Concomitant Deletions of Tumor Suppressor Genes MEN1 and AIP Are Essential for the Pathogenesis of the Brown Fat Tumor Hibernoma

Total Page:16

File Type:pdf, Size:1020Kb

Concomitant Deletions of Tumor Suppressor Genes MEN1 and AIP Are Essential for the Pathogenesis of the Brown Fat Tumor Hibernoma Concomitant deletions of tumor suppressor genes MEN1 and AIP are essential for the pathogenesis of the brown fat tumor hibernoma Karolin H. Norda,1, Linda Magnussona, Margareth Isakssona, Jenny Nilssona, Henrik Lilljebjörna, Henryk A. Domanskib, Lars-Gunnar Kindblomc,d, Nils Mandahla, and Fredrik Mertensa aDepartment of Clinical Genetics, University and Regional Laboratories, Skåne University Hospital, Lund University, SE-221 85 Lund, Sweden; bDepartment of Pathology, University and Regional Laboratories, Skåne University Hospital, SE-221 85 Lund, Sweden; cDepartment of Musculoskeletal Pathology, Royal Orthopaedic Hospital National Health Service Foundation Trust, Birmingham B15 2TT, United Kingdom; and dDivision of Cancer Studies, Birmingham University, Birmingham B15 2TT, United Kingdom Edited* by Janet D. Rowley, University of Chicago, Chicago, IL, and approved October 26, 2010 (received for review September 10, 2010) Hibernomas are benign tumors with morphological features re- logical features are shown in Fig. S1). Chromosome banding had sembling brown fat. They consistently display cytogenetic rear- been performed in eight of the cases and rearrangement of 11q13, rangements, typically translocations, involving chromosome band or the neighboring 11q21 band, was found in all of them (Table S1). 11q13. Here we demonstrate that these aberrations are associated Genomic copy numbers were analyzed using SNP arrays and with concomitant deletions of AIP and MEN1, tumor suppressor deletions in 11q13 were detected in all but one of the 15 cases genes that are located 3 Mb apart and that underlie the hereditary (Table S2). Apart from these deletions, few or no other aberrations syndromes pituitary adenoma predisposition and multiple endo- were identified. One additional recurrent deletion was detected in crine neoplasia type I. MEN1 and AIP displayed a low expression in 14q11 in two cases, both of which presented translocations in- hibernomas whereas the expression of genes up-regulated in volving this chromosome band. Also included in the SNP analyses brown fat—PPARA, PPARG, PPARGC1A, and UCP1—was high. were normal blood DNA samples from four of the patients with Thus, loss of MEN1 and AIP is likely to be pathogenetically essen- hibernoma; none of them displayed the aberrations detected in the tial for hibernoma development. Simultaneous loss of two tumor corresponding tumor samples (Table S2). Deletions in 11q13 pri- MEDICAL SCIENCES suppressor genes has not previously been shown to result from marily clustered around the regions covering MEN1 and AIP (Fig. a neoplasia-associated translocation. Furthermore, in contrast to 1, Fig. S2,andTable S2). Losses of these genes were confirmed by the prevailing assumption that benign tumors harbor relatively multiplex ligation-dependent probe amplification (MLPA) analysis few genetic aberrations, the present analyses demonstrate that (Fig. S3). Using this technique, the tumor lacking alterations by a considerable number of chromosome breaks are involved in SNP array (case 2) also displayed loss of MEN1 and AIP. Fur- the pathogenesis of hibernoma. thermore, FISH analysis on metaphase spreads from short-term cultured tumor cells could be performed in five cases (cases 1, 3, 6, soft tissue tumor | lipoma | adipocytic tumor | adipose tissue | SNP array 7, and 15). This technique confirmed the SNP array findings for MEN1 in three cases and for AIP in two cases (Table 1 and Fig. 1). ibernoma is a benign neoplasm with morphological features In the remaining cases, the results from SNP array and FISH Hhighly similar to brown adipose tissue (BAT) (1). In contrast to analyses were discrepant. When SNP array data were interpreted as white adipose tissue (WAT), which stores energy, BAT enables showing hemizygous loss of the genes, FISH analysis displayed energy from oxidized lipids to dissipate as heat. This ability is de- homozygous deletion of AIP in three cases and of MEN1 in one pendent on the expression of uncoupling protein 1 (UCP1), a mi- case. This is likely explained by the fact that when tumor cells are tochondrial proton transporter that uncouples electron transport mixed with stromal cells FISH analysis is more accurate than from ATP production. Morphological similarities between BAT the corresponding SNP array. In case 7, homozygous deletion of MEN1 fi and