A MORPHOLOGICAL AND MOLECULAR APPROACH TO THE STUDY OF
PLANKTONIC PROTIST PHYLOGENETICS WITH A FOCUS ON TAXA FROM
OLD WOMAN CREEK NATIONAL ESTUARINE RESEARCH RESERVE
A Thesis
Presented to
The Graduate Faculty of The University of Akron
In Partial Fulfillment
of the Requirements for the Degree
Master of Science
Hope Ball
May, 2006 A MORPHOLOGICAL AND MOLECULAR APPROACH TO THE STUDY OF
PLANKTONIC PROTIST PHYLOGENETICS WITH A FOCUS ON TAXA FROM
OLD WOMAN CREEK NATIONAL ESTUARINE RESEARCH RESERVE
Hope Ball
Thesis
Approved: Accepted:
______Advisor Dean of the College Dr. Robert Joel Duff Dr. Ronald F. Levant
______Committee Member Dean of the Graduate School Dr. Peter Lavrentyev Dr. George R. Newkome
______Committee Member Date Dr. Donald Ott
______Interim Department Chair Dr. Richard Londraville
ii
ABSTRACT
Planktonic protists play a vital role in many aspects of the Microbial Food Web including nutrient cycling, grazing controls and primary and secondary production in a variety of different systems including both salt and freshwater. Despite the importance of these organisms, few morphological and molecular studies have been conducted. This study provides both morphological characterization and complete 18S rDNA sequences for a number of single cell isolates of important planktonic protist taxa.
Single cell isolates of ten commonly encountered taxa were captured manually using micropipettes. DNA extraction, PCRs, cloning and sequence reactions were performed on these samples in order to obtain complete 18S rDNA sequences. The completed sequences were then manually aligned with existing 18S GenBank sequences of the same or related taxa. Phylogenetic analyses were performed on these alignments to assess the relationships of these sequences to other previously collected samples.
Typically, the results of the analyses performed in this study supported the taxonomic relationships observed on GenBank.
An analysis of community structure was performed at three of the primary collecting sites at Old Woman Creek National Estuarine Reserve in Huron, Ohio. At least 100 partial 18S sequences were acquired for each sampling location. These sequences were used to explore the community diversity and structure at each site as well
iii as for the Old Woman Creek watershed itself. Sequences for common taxa identified
from each site were aligned with other related sequences from GenBank. Each of the
sampling sites was located at a unique position of the estuary. The diversity of 18S
sequences observed from each site was generally reflective of those unique habitat types.
The study involved the use of both molecular and morphological techniques to provide correct identification for the species examined. Currently, data available for many abundant planktonic taxa lack combined morphological and molecular information.
This study aimed to draw on both detailed morphological and molecular data for species
identification and community structure analysis.
iv DEDICATION
For my parents: Mary Jo and Lawrence Ball. Thank you for always being there. Your love, never ending support, confidence and advice mean the world to me.
v ACKNOWLEDGMENTS
I would like to express my gratitude to the members of my committee, Dr. Joel
Duff, Dr. Peter Lavrentyev and Dr. Donald Ott. Thank you for giving me the opportunity to work on this project with you and for your continued guidance, advice, support and patience throughout the process.
Also, I would also like to thank my lab co-workers Traci Branch, Laurie Kay,
Chiara Benvenuto, Kristin Green and Ken Moats who offered support and advice and helped with the data acquisition.
vi
TABLE OF CONTENTS
Page
LIST OF TABLES ...... ix
LIST OF FIGURES ...... x
CHAPTER
I. INTRODUCTION...... 1
Current Taxonomic Relationships Among Planktonic Eukaryotes ...... 4
Importance of Proposed Research ...... 7
II. MATERIALS AND METHODS...... 10
Sampling Sites...... 10
Sampling Techniques...... 11
Sequence Analysis ...... 12
Single Cell Sample Treatment ...... 15
Morphology...... 18
III. PROTIST COMMUNITY STRUCTURE RESULTS AND DISUCUSSION...... 21
Individual Site Discussion of Community Structure ...... 22
Combined Site Discussion of Community Structure ...... 26
Total Community Analysis of Sequences from Five Selected Taxa ...... 27
IV. SINGLE CELL CHARACTERIZATION RESULTS AND DISCUSSION ...... 38
Morphological Analysis of Single Cell Isolates ...... 42
vii Description and Phylogenies of Single Cell Isolates ...... 42
V. SUMMARY...... 73
Community Studies...... 73
Single Cell analyses...... 75
REFERENCES ...... 77
viii
LIST OF TABLES
Table Page
1 Primers Applied in Single Cell 18S Acquisition ...... 18
2 GenBank Accession and Collection Data, Where Available, for Samples Included in Strobilidium sp. Total Sequence Alignments...... 28
3 GenBank Accession and Collection Data, Where Available, for Samples Included in Strombidium sp. Total Sequence Alignments...... 30
4 GenBank Accession and Collection Data, Where Available, for Samples Included in Cryptomonas sp. Total Sequence Alignments...... 32
5 GenBank Accession and Collection Data, Where Available, for Sample Included in Chlamydomonas sp. Total Sequence Alignments...... 34
6 GenBank Accession and Collection Data, Where Available, for Samples Included in Rotifer Total Sequence Alignments...... 36
7 OWC Sampling Information……………………………………………..39
ix
LIST OF FIGURES
Figure Page
1 Map of Old Woman Creek Sampling Locations...... 11
2 Schematic for DNA Extraction Used for SSU Molecular Identification of Individual Protists……………………………...... 17
3 Comparison of Community Composition from Site 1 Based on 18S Sequence BLAST Searches Grouped into Major Categories as Defined in the Text...... 23
4 Comparison of Community Composition from Site 3 Based on 18S Sequence BLAST Searches Grouped into Major Categories as Defined in the Text...... 24
5 Comparison of Community Composition from Site 4 Based on 18S Sequence BLAST Searches Grouped into Major Categories as Defined in the Text...... 25
6 Comparison of Community Composition from All Three Sites Based on 18S Sequence BLAST Searches Grouped into Major Categories as Defined in the Text...... 27
7 Phylogram Resulting from a Distance Analysis of Strobilidium sp. Sequences...... 29
8 Figure 8: Phylogram Resulting from a Distance Analysis of Strombidium sp. Sequences...... 31
9 Phylogram Resulting from a Distance Analysis of Cryptomonas sp. Sequences...... 33
10 Figure 10: Phylogram Resulting from a Distance Analysis of Chlamydomonas sp. Sequences……………………………………...... 35
11 Phylogram Resulting from a Distance Analysis of Rotifer Sequences………………………………………………………………..37
x 12 Photograph of Lugol Preserved Dileptus sp. ….……….………………..44
13 Phylogeny for Dileptus sp. Based on a Maximum Parsimony Analysis. C.I. = 0.9160, Number of Shortest Trees = 1, Total Length = 250……………………………………………………….…….46
14 Photograph of Protargol stained Codonella sp…………….…………….47
15 Phylogeny for Codonella sp. Based on a Maximum Parsimony Analysis. C.I. = 0.8246, Number of Shortest Trees = 1, Total Length = 268……..………………………………………..…………….48
16 Photograph of Protargol stained Synura sp...... 50
17 Phylogeny for Synura sp. Based on a Maximum Parsimony Analysis. C.I. = 0.7785, Number of Shortest Trees = 2, Total Length = 325…………………………………..……………………..…..51
18 Photograph of Lugol Preserved Monodinium sp..…….…..……………..53
19 Phylogeny of Monodinium sp. Based on Maximum Parsimony Analysis. C.I. = 0.8833, Number of Shortest Trees = 1, Total Length = 317……..……….………..…………………………………….54
20 Photograph of Lugol Preserved Coleps sp…………………………….....56
21 Phylogeny of Coleps sp. Based on a Maximum Parsimony Analysis. C.I. = 0.8413, Number of Shortest Trees = 1, Total Length = 630…………………………………….……..………………...57
22 Photograph of Protargol stained Strombidium sp…………………..…….59
23 Phylogeny of Strombidium sp. Based on a Maximum Parsimony Analysis. C.I. = 0.8393, Number of Shortest Trees =4, Total Length =448…...…………………………………………………..….….60
24 Photograph of Lugol Preserved Tintinnopsis sp……….………………...61
25 Phylogeny of Tintinnopsis sp. Based on a Maximum Parsimony Analysis. C.I. = 0.8289, Number of Shortest Trees = 1, Total Length = 304…...…………………………………………………..….....62
26 Photograph of Protargol stained Peridinium sp………………….………63
xi 27 Phylogeny of Peridinium sp. Based on a Maximum Parsimony Analysis. C.I. = 0.8356, Number of Shortest Trees = 1, Total Length = 432…...... …..…………………………………………………..65
28 Photograph of Protarol stained Ceratium sp……………………....….….67
29 Phylogeny of Ceratium sp. Based on a Maximum Parsimony Analysis. C.I. = 0.7204, Number of Shortest Trees = 1, Total Length = 1080…....……………..………………………………………..68
30 Photograph of live Vorticella sp…………….…………………………...70
31 Phylogeny of Vorticella sp. Based on a Maximum Parsimony Analysis. C.I.= 0.8055, Number of Shortest Trees = 2, Total Length = 401….……………………………………………...………...... 71
xii
CHAPTER 1
INTRODUCTION
Planktonic protists, eukaryotic organisms which include flagellate and ciliate
species, contribute greatly to aspects of the Microbial Food Web (MFW) such as nutrient
cycling, grazing controls and primary and secondary production, despite their diminutive
size (Belykh et al., 2000; Caroppo, 2000; Jurgens and Jeppesen, 2000; Kuipers et al.,
2003; Lynn, 1996; Modenutti et al., 2003; Savin et al., 2004; Sommer et al., 2002 and
Zeidner et al., 2003). Species at a variety of levels in the MFW may be heterotrophic or
autotrophic feeders or feed using a tactic called mixotrophy, which combines the tactics
of photosynthetic food acquisition and phagotrophy (Hammer and Pitchford, 2005). The
prey selection of many ciliate species is held in check by morphological restraints, such
as the size of their oral structures (Fenchel, 1987). This has been referred to as the size-
differential grazing concept (Kuipers et al., 2003)
Over time, several techniques for identifying and studying eukaryotic plankton have become traditional methods still in use today. One method is the use of light
microscopy. In use since the “Age of Discovery” almost 200 years ago (Corliss, 1974),
light microscopy is considered a vital technique for identification purposes and is still
applied today in studies worldwide (Belykh et al., 2000; Kuipers et al., 2003; Modenutti
1 et al., 2003 and Szelag-Wasielewska, 2003). A second important technique employing
fluorescent tagging is epifluorescent microscopy (Belykh et al., 2000, and Modenutti et al., 2003). A third technique developed is flow-through cytometry and it has been useful in increasing the ease of organism counts (Kuipers et al., 2003). A final technique traditionally used in morphological studies is electron microscopy. Both scanning electron microscopy, which focuses on external morphology, and transmission electron microscopy, applied to thinly sliced samples for studies of internal morphology, techniques have been employed in work with these organisms (Corliss, 1974; Belykh et al., 2000).
Molecular tools have been becoming increasingly useful in the process of identification and classification of many species. A few studies have been conducted on freshwater picoplankton species looking at rDNA sequences (Belykh et al., 2000 and
Miao et al., 2001). Also, an rDNA study by Hewitt et al. (2003) performed a molecular analysis of specimens from available cultures. Several studies have recently attempted to use molecular techniques to answer existing questions regarding ciliate taxonomy
(Baroin-Tourancheau et al., 1992, Greenwood et al., 1991, Hammerschmidt et al., 1996,
Hirt et al., 1995, Lynn et al., 1999, Miao et al., 2001, Petroni et al., 2002, Schlegel et al.,
1991, Stechmann et al., 1998 and Struder-Kypke and Lynn, 2003, and Wright and Lynn,
1997). Marine organisms have also been studied using rDNA techniques (Yuan et al.,
2004). Other marine studies have focused on the psbA gene and DGGE, or denaturing
gradient gel electrophoresis, techniques (Zeidner and Beja, 2004 and Zeidner et al.,
2003). To date, no large and comprehensive freshwater study has yet been undertaken.
2
As in all techniques, problems may arise. Morphological techniques can face challenges when no unique morphological trait can be found that could be used in identification or classification. The techniques used in identification themselves may also pose problems. These methods may have a bias towards the species that respond best to the procedure. Also, if a species is present in a habitat in very low numbers, the chance that that species shall be found in a laboratory sample is slim. In that case, the species may simply be overlooked. Molecular methods, also, are not without problems.
Problems involving the quality of the original samples used in the preparations, which may include contamination by other taxa, can have a profound effect on the end results.
Also, not all organisms are easily preserved for later study, which might result in DNA degradation. As with morphological techniques, molecular methodologies may also be biased towards species which respond best to the particular extraction method employed.
Likewise, DNA of one species may amplify more easily than others because of the specific primers used, which may lead to questions regarding the specificity of techniques
(Bowers et al., 2000).
Currently, a large number of sequences are available from on-line website sources such as GenBank. One problem with the majority of these sequences is that they come from organisms that were never identified to the species level during or prior to the acquisition of the sequences (Saldarriaga et al. 2004). If these eukaryotic plankton species are to be properly identified and classified, a comprehensive morphological and molecular study of these organisms must be undertaken. Despite the importance of these
3 organisms, few morphological and molecular studies have been conducted. To date,
most studies of community structure involving molecular techniques have focused
primarily on specific bacterial groups or less often some non-lucustrine eukaryotic species. A second problem regarding on-line sequence data is that many organisms lack sequences altogether or that the existing sequences represent only a few select genes.
This fact has been discussed in several papers published recently that dealt with ciliate taxonomy (Miao et al., 2001 and Struder-Kypke and Lynn, 2003). A comprehensive study of plankton taxa morphology and molecular sequencing is vital to our comprehension of the organisms.
Current Taxonomic Relationships Among Planktonic Eukaryotes
Taxonomy studies of eukaryotic groups often referred to as protists have been conducted in order to assess the relationship among the various groups. Traditionally, these studies have been based upon morphological characters. A few examples of characteristic morphological features include the following: existence of flagella or cilia, the shape of mitochondrial cristae, mitotic spindle behavior, presence of organelles and number, length and structure of the basal bodies (Patterson, 1999).
