A Study on Molecular Characterisation of Anti-Microbial Resistance In

A Study on Molecular Characterisation of Anti-microbial Resistance in

Salmonella enterica serovar typhi and paratyphi from

Blood Culture Isolates in a Tertiary Care Hospital.

Dissertation submitted in

Partial fulfillment of the Regulations required for the award of

M.D. DEGREE

MICROBIOLOGY – BRANCH IV

The Tamil Nadu

DR. M.G.R. Medical University, Chennai

MAY 2018. CERTIFICATE

This is to certify that the enclosed work “A Study on

Molecular Characterisation of Anti-microbial Resistance In Salmonella enterica serovar typhi and paratyphi from Blood Culture Isolates

In a Tertiary Care Hospital” submitted by Dr. S. VIJI to The Tamilnadu

Dr. MGR Medical University is based on bonafide cases studied and analysed by the candidate in the Department of Microbiology, Coimbatore

Medical College and Hospital , Coimbatore during the period from July

2016 to June 2017 under the guidance and supervision of

Dr. N.Mythily, MD., Professor and Head of Department , Department of

Microbiology and the conclusion reached in this study are her own.

Guide

Dr. N.MYTHILY, M.D.,

Professor & HOD Department of Microbiology, Coimbatore Medical College, Coimbatore.

Dr.B.ASOKAN, M.S., M.Ch., Dr. N.MYTHILY , M.D.,

Dean, Professor & HOD, Coimbatore Medical College and Hospital, Department of Microbiology, Coimbatore – 14. Coimbatore Medical College, Coimbatore – 14. DECLARATION

I, Dr. S. VIJI , solemnly declare that the dissertation entitled “A

Study on Molecular Characterisation of Anti-microbial Resistance In

Salmonella enterica serovar typhi and paratyphi from Blood Culture

Isolates In A Tertiary Care Hospital” was done by me at Coimbatore

Medical College Hospital, Coimbatore during the period from July 2016 to

June 2017 under the guidance and supervision of Dr. N. Mythily, M.D.,

Professor & HOD, Department of Microbiology, Coimbatore Medical College,

Coimbatore.

This dissertation is submitted to The Tamilnadu Dr. MGR. Medical

University towards the partial fulfilment of the requirement for the award of

M.D. Degree (Branch – IV) in Microbiology.

I have not submitted this dissertation on my previous occasion to any

University for the award of any degree.

Place: Coimbatore

Date :

Dr. S. VIJI

ACKNOWLEDGEMENT

I express my deep debt of gratitude to our respectful Dean,

Dr.B. Asokan M.S., Mch., for permitting me to do this study.

I thank Dr.A.Arjunan, M.D., Vice Principal, Coimbatore

Medical College, Coimbatore for her encouragement and suggestions in completing the study.

I wish to place my deep sense of gratitude and sincere thanks to Dr. N. Mythily MD., Professor and Head of the Department of

Microbiology, for the constant encouragement and timely advice given to me during the course of my post-graduation.

I express my deep sense of gratitude and indebtedness to

Professor Dr.N. Mythily MD., as a guide , for her constant guidance, valuable advice and inspiration throughout my study.

I sincerely place my thanks to Associate Professor

Dr.P.Sankar,M.D., for his support and encouragement.

I express my sincere thanks to my Assistant Professors

Dr.S.Deepa M.D., Dr.N.Bharathi Santhose M.D., Dr.B.Padmini M.D.,

Dr.C.Ashok Kumar MD., and Dr. R.Radhika MD., for their valuable suggestions.

My special thanks to my post graduate colleagues

Dr.K.Sivaram, Dr.N.Vandarkuzhali and Dr. P.Santhanalakshmi and other post graduates in the department of Microbiology for their co- operation in completing my study.

I take this opportunity to thank all the technical staffs in the

Department of Microbiology who gave me their kind co-operation throughout my study.

I affectionately thank my family members who are giving their constant support throughout my entire post-graduation course without which this work would not have been successful.

I am thankful to God, who have been with me all throughout my way to reach the destination.

CERTIFICATE - II

This is to certify that this dissertation work titled “A Study on Molecular Characterisation of Anti-microbial Resistance In Salmonella enterica serovar typhi and paratyphi from Blood Culture Isolates in a Tertiary Care Hospital.” of the candidate Dr. S. Viji with registration Number 201514254 for the award of Doctor of Medicine in the branch of Microbiology. I personally verified the urkund.com website for the purpose of plagiarism Check. I found that the uploaded thesis file contains from introduction to conclusion pages and result shows 2% percentage of plagiarism in the dissertation.

Guide sign with Seal.

CONTENTS

S.NO CONTENTS PAGE NO

1. INTRODUCTION 01

2. AIMS AND OBJECTIVES 07

3. REVIEW OF LITERATURE 08

4. MATERIALS AND METHODS 37

5. RESULTS 65

6. DISCUSSION 69

7. SUMMARY 77

8. CONCLUSION 79

9. BIBLIOGRAPHY

10. ANNEXURE

11. MASTERCHART

LIST OF TABLES

S.No TABLES

1 PERCENTAGE OF ENTERIC CULTURE POSITIVES

2 DISTRIBUTION OF SALMONELLA SPECIES

3 GENDER DISTRIBUTION OF ENTERIC FEVER CASES

4 AGE WISE DISTRIBUTION OF SALMONELLA SPECIES

5 CORRELATION BETWEEN NEUTROPHIL COUNT AND BLOOD CULTURE POSITIVE ENTERIC FEVER

6 CORRELATION BETWEEN HEPATOSPLENOMEGALY AND BLOOD CULTURE POSITIVE ENTERIC FEVER

7 ANTIMICROBIAL SUSCEPTIBILITY PATTERN OF Samonella typhi

8 ANTIMICROBIAL SUSCEPTIBILITY PATTERN OF Salmonella paratyhi A

9 QUINOLONE RESISTANCE AMONG SALMONELLA SPECIES 10 ANALYSIS OF RESISTANT GENES BY MOLECULAR METHODS 11 MUTATION ANALYSIS OF gyrA , gyrB and parC GENES.

LIST OF CHARTS

S.No CHART

1 PERCENTAGE OF ENTERIC CULTURE POSITIVES

2 DISTRIBUTION OF SALMONELLA SPECIES

3 GENDER DISTRIBUTION OF CULTURE POSITIVES

4 AGE WISE DISTRIBUTION OF SALMONELLA SPECIES

CORRELATION BETWEEN NEUTROPHIL COUNT AND CULTURE 5 POSITIVES

CORRELATION BETWEEN HEPATOSPLENOMEGALY 6 AND CULTURE POSITIVES

ANTIMICROBIAL SUSCEPTIBILITY PATTERN OF 7 Salmonella typhi

ANTIMICROBIAL SUSCEPTIBILITY PATTERN OF 8 Salmonella paratyphi A

QUINOLONE RESISTANCE AMONG SALMONELLA SPECIES 9

LIST OF COLOUR PLATES

S.NO COLOUR PLATES 1 Nutrient Agar plate : Salmonella typhi colonies 2 MacConkey Agar plate: Non - lactose Fermenting colonies of Salmonella typhi 3 Blood Agar plate : Grey white colonies of Salmonella typhi 4 DCA plate : Salmonella typhi with black head colonies 5 DCA plate : Salmonella paratyphi A with translucent colonies 6 Gram’s Stain – Gram Negative bacilli 7 Biochemical Reactions of Salmonella typhi 8 Biochemical Reactions of Salmonella paratyphi A 9 Sugar Fermentation by Salmonella typhi 10 LAO – Lysine Decarboxylated in Salmonella typhi 11 LAO – Ornithine Decarboxylated in Salmonella paratyphi A Mueller Hinton Agar – AST by Kirby – Bauer Method Salmonella typhi 12 Sensitive to Ciprofloxacin, Pefloxacin & Nalidixic acid Mueller Hinton Agar – AST by Kirby – Bauer Method Salmonella typhi 13 Resistant to Ciprofloxacin, Pefloxacin & Nalidixic acid Mueller Hinton Agar – AST by Kirby – Bauer Method Salmonella typhi 14 Sensitive to Chloramphenicol, Cotrimoxazole, Ceftriaxone & Azithromycin 15 MIC – E Test for Ciprofloxacin Multiplex PCR for Plasmid Mediated Quinolone Resitance genes 16 ( qnrA, qnrB, qnrS ) Multiplex PCR for Chromosomal Mediated Quinolone Resistance genes 17 (gyrA, gyrB, parC) 18 Gene Sequencing – gyrA, gene at quinolone resistance determining region 18 (a) DNA Sequence alignment Mutation Analysis : gyrA 19 Gene Sequencing – parC, gene at quinolone resistance determining region 19 (a) DNA Sequence alignment Mutation Analysis : parC

LIST OF ABBREVIATIONS

S. typhi Salmonella typhi

S.paratyphiA Salmonella paratyphi A

CLSI Clinical Laboratory Standards Institute

PCR Polymerase chain Reaction

MDR Multi – drug resistant

DNA Deoxyribonucleic Acid

MIC Minimum Inhibitory Concentration

MHA Mueller Hinton Agar

µg Microgram

Mac MacConkey Agar

BAP Blood Agar Plate

DCA Deoxycholate Citrate Agar

XLD Xylose Lysine Deoxycholate

H2S Hydrogen sulphide

K/A Alkaline / Acid

ONPG O-nitrophenyl beta D-galactopyranoside

HCl Hydrochloric acid

NaOH Sodium Hydroxide

AIDS Acquired Immuno Deficiency Syndrome

WHO World Health Organisation

ELISA Enzyme Linked Immunosorbent Assay

EUCAST European Committee on Antimicrobial Susceptibility Testing

ESBL Extended Spectrum Beta Lactamases

TSI Triple Sugar Iron

Bacl 2 Barium chloride

INTRODUCTION

Enteric fever is a world health problem, which occurs predominantly in the developing countries like India. The term enteric fever comprises of both typhoid fever and paratyphoid fever. Typhoid fever is caused by

Salmonella enterica subspecies enterica serovar typhi.

The organism that causes Paratyphoid fever can be either of the three serovars Salmonella paratyphi A, Salmonella paratyphi B (known as scholtmuelleri) or Salmonella paratyphi C (also called hirschfeldii).15

Salmonella paratyphi A is the common organism that occurs world wide, paratyphi B is more prevalent in Europe and paratyphi C is a very rare pathogen. The ratio of enteric fever caused by Salmonella typhi to that caused by Salmonella paratyphi is about 10 to 1.1.15

World Health Organisation has estimated, that the occurrence of typhoid fever being 21.7 million cases and 2,50,000 mortality occurring annually.11,12 Among that , the 80% of cases and deaths occur in Asia, the remaining occurs mainly in Africa and latin America.4,12,13 In developing countries like India, typhoid fever occurs with an incidence of 102 to 2,219 cases, per 1,00,000 population.12

Humans are the only natural hosts and act as a reservoir for

Salmonella typhi. The route of transmission of enteric fever occurs by faeco-oral route via contaminated food and water. The conditions that

1 facilitate the transmission of the disease are poor sanitation, unprotected drinking water supply, lack of hand washing and toilet access.

Enteric fever is an acute systemic illness characterized by step ladder pattern type of remittent fever, rose spots, coated tongue, hepatosplenomegaly and relative bradycardia. The complications of enteric fever are gastrointestinal bleeding, intestinal perforation and the neurological manifestations that occurs rarely like meningitis, cerebellar ataxia and neuropsychiatric symptoms.

The 10% of the enteric fever cases who are not treated properly will become carriers and they excrete the bacilli in feces or urine. 22 The multiplication of typhoid bacilli occurs in the gall bladder and are excreted in feces. Faecal carriers are more common than the urinary carriers. This carrier state contributes for the occurrence of epidemics and endemics.

Antibiotics are the mainstay for treatment of enteric fever. Prompt treatment of the disease with appropriate anti-microbials in appropriate time is a major criteria in reducing the mortality from 30% to 0.5%.10

Irrational use of antibiotics has led to the emergence of resistance in

Salmonella species. The emergence of antimicrobial resistance is a problem in the management of enteric fever, that becomes a challenge for both clinicians and the microbiologists.

Salmonella typhi strains developed resistance to Chloramphenicol in the early 1970s, following this the strains also developed resistance to

Ampicillin and Cotrimoxazole. 11,12 Multi drug resistant strains are those which are resistant to Chloramphenicol, Ampicillin and Cotrimoxazole.4

Due to the emergence of multi-drug resistant ( MDR ) Salmonella typhi strains, there occurred many epidemics of typhoid fever globally, especially in Southeast Asia. 4, 13

Resistance to Chloramphenicol in S.typhi are plasmid mediated, that occurs due to the acquisition of the R plasmid that encodes for an enzyme acetyl transferase, which inactivates chloramphenicol. In S.typhi, the resistance to Cotrimoxazole are due to the mutations in the chromosomal gene that encodes, the enzyme dihydrofolate reductase type VII. The development of multi-drug resistance is due to single plasmid that belongs to the incompatibility group, H I1 and this transmissible.4

The emergence of multi-drug resistant Salmonella strains, made the fluoroquinolones like Ciprofloxacin being the drug of choice in the treatment of typhoid fever. But indiscriminate use of fluoroquinolones led to the development of resistance against these agents also. This condition is further complicated by the emergence of quinolone resistant strain and there are studies that show, a steady increase in Minimum Inhibitory

Concentration (MIC) of Ciprofloxacin. 4,13

Since then several studies showed that, though the isolates are fully susceptible to Ciprofloxacin by disc diffusion tests, there occurs constant treatment failure. 4,13. A high level of Ciprofloxacin resistant strains of

Salmonella typhi, Salmonella paratyphi A were reported across India.4,13 3

Nalidixic acid being a reliable indicator for decreased ciprofloxacin susceptibility, it is considered as a surrogate marker for resistance to fluoroquinolones. Whereas Clinical and Laboratory Standards Institute

(CLSI 2015) recommends Pefloxacin as a surrogate marker for identification of fluoroquinolone resistance in a dose of 5µg by disc diffusion.18

Fluoroquinolones target DNA gyrase and topoisomerase IV, which are bacterial enzymes that are a part of a complex which uncoils and recoils the bacterial DNA for transcription.4 Salmonella typhi commonly develops fluoroquinolone resistance through specific mutations in gyr A and par C, that codes for binding region of DNA gyrase and topoisomerase

IV, respectively.

A single point mutation in gyrA gene confers a partial resistance, if a second gyrA point mutation is added the resistance increases. However a mutation in parC gene when added to a single gyrA mutation confers full invitro resistance to first generation fluoroquinolones.4 The other mechanisms of antimicrobial resistance in Salmonella isolates are plasmid mediated resistance, where plasmids of incompatibility group are important vectors of antibiotic resistance and rapid efflux of the drug.

Due to emergence of fluoroquinolones resistance, third generation

Cephalosporins are used in the treatment of enteric fever. But extensive use of these agents, lead to the development of Extended spectrum beta lactamase production in Salmonella. There are studies showing high level 4 resistance to Ceftriaxone and recently AmpC beta-lactamase producing

Salmonella typhi has been identified.4

Azithromycin can be used for treating Ceftriaxone, Ofloxacin and

Chloramphenicol resistant Salmonella isolates.4 Azithromycin is very effective in the eradication of intra-cellular Salmonella and gastro intestinal carriage is eliminated and it is also a potential drug in paediatric population where quinolones are contraindicated.4

Development of resistance to azithromycin has also been detected in Salmonella typhi and S. paratyphi A isolates.13 Salmonella species develop resistance to antimicrobial agents either due to chromosomal changes or the exchange of genetic material via plasmids or transposons.2

The risk factors for the emergence of antibiotic resistance in

Salmonella typhi are overuse, misuse and inappropriate prescription.

Difficulties in the diagnosis of S.typhi by culture methods are the factors behind irrational prescriptions of antibiotics. 12

The occurrence of relapse is common in the partially and fully resistant strains than the fully susceptible strains. As there is a steady increase in drug resistance among Salmonella species, it is necessary to continuously monitor the antimicrobial susceptibility patterns of Salmonella enterica isolates to update the therapeutic guidelines.13

The antimicrobial resistance pattern of Salmonella varies with geographical locations. 5 The treatment of enteric fever perhaps depend

5 on the understanding of local patterns of the antimicrobial resistance and on the results of the antimicrobial susceptibility testing of the Salmonella isolates from the individual patients.

Since serological methods of demonstration of antibodies in patients serum is possible only at second or third week of illness which may cause delay in the diagnosis of enteric fever, this study is targeted at isolation of Salmonella typhi and S.paratyphi from blood culture at an earlier stage.

Moreover Salmonella species are developing resistance to various categories of antibiotics, this study is aimed to determine the antimicrobial resistance pattern to design antibiotic policy that aids the clinicians to treat the patients earlier with appropriate antibiotics. This promotes complete cure of the patients and hence prevent them in developing complications of the disease. The patients going on to the carrier state is also eliminated that prevents the epidemics and endemics.

AIM & OBJECTIVES

AIMS AND OBJECTIVES

AIM OF THE STUDY :

The aim of the study is to isolate, identify the Salmonella typhi and Salmonella paratyphi from blood culture and to detect its antimicrobial resistance pattern, to study the molecular characterization of resistance genes.

OBJECTIVES:

1) To isolate Salmonella typhi and Salmonella paratyphi from blood

culture using conventional methods.

2) To confirm the isolated organisms by slide agglutination test using

High Titre Sera.

3) To evaluate the anti-microbial susceptibility pattern of the organisms

isolated, by Kirby-Bauer disc diffusion method.

4) To determine the antibiotic resistance pattern and to detect the

Minimum Inhibitory Concentration of resistance drugs by E-Strip

methods.

5) To analyse the resistant genes by molecular methods.

REVIEW OF LITERATURE

Historical Review of Salmonella :

In 1826, Bretonneau, detected an enteric lesion of the disease and

Louis named it as typhoid in 1829. In 1856 Budd described the disease to be transmitted by faeces of the patients.20 In 1880, Eberth identified typhoid bacillus in the mesenteric nodes and in the spleen of fatal cases of typhoid fever and Gaffky in 1884 isolated the bacillus. Since then the organism was called as Eberth-Gaffky bacillus or Eberthella typhi.22

Salmon and Smith, in 1885, identified a bacillus that caused hog cholera and named it as Salmonella cholera-suis. It was the first bacillus to be isolated in the genus Salmonella. Then onwards it was realized that, typhoid bacillus also belonged to this genus, with some differences in biochemical reactions. Eberth-Gaffky bacillus was renamed as

Salmonella typhi and the genus Eberthella had been no longer used.20

In 1898, Gwyn isolated Salmonella paratyphi A, and in 1896

Salmonella paratyphi B was isolated by Achard and Bensaude. In 1908,

Uhlenhuth and Hubener isolated S.paratyphi C. Salmonella currently comprises of > 2500 serotypes (serovars)22

Taxonomy of Salmonella typhi :

Domain : Bacteria

Phylum : Proteobacteria

Class : Gammaproteobacteria

Order : Enterobacteriales

Family : Enterobacteriaceae

Genus : Salmonella

Species : Salmonella enterica

Subspecies : Salmonella enterica enterica

Serovar : Salmonella enterica serovar Typhi

Morphology :

Salmonella typhi, Salmonella paratyphi A,B,C all belong to the genus Salmonella that comes under the family Enterobacteriaceae.