hibernoma include a typical yellow to brown appearance par- was detected by SNP array but could not be con rmed by tially as a result of their rich vascularization (1). Microscopically, the FISH, as the homozygous deletion was too small to be detected BAT/hibernoma cells show a multivacuolated cytoplasm, numerous by the fosmid clone used for the FISH analyses. mitochondria, and a centrally located nucleus. Intermingled with To map further the deletions associated with translocations the brown fat cells of hibernoma are varying proportions of mature, affecting chromosome band 11q13 in hibernomas, FISH was A univacuolated white adipocytes with a peripherally located nucleus. performed in case 1 using 18 different fosmid clones (Fig. 2 ). The percentage of white adipocytes can be high and tumors with This analysis revealed complex translocation and deletion events only small clusters of brown fat are referred to as lipoma-like. To that could be explained only partly by the t(11;17;12)(q13;q12; avoid misdiagnosing hibernomas as ordinary lipomas or, more im- p13) detected at banding analysis. Both the der(12) and the der portantly, liposarcomas, clinical and morphological data can be (17) chromosomes displayed genetic material from band 11q13, complemented by cytogenetic analysis. The presence of trans- the der(11) chromosome had at least two interstitial deletions, locations affecting 11q13 with few or no other aberrations is a kar- yotypic signature of hibernoma. FISH analysis has indicated that these rearrangements are more complex than expected from the Author contributions: K.H.N., N.M., and F.M. designed research; K.H.N., L.M., M.I., J.N., H.L., and H.A.D. performed research; L.-G.K. contributed new reagents/analytic tools; karyotypes (2). Both hemi- and homozygous deletions have been K.H.N., L.M., M.I., J.N., H.L., H.A.D., and F.M. analyzed data; and K.H.N. and F.M. wrote described in the affected region, although so far without conclusive the paper. results regarding the target gene(s) (3). In the present study, we The authors declare no conflict of interest. wished to determine the genetic pathways associated with hiber- *This Direct Submission article had a prearranged editor. noma development. Data deposition: The data reported in this paper have been deposited in the Gene Expres- sion Omnibus (GEO) database, www.ncbi.nlm.nih.gov/geo (accession no. GSE19040). Results 1To whom correspondence should be addressed. E-mail: [email protected]. Fifteen hibernomas were available for genetic analyses (clinical This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. information is presented in Table S1 and representative morpho- 1073/pnas.1013512107/-/DCSupplemental. www.pnas.org/cgi/doi/10.1073/pnas.1013512107 PNAS Early Edition | 1of6 Downloaded by guest on September 24, 2021 Fig. 1. Genomic losses in hibernoma detected by SNP array and FISH analyses. (A) Global DNA copy numbers were evaluated by SNP array analysis and all cases with an aberrant SNP array profile displayed deletions in 11q13. In case 2, the genomic profile was normal. The vertical blue lines represent the MEN1 and AIP genes. Eight tumors showed homozygous deletion of MEN1 and three showed homozygous loss of AIP. The remaining cases demonstrated hemi- zygous deletion of MEN1 and all but one showed hemizygous loss of AIP. The genomic positions of all alterations are available in Table S2 and the aberrations affecting MEN1 and AIP are presented in detail in Fig. S2. Fluorescence in situ hybridization analysis with fosmid probes covering MEN1 and AIP was used to detect deletions in tumor cells, identified by rearrangements of chromosome 11. (B) As controls, signals from the probes were readily observed in normal cells from the same cases. (C) In case 1, homozygous loss of AIP and hemizygous deletion of MEN1 were detected, (D) case 3 showed homozygous loss of MEN1,(E) case 6 displayed homozygous deletions of both genes, (F) case 7 showed hemizygous deletion of MEN1 and homozygous loss of AIP, and (G) in case 15 both genes were homozygously deleted. The discrepancies between the SNP array and FISH analyses can be explained by differences in resolution of the tech- niques as well as normal cell contamination. and the karyotypically normal chromosome 11 was rearranged cases in which homozygous losses of MEN1 and/or AIP could not with loss of a segment greater than 3 Mb. Combined, the rear- be confirmed, the coding regions of the genes were sequenced rangements and deletions must have involved at least 11 different without detecting any mutations. chromosome breaks. Two of the breakpoints were cloned by using Transcriptional