Enteric Oxalate Secretion Mediated by Slc26a6 Defends Against Hyperoxalemia in Murine Models of Chronic Kidney Disease

BASIC RESEARCH www.jasn.org

Enteric Oxalate Secretion Mediated by Slc26a6 Defends against Hyperoxalemia in Murine Models of Chronic Kidney Disease

Laura I. Neumeier,1 Robert B. Thomson,2 Martin Reichel ,3 Kai-Uwe Eckardt,3 Peter S. Aronson,2,4 and Felix Knauf 2,3

1Department of Nephrology and Hypertension, Friedrich Alexander Universität Erlangen-Nürnberg, Erlangen, Germany 2Department of Internal Medicine, Section of Nephrology, Yale University School of Medicine, New Haven, Connecticut 3Department of Nephrology and Medical Intensive Care, Charité Universitätsmedizin Berlin, Berlin, Germany 4Department of Cellular and Molecular Physiology, Yale University School of Medicine, New Haven, Connecticut

ABSTRACT Background A state of oxalate homeostasis is maintained in patients with healthy kidney function. How- ever, as GFR declines, plasma oxalate (Pox) concentrations start to rise. Several groups of researchers have described augmentation of oxalate secretion in the colon in models of CKD, but the oxalate transporters remain unidentiﬁed. The oxalate transporter Slc26a6 is a candidate for contributing to the extrarenal clearance of oxalate via the gut in CKD. Methods Feeding a diet high in soluble oxalate or weekly injections of aristolochic acid induced CKD in 2/2 age- and sex-matched wild-type and Slc26a6 mice. qPCR, immunohistochemistry, and western blot analysis assessed intestinal Slc26a6 expression. An oxalate oxidase assay measured fecal and Pox concentrations. Results Fecal oxalate excretion was enhanced in wild-type mice with CKD. This increase was abrogated in 2/2 Slc26a6 mice associated with a signiﬁcant elevation in plasma oxalate concentration. Slc26a6 mRNA and protein expression were greatly increased in the intestine of mice with CKD. Raising Pox without inducing kidney injury did not alter intestinal Slc26a6 expression, suggesting that changes associated with

CKD regulate transporter expression rather than elevations in Pox. Conclusions Slc26a6-mediated enteric oxalate secretion is critical in decreasing the body burden of oxalate in murine CKD models. Future studies are needed to address whether similar mechanisms contribute to intestinal oxalate elimination in humans to enhance extrarenal oxalate clearance.

JASN 31: ccc–ccc, 2020. doi: https://doi.org/10.1681/ASN.2020010105

Because oxalate is excreted by the kidneys, reduced wave velocity and central aortic BP.3,4 Similarly, un- renal function results in increased plasma oxalate recognized or insufﬁciently treated hyperoxalemia

(Pox) concentration as observed in patients with 1,2 CKD and ESKD. There is both experimental Received January 28, 2020. Accepted May 1, 2020. and clinical evidence that indicates a possible role Published online ahead of print. Publication date available at of elevated Pox concentration in the development of www.jasn.org. cardiovascular complications in patients with Correspondence: Prof. Felix Knauf, Department of Nephrology and ESKD.Forinstance,elevatedPox concentrations Medical Intensive Care, Charité Universitätsmedizin Berlin, Charitéplatz have been associated with cardiac ﬁbrosis and ele- 1, 10117 Berlin, Germany. Email: [email protected] vated hemodynamic parameters, such as pulse Copyright © 2020 by the American Society of Nephrology