Salmonella are gram negative bacilli, about 2-4 x 0.6 micrometer, non- capsulated, non-sporing, non acid-fast most serotypes are motile with peritrichous flagella, except S.gallinarum and S.pullorum, which are non- motile.21

Classification :

Many modifications are observed in the classification and nomenclature of Salmonella over the past years. The classifications are

1) Clinical classification :

This classification is the oldest one, but still used nowadays and also termed as User friendly classification. Salmonellae is classified into two group, i) Typhoidal Salmonella :

This comprises of both serovars Salmonella typhi and Salmonella paratyphi. These are the causative agents of enteric fever in human beings and they are defined to the human host alone. ii) Non-typhoidal Salmonella :

The rest of the serotypes that inhabit the intestine, of a wide range of animals causing food- borne gastroenteritis and septicemia in human beings comes under non-typhoidal Salmonella

2) Kauffmann-White Scheme Antigenic Classification:

In 1934, this scheme was first introduced and this classifies the

Salmonellae into different O serogroups which further contains a number of serotypes that possess a common O antigen which is not found in other O groups. This classification is based on the presence of somatic

(O) and flagellar (H) antigens that can be detected by agglutination with anti-sera.

10 i) Serogroups :

The genus Salmonellae are classified into serogroups based on the presence of somatic O antigen. ii) Serotypes :

Every serogroup is further classified into serotypes, based on the presence of flagellar antigens.

3) Molecular classification :

The genus Salmonella are classified into two species – Salmonella enterica and Salmonella bongori, based on DNA Hybridization studies

The species of Salmonella enterica, further have six subspecies, namely enterica, salamae, arizonae, diarizonae, houtenae and indica. Then the subspecies are further classified into serotypes as described in Kauffmann-

White scheme.

Kauffmann-White Antigenic Classification for Salmonella 22

Serogroup H Ag Serotype O Ag * Vi Ag name New Old Phase 1 Phase 2

2 A S.paratyphi A 1,2,12 _ A (1,5)

4 B S.paratyphi B 1,4,5,12 _ B 1,2

7 C1 S.paratyphi C 6,7 + C 1,5

9 D1 S.typhi 9,12 + d _

Cultural Characteristics :

Salmonellae are aerobic and facultative anaerobes, readily grows on simple media at pH of 6-8 and at optimum temperature of 37ᵒC. On

Nutrient agar, after 24 hours of incubation at 37ᵒC the colonies are large

2-3 mm in diameter, circular, low convex, surface smooth, translucent,with entire edges and, easily emulsifiable. 20

On MacConkey agar, Salmonella colonies appear as large, circular,

1-3 mm in diameter, low convex, non-lactose fermenting, colonies. On blood agar, the colonies appear as large, circular, moist, 1-3 mm in diameter, greyish white, low convex colonies with entire edges.

One of the selective media for Salmonella is Deoxycholate citrate

(DCA) media that contains high concentration of bile salts. S.typhi grow as pale, nearly colourless, smooth and shiny, translucent colonies with black centers due to the production of H2S. S.paratyphiA do not produce

H2S, so the colony morphology on DCA will be pale, nearly colourless, smooth, shiny and translucent colonies.

Xylose lysine deoxycholate (XLD), the selective media for

Salmonella and Shigella is less inhibitory for coliform bacilli. The concentration of bile salts in this medium is low which makes the media less selective compared with Salmonella –Shigella agar media and Hektoen enteric agar. The phenol red is the indicator used in this media.

S.typhi, which decarboxylate lysine, initially produce yellow colonies from the utilization of xylose and later on the colonies become red due to the decarboxylation of lysine with black head centers due to production of hydrogen sulphide.20, whereas S.paratyphi A colonies are red colour in XLD as they do not produce H2S.

On Wilson and Blair bismuth sulphite medium, H2S producing

S.typhi and S.paratyphi B cause reduction of sulphite to sulphide, thereby producing jet black colonies with a metallic sheen. Salmonella paratyphi A do not form H2S, so they produce green coloured colonies in Wilson and

Blair bismuth sulphite media. 22

In Salmonella –Shigella agar, another selective media, the colonies of S.typhi and S.paratyphi B appear colourless with black centers, owing to the production of H2S, whereas S. paratyphi A produce colourless colony without black centers.24

Hektoen enteric agar, one of the recently formulated media, S.typhi produces blue-green colonies, with black centers from H2S production, whereas S.paratyphi A produce blue green colonies without black centers.24

An enrichment media, are used mainly for the isolation of

Salmonella from faecal samples, sewage and foodstuff as they contain mixed bacterial flora and should be sub-cultured within 8 hours in selective media.

The commonly employed enrichment media in isolation of

Salmonella species from faeces are Selenite F broth, tetrathionate broth and gram negative broth. Whereas isolation of Salmonella from blood samples require either Bile broth or BHI broth.

Biochemical reactions :

Salmonellae are catalase positive and oxidase negative. They reduce nitrates to nitrites. Indole is not formed, citrate is utilized except by

S.typhi, S.paratyphi A, urease is not hydrolysed. In triple sugar iron,

Salmonella typhi produce [K/A] alkaline/acid slant with speck of H2S,

Salmonella paratyphi A produce K/A with gas, whereas Salmonella

24 paratyphi B produce K/A with abundant H2S.

Salmonellae are methyl red positive and Voges-Proskauer negative.

They ferment glucose, mannitol, mannose and donot ferment lactose and sucrose. Salmonella typhi ferment the sugars like xylose, trehalose, whereas Salmonella paratyphi A ferment arabinose, rhamnose, trehalose.24

Salmonellae do not deaminase phenylalanine and are O-nitrophenyl beta

D-galactopyranoside (ONPG) negative.24

Biochemical reactions of Salmonella species 22,24

Species Indole Citrate Urease TSI Gas/H2S Lysine Arginine Ornithine

-/+ S.typhi _ _ _ K/A + - - (speck)

S.paratyphi A _ _ _ K/A +/ - - - +

S.paratyphi B _ + _ K/A + / ++ + + +

Pathogenesis :

The infective dose of Salmonella typhi is 103 – 106 bacilli to

initiate the infection in humans.

Mode of transmission :

Enteric fever is transmitted commonly by feco-oral route, through

contaminated food and water. The carriers who are asymptomatic, or the

patients those who have recently recovered from the illness, excretes enormous

S.typhi in the stool which causes contamination of food and water.

The following are the modes of transmission,

i) handling food directly without hand washing

ii) Flies act as vector in transmission of bacilli

iii) Contamination of drinking water sources

Roughly about 10% of those who have recovered from enteric fever excretes the bacilli in the faeces for about 12 weeks and 2-3% became carriers in future and hence become the source of infection.

Predisposing factors for transmission :

The transmission of Salmonella enterica species are promoted by the following factors like

i) antacid ingestion

ii) achlorhydria

iii) prior Helicobacter pylori infection

iv) inflammatory bowel disease

v) prior GIT surgery

vi) suppression of the intestinal flora by antibiotics

The organisms enter the intestine via M cells which are epithelial cells that lines the mucosa of the intestine. The bacilli forms the membrane ruffles on the cell membrane of M cells. These ruffles enclose the adherent bacteria inside the large vesicles. This process of uptake is called bacteria mediated endocytosis. 22

Salmonellae has specialized type III secretion system that enhance transport of bacterial proteins directly into the cytoplasm of epithelial cells, which cause modifications in the actin cytoskeleton system that is

16 necessary for the bacterial uptake. Following entry, the bacilli remain inside the vacuoles in the cytoplasm. 22

Salmonellae present in the vacuoles cross the epithelial layer to reach submucosa, where the macrophages phagocytose the bacilli.

Salmonella typhi cause alterations on the surface, hence the organism are resistant to the lysosomal enzymes of macrophages. This process is regulated by the organisms regulatory systems such as PhoP/PhoQ system, that renders the expression of outer membrane proteins, thus facilitating the alterations in lipopolysaccharides. 22

The organisms that are present in the macrophages spread through the lymphatics to enter the blood stream, thus leading to transient primary bacteremia. The Salmonellae then disseminates throughout the reticulo endothelial tissues like liver, spleen, lymph nodes, bone marrow and the other organs like gall bladder, kidneys and lungs where further multiplication takes place. Secondary bacteremia occurs from the seeded organs, that leads to the onset of clinical illness.

Antigenic Structure and Virulence Factors :

Salmonellae have the following antigens on their cell wall. They are

i) Somatic antigen (O)

ii) Flagellar antigen (H)

iii) Surface envelope antigen (Vi)

The non-specific antigens like fimbriae are present in some strains of Salmonellae.

Somatic antigen (O) :

The somatic antigen O is a phospholipid-protein-polysaccharide complex and it is an integral part of the cell wall lipopolysaccharide. It is similar to endotoxin. Somatic (O) antigen is less immunogenic.

The antibody to O antigen develops early and disappears early, so its presence indicates recent infection. When mixed with antisera, O antigen suspension agglutinates and forms compact, granular,chalky clumps. But agglutination occurs slowly and the optimum temperature for agglutination is 55ᵒ C.22 The antibody to O antigen is cross reactive, so

H antigen is a more reliable indicator. 20

Flagellar antigen H :

This antigen is present on the flagella and is made up of proteins flagellin. H antigen is strongly immunogenic and induces antibody formation more rapidly. The antibody to H antigen appears late and disappears late, hence indicates convalescent stage. When mixed with antisera, H suspensions agglutinate rapidly producing large, loose, fluffy clumps. Agglutination occurs rapidly at an optimum temperature of 37ᵒC.

H antigen exists in two phases, phase I and phase II, most of the strains are biphasic except Salmonella typhi which is monophasic. 21

Vi antigen:

It is a surface polysaccharide envelope or capsular antigen that envelopes the O antigen. Vi antigen is related to its virulence. It is present in only few serotypes like S.typhi, S.paratyphi C and S.dublin.

The bacilli are inagglutinable to the O antiserum, when it contains Vi antigen. By heating at 100ᵒC for one hour, the strain becomes agglutinable with O antisera, when Vi antigen is removed and exposes the O antigen.

Vi antigen is destroyed by 1N HCl and 0.5 N NaOH but not by alcohol or formaldehyde.

Vi antigen is not used in the diagnostic purpose as it is poorly immunogenic and the antibody titres are low. Hence Vi antigen is not employed in the Widal test. However it is believed that the complete absence of Vi antibody in a case of typhoid fever indicates poor prognosis.

The Vi antibody disappears early in convalescence, so its presence indicates the development of carrier state. 20

The Vi antigen is predicted as a virulence factor as it inhibits phagocytosis, resists complement activation and bacterial lysis by the alternative pathway and peroxidase mediated killing. The young cultures of S.typhi are rich in Vi antigen, producing opaque colonies, than those strains that are lacking Vi antigen.22

M antigen :

It is a loose extracellular polysaccharide slime which contains colanic acid. These antigens are non-specific, as they are present in serotypes of Salmonella as well as in many strains of E.coli. These antigens resemble Vi antigens by masking agglutination with O antibodies.

When heated to 100ᵒ C, M antigen gets removed thereby rendering the bacilli agglutinable to O antibody. 21

Fimbrial antigens :

These antigens are non–specific and present among various members of the enterobacteriaceae. These antigens are shared between many serotypes of Salmonellae, hence cross reactions occur in agglutination tests, if bacteria is in fimbrial phase and the sera contains fimbrial antibodies. 21

Antigenic variations :

Salmonellae that possess various antigens undergo many types of phenotypic and genotypic variations.

Variations of O Antigen :

Broadbent SE et al on 2010 explained phase variations of O-antigen may contribute to immune evasion and the various variations are,

20 i) S -- R variation :

Mutation causes Smooth to Rough variation and this variation is

associated with the loss of O antigen and of virulence of the

organism. ii) Lysogenic conversion :

Salmonella when gets infected with a bacteriophage, they either

loose or gain O antigen, this is called as lysogenic conversion.

Variations in H antigen : i) OH -- O variation :

In this variation the motile strains of Salmonellae may loose

their flagella and they become non-motile. But the inhibition of

flagella is only temporary. ii) Phase variation :

The flagellar antigens exist in two phases, each phase comprising

of distinct set of flagellar antigens. Phase 1 antigens are serotype

specific and designated as a,b,c,, etc. Phase 2 antigens are

nonspecific or group antigens, they are few in number that are

designated as 1,2,3,etc.

Variation in Vi antigen : ( V-W Variation )

S.typhi, strains that possess Vi antigen (V forms) masks O antigen, so agglutination occurs with Vi antisera. By serial subcultures, Vi antigen

21 is lost completely and such strains W forms are agglutinable by O antisera and not by Vi antisera. 22

Clinical manifestations of Enteric fever :

The incubation period of enteric fever is about 10-14 days. With every spike, the fever peaks to higher level then gradually falls down

(step ladder pattern type of remittent fever). The other symptoms like headache, chills, cough, sweating, myalgia and arthralgia occurs. During the episode of fever, 25% of the patients develop rose spots, that are faint, salmon coloured, blanching, maculopapular rash occurring over trunk and abdomen.6

Rajesh Upadhyay et al in 2015 from New Delhi explained abdominal pain, nausea, vomiting, constipation in adults, diarrhea in children and anorexia are the early intestinal manifestations that may occur. The important clinical signs that are elicited are relative bradycardia, hepatospleenomegaly, and epistaxis.15

About 10% of the cases develop complications like gastrointestinal bleeding, intestinal perforation and peritonitis in the third or fourth week of illness. In enteric fever the high case fatality rate may be seen in those patients with altered sensorium.

Syed Ahmed Zaki et al study shows the increased incidence of complications and mortality are because of delay in starting the appropriate antibiotic therapy, virulence of bacteria and bacterial load in circulation.12

The other rare complications that may occur are neurological manifestations like meningitis, encephalomyelitis, Gullain-Barre syndrome, cranial or peripheral neuritis, cerebellar ataxia and neuro-psychiatric symptoms like hysteria, delirium, paranoid pyschosis and aggressive behaviour.

The major serious complications that are documented with typhoid fever are haemorrhage that may cause sudden death in some patients.

Hepatitis, myocarditis, pneumonia, disseminated intravascular coagulation, thrombocytopenia and haemolytic uremic syndrome are the other rare complications that may occur. About 15% of enteric fever cases died due to prolonged fever in the pre-antibiotic era. Few others develop genito- urinary manifestations or develop relapse or carrier state.

The factors that influence the severity and outcome of the infection are; duration of illness before the initiation of treatment, the choice of antimicrobials, age, vaccination history, the virulence of the bacterial strain, host factors (e.g. AIDS or other causes of immune-suppression) and whether the individual was taking other medications such as

H2 blockers or antacids to diminish gastric acid.

Carriers:

About 10% of enteric fever cases become carriers and they excrete the bacilli in faeces or urine. These carriers may be

i) Convalescent carriers : Those who shed the bacilli in faeces for

three weeks to three months after recovery of illness are called

convalescent carriers.

ii) Temporary carriers : Those who shed the bacilli in faeces for more

than three months but less than a year are called temporary carriers.

iii) Chronic carriers: Those who shed the bacilli in faeces for more

than a year are called chronic carriers, which occurs in about

1-4% of enteric fever cases.

Detection of carriers :

The stool culture and bile culture methods are used to detect the faecal carriers and urine culture detects the urinary carriers. The demonstration of Vi antibodies is also used to detect the carriers. Isolation of Salmonella from sewage is carried out either by Sewer –swab technique or by filtration method to trace the carriers in the communities.

Classification of typhoid fever cases ( WHO Guidelines )

Confirmed case The patients with fever for more than 3 days and culture positive for S.typhi (blood, urine, stool culture) Probable case The patients who have fever for more than 3 days with a positive serological test but S.typhi is not isolated in culture. Chronic carrier After complete recovery from acute typhoid fever if an individual excretes S.typhi in stool for more than a year, they are called as chronic carriers.

Laboratory Diagnosis :

The laboratory diagnosis of enteric fever begins with the basic investigations like complete blood counts with differential leukocyte count.

The clinical diagnosis of enteric fever is confirmed either by isolation of bacilli by culture methods or by the demonstration of antibodies in the serum.

The gold standard test for the diagnosis of enteric fever is isolation of organism by blood culture, so it is mandatory to perform it in all clinically suspected enteric fever cases. Blood culture is the ideal method for diagnosis in the first week of illness, which becomes positive in about

90% of cases.

Bone marrow culture can be done, when blood culture is negative especially when the patient is on antibiotics. Duodenal aspirate culture can be done if both blood and bone marrow culture are negative. Stool and urine culture are useful for the isolation of Salmonella in the third and fourth week of illness.

The demonstration of antibodies in serum can be done by Widal test. Recently the other methods like Typhidot test, IgM dip stick test and ELISA are also be employed in the diagnosis. Molecular based methods like nucleic acid amplification tests are available to detect typhoidal Salmonella.

Typing of Salmonellae :

This is done mainly for the purpose of surveillance and for determining the source of infection. There are several typing methods like

1. Phenotypic methods that includes Phage typing, Bacteriocin typing,

Biotypnig and Antibiogram typing

2. Genotypic methods : The most commonly used methods are the

following,

i) Plasmid typing : This is done on the basis of the numbers and

molecular weight of plasmids that are present in Salmonella

species.

ii) Chromosomal based : This is done by Pulse field gel

electrophoresis, Ribotyping and Restriction fragment length

polymorphism. DNA sequencing can be done to detect mutations

in resistant genes.

Treatment of Enteric fever :

WHO guidelines states that, for fully sensitive isolates either 15 mg/kg of ciprofloxacin or 15 mg/kg of Ofloxacin for a duration of 10-

14 days can be given. In case of multi-drug resistant strains either

15mg/kg of Ciprofloxacin or Cefixime of 15-20 mg/kg for 10-14 days should be prescribed. For quinolone resistant isolates, Ceftriaxone 75 mg/kg for 10-14 days or Azithromycin in a dose of 8-10 mg/kg for

10-14 days should be given for treating enteric fever.53

Treatment of Carriers :

Carriers should be treated either by Amoxycillin with probenicid of 30 mg/kg, orally tid for 6-12 weeks or Cotrimoxazole 4-20 mg/kg, oral bid for 6-12 weeks. Ciprofloxacin in a dose of 1500 mg oral bid for 4 weeks can also be used for treating carriers.

In 1948 chloramphenicol has been introduced as the drug of choice for treatment of enteric fever. This drug inhibits the bacterial synthesis and act as bacteriostatic agent. In the past, as Chloramphenicol is orally active and also a broad spectrum antibiotic, it was irrationally used resulting in the development of resistance. Moreover because of its adverse effect and its contraindication during pregnancy and in neonates,

Ampicillin and Cotrimoxazole were used as an alternative source in treatment of enteric fever.

Enteric fever responded to ampicillin, amoxicillin and cotrimoxazole.