Several studies have concluded that the protists are thought to be a monophyletic group (Patterson, 1999 and Greenwood et al., 1991). Experiments have been conducted using molecular sequence data to attempt to resolve the question of ciliate sister groups
(Hammerschmidt et al., 1996, Baroin-Tourancheau et al., 1992 and Hirt et al., 1995). A
4 study conducted by Greenwood et al (1991) attempted to use rRNA DNA sequences to study the relationships among one class of protists, Oligohymenophorea. According to this study, a dinoflagellate clade, illustrated by a sample of Peridinium micans, grouped as sister to all the other ciliates used in the distance matrix analysis.
Currently, there exists a debate concerning the pervasive nature of protists. One side of the debate views microbial eukaryotes as ubiquitous organisms having a worldwide pattern of distribution (Corliss, 2002 and Finlay, 2002). This view results in a drop in the estimate of the total number of taxa thought to occur worldwide (Finlay,
2002). Conversely, the other side of the debate maintains that there are geographic distributions that may occur in some taxa and that any attempt to reason global diversity patterns is nearly impossible with the scarcity of data currently in existence (Foissner,
1999). Fenchel and Finlay (2004) illustrated the possibility of geographic isolation in a study which showed that small organisms may show genetic variation based on their geography. An example of this process is the observation that certain species are commonly found to be either in freshwater or saltwater, although some are found in both habitats (Fenchel and Finlay 2004). They speculate that this may be due to freshwater organisms not being able to deal with higher salinity values. Also, the possibility of morphospecies may further complicate matters (Finaly, 2004).
Overall, phylogenetic relationships of many protists groups are still poorly understood or are still being investigated. One published paper briefly outlined three different taxonomic hypotheses involving various protist species (Greenwood et al.,
5 1991). The first classification discussed was developed by Corliss (1979). In that
classification, the basal species on the tree is Prorocentrum micans. It describes the
species discussed as breaking the monophyletic group into two clades. One clade shows that the following species group separately, but in the same branch of the division:
Tetrahymena hegewischi, Tetrahymena thermophila, Colpidium campylum, Glaucoma chattoni, Opisthonecta henneguyi, Paramecium tetraurelia and Colpoda inflata. The other branch of the division includes Oxytricha nova and Oxytricha granulifera, which
group together with Stylonychia pustulata, and the other members include Onychodromus quadricornutus, Euplotes aediculatus and Blepharisma americanum. The second taxonomic hypothesis discussed is the phylogeny developed by Lynn and Sogin (1988) and is based upon their analysis of small subunit ribosomal RNA (SSrRNA) sequences.
The analysis shown includes the same species used in the above mentioned Corliss taxonomy. It also shows the species present to be monophyletic with Prorocentrum micans, which grouped alone and as the basal taxa in the analysis. The first clade in the division includes the same species listed in the Corliss Tetrahymena hegewischi clade above. The same two Oxytricha species once more group together and closest to the
Stylonychia sample included. The Blepharisma americanum sample branched slightly differently in this analysis. In the Corliss (1979) taxonomy, it shared the same branch line as the other samples in the clade, but in the Lynn and Sogin (1988) taxonomy it branches alone as it’s own lineage. The remaining taxa, Onychodromus quadricornutus,
Euplotes aediculatus, still share a lineage branch with the Oxytricha and Stylonychia samples. The third taxonomy discussed was developed by Small and Lynn (1981, 1985) and it focused on the taxonomic relationship between Euplotes and Paramecium. As
6 before, the same species are included in the analysis. Multiple branching lineages are
seen in this arrangement. The Prorocentrum micans sample still branches alone in the
alignment. Also, the two Oxytricha samples group on a lineage with the Stylonichia and
the Blepharisma samples. The Colpoda inflata sample branches alone. The two species
being studied closely in the analysis, Euplotes aediculatus and Paramecium tetraurelia, branch together into a clade. The remaining samples form a Tetrahymena group that is identical to that seen in the other two analyses discussed.
As discussed above, there exist several different views on protist classification.
New information, morphological or molecular, has lead to alterations in existing relationship schemes. Presently, a commonly used scheme for classification is that employed by GenBank for higher order protist taxonomy. Material from the Tree of Life website (http://tolweb.org), which highlights the work of Patterson and Sogin, is included
in this analysis and in the taxonomic references of GenBank.
Importance of Proposed Research
Current data available on many abundant eukaryotic planktonic taxa lack
combined morphological and molecular information. Much of the molecular data
available in public databases has been gathered without detailed consideration of the
taxonomy of the sampled species; hence the stated association of several names in the molecular databases is suspect. Conversely, many morphological taxonomic and
7 phylogenetic studies have not included molecular information, so that sequence data for
many well described species is not available.
Old Woman Creek National Estuarine Research Reserve (hereafter OWC) plays a
vital role in the watershed of northern Ohio, especially in Huron and Erie counties. The
estuary, located along the Ohio shore of Lake Erie, was made a State Nature Preserve by the Ohio Department of Natural Resources in 1980 and includes a variety of different habitats including swamp forests, freshwater marshes, stream sites, barrier beaches and lakeshore locations that connect the estuary to Lake Erie. The estuary’s important status as a State Nature Preserve is further heightened due to its position as the only freshwater
National Estuarine Research Reserve site in the United States, according to NOS/NOAA-
US Department of Commerce.
In the two decades since its founding as a state preserve, many long range studies have been conducted in the area on a variety of subjects. These studies have yielded large amounts of data providing knowledge regarding existing species (as identified by classical taxonomy) and the chemical balance of the estuarine system itself. Hence, this location presents an excellent opportunity for the investigation of molecular and morphological taxonomic questions.
This study attempts to provide detailed morphological identifications and 18S rDNA sequence information for a number of eukaryote planktonic taxa in an effort to alleviate the existing identification problems for many of these groups. This study tests
8 the presumed relationships of eukaryotes that were identified using classical morphological methods. Commonly encountered eukaryotes, important members of the
Microbial Food Wed (MFW) of the OWC, were targeted for both morphological and molecular data. In addition, analyses of community structure were conducted for the same sites that yielded the single cell isolates to lend a broader perspective to those single cell samples.
9
CHAPTER II
MATERIALS AND METHODS
Sampling sites
Two sites provided the eukaryotic planktonic species samples used in both the morphological and molecular analyses portions of this experiment. The primary location was the Old Woman Creek National Estuarine Research Reserve (OWCNERR) in Huron,
Ohio. Sites at this location encompass the mouth of the estuary creek, the region of the estuary that experiences storm-driven lake influence and Lake Erie. They are labeled
Sites 1, 3 and 4, respectively, on the OWC figure below.
Several samples were also collected from a second location at the Bath Nature
Preserve, (BNP), in Bath, Ohio. The two locations at the Bath Nature Preserve, Garden
Pond and Round Pond, are freshwater temperate ponds that experience temperature and seasonal variations very similar in type to those found at OWC. Similar species were seen at both of these locations due to these similarities and the ubiquitous nature of protist species (Finlay and Esteban, 1998).
10 Sampling techniques
The samples were collected at a depth of approximately 1m using either 3L Van-
Dorn bottles or 11.4L plastic containers that were acid washed before the collections took
place. After the sampling was conducted, the sample water was immediately filtered using the techniques described below for the community structure analysis material. The sampling conducted for the single cell analysis study was immediately returned to the laboratory at The University of Akron for immediate treatment, observation and cell
isolation and for preservation using 1% final-concentration Lugol’s iodine solution or
20% Bounin’s solution.
Lake Erie (Site 4)
Estuary Site (Site 3)
Site 2
Upstream Site (Site 1)
Figure 1: Map of Old Woman Creek and Sampling Locations
11 Sequence analysis
Molecular analysis of community structure: To examine community structure, samples
were collected on September 22, 2004 from three sites at the OWC (1, 3 and 4 from
Figure 1). The water samples were transported back to the lab after their collection. The
water samples each site were treated with two slightly different filtering techniques. The
first technique used 150mL of original OWC water, which was then filtered under slight
pressure (less than 150mm Hg) using 47mm diameter 0.2µm Nylaflo® nylon membrane
filters (Pall Life Sciences). The second technique employed reverse filtration to
concentrate 2L of OWC sample to a final volume of 100mL. Here, the filtration device was a 20µm nylon mesh screening (made by Nitex) in place of the 47mm membranes
(Nylaflo®) described above. These filtration techniques were needed to help further
concentrate the sample material and to help remove larger debris found in the water
sample. After filtering, the filters were placed in 50 ml tubes with 2 ml of ATL
extraction buffer (Qiagen) and stored at -20C prior to extraction.
DNA extractions on the filtered samples were accomplished with the Plant
DNeasy kit (Qiagen). A modification of the protocol from this kit was the addition of extra steps to disrupt cell structure. Two disruption methods were utilized: sonication and bead-beating. The sonication treatment involved a 30 second burst on output control level 3 using the sonication probe of a Branson Sonifier 450. The bead-beating treatment used 0.5mm Zirconia/Silica synthetic beads (BioSpec Products) to lyse cells during vortexing.
12
PCR: After DNA extraction, a polymerase chain reaction (PCR) was performed on both the isolated single cell DNA and the OWC community sample DNAs. The polymerase chain reaction used primers specific to the organism and molecular sequence being studied, in this case 18S DNA, to procure large quantities of the extracted DNA. The primers 18SUF and 18SUR were used in both the community and single cell PCR
applications.
All PCR amplifications were completed using the LAPCR 2.1 LongPCR kit
(Panvera Corp). For amplifications of community samples multiple PCR reactions were
performed to insure proper sampling of the populations. Three 10µl reactions with the
products of each of these reactions pooled together after confirmation of correct product
sizes by gel electrophoresis. For single cells, PCR reactions were performed on each of
the individual cell extractions. PCR reactions were run on a 0.9% concentration agarose
gel and utilized Hyperladder 1 ladder (Bioline). The gel was visualized under ultraviolet
lights via the UV Transilluminator UVP BioDoc-It System. DNA was extracted from
positive bands visualized and cut from the agarose gel by kit purification using the
Ultrafree® DA kit from Millipore. Alternately, the PCR material was kit purified using
the MiniElute™ PCR purification kit (Qiagen).
After positive PCR products were kit purified, these products were cloned using
the TA TOPO cloning kit (Qiagen). The resulting bacteria were plated on labeled agar
plates treated with Kanamycin selective medium and the resulting colonies were allowed
13 to grow in 37°C conditions for approximately 30 hours. Positive colonies, which had
incorporated the selected insert, were visualized on the agar plates as white colonies. The negative colonies without the insert appeared blue in color. The positive colonies were selected by using a pipette tip to touch a colony and then depositing the tip in a labeled test tube filled with Kanamycin-treated LB Broth medium. The tubes were placed in the shaker at 37°C overnight. A PCR check of the clone insert was performed and LB broth solutions containing bacteria with the expected size insert were mini-prepped to isolate the plasmid from the bacteria using the QIAprep® spin miniprep kit (Qiagen). The mini- prepped DNA from this reaction was then used in sequence reactions.
Sequencing: All sequence reactions were performed using the Big Dye Terminator mix
(Applied Biosystems). After sequence reactions were performed, reactions were cleaned
to remove extraneous primer materials prior to visualization on an ABI prism 310
Genetic Analyzer (Applied Biosystems). The visualized sequences acquired were then
entered into the SeqApp program (Gilbert, 1993) located on a Macintosh G4 Powerbook
computer and manually aligned with each other.
Data Analysis: Completed sequencers were submitted to a BLAST search to determine
identification. Results of the BLAST search were recorded as the top three BLAST results including initial sample identity from morphological examinations, sample identity number, BLAST identity results, similarity values, gap percentages and group affiliations.
14 At least 100 plasmids representing individual sequences from each of the three
OWC sampling sites were sequenced using M13F or M13R primers in order to obtain
partial sequences. Each obtained sequence was subjected to a BLAST search and the
data, as mentioned above, was recorded and patterns of taxon distribution among the
three sites were compared. In cases were similarly identified taxa were found in each
sampling sites, incomplete 18S sequences from the 18SUF to 18SUR primer were
obtained (ca. 550-700 base pairs). These sequences were manually aligned with one
another and related GenBank samples and subject to a distance analyses.
Single Cell Sample Treatment
Extraction/filtration: The water samples taken from the BNP and from described Sites 3
and 4 at OWC were filter treated prior to the isolation of single cells for continuing
analysis. The samples were returned immediately to the lab after collection, and then
concentrated using the reverse filtration method described in the community sample
treatment with a 20µm mesh (by Nitex). The final volume of sample after the filtrations
were completed was 200mL. The samples were then viewed under an Olympus SZX-
TR30 dissection scope before being transferred to microscope slides for identification
and isolation. After preliminary morphological identification, cells were transferred
manually, via micropipette, into labeled microcentrifuge tubes filled with 10µl of
Instagene matrix buffer (Biorad). At least four to six replicate tubes were collected for
each of the ten individual protist species isolated. Each of these tubes contained three to four individually isolated cells, the DNA of which were extracted and used for continuing
15 molecular analysis. The tubes that contained samples were then quickly frozen using liquid Nitrogen and then immediately transferred to a -70°C freezer for storage until
continuing molecular analysis was performed.
The next step performed was the DNA extraction for the single cells isolations.
The samples selected for analysis were removed from the freezer and the tubes were
heated at 95°C for 5 minutes in order to lyse the cells. Samples of two Dinoflagellates,
Ceratium sp. and Peridinium sp., were heated an additional three minutes in order to
ensure the thecal plates surrounding the cells had ruptured. A schematic diagram
describing the process is located below. After heating, the tubes containing the single
cell isolates and the Instagene matrix buffer (Biorad) were cooled briefly on ice for
approximately 1 minute before being transferred to an Eppendorf Centrifuge 5415C and
centrifuged at 14000rpm for two minutes to separate the liquid with DNA extraction from the beads located in the Instagene matrix buffer (Biorad). The 7 to 8µl of liquid supernatant was carefully pipetted off and transferred to a clean, labeled microcentrifuge tube and frozen at -20°C prior to continuing treatment.