effects of the genomic losses were assessed in long-range PCR (Fig. 2B). One break was located in intron 1 of all but one of the hibernomas by using global gene expression MEN1 and the other was positioned 180 kb upstream of this gene. analysis. As references, 22 lipomas, three WAT, and two skeletal Thus, exon 1 of MEN1 was homozygously lost also in this case. In muscle (SM) samples were included. The expression of all genes summary, the whole or parts of MEN1 and AIP were homozy- located in the 3 Mb region in 11q13 to which the deletions clus- gously deleted in 10 and six of 15 cases, respectively. One case tered was extracted from the gene expression data set (Fig. 3A). showed normal copy number of AIP and in the remaining cases at This included 132 genes from NRXN2 in 11q13.1 to ALDH3B2 in least one of the alleles of both genes was deleted (Table 1). In all 11q13.2 (genomic position 64.13–67.20 Mb).
Recommended publications
  • Genetic Targeting of NRXN2 in Mice Unveils Role in Excitatory Cortical Synapse Function and Social Behaviors
    King’s Research Portal DOI: 10.3389/fnsyn.2015.00003 Document Version Publisher's PDF, also known as Version of record Link to publication record in King's Research Portal Citation for published version (APA): Born, G., Grayton, H. M., Langhorst, H., Dudanova, I., Rohlmann, A., Woodward, B. W., Collier, D. A., Fernandes, C., & Missler, M. (2015). Genetic targeting of NRXN2 in mice unveils role in excitatory cortical synapse function and social behaviors. Frontiers in Synaptic Neuroscience, 7(0), [3]. https://doi.org/10.3389/fnsyn.2015.00003 Citing this paper Please note that where the full-text provided on King's Research Portal is the Author Accepted Manuscript or Post-Print version this may differ from the final Published version. If citing, it is advised that you check and use the publisher's definitive version for pagination, volume/issue, and date of publication details. And where the final published version is provided on the Research Portal, if citing you are again advised to check the publisher's website for any subsequent corrections. General rights Copyright and moral rights for the publications made accessible in the Research Portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognize and abide by the legal requirements associated with these rights. •Users may download and print one copy of any publication from the Research Portal for the purpose of private study or research. •You may not further distribute the material or use it for any profit-making activity or commercial gain •You may freely distribute the URL identifying the publication in the Research Portal Take down policy If you believe that this document breaches copyright please contact [email protected] providing details, and we will remove access to the work immediately and investigate your claim.
    [Show full text]
  • P.1.H.029. Abnormality of Social Behavior and Dysfunction of Autism
    P.1.h.029. Abnormality of social behavior and dysfunction of autism related gene expression developing under chronic social defeat stress in male mice Kudryavtseva N.N., Kovalenko I.L., Smagin D.A., Galyamina A.G., Babenko V.N. Federal Research Center, Institute of Cytology and Genetics of SB RAS, Novosibirsk, Russia The ability of people to communicate with each other is a necessary component of social behavior and the normal development of individuals living in a community. An apparent decline in sociability may be the result of a negative social environment or the development of neurological disorders, including autistic spectrum disorders. The behavior of these humans may be characterized by the impairment of socialization, low communication, restricted and repetitive behaviors. This study aimed to analyze changes in the social behaviors induced by daily social defeat stress in male mice and to study the involvement of autism associated genes in the process of the deterioration of social behaviors. sensory contact agonistic interactions aggressive defeated mice Methods.The sensory contact model [1] was mice used to generate repeated experience of social defeats in male mice of C57BL/6J strain. After three days of sensory contact the partition is removed for 10 min to allow agonistic interactions between males. Undoubted superiority of one of the partners is evident The collected brain samples were sequenced at JSC Genoanalytica (www.genoanalytica.ru, within 2-3 daily social encounters with the same Moscow, Russia), where the mRNA was extracted using the Dynabeads mRNA Purification Kit (Ambion, USA). cDNA libraries were constructed using NEBNext mRNA Library PrepReagent Set opponent.