JASN 31: ccc–ccc, 2020 ISSN : 1046-6673/3109-ccc 1 BASIC RESEARCH www.jasn.org in the setting of kidney transplantation can have severe impli- Significance Statement cations for renal allograft survival.5,6 Hence, an understanding of oxalate homeostasis in health and disease is critical to de- Fecal oxalate excretion is critical in oxalate balance with progression velop new treatment strategies to decrease the body burden of of CKD. However, the identity of the transporter(s) responsible for oxalate and its consequences. increased intestinal oxalate secretion in CKD is unknown. Intestinal expression of oxalate transporter Slc26a6 is strongly upregulated in Slc26a6 is an oxalate transporter expressed in multiple ep- two murine models of CKD. Deletion of Slc26a6 completely abrogates ithelial tissues, including the kidney and intestine.7 Slc26a6 enhanced fecal oxalate excretion in CKD, increasing plasma oxalate can function in several exchange modes but primarily operates concentration. This study demonstrates that Slc26a6 mediates in- as a chloride-oxalate exchanger.8 Transcellular oxalate secre- testinal oxalate secretion and mitigates hyperoxalemia in murine CKD fi tion via Slc26a6 in the intestine plays a pivotal role in medi- models. The ndings suggest that pharmacologic approaches en- hancing intestinal Slc26a6 activity may stimulate extrarenal clearance ating back flux of oxalate to limit its net absorption. 2/2 of oxalate and prevent hyperoxalemia in CKD. Future studies are Slc26a6 mice demonstrated hyperoxalemia, hyperoxalu- needed to address whether similar mechanisms contribute to in- ria, and calcium-oxalate stones.9,10 The elevated concentra- testinal oxalate elimination in humans to enhance extrarenal oxalate 2/2 clearance. tions of Pox and urine oxalate in Slc26a6 mice were greatly ameliorated when mice were fed an oxalate-free diet,9 suggesting that an intestinal defect of Slc26a6-mediated oxalate se- local authorities in the State of Bavaria, Germany and the Yale cretion leads to an increased net intestinal oxalate absorption University Institutional Animal Care and Use Committee. and renal oxalate excretion. Upregulation of oxalate secretion in the colon in rat mod- AA Injections els of CKD was described by different groups of investigators Mice received a single or weekly intraperitoneal injections fi over 20 years ago prior to the molecular identi cation of with AA (Sigma-Aldrich Chemie GmBH, Steinheim, Germany). 11–13 oxalate transporters. These observations suggested that The average injection volume contained 200 mlofAAdiluted intestinal oxalate secretion may play an important role in in PBS to a dose of 1.5 mg/kg and was individually adapted mitigating the hyperoxalemia of CKD and its complications. for each mouse depending on the body weight on the day of Given the role of oxalate transporter Slc26a6 in oxalate ho- injection. The stock solution of AA consisting of powder was meostasis described above, we examined whether intestinal dissolved in 100% DMSO and diluted in PBS. Fresh AA in- expression of Slc26a6 is upregulated in CKD and whether jection solution was prepared prior to each injection. Control Slc26a6-mediated oxalate secretion in the intestine mitigates mice received DMSO/PBS as vehicle. the hyperoxalemia of CKD. Assessment of Renal Function Retro-orbital blood samples were obtained weekly. In order to METHODS prevent clotting, 5–20 ml125mM EDTA was added to a sterile 1.5-ml collection tube. The blood was centrifuged for Animal Studies 10 minutes at 7000 rpm at room temperature using a BIOFUGE All animal studies were performed on 12- to 16-week-old male fresco Heraeus centrifuge (Thermo Fisher ScientificInc., wild-type mice. All experiments except those using Waltham, MA) in order to separate plasma from blood cells. Slc26a62/2 mice were performed using C57BL/6N mice ob- Plasma was collected and stored at 220°C. Plasma creatinine tained from Charles River Laboratory (Sulzfeld, Germany); and BUN levels were measured using a Cobas Integra 800 129S6 mice were used as wild-type mice for the control and 2/2 autoanalyzer (Roche, Mannheim, Germany) by enzymatic aristolochic acid I (AA) CKD group to match the Slc26a6 2/2 measurement. background. The generation of Slc26a6 mice on a 129S 9 background was previously described. The 129S6 wild-type Measurement of Fecal Oxalate and Pox Concentrations mice were from Taconic Biosciences, Inc. (Rensselar, NY) and Pox and fecal oxalate were measured by an oxalate-oxidase bred in the Yale Animal Resources Center. All mice were assay as previously described.9,14 In brief, samples were housed at a 12-hour day/night cycle with free access to tap centrifuged to allow protein separation using 30-kD (plasma) water and food pellets. Mice were kept in groups of five in molecular weight cutoff filters (Sartorius Biotech GmbH, ventilated and pathogen-free cages. Synthetic mouse diets Goettingen, Germany) and acidified with 1 M hydrochloric with varying sodium oxalate concentrations of either high ox- acid. Oxalate concentration measurement was performed by alate (0.67% sodium oxalate), low oxalate (0.134% sodium using the Trinity Biotech Kit (Bray, Ireland). oxalate), or control (0% Oxalate) were obtained from Ssniff (Soest, Germany) and Envigo (Madison, WI). Oxalate- Real-Time RT-PCR containing diets were virtually calcium free to provide oxalate Mice were anesthetized with 2% isoflurane mixed with 1 L in soluble form. Animals were placed on the desired diet for a oxygen per minute and euthanized by neck fracture. Intestinal time period of 21 days after being placed on control oxalate- tissue was harvested, snap frozen in liquid nitrogen, and stored free diet for 3 days. All animal protocols were approved by the at 280°C until further use. Total RNA was isolated using a