Later on due to emergence of multidrug resistant Salmonella typhi, fluoroquinolones like ciprofloxacin, ofloxacin and pefloxacin are used for the treatment. These drugs act by inhibiting bacterial enzymes DNA gyrase and topoisomerase IV, which play a major role in division, coiling and supercoiling of bacterial DNA during multiplication. 4,18

If Nalidixic acid is found to be resistant to an isolate, even though if it is susceptible to ciprofloxacin, those strains required higher doses of ciprofloxacin, if not it resulted in treatment failure. So Nalidixic acid

27 considered to be a surrogate marker for fluoroquinolone resistance. Since

Nalidixic acid do not determine the low level resistance in Salmonella species, CLSI 2015 and EUCAST suggested Pefloxacin as the reliable surrogate marker of fluoroquinolone resistance. 18

Due to the development of resistance to fluoroquinolones by

Salmonella species, the Cephalosporins like Ceftriaxone, Cefixime,

Cefipime and Cefpodoxime are widely used for the treatment of enteric fever. Recently third generation cephalosporins like ceftriaxone, cefotaxime and cefoperazone are used effectively in treatment. The mechanism of action of Cephalosporins are inhibition of bacterial cell wall synthesis. 8

Jaspal Kaur on 2013 explained Azithromycin, a broad spectrum azilide, can be the drug of choice over fluoroquinolones, cephalosporins and chloramphenicol because of the following reasons.4

i) negligible relapse rate,

ii) its defervescence is rapid,

iii) effective in removing intracellular Salmonella,

iv) gastrointestinal carriage is eradicated,

v) potential drug in paediatrics where quinolones are contraindicated.

Jaspal Kaur on 2013 says Aztreonam, tigecycline and imipenem are currently used as an alternatives in case of serious infections.

Tigecycline is a tetracycline analogue, that acts by inhibiting the bacterial

28 protein synthesis. The carbapenems are a class of beta lactam antibiotics with broad spectrum activities and they are stable to the hydrolysis of

ESBL producing isolates. The carbapenems and tigecycline are the potent drugs in case of ceftriaxone resistant isolates.4

History of Antimicrobial resistance :

In 1950, the Chloramphenicol resistant S.typhi first emerged in UK and subsequently this resistance was observed in Greece and Israel. There were sporadic reports of Chloramphenicol resistance world wide, including

India. The plasmid encoded Chloramphenicol resistance was first observed

s followed by epidemics in Central America. However inיin early 1970

1972, chloramphenicol resistant S.typhi strains became a major problem in causing outbreaks worldwide.4,8

In 1980 multi-drug resistant S.typhi strains emerged in south east

Asia. A single plasmid is responsible for multi-drug resistance and this is highly transmissible. This plasmid belongs to incompatibility group, H

I1.In 1987 multi-drug resistant strains of S.typhi were first reported in

Pakisthan. In India MDR strains of S.typhi were first reported in 1990 and an outbreak called Dombivali fever reported in Mumbai. There were sporadic reports of multi drug resistant S.typhi strains all over India. 4,12

In 1992, at UK first strain of fluoroquinolone resistant S.typhi emerged. Das et al in 2000, at Orissa found S.typhi strains developed resistance to ciprofloxacin.Over a period of seven years S.typhi strains

29 gradually developed resistance to fluoroquinolones. Saha et al and Kumar et al in 2007 declared third generation cephalosporins also developed resistant to S.typhi strains.4,12

Mechanism of Antimicrobial resistance :

Typhoidal Salmonella exhibits antimicrobial resistance by two factors

i) Acquisition of foreign genes via plasmids

ii) Mutation on chromosomes.

Resistance can be achieved by horizontal acquisition of resistant genes, mobilized via insertion sequences, transposons, and conjugative plasmids. The antimicrobial resistance is also exhibited by recombination of foreign DNA into the chromosome or by mutations in different chromosome loci. 8

Plasmid mediated resistance :

Antimicrobial resistance in S.typhi are either plasmid mediated resistance or chromosomal mediated resistance. Plasmids of incompatibility group are important vectors of antibiotic resistance in S.typhi. Plasmid mediated resistance often code for enzymes that destroy or modify the drugs. Plasmid associated genes have been implicated in resistance to chloramphenicol, aminoglycosides, penicillins, cephalosporins, tetracyclines and sulphonamides.

The mechanism of drug resistance mediated by acquisition of

R plasmids are due to

i) Inactivation of the drug

ii) reduced membrane permeability

iii) modification of drug site

iv) rapid efflux of antibiotic i) Inactivation of drug :

This is the common cause of resistance that inactivates antimicrobials. The enzyme beta lactamase present in various bacteria is best known example for inactivation of the drug. Enzyme beta lactamase cause hydrolysis of beta lactam ring of penicillin and cephalosporins. The initial strains of antibiotic resistant S.typhi carried chloramphenicol acetyl transferase type I, which encodes an enzyme that inactivates chloramphenicol via acetylation.4,8

Datta et al reported that S.typhi has acquired R plasmid in the intestine of human beings from other enteric bacteria. Chloramphenicol resistant S.typhi have emerged due to acquisition of R plasmid which encodes the enzyme acetyl transferase that inactivates chloramphenicol. 4,8

The genes which are responsible for resistance to ampicillin and cotrimoxazole are dihydrofolate reductase type VII and TEM -1 Beta lactamase. 4 A single plasmid has been known to code for the multidrug

31 resistance and this plasmid belongs to the incompatibility group, H I1 and this is highly transmissible. ii) Reduced membrane permeability :

The pathogens by preventing the entrance of the drug they become resistant. The new genetic information changes the nature of proteins in the membrane, which leads to the alteration in the membrane permeability.

Such an alteration cause a change in the membrane transport system pores, and hence the antibiotics can no longer cross that membrane.

Salmonella typhi, exhibited resistance to tetracycline, quinolones and some aminoglycosides by this mechanism. iii) Modification of target site :

The mechanism of drug resistance in S.typhi occurs when the target enzyme or the cellular structure of the pathogen gets modified, so that it is no longer susceptible to the drug. iv) Rapid extrusion or efflux of the antibiotic :

Many pathogens develop resistance to antibiotics by pumping the drug out of the cell, after it has entered. These pathogens have plasma membrane translocases, often called efflux pumps that expels the drug.

Because they are non-specific and can pump many different drugs including quinolones, these transport proteins are called multi-drug resistance pumps. Resistance to sulfonamides is mediated by a plasmid encoded transport system that actively expels the drug out of the cell.

The genes like plasmid mediated beta lactamases, tetracycline –resistance genes, and aminoglycoside modifying enzymes are organized on transposons.

Chromosome mediated resistance :

Chromosomal resistance is due to the mutation in the gene that codes for either the target of the drug or the transport system in the membrane that controls the uptake of the drug. The irrational use of the antibiotic has led to the emergence of chromosomal mediated drug resistance phenomenon against fluoroquinolones. This has been attributed to a single point mutation in the quinolone resistance determining region of topoisomerase gene gyrA, which encodes DNA gyrase. 8

The fluoroquinolones target DNA gyrase and topoisomerase IV.

These are bacterial enzymes that are responsible for the uncoiling and recoiling of bacterial DNA for transcription. Salmonella typhi most commonly develops fluoroquinolone resistance through specific mutations in gyrA and par C which codes for DNA gyrase and topoisomerase IV, respectively.

A single point mutation in gyrA confers partial resistance, if a second gyrA point mutation is added, the resistance increases. However, a mutation in parC along with mutation in gyrA confers full invivo resistance. The risk of relapse after bacterial clearance is higher in both partially and fully resistant strains than fully susceptible strains.

The quinolones that are used in the treatment of enteric fever are ciprofloxacin, levofloxacin, ofloxacin and gatifloxacin. In gatifloxacin and moxifloxacin the primary target is gyrA gene, and for ciprofloxacin and levofloxacin it is the parC gene.This explains the varied pattern of susceptibilities, so all the fluoroquinolones should be tested individually.4

Resistance to trimethoprim is due to mutations in the chromosomal gene that encodes the enzyme dihydrofolate reductase. The resistance to sulfonamides is mediated by a chromosomal mutation in the gene encoding for the target enzyme dihydropteroate synthetase, that reduces the binding affinity of the drug.

Extensive use of Cephalosporins leads to the development of resistance by producing Extended Spectrum Beta Lactamases. S.typhi produces a variety of ESBL types like TEM, SHV, CTXM enzymes.

TEM types of ESBL was first discovered in a patient called Temonieria and hence named as TEM. SHV was named so because they are sulfhydryl variable.CTX-M are ESBL s that have the tendency to hydrolyse

Cefotaxime.

Prophylaxis for Enteric fever :

Since human is the only host and the mode of transmission of the disease is by contaminated food and water, it is possible to eliminate the disease by taking measures in providing safe water supply and maintaining proper sewage disposal.

The early diagnosis of illness and treatment with appropriate antibiotics prevents the development of carriers, who play a major role in the transmission of the disease. The prompt detection of carriers by stool / urine culture or by demonstration of Vi antibodies, aids in treating the carriers early.

Vaccines :

Vaccination of individuals protects only for short duration and it is indicated in following conditions,

i) those who are travelling to endemic areas

ii) household contacts

iii) school children and hostellers

The three types of vaccines available for typhoid fever are,

i) parenteral TAB vaccine

ii) parenteral Vi polysaccharide vaccine

iii) typhoral vaccine i) Parenteral TAB vaccine :

It is a killed whole cell S.typhi and S. paratyphi A,B vaccine, but not in usage because of its adverse effects.

35 ii) Parenteral Vi polysaccharide vaccine :

This vaccine contains purified Vi polysaccharide antigen obtained from S.typhi strain Ty2. It is advised after two years of age, given as a single dose of 25 µg of Vi antigen intramuscular or subcutaneous. It confers protection for 2 years. iii) Typhoral vaccine :

It is an oral, live, attenuated S.typhi Ty2 1 a vaccine given after six years of age, orally before food on 1,3,5 and /or 7th day i.e totally

3-4 doses. The vaccine is available as enteric coated capsules in lyophilized form. Protective immunity starts after 7 days and lasts for 4 years and booster dose is required every 3 years especially those who are residing in endemic zones.

MATERIALS & METHODS

MATERIALS AND METHODS :

Place of study :

This Study on Molecular Characterisation of Anti-Microbial

Resistance in Salmonella Enterica Serovar typhi and paratyphi From Blood

Culture Isolates in a Tertiary Care Hospital was carried out in fever OP and in Medicine / Paediatric Department in Coimbatore Medical College and Hospital, Coimbatore.

Duration of study :

The study was conducted over a period of one year from July

2016 to June 2017

Type of study : Prospective Study

Approval :

Ethical clearance was obtained from Institutional Ethics Committee and informed consent was obtained from the patients and also the parents or guardians of the accompanying children.

Sample size :

The blood samples from 250 fever cases with provisional diagnosis of enteric fever attending Fever clinic and also in medicine and paediatric ward were collected.

Inclusion Criteria :

Patients with signs and symptoms of enteric fever like ( step ladder pattern type of remittent fever, relative bradycardia, hepatosplenomegaly and rose spots) of all age groups attending on an outpatient or inpatient basis were included in this study.

Exclusion criteria :

Those patients who had taken antibiotics within a week were excluded from this study.

Evaluation :

A detailed information about this study was informed to the patients, parents / guardian and informed consent obtained before the study. A detailed history regarding the patients name, age, address, duration and history of presenting illness, treatment history about antibiotics taken were obtained.

Sample Collection :

For collection of blood, skin at the venepuncture site was meticulously prepared by thoroughly cleaning with 70% ethyl alcohol.

These bactericidal agents were applied in concentric circles moving outwards from the centre. The skin was then allowed to dry for one minute before the blood was withdrawn.

Under aseptic precautions, 5 ml and 10 ml of venous blood was collected from children and adults respectively in patients of acute febrile illness. Blood samples collected were inoculated aseptically into blood culture bottle containing 25 - 50 ml of Brain heart infusion broth and incubated aerobically at 37°C.

The broth was examined regularly for bacterial growth like turbidity and subculture was done on Nutrient agar, Mac Conkey agar and on Blood

Agar plate. The plates were incubated for 24 hours at 37°C. Any growth was further processed for identification as per the standard procedure. The organisms were identified by their colony morphology, Gram staining methods, motility test and following biochemical reactions with suitable controls.

 Catalase

 Oxidase

 Indole test

 Citrate test

 Urease test

 Triple sugar iron test

 Nitrate reduction test

 Methyl red and voges-Proskauer test

 Sugar fermentation tests

 Decarboxylation test

 Slide Agglutination test

GRAM STAIN :

A smear was prepared from 18-24 hours old colony from the agar plate. After air drying and heat fixation, Gram staining was done using

1% methyl violet as primary stain, grams iodine as mordant, acetone as decolouriser and dilute carbol fushcin as counterstain. Gram reaction, shape and arrangement of the bacteria were observed. Salmonella species appear as gram negative rods.

MOTILITY :

Hanging drop procedure was done using, the saline suspension of the colony and the edge of the drop was focused under high power microscope to observe for the motility of the bacteria. Salmonella species are motile except for S.gallinarum and S. pullorum.

CATALASE TEST:

This test is done to determine the ability of the organism to produce catalase which splits hydrogen peroxide into oxygen and water.

The release of oxygen produces brisk effervescence.

Procedure

 One or two colonies to be tested were picked up by a sterile glass

rod, introduced into a sterile glass test tube containing 3% hydrogen

peroxide.

 Production of brisk effervescence indicates catalase production.

Salmonella species were catalase positive.

OXIDASE TEST :

It is done to determine the presence of bacterial cytochrome oxidase that takes part in aerobic respiration by transferring electrons to oxygen forming water.

Procedure

Freshly prepared oxidase reagent (tetramethyl p-phenylene diamine

dihydrochloride) was poured on a filter paper placed in a petridish

and the colony to be tested was smeared on the filter paper and

development of a deep purple colour in 10 seconds shows the

organism was oxidase positive, otherwise negative. Salmonella

species were oxidase negative.

INDOLE TEST :

This test demonstrates the production of indole by splitting tryptophan into indole and pyurvic acid with the help of the enzyme tryptophanase. Two ml of 24-48 hours broth culture was taken in a test tube and to this 0.5ml Kovac’s reagent was added gently along the sides.

Formation of a red colour ring at the junction was taken as a positive test. Salmonella species do not split indole.

CITRATE UTILIZATION TEST :

This test is done to determine the ability of organism to utilize citrate as a sole source of carbon and inorganic ammonium salt as a sole source of nitrogen. The organisms was streaked on the surface of a slant of Simmon’s citrate medium and incubated at 37ºC for 18-24 hours.

Development of deep blue colour of the medium / presence of growth was taken as positive. Salmonella typhi and Salmonella paratyphi A do not utilize citrate where as Salmonella paratyphi B utilizes citrate.

UREASE HYDROLYSIS TEST :

The organisms ability to produce urease which hydrolyses urea into ammonia and carbon dioxide is determined by this test. The organisms was streaked on the slope of Christensen’s urease medium and incubated at 37ºC for 18-24 hours. Those organisms which hydrolyse urea will produce pink colour change. Salmonella species do not hydrolyse urea.

TRIPLE SUGAR IRON (TSI) TEST :

This test is done to determine the ability of organisms to ferment a specific carbohydrate incorporated in a basal growth medium with or without production of gas and H2S production.

The triple sugar iron agar medium contains 3 sugars glucose, lactose and sucrose. The medium was distributed in tubes with a butt and slant.

Using a straight wire, the organism from primary isolation plate was stabbed into the butt and streaked on the slant. TSI was incubated for

18-24 hours at 37ºC, and examined for the presence of growth and fermentation. Salmonella species produces alkaline slant and acid butt reaction ( K/A ) because of the fermentation of glucose alone which occurs in minimal concentration. Salmonella typhi produces K/A with speck of H2S present at the junction of slant and butt. Salmonella paratyphi A produce K/A with gas but no H2S whereas Salmonella paratyphi B produces K/A with gas and abundant H2S.

NITRATE REDUCTION TEST :

This was tested after growing the bacterium for 2-3 days at 37°c in nitrate broth. Those organisms which reduce nitrates to nitrites was detected by the addition of α-napthylamine (reagent A) and sulfanilic acid

(reagent B), which forms a red diazonium dye, p-sulfobenzene –azo –α

–naphthylamine. A red colour developing within a few minutes denotes a positive reaction, while absence of colour indicates negative reaction.

Salmonella species belonging to Enterobacteriaceae reduce nitrates to nitrites.

METHYL RED TEST ( MR ) :

This test is used to identify those organisms that produce and maintain stable acid end products from glucose fermentation and to overcome the buffering capacity of the medium.

The colonies to be tested were inoculated into MR/VP broth and incubated at 37°C for 48 to 72 hours. Then 5 drops of methyl red reagent

43 was added to the broth. Appearance of red colour at the surface of the medium is considered positive. Salmonella species are Methyl red positive.

VOGES PROSKAUER (VP ) test :

VP test is used to identify those organisms which produces neutral acid end products acetoin from glucose fermentation. The isolates to be tested were inoculated into MR/VP broth and incubated at 37°C for 48 to 72 hours. First reagent A 0.6 ml of 5 % α- napthol in absolute alcohol was added, followed by 0.2 ml of reagent B ( 40% KOH ). The tube was shaken gently without plugging, so that the medium gets exposed to atmospheric oxygen. The tubes were allowed to stand undisturbed for

10-15 minutes. A positive test is represented by the development of a red colour, indicating the presence of diacetyl, the oxidative product of acetoin. Salmonella species are VP negative.

CARBOHYDRATE FERMENTATION TEST :

This test is used to determine the ability of the organism to ferment a specific carbohydrate incorporated in a basal medium, and produce acid, gas. Basal medium with 1% of individual sugar and bromothymol blue as indicator was inoculated with the culture isolate and incubated at 37°C for 24 hours. A positive test was shown by yellow discolouration of the medium due to acid production.

DECARBOXYLASE & DIHYDROLASES TEST (Lysine –Arginine-Ornithine):

This test is done to determine the ability of the organism to decarboxylate an amino acid to form an amine with resulting alkalinity.

Moellers decarboxylase medium is the base most commonly used for determining the decarboxylase capabilities of Enterobacteriaceae. The amino acid to be tested is added to the decarboxylase base before inoculation of the test organism. A control tube consisting only the base without the amino acid was also set up in parallel.

The isolate to be tested was inoculated by using a straight wire into the two tubes of Moellers decarboxylase medium, one containing amino acid and the other without amino acid and the tubes are incubated anaerobically by overlaying with mineral oil. During the initial stages of incubation, both the tubes turn yellow, owing to the fermentation of small amounts of glucose in the medium. If the amino acid is decarboxylated, alkaline amines are formed and the medium reverts to its original purple colour.

Differentiation of serotypes within the Salmonella enterica.

TESTS S.typhi S.paratyphi A S.paratyphi B

Triple Sugar K/A with speck K/A with gas & K/A with

Iron of H2S no H2S abundant H2S,

gas

Citrate Not utilized Not utilized Utilized

Lysine Decarboxylated Not Not

decarboxylation decarboxylated decarboxylated

Ornithine Not decarboxylated Decarboxylated

decarboxylation decarboxylated

Arginine Not Not Decarboxylated

decarboxylation decarboxylated decarboxylated

Glucose + / ( no gas ) + / ( gas + ) + / ( gas + )

Xylose _ _ +

Arabinose _ + +

Slide Agglutination Test :

The basic principle of this test is that when the specific agglutinins bind to surface antigens of bacteria they cause the formation of visible clumps. This test is usually performed to confirm the identification and serotyping of bacterial colonies grown in culture.

