DNA Gyrase of Deinococcus Radiodurans Is Characterized As Type II Bacterial Topoisomerase and Its Activity Is Differentially Regulated by Ppra in Vitro

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Extremophiles (2016) 20:195–205 DOI 10.1007/s00792-016-0814-1 ORIGINAL PAPER DNA Gyrase of Deinococcus radiodurans is characterized as Type II bacterial topoisomerase and its activity is differentially regulated by PprA in vitro Swathi Kota1 · Yogendra S. Rajpurohit1 · Vijaya K. Charaka1,4 · Katsuya Satoh2 · Issay Narumi3 · Hari S. Misra1 Received: 8 October 2015 / Accepted: 20 January 2016 / Published online: 5 February 2016 © Springer Japan 2016 Abstract The multipartite genome of Deinococcus radio- W183R, which formed relatively short oligomers did not durans forms toroidal structure. It encodes topoisomerase interact with GyrA. The size of nucleoid in PprA mutant IB and both the subunits of DNA gyrase (DrGyr) while (1.9564 0.324 µm) was significantly bigger than the wild ± lacks other bacterial topoisomerases. Recently, PprA a plei- type (1.6437 0.345 µm). Thus, we showed that DrGyr ± otropic protein involved in radiation resistance in D. radio- confers all three activities of bacterial type IIA family DNA durans has been suggested for having roles in cell division topoisomerases, which are differentially regulated by PprA, and genome maintenance. In vivo interaction of PprA with highlighting the significant role of PprA in DrGyr activity topoisomerases has also been shown. DrGyr constituted regulation and genome maintenance in D. radiodurans. from recombinant gyrase A and gyrase B subunits showed decatenation, relaxation and supercoiling activities. Wild Keywords Deinococcus · DNA gyrase · Genome type PprA stimulated DNA relaxation activity while inhib- maintenance · PprA · Radioresistance ited supercoiling activity of DrGyr. Lysine133 to glutamic acid (K133E) and tryptophane183 to arginine (W183R) replacements resulted loss of DNA binding activity in Introduction PprA and that showed very little effect on DrGyr activi- ties in vitro. Interestingly, wild type PprA and its K133E Deinococcus radiodurans is a radioresistant bacterium that derivative continued interacting with GyrA in vivo while is known for its efficient DNA double strand break (DSB) repair (Zahradka et al. 2006; Ishino and Narumi 2015) and Communicated by L. Huang. an extraordinary tolerance to oxidative stress (Daly et al. 2010; Tian and Hua 2010; Misra et al. 2013). It contains a Electronic supplementary material The online version of this multipartite genome system comprising of chromosome I, article (doi:10.1007/s00792-016-0814-1) contains supplementary chromosome II and plasmids. Each of these genome ele- material, which is available to authorized users. ments are present in multiple copies (Minton 1994) and * Hari S. Misra packaged in the form of a doughnut shaped toroidal struc- [email protected] ture (Levin-Zaidman et al. 2003). A number of proteins including DNA topoisomerases have been found associ- 1 Molecular Biology Division, Bhabha Atomic Research ated with the nucleoid of this bacterium (de la Tour et al. Centre, Mumbai 400084, India 2013). In Escherichia coli, DNA topoisomerases roles in 2 Ion Beam Mutagenesis Research Group, Quantum Beam maintaining correct DNA topology as well as in the res- Science Center, Japan Atomic Energy Agency, Takasaki, Gunma 370‑1292, Japan olution of duplicated intertwined circular chromosome have been reported (Buck and Zechiedrich 2004). It has 3 Radiation Microbiology Laboratory, Department of Life Sciences, Toyo University, Itakura, Gunma 374‑0193, Japan been shown that DNA topoisomerase IV (TopoIV) but not DNA gyrase is responsible for decatenation of site-spe- 4 Present Address: Department of Radiation Oncology, Houston Methodist Research Institute, Houston Methodist cific recombination intermediates in E. coli chromosome Hospital, Houston, TX 77030, USA (Zechiedrich et al. 1997). More recently, it is observed that 1 3 196 Extremophiles (2016) 20:195–205 Topo IV is actually knots and unknots the sister duplexes Materials and methods of DNA during replication in E. coli (Lopez et al. 2012). The mechanisms underlying the regulation of mutu- Bacterial strains and plasmids ally incompatible (knot and unknot) activities of TopoIV in vivo are not known yet. The D. radiodurans genome D. radiodurans R1 (ATCC13939) was a gift from Profes- does not encode TopoIV but encodes DNA topoisomerase sor J. Ortner, Germany (Schaefer et al. 2000) and is main- IB (DraTopoIB) and DNA gyrase (DrGyr) (White et al. tained in TGY (0.5 % Bacto Tryptone, 0.3 % Bacto Yeast 1999). PprA (named after pleiotropic protein promot- Extract, and 0.1 % glucose) medium at 32 °C. E. coli strain ing DNA repair) has been known for its role in radiation DH5α is used for maintaining cloned genes on plasmids resistance in D. radiodurans (Narumi et al. 2004). Earlier, while E. coli