    [Show full text]
  • Neurexin II Alpha (NRXN2) (NM 015080) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC219788 Neurexin II alpha (NRXN2) (NM_015080) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Neurexin II alpha (NRXN2) (NM_015080) Human Tagged ORF Clone Tag: Myc-DDK Symbol: NRXN2 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RC219788 representing NM_015080 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCGTCCGGGAGCCGGTGGCGGCCGACACCGCCGCCGCTGCTGTTGCTGCTGCTGCTGGCGCTGGCGG CGCGCGCGGACGGCCTGGAGTTCGGCGGCGGCCCCGGGCAGTGGGCTCGCTACGCGCGCTGGGCGGGCGC GGCGAGCAGCGGCGAGCTCAGCTTCAGCCTGCGCACCAACGCCACGCGCGCGCTGCTGCTCTACCTGGAC GACGGCGGCGACTGCGACTTCCTGGAGCTGCTGCTGGTGGACGGCCGCCTGCGGCTGCGCTTCACGCTTT CGTGCGCCGAGCCGGCCACGCTGCAGCTGGACACGCCGGTGGCCGACGACCGCTGGCACATGGTGCTGCT GACCCGCGACGCGCGCCGCACGGCGCTGGCGGTGGACGGCGAGGCCCGCGCCGCCGAGGTGCGCTCCAAG CGGCGCGAGATGCAGGTGGCCAGCGACCTGTTCGTGGGCGGCATCCCGCCCGACGTGCGCCTCTCGGCGC TTACGCTGAGCACCGTCAAGTACGAGCCGCCCTTCCGCGGCCTCTTGGCCAACCTGAAGCTGGGCGAGCG GCCCCCCGCGCTGCTGGGCAGCCAGGGCCTGCGCGGCGCCACCGCCGACCCGCTGTGCGCGCCCGCGCGC AACCCCTGCGCCAACGGCGGCCTCTGCACCGTGCTGGCCCCCGGCGAGGTGGGCTGCGACTGCAGCCACA CGGGCTTCGGCGGCAAGTTCTGCAGCGAAGAGGAGCACCCCATGGAAGGTCCGGCTCACCTGACGTTAAA CAGCGAAGTAGGGTCCTTACTGTTCTCCGAGGGGGGGGCCGGGAGAGGAGGAGCCGGCGATGTGCACCAG CCAACAAAAGGCAAGGAGGAGTTTGTGGCGACCTTCAAAGGCAATGAGTTCTTCTGCTACGACCTGTCAC
    [Show full text]
  • Deletion of Α-Neurexin II Results in Autism-Related
    OPEN Citation: Transl Psychiatry (2014) 4, e484; doi:10.1038/tp.2014.123 www.nature.com/tp ORIGINAL ARTICLE Deletion of α-neurexin II results in autism-related behaviors in mice J Dachtler1, J Glasper2, RN Cohen1, JL Ivorra1, DJ Swiffen1, AJ Jackson1, MK Harte2, RJ Rodgers3 and SJ Clapcote1 Autism is a common and frequently disabling neurodevelopmental disorder with a strong genetic basis. Human genetic studies have discovered mutations disrupting exons of the NRXN2 gene, which encodes the synaptic adhesion protein α-neurexin II (Nrxn2α), in two unrelated individuals with autism, but a causal link between NRXN2 and the disorder remains unclear. To begin to test the hypothesis that Nrxn2α deficiency contributes to the symptoms of autism, we employed Nrxn2α knockout (KO) mice that genetically model Nrxn2α deficiency in vivo. We report that Nrxn2α KO mice displayed deficits in sociability and social memory when exposed to novel conspecifics. In tests of exploratory activity, Nrxn2α KO mice displayed an anxiety-like phenotype in comparison with wild-type littermates, with thigmotaxis in an open field, less time spent in the open arms of an elevated plus maze, more time spent in the enclosure of an emergence test and less time spent exploring novel objects. However, Nrxn2α KO mice did not exhibit any obvious changes in prepulse inhibition or in passive avoidance learning. Real-time PCR analysis of the frontal cortex and hippocampus revealed significant decreases in the mRNA levels of genes encoding proteins involved in both excitatory and inhibitory transmission. Quantification of protein expression revealed that Munc18-1, encoded by Stxbp1, was significantly decreased in the hippocampus of Nrxn2α KO mice, which is suggestive of deficiencies in presynaptic vesicular release.