The isolates were therefore confirmed by slide agglutination test using the High titre sera of Salmonella typhi O, H, Salmonella paratyphi

AH and Salmonella paratyphi BH procured from King Institute of

Preventive Medicine and Research, Chennai. In a sterile clean glass slide the colony to be tested was emulsified in normal saline to form a uniform smooth milky white suspension. To this suspension 1-2 drops of

High titre sera were added and the slide was rotated thoroughly for few seconds.

A positive result is indicated by visible clumping with clearing of suspension, whereas if the milky white suspension remains unchanged it indicates a negative result. Salmonella typhi agglutinates with S.typhi O,

H antisera, S. paratyphi A agglutinates with S.paratyphi AH antisera and

S.paratyphi B agglutinates with S.paratyphi BH antisera.

ANTIBIOTIC SUSCEPTIBILITY TESTING:

This test was done by modified Kirby-Bauer disc diffusion technique using Mueller Hinton agar as per CLSI guidelines (Clinical

Laboratory Standards Institute ). Four to five colonies of the organism was taken with a wire loop, and was inoculated into the peptone water and incubated. The result was compared with McFarlands turbidity standard.

Mueller-Hinton agar was prepared according to the manufacturer’s instructions and poured into petri dishes of 9 cm diameter to a depth of

4mm.

Preparation of 0.5 McFarland standards

1. Prepare 1% solution of sulphuric acid by adding 1ml of

concentrated sulphuric acid to 99 ml of distilled water. Mix well.

2. Prepare 1% solution of barium chloride by dissolving 0.5g of

dihydrate barium chloride in 50ml of distilled water.

3. Add 0.6 ml of BaCl² solution to 99.4 ml of H2SO4 solution

to make upto 100 ml.

This can be stored at room temperature for up to six months. The

0.5 McFarland standard provides an optical density equivalent to the density of 1.5 × 108 colony forming units/ml.

List of Antibiotics:

The antibiotics were selected based on CLSI guidelines. Antibiotics like Ampicillin(10µg), Chloramphenicol(30µg), trimethoprim / sulfamethoxazole (1.25/23.75µg), nalidixic acid (30µg), Ciprofloxacin

(5µg), Pefloxacin (5 µg), Ceftriaxone (30µg), ,Cefotaxime (30µg) and

Azithromycin (15 µg).

Procedure :

A sterile swab was immersed in the prepared bacterial suspension and lawn culture was done on Mueller Hinton Agar plate. The surface of MHA plate was swabbed in three directions ensuring even and complete distribution of the inoculum over the entire plate. Within 15 minutes of inoculation the antimicrobial discs were applied using a sterile forceps.

The antimicrobial discs used were procured from Himedia. Each disc was pressed down to ensure complete contact with the surface of

MHA. The plates were inverted for incubation to prevent accumulation of moisture on the agar surface which would interfere with the interpretation of the test.

The plates were incubated at 37 °C for 18-24 hours. The zone of inhibition was measured using the zone measuring scale and interpreted according to the CLSI standards. However, Azithromycin interpretation was based on the disc manufacturers recommendations. Minimum inhibitory concentrations (MIC) were determined for ciprofloxacin for all

Salmonella isolates which showed resistance by Kirby –Bauer disc diffusion methods using Epsilon test strips.

MIC Determination by E – strips :

Epsilon MIC strip is useful for quantitative determination of susceptibility of bacteria to antibacterial agents. The system comprises of

49 a predefined quantitative gradient which is used to determine the Minimum

Inhibitory Concentration (MIC) in mcg/ml of different antimicrobial agents against microorganisms as tested on MHA, following overnight incubation.

MIC of ciprofloxacin was determined by using Ciprofloxacin Ezy MICTM

Strip (CIP) of concentration 0.002 - 32 mcg/ml procured from HIMEDIA.

Preparation of Inoculum :

The 4-5 similar colonies to be tested was transferred with a loop to peptone water and incubated at 35-37°C for 2-8 hours until turbidity develops. Compare the inoculum turbidity with that of 0.5 McFarland standard.

Test Procedure :

The inoculum was prepared with 4-5 colonies from 24 hrs young culture and inoculated as a lawn culture on to the Muller Hinton agar after adjusting the turbidity to 0.5 Mc Farland standards. The E test strip container was taken from the freezer and kept at room temperature for

15 minutes before opening. The strip was then taken with a sterile forceps or E test applicator and applied to the dried agar surface with the MIC scale facing upwards. Within 60 seconds, Ezy MIC strip will be adsorbed and will firmly adhere to the agar surface with the MIC scale facing upwards. The plate was incubated aerobically for 16-18 hrs at 370C.

Interpretation:

The plate was read after the determined time of incubation. The

MIC of the isolate was interpreted where the zone of inhibition intersects with the strip.

Molecular characterization of Antimicrobial Resistance Genes :

The Quinolone resistant Salmonella enterica species were subjected for the plasmid mediated quinolone resistance genes qnrA, qnrB and qnrS, as well as chromosomal mediated resistance genes gyrA, gyrB and parC by Multiplex PCR.

Requirements:

. Micro Pipettes of variable volume 0.5-10 µl, 10-100 µl, and

100-1000 µl

. Pipette tips with aerosol barrier

. Spin columns

. Collection tubes

. Vortex mixer

. Water bath

. Centrifuge (Refrigerated) with rotor for 1.5ml reaction tubes

. 1.5ml / 2ml microcentrifuge tubes

. Veriti Thermal cycler

DNA Extraction:

The DNA extraction procedure yields purified DNA of more than

30kb in size obtained after the lysis of the cell. This kit utilizes the silica based membrane technology in the form of a spin column. The isolated DNA can be used directly for the PCR amplification.

Components of extraction

 Phosphate buffered saline

 Lysozyme

 Digestion buffer

 Binding buffer

 Proteinase K ( protease )

 Internal control template

 Isopropanol

 70% Ethanol

 Elution buffer

Storage and stability:

 The bacterial genomic DNA extraction kit was stored at room

temperature.

 The proteinase K and Lysozyme were stored at -20 0 C.

Bacterial pellet preparation:

About 4-6 colonies of the test strains were inoculated in peptone water and incubated at 370C overnight. 1-1.5 ml of bacterial culture was transferred into the sterile 2ml centrifuge tube. The tube was centrifuged

52 at 8000 rpm for 5 minutes at room temperature. The supernatant was discarded and the pellet was used for the DNA extraction.

Plasmid Mediated Quinolone resistance genes (qnrA, qnrB and qnrS):

DNA extraction procedure :

The DNA extraction procedure for both plasmid mediated quinolone resistance genes and the quinolone resistance determining region genes were similar.

i) Pipette 20 μl Protease (or proteinase K) into the bottom of a 1.5

ml microcentrifuge tube.

2. Add bacterial pellets suspended in 200 μl phosphate buffered saline

to the microcentrifuge tube.

3. Add 200 μl Buffer AL to the sample. Mix by pulse-vortexing for

15 s.

4. Incubate at 56°C for 10 min.

5. Briefly centrifuge the 1.5 ml microcentrifuge tube to remove drops

from the inside of the lid.

6. Add 200 μl ethanol (96–100%) to the microcentrifuge tube, and

mix again by pulse-vortexing for 15 sec. After mixing, briefly

centrifuge the 1.5 ml microcentrifuge tube to remove drops from

the inside of the lid.

7. Carefully apply the mixture from step 6 to the spin column (in a

2 ml collection tube) without wetting the rim. Close the cap, and

centrifuge at 8000 rpm for 1 min. Place the spin column in a

clean 2 ml collection tube and discard the tube containing the

filtrate.

8. Carefully open the QIA amp Mini spin column and add 500 μl

Buffer AW1 without wetting the rim. Close the cap and centrifuge

at 8000 rpm for 1 min. Place the spin column in a clean 2 ml

collection tube and discard the collection tube containing the filtrate

9. Carefully open the spin column and add 500 μl Buffer AW2

without wetting the rim. Close the cap and centrifuge at 14,000

rpm for 3 min.

10. Place the spin column in a new 2 ml collection tube and discard

the old collection tube with the filtrate. Centrifuge at 14000 rpm

for 1 min. This step helps to eliminate the chance of possible

Buffer AW2 carryover.

11. Place the spin column in a clean 1.5 ml microcentrifuge tube and

discard the collection tube containing the filtrate. Carefully open

the spin column and add 200 μl Buffer AE. Incubate at room

temperature (15–25°C) for 1 min, and then centrifuge at 8000 rpm

for 1 min. The purified DNA was obtained for PCR procedure.

PCR Procedure:

Reaction Mixture: (for one sample)

Master Mix – 10 µl

Q-solution – 2 µl

Primer Mix – 2 µl

Water – 4 µl

DNA Template – 2 µl

Total – 20 µl

Note : Master mix – Qiagen multiplex master mix; Primer mix –

contains primers qnrA, qnrB and qnrS

Cycling condition

Initial denaturation 94° C for 5 min

Denaturation 94°C for 45 sec

Annealing 53°C for 45 sec 32 cycles

Extension 72°C for 1 min

Final extension 72°C for 7 min

4°C – hold

Initial Denaturation:

This is the first step in the amplification procedure. The thermocycler raises the temperature to 94˚C for five minutes for

Taq enzyme activation.

Denaturation:

The temperature is elevated to 94˚C for 45 seconds. The double stranded template DNA gets separated into two complementary strands.

Annealing:

When the temperature is decreased to 53˚C for 45 seconds the complementary binding of the two specific oligonucleotide primers to the

DNA template take place.

Extension:

The DNA polymerase extends the primers when the temperature is increased to 72˚C for 1 minute. Final extension takes place at 72°c for

7 minutes. The template DNA is synthesised using deoxynucleotides

(dNTPs) in the reaction mixture. Two single stranded DNA templates and newly synthesized complementary DNA strands attach together to form new double stranded DNA copies. Every copy of newly formed DNA may function as a template for further amplification. The products will be amplified in an exponential manner in each cycle. At the end of 32 cycles, the final PCR products will have 2n copies of template DNA.

Data analysis was made at the end of extension and the computer produces

56 the cross threshold (Ct) value by calculating the fluorescence emitted at the end of each cycle.

Agarose gel electrophoresis :

Detection of the specific amplicons was done by performing electrophoresis on 2% Agarose gel. The gel was prepared by adding 2 mg agarose in 100ml of 1xTBE buffer and was melted using micro oven.

When the agarose gel temperature was around 60°c, ethidium bromide was added. Warm agarose gel was poured slowly into the gel platform.

Carefully place the gel platform into submarine gel tank once it solidifies.

 Load 8 µl of PCR product and 2 µl of loading dye to the

2% agarose gel.

 Load 4 µl of 100bp DNA ladder.

The electrophoresis was run at 100 volt for one hour till the dye reaches three fourth distance of the gel. Gel was viewed in UV

Transilluminator and observed for the expected bands pattern. The plasmid mediated resistance genes (qnrA, qnrB and qnrS) were not amplified.

Quinolone Resistance Determining Region genes (gyrA, gyrB, and parC):

The DNA extraction for genes gyrA and gyrB of DNA gyrase subunit II and parC of DNA topoisomerase subunit IV in the quinolone resistance determining region was done as per the protocols described earlier in plasmid mediated quinolone resistant genes. Here the Master

57 mix – Qiagen multiplex master mix and the primer mix – that contains primers gyrA, gyrB and parC are used.

PCR Procedure:

Reaction Mixture: (for one sample)

Master Mix – 10 µl

Q-solution – 2 µl

Primer Mix – 2 µl

Water – 4 µl

DNA Template – 2 µl

Total – 20 µl

Note : Master mix – Qiagen multiplex master mix; Primer mix –

contains primers gyrA, gyrB and parC.

Cycling condition

Initial denaturation 92° C for 5 min

Denaturation 92°C for 1 min

Annealing 62°C for 1 min 30 cycles

Extension 74°C for 2 min

Final extension 74°C for 1 min

4°C – hold

Agarose gel electrophoresis:

Detection of the specific amplicons was done by performing electrophoresis on 2% Agarose gel. The gel was prepared by adding 2mg agarose in 100ml of 1xTBE buffer and was melted using micro oven.

When the agarose gel temperature was around 60°c, ethidium bromide was added. Warm agarose gel was poured slowly into the gel platform.

Carefully place the gel platform into submarine gel tank once it solidifies.

 Load 8 µl of PCR product and 2 µl of loading dye to the 2%

agarose gel.

 Load 4 µl of 100bp DNA ladder.

The electrophoresis was run at 100 volt for one hour till the dye reaches three fourth distance of the gel. Gel was viewed in UV

Transilluminator and observed for the expected bands pattern. The genes gyrA, gyrB and parC in the quinolone resistance determining region were amplified and the expected bands were obtained.

Protocol of gene sequencing :

The amplicons were then subjected for DNA sequencing to identify the mutations in gyrA, gyrB and parC genes by using the

Sequencing Machine – 9500 genetic analyzer and the primers used were mentioned below.

Antimicrobial resistance gene sequences – Salmonella

Oligo Base 5'<------Sequence----->3' S.No Name pair Reference

1 gyrA F TGTCCGAGATGGCCTGAAGC 347bp 2 gyrA R TACCGTCATAGTTATCCACG

3 gyrB F CAAACTGGCGGACTGTCAGG Chau et 345bp 4 gyrB R TTCCGGCATCTGACGATAGA al. 2007

5 parC F CTATGCGATGTCAGAGCTGG 270bp 6 parC R TAACAGCAGCTCGGCGTATT

7 qnrA F ATTTCTCACGCCAGGATTTG 516bp 8 qnrA R GATCGGCAAAGGTTAGGTCA

9 qnrB F GATCGTGAAAGCCAGAAAGG Gay et 469bp 10 qnrB R ACGATGCCTGGTAGTTGTCC al.2006

11 qnrS F ACGACATTCGTCAACTGCAA 417bp 12 qnrS R TAAATTGGCACCCTGTAGGC

Pre cleanup:

1. Take the 20ul of first round PCR product, to that add 100ul

of PB solution in the spin column

2. Spin at 13, 000 rpm for 1 min. Discard the supernatant.

3. Add 750ul of PE. Spin at 13, 000 rpm for 1 min. Discard

the supernatant.

4. Repeat spin at 13, 000 rpm for 1 min to remove the

remaining buffer completely.

5. Place the spin column in the new 1. 5 ml centrifuge tube.

6. Add 30ul of Elution buffer. Spin at 13, 000 rpm for 1 min.

7. Load 5 ul of eluted DNA and run it in the gel to confirm

the presence of band.

8. Quantify the eluted DNA.

PCR:

1. By using the eluted product, set up the sequencing PCR

for 25 cycles using the Big dye Terminator v3.1 cycle

sequencing kit.

PCR Master mix

RR mix – 0.5µl

Buffer – 1.75µl

Primer – 0.5µl

Template – 1µl

Water - 6.25µl

Total - 10µl

Note: Template – pre-cleanup product

Cycling condition

96°C for 1 min

96°C for 10 sec

50°C for 5 sec 25 cycles

60°C for 4 min

4°C – hold

Post PCR cleanup:

Master Mix 1 – 2ul of 125mM EDTA + 10ul MilliQ water

Master Mix 2 – 2ul of 3M sodium acetate + 50ul of absolute ethanol.

1. Add 10ul of sequencing PCR product to 1.5 ml

centrifuge tube.

2. Add 12ul of master mix 1 and 52ul of master mix 2.

3. Incubate at room temperature for 15 mins.

4. Spin at 15,000 rpm for 20 mins. Discard the supernatant.

5. Add 250ul of 70% ethanol. Spin at 15,000 rpm for 10 mins.

6. Discard the supernatant.

7. Add 12ul of Hi-Di formamide. Mix well.

8. Load the product into the sequencing plate.

9. Load it into the sequencing machine

10. Start the run.

Using BioEdit to Refine DNA Sequences:

1. Forward sequence and reverse sequences were refined using BioEdit.

Forward sequence and reverse sequences in fasta format were copied.

The reverse complement of the reverse sequence was generated. The

Forward and Reverse Sequences when put together run in the same

direction and had mostly the same nucleotides. Alignment Editing was

performed using “ClustalW multiple alignment. Editing was performed

to remove inconsistencies from the end of the sequence and the first

10 base pairs from the beginning of the sequence (where the primers

annealed) were deleted. The sequence from starting to end with

overlapped regions represents the complete sequence.

Mutation identification at DNA sequence level:

Mutation identification at DNA sequence level was performed using Clustal Omega (http://www.ebi.ac.uk/Tools/msa/clustalo/) The sequence alignment between reference DNA sequence and mutant was detected. The regions with stars (*) indicate the conserved regions and the regions with colon (:) indicate semi conserved (similarity-can be considered as silent mutation) and the regions with no marks () indicate the mutations.

Mutation identification at amino acid level:

The DNA sequences were translated using www.bioinformatics.org

The translated sequences were checked to make sure that they do not

63 have stop codon (*). The reading frame was selected. The amino acid sequence was saved. Mutation identification at amino acid sequence level was performed using Clustal Omega (www.ebi.ac.uk/Tools/msa/clustalo).

The sequence alignment between reference amino acid sequence and test was performed to detect mutation if any. The regions with stars (*) indicate the conserved regions, the regions with colon (:) indicate conservative mutation, (.) indicate semi conservative mutation, and () indicate the non-conservative mutations.

Mutations were observed in gyrA and parC genes in all the quinolone resistant Salmonella isolates.

STATISTICAL ANALYSIS :

The statistical analysis was done using R version 3.2 and p- value was calculated using Chi-Square test and graphs were made on Microsoft

Excel sheet.