BL21 (DE3) pLysS is used for the expression PprA was shown to contribute in DSB repair by stimu- of recombinant protein. E. coli BL21 cells containing pET lating DNA ends joining activities of T4 DNA ligase, E. vectors (Novogen Inc.) and their derivatives while E. coli coli DNA ligase and a deinococcal DNA ligase (LigB) BTH101 containing pKNT25 and pUT18 plasmids (Kari- (Narumi et al. 2004; Kota et al. 2010). PprA and DraT- mova et al. 1998) and their derivatives were grown in LB opoIB were found in a multiprotein DNA processing com- broth with appropriate antibiotics. All recombinant tech- plex characterized from this bacterium (Kota and Misra niques used in this study were as described earlier (Sam- 2008). Molecular mechanisms underlying the packaging brook and Russell 2001). of multipartite genome in toroidal structure, its remodel- ling during replication, transcription, recombination and Generation of PprA mutants by random mutagenesis segregation, and faithful inheritance are largely unexplored in D. radiodurans. Recently, the identification of centro- The pprA gene was mutagenized by error-prone PCR or meric sequences in the chromosome I of D. radiodurans hydroxylamine treatment. For error-prone PCR, the pprA and functional characterization of its partitioning pro- gene was amplified using a GeneMorph PCR Mutagen- teins has been reported (Charaka and Misra 2012). Also, esis Kit (Stratagene, Inc) with a set of primers that were the interaction with DNA gyrase A subunit (GyrA) and used to generate the pprA expression plasmid pET3pprAwt DraTopoIB with PprA and the stimulation of DraTopoIB (Narumi et al. 2004). For hydroxylamine treatment, pET- activity by this protein have been demonstrated (Kota 3pprAwt was treated with 0.1 M potassium phosphate (pH et al. 2014a, b). Therefore, the involvement of deinococcal 6.0) containing 0.4 M hydroxylamine and 5 mM EDTA DNA topoisomerases and their possible interaction with at 68 °C for 1 h, and purified using a MinElute Reaction PprA in the maintenance of multipartite genome struc- Cleanup Kit (Qiagen, Inc). The purified plasmids were ture and functions would be worth understanding. Here, transformed into E. coli BMH 71-18 to efficiently fix muta- we report the functional characterization of recombinant tions. Plasmids were digested with NdeI and BamHI and DNA gyrase of D. radiodurans. Using purified recombi- mutated inserts were ligated into pET3a at NdeI and BamHI nant gyrase A and gyrase B (GyrB) subunits of D. radio- site, and introduced into E. coli BL21 (DE3) to select durans an active DNA gyrase enzyme was reconstituted. mutant clones. Large colonies grown on LB agar plates Interestingly, DrGyr showed all three activities like DNA were selected as candidate clones containing a mutation relaxation, supercoiling and decatenation of bacterial in the pprA gene. The presence of mutation was checked type IIA family DNA topoisomerases. PprA and its DNA by DNA sequencing and pprA A397G (K133E) and pprA binding mutant K133E interacted with GyrA. However, T547A (W183R) mutants have been used in this study. W183R mutant that had compromised both DNA binding and polymerization functions of PprA did not interact with Construction of expression plasmids GyrA. The relaxation activity of DrGyr was stimulated by wild type PprA but not by K133E and W183R derivatives. The ORF DR_1913 (gyrA) encoding GyrA and DR_0906 Interestingly, the DNA supercoiling activity of DrGyr (gyrB) GyrB subunits of DrGyr in the D. radiodurans was inhibited in the presence of wild type PprA but not genome were PCR amplified from genomic DNA using the mutants. These results suggested that DrGyr seems to be gene specific primers gryAF (5′ CGGGATCCATGACCGG a sole multifunctional type IIA family DNA topoisomer- AATTCAACCT 3′) and gyrAR (5′ AGCAAGCTTTTACAG ase in D. radiodurans, and the DNA binding characteristic CTCGTCTTCCTTGCGA 3′) for the gyrA, and gyrBF (5′ C of PprA is crucial for its regulation of DrGyr activities at GGGATCCATGAGCTTTTCCCATGC 3′) and gyrBR (5′ A least in vitro. The possibility of DrGyr and PprA interac- GCAAGCTTTCAGACGCTGATTTCAGCGA 3′) for the tion contributing in dynamic regulation of the chromo- gyrB, respectively. PCR amplified gyrA (2439 bp) and gyrB some functions during growth of this bacterium may be (1992 bp) were cloned in pET28a vector at BamHI and + suggested. HindIII sites to generate recombinant plasmids pETgyrA 1 3 Extremophiles (2016) 20:195–205 197 and pETgyrB. The PprA expression plasmids were con- 0.8 % agarose gel electrophoresis using TA buffer. Gel shift structed as described earlier (Narumi et al. 2004; Kota assay was also employed for checking the physical inter- and Misra 2006). The coding sequences of DNA bind- action of purified PprA and DrGyr subunits. For that plas- ing mutants K133E and W183R of pprA were cloned
Recommended publications
  • The First Recorded Incidence of Deinococcus Radiodurans R1 Biofilm

