for these actions because oxidative stress decreased KDM1A protein expression both in vitro and in vivo, and knockdown of Kdm1a dampened the suppressive effects of oxidative stress on the expression of lipogenic genes. KDM1A is reportedly destabilized by Jade2 (44) and is stabilized by Usp28 (45). Thus, oxidative stress might decrease the stability of KDM1A through these ubiquitinrelated proteins, although further studies will be required to confirm this hypothesis. Page 19 of 52 Diabetes

In Fat ROSeliminated mice, mesenteric WAT was paradoxically decreased in contrast

to the expansion of subcutaneous/gonadal WAT. This finding is important because expansion

of mesenteric WAT is clinically more correlated with metabolic syndrome (46). These

differences were probably mediated by distinct sensitivity to antioxidants among fat depots,

as overexpression of Cat and Sod1 efficiently eliminated Fat ROS in subcutaneous and

gonadal WAT, but not in mesenteric WAT (Fig. 1G). The highest expression of NADPH

oxidase in mesenteric WAT (see Supplementary Figure 10) might explain these different

sensitivity to antioxidants, but further analyses would be required.

The concept of healthy adipose expansion is also applicable to human. Many studies

have reported that 1025% of obese subjects do not present metabolic disturbances, which is

categorized as ‘metabolically healthy but obese (MHO) phenotype (4749). MHO subjects

were characterized by predominant fat accumulation toward subcutaneous WAT (50), lower

liver fat content (51) and lower number of adipose tissue macrophages (52), which are highly

consistent with the phenotypes of Fat ROSeliminated mice. Although the underlying

mechanisms which arise MHO phonotype are still poorly understood, lower Fat ROS might

lead to MHO phenotypes in human subjects as well as in mice. Also, PPARγ agonists reduce

the intraabdominal fat mass without affecting total fat and improve insulin sensitivity in

human subjects (53), similar to the phenotypes seen in Fat ROSeliminated mice. Considering

that Cat and Sod1 are direct PPARγ target genes in adipocytes (5456), it is fascinating to

speculate that the beneficial effects of PPARγ agonists could be mediated, at least in part, by

a reduction of Fat ROS. Further studies will be required whether oxidative stressrelated

genes, including CAT and SOD, are regulated in the WAT of MHO subjects or patients treated

with PPARγ agonists.

In this study, we used aP2 promoter to specifically drive Cat and Sod1 in adipocytes.

However, expression of aP2 gene is not known to be strictly specific in adipocytes. In fact, Diabetes Page 20 of 52

ectopic Cat and Sod1 were to some extent expressed in tissues other than adipose tissues and expressed in ATM with comparable level to adipocytes (Figure 1B, C). Although we evaluated oxidative stress and found no change in liver or SVC, it did not completely exclude the involvement of ROS in tissues other than adipocytes. Nevertheless, we believe that healthy adipose expansion in aP2dTg mice was a consequence of ROSelimination in adipocytes, as AKO mice, in which highly adipocyte specific AdipoqCre was used, showed nearly completely opposite phenotype to that of aP2dTg mice. Further studies using models with more adipocytespecific deletion of ROS would be warranted.

In conclusion, we demonstrated, through loss and gainoffunction studies in vivo, that obesityinduced Fat ROS led to accelerated adipose inflammation, augmented fibrosis and attenuated de novo lipogenesis in WAT, resulting in restricted healthy adipose expansion with increased ectopic lipid accumulation, eventually leading to deteriorated insulin sensitivity.

Attenuation of de novo lipogenesis by oxidative stress was mediated by inhibition of

SREBF1 transcriptional activities through the suppression of KDM1A protein expression

(Figure 8F). Because these unfavorable effects of Fat ROS could be reversed by the enrichment of antioxidants, such as Cat and Sod1, the development of agents that could increase antioxidants specifically in adipocytes could potentially be useful in the treatment of metabolic syndrome.

Page 21 of 52 Diabetes

Acknowledgments

Y.O. designed and performed the experiments, analyzed the data and wrote the manuscript;

A.F. interpreted the data and wrote the manuscript; E.H., H.K., and S.K. generated and

maintained the mice; and M.O. and I.S. supervised the project and wrote the manuscript. The

authors thank Haruyo Sakamoto for technical support. The authors have declared that no

conflict of interest exists. This work was supported by JSPS KAKENHI Grant #24591329

and by grants from the Japan Foundation for Applied Enzymology and from the Japan Health

Foundation. Dr. Atsunori Fukuhara is the guarantor of this work and, as such, had full access

to all the data in the study and takes responsibility for the integrity of the data and the

accuracy of the data analysis.