2 JASN JASN 31: ccc–ccc,2020 www.jasn.org BASIC RESEARCH

Table 1. Primer sequences used to determine mRNA PA) at 1:20,000 dilution was used. Antibody labeling was vi- expression levels sualized by enhanced chemiluminescence (Clarity; Bio-Rad, Target Primer Sequence (59 to 39) Hercules, CA) and captured on film. Membrane staining with 18s Forward: TTGATTAAGTCCCTGCCCTTTGT Coomassie Brilliant Blue was used as loading control. Speci- Reverse: CGATCCGAGGGCCTCACTA ficity of R29 antibody was verified by comparison of immu- 2/2 Slc26a6 Forward: CAGTTCTTTCTACCCCGTCTTC noblotting of wild-type and Slc26a6 tissue. Reverse: CACACTGCCCACCATCACAG Slc26a1 Forward: ACAACACTGATCATTGGGCTACA Immunocytochemistry for Intestinal Slc26a6 Expression Reverse: GCCGGAGGATACCCATGAG Tissue was embedded in Epon 812 (Electron Microscopy Sci- Slc26a2 Forward: ACCTTCATGGCTGGAGTTTATCAG ences, Hatfield, PA) and processed for immunocytochemistry Reverse: CTGAGACGTGAGGATGGTGAAG as described previously.15 In brief, 1-mm sections were subjected Slc26a3 Forward: CTGCAGCCGCTACAAAAGTC to antigen retrieval and then labeled with a rabbit polyclonal Reverse: TTTTCCACAATCTGCCTATTTCAG antibody directed against Slc26a6 (R29; 1:10,000 dilution). Pri- Sglt-1 Forward: GACATCTCAGTCATCGTCATC Reverse: TGTGATTGTATAAAGGGCAGTG mary antibody labeling was visualized by incubation with a fl Cat-1 Forward: GGGTTTATGCCCTTTGGATT uorochrome-labeled secondary antibody (donkey anti-rabbit Reverse: TAAGGCATCATGAGCGTGAG Alexa-Fluor 488; 1:200 dilution; Thermo Fisher Scientific, Grand Island, NY). Specificity of R29 was verified by western analysis15 and comparison of immunofluorescence in wild-type 2/2 PureLink RNA Mini Kit (catalog no. 12183018A; Ambion, and Slc26a6 tissue. Austin, TX) following the manufacturer’s instructions. The frozen tissue was homogenized by a T25 basic ULTRA-TUR- Statistical Analyses RAX dispersing device (IKA-Werke GmbH & Co. KG, Staufen, Data are presented as mean 6 SEM. Unpaired, two-tailed t test Germany) in 500 ml lysis buffer containing 1% 2- was used for determining statistical significance, in which a P mercaptoethanol. RNA was quantified and subjected to re- value ,0.05 was considered as significant. verse transcription using Thermo Scientific RevertAid Reverse Transcription (Thermo Fisher Scientific Inc.). Gene expression measurement was performed using StepOnePlus Real- RESULTS Time PCR System (Thermo Fisher ScientificInc.)with SYBR Green PCR master mix. Detection and evaluation of A Diet High in Soluble Oxalate or Weekly Injections of the samples were performed using StepOne Software (Version AA Induce Progressive CKD 2.3). Expression data were analyzed using the comparative We have recently demonstrated that feeding a diet high in threshold cycle method, and mRNA ratios were calculated soluble oxalate causes progressive kidney failure.14,16 One lim- 2D by 2 comparative threshold cycle; 18S RNA served as the house- itation of the model is that it does not allow study of the effect keeping gene to normalize all mRNA expression values. In of CKD on Pox because it requires feeding of supraphysiologic order to compare groups, expression of each gene in wild- dietary oxalate concentrations resulting in severe hyperoxalemia type animals receiving a control diet was set to one. All primers and hyperoxaluria.14,16 Hence, we established a second model of were obtained from Sigma-Aldrich Chemie GmBH and are progressive CKD in mice by injecting AA.17,18 We performed listed in Table 1. weekly injections of AA and monitored kidney function by mea- suring BUN and creatinine. As shown in Figure 1, weekly injec- Western Blot Analysis tions of AA or feeding mice a diet high in soluble oxalate leads to Mice were anesthetized with 2% isoflurane mixed with 1 L progressive CKD as indicated by rising BUN and creatinine. oxygen per minute and euthanized by neck fracture. Proximal colon was harvested and cleared with ice-cold PBS containing Fecal Oxalate Excretion Is Reduced and Pox 2 2 protease inhibitors (Roche cOmplete; Sigma-Aldrich, St. Concentration Is Increased in Slc26a6 / Mice Louis, MO). Connective tissue was removed, and intestinal In the next series of experiments, we examined whether fecal segments were opened longitudinally. The mucosa was then oxalate excretion is increased in mice with AA-induced CKD. scraped into cold PBS containing protease inhibitors and ho- Animals were maintained on an oxalate-free diet so that fecal mogenized using a Thomas-style glass homogenizer and a ser- oxalate must represent net intestinal oxalate secretion. As rated pestle. Samples were stored at 280°C until further use. shown in Figure 2A, following induction of CKD there was a Intestinal homogenates were solubilized in SDS sample buffer fivefold increase in fecal oxalate excretion. This increase was 2/2 and subjected to SDS-PAGE and western blot analysis. West- abrogated in Slc26a6 mice, indicating that oxalate trans- ern blots were probed with a primary rabbit anti-human porter Slc26a6 is absolutely required for enhanced fecal oxa- Slc26a6 antibody (R29; 1:50,000 dilution). As secondary an- late secretion of endogenously produced oxalate accumulating 2/2 tibody, horseradish peroxidase-conjugated anti-rabbit anti- in CKD. The reduced fecal oxalate excretion in Slc26a6 body (Jackson ImmunoResearch Laboratories, West Grove, mice was accompanied by an increased Pox concentration

JASN 31: ccc–ccc, 2020 Role of Enteric Slc26a6 in CKD 3 BASIC RESEARCH www.jasn.org

AB 250 1.5 *** 200 *** *** *** 1.0 150 OX-CKD *** OX-CKD *** *** *** AA-CKD 100 *** *** AA-CKD *** 0.5 *** Control BUN (mg/dl) Control 50 Creatinine (mg/dl)