FIG 1: NUTRIENT AGAR PLATE – Salmonella typhi colonies

FIG 2: MacConkey Agar – Non-lactose fermenting colonies of Salmonella typhi

FIG 3: BLOOD AGAR PLATE : Salmonella typhi – greyish white colonies

FIG 4: DEOXYCHOLATE CITRATE AGAR – Salmonella typhi with black head colonies

FIG 5: DEOXYCHOLATE CITRATE AGAR – Salmonella paratyphi A

FIG 6: Gram’s Stain – Gram Negative bacilli

FIG 7: Biochemical Reactions of Salmonella typhi

Triple Sugar Iron – Alkaline / Acid with Speck of H2S

FIG 8: Biochemical Reactions of Salmonella paratyphi A

Triple Sugar Iron – Alkaline / Acid with Gas

FIG 9: Sugar Fermentation by Salmonella typhi

GLUCOSE LACTOSE SUCROSE MALTOSE MANNITOL MMM

FIG 10: LAO – Lysine Decarboxylated in Salmonella typhi

LYSINE ARGININE ORNITHINE LAO BASE

FIG 11: LAO – Ornithine Decarboxylated in Salmonella paratyphi A

LYSINE ARGININE ORNITHINE LAO BASE

FIG 12: Mueller Hinton Agar – AST by Kirby – Bauer Method

CIP

AMP

AST : Salmonella typhi Sensitive to Ciprofloxacin, Pefloxacin & Nalidic acid

FIG 13: Mueller Hinton Agar – AST by Kirby – Bauer Method

CIP

AMP

AST : Salmonella typhi Resistant to Ciprofloxacin, Pefloxacin & Nalidicacid FIG 14: Mueller Hinton Agar – AST by Kirby – Bauer Method

COT

C CTR

AZM

AST : Salmonella typhi Sensitive to Chloramphenicol, Cotrimoxazole, Ceftriaxone & Azithromycin

FIG 15: MIC – E Test for Ciprofloxacin

Salmonella typhi shows MIC of Ciprofloxacin > 2µg/ml

FIG 16: Multiplex PCR for Plasmid Mediated Quinolone Resistance genes (qnrA, qnrB, qnrS)

FIG 17: Multiplex PCR for Chromosomal Mediated Quinolone Resistance genes (gyrA, gyrB, parC)

FIG 18: Gene Sequencing – gyrA, gene at quinolone resistance determining region

FIG 18a: DNA Sequence alignment Mutation Analysis : gyrA

FIG 19: Gene Sequencing – parC, gene at quinolone resistance determining region

FIG 19a: DNA Sequence alignment Mutation Analysis : parC

RESULTS

During the study period of July 2016 to June 2017, 250 patients of clinically suspected enteric fever cases, attending fever OP and those who were admitted in paediatric and medicine wards at Coimbatore

Medical College Hospital, were included in this study. Blood in BHI broth was collected for culture and the antibiotic sensitivity pattern of the isolates were analysed.

A total of 28 blood culture positive Salmonella enterica were isolated from 250 blood culture samples over a period of one year. The rate of isolation was 11.2 % (n=28). (Refer table no:1 and chart no:1).

Among the 28 isolates of Salmonella enterica species, the serovars identified were 24 Salmonella typhi 86% (n=28 ) and 4 Salmonella paratyphi A 14% ( n=28). Salmonella typhi were the predominant serotype isolated, followed by Salmonella paratyphi A. (Refer table no: 2 and chart no: 2). No other Salmonella serotypes were isolated during this study period.

Though the Male : Female ratio of the patients included in this study was relatively insignificant (1.03 : 1 ), the ratio of culture positives was higher among the males than females ( 2.1 : 1 ). Statistically significant p-value of 0.05 was obtained.( Refer table no : 3)

The age group of patients included in this study ranged from 1 year to 55 years. Majority of the Salmonella enterica species 9 (33%)

65 was isolated from young adults in the age group of 21-30 years. An equal prevalence of 7 (25%) was found both in 11- 20 yrs and 31-40 yrs respectively. It was found that Salmonella enterica isolated from paediatric age group (1-10 years) and above 55 years was only (3%).

(Refer table no.4).

The clinical signs like hepatosplenomegaly and haematological parameters like neutropenia were compared with the positive blood culture results. The 26 (93%) of blood culture positive cases showed neutropenia, whereas neutrophilia and normal neutrophil count was observed in 1

(3.5%) case of enteric fever. The statistical p-value is <0.001 that is significant. ( Refer table no.5 & chart no. 5 ).

In this present study, hepatosplenomegaly was observed in all the

28 (100%) blood culture positive cases. The satistical p-value is <0.001 being significant. ( Refer table no. 6 & chart no. 6).

The antimicrobial susceptibility pattern of Salmonella typhi showed

100% sensitivity to Cefotaxime, Ceftriaxone and Azithromycin. 95% of

S.typhi isolates were sensitive to Chloramphenicol and 91% of S.typhi isolates were sensitive to Ampicillin and Cotrimoxazole. Whereas the 25% of the isolated S.typhi strains were resistant to Nalidixic acid ( surrogate marker for fluoroquinolone resistance ) and to Pefloxacin ( a surrogate marker, as per CLSI 2015 ). The resistance to Ciprofloxacin was also found to be 25%. ( Refer table no: 7 )

In the current study, only a single strain (4%) out of the 24 isolated Salmonella typhi was found to be Multi-drug resistant and this isolate was also resistant to fluoroquionolones. (Refer table no: 7)

The overall sensitivity pattern of Salmonella paratyphiA are shown in Table 8. The (100%) sensitivity was observed in Chloramphenicol,

Cotrimoxazole, Ampicillin, Cefotaxime, Ceftriaxone and Azithromycin whereas 50% of the isolates were resistant to Nalidixic acid, Pefloxacin and Ciprofloxacin.

However (25% ) of the S.typhi isolates and (50% ) of S.paratyphi

A showed resistance to fluoroquinolones. The quinolone resistance was found to be high in S.paratyphi A (50%) than in S.typhi (25%).

All the 25%(n=24), of quinolone resistant S.typhi isolates and 50%

(n=4) of S.paratyphi A isolates were found to be negative for qnrA, qnrB and qnrS which are plasmid mediated quinolone resistance genes.

All the six fluoroquinolone resistant S.typhi isolates showed mutations in gyrA gene in the quinolone resistance determining region, whereas only two of them showed mutations in parC gene.

Two of the fluoroquinolone resistant S. paratyphi A isolates showed mutations in gyrA and parC gene. (Refer table no: 12 &13).

None of the fluoroquionolone resistant isolates of S.typhi and S.paratyphi

A showed mutations in gyrB gene. Some of the isolates showed single

67 point mutation and few others showed two to three mutations in gyrA and parC gene.

The mutations observed in gyrA gene was at position 83 where serine was replaced by phenyl alanine in all the six quinolone resistant

S.typi isolates and two of those isolates showed mutation at position

87, Aspartic acid being replaced by asparagine. Whereas in parC gene mutation was detected at position 57 threonine replaced by serine and at position 80 serine was replaced by isoleucine. ( Refer table : 11)

TABLE 1: PERCENTAGE OF ENTERIC CULTURE POSITIVES

Number of Samples Percentage Culture results Tested (n=250) (%) No of Culture Positives 28 11%

No of Culture Negative 222 89%

TABLE 2: DISTRIBUTION OF SALMONELLA SPECIES (n=28)

Percentage Salmonella species No. of Isolates (%) Salmonella Typhi 24 86%

Salmonella Paratyphi A 4 14%

Total 28 100%

TABLE 3: GENDER DISTRIBUTION OF ENTERIC FEVER CASES

Suspected Culture Percentage Enteric Fever Positive Enteric Gender Cases Fever (n=28) (n= 250)

MALE 127 19 15%

7% FEMALE 123 9

p-value – 0.055 (Chi-Square test was used to calculate the p-value)

TABLE 4: AGE WISE DISTRIBUTION OF SALMONELLA SPECIES (n=28)

Salmonella Salmonella Percentage paratyphiA Typhi Isolated Isolated (%) Age (n= 24) (n=4) (n=28) (years) No (%) No (%) No (%)

1– 10 1(4%) _ 1(4%)

11– 20 7(29%) _ 7(25%)

21– 30 6(25%) 3(75%) 9(32%)

31 – 40 6(25%) 1(25%) 7(25%)

41 – 50 3(13%) _ 3(11%)

> 50 years 1(4%) _ 1(4%)

Total 24(100%) 4(100%) 28(100%)

p-value – 0.577 (Fisher’s Exact test was used to calculate the p-value)

TABLE 5: CORRELATION BETWEEN NEUTROPHIL COUNT AND BLOOD CULTURE POSITIVE ENTERIC FEVER

No. of. Blood

Neutrophil Culture Positive Percentage (%) Count ( n=28 )

Neutropenia 26 93%

1 3.5% Neutrophilia

Normal 1 3.5%

p-value – <0.001 (Chi-Square test was used to calculate the p-value)

TABLE 6: CORRELATION BETWEEN HEPATOSPLENOMEGALY AND BLOOD CULTURE POSITIVE ENTERIC FEVER

No. of. Blood

Culture Positive Liver & Spleen Percentage (%) ( n= 28 )

Enlarged 28 100%

Normal _ _

p-value – <0.001 (Chi-Square test was used to calculate the p-value)

TABLE 7: ANTIMICROBIAL SUSCEPTIBILITY PATTERN OF

SALMONELLA TYPHI (n=24)

SALMONELLA TYPHI (n = 24) Antibiotic Disc

Sensitive Resistant

Chloramphenicol(30µg) 23(95%) 1(4%)

Ampicillin(10µg)) 22(91%) 2(8%)

Trimethoprim / Sulfamethoxazole 22(91%) 2(8%) (1.25/23.75µg)

Nalidixic Acid (30µg) 18(75%) 6(25%)

Ciprofloxacin (5µg) 18(75%) 6(25%)

Pefloxacin (5 µg) 18(75%) 6(25%)

Ceftriaxone (30µg), 24(100%) -

Cefotaxime (30µg ) 24(100%) -

Azithromycin (15 µg) 24(100%) -

Multi-drug resistance - 1(4%)

Multi-drug resistance to Ampicillin , Chloramphenicol , Cotrimoxazole

TABLE 8: ANTIMICROBIAL SUSCEPTIBILITY PATTERN OF

SALMONELLA PARATYPHIA (n=4)

SALMONELLA PARATYPHIA Antibiotic Disc ( n = 4)

Sensitive Resistant

Chloramphenicol(30µg) 4(100%) -

Ampicillin(10µg) 4(100%) -

Trimethoprim / Sulfamethoxazole 4(100%) - (1.25/23.75µg)

Nalidixic Acid (30µg) 2(50%) 2(50%)

Ciprofloxacin (5µg) 2(50%) 2(50%)

Pefloxacin (5 µg) 2(50%) 2(50%)

Ceftriaxone (30µg), 4(100%) -

Cefotaxime (30µg ) 4(100%) -

Azithromycin (15 µg) 4(100%) -

TABLE 9: QUINOLONE RESISTANCE AMONG

SALMONELLA SPECIES

Quinolone Salmonella Species No. of Isolates Quinolone Resistant Sensitive

Salmonella Typhi 24 6(25%) 18(75%)

Salmonella 4 2(50%) ParatyphiA 2(50%)

TABLE 10: ANALYSIS OF RESISTANT GENES BY MOLECULAR METHODS

PMQR Genes Mutation of QRDR Genes

No.

Species

Isolates

Resistant

qnrS gyrB

gyrA

qnrB parC

Salmonella

qnrA

Salmonell 6 - - - a typhi 6(100%) - 2(33%)

Salmonell

a 2 - - - 2(100% paratyphi 2(100%) - ) A PMQR - Plasmid Mediated Quinolone Resistance

QRDR - Quinolone Resistance Determining Region

TABLE 11: MUTATION ANALYSIS OF

gyrA , gyrB and parC GENES.

Mutations in Mutations in Resistant Strain Mutations in gyrA gyrB parC Salmonella Serine 83 –– No mutation No mutation typhi 1 Phenylalanine Serine 83 –– Salmonella PhenylalanineAspartic No mutation No mutation typhi 2 acid 87–– Asparagine Salmonella Serine 83 – tyrosine No mutation No mutation typhi 3

Salmonella No mutation Serine 83 – tyrosine No mutation typhi 4

Salmonella Threonine -57 Serine 83 – tyrosine No mutation typhi 5 Serine Serine 83 –– Salmonella Phenylalanine Threonine -57 No mutation typhi 6 Aspartic acid 87 –– Serine Asparagine Serine 83 –– Phenylalanine Salmonella Serine 80 - Aspartic acid 87–– No mutation paratyphi A1 Isoleucine Asparagine

Serine 83 –– Salmonella Phenylalanine Serine 80- No mutation paratyphi A 2 Aspartic acid 87–– Isoleucine Asparagine

1. PERCENTAGE OF ENTERIC CULTURE POSITIVES

Percentage of Culture Postive

89%

11%

% of Culture Positives % of Culture Negative

2. DISTRIBUTION OF SALMONELLA SPECIES

14%

86%

Salmonella Typhi Salmonella Paratyphi A

3. GENDER DISTRIBUTION OF CULTURE POSITIVES

100%

80% 51% 60% 49%

40% 15% 20% 7%

0% Male Female

Gender % of Culture Positive

4. AGE WISE DISTRIBUTION OF SALMONELLA SPECIES

> 50 years 4%

41 – 50 13% 25% 31 – 40 25%

21– 30 75% 25% 11– 20 29% 1– 10 4%

0% 20% 40% 60% 80% 100% Salmonella ParatyphiA Salmonella Typhi

5. CORRELATION BETWEEN NEUTROPHIL COUNT AND CULTURE POSITIVES

100% 80% 60% 40% Neutropenia 20% Neutrophilia 0%

Normal % of % Positive Blood Culture

6. CORRELATION BETWEEN HEPATOSPLENOMEGALY

AND CULTURE POSITIVES

100%

80%

60% Enlarged 40% Normal 20%

% of % positive Blood culture 0% Enlarged Normal

7. ANTIMICROBIAL SUSCEPTIBILITY PATTERN OF Salmonella typhi (n=24)

100% 90% 80% 70% 60% 50% 40% 30% 20% 10% 0%

Sensitive Resistant

8. ANTIMICROBIAL SUSCEPTIBILITY PATTERN OF

Salmonella paratyphi A

100%100%100% 100% 100%100% 100% 90% 80% 70% 60% 50% 50% 50% 50% 40% 30% 20% 10% 0%

Sensitive Resistant

9. QUINOLONE RESISTANCE AMONG SALMONELLA SPECIES

100%

90% 75% 80%

70%

60% 50% 50% 50%

40% 25% 30%

20%

10%

0% Salmonella Typhi Salmonella ParatyphiA Quinolone Resistant Quinolone Sensitive

DISCUSSION

Enteric fever remains a global health problem , especially in developing countries like India. The development of drug resistance by

Salmonellae enterica species to various antibiotics , contributes to the treatment failure , thereby leading to morbidity and mortality .

Though antibiotics remain the mainstay in treatment of enteric fever ,

Salmonella typhi develops resistance to various group of antimicrobials is an emerging problem . In the past with the widespread emergence and spread of Multi-drug resistance Salmonella typhi strains, Ciprofloxacin became the first line drug in treatment of enteric fever.6

Later on Salmonella enterica species developed resistance to quionlones by various mechanisms ,

i) mutations in the gyrA and gyrB genes encoding DNA

gyrase, parC and parE genes that encodes

topoisomerase.

ii) Plasmid mediated quinolone resistance genes qnrA,

qnrB and qnrS that are present in Salmonella enterica

species being transmitted by plasmids or transposon.

iii) Decreased permeability to quinolones.

iv) Overexpression of efflux pumps .8

Then third generation Cephalosporins, Cefotaxime and Ceftriaxone were effective in treatment of enteric fever . Later on due to production of

Extended spectrum beta lactamases S. typhi develops resistance to these group of drugs . Recently there are studies showing S.typhi strains developing resistance to Azithromycin also.

In this study , 250 clinically suspected cases of enteric fever were investigated and 28 ( 11.2%) were found to be blood culture positive for

Salmonella enterica species. This isolation rate (11.2%) is comparable with the 11.8 % isolation by Sunil Poudel et al (2014), 14% isolation by Suresh K and Balachandran C.S et al (2017).

The 7.4 % isolation by Adnan Mannan et al ( 2014 ) which is lower compared to our results and 16% isolation by Ruchi Girotra et al (2016) is relatively higher to the present study .The difference in the isolation rate could be due to the endemicity of the disease which varies with different geographical locations. Difficulty in diagnosing the disease in the first week, before the prescription of the antibiotics to the patients also contributes to the different isolation rate in various studies . 36 ,35, 30 , 32

Among 28 isolated Salmonella enterica species the serovars identified were 24 ( 85.7% ) S.typhi and 4 (14.2 %) S.paratyphi A which is consistent with the studies of Balaji Veeraraghavan et al (2016) from CMC , Vellore with the isolation of S.typhi ( 84%) and S.paratyphi A ( 15%). Another study by

Shoorashetty Manohar Rudresh et al from PGIMSR also identified 80%

S.typhi and 20% S.paratyphi A. Ruchi Girotra et al (2016) too showed an isolation rate of S.typhi ( 78% ) and S.paratyphi A( 22%). 9, 3 , 32

The sex predilection is more in males than in females with a ratio of 2 . 1 : 1 , which is comparable with the other studies of Shoorashetty

Manohar Rudresh et al (2015) , Riyaz chungathu et al ( 2015 ) , Varsha Gupta et al (2013) and Sarika Jain et al ( 2012) . 3, 5, 1, 13

In the present study, Salmonella enterica species in blood culture were isolated predominantly in young adults , 21- 30 yrs ( 32% ) and then , in the age group of, 11-20 yrs( 25%) , while the prevalence was low in extremes of age like < 10 years and > 50 years (i.e 1%) . This correlates with the study by Lovely Akter et al ( 2012) 2

But various studies including that of Sarika Jain et al (2013), Varsha

Gupta et al (2013) and in Shoorashetty Manohar Rudresh , et al ( 2015 ) reports a higher frequency among paediatric age group followed by young adults . 13 , 1 , 3

The increased prevalence of enteric fever in males and in the age group of young adults can be attributed to the fact that they are more vulnerable to stay outside the home for various reasons like study , occupation and are likely to take outside food, with the possibility of contamination .

Personal hygiene, proper sanitation and vaccination will prevent these situations .

In contrast the study by Ashraf M . Dewan et al , from Bangladesh (

2013) showed an increased prevalence of enteric fever in 0-4 years and > 60 years of age as the immune status of the individuals in both the age groups will be decreased . The decreased occurrence of enteric fever in age group of < 10 years in the present study , can be attributed to vaccination being provided to school children in that age group .

The percentage of hepatosplenomegaly and neutropenia observed in blood culture positive cases were 100% and 93% respectively, that correlates with the various studies like Taraknath Ghosh et al (2016) ,

Ranganatha A et al (2017) and Rajesh Upadhyay et al ( 2015).37,38, 15 The most of the studies insists that the hallmark signs in the diagnosis of typhoid fever are neutropenia and hepatosplenomegaly. 50, 6,15

The twenty four isolates of S.typhi and four of S.paratyphi A isolates were 100% sensitive to Cefotaxime, Ceftriaxone and Azithromycin which correlates the study of Nata Pratama et al (2017) , Balaji Veeraraghavan et al

(2016), Reena Raveendaran et al (2010) 47 , 9, 10

In constrast to this there are studies like Sarika jain et al (2013),

Muzamil Mahdi Abdel Hamid (2017) , which shows that S.typhi strains have developed low level of resistance to ceftriaxone . Another study by Sunil

Poudel et al ( 2014 ) also reveals that 7% of S.typhi strains show resistance to

Azithromycin. 13,45, 36 The development of resistance to III generation

Cephalosporins and Azithromycin can be attributed to the facts like inappropriate prescription and irrational use of these drugs by clinicians. 72

There are reports of emerging extended spectrum beta lactamase mediated resistance to Ceftriaxone in S.typhi . And the resistance to broad spectrum Cephalosporins are also mediated by AmpC beta lactamase production by Salmonella typhi isolates . This alarming situation creates limitations in the treatment options of enteric fever.