Diabetes Page 22 of 52

References

1. Maeda N, Shimomura I, Kishida K, Nishizawa H, Matsuda M, Nagaretani H, Furuyama N, Kondo H, Takahashi M, Arita Y, Komuro R, Ouchi N, Kihara S, Tochino Y, Okutomi K, Horie M, Takeda S, Aoyama T, Funahashi T, Matsuzawa Y: Diet-induced insulin resistance in mice lacking adiponectin/ACRP30. Nature medicine 2002;8:731-737 2. Uysal KT, Wiesbrock SM, Marino MW, Hotamisligil GS: Protection from obesity-induced insulin resistance in mice lacking TNF-alpha function. Nature 1997;389:610-614 3. Rotter V, Nagaev I, Smith U: Interleukin-6 (IL-6) induces insulin resistance in 3T3-L1 adipocytes and is, like IL-8 and tumor necrosis factor-alpha, overexpressed in human fat cells from insulin-resistant subjects. The Journal of biological chemistry 2003;278:45777-45784 4. Steppan CM, Bailey ST, Bhat S, Brown EJ, Banerjee RR, Wright CM, Patel HR, Ahima RS, Lazar MA: The hormone resistin links obesity to diabetes. Nature 2001;409:307-312 5. Weisberg SP, McCann D, Desai M, Rosenbaum M, Leibel RL, Ferrante AW, Jr.: Obesity is associated with macrophage accumulation in adipose tissue. J Clin Invest 2003;112:1796-1808 6. Ozcan U, Cao Q, Yilmaz E, Lee AH, Iwakoshi NN, Ozdelen E, Tuncman G, Gorgun C, Glimcher LH, Hotamisligil GS: Endoplasmic reticulum stress links obesity, insulin action, and type 2 diabetes. Science (New York, NY) 2004;306:457-461 7. Hosogai N, Fukuhara A, Oshima K, Miyata Y, Tanaka S, Segawa K, Furukawa S, Tochino Y, Komuro R, Matsuda M, Shimomura I: Adipose tissue hypoxia in obesity and its impact on adipocytokine dysregulation. Diabetes 2007;56:901-911 8. Furukawa S, Fujita T, Shimabukuro M, Iwaki M, Yamada Y, Nakajima Y, Nakayama O, Makishima M, Matsuda M, Shimomura I: Increased oxidative stress in obesity and its impact on metabolic syndrome. J Clin Invest 2004;114:1752-1761 9. Hirata A, Maeda N, Nakatsuji H, Hiuge-Shimizu A, Okada T, Funahashi T, Shimomura I: Contribution of glucocorticoid-mineralocorticoid receptor pathway on the obesity-related adipocyte dysfunction. Biochemical and biophysical research communications 2012;419:182-187 10. Okauchi Y, Kishida K, Funahashi T, Noguchi M, Ogawa T, Okita K, Iwahashi H, Ohira T, Imagawa A, Nakamura T, Shimomura I: Cross-sectional and longitudinal study of association between circulating thiobarbituric acid-reacting substance levels and clinicobiochemical parameters in 1,178 middle-aged Japanese men - the Amagasaki Visceral Fat Study. Nutrition & metabolism 2011;8:82 11. Fujita K, Nishizawa H, Funahashi T, Shimomura I, Shimabukuro M: Systemic oxidative stress is associated with visceral fat accumulation and the metabolic syndrome. Circulation journal : official journal of the Japanese Circulation Society 2006;70:1437-1442 12. Houstis N, Rosen ED, Lander ES: Reactive oxygen species have a causal role in multiple forms of insulin resistance. Nature 2006;440:944-948 13. Kawasaki N, Asada R, Saito A, Kanemoto S, Imaizumi K: Obesity-induced endoplasmic reticulum stress causes chronic inflammation in adipose tissue. Scientific reports 2012;2:799 14. Kusminski CM, Holland WL, Sun K, Park J, Spurgin SB, Lin Y, Askew GR, Simcox JA, McClain DA, Li C, Scherer PE: MitoNEET-driven alterations in adipocyte mitochondrial activity reveal a crucial adaptive process that preserves insulin sensitivity in obesity. Nature medicine 2012;18:1539-1549 15. Minamino T, Orimo M, Shimizu I, Kunieda T, Yokoyama M, Ito T, Nojima A, Nabetani A, Oike Y, Matsubara H, Ishikawa F, Komuro I: A crucial role for adipose tissue p53 in the regulation of insulin resistance. Nature medicine 2009;15:1082-1087 16. Cani PD, Bibiloni R, Knauf C, Waget A, Neyrinck AM, Delzenne NM, Burcelin R: Changes in gut microbiota control metabolic endotoxemia-induced inflammation in high-fat diet-induced obesity and diabetes in mice. Diabetes 2008;57:1470-1481 17. Yamauchi T, Nio Y, Maki T, Kobayashi M, Takazawa T, Iwabu M, Okada-Iwabu M, Kawamoto S, Kubota N, Kubota T, Ito Y, Kamon J, Tsuchida A, Kumagai K, Kozono H, Hada Y, Ogata H, Tokuyama K, Tsunoda M, Ide T, Murakami K, Awazawa M, Takamoto I, Froguel P, Hara K, Tobe K, Nagai R, Ueki K, Kadowaki T: Targeted disruption of AdipoR1 and AdipoR2 causes abrogation of adiponectin binding and metabolic actions. Nature medicine 2007;13:332-339 18. Kurata A, Nishizawa H, Kihara S, Maeda N, Sonoda M, Okada T, Ohashi K, Hibuse T, Fujita K, Yasui A, Hiuge A, Kumada M, Kuriyama H, Shimomura I, Funahashi T: Blockade of Angiotensin II type-1 receptor reduces oxidative stress in adipose tissue and ameliorates Page 23 of 52 Diabetes