0 0.0 Day 0 Week 1 Week 2 Week 3 Day 0 Week 1 Week 2 Week 3

Figure 1. A diet high in soluble oxalate or weekly injections of AA induce CKD. Wild-type mice were fed a control diet (0% calcium and 0% oxalate) or a diet high in soluble oxalate (0% calcium and 0.67% oxalate; termed OX-CKD). In addition, mice on a control diet received weekly intraperitoneal injections of PBS or 1.5 mg/kg AA (termed AA-CKD). (A) Plasma BUN and (B) plasma creatinine were measured at baseline and days 7, 14, and 21. Data are means 6 SEM; n58 for mice on a control diet and receiving PBS injections, n524 for mice receiving AA injections, and n518 for mice on a high-soluble oxalate diet. ***P,0.001 versus control group. compared with wild-type mice with CKD (Figure 2B), indi- expression of Slc26a6 was observed in the duodenum followed cating that enteric oxalate secretion mediated by Slc26a6 plays by decreasing expression in more distal segments of the small asignificant role in defending against hyperoxalemia in CKD. intestine and extremely low expression in the colon, confirming previous findings.19 We next evaluated the expression of Slc26a6 Expression Is Upregulated in Ileum and Slc26a6 along the intestine in the models of progressive CKD Proximal Colon in CKD (Figure 1). Slc26a6 expression was increased in CKD in the Enhanced fecal oxalate excretion in CKD may possibly be ex- ileum and the proximal colon, reaching 8- to 12-fold upreg- plained by the increased Pox concentration in CKD and the ulation in the latter segment (Figure 3B). In addition, we ob- resulting more favorable driving force for secretion. However, served an increased expression of the oxalate transporters given the critical role of Slc26a6 for fecal oxalate excretion in Slc26a1, Slc26a2, and Slc26a320–22 in the proximal colon CKD, we examined whether there might be increased expres- (Figure 3C). To exclude the possibility that the increased ex- sion of Slc26a6 in any segments of the intestine as an addi- pression of members of the Slc26a family of transporters re- tional mechanism for enhanced fecal oxalate secretion sults from general upregulation of intestinal transport in CKD. processes, we also measured proximal colon expression levels Baseline expression of Slc26a6 along the intestinal tract was of glucose (Sglt-1) and amino acid transporters (Cat-1), other measured by quantitative PCR. As shown in Figure 3A, highest representative intestinal transport processes. We observed a

AB40 ns ns *** 40 **

30 30

20 20

Fecal oxalate( μ mol/g) 10 Plasma oxalate ( μ mol/l)

0 0 WT A6-/- WT A6-/- WT A6-/- WT A6-/- Control AA-CKD Control AA-CKD

Figure 2. Slc26a62/2 mice demonstrate reduced fecal and increased Pox concentrations in CKD. (A) Fecal oxalate and (B) Pox concentrations were measured in wild-type (WT) and Slc26a62/2 mice receiving weekly intraperitoneal injections of PBS (control) or 1.5 mg/kg AA (AA-CKD) at 21 days. Data are means 6 SEM from six mice per group. ns, not signiﬁcant versus control group. **P50.01, *** P,0.001 versus control group.

4 JASN JASN 31: ccc–ccc,2020 www.jasn.org BASIC RESEARCH

AB***

3x10-3 25 ** 20 15 Control 2x10-3 * 10 OX-CKD ns AA-CKD 5 ns ns ns -3 1x10 2 Slc26a6/18S

Relative expression 1

Slc26a6 expression/18s rRNA 0 0 Duodenum Jejunum Ileum PC DC Duodenum Jejunum Ileum PC DC C 15 *** ** Slc26a6 10 ** *** ** Slc26a3 * Slc26a2 Slc26a1 5 ** ** ns Cat-1

in proximal colon ns ns ns Relative expression Sglt-1 0 Control AA-CKD OX-CKD

Figure 3. Intestinal Slc26a6 is upregulated in mouse models of CKD. (A) Slc26a6 mRNA expression levels were measured in different intestinal segments of wild-type mice and relative to housekeeping genes. Data are means 6 SEM from five mice. (B) Slc26a6 mRNA expression levels were measured and normalized to control condition in intestinal segments of wild-type mice maintained on a control diet (0% calcium and 0% oxalate) and receiving weekly intraperitoneal injections of PBS (control). In addition, one group of mice received a high-soluble oxalate diet (0% calcium and 0.67% oxalate; termed OX-CKD) or weekly intraperitoneal injections of 1.5 mg/kg AA (termed AA-CKD) for 21 days. Data are means 6 SEM; n58 for mice on a control diet and receiving PBS injections, n512 for mice on a high-soluble oxalate diet, and n510 for mice receiving AA injections. PC5 proximal colon, DC5 distal colon. (C) Slc26a6, Slc26a1, Sglt-1, and Cat-1 mRNA expression levels were measured and normalized to control condition in proximal colon of control mice compared with mice on a diet high in soluble oxalate or receiving AA injections following 21 days. Data are means 6 SEM. For Slc26a6, Slc26a1, Cat-1, and Sglt-1, n58 for mice on a control diet and receiving PBS injections, n510 for mice receiving AA injections, and n512 for mice on a high-soluble oxalate diet. For Slc26a3 and Slc26a2, n56 for mice on a control diet and receiving PBS injections, n58 for mice receiving AA injections, and n56 for mice on a high-soluble oxalate diet. ns, not significant versus control group. *P50.05 versus control group; **P50.01 versus control group; ***P,0.001 versus control group. slight increase of Sglt-1 expression in the oxalate-induced blot of mouse proximal colon of sections prepared from 2/2 CKD model but otherwise, no changes in Cat-1 or Sglt-1 in Slc26a6 mice with CKD was also probed, confirming again AA-induced CKD, suggesting that the changes observed are the absence of a signal and the specificity of our antibody. specific to transporters involved in oxalate homeostasis Together, our findings demonstrate that Slc26a6 expression (Figure 3C). is increased on a transcriptional and protein level in proximal colon of mice with CKD. Slc26a6 Protein Expression Is Increased in Proximal