    [Show full text]
  • Structures of Neurexophilin–Neurexin Complexes Reveal a Regulatory Mechanism of Alternative Splicing
    Article Structures of neurexophilin–neurexin complexes reveal a regulatory mechanism of alternative splicing Steven C Wilson1 , K Ian White1 , Qiangjun Zhou1, Richard A Pfuetzner1, Ucheor B Choi1, Thomas C Südhof1,2 & Axel T Brunger1,2,* Abstract Neurexins (Nrxns) are a family of presynaptic cell-adhesion mole- cules that are important for specifying the functional properties of Neurexins are presynaptic, cell-adhesion molecules that specify synapses (Su¨dhof, 2017). Through their interactions with various the functional properties of synapses via interactions with trans- binding partners, neurexins constitute part of a molecular code and synaptic ligands. Neurexins are extensively alternatively spliced at act as hub molecules to organize and regulate synaptic function six canonical sites that regulate multifarious ligand interactions, (Su¨dhof, 2017). but the structural mechanisms underlying alternative splicing- Neurexins are encoded by three genes (Nrxn1–3 in mice), each dependent neurexin regulation are largely unknown. Here, we of which contains multiple promoters to drive expression of determined high-resolution structures of the complex of neurex- Nrxn1a–3a, Nrxn1b–3b, and Nrxn1c. The extracellular sequences of ophilin-1 and the second laminin/neurexin/sex-hormone-binding a-neurexins contain six LNS domains (LNS1–LNS6) interspersed globulin domain (LNS2) of neurexin-1 and examined how alterna- with epidermal growth factor-like domains (EGFA–EGFC), followed tive splicing at splice site #2 (SS2) regulates the complex. Our data by a cysteine loop and a highly glycosylated stalk region (Fig 1A). reveal a unique, extensive, neurexophilin–neurexin binding inter- The b-neurexins include only the C-terminal region of a-neurexins face that extends the jelly-roll b-sandwich of LNS2 of neurexin-1 from the LNS6 domain onward.
    [Show full text]
  • Autism-Associated Mir-873 Regulates ARID1B, SHANK3 and NRXN2
    Lu et al. Translational Psychiatry (2020) 10:418 https://doi.org/10.1038/s41398-020-01106-8 Translational Psychiatry ARTICLE Open Access Autism-associated miR-873 regulates ARID1B, SHANK3 and NRXN2 involved in neurodevelopment Jing Lu 1, Yan Zhu 1, Sarah Williams2, Michelle Watts 3,MaryA.Tonta1, Harold A. Coleman1, Helena C. Parkington1 and Charles Claudianos 1,4 Abstract Autism spectrum disorders (ASD) are highly heritable neurodevelopmental disorders with significant genetic heterogeneity. Noncoding microRNAs (miRNAs) are recognised as playing key roles in development of ASD albeit the function of these regulatory genes remains unclear. We previously conducted whole-exome sequencing of Australian families with ASD and identified four novel single nucleotide variations in mature miRNA sequences. A pull-down transcriptome analysis using transfected SH-SY5Y cells proposed a mechanistic model to examine changes in binding affinity associated with a unique mutation found in the conserved ‘seed’ region of miR-873-5p (rs777143952: T > A). Results suggested several ASD-risk genes were differentially targeted by wild-type and mutant miR-873 variants. In the current study, a dual-luciferase reporter assay confirmed miR-873 variants have a 20-30% inhibition/dysregulation effect on candidate autism risk genes ARID1B, SHANK3 and NRXN2 and also confirmed the affected expression with qPCR. In vitro mouse hippocampal neurons transfected with mutant miR-873 showed less morphological complexity and enhanced sodium currents and excitatory neurotransmission compared to cells transfected with wild-type miR- 873. A second in vitro study showed CRISPR/Cas9 miR-873 disrupted SH-SY5Y neuroblastoma cells acquired a neuronal-like morphology and increased expression of ASD important genes ARID1B, SHANK3, ADNP2, ANK2 and CHD8.