adipocytokine dysregulation. Kidney international 2006;70:1717-1724 19. Hoehn KL, Salmon AB, Hohnen-Behrens C, Turner N, Hoy AJ, Maghzal GJ, Stocker R, Van Remmen H, Kraegen EW, Cooney GJ, Richardson AR, James DE: Insulin resistance is a cellular antioxidant defense mechanism. Proceedings of the National Academy of Sciences of the United States of America 2009;106:17787-17792 20. Liu Y, Qi W, Richardson A, Van Remmen H, Ikeno Y, Salmon AB: Oxidative damage associated with obesity is prevented by overexpression of CuZn- or Mn-superoxide dismutase. Biochemical and biophysical research communications 2013;438:78-83 21. Anderson EJ, Lustig ME, Boyle KE, Woodlief TL, Kane DA, Lin CT, Price JW, 3rd, Kang L, Rabinovitch PS, Szeto HH, Houmard JA, Cortright RN, Wasserman DH, Neufer PD: Mitochondrial H2O2 emission and cellular redox state link excess fat intake to insulin resistance in both rodents and humans. J Clin Invest 2009;119:573-581 22. Lee HY, Choi CS, Birkenfeld AL, Alves TC, Jornayvaz FR, Jurczak MJ, Zhang D, Woo DK, Shadel GS, Ladiges W, Rabinovitch PS, Santos JH, Petersen KF, Samuel VT, Shulman GI: Targeted expression of catalase to mitochondria prevents age-associated reductions in mitochondrial function and insulin resistance. Cell metabolism 2010;12:668-674 23. Lettieri Barbato D, Tatulli G, Maria Cannata S, Bernardini S, Aquilano K, Ciriolo MR: Glutathione Decrement Drives Thermogenic Program In Adipose Cells. Scientific reports 2015;5:13091 24. Elshorbagy AK, Jerneren F, Scudamore CL, McMurray F, Cater H, Hough T, Cox R, Refsum H: Exploring the Lean Phenotype of Glutathione-Depleted Mice: Thiol, Amino Acid and Fatty Acid Profiles. PloS one 2016;11:e0163214 25. Kendig EL, Chen Y, Krishan M, Johansson E, Schneider SN, Genter MB, Nebert DW, Shertzer HG: Lipid metabolism and body composition in Gclm(-/-) mice. Toxicology and applied pharmacology 2011;257:338-348 26. Eguchi J, Wang X, Yu S, Kershaw EE, Chiu PC, Dushay J, Estall JL, Klein U, Maratos-Flier E, Rosen ED: Transcriptional control of adipose lipid handling by IRF4. Cell metabolism 2011;13:249-259 27. Miyata Y, Fukuhara A, Otsuki M, Shimomura I: Expression of activating transcription factor 2 in inflammatory macrophages in obese adipose tissue. Obesity (Silver Spring, Md) 2013;21:731-736 28. Cho KW, Morris DL, Lumeng CN: Flow cytometry analyses of adipose tissue macrophages. Methods in enzymology 2014;537:297-314 29. Amemiya-Kudo M, Shimano H, Hasty AH, Yahagi N, Yoshikawa T, Matsuzaka T, Okazaki H, Tamura Y, Iizuka Y, Ohashi K, Osuga J, Harada K, Gotoda T, Sato R, Kimura S, Ishibashi S, Yamada N: Transcriptional activities of nuclear SREBP-1a, -1c, and -2 to different target promoters of lipogenic and cholesterogenic genes. Journal of lipid research 2002;43:1220-1235 30. Stoeckman AK, Ma L, Towle HC: Mlx is the functional heteromeric partner of the carbohydrate response element-binding protein in glucose regulation of lipogenic enzyme genes. The Journal of biological chemistry 2004;279:15662-15669 31. Pelton PD, Zhou L, Demarest KT, Burris TP: PPARgamma activation induces the expression of the adipocyte fatty acid binding protein gene in human monocytes. Biochemical and biophysical research communications 1999;261:456-458 32. Morrow JD, Hill KE, Burk RF, Nammour TM, Badr KF, Roberts LJ, 2nd: A series of prostaglandin F2-like compounds are produced in vivo in humans by a non-cyclooxygenase, free radical-catalyzed mechanism. Proceedings of the National Academy of Sciences of the United States of America 1990;87:9383-9387 33. Sun K, Kusminski CM, Scherer PE: Adipose tissue remodeling and obesity. J Clin Invest 2011;121:2094-2101 34. Dalmas E, Toubal A, Alzaid F, Blazek K, Eames HL, Lebozec K, Pini M, Hainault I, Montastier E, Denis RG, Ancel P, Lacombe A, Ling Y, Allatif O, Cruciani-Guglielmacci C, Andre S, Viguerie N, Poitou C, Stich V, Torcivia A, Foufelle F, Luquet S, Aron-Wisnewsky J, Langin D, Clement K, Udalova IA, Venteclef N: Irf5 deficiency in macrophages promotes beneficial adipose tissue expansion and insulin sensitivity during obesity. Nature medicine 2015;21:610-618 35. Khan T, Muise ES, Iyengar P, Wang ZV, Chandalia M, Abate N, Zhang BB, Bonaldo P, Chua S, Scherer PE: Metabolic dysregulation and adipose tissue fibrosis: role of collagen VI. Molecular and cellular biology 2009;29:1575-1591 36. Tanaka M, Ikeda K, Suganami T, Komiya C, Ochi K, Shirakawa I, Hamaguchi M, Nishimura S, Diabetes Page 24 of 52