Colon of Mice with CKD Dietary Oxalate and Pox May Not Serve to Regulate To confirm the striking upregulation of Slc26a6 in the proxi- Slc26a6 Activity mal colon in CKD, we performed immunohistochemistry. As One possible mechanism leading to the adaptive upregulation shown in Figure 4, immunofluorescence microscopy revealed of colonic Slc26a6 in CKD is elevation in Pox. Several intestinal low baseline expression of Slc26a6 that was greatly increased transporters are regulated by their respective substrate. For in colonocytes in CKD (Figure 4B). Staining was absent in example, intestinal glucose transporters are modulated by di- 2/2 Slc26a6 mice, demonstrating the specificity of our anti- etary carbohydrate content.23,24 Hence, in the next series of body (Figure 4C). To evaluate the expression of Slc26a6 by a experiments we examined the effect of feeding a soluble oxa- more quantitative method, we performed immunoblotting of late diet on intestinal Slc26a6 expression. In order to dissect homogenates of epithelial cells from proximal colon of mice the effect of increased dietary and Pox on Slc26a6 expression with CKD. As illustrated in Figure 5, Slc26a6 polypeptide from changes secondary to reduced GFR, we established a di- abundance was clearly higher in mice with CKD than in prox- etary oxalate content that raises Pox concentration yet does not imal colon cell homogenates from control tissue. In order to induce CKD. Therefore, we reduced the dietary oxalate con- demonstrate the specificity of anti-Slc26a6 antibody, western tent from 50 mmol/g sodium oxalate that caused advanced

JASN 31: ccc–ccc, 2020 Role of Enteric Slc26a6 in CKD 5 BASIC RESEARCH www.jasn.org

ABC

CT CKD CKD WT A6 -/-

Figure 4. Slc26a6 expression is increased on the apical membrane of colonocytes in mice with CKD. Immunolocalization of Slc26a6 in the proximal colon of (A) wild-type (WT) mice on a control diet, (B) WT mice on a control diet receiving weekly intraperitoneal injections of 1.5 mb/kg AA, and (C) Slc26a62/2 mice receiving weekly intraperitoneal injections of 1.5 mg/kg AA (CKD), respectively. All sections were probed with the anti-Slc26a6 antibody R29 at a dilution of 1:10,000. All sections were matched for magniﬁcation and exposure, and asterisks label the lumen of proximal colon tissue. Scale bar: 16 mm.

CKD (Figure 1) to 10 mmol/g sodium oxalate. Feeding was maintained on an oxalate-free diet. Under these condi- 10 mmol/g sodium oxalate does not induce CKD as measured tions, an elevation of Pox concentration reflects the accumula- by BUN and creatinine yet significantly raises Pox concentration of endogenously produced oxalate. Feeding mice dietary tion as shown in Figure 6, A–C. We compared the group of oxalate raised Pox concentration but did not alter intestinal mice receiving 10 mmol/g dietary sodium oxalate with a group A6 expression significantly compared with control mice on of mice with CKD following AA injections. The latter group an oxalate-free diet (Figure 6D). Moreover, as previously

AB200 P = 0.0104 150 100 )

3 30 MW (kDa)

10 Arbitrary Dens Units (x10 MW (kDa) 37 0 CT CKD CT CKD CT CKD CKD CT CKD WT A6-/-

Figure 5. Slc26a6 protein expression is increased in proximal colon of mice with CKD. (A) Western analysis of proximal colon homogenates isolated from wild-type (WT) mice maintained on a control diet (CT). In addition, there are tissues of WT mice and 2 2 2 2 Slc26a6 / (A6 / ) mice receiving weekly intraperitoneal injections of 1.5 mg/kg AA (CKD). The upper panel of each blot was probed with the anti-Slc26a6 antibody R29, and the lower panel of each blot was stained with Coomassie Brilliant Blue for use as a protein loading control. All lanes came from the same gel, blot, and ﬁlm exposure. MW, molecular mass. (B) Densitometric analysis of Slc26a6 expression levels depicted in (A). Slc26a6 densitometry values were normalized to corresponding Coomassie Brilliant Blue densi- 2 2 tometry before statistical analysis. Data are means 6 SEM from three separate mice per group, except for one Slc26a6 / to demonstrate speciﬁcity of the antibody. P50.01 versus control group.