    The First Recorded Incidence of Deinococcus Radiodurans R1 Biofilm

    bioRxiv preprint doi: https://doi.org/10.1101/234781; this version posted December 15, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 The first recorded incidence of Deinococcus radiodurans R1 biofilm 2 formation and its implications in heavy metals bioremediation 3 4 Sudhir K. Shukla1,2, T. Subba Rao1,2,* 5 6 Running title : Deinococcus radiodurans R1 biofilm formation 7 8 1Biofouling & Thermal Ecology Section, Water & Steam Chemistry Division, 9 BARC Facilities, Kalpakkam, 603 102 India 10 11 2Homi Bhabha National Institute, Mumbai 400094, India 12 13 *Corresponding Author: T. Subba Rao 14 Address: Biofouling & Thermal Ecology Section, Water & Steam Chemistry Division, 15 BARC Facilities, Kalpakkam, 603 102 India 16 E-mail: [email protected] 17 Phone: +91 44 2748 0203, Fax: +91 44 2748 0097 18 1 bioRxiv preprint doi: https://doi.org/10.1101/234781; this version posted December 15, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 19 Significance and Impact of this Study 20 This is the first ever recorded study on the Deinococcus radiodurans R1 biofilm. This 21 organism, being the most radioresistant micro-organism ever known, has always been 22 speculated as a potential bacterium to develop a bioremediation process for radioactive heavy 23 metal contaminants. However, the lack of biofilm forming capability proved to be a bottleneck 24 in developing such technology. This study records the first incidence of biofilm formation in a 25 recombinant D.
  • Protection of Chemolithoautotrophic Bacteria Exposed to Simulated