Manabe I, Matsuda T, Kimura K, Inoue H, Inagaki Y, Aoe S, Yamasaki S, Ogawa Y: Macrophage-inducible C-type lectin underlies obesity-induced adipose tissue fibrosis. Nature communications 2014;5:4982 37. Wernstedt Asterholm I, Tao C, Morley TS, Wang QA, Delgado-Lopez F, Wang ZV, Scherer PE: Adipocyte inflammation is essential for healthy adipose tissue expansion and remodeling. Cell metabolism 2014;20:103-118 38. Herman MA, Peroni OD, Villoria J, Schon MR, Abumrad NA, Bluher M, Klein S, Kahn BB: A novel ChREBP isoform in adipose tissue regulates systemic glucose metabolism. Nature 2012;484:333-338 39. Abdulla A, Zhang Y, Hsu FN, Xiaoli AM, Zhao X, Yang ES, Ji JY, Yang F: Regulation of lipogenic gene expression by lysine-specific histone demethylase-1 (LSD1). The Journal of biological chemistry 2014;289:29937-29947 40. Pajvani UB, Trujillo ME, Combs TP, Iyengar P, Jelicks L, Roth KA, Kitsis RN, Scherer PE: Fat apoptosis through targeted activation of caspase 8: a new mouse model of inducible and reversible lipoatrophy. Nature medicine 2005;11:797-803 41. Shimomura I, Hammer RE, Richardson JA, Ikemoto S, Bashmakov Y, Goldstein JL, Brown MS: Insulin resistance and diabetes mellitus in transgenic mice expressing nuclear SREBP-1c in adipose tissue: model for congenital generalized lipodystrophy. Genes & development 1998;12:3182-3194 42. Reuter S, Gupta SC, Chaturvedi MM, Aggarwal BB: Oxidative stress, inflammation, and cancer: how are they linked? Free radical biology & medicine 2010;49:1603-1616 43. Guo W, Xie W, Han J: Modulation of adipocyte lipogenesis by octanoate: involvement of reactive oxygen species. Nutrition & metabolism 2006;3:30 44. Han X, Gui B, Xiong C, Zhao L, Liang J, Sun L, Yang X, Yu W, Si W, Yan R, Yi X, Zhang D, Li W, Li L, Yang J, Wang Y, Sun YE, Zhang D, Meng A, Shang Y: Destabilizing LSD1 by Jade-2 promotes neurogenesis: an antibraking system in neural development. Molecular cell 2014;55:482-494 45. Wu Y, Wang Y, Yang XH, Kang T, Zhao Y, Wang C, Evers BM, Zhou BP: The deubiquitinase USP28 stabilizes LSD1 and confers stem-cell-like traits to breast cancer cells. Cell reports 2013;5:224-236 46. Despres JP, Lemieux I: Abdominal obesity and metabolic syndrome. Nature 2006;444:881-887 47. Sims EA: Are there persons who are obese, but metabolically healthy? Metabolism: clinical and experimental 2001;50:1499-1504 48. Ferrannini E, Natali A, Bell P, Cavallo-Perin P, Lalic N, Mingrone G: Insulin resistance and hypersecretion in obesity. European Group for the Study of Insulin Resistance (EGIR). J Clin Invest 1997;100:1166-1173 49. Bonora E, Kiechl S, Willeit J, Oberhollenzer F, Egger G, Targher G, Alberiche M, Bonadonna RC, Muggeo M: Prevalence of insulin resistance in metabolic disorders: the Bruneck Study. Diabetes 1998;47:1643-1649 50. Karelis AD, Faraj M, Bastard JP, St-Pierre DH, Brochu M, Prud'homme D, Rabasa-Lhoret R: The metabolically healthy but obese individual presents a favorable inflammation profile. The Journal of clinical endocrinology and metabolism 2005;90:4145-4150 51. O'Donovan G, Thomas EL, McCarthy JP, Fitzpatrick J, Durighel G, Mehta S, Morin SX, Goldstone AP, Bell JD: Fat distribution in men of different waist girth, fitness level and exercise habit. International journal of obesity (2005) 2009;33:1356-1362 52. Hardy OT, Perugini RA, Nicoloro SM, Gallagher-Dorval K, Puri V, Straubhaar J, Czech MP: Body mass index-independent inflammation in omental adipose tissue associated with insulin resistance in morbid obesity. Surgery for obesity and related diseases : official journal of the American Society for Bariatric Surgery 2011;7:60-67 53. Kelly IE, Han TS, Walsh K, Lean ME: Effects of a thiazolidinedione compound on body fat and fat distribution of patients with type 2 diabetes. Diabetes care 1999;22:288-293 54. Okuno Y, Matsuda M, Kobayashi H, Morita K, Suzuki E, Fukuhara A, Komuro R, Shimabukuro M, Shimomura I: Adipose expression of catalase is regulated via a novel remote PPARgamma-responsive region. Biochemical and biophysical research communications 2008;366:698-704 55. Okuno Y, Matsuda M, Miyata Y, Fukuhara A, Komuro R, Shimabukuro M, Shimomura I: Human catalase gene is regulated by peroxisome proliferator activated receptor-gamma through a response element distinct from that of mouse. Endocrine journal 2010;57:303-309 56. Inoue I, Goto S, Matsunaga T, Nakajima T, Awata T, Hokari S, Komoda T, Katayama S: The Page 25 of 52 Diabetes