16 SSU Molecular Identifications of Individual Protists
Live cells are captured directly from lake water
“Fragile” cells Resilient cells Ciliates, naked amoeba Diatoms, other algae In ca 10ul H20 in ca 10ul H20
o Freeze on CO2 and store at -70 C Tubes with Or add PCR mix and cycle immediately 10ul Instagene
Described bead beating treatment
Heat for 5 min, spin and transfer Perform PCR*, clone liquid to new tube and sequence products
*If no result, add additional primers redo PCR
Figure 2: Schematic for DNA Extraction Used for SSU Molecular Identification of Individual Protists
The buffer matrix containing the single cell isolate DNA was thawed prior to continuing molecular treatment. The subsequent steps of PCR, cloning, clone checks, minipreps and sequence reactions were all conducted using the same protocols described for community structure analysis material. Additional sequencing treatments were needed, however, in order to obtain the complete 18S DNA sequence for each of the targeted single cells. Supplementary sequence reactions were conducted using other primers such as M13F, M13R, 100F, 1769R, 557F, 528F, 690R, 1055F, 1492R, 1705R and 1390R (primer sequences shown in Table 1).
17
Table 1: Primers Applied in Single Cell 18S Acquisition
Primer Applied Sequence of Primer 18SUF 5’CGATTCAACCTGGTTGATCCTGCCAGT3’ 18SUR 5’CCGGATCCTGATCCTTCTGCAGGTTCACCTAC3’ M13F GTAAAACGACGGCCAGTG M13R GGAAACAGCTATGACCATG 18S690R 5’AGAATTTCACCTCTG3’ 18S557F 5’GCCAGCMGCCGCGGT3’ 18S528F 5’CGGTAATTCCAGCTCC3’ 18S1492R 5’GGTTACCTTGTTACGACTT3’ 18S1705R 5’ACGGGCGGTGTGTRC3’ 18S1055F 5’GGTGCATGGCCG3’ 18S100F 5’CGATCAGATACCGTCCTAGTCT3’ 18S1769R 5’CACCTACGGAAACCTTGTT3’
Data analysis: The single cell isolates were subjected to similar forms of analyses as the
community data. One difference was that the single cell complete 18S sequence data was
manually aligned with samples from GenBank that were from the same or related taxa.
Then, the alignment was used in a Maximum Parsimony analysis with 100 Bootstrap
replications.
Morphology
Live Photography: Morphological identification of the organisms for the single cell isolates employed several techniques to illuminate traits that allowed for correct taxonomic classification. As described in the sample treatment, the first steps in the process were filtration to concentrate the water sample and observation of the specimens under a high powered dissecting scope (Olympus SZX-TR30). The cells were then viewed under an Olympus IX70 inverted compound microscope outfitted with (DIC)
Nomarsky (DIC) contrast that allowed for accurate images. When the species viewed
18 were identified, pictures of the organism were taken using either the QICAMFast 1394
digital camera by Qimaging or the SPOT imagining camera and software (Diagnostic
Instruments Inc.) linked to the inverted Olympus microscope and an attached PC. This
provided a visual record of the protists observed.
Protargol staining: Protargol preservation techniques were also used in this experiment.
Protargol staining techniques stain the cilia and nuclear structures of the organisms
important in the correct taxonomic identification of the organism. Water samples taken
from both OWC and the BNP were preserved in either a 20% Bouin’s solution or a 1%
final-concentration Lugol’s iodine solution with post-fixation in Bouin’s solution.
Previously published protocols were applied to the samples following fixation (Skibbe,
1994).
Protocol Modifications: The published protocols were slightly modified in this
experiment through the use of SuperfrostPlus® Gold slides (Fisher) purchased from Erie
Scientific, Inc., which were described in a paper written by Fried et al. (2002). These
slides used electrostatic charges to affix individual cells to the surface of the glass slide,
and altered the original protocols by removing the need for glycerol-albumen or agar
treated filters for cell fixation prior to staining treatment. Multiple slides were prepared
for each site to ensure a representative sampling of the population. The preserved sample
material was allowed to dry on the SuperfrostPlus® Gold slides (Fisher) overnight prior
to Protargol treatment following published protocols.
19 Protargol staining was performed on sample water taken from the OWC sampling sites. The protocol performed was modified from a protocol described in previously
published papers (Skibbe, 1994) to provide the preemptive staining result for the OWC samples. The samples were preserved in either a 20% final concentration Bouin’s
solution or a 1% Lugol’s iodine solution which was post-fixed with and equal volume of
Bouin’s solution. These samples settled for several days in a settling chamber
(Utermohl) before being pipetted onto SuperfrostPlus® Gold slides (Fisher) and allowed
to dry completely overnight. The steps taken were the same as that in the published
protocol (Skibbe, 1994), but the exposure times of several steps, Protargol stain,
Hydroquionine developer and Gold Chloride exposure, were altered multiple times to
achieve the preemptive final result. The ultimate Protargol staining time for the Bouin’s
post-fixed samples was 35 minutes, the Hydroquinone developer time was reduced from
20 to 15 seconds and the Gold Chloride exposure was reduced to a one second dip. For
the samples preserved in Bouin’s solution only, the protocol was altered to 40 minutes in
the Protargol stain, 15 seconds for the Hydroquinone developer and a one second dip in
the Gold Chloride solution. These procedures yielded the best staining result for the
OWC samples.
20
CHAPTER III
PROTIST COMMUNITY STRUCTURE RESULTS AND DISUCUSSION
Each of the three OWC sites sampled yielded approximately 100 partial 18S
rDNA sequences. These sequences were grouped into broad taxonomic categories based on BLAST searches of each sequence. The categories, established from GenBank taxonomic searches and references, included the following: Cryptophytes, Rotifers,
Viridinales, Fungi, Stramenopiles, Ciliophora, Chlamydomonas, Euglenoid,
Dinoflagellates, Cercozoa and Cnidaria. Each site was analyzed separately to determine site composition. In addition, a combined analysis using data from all three sites was also performed to determine total community structure.
The community structure analysis of Sites 1, 3 and 4 employed several different sequencing techniques. Each site was subjected to the previously described molecular procedures. In addition, three taxa were selected that were found to be represented by multiple sequences from each site were sequenced using additional primers, 18SUR and
18SUF, to assess genetic variation within and between the sites. These taxa were those identified from BLAST search results as Strombidium (and related taxa), Cryptomonads
(and related taxa) and Rotifers.
21
Individual Site Discussion of Community Structure
Analyses of each set of sequences obtained from the three collection sites were performed and these results summarized by grouping into the previously mentioned taxonomic categories. These results demonstrated the presence of different taxonomic compositions at each sampling location. Ecological differences between the sampling sites may account for these differences. Each sampling location represented at a unique area of the estuary possessing different nutrient and light availability.
Site 1 was located in the upstream creek portion of the OWC which is farthest from Lake Erie. The sampling site was from a shallow creek area with mild current that
was edged on both sides by a section of semi-dense woodland and partially shaded
sections of the creek near the sampling location. A total of 107 sequenced were obtained
from this site. An analysis of these sequences showed that the site was dominated by
Stramenopile species, which accounted for 35 percent of the site sequences. The other
categories that were most important at this site included the Cryptophyte (21 percent),
Rotifer (20 percent) and Ciliophora categories (16 percent). The other categories each
were represented by ten or fewer sequences. An overview of the community structure as
illustrated by these data is shown in Figure 3.
22 Site 1 Community Structure Analysis Cryptophytes
Rotifers
Viridinales
Stramenopiles
Ciliophora
Chlamydomonas
Euglenoid
Fungi
Dinoflagellates
Cercozoa
Cnidaria
Centroheliozoa
Figure 3: Comparison of Community Composition from Site 1 Based on 18S Sequence BLAST Searches Grouped into Major Categories as Defined in the Text.
The Site 3 sequence data was obtained from the estuary sample site nearest Lake
Erie. The location consisted of a broad, slow moving shallow creek that experienced periodic direct exposures to Lake Erie water that allow for a mixing of the two water types. There was practically no shade provided by vegetation at this sampling site.
Eighty-four total sequences were obtained from this location. Rotifers comprised 33 percent of the total sequences examined and were the largest group from this site studied.
The Cryptophyte (20 percent), Ciliophora (25 percent) and Stramenopile (14 percent) categories also made up a large portion of the total sequences acquired. The remaining groups each were represented by five or fewer sequences. The community analysis data for Site 3 is shown in Figure 4. 23
Site 3 Community Structure Analysis Cryptophytes Rotifers Viridinales Stramenopiles Ciliophora Chlamydomonas Euglenoid Fungi Dinoflagellates Cercozoa Cnidaria Ichthyosporea
Figure 4: Comparison of Community Composition from Site 3 Based on 18S Sequence BLAST Searches Grouped into Major Categories as Defined in the Text.
Site 4 was located along the shores of Lake Erie. The sample water was taken
from a site near to the shore of the lake, far from the estuary vegetation and where light
wave action normally was found. From this site, a total of 98 individual sequences were
analyzed. The two most commonly occurring taxonomic types found at the site were
Stramenopile and the Viridinales, which each accounted for 21 percent of the sequences
studied. Cryptophyte (11 percent) and Ciliophora (19 percent) taxonomic types also were represented by significant numbers of sequences. The remaining groups accounted for
less than ten sequences each. The community analysis information for Site 4 is shown in
Figure 5. 24 Site 4 Community Structure Analysis Cryptophytes
Rotifers
Viridinales
Stramenoplies
Ciliophora
Chlamydomonas
Euglenoid
Fungi
Dinoflagellates
Cercozoa
Cnidaria
Figure 5: Comparison of Community Composition from Site 4 Based on 18S Sequence BLAST Searches Grouped into Major Categories as Defined in the Text.
Rotifers, multicellular metazoans, are significant members of the MFW, where they
may act as a to-down predator on other species, including various protists taxa (Kasprzak et al., 2000 and Jurgens and Jeppesen, 2000). The graphs of community structure analyses (Figures 3-5) illustrate a notable difference in the composition of these important MFW members at the three sampling locations. For Sites 1 and 3, Rotifers compose a substantial portion of the observed community structure (20 percent for Site 1 and 33 percent for Site 3). The portion composed of Rotifers was notably smaller in Site
4, where they did not compile a large portion of the structure. This result may be
25 explained by the differing habitats encountered. Sites 3 and 4 both contain slow moving
waters with little to no current observed. Rotifers would be expected under these
conditions. Site 4, however, comprised the lakeshore sampling location, which
experienced light wave action and currents that would make it a less suitable habitat for
planktonic Rotifers.
Combined Site Discussion of Community Structure
Sequence acquired from all three of the OWC sampling sites were combined and analyzed together. The analysis of the grouped data placed the sequences into the same broad taxonomic categories applied in the individual site analyses. A total of 287 sequences were used in the combined analysis. Of these sequences, those placed in the
Stramenopile category yielded the most analyzed sequences and accounted for approximately 24 percent of the data. Other prominent categories represented included the Ciliophora (approximately 20 percent of analyzed sequences), the Rotifers
(approximately 18 percent) and Cryptophyte category (approximately 17 percent). The other taxonomic categories were represented by less than ten percent each. The information for the combined community structure analysis is shown in Figure 6.
26 Total Community Structure Analysis
Cryptophytes
Rotifers
Viridinales
Stramenopiles
Ciliophora
Chlamydomonas
Euglenoid
Fungi
Dinoflagellates
Cercozoa
Cnidaria
Figure 6: Comparison of Community Composition from All Three Sites Based on 18S Sequence BLAST Searches Grouped into Major Categories as Defined in the Text.
Total Community Analysis of Sequences from Five Selected Taxa
A manual sequence alignment including 400-700 base pairs of sequence acquired from multiple sequences from Sites 1, 3 and 4 from OWC and GenBank sequence data as determined by BLAST analysis was constructed. These alignment were constructed for five different commonly encountered taxa, Strombidium (and related taxa), Strobilidium
(and related taxa), Cryptomonas (and related taxa), Chlamydomonas (and related taxa) and Rotifer samples, found at each of these collection locations. Distance Analysis was performed on each of these alignments and the resultant phylograms are shown in Figures
7-11. 27
Strobilidium Total Sequence Analysis: An alignment of 22 total samples was constructed.
These included 17 samples from OWC including no samples from the lake site, Site 4,
fourteen samples from the estuary site nearest the lake, Site 3, (Sample numbers: S3253
Strobilidium sp., S3313 Strobilidium sp., S3330 Strobilidium sp., S3120 Strobilidium sp.,
S3376 Strobilidium sp., S3296 Strobilidium sp., S3323 Strobilidium sp., S3349
Strobilidium sp., S3262 Strobilidium sp., S3450 Strobilidium sp., S3344 Strobilidium sp.,
S3288 Strobilidium sp., S3464 Strobilidium sp., and S3338 Strobilidium sp.) and three
samples came from the upstream Site 1 location (Sample numbers: S1920 Strobilidium
sp., S11057 Strobilidium sp., and S11058 Strobilidium sp.). The alignment also included five GenBank samples chosen because of their high sequence similarity values resulting from BLAST searches were with sample from OWC. Many of these available sequences from similar organisms represented far reaching geographic locations (Table 2). The
GenBank samples included both freshwater and marine taxa.
Table 2: GenBank Accession and Collection Data, Where Available, for Samples Included in Strobilidium sp. Total Sequence Alignments
Sample Identification Location of Sampling GenBank Accession Number Strombilidium sp. North America AF399123 Freshwater eukaryote Lake George, NY AY919790 North America Freshwater eukaryote Lake George, NY AY919767 North America Freshwater eukaryote France AY821916 Strombilidium caudatum Guelph, Ontario, Canada AY143573
The results of the Distance Analysis conducted on the Strobilidium sp.is shown as a phylogram in Figure 7. Both the Site 1 and Site 3 sequences were shown to be
28 paraphyletic. Three Site 3 sequences, S3133 Strobilidium sp., S3376 Strobilidium sp.,
and S3120 Strobilidium sp. were shown to cluster together while the remaining Site 3
sequences grouped together in two different clusters alongside sequences from the
upstream location.
S3133 Strobilidium sp.