    [Show full text]
  • Deciphering the Molecular Profile of Plaques, Memory Decline And
    ORIGINAL RESEARCH ARTICLE published: 16 April 2014 AGING NEUROSCIENCE doi: 10.3389/fnagi.2014.00075 Deciphering the molecular profile of plaques, memory decline and neuron loss in two mouse models for Alzheimer’s disease by deep sequencing Yvonne Bouter 1†,Tim Kacprowski 2,3†, Robert Weissmann4, Katharina Dietrich1, Henning Borgers 1, Andreas Brauß1, Christian Sperling 4, Oliver Wirths 1, Mario Albrecht 2,5, Lars R. Jensen4, Andreas W. Kuss 4* andThomas A. Bayer 1* 1 Division of Molecular Psychiatry, Georg-August-University Goettingen, University Medicine Goettingen, Goettingen, Germany 2 Department of Bioinformatics, Institute of Biometrics and Medical Informatics, University Medicine Greifswald, Greifswald, Germany 3 Department of Functional Genomics, Interfaculty Institute for Genetics and Functional Genomics, University Medicine Greifswald, Greifswald, Germany 4 Human Molecular Genetics, Department for Human Genetics of the Institute for Genetics and Functional Genomics, Institute for Human Genetics, University Medicine Greifswald, Ernst-Moritz-Arndt University Greifswald, Greifswald, Germany 5 Institute for Knowledge Discovery, Graz University of Technology, Graz, Austria Edited by: One of the central research questions on the etiology of Alzheimer’s disease (AD) is the Isidro Ferrer, University of Barcelona, elucidation of the molecular signatures triggered by the amyloid cascade of pathological Spain events. Next-generation sequencing allows the identification of genes involved in disease Reviewed by: Isidro Ferrer, University of Barcelona, processes in an unbiased manner. We have combined this technique with the analysis of Spain two AD mouse models: (1) The 5XFAD model develops early plaque formation, intraneu- Dietmar R. Thal, University of Ulm, ronal Ab aggregation, neuron loss, and behavioral deficits. (2)TheTg4–42 model expresses Germany N-truncated Ab4–42 and develops neuron loss and behavioral deficits albeit without plaque *Correspondence: formation.
    [Show full text]
  • Mycobacterium Tuberculosis-Induced Maternal Immune Activation Promotes Autism-Like Phenotype in Infected Mice Offspring
    International Journal of Environmental Research and Public Health Article Mycobacterium tuberculosis-Induced Maternal Immune Activation Promotes Autism-Like Phenotype in Infected Mice Offspring Wadzanai Manjeese 1 , Nontobeko E. Mvubu 2 , Adrie J. C. Steyn 2,3,4 and Thabisile Mpofana 1,* 1 Department of Human Physiology, School of Laboratory Medicine and Medical Sciences, College of Health Sciences, University of KwaZulu Natal, Durban 4001, South Africa; [email protected] 2 Discipline of Microbiology, School of Life Sciences, College of Agriculture, Engineering and Science, University of KwaZulu Natal, Durban 4001, South Africa; [email protected] (N.E.M.); [email protected] (A.J.C.S.) 3 Africa Health Research Institute, K-Rith Tower Building, Nelson Mandela School of Medicine, Durban 4001, South Africa 4 Department of Microbiology, University of Alabama, Birmingham, AL 35294, USA * Correspondence: [email protected] Abstract: The maternal system’s exposure to pathogens during pregnancy influences fetal brain development causing a persistent inflammation characterized by elevated pro-inflammatory cytokine levels in offspring. Mycobacterium tuberculosis (Mtb) is a global pathogen that causes tuberculosis, a pandemic responsible for health and economic burdens. Although it is known that maternal Citation: Manjeese, W.; Mvubu, N.E.; infections increase the risk of autism spectrum disorder (ASD), it is not known whether Mtb infection Steyn, A.J.C.; Mpofana, T. is sufficient to induce ASD associated behaviors, immune dysregulation and altered expression Mycobacterium tuberculosis-Induced of synaptic regulatory genes. The current study infected pregnant Balb/c mice with Mtb H37Rv Maternal Immune Activation and valproic acid (VPA) individually and in combination. Plasma cytokine profiles were measured Promotes Autism-Like Phenotype in Infected Mice Offspring.