ligands/activators for peroxisome proliferator-activated receptor alpha (PPARalpha) and PPARgamma increase Cu2+,Zn2+-superoxide dismutase and decrease p22phox message expressions in primary endothelial cells. Metabolism: clinical and experimental 2001;50:3-11 Diabetes Page 26 of 52

Figure Legends

Figure 1. Generation of Fat ROSeliminated mice. A: Schematic representation of the antioxidant pathway. GCLC: glutamatecysteine ligase catalytic subunit, GSS: glutathione synthetase, GPX: glutathione peroxidase, GSH: glutathione, GSSG: glutathione disulfide,

SOD: superoxide dismutase, CAT: catalase. B: Relative expression levels of the rat Cat gene and human SOD1 gene in the indicated tissues of aP2dTg mice, as quantified by realtime

RTPCR. gWAT: gonadal WAT, sWAT: subcutaneous WAT. C: Relative expression levels of the rat Cat gene and human SOD1 gene in adipocyte fraction (Adipo) and adipose tissue macrophages (ATM) in subcutaneous WAT of aP2dTg mice (n=3, each). D: Enzymatic activities of CAT and SOD in gonadal WAT of wildtype (WT) and aP2dTg animals fed a

HF/HS diet (n=5, each). E: Tissue hydrogen peroxide in the indicated tissues of wildtype

(WT) and aP2dTg mice fed a HF/HS diet (n=5, each). sWAT: subcutaneous WAT, gWAT: gonadal WAT, mWAT: mesenteric WAT. F: Tissue 8isoprostane in the gonadal WAT (Left) and the liver (Right) of wildtype (WT) and aP2dTg animals fed a HF/HS diet (n=12, each).

G: Tissue 8isoprostane in the adipocyte fraction (Adipo) and stromal vascular cells (SVC) in wildtype (WT) and aP2dTg mice fed and HF/HS diet (n=5, each). Data represent the mean

± SEM. *P<0.05; ***P<0.001, compared with control mice.

Figure 2. Generation of Fat ROSaugmented mice. A: Expression levels of Gclc genes from the indicated tissues of floxed or AKO mice, as quantified by realtime RTPCR (n=36, each). sWAT: subcutaneous WAT, gWAT: gonadal WAT. B: Tissue total glutathione in the gonadal

WAT of floxed or AKO mice fed a HF/HS diet (n=3, each). C: Tissue hydrogen peroxide in the gonadal WAT of floxed or AKO mice fed a HF/HS diet (n=5, each). D: Tissue

8isoprostane in the indicated tissues of floxed or AKO mice fed a HF/HS diet (n=6, each). sWAT: subcutaneous WAT, gWAT: gonadal WAT. E: OxyBlot and western blot with Page 27 of 52 Diabetes

antiACTB antibody of lysates from gonadal WAT of floxed or AKO mice (n=5, each) (left).

Density of OxyBlot was quantified and normalized by that of ACTB (right). Data represent

the mean ± SEM. *P<0.05; **P<0.01, compared with control mice.