S3376 Strobilidium sp.
S3120 Strobilidium sp.
Ay919767 freshwater (Lake George, NY)
AY919790 freshwater (Lake George, NY)
S3330 Strobilidium sp.
S3253 Strobilidium sp. S1920 Strobilidium sp. Strobilidiidae 0.009 S11058 Strobilidium sp.
S11057 Strobilidium sp.
AF399123 Strobilidium sp. , North America
AY143573 Strobilidium caudatum (Guelph, Ontario, Canada)
AY821916 freshwater (France)
S3464 Strobilidium sp.
S3344 Strobilidium sp.
S3262 Strobilidium sp.
S3450 Strobilidium sp.
S3323 Strobilidium sp.
S3349 Strobilidium sp.
S3296 Strobilidium sp.
S3288 Strobilidium sp.
S3338 Strobilidium sp. 0.01 substitutions/site
Figure 7: Phylogram Resulting from a Distance Analysis of Strobilidium sp. Sequences
Strombidium Total Sequence Analysis: An alignment of 16 total samples was
constructed. These included 6 samples from OWC including three samples from the lake site, Site 4 (Sample numbers: S4581 Strombidium sp., S4490 Strombidium sp., and
S4398 Strombidium sp.), none from the upstream site, Site 1, and three sequences from
29 the estuary site, Site 3 (Sample numbers: S3290 Parastrombidinopsis sp., S3142
Strombidium sp., and Strombidium sp.). The alignment also included ten GenBank samples chosen because of their high sequence similarity values resulting from BLAST searches were with sample from OWC. The sequence identities, available sequences from similar organisms represented far reaching geographic locations, included both freshwater and marine taxa are shown in Table 3.
Table 3: GenBank Accession and Collection Data, Where Available, for Samples Included in Strombidium sp. Total Sequence Alignments
Sample Identification Location of Sampling GenBank Accession Number Strombidium sp. North American AF399116 Freshwater eukaryote Lake George, NY AY919679 North America Tintinnopsis fimbriata Florida, marine sample AY143560 North America Laboea strobia Italy AY302563 Freshwater eukaryote Italy AJ48911 Strombidinopsis jeukjo South Korea, marine AJ628250 Strombidinopsis acuminata South Korea, marine AJ877014 Parastrombidinopsis shimi South Korea AJ786648 Codenellopsis mericana South Korea, marine AY143571 Tintinnopsis tubulosoides South Korea, marine AF399111
The result of the Distance Analysis is shown in Figure 8 as a phylogram. This tree shows that the sequence for S3290 Parastrombidinopsis sp was related to the
GenBank sequence Parastrombidinopsis shimi (AJ86648). Also, sequences from Sites 3 and 4 often grouped together on the phylogram. This arrangement of samples from Sites
3 and 4 makes sense because of the sampling locations. The waters at Sites 3 and 4 may mix because of the storm-driven nature of the estuary. As a result, species located at either of the two locations may be found in the other location after the merging of the lake and estuary waters.
30 S3142 Strombidium sp.
S3313 Strombidium sp.
S4398 Strombidium sp.
S4490 Strombidium sp. Strombidiidae
AY919679 freshwater (Lake George, NY)
S4581 Strombidium sp.
AJ48911 freshwater sample (Italy)
AF399116 Strombidium sp. (North America)
AY302563 Laboea strobia (Italy) Laboea
AJ877014 Strombidinopsis acuminata (South Korea, marine) Strombidiidae AJ628250 Strombidinopsis jeukjo (South Korea, marine)
AF399111 Tintinnopsis tubulosoides (South Korea, marine) Codonellidae
AY143571 Codonellopsis americana (South Korea, marine) Codonellopsidae
AY143560 Tintinnopsis fimbriata (Florida, marine) Codonellidae
AJ786648 Parastrombidinopsis shimi (South Korea) Strombidinopsidae 0.01 substitutions/site S3290 Parastrombidinopsis sp.
Figure 8: Phylogram Resulting from a Distance Analysis of Strombidium sp. Sequences
Cryptomonas sp. Total Sequence Analysis: An alignment of 29 total samples was constructed These included 25 samples from OWC including one sample sequence from the lake, Site 4, (S4411 Cryptomonas sp.) thirteen sequences from Site 3 (S3465
Cryptomonas sp., S3393 Campylomonas sp., S3322 Campylomonas sp., S3358
Cryptomonas sp., S3385 Cryptomonas sp., S3359 Cryptomonas sp., S3361 Cryptomonas sp., S3302 Cryptomonas sp., S3326 Cryptomonas sp., S3320 Cryptomonas sp., S3307
Cryptomonas sp., S3314 Cryptomonas sp., and S3301 Cryptomonas sp.) and eleven sequences from Site 1 (S1740 Cryptomonas sp., S11062 Cryptomonas sp., S1779
Cryptomonas sp., S1677 Cryptomonas sp., S1831 Cryptomonas sp., S11063
Cryptomonas sp., S11021 Campylomonas sp., S1729 Cryptomonas sp., S1679
Cryptomonas sp., S11012 Cryptomonas sp., and S1733 Cryptomonas sp.). The alignment 31 also included four GenBank sequences that showed high sequence similarity values to the
OWC sequences resulting from BLAST searches. These GenBank sequences are listed
in Table 4.
Table 4: GenBank Accession and Collection Data, Where Available, for Samples Included in Cryptomonas sp. Total Sequence Alignments
Sample Identification Location of Sampling GenBank Accession Number Campylomonas reflexa CCMP 152, MUCC 067 culture isolate AF508267 Cryptomonas sp. M420 Cornwall, England AJ007280 Cryptomonas ovata UTEX 358 culture isolate AF508270 Cryptomonas sp. M1094 England AJ007281
The results of the Distance Analysis conducted on the Cryptomonas sp. are shown
in Figure 9. Sequences from all three sites were determined to be paraphyletic. Three
Site 1 samples, S1733 Cryptomonas sp., S11012 Cryptomonas sp. and S1679
Cryptomonas sp., grouped into a single cluster while the other Site 1 samples were
interspersed with sequences from the other sites in several larger clusters. Most of the
Campylomonas sp. samples also formed their own cluster, but two samples were seen to
group alongside other Cryptomonas sp. sequences in the larger cluster.
32 AF508267 Campylomonas reflexa S3393 Campylomonas sp. S3322 Campylomonas sp. S1733 Cryptomonas sp. S11012 Cryptomonas sp. S1679 Cryptomonas sp. AJ007280 Cryptomonas sp. M420 S3359 Cryptomonas sp. S3358 Cryptomonas sp. S3465 Cryptomonas sp. S1779 Cryptomonas sp. S11062 Cryptomonas sp. S3361 Cryptomonas sp. S3385 Cryptomonas sp. S4411 Cryptomonas sp. Cryptomonadaceae S1677 Campylomonas sp. S1729 Cryptomonas sp. S11063 Cryptomonas sp. S11021 Campylomonas sp. S1831 Cryptomonas sp. S3301 Cryptomonas sp. S3307 Cryptomonas sp. S3320 Cryptomonas sp. S3314 Cryptomonas sp. S3326 Cryptomonas sp. S3302 Cryptomonas sp. AF508270 Cryptomonas ovata S1740 Cryptomonas sp. AJ007281 Cryptomonas sp. M1094
0.005 substitutions/site
Figure 9: Phylogram Resulting from a Distance Analysis of Cryptomonas sp. Sequences
Chlamydomonas Total Alignment: An alignment of 17 total samples was constructed.
These included 13 samples from OWC including eleven sample sequences from the lake,
Site 4, (S4489 Chlamydomonad sp., S4550 Chlamydomonad sp., S4374 Chlamydomonad sp., S4403 Chlamydomonad sp., S4366 Chlamydomonas sp., S4373 Chlamydomonas sp.,
S4482 Chlamydomonas sp., S4483 Chlamydomonas sp., S4501 Chlamydomonas sp.,
S4514 Chlamydomonas sp., and S4578 Chlamydomonas sp.), two samples from the estuary site, Site 3, (S3356 Chlamydomonad sp., and S3312 Chlamydomonas sp.) and
33 none from the upstream, Site 1, location. The alignment also included four GenBank sequences that showed high sequence similarity values to the OWC sequences resulting from BLAST searches. These GenBank sequences are listed in Table 5.
Table 5: GenBank Accession and Collection Data, Where Available, for Sample Included in Chlamydomonas sp. Total Sequence Alignments
Sample Identification Location of Sampling GenBank Accession Number Chlamydomonas noctigama SAG 33.72 culture isolate AF008242 Chlamydomonas sp. MBIC10473 Unpublished AB058351 Chlamydomonad sp. Tow 2/24 P-8d Unpublished AY220083 Chlamydomonad sp. Tow 8/18T-12w Unpublished AY220607
The results of the Distance Analysis conducted on the Chlamydomonad sp.
sequences are shown in Figure 10. The majority of the sequences from Sites 3 and 4
were shown in group together into two large clusters. The remaining Site 4 sequences,
S3312 Chlamydomonas sp., S4482 Chlamydomonas sp., S4373 Chlamydomonas sp., and
S4366 Chlamydomonas sp., all grouped together into a cluster containing only sequences
from Site 4 of OWC.
34 AF008242 Chlamydomonas noctigama
AB058351 Chlamydomonas sp. MBIC10473
S4482 Chlamydomonas sp.
S3312 Chlamydomonas sp.
S4373 Chlamydomonas sp.
S4366 Chlamydomonas sp.
AY220083 Chlamydomonad sp. Tow2/24 P-8d
S4403 Chlamydomonad sp Chlamydomonadaceae S4374 Chlamydomonad sp
S4489 Chlamydomonad sp
AY220607 Chlamydomonad sp. Tow8/18T-12w
S4550 Chlamydomonad sp
S3356 Chlamydomonad sp
S4578 Chlamydomonas sp.
S4514 Chlamydomonas sp.
S4501 Chlamydomonas sp.
S4483 Chlamydomonas sp.
0.01 substitutions/site
Figure 10: Phylogram Resulting from a Distance Analysis of Chlamydomonas sp. Sequences
Rotifer total alignment: An alignment of 53 total samples was constructed. These
included 46 samples from OWC including three samples from the lake site, Site 4 (S4372
Lepadella sp., S4399 Lepadella sp., and S4572 Euchlanis sp.), 24 sequences from Site 3
(S3339 Brachionus sp., S3357 Euchlanis sp., S3443 Euchlanis sp., S3303 Euchlanis sp.,
S3447 Lepadella sp., S3378 Lepadella sp., S3463 Euchlanis sp., S3386 Euchlanis sp.,
S3347 Euchlanis sp , S3466 Euchlanis sp., S3300 Euchlanis sp., S3382 Euchlanis sp.,
S3353 Euchlanis sp., S3306 Euchlanis sp., S3469 Euchlanis sp., S3352 Euchlanis sp.,
S3390 Euchlanis sp., S3345 Euchlanis sp., S3335 Euchlanis sp., S3355 Notholca sp.,
S3297, S3319 Lepadella sp., S3298 Lepadella sp. and S3343 Lepadella sp.) and nineteen samples from Site 1 (S1923 Brachionus sp., S1702 Brachionus sp., S11041 Euchlanis 35 sp., S11037 Euchlanis sp., S1675 Brachionus sp., S1888 Brachionus sp., S1038
Euchlanis sp., S11043 Euchlanis sp., S1725 Brachionus sp., S1880 Brachionus sp.,
S11065 Euchlanis sp., S11044 Euchlanis sp., S11068 Euchlanis sp., S1737 Brachionus sp., S11066 Euchlanis sp., S1739 Euchlanis sp., S1751 Brachionus sp., S11040
Brachionus sp. and S11064 Brachionus sp.). The alignment also included seven
GenBank samples that showed high sequence similarity values from BLAST searches to
the sequences from OWC. These GenBank sequences are listed in Table 6.
Table 6: GenBank Accession and Collection Data, Where Available, for Samples Included in Rotifer Total Sequence Alignments
Sample Identification Location of Sampling GenBank Accession Number Lepadella patella Published material AY218117 Asplanchna sieboldi Culture material AF092434 Lecane bulla Culture material AF154566 Euchlanis dilatata Published material AY218116 Brachionus plicatilis Published material U49911 Brachionus patulus Culture material AF154568 Notholca acuminata Published material AY218115
The Distance Analysis results are shown in Figure 11. The Lepadella sp. OWC
sequences were shown to be paraphyletic. The OWC sequences, all from Sites 3 and 4, tended to group together into three main clusters. One contained only one Site 3 sample
(S3297), one cluster contained three Site 3 samples and two GenBank sequences,
Lepadella patella (AY218117) and Asplanchna sieboldi (AF092434), and the final cluster contained only OWC sequences from both Sites 3 and 4. The Brachionus
sequences also were shown to be paraphyletic. The sequences grouped into seven
different clusters, which all contained fewer than five samples. The OWC sequences,
from Sites 1 and 4 only, grouped amongst themselves and not with the expected
36 GenBank sequences. The Notholca sequence from Site 3 was shown to group with the
GenBank sequence for Notholca acuminate. The Euchlanis sequences were paraphyletic as well and formed six total clusters. The sequence from Sites 1 and 3 grouped together with only other OWC sequences and not as expected with the GenBank sequences, which the phylogram resulting from the analysis showed grouped in an individual cluster.