    [Show full text]
  • Neurexin II Alpha (NRXN2) (NM 138732) Human Untagged Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC306070 Neurexin II alpha (NRXN2) (NM_138732) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: Neurexin II alpha (NRXN2) (NM_138732) Human Untagged Clone Tag: Tag Free Symbol: NRXN2 Vector: pCMV6 series Fully Sequenced ORF: >NCBI ORF sequence for NM_138732, the custom clone sequence may differ by one or more nucleotides ATGGCGTCCGGGAGCCGGTGGCGGCCGACACCGCCGCCGCTGCTGTTGCTGCTGCTGCTG GCGCTGGCGGCGCGCGCGGACGGCCTGGAGTTCGGCGGCGGCCCCGGGCAGTGGGCTCGC TACGCGCGCTGGGCGGGCGCGGCGAGCAGCGGCGAGCTCAGCTTCAGCCTGCGCACCAAC GCCACGCGCGCGCTGCTGCTCTACCTGGACGACGGCGGCGACTGCGACTTCCTGGAGCTG CTGCTGGTGGACGGCCGCCTGCGGCTGCGCTTCACGCTTTCGTGCGCCGAGCCGGCCACG CTGCAGCTGGACACGCCGGTGGCCGACGACCGCTGGCACATGGTGCTGCTGACCCGCGAC GCGCGCCGCACGGCGCTGGCGGTGGACGGCGAGGCCCGCGCCGCCGAGGTGCGCTCCAAG CGGCGCGAGATGCAGGTGGCCAGCGACCTGTTCGTGGGCGGCATCCCGCCCGACGTGCGC CTCTCGGCGCTTACGCTGAGCACCGTCAAGTACGAGCCGCCCTTCCGCGGCCTCTTGGCC AACCTGAAGCTGGGCGAGCGGCCCCCCGCGCTGCTGGGCAGCCAGGGCCTGCGCGGCGCC ACCGCCGACCCGCTGTGCGCGCCCGCGCGCAACCCCTGCGCCAACGGCGGCCTCTGCACC GTGCTGGCCCCCGGCGAGGTGGGCTGCGACTGCAGCCACACGGGCTTCGGCGGCAAGTTC TGCAGCGAAGAGGAGCACCCCATGGAAGGTCCGGCTCACCTGACGTTAAACAGCGAAGGC AAGGAGGAGTTTGTGGCGACCTTCAAAGGCAATGAGTTCTTCTGCTACGACCTGTCACAC AACCCCATCCAGAGCAGCACTGATGAGATCACACTGGCCTTCCGCACCCTGCAACGCAAC GGCCTGATGCTGCATACAGGCAAGTCGGCCGACTACGTCAACCTGTCCCTCAAGTCTGGG GCTGTCTGGCTGGTCATCAACCTAGGCTCAGGTGCCTTCGAGGCCCTTGTGGAACCCGTC
    [Show full text]
  • Cartography of Neurexin Alternative Splicing Mapped by Single
    Cartography of neurexin alternative splicing mapped PNAS PLUS by single-molecule long-read mRNA sequencing Barbara Treutleina,b,1, Ozgun Gokcec,1, Stephen R. Quakea,b,d,2, and Thomas C. Südhofc,d,2 Departments of aBioengineering and cMolecular and Cellular Physiology, School of Medicine, bDepartment of Applied Physics, and dHoward Hughes Medical Institute, Stanford University, Stanford, CA 94305 Contributed by Thomas C. Südhof, February 24, 2014 (sent for review January 24, 2014) Neurexins are evolutionarily conserved presynaptic cell-adhesion α-andβ-neurexins contain different extracellular sequences molecules that are essential for normal synapse formation and but identical transmembrane regions and short cytoplasmic tails. synaptic transmission. Indirect evidence has indicated that exten- Specifically, the extracellular sequences of α-neurexins are sive alternative splicing of neurexin mRNAs may produce hundreds composed of six LNS (laminin-α, neurexin, sex hormone-binding if not thousands of neurexin isoforms, but no direct evidence for globulin) domains with three interspersed EGF-like repeats such diversity has been available. Here we use unbiased long-read followed by an O-linked sugar attachment sequence and a con- sequencing of full-length neurexin (Nrxn)1α, Nrxn1β,Nrxn2β, served cysteine loop sequence (8, 15). In contrast, the extracel- Nrxn3α, and Nrxn3β mRNAs to systematically assess how many lular sequences of β-neurexins comprise a short β-neurexin– sites of alternative splicing are used in neurexins with a significant specific sequence, and then splice into the sixth LNS domain of frequency, and whether alternative splicing events at these sites α-neurexins, from which point on β-neurexins are identical to are independent of each other.