Figure 3. Tissues of Fat ROSeliminated mice. A: Growth curves of wildtype (WT) and

aP2dTg mice fed a HF/HS diet (n=25, each). B: Wet weights of the indicated tissues of

wildtype (WT) and aP2dTg mice fed a HF/HS diet for 24 weeks (n= 15, each). Values were

normalized by body weight. gWAT: gonadal WAT, sWAT: subcutaneous WAT, mWAT:

mesenteric WAT. C: Representative HE staining (upper) and distribution (left) and average

(right) area of adipocytes from subcutaneous WAT of wildtype (WT) and aP2dTg mice fed

a HF/HS diet for 24 weeks (n=4, each). D: Expression levels of the indicated genes from the

subcutaneous WAT of wildtype (WT) and aP2dTg mice fed a HF/HS diet (n=6, each). E:

Representative Oil RedO staining of liver in wildtype (WT) and aP2dTg mice fed a HF/HS

diet. F: Liver triglyceride, glycogen, and mRNA levels of Pparg of wildtype (WT) and

aP2dTg mice fed a HF/HS diet for 24 weeks (n=12, each). Data represent the mean ± SEM.

*P<0.05; **P<0.01, compared with wildtype (WT).

Figure 4. Insulin sensitivity and characterization of WAT in Fat ROSeliminated mice. A:

Intraperitoneal insulin tolerance test was performed in wildtype (WT) and aP2dTg mice fed

a HF/HS diet (n=12, each). B: PhosphoAKT (Ser 473) protein in the indicated tissues of

wildtype (WT) and aP2dTg mice fed a HF/HS diet administered with insulin. Values are

expressed relative to total AKT protein (n=6, each). C: Picrosirius staining of subcutaneous

WAT of wildtype (WT) and aP2dTg mice fed a HF/HS diet (n=6, each). D: Expression

levels of the indicated genes from the subcutaneous WAT of wildtype (WT) and aP2dTg

mice fed a HF/HS diet (n=6, each). E: Population of M1 (CD11c+) and M2 (CD301+) Diabetes Page 28 of 52

macrophages in subcutaneous WAT of wildtype (WT) and aP2dTg mice fed a HF/HS diet

(n=5, each). Data represent the mean ± SEM. *P<0.05; **P<0.01, compared with wildtype

(WT).

Figure 5. Tissues of Fat ROSaugmented mice. A: Growth curves of floxed mice and AKO mice fed a HF/HS diet (n=13, each). B: Wet weights of the indicated tissues of floxed mice and AKO mice fed a HF/HS diet for 6 weeks (n=6, each). gWAT: gonadal WAT, sWAT: subcutaneous WAT, mWAT: mesenteric WAT. C: Distribution (left) and average (right) area of adipocytes from gonadal WAT of floxed and AKO mice fed a HF/HS diet for 6 weeks (n=4, each). D: Expression levels of the indicated genes from the gonadal WAT of floxed and AKO mice fed a HF/HS diet (n=3, each). E: Liver triglycerides of floxed mice and AKO mice fed a

HF/HS diet for 6 weeks (n=6, each). F: Representative HE staining of BAT from floxed and

AKO mice fed a HF/HS diet for 6 weeks. G: Expression levels of the indicated genes from the BAT of floxed and AKO mice fed a HF/HS diet (n=3, each).

Data represent the mean ± SEM. *P<0.05; **P<0.01, compared with floxed mice.

Figure 6. Insulin sensitivity and characterization of WAT in Fat ROSaugmented mice. A:

Intraperitoneal insulin tolerance test was performed in floxed mice and AKO mice fed a

HF/HS diet for 6 weeks (n=10, each). B: Picrosirius staining of gonadal WAT of floxed and

AKO mice fed a HF/HS diet for 6 weeks (n=4, each). C: Expression levels of indicated genes from gonadal WAT of floxed mice or AKO mice fed a HF/HS diet for 6 weeks (n=3, each).

D: Population of M1 (CD11c+) and M2 (CD301+) macrophages in gonadal WAT of floxed and AKO mice fed a HF/HS diet (n=3, each). E: Expression levels of indicated genes from gonadal WAT of floxed mice or AKO mice (n=3, each). Data represent the mean ± SEM.

*P<0.05; **P<0.01, compared with floxed mice. Page 29 of 52 Diabetes

Figure 7. ROS downregulates the expression of lipogenic genes. A: Expression levels of the

indicated genes in 3T3L1 adipocytes treated with or without 0.1 mM TBHP in FBSfree

medium for 24 hours (n=3, each). B: Expression levels of the indicated genes in 3T3L1

adipocytes treated with or without 10 mM NAC in FBSfree medium for 24 hours (n=3,

each). C: Cellular ROS detected by DCFDA assay. 3T3L1TetONCat/Sod1 adipocytes were

treated with or without 10 g/ml doxycycline for 24 hours and then were stained with

DCFDA and treated with or without TBHP in FBSfree medium for 30 minutes (n=3, each).