6 JASN JASN 31: ccc–ccc,2020 www.jasn.org BASIC RESEARCH

AB 150 0.8 *** *** *** *** 0.6 100 ***

*** 0.4 AA-CKD AA-CKD Low-Ox

BUN (mg/dl) BUN 50 Low-Ox Control

Control Creatinine (mg/dl) 0.2

0 0.0 Day 0 Week 1 Week 2 Week 3 Day 0 Week 1 Week 2 Week 3

C *** D ns (P = 0.128) 20 *** * *** *** 40 15 30 10 20 Slc26a6/18S 5 10 expression relative Plasma oxalate ( mol/l) Plasma oxalate 0 0 Control AA-CKD Low-Ox Control AA-CKD Low-Ox

Figure 6. Enteric Slc26a6 expression is not directly regulated via oxalate. Wild-type mice were fed a control diet (0% calcium and 0% oxalate) and additionally received weekly intraperitoneal injections of PBS (control). A separate group of mice was fed a soluble low- oxalate diet (0% calcium and 0.134% oxalate; termed Low-Ox) or injected weekly with 1.5 mg/kg AA (AA-CKD) for 21 days. (A) Plasma

BUN and (B) plasma creatinine were measured at baseline and days 7, 14, and 21. (C) Pox concentrations were measured in each group of mice at 21 days. (D) Slc26a6 mRNA expression levels were measured and normalized to control condition in proximal colon of control mice, mice receiving a low-oxalate diet, or mice receiving weekly AA injections. Data are means 6 SEM; n58 for mice on a control diet and receiving PBS injections, n514 for mice receiving AA injections, and n58 for mice on a low-soluble oxalate diet. ns, not significant versus control group. *P50.05 versus control group; ***P,0.001 versus control group. showninFigure3C,upregulationofSlc26a6inproximal resulting more favorable driving force for secretion. However, colon was similar in both the AA-induced and high oxalate– we also identified upregulation of Slc26a6 in the ileum and induced CKD models despite high ingested oxalate in the proximal colon on the basis of mRNA expression. The marked latter. Taken together, our findings suggest that elevated di- upregulation of Slc26a6 expression in the proximal colon was etary and Pox concentrations may not serve as the signal to confirmed at the protein level by immunohistochemistry and regulate enteric Slc26a6 expression. immunoblotting. It is therefore possible that upregulation of intestinal Slc26a6 expression may also contribute to the enhanced fecal excretion of oxalate in CKD. However, the abso- DISCUSSION lute level of expression of Slc26a6 in the proximal colon even in CKD is much lower than transporter expression in the small In this study, we confirm that substantial extrarenal clearance intestine, and therefore, it is unclear to what extent the prox- of oxalate occurs via the mouse intestine in CKD, consistent imal colon contributes to enhanced fecal oxalate excretion in with reports from different groups of investigators using rat CKD. Indeed, we were unable to detect active transcellular models.11–13 Moreover, using gene-deficient mice, we demon- oxalate secretion across proximal colon tissue mounted in Us- strate that Slc26a6 is required for the increased intestinal oxa- sing chambers in vitro (data not shown), although this could late secretion in CKD, thereby lowering the body burden of be due to the absence of critical agonists or factors that stim- oxalate as reflected by Pox as schematically summarized in ulate secretion in vivo. We therefore cannot determine to what Figure 7. extent Slc26a6-mediated fecal oxalate excretion in CKD is the Enhanced fecal oxalate excretion in CKD may possibly be result of oxalate secretion in the proximal colon versus the explained by the increased Pox concentration in CKD and the small intestine.

JASN 31: ccc–ccc, 2020 Role of Enteric Slc26a6 in CKD 7 BASIC RESEARCH www.jasn.org

AB Oxalate homeostasis in CKD Defective oxalate Secretion in Slc26a6-/- mice with CKD

Secretion Production Secretion Production Plasma Plasma Slc26a6 oxalate oxalate

Fecal Fecal Oxalate Oxalate

Urine Urine Oxalate Oxalate

Figure 7. Slc26a6 plays a pivotal role to defend against hyperoxalemia in CKD, as shown schematically. (A) As kidney function declines, reduced renal oxalate clearance is partially compensated via increased fecal excretion mediated by oxalate transporter Slc26a6. (B) In the absence of Slc26a6, augmentation of enteric oxalate secretion is abrogated, aggravating hyperoxalemia.