AY218117 Lepadella patella S3378 Lepadella sp. Lepadella S4372 Lepadella sp. S4399 Lepadella sp. S3447 Lepadella sp. S3355 Notholca sp. Notholca AF154568 Brachionus patulus S3339 Brachionus sp Brachionus S3347 Euchlanis sp S1702 Brachionus sp S3335 Euchlanis sp S3390 Euchlanis sp Euchlanis S3345 Euchlanis sp AF154566 Lecane bulla Lecane S3463 Euchlanis sp S3386 Euchlanis sp Euchlanis S3353 Euchlanis sp S1880 Brachionus sp St1040 Brachionus sp S1923 Brachionus sp Brachionus AF092434 Asplanchna sieboldi Asplanchna St1038 Euchlanis sp S3469 Euchlanis sp S3352 Euchlanis sp S4572 Euchlanis sp Euchlanis St11043 Euchlanis sp S3306 Euchlanis sp S1751 Brachionus sp S1725 Brachionus sp Brachionus S11068 Euchlanis sp S11066 Euchlanis sp Euchlanis St11044 Euchlanis sp S3466 Euchlanis sp S1737 Brachionus sp Brachionus S3300 Euchlanis sp S11065 Euchlanis sp S1739 Euchlanis sp Euchlanis S1888 Brachionus sp S1675 Brachionus sp Brachionus St11037 Euchlanis sp S3357 Euchlanis sp S3443 Euchlanis sp Euchlanis St11041 Euchlanis sp S3343 Lepadella sp. S3298 Lepadella sp. Lepadella S3297 Lepadella sp. S11064 Brachionus sp Brachionus S3319 Lepadella sp. Lepadella S3303 Euchlanis sp. S3382 Euchlanis sp Euchlanis U49911 Brachionus plicatilis Brachionus AY218116 Euchlanis dilatata Euchlanis AY218115 Notholca acuminata Notholca 0.005 substitutions/site
Figure 11: Phylogram Resulting from a Distance Analysis of Rotifer Sequences
37
CHAPTER IV
SINGLE CELL CHARACTERIZATION RESULTS AND DISCUSSION
Complete 18S sequence data was acquired for ten different taxa from OWC and
BNP. The completed sequences were subjected to a BLAST analysis as a means of estimating which GenBank specimens the samples had the highest sequence similarity.
The BLAST searches tested the tentative species identification, based upon behavioral swimming patterns of live specimens, identification under a dissecting microscope, and taxonomic references (Foissner et al., 1999; Wehr and Sheath, 2003). In addition, the
18S sequences obtained for each of these samples were aligned with existing GenBank sequences of the same species if possible (based on sequence identity percentages), and also with related taxa as determined by current phylogenetic studies, for phylogenetic analysis. The species that yielded sequence data were the following (according to tentative live specimen morphological identification and GenBank BLAST result data):
Coleps sp., Codonella sp., Dileptus sp., Monodinium sp., Peridinium sp., Synura sp.,
Strombidium sp., Tintinnopsis sp., Vorticella sp., and Ceratium sp. The resulting phylogenetic trees are shown in Figures 13, 15, 17, 19, 21, 23, 25, 27, 29, and 31.
38
Table 7: OWC Sampling Information
Sample Name Sample Number Collection Date Collection Location GenBank Accession Number Vorticella sp. Pt. 92 6/29/2005 BNP-Garden Pond DQ487201 Peridinium sp. Pt.128 7/26/2005 BNP-Round Pond DQ487197 Ceratium sp. Pt.56 6/19/2005 BNP-Garden Pond DQ487192 Strombidium sp. Pt.139 9/10/2005 OWC Lake DQ487198 Tintinnopsis sp. Pt.135 6/15/2005 OWC Mouth DQ487200 Coleps sp. Pt.12 6/1/2005 OWC Lake DQ487194 Codonella sp. Pt.40 6/15/2005 OWC Mouth DQ487193 Dileptus sp. Pt.133 9/10/2005 OWC Mouth DQ487195 Monodinium sp. Pt.3 6/1/2005 OWC Lake DQ487196 Synura sp. Pt. 186 10/28/2005 BNP-Garden Pond DQ487199
Replicate tubes were used during all of the single cell DNA extractions. At least two collections of each sample of interest were extracted because the resultant PCR reactions were not always successful. Each extraction was performed concurrently and then was subjected to the same molecular analyses. Even when PCR on the replicate samples resulted in amplified products the resultant sequences sometimes failed to yield the results expected based on the initial morphological identifications. Furthermore, a diversity of amplified organisms was sometimes observed between presumably replicate tubes.
Several possible explanations for these results were possible. First, the sample water had been contaminated with very small alternate species that were not seen or removed during the initial capture. A second possibility is that the micropipette used in the isolation had been contaminated with residual DNA from previous collections. A third possibility is that the slides used during the identification of the single cells had
DNA residue on them from previous sampling that may have contacted the sample water.
39 Lastly, a possible source of contamination is the presence of prey DNA inside the digestive tract of the predators of interest. Most of the taxa isolated are predators of other taxa so the DNA extracted could possibly be that of the prey species and not the target.
To remedy some of these possible problems, the cells were individually selected using a hand held pipette before an additional wash treatment using DNAse treated pond water was added prior to the cells being added to the labeled microcentrifuge tubes. Pond water from the original location was chosen over distilled water due to the ephemeral nature of many protist taxa. Often, the protist cells will rupture if the cells experience a drastic change in water conditions. Using pond water from the original sampling location allowed the same type of water to be used but removed the possibility of residual DNA entering the isolations. To obtain this water, pond water was filtered using a 0.4µm filter and then treated with DNAse (AMBION®) for approximately 10 minutes. The water sample was then heated at 100°C for 10 minutes to denature the DNAse so that it would not contaminate the subsequent PCR reactions. A test polymerase chain reaction (PCR) using 18SUR and 18SUF primers was conducted on the DNAse treated water in order to ascertain whether the DNA had been removed. Once the water was confirmed to be
DNA free, this treated water was then used to wash the cells twice under the dissecting scope before placing the cells into the labeled tubes for preservation.
Additional techniques were applied to counteract other possible sources of the contamination, including changing the slides used in the isolations more often and periodically rinsing them with the DNAse treated water. The micropipette utilized was
40 also rinsed with the same treated water. The possibility of predator-prey interactions, however, could not be countered. This is because the species isolated do not survive well
in culture and they were too unstable to exist long enough to starve.
Further protocol enhancements for single cell PCR reactions were undertaken in
order to compensate for lower concentrations of DNA. The PCR was performed using
the same LAPCR 2.1 LongPCR kit (Panvera Corp) used for community structure
analysis. However, 7µof the extracted DNA was used instead of the 0.5µl of DNA and
3.0µl of DNA-free sterilized water described in the procedure. The remainder of the
PCR protocols were followed as previously described.
In the initial protocols, single cell 18S DNAs were extracted using Instagene matrix buffer (Biorad) and heat treated at 95°C for five minutes. Afterwards, a PCR using 18SUF and 18SUR primers was conducted and gel visualized. Then, positive fragments were band purified via the Ultrafree® DA kit from Millipore to separate the
PCR product from the agarose gel. A problem arose, though, when this protocol was put into practice on the single cell isolates. When the gel purification was conducted, the resulting DNA mixture could not be cloned. To attempt to solve this problem a set of
PCR reactions were conducted on the gel purified PCR DNA product. When the PCR was gel visualized, no bands were seen indicating that there was no DNA present in the gel purified PCR product. Therefore, there was no DNA insert to be included in the bacterial plasmids during cloning. The problem was overcome by using a kit purification
41 method, MiniElute™ PCR purification kit (Qiagen), in place of the Ultrafree® DA kit
(Millipore).
Morphological Analysis of Single Cell Isolates
Preserved samples were treated with the Protargol staining treatment and the
resulting specimens were photographed using the SPOT imagining camera (Diagnostic
Instruments Inc.) and software. Photographs were taken of live, Lugol preserved and
Protargol stained single cell isolate specimens, using both the SPOT camera and imaging
software (Diagnostic Instruments Inc.) and the Olympus IX70 inverted compound microscope, for all the single cell isolate taxa. These images are shown in Figures 12,
14, 16, 18, 20, 22, 24, 26 28 and 30.
Description and phylogenies of single cell isolates
Complete 18S rDNA sequences were obtained for ten OWC taxa tentatively identified under Olympus SZX-TR30 dissecting scope and the using live specimen behavior and taxonomic references (Foissner et al., 1999; Wehr and Sheath, 2003). The sequences acquired were BLAST searched for identification using sequence homology percentages. Afterwards, the sequences acquired in the research were manually aligned using the SeqApp program (Gilbert, 1993) to existing sequences of the same (if possible) and related taxa located in GenBank. Portions of the aligned sequences that were found to have poor sequence homology and partial GenBank sequences were not used in the
42 phylogenetic analyses to lessen the potential of ambiguous results. The quantity of non-
homologous sequence differed among the sequences.
The complete 18S sequences obtained were all subjected to the same phylogenetic
analyses. A Maximum Parsimony analysis (MP) was conducted on each using the
program PAUP 4.0. A MP analysis was chosen in order to ascertain the evolutionary
relationship between the included taxa. It does so by assuming that common ancestry
accounts for common characteristics found between taxa (Hall, 2004). In addition, a
Bootstrap analysis was conducted consisting of 100 replicate samplings. This process
uses random sub-sampling of the included sequences in order to build a tree topology and
test the arrangement of the groups for reliability (Hall, 2004). The resulting phylogenetic trees were visualized as unrooted phylograms.
Dileptus: Habitat: Not common, found in planktonic habitats; Collection Site: Old
Woman Creek Site 3; Observed diagnostic characteristics: club-shaped, slender body often greenish in color because of symbiotic algae, contains many contractile vacuoles; possessing a short to long anterior motile proboscis, characteristic slow swimming with circular movements of motile proboscis; (See Figure 12); Preliminary morphological taxonomic identification: Dileptus sp.
43
Figure 12: Photograph of Lugol Preserved Dileptus sp.
An 18S sequence was obtained from three isolated cells obtained from an OWC field sample. A BLAST search of this sequence resulted in a closest match to Dileptus sp. (Accession number AF029764). These sequences had a 98 percent sequence similarity value. A taxonomic search was conducted using GenBank in order to gather information regarding existing sequences for related taxa. Existing sequences were found for five related taxa and these were used in the analyses. They included the comparison sequence Dileptus sp. (AF029764), Homalozoon vermiculare (L26447), Didinium nasutum (U57771), Spathidium sp. (Z22931) and Chaena teres (DQ190461). The alignment of the sequences was completed manually and portions that were unable to be unambiguously aligned (0-22, 130-134, 153-154, 235-250, 600-644, 941-952, 1242sp.
(Accession number AF029764). These sequences had a 98 percent sequence similarity value. A taxonomic search was conducted using GenBank in order to gather information regarding existing sequences for related taxa. Existing sequences were found for five related taxa and these were used in the analyses. They included the comparison sequence
44 Dileptus sp. (AF029764), Homalozoon vermiculare (L26447), Didinium nasutum
(U57771), Spathidium sp. (Z22931) and Chaena teres (DQ190461). The alignment of the sequences was completed manually and portions that were unable to be unambiguously aligned (0-22, 130-134, 153-154, 235-250, 600-644, 941-952, 1242-
1255, 1284-1294, 1379-1405 and 1648-end base) were excluded from the MP analysis.
The Heuristic search provided the tree shown in Figure 13 with Bootstrap values beneath in bold.
In the completed analysis, the OWC Dileptus sample was more closely related to the GenBank Dileptus sp. (AF029764) than the other included taxa and, together, they formed the members in the Tracheliidae group for this analysis. The two Dileptus samples were well delineated from the other included taxa by a Bootstrap support of 100, and this strongly supports a close relationship of the OWC sample to Dileptus sp.
45 20 Didinium nasutum U57771 Didiniidae
23 Homalozoon vermiculare L26447 Homalozoon
14 109 79 Chaenea teres DQ19461 Trachelophyllidae
19 3 76 Dileptus sp. AF029764 31 100 Tracheliidae 6 Dileptus OWC
22 Spathidium sp. Z22931 Spathidium 10 changes
Figure 13: Phylogeny for Dileptus sp. Based on a Maximum Parsimony Analysis. C.I. = 0.9160, Number of Shortest Trees = 1, Total Length = 250.
Early extraction attempts for this sample provided different results. BLAST
results of early Dileptus extractions yielded high sequence similarities with species of
Cryptomonas, Chlamydomonas and Tintinnidium. The replicate isolations of this taxa were performed prior to the additional rinse step using DNAse-treated pond water. The appearance of high BLAST sequence similarities with untargeted taxa may be due to
contaminations in the isolation protocols.
46 Codenella: Habitat: common in community structure of lakes and ponds; Collection Site:
Old Woman Creek Site 3; Observed diagnostic characteristics: body shape is cylindrical with a contractile vacuole located near the anterior of the cell, colorless but may be slightly green due to ingested algal prey, firm lorica with varying shape is commonly made of materials from habitat, swimming pattern is constant without jumps or rotations;
(See figure 14); Preliminary morphological taxonomic identification: Codonella sp.
Figure 14: Photograph of Protargol stained Codonella sp.
An 18S sequence was obtained from two isolated cells obtained from an OWC
field sample. The completed sequence was BLAST searched and the closest existing
GenBank sample was that of Codonellopsis americana (Accession number AY143571).
The sequence similarity value was 98 percent between the two sequences. A taxonomic 47 search of Codonellopsis was performed in order to obtain existing GenBank 18S
sequences for related taxa to be used in the analyses. The taxa used in the alignment
included: the comparison sequence, Codonellopsis americana (AY143571), Tintinnopsis
dadayi (AY143562), Tintinnopsis tocatinensis (AY143561), Tintinnopsis fimbriata
(AY143560), Metacylis angulata (AY143568), Metacylis sp. MNB99 (AY143567),
Rhabdonella hebe (AY143566), and Tintinnidium mucicola (AY143563). Portions of sequence that were ambiguously aligned (414-422 and 569-609) were removed from the
MP analysis. The Heuristic search analysis yielded the tree shown in Figure 15 with
Bootstrap values beneath in bold.
49 Tintinnopsis dadayi AY143562
28 Tintinnopsis tocatinensis AY143561 Codonellidae 5
14 4 Codonella OWC Codonellopsidae
11 9 Tintinnopsis fimbriata AY143560 66 Codonellidae
10 Codonellopsis americana AY143571 Codonellopsidae 26 1 92 Metacylis angulata AY143568 8 Metacylididae 84 8 12 Rhabdonella hebe AY143566 Rhabdonellidae 99 7 Metacylis sp. MNB99 AY143567 Metacylididae
76 Tintinnidium mucicola AY143563 Tintinnidae 10 changes
Figure 15: Phylogeny for Codonella sp. Based on a Maximum Parsimony Analysis. C.I. = 0.8246, Number of Shortest Trees = 1, Total Length –=268
48 The Codonella sample from OWC was compared to the BLAST result species,
Codonellopsis americana and other related taxa. When the Maximum Parsimony
analysis was completed, the OWC sample was shown to group with the Codonellopsidae
species, Codonellopsis americana. The Codonellidae samples, Tintinnopsis tocatinensis
and Tintinnopsis fimbriata, grouped sister to the OWC and comparison sequences. The
A Bootstrap value of 67 supported this arrangement. This result suggested a close
relationship between OWC and comparison sequence of Codonellopsis americana.