D: Expression levels of the indicated genes. 3T3L1TetONCat/Sod1 adipocytes pretreated

with or without 10 g/ml doxycycline for 24 hours were treated with or without 0.1 mM

TBHP in FBSfree medium for 24 hours (n=3, each). E: Luciferase activities of 3T3L1

adipocytes transfected with the indicated genes with 0 mM, 0.1 mM, 0.2 mM or 0.4 mM of

TBHP for 24 hours. F: Luciferase activities of 3T3L1 adipocytes transfected with indicated

genes with 0 mM, 0.2 mM or 0.4 mM of TBHP for 24 hours (n=3, each). Data represent the

mean ± SEM. *P<0.05; **P<0.01; ***P<0.001, compared with the blank.

Figure 8. ROS suppressed SREBF1 transcriptional activities through downregulation of

protein expression of KDM1A. A: mRNA expression levels of Kdm1a in 3T3L1 adipocytes

48 hours after transfection with the negative control siRNA or different kinds of siRNA

targeting Kdm1a (n=3, each). B: Luciferase activities of 3T3L1 adipocytes transfected with

3xSRELuc, the indicated expression plasmids and siRNA (n=3, each). At 24 hours after

3T3L1 adipocytes were transfected with siRNA, 3xSRELuc and expression plasmids were

transfected and incubated for an additional 24 hours. C: Western blotting of lysates from

3T3L1 adipocytes treated with or without 0.4 mM TBHP for 24 hours with the indicated

antibodies. D: Luciferase activities of 3T3L1 adipocytes transfected with 3xSRELuc, Diabetes Page 30 of 52

indicated expression plasmids and siRNA with or without 0.4 mM TBHP for 24 hours (n=3, each). E: Western blotting of lysates from gonadal WAT of floxed mice and AKO mice with antiKDM1A antibody. Bands of KDM1A were normalized to bands of ACTB (n=10, each).

Data represent the mean ± SEM. *P<0.05; **P<0.01, compared with control. F: Impact of

Fat ROS on healthy adipose expansion. Obesityinduced Fat ROS inhibits healthy adipose expansion through suppression of de novo lipogenesis, increased inflammation and accelerated fibrosis in WAT. Suppression of de novo lipogenesis is mediated by decreased

KDM1A protein and SREBF1 transcriptional activities. Inhibition of adipose healthy expansion results in lipid accumulation of liver and BAT, leading to insulin resistance.

Page 31 of 52 Diabetes

Figure1

254x357mm (300 x 300 DPI)

Diabetes Page 32 of 52

Figure2

209x244mm (300 x 300 DPI)

Page 33 of 52 Diabetes

Figure3

279x432mm (300 x 300 DPI)

Diabetes Page 34 of 52

Figure4

279x432mm (300 x 300 DPI)

Page 35 of 52 Diabetes

Figure5

279x432mm (300 x 300 DPI)

Diabetes Page 36 of 52

Figure6

228x289mm (300 x 300 DPI)

Page 37 of 52 Diabetes

Figure7

203x228mm (300 x 300 DPI)

Diabetes Page 38 of 52

Figure8

228x289mm (300 x 300 DPI)

Page 39 of 52 Diabetes

Supplementary Figure Legends

Supplementary Figure 1. PCR products from the indicated tissues of floxed or AKO

mice. The slower and faster migrated bands correspond to floxed allele and null allele,

respectively.

Supplementary Figure 2. Distribution (left), average area (right) and representative H-E

staining (lower) of adipocytes from gonadal WAT (A) and mesenteric WAT (B) of

wild-type (WT) or aP2-dTg mice fed a HF/HS diet for 24 weeks (n=4, each).

Supplementary Figure 3. Gene profile of Fat ROS-eliminated mice. A: Expression

levels of the indicated genes from the mesenteric WAT of wild-type (WT) and aP2-dTg

mice fed a HF/HS diet (n=4, each). B: Expression levels of the indicated genes from

subcutaneous WAT of wild-type (WT) and aP2-dTg mice fed a HF/HS diet (n=10, each).

C: Expression levels of the indicated genes from liver of wild-type (WT) and aP2-dTg

mice fed a HF/HS diet (n=12, each). Data represent the mean ± SEM. *P<0.05;

**P<0.01, compared with wild-type (WT).

Diabetes Page 40 of 52

Supplementary Figure 4. A: Plasma insulin, triglyceride (TG) and NEFA of wild-type

(WT) and aP2-dTg mice fed a HF/HS diet (n=7, each). B: Intraperitoneal glucose tolerance test was performed in wild-type (WT) and aP2-dTg mice fed a HF/HS diet

(n=12, each). Data represent the mean ± SEM.

Supplementary Figure 5. The raw immunoblot of Figure 4B. Phospho-AKT (Ser 473) protein and AKT protein in the indicated tissues of wild-type (WT) and aP2-dTg mice fed a HF/HS diet administered with insulin.

Supplementary Figure 6. Expression levels of the indicated genes in

3T3-L1-TetON-Cat/Sod1 adipocytes treated with or without 10 µg/ml doxycycline (n

=3, each). Data represent the mean ± SEM. **P<0.01; ***P<0.01 compared with the blank.