Out of 24 isolates of S.typhi, 95% (n=23 ) were susceptible to

Chloramphenicol, 91% ( n= 22) to Cotrimoxazole and Ampicillin which correlates with most of the studies like Balaji Veeraraghavan et al ( 2016 ) ,

Riyaz chungathu et al ( 2015), Reena Raveendran et al ( 2010 ) and Shoorashetty et al (2015) . 9,5, 10

Only 1 (4%) S.typhi was found to be multi-drug resistant that coincides with the studies of Sarika Jain et al ( 2013 ) and Varsha Gupta et al

(2013) . This decline in the MDR – S.typhi is due to the restricted use of

Chloramphenicol , Ampicillin and Cotrimoxazole over the past decade.13,1 The re-emergence of Chloramphenicol sensitive strains led to the concept of antibiotic recycling , thereby preserving the use of older ones. 11

In contrast, the study by Adnan Mannan et al (2014) from Bangladesh , isolated 64.28 % MDR S.typhi . The reason could be the variation in resistance pattern with the geographical location which has led to increased isolation of

MDR strains . 30

None of the S.paratyphi A isolates were MDR , correlating with the study of Sarika Jain et al ( 2013) , this specifies the possibility of reuse of

73 antibiotics like Ampicillin , Chloramphenicol and Cotrimoxazole for the treatment of enteric fever . 13

With the emergence of MDR strains , ciprofloxacin was the drug of choice for the treatment of enteric fever. But later on , several reports of treatment failure with ciprofloxacin have been documented. In this study 25 %

(n= 6) out of the 24 S.typhi and 50% ( n=2) S.paratyphi A isolates showed resistance to Nalidixic acid , Ciprofloxacin and Pefloxacin .This correlates with the study of Sarika jain et al ( 2013) , Reena Raveendran et al ( 2010) , Adnan

Mannan et al ( 2014 ) . 13, 30

In contrast most of the studies like Riyaz chungathu et al ( 2015 ) , Balaji

Veeraraghavan et al ( 2016 ) , Ruchi Girotra et al ( 2016 ) , B.A.Rahman et al

( 2014) show increased prevalence of Nalidixic acid and fluoroquinolone resistant S.typhi strains. 5,9,32,39

The irrational use of fluoroquinolones following emergence of MDR

S.typhi strains and the rampant use of Ciprofloxacin not only for enteric fever but also for other infections has led to the development of resistance for these drugs .

The antimicrobials like Ceftriaxone , Cefixime and Azithromycin are effective against fluoroquinolone resistant isolates , which showed 100% sensitivity in this study , but are cost-effective. The other alternatives are

Ampicillin , Cotrimoxazole and Chloramphenicol but the clinical outcome is questionable and the re-emergence of MDR isolates has to be borne in mind .

The quinolone resistance is mediated by mutations in chromosomal genes ( gyrA , gyrB and parC ) . The point mutations alter DNA gyrase and topoisomerase IV that targets the quinolone drugs . A single point mutation at the quinolone resistance determining region of the gyrA confers resistance to

Nalidixic acid in S.typhi , whereas complete resistance to fluoroquinolones is usually associated with double mutation in gyrA gene. 3

The common mutations encountered in gyrA gene is a single point mutation at position 83 changing serine to phenylalanine and at position 87 changing aspartate to tyrosine or glycine as explained by the study of Reena

Raveendran et al (2010), Tzonyo Dimitrov et al ( 2009) .10, 46

In this study , fluoroquinolone resistant typhoidal Salmonella isolates were negative for plasmid mediated quinolone resistant genes like qnrA, qnrB and qnrS. But all these isolates were found to have mutations in these genes gyrA and parC which indicates chromosomal mediated resistance that correlates with the studies of Balaji Veeraraghavan et al (2016),

Godfred A . Menezes et al ( 2016 ) and BN Harish et al ( 2011),

Surojit Das et al ( 2017) . 9,40 ,11,51

Most of the isolates in the present study had mutations in gyrA gene that were observed at position 83 , Serine being replaced by phenylalanine and at position 87 Aspartic acid replaced by Asparagine , correlating with the studies of Surojit Das et al (2016) , Godfred A . Menezes et al ( 2016 ) and

BN Harish et al ( 2011) and Tzonyo Dimitrov et al ( 2008). 51, 40, 11, 46

The mutations in par C gene are commonly encountered at position 57

Threonine being replaced by serine and at position 80 threonine being replaced by Isoleucine . In this study few isolates show mutation at position

57 threonine replaced by serine and at position 80 serine being replaced by isoleucine. This correlates with the studies of Surojit Das et al (2016) ,

Godfred A . Menezes et al ( 2016 ) and BN Harish et al ( 2011) and Tzonyo

Dimitrov et al ( 2008). 51, 40, 11, 46. The mutations in quinolone resistance determining region genes infers treatment failure if the patients are treated with Ciprofloxacin .

No mutations was observed in gyrB gene in the present study . This correlates with the study of Surojit Das et al (2016), Balaji Veeraraghavan et al (2016)51,9 But there are studies by Muzamil Mahdi abdel hammid et al (2017) and Surojit Das et al (2017) showing mutations in gyrB gene , with following amino acid changes , Methionine – Asparagine , Proline – Arginine , Glutamic acid – Glycine . 45, 51 If mutations occur in all three genes of QRDR region

, will lead to an increased in-vitro resistance. Such patients do not respond to treatment with fluoroquinolones and go in for complications resulting in increased morbidity and mortality.

SUMMARY

The present study was carried out in Fever clinic , Medicine and

Paediatric departments at Coimbatore Medical College and Hospital,

Coimbatore for a period of one year from July 2016 to June 2017 . A total of

250 clinically suspected enteric fever cases were subjected for blood culture and sensitivity and antibiotic sensitivity pattern of the isolates were analysed .

 A total of 28 Salmonella enterica isolates were isolated from 250 blood

culture samples with the isolation rate of 11.2 %.

 Among the 28 isolates of Salmonella enterica , the serovars identified

were Salmonella typhi (86%) and Salmonella paratyphi A (14%).

 Enteric fever was predominantly seen among males (68%) than females

(32%) .

 32% of enteric fever was seen in young adults of age 21 – 30 yrs and

25% in age group of 11-20 yrs, 31-40 yrs .

 Neutropenia was observed in 93% of blood culture positive enteric fever

cases .

 All the 28 blood culture positive enteric fever cases had

hepatosplenomegaly (100%) .

 Salmonella typhi showed 100% sensitivity to Ceftriaxone and

Azithromycin .

 Only one isolate of S.typhi (4%) was found to be Multi-drug resistant.

 S.typhi showed 25% resistance to Nalidixic acid , Pefloxacin and

Ciprofloxacin.

 Minimum Inhibitory Concentration of all these resistant isolates to

Ciprofloxacin were determined to be > 1 µg/ml.

 S. paratyphi A showed 100% sensitivity to Chloramphenicol ,

Ampicillin , Cotrimoxazole , Ceftriaxone and Azithromycin .

 50% of S.paratyphi A were resistant to Nalidixic acid , Pefloxacin and

Ciprofloxacin .

 Molecular characterisation was done, to determine whether

fluoroquinolone resistance was plasmid mediated or chromosomal

mediated .

 The eight resistant isolates of both S.typhi and S.paratyphi A were

found to be negative for plasmid mediated quinolone resistance genes

like qnrA, qnrB and qnrS .

 All the six resistant isolates of S.typhi were found to have mutations

in gyrA gene and two of them had mutations in parC genes .

 The two isolate of S.paratyphi A showed mutations both in gyrA

and parC gene.

 There was no mutations in gyrB gene.

 The mutations were commonly encountered at position 83 serine

replaced by phenyl alanine and at position 87 aspartic acid replaced by

asparagine in gyrA gene.

 Whereas in parC gene the mutations were observed at position 57

threonine replaced by serine and at position 80 serine being replaced

by isoleucine.

CONCLUSION

Enteric fever continues to be a major public health problem and the emergence of antimicrobial resistance by Salmonellae enterica adds to the complexity in treating the patients . The definitive treatment of enteric fever depends on the susceptibility pattern of the organism isolated from the patients themselves .

The present study reveals that, typhoidal Salmonellae isolated were mostly resistant to fluoroquinolones , which was due to mutations in the quinolone resistance determining region ( QRDR ) of gyrA and parC gene .

Occurrence of mutations in many genes may lead to high – level of

Ciprofloxacin resistance.

As the isolates were 100% sensitive to Ceftriaxone, it can be considered as an alternative source in treatment of fluoroquinolone resistant strains . Furthermore MIC of Ceftriaxone and its susceptibility pattern are to be monitored closely , because of their emerging resistance .

Declining trends of Multi-drug resistance in S.typhi suggests recycling of first –line drugs (Ampicillin , Chloramphenicol, Cotrimoxazole ).

The adverse effects of drugs such as bone marrow suppression and high relapse rate hinders its use in treatment purpose .

To conclude , narrowing of therapeutic options warrants the control of diseases through proper sanitation , personal hygiene measures , safe water supply, detection and treatment of Typhoid carriers and adoption of vaccination.

BIBLIOGRAPHY

1. Varsha Gupta , Nidhi Singla , Neha Bansal , Neelam Kaistha and Jagdish Chander.

Trends In the Antibiotic Resistance Patterns of Enteric Fever Isolates – a three year

report from a tertiary care centre .Malays J Med Sci , 2013 Jul; 20(4) : 71-75.

2. Lovely Akter , Munir Hassan , Zakaria Ahmed . Present Status and Antibiotic

Sensitivity Pattern of Salmonella typhi and S.paratyphi in Different Age Group

Hospitalized Patients in Dhaka City , Bangladesh – IOSR JPBS , ISSN : 2278-3008.

Volume 4, Isssue 3 ( Nov - Dec . 2012) , PP 27-30.

3. Shoorashetty Manohar Rudresh , Nagarathnamma . Antibiotic susceptibility

pattern of Salmonella enterica serovar typhi and Salmonella enterica serovar

paratyphi A with special reference to quinolone resistance. OPUBS – 2015 ,

Volume : 6 , Issue : 2 , page : 70 -73 .

4. Jaspal Kaur , Increasing Antimicrobial Resistance and Narrowing Therapeutics in

Typhoidal Salmonellae . JCDR .2013 Mar ; 7 (3): 576-579. PMICD : PMC3616589.

5. Riyaz chungathu , Jayavardhana A , Current pattern of Salmonella typhi

antimicrobial susceptibility in the era of antibiotic abuse . Indian Journal of Basic

and Applied Medical Research ; December 2015 : Vol -5 , Issue -1 , P. 400-404

6. R Leon Ochia , Camilo Acosta , M Carolina Danovaro – Holiday ,et al . A Study

of typhoid fever in five Asian countries : disease burden and implications for

controls . Bulletin of the World Health Organisation . 7. Crump JA, Mintz ED. Global Trends in typhoid and paratyphoid fever. Clin Infect

Dis. 2010;50(2):241-246.

8. Harriet Ugboko and Nandita De , Mechanisms of Antibiotic resistance in

Salmonella typhi . Int .J. Curr. Microbiol.App.Sci ; ISSN : 2319-7706 :V 3, N (12)

(2014) : 461-476 .

9. 9. Balaji Veeraraghavan , Shalini Anandan , Dhivya Prabaa Muthuirulandi Sethuvel

, Nivetha Puratchiveeran , et al . Molecular characterization of intermediate

susceptible typhoidal Salmonella to Ciprofloxacin and its impact. Mol Diagn Ther

; 07 , March 2016 .

10. . Reena raveendran , S Datta , Chand Wattal . Drug resistance in Salmonella enterica

serotype typhi and paratyphiA : JIMSA January - March 2010 ; Vol .23 No.1 .

11. BN Harish GA Menezes . Antimicrobial resistance in typhoidal Salmonellae:

IJMM ; Year 2011/ Volume : 29 / Issue :3 , P: 223-229 .

12. . Syed Ahmed Zaki , Sunil karande . Multi-drug resistant typhoid fever : A review ;

Journal of infection in developing countries : May 2011 / Vol 5 .

13. Sarika Jain, Tulsi Das Chugh . Antimicrobial resistance among blood culture

isolates of Salmonella enterica in New Delhi : J Infect Dev Ctries 2013; 7(11):788-

795. doi:10.3855/jidc.3030.

14. . Kavitha Nagshetty , Shivannavar T. Channappa and Subhashchandra M.Gaddad .

Antimicrobial susceptibility of Salmonella Typhi in India : The Journal of Infection

in Developing Countries : March 2010 / DOI: 10.3855/jidc.109 · 15. Rajesh Upadhyay, R & Nadkar, M.Y. & Muruganathan, A & Tiwaskar, Mangesh

& Amarapurkar, Deepak & Banka, N.H. & Mehta, K.K. & Sathyaprakash, B.S. API

recommendations for the management of typhoid fever: (2015) / 63/ 77-96.

16. Beeching NJ, Parry CM. Outpatient treatment of patients with enteric fever. Lancet

Inf. Dis. 2011;11:420-21.

17. D. R., Naveen Kumar & ms, Dhiviya Prabaa & Abirami Shankar, Baby &

Munusamy, Elakkiya & Anandan, Shalini & Veeraraghavan, Balaji. (2016). Draft

genome sequence of blaTEM-1-mediated cephalosporin-resistant Salmonella

enterica serovar Typhi from bloodstream infection: Journal of Global Antimicrobial

Resistance. //7. . 10.1016/j.jgar.2016.06.003.

18. . Veeraraghavan, Balaji & Anandan, Shalini & ms, Dhiviya Prabaa & D. R., Naveen

Kumar. (2016). Pefloxacin as a Surrogate Marker for Fluoroquinolone

Susceptibility for Salmonella typhi: Problems and Prospects. Journal of Clinical and

Diagnostic Research. 10. . 10.7860/JCDR/2016/17022.8306.

19. Priyanka Sharma1 , Sushila Dahiya1 , Bhavana Kumari1 , Veeraraghavan Balaji2

, Seema Sood1 , Bimal Kumar Das1 & Arti Kapil . Pefloxacin as a surrogate marker

for quinolone susceptibility in Salmonella enterica serovars Typhi & Paratyphi A in

India: Indian J Med Res 145, May 2017, pp 687-692

20. . Ananthanarayan and Panikers Textbook of Microbiology

21. . Mackie & McCartney Practical Medical Microbiology

22. Essentials Of Medical Microbiology by Apurba Sankar Sastry , Sandhya Bhat K 23. Mogasale V, Maskery B, Ochiai RL, Lee JS, Mogasale VV, Ramani E, et al.

Burden of typhoid fever in low-income and middle-income countries: A systematic,

literature-based update with risk-factor adjustment. Lancet Glob Health 2014; 2 :

e570-80.

24. Koneman's Color Atlas and Textbook of Diagnostic Microbiology .

25. Bhattacharya SS, Das U, Choudhury BK. Occurrence & antibiogram of Salmonella

Typhi & S. Paratyphi A isolated from Rourkela, Orissa. Indian J Med Res 2011;

133 : 431-3.

26. . Thamizhmani R, Bhattacharya D, Sayi DS, Bhattacharjee H, Muruganandam N,

Ghosal SR, et al. Emergence of fluoroquinolone resistance in Salmonella enterica

serovar Typhi in Andaman and Nicobar Islands, India. Indian J Med Res 2012; 136

: 98-101.

27. Choudhary A, Gopalakrishnan R, Nambi PS, Ramasubramanian V, Ghafur KA,

Thirunarayan MA. Antimicrobial susceptibility of Salmonella enterica serovars in

a tertiary care hospital in Southern India. Indian J Med Res 2013; 137 : 800-2.

28. + Gokul BN, Menezes GA, Harish BN. ACC-1 beta-Lactamaseproducing

Salmonella enterica serovar Typhi, India. Emerg Infect Dis 2010; 16 : 1170-1. 25.

Balaji V, Sharma A, Ranjan P, Kapil .

29. Balaji V, Sharma A, Ranjan P, Kapil A. Revised ciprofloxacin breakpoints for

Salmonella Typhi : Its implications in India. Indian J Med Microbiol 2014; 32: 161-

3 30. Adnan Mannan1* , Mohammad Shohel2 , Sultana Rajia3 , Niaz Uddin Mahmud4

, Sanjana Kabir2 , Imtiaj Hasan5,6 . A cross sectional study on antibiotic resistance

pattern of Salmonella typhi clinical isolates from Bangladesh . Asian Pac J Trop

Biomed 2014; 4(4): 306-311.

31. . skov R, Matuschek E, Sjölund-Karlsson M, Åhman J, Petersen A, Stegger M, et

al. Development of a pefloxacin disk diffusion method for detection of

fluoroquinolone-resistant Salmonella enterica. J Clin Microbiol 2015; 53 : 3411-7.

32. Ruchi Girotra1* , Reetika Dawar2 , Ruby naz1 , Sunil Garg3 and Rakesh

Gupta3.Prevalence of Salmonella serotypes and antibiogram of Salmonella typhi in

a Tertiary Care Hospital in NCR Region, India. Int.J.Curr.Microbiol.App.Sci (2016)

5(4): 803-810.

33. The European Committee on Antimicrobial Susceptibility Testing. Breakpoint

tables for interpretation of MICs and Zone Diameters. Version 4.0; 2014. Available

from: http://www. eucast.org/clinical_breakpoints/, accessed on January 1, 2014.

34. Hetal N. Jeeyani, Baldev S. Prajapati, Afroz Bloch Enteric Fever in Children -

Clinical Profile, Sensitivity Patterns and Response to Antimicrobials. GCSMC

Journal of Medical Sciences.2015; 4(1): 40-43.

35. Suresh.K.1 , Balachandran C.S.2 , Yogavalli.S3 , Chidambaranathan.S4. A Study

on Antibiotic Sensitivity Pattern of Salmonella Typhi in Pediatric Age Group:

JMSCR Vol||05||Issue||05||Page 22059-22063||May 2017 .

36. Akhtar, Indu Shukla, Fatima Khan and Anjumparwez., A Multi-drug Resistant

Salmonella enterica Subspecies enterica Serotype Typhi: A Diagnostic and Therapeutic Challenge. International Journal of Current Microbiology and Applied

Sciences. 2015; Special Issue-1: 19-25.

37. . Taraknath Ghosh1 , Mithun Chandra Konar2, # , Archan Sil3 , Prashanth Kumar4

, Asok Kumar Datta5 , Subhasri Middya6 . A Hospital Based Cross-Sectional Study

on Enteric Fever – Evolving Clinical Features, Basic Laboratory Parameters And

Serological Profiles: IOSR-JDMS: Volume 15, Issue 12 Ver. VII (December. 2016),

PP 43-49.

38. Sudharshan Raj. Clinical profile and antibiotic sensitivity pattern of typhoid fever

in Patients admitted to pediatric ward in a rural teaching hospital. International

Journal of Medical Research & Health Sciences. 2013; 3(2): 245-249.

39. B. A. Rahman1 , M. O. Wasfy1,, M. A. Maksoud1 , N. Hanna2 , E. Dueger1,3 and

B. House. Multi-drug resistance and reduced susceptibility to ciprofloxacin among

Salmonella enterica serovar Typhi isolates from the Middle East and Central Asia

.New Microbes New Infect. 2014 July; 2(4): 88–92.