Multiple extractions were performed to obtain the sequence of Codonella from
OWC. Early extractions, when subjected to a BLAST search, provided sequences for
Cryptomonas sp. and Trimastix pyriformis and not Codonella sp. One possible
explanation for these results is that the isolation water was contaminated. Another
possibility is that the Cryptomonas sp. seen in the BLAST result may be a prey species since Codonella sp. have been shown to feed on various flagellate species (Foissner and
Schaumburg, 1999).
Synura: Habitat: cosmopolitan habitat, common in freshwater; Collection Site: Bath
Nature Preserve, Garden Pond; Observed diagnostic characteristics: colony of club
shaped cells each with 2 long, uneven flagella per cell, colony possesses overlapping
silica scales, number of cell per colony is variable, rolling swim pattern; (See figure 16);
Preliminary morphological taxonomic identification: Synura sp.
49
Figure 16: Photograph of Protargol stained Synura sp.
An 18S sequence was obtained from three isolated cells obtained from a BNP field sample. The sequence was subjected to a GenBank BLAST search and the species with the highest identity (98 percent) was shown to be Synura glabra (Accession number
U73224). The genus Synura was searched using the taxonomic search option in
GenBank and several related taxa yielded 18S sequence data. The taxa included: Synura mammillosa (M873220), Synura spinosa (M87336), Synura uvella (U73222), Synura sphagnicola (U73221), Synura petersenii (U73223), Tessellaria volvocina (U73219),
Mallomonas adamas (U73225) and Mallomonas striata (U73232). Sequence portions that were ambiguously aligned (0-9, 707-709, 1060, 1355-1368 and 1788-end) were removed before the analysis was conducted. A Heuristic search analysis yielded the tree shown in Figure 17 with Bootstrap values beneath in bold.
50 21 Synura mammillosa U73220
15 17 Synura spinosa M87336 52 52 Synura sphagnicola U73221
14 Synura uvella U73222 Synura 3 Synura petersenii U73223 27 17 100 1 4 Synura glabra U73224 73 7 70 18 Synura BNP
10 37 Tessellaria volvocina U73219 Tessellaria
37 Mallomonas adamas U73225 12 Mallomonas 74 30 Mallomonas striata U73232 10 changes
Figure 17: Phylogeny for Synura sp. Based on Maximum Parsimony Analysis. C.I. = 0.7785, Number of Shortest Trees = 2, Total Length = 325
The complete sequence obtained from the Synura sample was analyzed using
Maximum Parismony. The ensuing tree showed that the BNP sample was closely related to the GenBank Synura sample for the comparison sequence, Synura glabra (U73224).
A Bootstrap value of 70 supported this arrangement. The BNP Synura sample and the
GenBank Synura glabra sample were most closely related to another GenBank sample,
Synura petersenii (U73223). These three samples were well delineated from all other included taxa (Bootstrap support of 100) strongly supporting a close relationship of the
BNP sample to S. petersenii or S. glabra. The one Tessellaria sample, Tessellaria volvocina, was grouped as sister to the Synura sample clade that included the BNP 51 Synura sample, Synura glabra and Synura petersenii. The three closely related samples, along with another Synura GenBank sample, Synura uvella, grouped together with the
Tessellaria sample, Tessellaria volvocina, and the two Mallomonas samples, Mallomonas
striata and Mallomonas adamas. This grouping, separate from the remaining Synura
samples, had the support of a 73 Bootstrap value. Two of the remaining GenBank
Synura samples of Synura spinosa and Synura sphagnicola grouped together with a 52
Bootstrap support value. The other included Synura sample, Synura mammillosa, grouped alone on the Maximum Parsimony analysis tree. The two members of the
Mallomonas group, Mallomonas striata and Mallomonas adamas grouped together as well, and the Bootstrap support value was 74 for this grouping.
Early extractions of Synura samples from BNP provided sequences that were subjected to BLAST searches. The results of these provided sequences for Cryptomonas sp. and Adriamonas peritocrescens. One possible explanation for this contamination is that these isolations occurred before the introduction of the DNAse treated water rinses.
Therefore, the slide or pipette used in the extraction may have been contaminated.
Monodinium: Habitat: pelagic and benthic waters; Collection Site: Old Woman Creek
Site 4; Observed diagnostic characteristics: slender shaped body with a rounded posterior and a cone-shaped anterior proboscis, contractile vacuole present at posterior end of cell, fast swimmer with characteristic sipping and jumping motion; (See Figure 18);
Preliminary morphological taxonomic identification: Monodinium sp.
52
Figure 18: Photograph of Lugol Preserved Monodinium sp.
An 18S sequence was obtained from three isolated cells obtained from an OWC
field sample. A BLAST search showed the sequence was most closely related to the
GenBank sequence for Didinium nasutum (Accession number U57771). These sequences shared a 97 percent sequence similarity value. In addition, the BLAST search
revealed several different related taxa for which 18S sequence data was already available
including the following: Homalozoon vermiculare (L26447), Spathidium sp. (Z22931),
Dileptus sp. (AF029764) and Chaenea teres (DQ190461). Sequences for these taxa were
entered into the sample alignment, and bases illustrating ambiguous alignment (0-20,
189, 239-251, 607-645, 1061-1065, 1083, 1169-1171, 1250, 1258-1265, 1636-end) were
53 removed prior to the analysis. The results of the completed MP analysis are found in
Figure 19 with Bootstrap values beneath in bold.
28 Homalozoon vermiculare L26447 Homalozoon
26 Spathidium sp. Z22931 Spathidium
41 Dileptus sp. AF029764 Tracheliidae 29 96 126 Chaenea teres DQ190461 Trachelophyllidae 22 82 8 Didinium nasutum U57771 17 Didiniidae 100 20 Monodinium OWC 50 changes
Figure 19: Phylogeny of Monodinium sp. Based on Maximum Parsimony Analysis. C.I. = 0.8833, Number of Shortest Trees = 1, Total Length = 317
The Maximum Parsimony analysis conducted on the Monodinium sample taken
from OWC showed that the sample shared the closest sequence homology with the
GenBank sequence for Didinium nasutum (U57771) compared with other included taxa.
These two samples were well delineated from all other included taxa (Bootstrap support of 100) and this strongly supported a close relationship of the OWC sample to Didinium 54 nasutum. The OWC Monodinium sample and Didinium sample was sister, with a
Bootstrap support of 82, to another clade containing two species, which included the
Tracheliidae sample, Dileptus sp. and the Trachelophyliidae sample, Chaenea teres.
This grouping was supported by a 96 Bootstrap value.
Recently, published phylogenies, concerned with the phylogenies of members of
this group of protists, have including several of the species used in this analysis. In one
paper, a sample of Didinium was shown to be the sister taxon in a clade with
Homalozoon vermiculare (Lynn et al., 1999). Another paper published a similar
phylogeny where their Didinium sample grouped into a clade with the following ciliate
taxa when a large number of protist species were included in the Maximum Parsimony
analysis: Homalozoon vermiculare, Spathidium sp., and Loxophyllum utriculariae
(Wright and Lynn, 1997). A close relationship between Didinium and Homalozoon taxa
was also seen in this analysis which supports this relationship.
Coleps: Habitat: common in still to slow moving waters; Collection Site: Old Woman
Creek Site 4; Observed diagnostic characteristics: usually body is barrel-shaped and covered in calcified plates, cell possesses a contractile vacuole near the posterior of the cell, cell lacks symbionts and is normally brownish in color; fast swimmer with uncharacteristic swim pattern; (See Figure 20); Preliminary morphological taxonomic identification: Coleps sp.
55
Figure 20: Photograph of Lugol Preserved Coleps sp.
An 18S sequence was obtained from three isolated cells obtained from an OWC field sample. The sample shared a 99 percent sequence similarity value to the most closely related existing sequence on GenBank, Coleps sp. (Accession number X76646).
A BLAST search yielded several related taxa, such as Coleps hirtus (U97109), Prorodon viridis (U97111), Sorogena stoianovitchae (AF300288), Bryometopus sphagni
(AF060455), Bursaria truncatella (U82204), Platyophyra vorax (AF060454), and
Blepharisma americanum (M97909), as closely related taxa and these were included in the alignment. Base pairs (0-60, 460-474, 1093-1111, 1175-1187, 1550-1573, 1585-
1613, 1810-end) that were ambiguously aligned between the included taxa were removed from the analysis. Results of a parsimony analysis are shown in Figure 21 with Bootstrap values beneath in bold.
56 23 Sorogena stoianovitchae AF300288 Sorogenida
26 Platyophyra vorax AF060454 Cyrtolophosidida
9 Coleps hirtus U97109
95 8 100 Coleps OWC Colepidae 11 50 88 2 78 Coleps sp. X76646
41 58 54 Prorodon viridis U97111 Prorodontidae
86 65 Bursaria truncatella U82204 100 Bursariomorphida
164 Blepharismidae americanum M97909 Heterotrichida 50 changes
Figure 21: Phylogeny of Coleps sp. Based on a Maximum Parsimony Analysis. C.I. = 0.8413, Number of Shortest Trees = 1, Total Length = 630
A high Bootstrap value, 88, supported the finding that the Coleps sample taken from OWC grouped with the GenBank sample of Coleps sp. The other Coleps sample,
Coleps hirtus, formed the last member of this clade. These three samples were well delineated from all other included taxa (Bootstrap support of 100) strongly supporting a close relationship of the OWC sample to Coleps sp. and Coleps hirtus. The GenBank sample that was shown to be sister to the Coleps clade was the Prorodontidae sample,
Prorodon viridis. A Bootstrap value of 78 supported this arrangement.
57 A recently published paper analyzed relationships between Colpodean and
Prostome ciliates utilizing information from small subunit rRNA sequences (Stechmann
et al., 1998). They authors included a sample of both Coleps hirtus, a sample used in this
18S sequence analysis, and Prorodon teres in their Maximum Parsimony analysis
(Stechmann et al., 1998). The results of their analysis and the OWC 18S analysis were
similar in regards to these two taxa. Both the analyses found the Prorodon taxa and the
Coleps taxa to form a sister relationship to one another (Stechmann et al., 1998). The
Bootstrap support values, too, were fairly significant in both cases. The support was 78
in this analysis and 91 in the published analysis (Stechmann et al., 1998).
Strombidium: Habitat: common member of eutrophic lakes and ponds; Collection Site:
Old Woman Creek Site 4; Observed diagnostic characteristics: elliptical body that is
more narrow towards the anterior, orange colored cytoplasm due to pigment granules,
any chloroplasts are seen in vacuoles, very quick swimmer with scattered swimming pattern; (See Figure 22); Preliminary morphological taxonomic identification:
Strombidium sp.
58
Figure 22: Photograph of Protargol stained Strombidium sp.
An 18S sequence was obtained from three isolated cells obtained from an OWC
field sample. The entire sequence obtained was highlighted and BLAST searched, and
the sequence showing the highest sequence similarity value (96 percent) was that of
Strombidium sp. SNB99-2 (Accession number AY143564). A taxonomic search was also
conducted and five related taxa, which included Strombidium inclinatum (AJ488911),
Strombidium purpureum (U97112), Novistrombidium testaceum (AJ488910), Halteria
grandinella (AF194410), and Pelagostrombilidium neptuni (AY541683), were included
in the continuing phylogenetic analysis. Parsimony analysis excluding ambiguously
aligned base pairs (0-19, 577-584, 1608-1619, 1685-end) was performed and the results are shown in Figure 23 with Bootstrap values beneath in bold.
59 56 Halteria grandinella AF194410 Halteria
38 Strombidium inclinatum AJ488911 12
73 Strombidium purpureum U97112 16 Strombidium 92 53 Strombidium OWC 6 38 73 2 Strombidium sp. SNB99-2 AY143564
29 Novistrombidium testaceum AJ488910 Novistrombidium
120 Pelagostrombilidium neptuni AY541683 Pelagostrombilidium
50 changes
Figure 23: Phylogeny of Strombidium sp. Based on a Maximum Parsimony Analysis. C.I. = 0.8393, Number of Shortest Trees =4, Total Length =448
The OWC Strombidium sample was shown to be the most closely related to the
Strombidium sp. SNB99-2 sample. The Bootstrap support value was 73 for this arrangement. In addition, those two samples grouped closely with the other two
Strombidium samples, Strombidium inclinatum and Strombidium purpureum, and this clade was supported with a 92 Bootstrap value. The close association of these samples in
60 regards to the other included taxa strongly supports a close relationship of the OWC
sample to these Strombidium taxa.
Tintinnopsis: Habitat: common in lentic waters; Collection Site: Old Woman Creek Site
3; Observed diagnostic characteristics: cylinder-shaped body, contractile vacuole and oral
opening near cell anterior, colorless or slightly green because of ingested algae, loric near
bottom of cell made of a mixture of organic and inorganic materials, swimming pattern is
constant without jumps or spins; (See Figure 24); Preliminary morphological taxonomic
identification: Tintinnopsis sp.
Figure 24: Photograph of Lugol Preserved Tintinnopsis sp.
An 18S sequence was obtained from three isolated cells obtained from an OWC
field sample. The sequence on GenBank that was shown via BLAST search to have the
highest similarity (96 percent) was that of Tintinnidium mucicola (Accession number
AY143563). A taxonomic search yielded five related taxa with available 18S sequences
61 that were manually aligned and used in a Heuristic search analysis. The samples were of
Favella panamensis (AY143572), Rhabdonella hebe (AY143566), Codonellopsis americana (AY143571), Tintinnopsis dadayi (AY143562) and Tintinnopsis fimbriata
(AY143560). Ambiguously aligned bases (566-610 and 1265-1292) were removed prior to the MP analysis. The resulting analysis results are shown in Figure 25 with Bootstrap values beneath in bold.