In series with Slc26a6 expressed on the apical membrane of ACKNOWLEDGMENTS the colonocyte, basolateral uptake of oxalate is required for transcellular oxalate secretion. Of interest in this regard, we We thank Michaela Arend and Susanne Rößler for expert technical also demonstrated increased expression of the basolateral oxa- assistance. late transporter Slc26a1 in proximal colon in both CKD models. Dr. Felix Knauf and Ms. Laura Neumeier designed the study 2/2 Although previous studies of Slc26a1 mice under baseline and experiments; Ms. Laura Neumeier, Dr. Martin Reichel, and control conditions could not detect a role of Slc26a1 in intestinal Dr. Robert Thomson performed the experiments; Dr. Peter oxalate transport,25,26 it is quite possible that Slc26a1 contributes S. Aronson, Dr. Kai-Uwe Eckardt, Dr. Felix Knauf, and Ms. Laura to intestinal oxalate secretion when its expression is upregulated Neumeier supervised experiments and interpreted the data; in CKD. We also observed increased expression of additional Ms. Laura Neumeier, Dr. Peter S. Aronson and Dr. Felix Knauf transporters previously suggested to contribute to oxalate ho- wrotethepaper;andDr.PeterS.Aronson,Dr.Kai-UweEckardt, meostasis. Slc26a2 has been suggested to mediate intestinal ox- Dr. Felix Knauf, Ms. Laura Neumeier, Dr. Martin Reichel, and alate secretion in exchange for luminal chloride or sulfate.21 Dr. Robert Thomson reviewed the manuscript. Dr. Kai-Uwe Because enhanced fecal oxalate excretion in CKD was com- Eckardt reports personal fees from Akebia, Bayer, Fresenius, 2/2 pletely abrogated in Slc26a6 mice, our findings indicate Genzyme, and Vifor, and grant support from Amgen and Shire, that Slc26a2 must not play a major role in mediating intestinal outside the submitted work. Dr. Felix Knauf reports personal oxalate secretion in CKD. We also detected increased expression fees from Allena, Oxthera, Fresenius, and Sanofi, outside the of Slc26a3 in proximal colon in CKD. The transporter has been submitted work. previously suggested to mediate transcellular oxalate absorption.22 However, studies using heterologous expression systems to characterize the transport function of Slc26a3 have failed to DISCLOSURES demonstrate robust transport activity for oxalate.27,28 Thus, the role of Slc26a3 in oxalate homeostasis remains uncertain. All authors have nothing to disclose. Human SLC26A6 has been shown to mediate efflux of oxalate in exchange for extracellular chloride at a greater rate than the mouse ortholog.29 The relevance of SLC26A6 expres- FUNDING sion to oxalate homeostasis in humans is further demonstrated by a report of a patient with subclinical celiac disease This study was supported by Deutsche Forschungsgemeinschaft Project KN 1148/4-1 and project number 394046635 (to F. Knauf), the Oxalosis and absence of fat malabsorption in whom hyperoxaluria cor- and Hyperoxaluria Foundation (F. Knauf), Deutscher Akademischer related with markedly reduced expression of SLC26A6 in the Austauschdienst thematic network grant Translational kidney research – intestine.30 However, at present our findings are limited to from physiology to clinical application (TRENAL) (to F. Knauf), National murine models of CKD. Future research will need to examine Institutes of Health grant R01DK33793 (to P.S. Aronson), and George ’ the relevance of intestinal SLC26A6 in humans in order to M. O Brien Kidney Center at Yale grant P30DK079310. L. Neumeier is a fi recipient of a TRENAL, Interdisziplinäre Zentrum für Klinische Forschung de ne whether SLC26A6 may be a suitable pharmacologic tar- (IZKF) Friedrich-Alexander-Universität Erlangen-Nürnberg scholarship. get to enhance extrarenal clearance of oxalate and mitigate This study was performed in fulfillment of her requirements for obtaining hyperoxalemia in oxalate-related disorders with CKD. the degree “Dr. med.”