Supplementary Figure 7. mRNA expression levels of Kdm1a in 3T3-L1 adipocytes treated with or without 0.4 mM TBHP for 24 hours (n=3, each). Data represent the mean ± SEM.

Page 41 of 52 Diabetes

Supplementary Figure 8. A: The raw immunoblot of Figure 8E. B, C: Western blotting

of lysates from subcutaneous WAT of wild-type (WT) mice and aP2-dTg mice with

anti-KDM1A antibody. Bands of KDM1A were normalized to those of ACTB (n=10,

each). Data represent the mean ± SEM.

Supplementary Figure 9. A: mRNA expression levels of Kdm1a in the subcutaneous

WAT (sWAT) and gonadal WAT (gWAT) of floxed mice or AKO mice fed a HF/HS diet

(n=4, each). B: mRNA expression levels of Kdm1a in the subcutaneous WAT (sWAT)

and gonadal WAT(gWAT) of wild-type mice (WT) or aP2-dTg mice fed a HF/HS diet

(n=10, each). Data represent the mean ± SEM.

Supplementary Figure 10. mRNA expression levels of Ncf1 in the subcutaneous WAT

(sWAT), gonadal WAT(gWAT) and mesenteric WAT (mWAT) of wild-type mice (WT)

or aP2-dTg mice fed a HF/HS diet (n=10, each). Data represent the mean ± SEM. Diabetes Page 42 of 52

Supplementary Table

Forward primer Reverse primer mouse Rplp0 AAAGGAAGAGTCGGAGGAATCAG GGCTGACTTGGTTGCTTTGG rat Cat ACTGACGTCCACCCTGACTA GCACCTGAGGAGTGAATTGG transgene human SOD1 TGGCCGATGTGTCTATTGAA TTACACCACAAGCCAAACGA mouse Pparg CCAGAGTCTGCTGATCTGCG GCCACCTCTTTGCTCTGCTC mouse CAGCCTCTTTGCCCAGATCT CCGCTAGCAAGTTTGCCTCA Ppargc1a mouse Fasn GAGAAGCCATGTGGGGAAGATTTC TGAGCAGGGACAGGACAAGAC mouse Scd1 TGGGTTGGCTGCTTGTG GCGTGGGCAGGATGAAG mouse Ucp1 ATCAACTCTCTGCCAGGACAGT GTCCTTCCTTGGTGTACATGGA mouse Col6a3 CACCTCTTCAGGCAGCACAC TCCACACAAGTCCCAGCATC mouse Tgfb1 ACCATGCCAACTTCTGTCTG CGGGTTGTGTTGGTTGTAGA mouse Col1a1 GTGCTCCTGGTATTGCTGGT GGCTCCTCGTTTTCCTTCTT mouse Timp1 GTGGGAAATGCCGCAGAT GGGCATATCCACAGAGGCTTT mouse Vegfa TCTCTTGGGTGCACTGGACC GTTACAGCAGCCTGCACAGC mouse Vegfb TGACGATGGCCTGGAATG GCATTCACATTGGCTGTGTTCTTC mouse Fgf2 AACGGCGGCTTCTTCCTG CACAACTCCTCTCTCTTCTGCTTG mouse Tnf TGTGCTCAGAGCTTTCAAAAC GCCCATTTGAGTCCTTGATG mouse Il6 ACAACCACGGCCTTCCCTACTT CACGATTTCCCAGAGAACATGTG mouse Acly ACCCTTTCACTGGGGATCACA GACAGGGATCAGGATTTCCTTG mouse Acaca AACTGGCCTTCTTGATGTTAGGAG AGCACCGAGACTGAACTGTAAGG mouse Lpl CCCTGAAGACACAGCTGAGG GGGTGTACCCTAAGAGGTGG mouse Lipe CCGCTGACTTCCTGCAAGAG CTGGGTCTATGGCGAATCGG mouse Pnpla2 GGTGACCATCTGCCTTCCAG TGCAGAAGAGACCCAGCAGT mouse Adgre1 TTACGATGGAATTCTCCTTGTATATC CACAGCAGGAAGGTGGCTATG AT mouse Gclc CATGTTGGTGTCCTTCGATCATG TGGTTGGGGTTTGTCCTTC

Page 43 of 52 Diabetes

101x57mm (300 x 300 DPI)

Diabetes Page 44 of 52

297x489mm (300 x 300 DPI)

Page 45 of 52 Diabetes

203x228mm (300 x 300 DPI)

Diabetes Page 46 of 52

203x228mm (300 x 300 DPI)

Page 47 of 52 Diabetes

177x175mm (300 x 300 DPI)

Diabetes Page 48 of 52

127x89mm (300 x 300 DPI)

Page 49 of 52 Diabetes

127x89mm (300 x 300 DPI)

Diabetes Page 50 of 52

228x289mm (300 x 300 DPI)

Page 51 of 52 Diabetes

127x89mm (300 x 300 DPI)

Diabetes Page 52 of 52

127x89mm (300 x 300 DPI)