40. GA Menezes, BN Harish, MA Khan, W Goessens, JP Hays. Antimicrobial

resistance trends in blood culture positive Salmonella Paratyphi A isolates from

Pondicherry, India : Indian Journal of Medical Microbiology, Year 2016, Volume

34, Issue 2 [p. 222-227]

41. Joshi BG, Keyal K, Pandey R, Shrestha BM. Clinical Profile and Sensitivity Pattern

of Salmonella Serotypes in Children: A Hospital Based Study. Journal of Nepal

Paediatric Society. 2011;31(3): 180-83. 6. 42. Chandrashekar, Anil Kumar YC, KirandeepSodhi and Dalal S.S. A Study of

clinical and laboratory profile of enteric fever in pediatric age group. International

Journal of Basic and Applied Medical Sciences 2013; 3(3): 16-23 .

43. Kumar M, Dahiya S, Sharma P, Sharma S, Singh TP, Kapil A, et al. Structure based

in silico analysis of quinolone resistance in clinical isolates of Salmonella typhi

from India. PLoS One 2015; 10 : e0126560. 14.

44. Sjölund-Karlsson M, Howie RL, Crump JA, Whichard JM. Fluoroquinolone

susceptibility testing of Salmonella enterica: Detection of acquired resistance and

selection of zone diameter breakpoints for levofloxacin and ofloxacin. J Clin

Microbiol 2014; 52 : 877-84.

45. .Muzamil Mahdi Abdel Hamid Detection and molecular characterization of gyrA

and gyrB genes of MDR-Salmonella typhi isolated from clinical sample in Sudan:

Research gate : April 2017.

46. . Tzonyo Dimitrov1, Ali A. Dashti2, Ossama Albaksami3, Edet E. Udo4, Mehrez

M. Jadaon2 and M. John Albert4,Ciprofloxacin-Resistant Salmonella

entericaSerovar Typhi from Kuwait with Novel Mutations in gyrA and parC Genes:

JCM// Jan 2009 : Vol- 47, No: 1 p- 208- 211.

47. Nata Pratama Hardjo Lugito1 and Cucunawangsih2.Antimicrobial Resistance

of Salmonella enterica Serovars Typhi and Paratyphi Isolates from a General

Hospital in Karawaci, Tangerang, Indonesia: A Five-Year Review :IJM

//Volume 2017 (2017), Article ID 6215136, 7 pages .

48. . Chiou C-S., et al. “Antimicrobial resistance in Salmonella enterica serovar Typhi

isolates from Bangladesh, Indonesia, Taiwan, and Vietnam”. Antimicrobial Agents

and Chemotherapy 58.11(2014): 6501-6507. 7.

49. Acharya D., et al. “Antibiotic susceptibility pattern and the indicator of decreased

ciprofloxacin susceptibility of Salmonella enterica serovar typhi isolated from

Dhulikhel Hospital, Nepal”. Japanese Journal of Infectious Diseases 65.3 (2012):

264-267.

50. A. Devaranavadagi, Ranganatha & S, Srinivasa. (2017). A study on clinical profile

of typhoid fever in children. International Journal of Contemporary Pediatrics. 4.

1067. 10.18203/2349-3291.ijcp20171730.

51. Das S1, Samajpati S1, Ray U2, Roy I3, Dutta S4.Antimicrobial resistance and

molecular subtypes of Salmonella enterica serovar Typhi isolates from Kolkata,

India over a 15 years period 1998-2012//2017 Jan;307(1):28-36. /j.ijmm

52. Ashraf M. Dewan1 , Robert Corner1 *, Masahiro Hashizume2 , Emmanuel T.

Ongee1. Typhoid Fever and Its Association with Environmental Factors in the

Dhaka Metropolitan Area of Bangladesh: A Spatial and Time-Series Approach.

//2013 Jan 24 / journal .pntd .

53. WHO Mannual of Guidelines for the Management of Typhoid Fever July 2011 . 54. . Doss CGP., et al. “Screening of mutations affecting protein stability and dynamics

of FGFR1—A simulation analysis”. Applied and Translational Genomics 1 (2012):

37-43.

55. . S. Le Hello, A. Bekhit, S. A. Granier et al., “The global establishment of a highly-

fluoroquinolone resistant Salmonella enterica serotype Kentucky ST198

strain,” Frontiers in Microbiology, vol. 4, article 395, 2013. ·

56. N. H. Punjabi, M. D. Agtini, R. L. Ochiai et al., “Enteric fever burden in North

Jakarta, Indonesia: a prospective, community-based study,” Journal of Infection in

Developing Countries, vol. 7, no. 11, pp. 781–787, 2013.

57. J. Yaxian, Z. Hui, N. Hua et al., “Antimicrobial resistance surveillance

of Salmonella isolates from the First People's Hospital of Yunnan Province,

China,” Journal of Infection in Developing Countries, vol. 9, no. 4, pp. 333–337,

2015.

58. F . N. Qamar, A. Azmatullah, A. M. Kazi, E. Khan, and A. K. M. Zaidi, “A three-

year review of antimicrobial resistance of Salmonella enterica serovars Typhi and

Paratyphi A in Pakistan,” Journal of Infection in Developing Countries, vol. 8, no.

8, pp. 981–986, 2014.

59. H. J. Chand, K. R. Rijal, B. Neupane, V. K. Sharma, and B. Jha, “Re-emergence of

susceptibility to conventional first line drugs in Salmonella isolates from enteric

fever patients in Nepal,” Journal of Infection in Developing Countries, vol. 8, no.

11, pp. 1483–1487, 2014. 60. C.-S. Chiou, T.-L. Lauderdale, D. C. Phung et al., “Antimicrobial resistance

in Salmonella enterica serovar Typhi isolates from Bangladesh, Indonesia, Taiwan,

and Vietnam,” Antimicrobial Agents and Chemotherapy, vol. 58, no. 11, pp. 6501–

6507, 2014.

61. S . Kariuki, G. Revathi, J. Kiiru et al., “Typhoid in Kenya is associated with a

dominant multidrug-resistant Salmonella enterica serovar typhi haplotype that is

also widespread in Southeast Asia,” Journal of Clinical Microbiology, vol. 48, no.

6, pp. 2171–2176, 2010 .

62. A. B. Anggraini, C. Opitasari, and S. Qamp, “The use of antibiotics in hospitalized

adult typhoid patients in an Indonesian hospital,” Health Science Journal

of Indonesia, vol. 1, pp. 40–43, 2014.

63. Amenu, D. (2014) Antimicrobial resistance for enteric pathogens isolated from

acute gastroenteritis patients. World1: 1-14.

64. Krishnan P, Stalin M and Balasubramanian S (2009) Changing trends in

antimicrobial resistance of Salmonella enterica serovar typhi and salmonella

enterica serovar paratyphi A in Chennai. Indian J Pathol Microbiol, 52: 505-8.

65. Nair S, Unnikrishan M, Turner K et al. Molecular analysis of fluoroquinolone-

resistant Salmonella Paratyphi A isolate, India. Emerg Infect Dis 2006; 12: 489–91.

ANNEXURES

CONSENT FORM

Shri / Smt / Kum……………………………… aged ……………… Years, S/o / D/o / W/o ………………………………., residing at ………………………...... are requested to permit your child to be a participant in the research study titled “ Study on Molecular Characterisation of Anti – Microbial Resistance in Salmonella Enterica Serovar Typhi And Paratyphi From Blood Culture Isolates In CMCH” conducted by Dr. VIJI.S one of the post graduate trainees in the Dept. Of Microbiology, Govt, Coimbatore Medical College and Hospital, Coimbatore. You are eligible for the study as per the inclusion criteria. You can ask her any question or seek from her any clarifications about the study which you may have before agreeing to participate in the study.

Name :

Place :

Date :

Signature :

ஒப்ꯁதல் ப羿வம்

நான் ...... டாக்டர் 毁. விஜி அவர்கள் என鏁

குழந்ததக்கு செய்뿁ம் பரிசொததனக்கு தானாக 믁ன்வந்鏁 என鏁 ெம்மதத்தத

சதரிவித்鏁க்சகாள்கிசேன். இந்த ஆராய்ச்ெியின் ஒப்ꯁதல் சகா쏁ம் ப羿வத்தத

믁폁வ鏁மாக ப羿த்鏁 சதரிந்鏁 சகாண்சடன். இந்த சொததனயின் எந்த

நிதையி쯁ம் என鏁 ெந்சதகங்கதை எப்சபா鏁 சவண்翁மானா쯁ம் சகட்翁

சகாள்ைைாம் என்பதத அேிந்சதன்.

குழந்ததயின் சபற்சோர் தகசயாப்பம் /

இட鏁 தக சப쏁விரல் சரதக

இடம் - சகாதவ

சததி -

ொட்ெியின் தகசயாப்பம் /

இட鏁 தக சப쏁விரல் சரதக

இடம் - சகாதவ

சததி – PROFORMA Name : S/O, W/O: Age / Sex : Address: Complaints:

History of Present Illness :

Past History: Treatment History:

Examination: Well / Moderately / ill built Temp: F

Pallor : Yes / No HR/PR /Min

Icterus : Yes / No RR: /Min

Pedal edema: Yes / No

CVS.

P/A: : Hepatospleenomegaly + / -

INVISTIGATION: CBC:

WBC- NEUT % %

RBC- LYM-

Hb%- PLT-

RBS:

Blood Culture:

Others: ஒப்ꯁதல் சகா쏁வதற்கான ப羿வம்

தி쏁 / தி쏁மதி ...... வய鏁 ...... த/ சப, க/சப ......

இடத்தில் வெிக்கும் ஆகிய நீங்கள் டாக்டர் . 毁. விஜி பட்ட சமற்ப羿ப்ꯁ மாணவி, ꏁண்迁யிரியல் 鏁தே, சகாதவ ம쏁த்鏁வ கல்쯂ரி ஆகிய நான் செய்뿁ம் ( Study on Molecular Characterisation of Anti – Microbial Resistance in Salmonella Eaterica Serovar typhi and paratyphi from Blood

Culture isolates in a Tertiary care Hospital) குழந்ததக쿁க்கு தடபாய்ட் காய்ச்ெல் கண்டேி뿁ம் இரத்த பரிசொததன 믁தேகள், மற்쟁ம் அதற்கு ஏற்ே ம쏁ந்鏁கள் சகா翁ப்ப鏁 சதாடர்பாக ஆராய்தல் என்ே ஆராய்ச்ெிக்கு உங்கள் குழந்ததயின் விவரங்கள் மற்쟁ம் இரத்த மாதிரிதய உபசயாகப翁த்திக்சகாள்ை அꟁமதிக்குமா쟁 சகட்翁க்சகாள்கிசேன். உங்கள் குழந்தத இந்த ஆராய்ச்ெிக்கு தகுதி உதடயவர். நீங்கள் இதற்க்கு ெம்மதம் சதரிவிக்கும் 믁ன் உங்க쿁தடய எந்த விதமான ெந்சதகங்கதை மற்쟁ம் விவரங்கதை சகட்翁 அேிந்鏁க்சகாள்ைைாம்.

இததன அேிய உங்கள் குழந்தத뿁தடய வய鏁, பால் சபான்ே விவரங்கள் மற்쟁ம் சநாய்க்கான அேிகுேிகள், உடல் மற்쟁ம் இரத்த பரிசொததன ஆகியதவ குழந்தத ெிேப்ꯁ ம쏁த்鏁வரின் ஆசைாெதனயின்ப羿 செய்யப்ப翁ம். இந்த பரிசொததனகதை என்ꟁதடய ஆராய்ச்ெிக்கு உபசயாகப்ப翁த்தி பதிퟁ செய்鏁, ꯁள்ைியியல் 믁தேப்ப羿 ஆராய்ந்鏁 믁羿ퟁகதை அேிய இ鏁 உபசயாகப்ப翁ம். இந்த பரிசொததனக்கு ம쟁ப்ꯁ சதரிவிப்பதற்கு 믁폁 உரிதம உள்ை鏁.

உங்க쿁தடய குழந்ததயின் பரிசொததன விவரங்கள் கண்羿ப்பாக இரகெியமாக தவக்கப்ப翁ம். இந்த ஆராய்ச்ெியின் 믁羿ퟁகள் ஆராய்ச்ெி கமிட்羿 믁ன் ெமர்பிக்கும் சபா鏁 உங்க쿁தடய குழந்ததயின் தனிப்பட்ட அதடயாைம் சவைியிடப்படா鏁.

MASTER CHART

16 15 14 13 12 11 10

9 8 7 6 5 4 3 2 1 S.No Moses Sumithra Pavithra Akila Kiruthika Sarojini Jothi Selvi kalaivani ali Earuk Lawrence Makeshwaran kumar Senthil kumar Manoj Subash Balu Santhosh Name 24/M 6/Fch 8/Fch 5/Fch 7/Fch 40/F 42/F 25/F 24/M 24/M 39/M 37/M 17/M 19/M 25/M 8/Mch

Age/Sex MM1/M1 MM3/M4 MM3/M4 Fever OP Fever OP Fever OP Fever OP Fever OP FM I/M3 Med OP PICU II PICU II PICU II 342305 644800 643735 ]52121 PICU I PICU1 IMCU 43070 28251 41427 43126 64879 41961 43567 42436 41898 42157 42158 42077 OP/IP No Ward Cbe Cbe Cbe Cbe Cbe Cbe Cbe Tirupur Cbe Cbe Cbe Cbe Cbe Cbe Cbe Cbe

Place Normal Tachy Normal Tachy Normal Tachy Tachy Normal Tachy Normal Normal Normal Tachy Normal Normal Normal

Heart rate Normal INC Normal Normal INC Normal DEC INC DEC Normal DEC Normal Normal INC Normal Normal

Neutrophil count No No No No No No No No No No No yes No No No No

Hepatosplenomegaly NEG NEG NEG NEG NEG NEG NEG NEG NEG NEG NEG NEG NEG NEG NEG NEG Blood Culture Blood S.typhi NEG NEG NEG NEG NEG NEG NEG NEG NEG NEG NEG NEG NEG NEG NEG NEG

S.paratyphiA ______- I Line Drug AST Pattern AST (Amp, C, Cot) ______Quinolones (Cip, PF, NA) ______Cephalosporins (CTR, CTX) ______PlasmidMediated qnr A ______QuinoloneResistantGenes qnr B ______

qnr S ______ChromosomalMediated

gyrA ______

gyrB ______

parC 651079 17 Basudev 29/M Cbe Normal DEC Yes NEG POS S S S ______Med OP 43140 18 Dhivya 22/F Cbe Normal Normal No NEG NEG ______LW 42305 19 Lawerence 20/M Cbe Tachy Normal No NEG NEG ______MM2/M5 43385 20 Balaji 21/M Cbe Tachy DEC No NEG NEG ______MM3/M3 652732 21 Prithvi 21/M Cbe Normal INC No NEG NEG ______Fever OP 43970 22 Santhosh 6/Mch Cbe Tachy DEC Yes NEG NEG ______PICU II 43709 23 Srivarshini 3/Fch Cbe Normal Normal No NEG NEG ______PICU I 43732 24 Rajan 60/M Cbe Tachy Normal No NEG NEG ______MM3/M4 43015 25 Pandi 15/M Cbe Normal INC No NEG NEG ______MM1M1 44435 26 Ramalakshmi 30/F Tirupur Tachy DEC No NEG NEG ______LW 44368 27 Lakshmi 20/F Cbe Tachy DEC No NEG NEG ______LW 43962 28 Raja 55/M Cbe Tachy INC No NEG NEG ______MM2/M5 44069 29 Suresh 25/M Cbe Normal DEC Yes POS NEG R S S ______MM2/M5 43130 30 Kavitha 23/F Cbe Normal INC No NEG NEG ______LW 43745 31 Vinushree 44/F Cbe Normal DEC No NEG NEG ______PICU I 41326 32 Davidakash 11/MCH Cbe Tachy DEC No NEG NEG ______PICU I 43526 33 Jaya 26/F Tirupur Normal Normal Yes NEG NEG ______LW 44527 34 Manikandan 14/M Cbe Tachy DEC No NEG NEG ______MM1/M1 52143 35 Valliyammal 35/F Cbe Tachy INC No NEG NEG ______FS2/S4 646828 36 Suganthi 9/Fch Cbe Tachy Normal No NEG NEG ______PICU I 44158 37 Bagiyalakshmi 50/F Cbe Normal INC No NEG NEG ______FM1/M6 43518 38 Thangamani 20/F Erode Brady DEC Yes NEG NEG ______LW 45597 39 Karthick 27/M Cbe Tachy Normal No NEG NEG ______IA/M5 46985 40 Toufiya 10/Fch Cbe Normal DEC Yes POS NEG R R S _ _ _ Mut _ Mut PICU I 47528 41 Meena 65/F Cbe Tachy INC No NEG NEG ______MM1/M1 680828 42 Subusaran 17/M Cbe Tachy Normal No NEG NEG ______Gen OP 48823 43 Nijamutheen 20/M Cbe Tachy DEC No NEG NEG ______MM2/M5 50167 44 Sathiya 21/F Cbe Normal INC No NEG NEG ______LW 50297 45 Sivasakthi 37/F Nilgiris Tachy INC No NEG NEG ______FM1/M4 50901 46 Nirosha 31/F Cbe Tachy Normal No NEG NEG ______FM1/M1 697136 47 Velpandi 23/M Cbe Brady DEC yes NEG POS S S S ______Fever OP 57070 48 Karuppanan 45/M Cbe Normal INC No NEG NEG ______MM1/M1 51541 49 Irfan 17/M Cbe Normal DEC No NEG NEG ______MM3/M3 785050 50 Francis xavier 53/M Cbe Normal INC No NEG NEG ______Fever OP 62571 51 Anandhalakshmi 35/F Cbe Tachy Normal No NEG NEG ______FM1/M1 778149 52 Senthil kumarI 37/F Tirupur Brady DEC yes POS NEG S S S ______Fever OP 65415 53 Surendar 16/M Cbe Normal INC No NEG NEG ______Fever OP 783463 54 Durai raj 31/M Nilgiris Tachy Normal No NEG NEG ______Fever OP 787079 55 Hasini 7/Fch Cbe Tachy INC No NEG NEG ______Fever OP 787587 56 Asif 26/F Cbe Tachy Normal No NEG NEG ______Fever op 788371 57 Vellingiri 45/M Tirupur Normal Normal No NEG NEG ______Fever OP 788557 58 Revathi 21/F Cbe Tachy INC No NEG NEG ______FeverOP 791257 59 Sathiya moorthy 20/M Cbe Tachy Normal No NEG NEG ______Fever OP 793258 Munisamy 47/M Cbe Normal INC No NEG NEG ______60 Fever OP 793834 61 Venkatesan 50/M Cbe Normal DEC yes NEG NEG ______Fever OP 790788 62 Vedhapriya 16/F Cbe Tachy INC l No NEG NEG ______Fever OP 792991 63 Sulthan 27/M Cbe Tachy Normal yes NEG NEG ______Fever OP 797290 64 Deepika 21/F Cbe Brady DEC No NEG NEG ______Fever OP 501411 65 Gunasekar 43/M Cbe Tachy DEC No NEG NEG ______Fever OP 807814 66 Babu 58/M Cbe Tachy INC No NEG NEG ______Fever OP 72932 67 Chandrasekaran 8/Mch Tirupur Brady Normal No NEG NEG ______PICU II 822732 68 Balu 41/M Cbe Normal DEC yes POS NEG S S S ______Fever op 479094 N 69 Balasubramani 58/M Nilgiris Normal No NEG NEG ______Fever OP o 829108 70 Velmurugan 38/M Cbe Tachy INC No NEG NEG ______Fever OP 829056 71 Ravikumar 50/M Cbe Tachy DEC No NEG NEG ______Fever OP 740412 72 Janani 3yrs/Fch Cbe Normal Normal No NEG NEG ______PICU II 832780 73 Shameer 31/M Cbe Tachy INC No NEG NEG ______Fever OP 829475 74 Vijayalakshmi 16/F Cbe Tachy Normal No NEG NEG ______Fever OP 739910 75 Ajith 29/M Cbe Tachy Normal No NEG NEG ______Fever OP