47 Tintinnopsis dadayi AY143562 Tintinnopsis 12 Tintinnopsis fimbriata AY143560 9 90 7 23 Codonellopsis americana AY143571 Codonellopsis 89 21 Rhabdonella hebe AY143566 Rhabdonella
40 Favella panamensis AY143572 Favella
34 22 88 Tintinnidium mucicola AY143563 Tintinnidium 48 100 41 10 changes Tintinnopsis OWC Tintinnopsis
Figure 25: Phylogeny of Tintinnopsis sp. Based on a Maximum Parsimony Analysis. C.I. = 0.8289, Number of Shortest Trees = 1, Total Length = 304
The OWC Tintinnopsis sequence was aligned with sequences from related taxa located on GenBank. When the Maximum Parsimony analysis was completed, the OWC 62 sample grouped with the GenBank comparison sequence, Tintinnidium mucicola. The
Bootstrap support for this clade was 100, which strongly supports that the OWC and the
Tintinnidium mucicola sequences are related. The species shown in the analysis to be sister to this OWC and GenBank clade was the Favella species, Favella panamensis, and the Bootstrap support of 88 was obtained for this arrangement.
Peridinium: Habitat: lentic waters; Collection Site: Bath Nature Preserve, Round Pond;
Observed diagnostic characteristics: heavily thecated body with ornamented plates, usually photosynthetic, cells are rounded to oval in shape, cingulum groove with flagella, typical whirling motion when swimming; (See Figure 26); Preliminary morphological taxonomic identification: Peridinium sp.
Figure 26: Photograph of Protargol stained Peridinium sp.
63 An 18S sequence was obtained from five isolated cells obtained from a BNP field
sample. A BLAST search of this sequence showed that the closest existing sequence at
the time on GenBank was that of Peridinium gatunense (Accession number DQ166208),
which showed a 97 percent similarity value. Related sequences from Peridinium cinctum
(DQ166209), Peridinium foliaceum (AF231804), Peridinium balticum (AF231803),
Peridinium polonicum (AY443017), Peridinium sp. (AF022202), Kryptoperidinium foliaceum strain UTEX LB 1688 (AF274268) and Pentapharsodinium tyrrhenicum
(AF022201) were used in phylogenetic analysis of the BNP sequence. No ambiguous bases were removed before the analysis suggesting high similarities of all of these sequences. Results of the analysis are shown in Figure 27 Bootstrap values in bold.
64 23 Peridinium cinctum DQ166209
4 Peridinium Peridinium foliaceum AF231804 99 100 27 Kryptoperidinium foliaceum (strain UTEX-LB 1688) Kryptoperidinium 100 AF274268 36 16 Peridinium balticum AF231803 90 Peridinium
72 6 Pentapharsodinium tyrrhenicum AF022201 100 Pentapharsodinium
36 16 Peridinium polonicum AY443017 100
47 Peridinium sp. AF022202 Peridinium 16 Peridinium gatunense DQ166208 10 88 24 10 Peridinium BNP changes
Figure 27: Phylogeny of Peridinium sp. Based on a Maximum Parsimony Analysis. C.I. = 0.8356, Number of Shortest Trees = 1, Total Length = 432
A Maximum Parsimony analysis conducted for the BNP sample showed it grouped closest to the comparison sequence of Peridinium gatunense from GenBank.
This close association strongly supports the idea that the BNP and Peridinium gatunense are related. The Peridinium samples themselves were shown to form a paraphyletic assemblage with Petnapharsodinium tyrrhenicum embedded in the phylogeny. A
Bootstrap support value of 88 was calculated for this arrangement. The Peridinium sample of Peridinium cinctum was also quite similar to the BNP and Peridinium gatunense samples. The remaining related taxa used in the analysis formed a
65 paraphyletic clade that was highly divergent from the two samples most closely
associated with the BNP sample.
A study conducted by Saldarriaga et al used small subunit rRNA molecular data
to discuss dinoflagellate evolution (2004). One of the phylogenetic analyses used in their
study was a gamma-corrected distance matrix analysis including 117 Alveolate species,
where Dinoflagellates were the most numerous (Saldarriaga et al., 2004). There analyses
showed a very similar phylogeny to that shown above. The paper also discussed the
importance of dinoflagellates as common members of planktonic communities, parasites
of many species and toxin producers. This study found the species to be very common at
its sampling location.
Ceratium: Habitat: lentic waters; Collection Site: Bath Nature Preserve, Garden Pond;
Observed diagnostic characteristics: three ornamental horns, heavily thecated body with ornamental plates, pale to golden yellow in color, cingulum groove with flagella, characteristic whirling motion when swimming; (See Figure 28); Preliminary
morphological taxonomic identification: Ceratium sp.
66
Figure 28: Photograph of Protarol stained Ceratium sp.
An 18S sequence was obtained from three isolated cells obtained from a BNP field sample. The sample sequence was BLAST searched and the closest GenBank sequence (99 percent similarity) was found to be that of Ceratium hirundinella
(Accession number AY443014). Several related taxa were used in the continuing analysis. These sequences were those of Ceratium furca (AJ276699) Ceratium fusus
(AF022153), Ceratium tenue (AF022192), Amphidiniella sedentaria (AB212091),
Ceratocorys horrida (AF022154), Crypthecodinium cohnii (DQ241737), Gonyaulax fragilis (AY672702), Thecadinium mucosum (AY1238477), and Fragilidium subglobosum (AF033869). Base pair portions that were unable to be unambiguously aligned (0-41, 105-113, 233-243, 875-886, 1700-end) were removed from the analysis.
Figure 29 shows the completed Heuristic search with Bootstrap values in bold.
67
11 Ceratium tenue AF022192
14 Ceratium furca AJ276699 Ceratiaceae
15 Ceratium fusus AF022153
70 Ceratocorys horrida AF022154 Ceratocoryaceae 30 106 33 Amphidiniella sedentaria AB212091 Amphidiniella 14 106 96 37 Thecadinium mucosum AY238477 Oxytoxaceae 69 95 Gonyaulax fragilis AY672702 46 Gonyaulax 136 95 47 Fragilidium subglobosum AF033869 Pyrophacaceae 100 52 144 Crypthecodinium cohnii DQ241737 Crypthecodiniaceae 1 Ceratium hirundinella AY443014 70 Ceratiaceae 100 10 50 Ceratium BNP changes
Figure 29: Phylogeny of Ceratium sp. Based on a Maximum Parsimony Analysis. C.I. = 0.7204, Number of Shortest Trees = 1, Total Length = 1080
A Maximum Parsimony analysis was conducted on a sample of Ceratium taken from Garden Pond at the Bath Nature Preserve (BNP). The BNP sample was shown to have the closest relationship with the GenBank sample for Ceratium hirundinella. This clade was supported by a 100 Bootstrap support value. Furthermore, the BNP sample and comparison sequence were shown to be closely related to the other three Ceratium
GenBank samples used in the alignment (Ceratium furca, Ceratium fusus and Ceratium tenue). The Bootstrap support value for the arrangement of the clade containing these three Ceratium samples was 96. The close relationship of the BNP Ceratium sample to
68 both the comparison sequence, Ceratium hirundinella, and the other included Ceratium
samples supports the close relationship of these sequences.
The 2004 study conducted by Saldarriaga et al that studied dinoflagellate evolution included analyses that involved four species of Ceratium. A gamma-corrected distance matrix analysis involving multiple Aveolate species was conducted and the
Ceratium samples all grouped together into a single clade with Ceratium hirundinella
illustrating more genetic differences (Saldarriaga et al., 2004). The Bootstrap value of
88 was obtained for that group. The four species included in the analysis were Ceratium
tripos, Ceratium lineatum, Ceratium hirundunella and Ceratium fusus, which was used in
the OWC 18S analysis as well. Also, as previously discussed, the paper describes the
importance of dinoflagellate species in aquatic habitats. Ceratium was discovered to be a
common taxa at the BNP sampling location.
Vorticella: Habitat: commonly attached to benthic substrates; Collection Site: Bath
Nature Preserve, Garden Pond; Observed diagnostic characteristics: cells possess a smooth contractile stalk with ability for helical contractions, the cells are pyriform in shape when extended and cylindrical when contracted, contractile vacuole exists, cell
possess a pellicle, oral opening is near anterior portion of the cell, attached to substrates;
(See Figure 30); Preliminary morphological taxonomic identification: Vorticella sp.
69
Figure 30: Photograph of live Vorticella sp.
An 18S sequence was obtained from three isolated cells obtained from a BNP
field sample. The sequence was BLAST searched and the sequence that yielded the
highest similarity was that of Vorticella fusa (Accession number DQ196468). The
sequence similarity value between these two sequences was 99 percent. Also, a taxonomic search was conducted on Vorticella using GenBank and related taxa with sequence data were chosen for a MP analysis. The related taxa included were: Vorticella
fusa (DQ196468), Vorticella campanula (AF335518), Vorticella microstoma
(AF070701), Carchesium polypinum (AF401522), Epicarchesium abrae (DQ190462),
Pseudovorticella punctata (DQ190466), Zoothamnium arbuscula (AF401523) and
Vaginicola crystalline (AF401521). Base pairs showing ambiguity amongst included
taxa (0-46, 687-700, 630-665, 1699-1720, 1754-end) were removed from the analysis.
70 Figure 31 shows the tree resulting from the Heuristic MP analysis with Bootstrap values
beneath in bold.
33 Pseudovorticella punctata DQ190466 Pseudovorticella
35 Epicarchesium abrae DQ190462 Epicarchesium
30 Carchesium polypinum AF401522 14 Carchesium 84 43 Zoothamnium arbuscula AF401523 24 Zoothamnium 68 71 Vaginicola crystallina AF401521 25 Vaginicola 80 16 92 Vorticella microstoma AF070701 53 17 Vorticella campanula AF335518 14 Vorticella 10 97 Vorticella BNP
7 6 97 2 Vorticella fusa DQ190468 10 changes
Figure 31: Phylogeny of Vorticella sp. Based on a Maximum Parsimony Analysis. C.I.= 0.8055, Number of Shortest Trees = 2, Total Length = 401
Here, the results of a Maximum Parsimony analysis conducted on the Bath Nature
Preserve sample of Vorticella show that it groups closest to the GenBank comparison sequence for Vorticella fusa. The GenBank sample for Vorticella campanula also groups closely with these samples showing high sequence homology, although the Vorticella samples show themselves to be paraphyletic. The Vorticella samples group both within a clade including the Bath Nature Preserve sample and in another clade with a Vaginicola
71 sample, Vaginicola crystallina. A 97 Bootstrap support was shown for the clade
containing the BNP sample and the comparison sequence. A Bootstrap support of 97
also accompanies the relationship of the Vorticella campanula sample to the above mentioned two sequences. The close association of the BNP sequence to that of the included GenBank Vorticella fusa sequence supports a close relationship between these two sequences.
A recently published paper concerned with the phylogenetic relationships surrounding the Subclass Peritrichia, including a focus on the genus Epistylis, included several samples of Vorticella species in the analysis (Miao et al., 2001). The tree resulting from Maximum Parsimony analysis showed the Vorticella samples to be paraphyletic. Vorticella campanula and Vorticella microstoma grouped together into one clade and Vorticella convallaria was shown to group with a sample of Opisthonecta henneguyi (Miao et al., 2001). The paper discusses that members of the Epistylis Genus, of which Vorticella species are a member, are commonly found in freshwater. This was found to be true of the Vorticella taxa isolated from BNP as well.
72
CHAPTER V
SUMMARY
This project yielded sequence data for both single cell isolates and for the three
community sites used for structure analysis. Complete 18S sequence data was acquired
for ten single cell isolates. Multiple sequences, 107 from Site 1, 84 from Site 3 and 98
from Site 4, were analyzed for the community analysis data. Each of these sequences
was subjected to a BLAST search to identify the taxa represented. The results of these
analyses were then grouped into broad taxonomic categories according to the
classification scheme utilized by GenBank.
Community Studies
Sequences derived from each of the three sites revealed differences in community
structure among the three sites. The upstream site was predominated by Stramenopile,
Cryptophyte, Ciliophora and Rotifer taxa with small numbers of Viridinales,
Dinoflagellates, Cercozoa and Centroheliozoa taxa. The estuary collection site, Site 3,
was dominated by Rotifers and Ciliophora with Cryptophyte, and Stramenopile categories also accounting for a large portion of the sequences examined.
Dinoflagellates, Viridinales and Cercozoa categories also made up a small percentage of sequences. In addition, sequences from two categories, Chlamydomonas and
73 Ichthyosporea, were seen at very low numbers at Site 3 that were not obtained from the upstream site. The lake site, Site 4, was dominated by sequences from the Stramenopile,
Viridinales, Cryptophyte and Ciliophora categories. Sequences identified via BLAST search identification and grouped into Chlamydomonas, Cercozoa, Rotifer,
Dinoflagellate categories also made up a small portion of the total sequences. In addition, several samples from other taxonomic groups, such as members of the Fungi,
Euglenoid, and Cnidaria were found at the lake site.
What could account for the observed differences in community composition? The most important factor is likely the different habitat conditions at each of the sampling locations. These differences include the amount of water current, sunlight and nutrient availability influence the species present in a location and their abundance. In combination with the molecular sequence data, morphological counts were performed on water samples taken from the three OWC sampling sites on the same day community
DNA analysis material was collected (Lavrentyev, unpublished). These counts revealed that the dominant groups seen at OWC Site 1 were the Stramenopile, Alveolata and
Cryptophyta. The same three dominant species were observed at Site 3. Stramenopile,
Alveolata, Chlorophyta and Cryptophyta were observed to be dominant at Site 4. This morphological data is in general agreement with the findings based on molecular sequence data, which showed the same major groups as being dominant in the molecular analyses.
74 Single Cell analyses
Complete 18S sequence data was acquired for a total of ten single cell protist
isolates from OWC and BNP. Generally, the taxa isolated were conspicuous taxa at the date and location of sampling. A few exceptions are the Vorticella and Dileptus taxa, which were not as abundant during collection. Each taxa, with the exception of
Monodinium, also had at least one available 18S sequence on GenBank that could be used as a comparison sequence.