    [Show full text]
  • An Integrative Analysis of Non-Coding Regulatory DNA Variations Associated with Autism Spectrum Disorder
    Molecular Psychiatry (2019) 24:1707–1719 https://doi.org/10.1038/s41380-018-0049-x ARTICLE An integrative analysis of non-coding regulatory DNA variations associated with autism spectrum disorder 1,2 2,3,4 2 2 1 Sarah M. Williams ● Joon Yong An ● Janette Edson ● Michelle Watts ● Valentine Murigneux ● 5,6 7 8 1 Andrew J. O. Whitehouse ● Colin J. Jackson ● Mark A. Bellgrove ● Alexandre S. Cristino ● Charles Claudianos 2,9 Received: 15 October 2016 / Revised: 16 January 2018 / Accepted: 19 February 2018 / Published online: 27 April 2018 © The Author(s) 2018. This article is published with open access Abstract A number of genetic studies have identified rare protein-coding DNA variations associated with autism spectrum disorder (ASD), a neurodevelopmental disorder with significant genetic etiology and heterogeneity. In contrast, the contributions of functional, regulatory genetic variations that occur in the extensive non-protein-coding regions of the genome remain poorly understood. Here we developed a genome-wide analysis to identify the rare single nucleotide variants (SNVs) that occur in non-coding regions and determined the regulatory function and evolutionary conservation of these variants. Using publicly fi 1234567890();,: 1234567890();,: available datasets and computational predictions, we identi ed SNVs within putative regulatory regions in promoters, transcription factor binding sites, and microRNA genes and their target sites. Overall, we found that the regulatory variants in ASD cases were enriched in ASD-risk genes and genes involved in fetal neurodevelopment. As with previously reported coding mutations, we found an enrichment of the regulatory variants associated with dysregulation of neurodevelopmental and synaptic signaling pathways.
    [Show full text]
  • 1 a Novel Function for Neurexin and Neuroligin
    A NOVEL FUNCTION FOR NEUREXIN AND NEUROLIGIN FAMILY MEMBERS IN PROMOTING NEURITE OUTGROWTH Dana A. Murchison Department of Neurology and Neurosurgery McGill University, Montreal August, 2009 A thesis submitted in partial fulfillment of the requirements of a Master’s degree © Dana A. Murchison, 2009 1 Library and Archives Bibliothèque et Canada Archives Canada Published Heritage Direction du Branch Patrimoine de l’édition 395 Wellington Street 395, rue Wellington Ottawa ON K1A 0N4 Ottawa ON K1A 0N4 Canada Canada Your file Votre référence ISBN: 978-0-494-66171-0 Our file Notre référence ISBN: 978-0-494-66171-0 NOTICE: AVIS: The author has granted a non- L’auteur a accordé une licence non exclusive exclusive license allowing Library and permettant à la Bibliothèque et Archives Archives Canada to reproduce, Canada de reproduire, publier, archiver, publish, archive, preserve, conserve, sauvegarder, conserver, transmettre au public communicate to the public by par télécommunication ou par l’Internet, prêter, telecommunication or on the Internet, distribuer et vendre des thèses partout dans le loan, distribute and sell theses monde, à des fins commerciales ou autres, sur worldwide, for commercial or non- support microforme, papier, électronique et/ou commercial purposes, in microform, autres formats. paper, electronic and/or any other formats. The author retains copyright L’auteur conserve la propriété du droit d’auteur ownership and moral rights in this et des droits moraux qui protège cette thèse. Ni thesis. Neither the thesis nor la thèse ni des extraits substantiels de celle-ci substantial extracts from it may be ne doivent être imprimés ou autrement printed or otherwise reproduced reproduits sans son autorisation.
    [Show full text]