804653 76 Mohammed Fritheen 19/M Cbe Tachy INC yes NEG NEG ______Fever OP

816043 77 Yasmin 13/F Cbe Tachy Normal No NEG NEG ______Medicine 813727 78 Sivagami 45/F Cbe Normal INC No NEG NEG ______Fever OP 834899 79 Abimannan 38/M Cbe Tachy Normal No NEG NEG ______Fever OP

80 Karmel 18/F 839579 Nilgiris Tachy Normal No NEG NEG ______

81 Selvakumar 6/Mch Fever OP Cbe Normal INC No NEG NEG ______

839396 82 Nehar nesha 16/F Cbe Normal INC No NEG NEG ______Fever OP 839295 83 Anjali 17/F Cbe Brady DEC yes POS NEG S R S _ _ _ Mut _ Mut Fever OP 842649 84 Manikandan 9/Mch Cbe Tachy Normal No NEG NEG ______Paediatric 874967 85 Vishnu 11/Mch Cbe Normal DEC No NEG NEG ______Paediatric 875032 86 Yusuf 25/M Cbe Tachy Normal No NEG NEG ______Med OP 871542 87 Poonkodi 30/F Cbe Normal INC No NEG NEG ______Fever OP

88 Praveen 21/M 871746 Cbe Tachy INC No NEG NEG ______89 Srinivasan 43/M Fever OP Cbe Normal Normal No NEG NEG ______

877858 90 Pandiyaraj 2/Mch Cbe Normal DEC No NEG NEG ______Fever OP 874756 91 Keerthana 4/Fch Cbe Normal DEC No NEG NEG ______Fever OP 832036 92 Selvaraj 60/M Cbe Tachy INC No NEG NEG ______Fever OP 846647 93 Arumugam 55/M Cbe Tachy Normal No NEG NEG ______Fever OP 880400 94 Kurusamy 60/M Cbe Normal INC No NEG NEG ______Fever OP 841260 95 Sumitha 35/F Cbe Brady DEC Yes POS NEG S R S _ _ _ Mut _ Mut Fever OP 736512 96 Rajeshwari 57/F Cbe Normal Normal No NEG NEG ______Fever OP 659437 97 Masilamani 48/F Cbe Tachy INC No NEG NEG ______Fever OP 848590 98 Karthiraja 11/Mch Cbe Normal Normal No NEG NEG ______Fever OP 844103 99 Fathimanazreen 14/F Cbe Tachy INC No NEG NEG ______Fever OP 77072 100 Punithavalli 28/F Cbe Normal DEC No NEG NEG ______LW 851552 101 Senthil kumar 45/M Cbe Tachy INC No NEG NEG ______Fever OP

849370 102 Thangamani 45/F Cbe Normal Normal No NEG NEG ______Fever OP

889633 103 Nashima banu 37/F Cbe Normal INC No NEG NEG ______Fever OP 889597 104 Kulanchiammal 50/F Cbe Tachy DEC No NEG NEG ______Fever OP 888492 105 Sathya 16/M Cbe Tachy Normal No NEG NEG ______Fever OP 857666 106 Monishkumar 7/Mch Cbe Normal INC No NEG NEG ______Fever OP 858470 107 Martin 15/M Cbe Tachy Normal No NEG NEG ______Fever OP 860015 108 Samsathbegam 36/F Cbe Normal DEC yes POS NEG S R S _ _ _ Mut _ Mut Fever OP 870322 109 Thangamani 30/F Cbe Normal Normal No NEG NEG ______Fever OP 8242335 110 Nithya 20/F Cbe Tachy INC No NEG NEG ______Med OP 871542 111 Poonkodi 30/F Cbe Tachy Normal No NEG NEG ______Fever OP 860701 112 Srinivasan 43/M Cbe Tachy INC No NEG NEG ______Fever OP 878266 113 Selvi 43/F Cbe Normal Normal No NEG NEG ______Fever OP

808721 114 Dhanalakshmi 13/F Cbe Normal INC No NEG NEG ______Fever OP

869517 115 Krishnan 35/M Cbe Tachy Normal No NEG NEG ______Fever OP 875032 116 Yusuf 28/M Cbe Brady DEC yes POS NEG S S S ______Med OP 83058 117 Srimathi 11/Mch Cbe Tachy Normal No NEG NEG ______PICU I 832036 118 Selvaraj 60/M Cbe Tachy INC No NEG NEG ______Fever OP 83407 119 Kannalli 48/F Cbe Normal Normal No NEG NEG ______FM1/M6 499938 120 Saleema 43/F Cbe Normal DEC yes POS NEG S S S ______Fever OP 808706 121 Dhanalakshmi 13/F Cbe Normal Normal No NEG NEG ______Fever OP 885717 122 Jaisthounisha 38/F Cbe Tachy INC No NEG NEG ______Fever OP 886174 123 Amutha 27/F Cbe Tachy Normal No NEG NEG ______Fever OP 889633 124 Naslaima 37/F Cbe Normal DEC No NEG NEG ______Fever OP 889824 125 Magesh 22/F Cbe Tachy INC No NEG NEG ______Fever OP 890188 126 Muthukumaran 50/M Cbe Tachy Normal No NEG NEG ______Fever OP 890387 127 Selvaraj 50/M Cbe Tachy INC No NEG NEG ______Fever OP 880496 128 Eswari 54/F Cbe Tachy DEC No NEG NEG ______Fever OP 894880 129 Karthik 27/M Cbe Normal INC No NEG NEG ______Fever OP 864582 130 Nasim began 16/F Cbe Normal Normal No NEG NEG ______Fver OP 895995 131 Ragul 14/M Cbe Tachy INC No NEG NEG ______Fever OP 846647 Arumugam 55/M Cbe Tachy DEC Yes POS NEG S S S ______132 Fever OP 875510 133 Fousiya begam 28/F Cbe Tachy DEC No NEG NEG ______Med OP

351257 134 Antonisami 61/M Cbe Normal INC No NEG NEG ______Med OP 896677 135 Haritha 5/Fch Cbe Tachy Normal No NEG NEG ______Fever OP 902031 136 Chithra 36/F Cbe Tachy INC No NEG NEG ______Med OP 1039 137 Nandhini 15/F Cbe Normal Normal No NEG NEG ______Fever OP 9162 138 Sarfardeen 49/M Cbe Tachy Normal No NEG NEG ______Fever OP

876412 139 Mohammed Rafeeq 49/M Cbe Normal Normal No NEG NEG ______Fever OP

4219 140 Sopna 8/Fch Tirupur Tachy INC No NEG NEG ______Fever OP 9134 141 Stephen 42/M Cbe Brady DEC Yes POS NEG S R S _ _ _ Mut _ Mut Fever OP 3027 142 Abdul khadar 38/M Cbe Normal Normal No NEG NEG ______Med OP 907846 143 Sakthi 13/M Cbe Normal INC No NEG NEG ______Fever OP 914171 144 Rabiya 27/F Cbe Tachy Normal No NEG NEG ______Fever OP 4653 145 Kalaiselvi 40/F Cbe Tachy DEC No NEG NEG ______LW

914171 146 Pushparani 50/F Cbe Tachy INC No NEG NEG ______Fever OP

4653 147 Sridevi 25/F Cbe Tachy Normal No NEG NEG ______LW

4243 148 Mohammed Hussain 53/M Cbe Tachy INC No NEG NEG ______MM#/M

917456 149 Vijayalakshmi 14/F Cbe Normal DEC No NEG NEG ______Fever OP 861696 150 Murugesan 25/M Cbe Normal Normal No NEG NEG ______Med OP 919169 151 Parthiban 28/M Cbe Tachy INC No NEG NEG ______Fever OP 5311 152 Kaleeswari 23/F Cbe Tachy Normal No NEG NEG ______LW 919776 153 Gokulraj 15/M Cbe Brady INC yes POS NEG S S S ______Fever OP 915712 154 Hemalatha 19/F Cbe Tachy Normal No NEG NEG ______Fever OP 917254 155 Kalpana 31/F Cbe Normal INC No NEG NEG ______Fever OP 919973 156 Kumar 40/M Cbe Tachy Normal No NEG NEG ______Fever OP 920616 157 Raja 39/M Cbe Brady DEC yes NEG POS S R S _ _ _ Mut _ Mut Fever OP 919806 158 Sakthivel 17/M Cbe Tachy Normal No NEG NEG ______Fever OP 267632 159 Karthick 21/M Cbe Normal INC No NEG NEG ______Med OP 922680 160 Gowtham 24/M Cbe Normal DEC No NEG NEG ______Fever OP 6630 161 Mylathal 70/F Cbe Tachy Normal No NEG NEG ______FM1/M6 925873 162 Ramasamy 51/M Cbe Normal INC No NEG NEG ______Fever OP 957352 163 Apsana 6/Fch Cbe Normal INC No NEG NEG ______Fever OP 424226 164 Ashika 14/F Cbe Tachy Normal No NEG NEG ______Fever OP 925613 165 Akila 16/F Cbe Brady DEC No NEG NEG ______Fever OP 926812 166 Nishanthini 25/F Cbe Normal Normal No NEG NEG ______Med OP 937373 167 Santhosh kumar 20/M Cbe Brady DEC yes POS NEG S R S _ _ _ Mut _ Mut Fever OP 940199 168 Sathya banu 70/F Cbe Normal DEC No NEG NEG ______Fevr OP 941074 169 Nandhini 16/F Cbe Brady INC No NEG NEG ______Fever OP 939762 170 Mohammed Azad 4/Mch Cbe Tachy Normal No NEG NEG ______Fever OP 945263 171 Banumathi 19/F Cbe Normal INC No NEG NEG ______Fever OP

709685 172 Dinesh 15/M Cbe Normal Normal No NEG NEG ______Fever OP

941526 173 Sairabanu 37/F Cbe Normal Normal No NEG NEG ______Fever OP 842459 174 Sandhiya 17/F Cbe Tachy DEC No NEG NEG ______Fever OP 938515 175 Asfag 21/M Cbe Normal INC No NEG NEG ______Fever OP

944815 176 Nusaarthi 31/F Cbe Tachy Normal No NEG NEG ______Fever OP

951226 177 Sridhar 23/M Tirupur Brady DEC yes POS NEG S R S - _ _ Mut _ Mut Fever OP 952004 178 Palix 18/M Cbe Normal Normal No NEG NEG ______Fever OP 952137 179 Sundari 45/F Cbe Normal INC No NEG NEG ______Fever OP 7867 180 Manikandan 26/M Cbe Tachy INC No NEG NEG ______Fever OP 953673 181 Poongodi 25/F Cbe Tachy INC No NEG NEG ______Fever OP 955871 182 Chinnasamy 23/M Cbe Normal DEC Yes POS NEG S S S ______Fever OP 956415 183 Sathish kumar 26/M Cbe Tachy Normal No NEG NEG ______Fever OP 956605 184 Chithra 25/F Cbe Normal INC No NEG NEG ______Fever OP 960128 185 Ramathal 58/F Cbe Normal INC No NEG NEG ______Fever OP

950780 186 Deepika 15/F Cbe Tachy Normal No NEG NEG ______Fever OP 14345 187 Yakshini 6/Fch Cbe Normal DEC No NEG NEG ______PICU III 963802 188 Rohini 21/F Nilgiris Brady DEC yes NEG POS S R S _ _ _ Mut _ Mut Fever OP 973802 189 Backiyam 22/F Kerala Tachy INC No NEG NEG ______Fever OP 968506 190 Dharani priya 14/F Cbe Tachy INC No NEG NEG ______Fever OP 11258 191 Priyadharsini 6/Fch Cbe Tachy Normal No NEG NEG ______Paed OP 971542 192 Reyan 31/M Cbe Tachy INC No NEG NEG ______Med OP 971574 193 Mathumitha 6/Fch Cbe Normal Normal No NEG NEG ______Paed OP 15923 194 Suseela 46/F Cbe Tachy INC No NEG NEG ______FM2/M5 16051 195 Manju 16/F Cbe Tachy Normal No NEG NEG ______FM2/M5 978160 196 Shankar 34/M Tirupur Normal DEC yes POS NEG S S S ______Fever OP 978315 197 Karthick 21/M Cbe Normal Normal No NEG NEG ______Fever OP 978443 198 Annapoorani 30/F Cbe Normal INC No NEG NEG ______Med OP 979926 199 Manisekaran 44/M Cbe Tachy Normal No NEG NEG ______Med OP 980725 200 Kanagavalli 35/F Tirupur Brady DEC yes POS NEG S S S ______Fever OP 11289 201 Oviyasri 8/Fch Cbe Tachy Normal No NEG NEG ______PICU III 18120 202 Nishanth 4/Mch Cbe Tachy INC No NEG NEG ______PICU II 984384 203 Aiswarya 26/F Cbe Tachy Normal No NEG NEG ______Fever OP 981122 204 Ananda kumar 14/M Cbe Normal INC No NEG NEG ______Fever OP 985154 205 Nepoliyan 19/M Tirupur Tachy Normal No NEG NEG ______Fever OP 986915 206 Sanjaykumar 17/M Cbe Brady DEC yes POS NEG S S S ______Fever OP 986892 207 Suresh kumar 39/M Cbe Tachy INC No NEG NEG ______Fever OP 986953 208 Arun kumar 19/M Cbe Tachy Normal No NEG NEG ______Fever OP 987525 209 Thamarai 24/F Cbe Normal INC No NEG NEG ______Fever OP 989983 210 Srither 25/M Tirupur Tachy Normal No NEG NEG ______Fever OP 990548 211 Nehru 12/Mch Tirupur Tachy Normal No NEG NEG ______Fever OP 990570 212 Sivakumar 29/M Cbe Normal INC No NEG NEG ______Fever OP 20091 213 Imran 17/M Nilgiris Brady DEC yes POS NEG S S S ______Fever OP 997532 214 Murugan 35/M Cbe Tachy Normal No NEG NEG ______Fever OP 994424 215 Joseph 62/M Cbe Tachy INC No NEG NEG ______Fever OP 100680 216 Vijayakumar 26/M Cbe Brady Normal Yes POS NEG S S S ______Fever OP 994386 217 Jothimeena 22/F Cbe Normal INC No NEG NEG ______Fever OP 1008266 218 Ramya 20/F Cbe Tachy Normal No NEG NEG ______Fever OP 21179 219 Ramya 20/F Tirupur Normal INC No NEG NEG ______OG II 22681 220 Pugalandhi 10/Mch Cbe Normal Normal No NEG NEG ______PICU II

101063 221 Vasanthamani 39/F Cbe Tachy DEC No NEG NEG ______Fever OP

1014503 222 Mini 44/F Cbe Tachy INC No NEG NEG ______Fever OP

1020923 223 Pavithra 15/F Cbe Normal DEC No NEG NEG ______Fever OP

1025448 224 Mythili 27/F Tirupur Tachy Normal No NEG NEG ______Fever OP

102524 225 Sabarigirisan 16/M Cbe Tachy Normal No NEG NEG ______Fever OP 1023180 226 Ribana 13/Fch Cbe Tachy INC No NEG NEG ______Fever OP

1029110 227 Mathee 35/M Cbe Normal DEC yes POS NEG S S S ______Fever OP

23607 228 Ponmani 50/F Cbe Tachy INC No NEG NEG ______Fever OP

103835 229 Vaishnavi 24/F Cbe Normal Normal No NEG NEG ______Fever OP

104135 230 Amarnath 17/M Cbe Normal INC No NEG NEG ______Fever OP 1040621 231 Mallika 37/F Cbe Normal Normal No NEG NEG ______Fever OP

21025 232 Sakthimeena 12/Fch Cbe Tachy DEC No NEG NEG ______PICU I

307401 233 Nandhini 23/F Cbe Tachy Normal No NEG NEG ______Fever OP

309102 234 Poongodi 22/F Cbe Tachy DEC No NEG NEG ______FM2/M2 31128 235 Porkodi 7/Fch PICU II Cbe Tachy Normal No NEG NEG ______

1049580 Perambalu 236 Sivasakthi 24/M Normal DEC yes POS NEG S S S ______Fever OP r 29520 237 Dinesh kumar 32/M Cbe Normal Normal No NEG NEG ______MM2/M 31523 238 Nandhana 14/F Cbe Tachy INC No NEG NEG ______FM4/M3 31126 239 Niyasudeen 13/M Cbe Brady Normal No NEG NEG ______MM4/M 352912 240 Loganathan 55/M Cbe Tachy Normal No NEG NEG ______Fever OP 432812 241 Bhushan 17/M Cbe Brady DEC Yes POS NEG S S S ______Fever OP 989362 242 Saleem 37/M Cbe Normal Normal No NEG NEG ______Fever OP 37738 243 Kavitha 27/F Cbe Tachy INC No NEG NEG ______FM3/M2 37585 244 Kuppusamy 60/M Cbe Tachy DEC No NEG NEG ______MM2/M 38086 245 Mahesh kumar 35/M Cbe Normal INC No NEG NEG ______MM3/M 245038 246 Ramya 21/F Cbe Tachy DEC No NEG NEG ______Med OP

1074128 247 Senthil arumugam 25/M Cbe Tachy Normal Yes NEG NEG ______Fever OP

39536 248 Sarath kumar 19/M Cbe Tachy INC No NEG NEG ______MM2/M 1066947 249 Kavitha 24/F Cbe Tachy Normal No NEG NEG ______Fever OP 1021030 250 Krishnan 75/M Cbe Normal DEC No NEG NEG ______Fever OP

KEYWORDS TO MASTER CHART

M Male F Female Mch Male Child Fch Female Child Cbe Coimbatore MM Male Medical Ward OP Out Patient Department FM Female Medical Ward PICU Paediatric Intensive Care Unit Med OP Medicine OP IMCU Intensive Medical Care Unit LW Labour ward Tachy Tachycardia Brady Bradycardia INC Increased DEC Decreased POS Positive NEG Negative S Sensitive R Resistant I line drugs Amp Ampicillin C Chloramphenicol Cot Cotrimoxazole Fluoroquinolones Cip Ciprofloxacin PF Pefloxacin NA Nalidixic Acid Cephalosporins CTR Ceftriaxone CTX Cefotaxime