8 JASN JASN 31: ccc–ccc,2020 www.jasn.org BASIC RESEARCH

REFERENCES 16. Knauf F, Asplin JR, Granja I, Schmidt IM, Moeckel GW, David RJ, et al.: NALP3-mediated inflammation is a principal cause of progressive renal failure in oxalate nephropathy. Kidney Int 84: 895–901, 2013 1. Marangella M, Cosseddu D, Petrarulo M, Vitale C, Linari F: Thresholds of serum calcium oxalate supersaturation in relation to renal function in 17. Debelle FD, Nortier JL, De Prez EG, Garbar CH, Vienne AR, Salmon IJ, fi patients with or without primary hyperoxaluria. Nephrol Dial Transplant et al.: Aristolochic acids induce chronic renal failure with interstitial - – 8: 1333–1337, 1993 brosis in salt-depleted rats. JAmSocNephrol13: 431 436, 2002 2. Hoppe B, Kemper MJ, Bökenkamp A, Langman CB: Plasma calcium- 18. Huang L, Scarpellini A, Funck M, Verderio EA, Johnson TS: Develop- oxalate saturation in children with renal insufficiency and in children ment of a chronic kidney disease model in C57BL/6 mice with relevance – with primary hyperoxaluria. Kidney Int 54: 921–925, 1998 to human pathology. Nephron Extra 3: 12 29, 2013 fi 3. Tomson CR, Channon SM, Ward MK, Laker MF: Plasma oxalate con- 19. Wang Z, Petrovic S, Mann E, Soleimani M: Identi cation of an apical centration, oxalate clearance and cardiac function in patients receiving Cl(-)/HCO3(-) exchanger in the small intestine. Am J Physiol Gastrointest – haemodialysis. Nephrol Dial Transplant 4: 792–799, 1989 Liver Physiol 282: G573 G579, 2002 4. Salyer WR, Keren D: Oxalosis as a complication of chronic renal failure. 20. Dawson PA, Russell CS, Lee S, McLeay SC, van Dongen JM, Cowley Kidney Int 4: 61–66, 1973 DM, et al.: Urolithiasis and hepatotoxicity are linked to the anion 5. Palsson R, Chandraker AK, Curhan GC, Rennke HG, McMahon GM, transporter Sat1 in mice. JClinInvest120: 706–712, 2010 et alSS: The association of calcium oxalate deposition in kidney allo- 21. Heneghan JF, Akhavein A, Salas MJ, Shmukler BE, Karniski LP, grafts with graft and patient survival. Nephrol Dial Transplant 35: Vandorpe DH, et al.: Regulated transport of sulfate and oxalate by 888–894, 2020 SLC26A2/DTDST. Am J Physiol Cell Physiol 298: C1363–C1375, 2010 6. Pinheiro HS, Câmara NO, Osaki KS, De Moura LA, Pacheco-Silva A: 22. Freel RW, Whittamore JM, Hatch M: Transcellular oxalate and Cl- ab- Early presence of calcium oxalate deposition in kidney graft biopsies is sorption in mouse intestine is mediated by the DRA anion exchanger associated with poor long-term graft survival. Am J Transplant 5: Slc26a3, and DRA deletion decreases urinary oxalate. Am J Physiol 323–329, 2005 Gastrointest Liver Physiol 305: G520–G527, 2013 7. Knauf F, Yang CL, Thomson RB, Mentone SA, Giebisch G, Aronson PS: 23. Dyer J, Hosie KB, Shirazi-Beechey SP: Nutrient regulation of human Identification of a chloride-formate exchanger expressed on the brush intestinal sugar transporter (SGLT1) expression. Gut 41: 56–59, 1997 border membrane of renal proximal tubule cells. Proc Natl Acad Sci U S 24. Ferraris RP, Diamond J: Regulation of intestinal sugar transport. Physiol A 98: 9425–9430, 2001 Rev 77: 257–302, 1997 8. Jiang Z, Grichtchenko II, Boron WF, Aronson PS: Specificity of anion 25. Ko N, Knauf F, Jiang Z, Markovich D, Aronson PS: Sat1 is dispensable exchange mediated by mouse Slc26a6. JBiolChem277: 33963–33967, for active oxalate secretion in mouse duodenum. Am J Physiol Cell 2002 Physiol 303: C52–C57, 2012 9. Jiang Z, Asplin JR, Evan AP, Rajendran VM, Velazquez H, Nottoli TP, 26. Whittamore JM, Stephens CE, Hatch M: Absence of the sulfate trans- et al.: Calcium oxalate urolithiasis in mice lacking anion transporter porter SAT-1 has no impact on oxalate handling by mouse intestine and Slc26a6. Nat Genet 38: 474–478, 2006 does not cause hyperoxaluria or hyperoxalemia. Am J Physiol Gastro- 10. Freel RW, Hatch M, Green M, Soleimani M: Ileal oxalate absorption and intest Liver Physiol 316: G82–G94, 2019 urinary oxalate excretion are enhanced in Slc26a6 null mice. Am 27. Chernova MN, Jiang L, Shmukler BE, Schweinfest CW, Blanco P, J Physiol Gastrointest Liver Physiol 290: G719–G728, 2006 Freedman SD, et al.: Acute regulation of the SLC26A3 congenital 11. Costello JF, Smith M, Stolarski C, Sadovnic MJ: Extrarenal clearance of chloride diarrhoea anion exchanger (DRA) expressed in Xenopus oo- oxalate increases with progression of renal failure in the rat. JAmSoc cytes. JPhysiol549: 3–19, 2003 Nephrol 3: 1098–1104, 1992 28. Alper SL, Stewart AK, Vandorpe DH, Clark JS, Horack RZ, Simpson JE, 12. Hatch M, Freel RW, Vaziri ND: Intestinal excretion of oxalate in chronic et al.: Native and recombinant Slc26a3 (downregulated in adenoma, renal failure. JAmSocNephrol5: 1339–1343, 1994 Dra) do not exhibit properties of 2Cl-/1HCO3- exchange. Am J Physiol 13. Dobson DM, Finlayson B: Oxalate transport from plasma to intestinal Cell Physiol 300: C276–C286, 2011 lumen in the rat. Surg Forum 24: 540–542, 1973 29. Clark JS, Vandorpe DH, Chernova MN, Heneghan JF, Stewart AK, 14. Mulay SR, Eberhard JN, Pfann V, Marschner JA, Darisipudi MN, Daniel Alper SL: Species differences in Cl- affinity and in electrogenicity of C, et al.: Oxalate-induced chronic kidney disease with its uremic and SLC26A6-mediated oxalate/Cl- exchange correlate with the distinct cardiovascular complications in C57BL/6 mice. Am J Physiol Renal human and mouse susceptibilities to nephrolithiasis. JPhysiol586: Physiol 310: F785–F795, 2016 1291–1306, 2008 15. Knauf F, Thomson RB, Heneghan JF, Jiang Z, Adebamiro A, Thomson 30. Capolongo G, Abul-Ezz S, Moe OW, Sakhaee K: Subclinical celiac CL, et al.: Loss of cystic fibrosis transmembrane regulator impairs in- disease and crystal-induced kidney disease following kidney trans- testinal oxalate secretion. JAmSocNephrol28: 242–249, 2017 plant. AmJKidneyDis60: 662–667, 2012

JASN 31: ccc–ccc, 2020 Role of Enteric Slc26a6 in CKD 9