Each completed sequence from multiple sequence reactions was subjected to a
BLAST search on GenBank. The GenBank taxa that showed the highest sequence similarity value was considered the comparison sequence. All of the tentative morphological taxa identifications made during collection were supported by the BLAST analyses. The sequence similarities differed among the single cell isolates. Several taxa,
Synura sp., Dileptus sp., Codonella sp., Coleps sp., Ceratium sp., and Vorticella sp.,
appeared to be identical with a 98% or higher sequence similarity with the available
GenBank sequence. Others, Peridinium sp., Tintinnopsis sp., Strombidium sp., and
Monodinium sp., all had high sequence similarity, 96-97 percent, with comparison
GenBank sequences.
Initially the procedures used to isolate and amplify single or a few cells proved challenging. After the sample water was filtered, using previously described techniques, the water was viewed under the dissecting microscope (Olympus SZX-TR30) and
75 tentatively identified based on body shape, behavior and characteristic swimming patterns with the assistance of published references (Foissner and Schaumburg, 1999;
Wehr and Sheath, 2003). The cell then had to be captured manually using a micropipette and viewed again on a separate microscope slide to confirm the correct cell had been isolated. Often, this was a difficult process due to the speed or swimming pattern of the targeted organism. This procedure was repeated at least two more times before the cells were transferred to a labeled microcentrifuge tube and frozen using liquid Nitrogen.
Replicate tubes were made for each selected taxa. DNA extraction difficulties included no extraction of DNA during the PCR reactions and contamination problems on the isolation slides, in the micropipette or in the water used during the isolation.
Morphological techniques provided difficulties such as low concentrations of target cells that could be used in the Protargol staining and the necessity of changes in the Protargol staining procedure to provide the best staining result.
Continuing work will be both challenging and beneficial in providing more information on protist taxa. The techniques have been shown to work on common to moderately abundant taxa and are expected to work on rarer taxa as well. Potential problems may exists in locating the rare target cells for capture, acquiring enough cells for replicate isolations for molecular treatment, and the preservation of a large enough quantity of material for use in Protargol staining.
76
REFERENCES
Baroin-Tourancheau, Anne, Pilar Delgado, Roland Perasso and Andre Adoutte. 1992. “A Broad Molecular Phylogeny of Ciliates: Identification of Major Evolutionary Trends and Radiations Within the Phylum.” Proc. Natl. Acad. Sci. USA 89:9764- 9768.
Bowers, Holly A., Torstein Tengs, Howard B. Glasgow Jr., Joann M. Burkholder, Parke A. Rublee and David W. Oldach. 2000. “Development of Real-Time PCR Assays for Rapid Detection of Pfiesteria piscicida and Related Dinoflagellates.” Applied and Environmental Microbiology 66:4641-4648.
Belykh, Olga I., Ekaterina A. Semenova, Konstantin D. Kuznedelov, Elena I. Zaika and Nina E. Guselnikova. 2000. “A Eukaryotic Alga from Picoplankton of Lake Baikal: Morphology, Ultrastructure and rDNA Sequence Data.” Hydrobiologia 435:83-90.
Caroppo, Carmela. 2000. “The Contribution of Picophytoplankton to Community Structure in a Mediterranean Brackish Environment.” Journal of Plankton Research 22:381-397.
Corliss, John O. 1974. “The Changing World of Ciliate Systematics: Historical Analysis of Past Efforts and a Newly Proposed Phylogenetic Scheme of Classification for the Protistan Phylum Ciliophora.” Systematic Zoology 23:91-138.
Corliss, John O. 1979. “The Ciliated Protozoa: Characterization, Classification, and Guide to the Literature, ed. 2. Pergamon, New York.
Corliss, John O. 2002. “Biodiversity and Biocomplexity of the Protists and an Overview of Their Significant Roles in Maintenance of Our Biosphere.” Acta Protozoologica 41:199-219.
Fenchel, Tom. 1987. Ecology of Protozoa. New York: Science Tech Publishers.
Fenchel, Tom and Bland J. Finlay. 2004. “The Ubiquity of Small Species: Patterns of Local and Global Diversity.” BioScience 54:777-784.
77 Finlay, Bland J. 2002. “Global Dispersal of Free-Living Microbial Eukaryote Species.” Science 296:1061-1063.
Finlay, Bland J. 2004. “Protist Taxonomy: An Ecological Perspective.” Phil. Trans. R. Soc. London. 359:599-610.
Finlay, B.J. and G.F. Esteban. 1998. “Freshwater Protozoa: Biodiversity and Ecological Function.” Biodiversity and Conservation 7:1163-1186.
Foissner, Wilhelm. 1999. “Protist Diversity: Estimates of the Near-Imponderable.” Protist 150:363-368.
Foissner, W., H. Berger, and J. Schaumburg. 1999: Identification and Ecology of Limnetic Plankton Ciliates. Informationsberichte des Bayer. Landesamtes fur Wasserwirtschaft, Heft 3/99, 793 pp.
Fried, Johannes, Wolfgang Ludwig, Roland Psenner and Karl Heinz Schleifer. 2002. “Improvement of Ciliate Identification and Quantification: a New Protocol for Fluorescence In Situ Hybridization (FISH) in Combination with Silver Staining Techniques.” Systematic and Applied Microbiology 25:555-571.
Gilbert, D. 1993. SeqApp. Version 1.9a157. Biocomputing Office, Biology Department, Indiana State University, Bloomington.
Greenwood, Spencer J., Mitchell L. Sogin and Denis H. Lynn. 1991. “Phylogenetic Relationships Within the class Oligohymenophorea, Phylum Ciliophora, Inferred from the Complete Small Subunit rRNA Gene Sequences of Colpidium campylum, Glaucoma chattoni and Opisthonecta henneguyi.” Journal of Molecular Evolution 33:163-174.
Hall, Barry G. 2004. Phylogenetic Trees Made Easy: A How-To Manual ed 2. Sinauer Associates, Inc. Sunderland, Massachusetts.
Hammer, Astrid C., and Jonathan W. Pitchford. 2005. “The Role of Mixotrophy in Plankton Bloom Dynamics, and the Consequences for Productivity.” ICES Journal of Marine Science 62:833-840.
Hammerschmidt, Brigitte, Martin Schlegel, Denis H. Lynn, Detlef D. Leipe, Mitchell L. Sogin and Igor B. Raikov. 1996. “Insights into the Evolution of Nuclear Dualism in the Ciliates Revealed by Phylogenetic Analysis of rRNA Sequences.” Journal of Eukaryotic Microbiology 43:225-230.
78 Hewitt, Elizabeth A., Kirsten M. Muller, Jamie Cannone, Daniel J. Hogan, Robin Gutell and David M. Prescott. 2003. “Phylogenetic Relationships Among 28 Spirotrichous Ciliates Documented by rDNA.” Molecular Phylogenetics and Evolution 29:258-267.
Hirt, Robert P., Patricia L. Dyal, Mark Wilkinson, Bland J. Finlay, David McL. Roberts and T. Martin Embley. 1995. “Phylogenetic Relationships Among Karyorelictids and Heterotrichs Inferred from Small Subunit rRNA Sequences: Resolution at the Base of the Ciliate Tree.” Molecular Phylogenetics and Evolution 4:77-87.
Jurgens, Klaus and Erik Jeppesen. 2000. “The Impact of Metazooplankton on the Structure of the Microbial Food Web in a Shallow, Hypertrophic Lake.” Journal of Plankton Research 22:1047-1070.
Kasprzak, Peter, Frank Gervais, Rita Adrian, Winfried Weiler, Robert Radke, Ines Jager, Silke Riest, Ulrike Siedel, Beate Schneider, Michael Bohme, Reiner Eckmann and Norbert Walz. 2000. “Trophic Characterization, Pelagic Food Web Structure and Comparison of Two Mesotrophic Lakes in Brandenburg (Germany).” International Review of Hydrobiology 85:167-189.
Kuipers, Bouwe, Harry Witte, Govert van Noort and Santiago Gonzalez. 2003. “Grazing Loss-rates in Pico- and Nanoplankton in the Faroe-Shetland Channel and Their Different Relations with Prey Density.” Journal of Sea Research 50:1-9.
Lynn, Denis, H. 1996. “My Journey in Ciliate Systematics.” The Journal of Eukaryotic Microbiology 43: 253-260.
Lynn, D.H. and M.L. Sogin. 1988. “Assessment of the Phylogenetic Relationships Among Ciliated Protists Using Partial Ribosomal RNA Sequences Derived from Reverse transcripts.” BioSystems 21:249-254.
Lynn, Denis H., Andre-Denis G. Wright, Martin Schlegel and Wilhelm Foissner. 1999. “Phylogenetic Relationships of Orders Within the Class Colpodea (Phylum Ciliophora) Inferred from Small Subunit rRNA Gene Sequences.” Journal of Molecular Evolution 48:605-614.
Miao, Wei, Yu-He Yu and Yun-Fen Shen. 2001. “Phylogenetic Relationships of the Subclass Peritrichia (Oligohymenophora, Ciliophora) with Emphasis on the Genus Epistylis, Inferred from Small Subunit rRNA Gene Sequences.” Journal of Eukaryotic Microbiology 48:583-587.
Modenutti, Beatriz, Claudia Queimalinos, Esteban Balseiro and Mariana Reissig. 2003. “Impact of Different Zooplankton Structures on the Microbial Food Web of a South Andean Oligotrophic Lake.” Acta Oecologica 24:S289-S298.
79 Patterson, David J. 1999. “The Diversity of Eukaryotes.” The American Naturalist 65:S96-S124.
Petroni, Giulio, Fernando Dini, Franco Verni and Giovanna Rosati. 2002. “A Molecular Approach to the Tangled Intragenetic Relationships Underlying Phylogeny in Euplotes (Ciliophora, Spirtotrichea).” Molecular Phylogenetics and Evolution 22:118-130.
Saldarriaga, Juan F., F.J.R. “Max” Taylor, Thomas Cavalier-Smith, Susanne Menden- Deuer and Patrick J. Keeling. 2004. “Molecular Data and the Evolutionary History of Dinoflagellates.” European Journal of Protistology 40:85-111.
Savin, M.C., J.L. Martin, M. LeGresley, M. Giewat and J. Rooney-Varga. 2004. “Plankton Diversity in the Bay of Fundy as Measured by Morphological and Molecular Methods.” Microbial Ecology 48:51-65.
Schlegel, M., H.J. Elwood and M.L. Sogin. 1991. “Molecular Evolution in Hypotrichous Ciliates: Sequence of the Small Subunit Ribosomal RNA Genes from Onychodromus quadricornutus and Oxytricha granulifera (Oxytrichidae, Hypotrichida, Ciliophora).” Journal of Molecular Evolution 32:64-69.
Skibbe, O. 1994. “An Improved Quantitative Protargol Stain for Ciliates and Other Planktonic Protists.” Arch Hydrobiol 130:339-347.
Small, E.B. and D.H. Lynn. 1981. “A new macrosystem for the phylum Ciliophora Dolflein 1901.” BioSystems 14:387-401.
Small, E.B. and D.H. Lynn. Phylum Ciliophora. 1985. In: Lee, JJ, S.H. Hunter and E.C. Bovee (eds) “An Illustrated Guide to the Protozoa.” Society of Protozoology, Lawrence, KS, pp 393-575.
Sogin, Mitchell L., and Patterson, David J. Alveolates. Version 01 January 1995 (under construction). http://tolweb.org/Alveolates/2379/1995.01.01 in The Tree of Life Project, http://tolweb.org
Sogin, Mitchell L., and Patterson, David J. Stramenopiles. Version 01 January 1995 (under construction). http://tolweb.org/Stramenopiles/2380/1995.01.01 in The Tree of Life Web Project, http://tolweb.org
Sommer, Ulrich, Herwig Stibor, Alexis Katechakis, Frank Sommer and Thomas Hansen. 2002. “Pelagic Food Web Configurations at Different Levels of Nutrient Richness and Their Implications for the Ratio Fish Production: Primary Production.” Hydrobiologia 484:11-20.
80 Stechmann, Alexandra, Martin Schlegel and Denis H. Lynn. 1998. “Phylogenetic Relationships Between Prostome and Colpodean Ciliates Tested by Small Subunit rRNA Sequences.” Molecular Phylogenetics and Evolution 9:48-54.
Struder-Kypke, Michaela C. and Denis H. Lynn. 2003. “Sequence Analyses of the Small Subunit rRNA Gene Confirm the Paraphyly of Oligotrich Ciliates Sensu Lato and Support the Monophyly of the Subclasses Oligotrichia and Choreotrichia (Ciliophora, Spirotrichea).” Journal of Zoology, London 260:87-97.
Szelag-Wasielewska, Elzbieta. 2003. “Phytoplankton Community Structure in Non- Stratified Lakes of Pomerania (NW Poland).” Hydrobiologia 506-509:229-236.
Wehr, John D. and Robert G. Sheath (eds.). 2003. Freshwater Algae of North America: Ecology and Classification. Academic Press, Boston, 918 pp.
Wright, Andre-Denis G., and Denis H. Lynn. 1997. “Monophyly of the Trichostome Ciliates (Phylum Ciliophora: Class Litostomatea) Tested Using New 18S rRNA Sequences from the Vestibuliferids, Isotricha intestinalis and Dasytricha ruminantium, and the Haptorian Didinium nasutum.” European Journal of Protistology 33:305-315.
Yuan, Jie, Min-Yi Chen, Peng Shao, Hui Zhou, Yue-Qin Chen and Liang-Hu Qu. 2004. “Genetic Diversity of Small Eukaryotes from the Coastal Waters of Nansha Islands in China.” FEMS Microbiology Letters 240:163-170.
Zeidner, Gil and Oded Beja. 2004. “The Use of DGGE Analyses to Explore Eastern Mediterranean and Red Sea Marine Picophytoplankton Assemblages.” Environmental Microbiology 6:528-534.
Zeidner, Gil, Christina M. Preston, Edward F. Delong, Ramon Massana, Anton F. Post, David J. Scanlan and Oded Beja. 2003. “Molecular Diversity Among Marine Picophytoplankton as Revealed by PsbA Analyses.” Environmental Microbiology 5:212-216.
81