    Protection of Chemolithoautotrophic Bacteria Exposed to Simulated

    Protection Of Chemolithoautotrophic Bacteria Exposed To Simulated Mars Environmental Conditions Felipe Gómez, Eva Mateo-Martí, Olga Prieto-Ballesteros, Jose Martín-Gago, Ricardo Amils To cite this version: Felipe Gómez, Eva Mateo-Martí, Olga Prieto-Ballesteros, Jose Martín-Gago, Ricardo Amils. Pro- tection Of Chemolithoautotrophic Bacteria Exposed To Simulated Mars Environmental Conditions. Icarus, Elsevier, 2010, 209 (2), pp.482. 10.1016/j.icarus.2010.05.027. hal-00676214 HAL Id: hal-00676214 https://hal.archives-ouvertes.fr/hal-00676214 Submitted on 4 Mar 2012 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Accepted Manuscript Protection Of Chemolithoautotrophic Bacteria Exposed To Simulated Mars En‐ vironmental Conditions Felipe Gómez, Eva Mateo-Martí, Olga Prieto-Ballesteros, Jose Martín-Gago, Ricardo Amils PII: S0019-1035(10)00220-4 DOI: 10.1016/j.icarus.2010.05.027 Reference: YICAR 9450 To appear in: Icarus Received Date: 11 August 2009 Revised Date: 14 May 2010 Accepted Date: 28 May 2010 Please cite this article as: Gómez, F., Mateo-Martí, E., Prieto-Ballesteros, O., Martín-Gago, J., Amils, R., Protection Of Chemolithoautotrophic Bacteria Exposed To Simulated Mars Environmental Conditions, Icarus (2010), doi: 10.1016/j.icarus.2010.05.027 This is a PDF file of an unedited manuscript that has been accepted for publication.
  • Ionizing Radiation Resistance in Deinococcus Radiodurans

    Ionizing Radiation Resistance in Deinococcus Radiodurans

    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by CSCanada.net: E-Journals (Canadian Academy of Oriental and Occidental Culture,... ISSN 1715-7862 [PRINT] Advances in Natural Science ISSN 1715-7870 [ONLINE] Vol. 7, No. 2, 2014, pp. 6-14 www.cscanada.net DOI: 10.3968/5058 www.cscanada.org Ionizing Radiation Resistance in Deinococcus Radiodurans LI Wei[a]; MA Yun[a]; XIAO Fangzhu[a]; HE Shuya[a],* [a]Institute of Biochemistry and Molecular Biology, University of South Treatment of D. radiodurans with an acute dose of 5,000 China, Hengyang, China. Gy of ionizing radiation with almost no loss of viability, *Corresponding author. and an acute dose of 15,000 Gy with 37% viability (Daly, Supported by the National Natural Science Foundation of China 2009; Ito, Watanabe, Takeshia, & Iizuka, 1983; Moseley (81272993). & Mattingly, 1971). In contrast, 5 Gy of ionizing radiation can kill a human, 200-800 Gy of ionizing radiation will Received 12 March 2014; accepted 2 June 2014 Published online 26 June 2014 kill E. coli, and more than 4,000 Gy of ionizing radiation will kill the radiation-resistant tardigrade. D. radiodurans can survive 5,000 to 30,000 Gy of ionizing radiation, Abstract which breaks its genome into hundreds of fragments (Daly Deinococcus radiodurans is unmatched among all known & Minton, 1995; Minton, 1994; Slade & Radman, 2011). species in its ability to resist ionizing radiation and other Surprisingly, the genome is reassembled accurately before DNA-damaging factors. It is considered a model organism beginning of the next cycle of cell division.
  • Biology of Extreme Radiation Resistance: the Way of Deinococcus Radiodurans

    Biology of Extreme Radiation Resistance: the Way of Deinococcus Radiodurans

    Biology of Extreme Radiation Resistance: The Way of Deinococcus radiodurans Anita Krisko1 and Miroslav Radman1,2 1Mediterranean Institute for Life Sciences, 21000 Split, Croatia 2Faculte´ de Me´decine, Universite´ Rene´ Descartes—Paris V, INSERM U1001, 75015 Paris, France Correspondence: [email protected] The bacterium Deinococcus radiodurans is a champion of extreme radiation resistance that is accounted for by a highly efficient protection against proteome, but not genome, damage. A well-protected functional proteome ensures cell recovery from extensive radiation damage to other cellular constituents by molecular repair and turnover processes, including an efficient repair of disintegrated DNA. Therefore, cell death correlates with radiation- induced protein damage, rather than DNA damage, in both robust and standard species. From the reviewed biology of resistance to radiation and other sources of oxidative damage, we conclude that the impact of protein damage on the maintenance of life has been largely underestimated in biology and medicine. everal recent reviews comprehensively pres- rather than the genome. A cell that instantly Sent the extraordinary bacterium Deinococ- loses its genome can function for some time, cus radiodurans, best known for its biological unlike one that loses its proteome. In other robustness involving an extremely efficient words, the proteome sustains and maintains DNA repair system (Cox and Battista 2005; Bla- life, whereas the genome ensures the perpetua- sius et al. 2008; Daly 2009; Slade and Radman tion of life by renewing the proteome, a process 2011). The aim of this short review of the biol- contingent on a preexisting proteome that re- ogy of D. radiodurans is to single out a general pairs, replicates, and expresses the genome.
  • New Insights Into the Activation of Radiation Desiccation Response Regulon in Deinococcus Radiodurans

    New Insights Into the Activation of Radiation Desiccation Response Regulon in Deinococcus Radiodurans

    J Biosci (2021)46:10 Ó Indian Academy of Sciences DOI: 10.1007/s12038-020-00123-5 (0123456789().,-volV)(0123456789().,-volV) New insights into the activation of Radiation Desiccation Response regulon in Deinococcus radiodurans 1,2 1,2 ANAGANTI NARASIMHA and BHAKTI BASU * 1Molecular Biology Division, Bhabha Atomic Research Centre, Mumbai 400 085, India 2Homi Bhabha National Institute, Training School Complex, Anushakti Nagar, Mumbai 400 094, India *Corresponding author (Email, [email protected]) MS received 3 September 2020; accepted 17 November 2020 The highly radiation-resistant bacterium Deinococcus radiodurans responds to gamma radiation or desiccation through the coordinated expression of genes belonging to Radiation and Desiccation Resistance/Response (RDR) regulon. RDR regulon is operated through cis-acting sequence RDRM (Radiation Desiccation Response Motif), trans-acting repressor DdrO and protease IrrE (also called PprI). The present study evaluated whether RDR regulon controls the response of D. radiodurans to various other DNA damaging stressors, to which it is resistant, such as UV rays, mitomycin C (MMC), methyl methanesulfonate (MMS), ethidium bromide (EtBr), etc. Activation of 3 RDR regulon genes (ddrB, gyrB and DR1143) was studied by tagging their promoter sequences with a highly sensitive GFP reporter. Here we demonstrated that all the DNA damaging stressors elicited activation of RDR regulon of D. radiodurans in a dose-dependent and RDRM-/ IrrE-dependent manner. However, ROS-mediated indirect effects [induced by hydrogen peroxide (H2O2), methyl viologen (MV), heavy metal/metalloid (zinc or tellurite), etc.] did not activate RDR regulon. We also showed that level of activation was inversely proportional to cellular abundance of repressor DdrO.
  • On the Stability of Deinoxanthin Exposed to Mars Conditions During a Long-Term Space Mission and Implications for Biomarker Detection on Other Planets

    On the Stability of Deinoxanthin Exposed to Mars Conditions During a Long-Term Space Mission and Implications for Biomarker Detection on Other Planets

    fmicb-08-01680 September 14, 2017 Time: 15:33 # 1 ORIGINAL RESEARCH published: 15 September 2017 doi: 10.3389/fmicb.2017.01680 On the Stability of Deinoxanthin Exposed to Mars Conditions during a Long-Term Space Mission and Implications for Biomarker Detection on Other Planets Stefan Leuko1*, Maria Bohmeier1, Franziska Hanke2, Ute Böettger2, Elke Rabbow1, Andre Parpart1, Petra Rettberg1 and Jean-Pierre P. de Vera3 1 German Aerospace Center, Research Group “Astrobiology”, Radiation Biology Department, Institute of Aerospace Medicine, Köln, Germany, 2 German Aerospace Center, Institute of Optical Sensor Systems, Berlin, Germany, 3 German Aerospace Center, Institute of Planetary Research, Berlin, Germany Outer space, the final frontier, is a hostile and unforgiving place for any form of life as we know it. The unique environment of space allows for a close simulation of Mars surface conditions that cannot be simulated as accurately on the Earth. For this experiment, we tested the resistance of Deinococcus radiodurans to survive exposure to simulated Mars-like conditions in low-Earth orbit for a prolonged period of time as part Edited by: of the Biology and Mars experiment (BIOMEX) project. Special focus was placed on the Baolei Jia, Chung-Ang University, South Korea integrity of the carotenoid deinoxanthin, which may serve as a potential biomarker to Reviewed by: search for remnants of life on other planets. Survival was investigated by evaluating James A. Coker, colony forming units, damage inflicted to the 16S rRNA gene by quantitative PCR, University of Maryland University College, United States and the integrity and detectability of deinoxanthin by Raman spectroscopy. Exposure Haitham Sghaier, to space conditions had a strong detrimental effect on the survival of the strains and the Centre National des Sciences et 16S rRNA integrity, yet results show that deinoxanthin survives exposure to conditions Technologies Nucléaires, Tunisia as they prevail on Mars.
  • Metabolic Engineering of Extremophilic Bacterium Deinococcus Radiodurans for the Production of the Novel Carotenoid Deinoxanthin

    Metabolic Engineering of Extremophilic Bacterium Deinococcus Radiodurans for the Production of the Novel Carotenoid Deinoxanthin

    microorganisms Article Metabolic Engineering of Extremophilic Bacterium Deinococcus radiodurans for the Production of the Novel Carotenoid Deinoxanthin Sun-Wook Jeong 1 , Jun-Ho Kim 2, Ji-Woong Kim 2, Chae Yeon Kim 2, Su Young Kim 2 and Yong Jun Choi 1,* 1 School of Environmental Engineering, University of Seoul, Seoul 02504, Korea; [email protected] 2 Material Sciences Research Institute, LABIO Co., Ltd., Seoul 08501, Korea; [email protected] (J.-H.K.); [email protected] (J.-W.K.); [email protected] (C.Y.K.); [email protected] (S.Y.K.) * Correspondence: [email protected]; Tel.: +82-02-6490-2873; Fax: +82-02-6490-2859 Abstract: Deinoxanthin, a xanthophyll derived from Deinococcus species, is a unique organic com- pound that provides greater antioxidant effects compared to other carotenoids due to its superior scavenging activity against singlet oxygen and hydrogen peroxide. Therefore, it has attracted signifi- cant attention as a next-generation organic compound that has great potential as a natural ingredient in a food supplements. Although the microbial identification of deinoxanthin has been identified, mass production has not yet been achieved. Here, we report, for the first time, the development of an engineered extremophilic microorganism, Deinococcus radiodurans strain R1, that is capable of produc- ing deinoxanthin through rational metabolic engineering and process optimization. The genes crtB and dxs were first introduced into the genome to reinforce the metabolic flux towards deinoxanthin. The optimal temperature was then identified through a comparative analysis of the mRNA expression of the two genes, while the carbon source was further optimized to increase deinoxanthin production.
  • Single-Molecule Insights Into ATP-Dependent Conformational Dynamics of Nucleoprotein Filaments of Deinococcus Radiodurans Reca

    Single-Molecule Insights Into ATP-Dependent Conformational Dynamics of Nucleoprotein Filaments of Deinococcus Radiodurans Reca

    International Journal of Molecular Sciences Article Single-Molecule Insights into ATP-Dependent Conformational Dynamics of Nucleoprotein Filaments of Deinococcus radiodurans RecA Aleksandr Alekseev 1, Galina Cherevatenko 1, Maksim Serdakov 1, Georgii Pobegalov 1,* , Alexander Yakimov 1,2 , Irina Bakhlanova 2, Dmitry Baitin 2 and Mikhail Khodorkovskii 1,3 1 Peter the Great St Petersburg Polytechnic University, St Petersburg 195251, Russia; [email protected] (A.A.); [email protected] (G.C.); [email protected] (M.S.); [email protected] (A.Y.); [email protected] (M.K.) 2 Department of Molecular and Radiation Biophysics, Petersburg Nuclear Physics Institute (B.P. Konstantinov of National Research Centre ‘Kurchatov Institute’), Gatchina 188300, Russia; [email protected] (I.B.); [email protected] (D.B.) 3 Institute of Cytology, Russian Academy of Sciences, St. Petersburg 194064, Russia * Correspondence: [email protected]; Tel.: +7 950 0191425 Received: 1 September 2020; Accepted: 4 October 2020; Published: 7 October 2020 Abstract: Deinococcus radiodurans (Dr) has one of the most robust DNA repair systems, which is capable of withstanding extreme doses of ionizing radiation and other sources of DNA damage. DrRecA, a central enzyme of recombinational DNA repair, is essential for extreme radioresistance. In the presence of ATP, DrRecA forms nucleoprotein filaments on DNA, similar to other bacterial RecA and eukaryotic DNA strand exchange proteins. However, DrRecA catalyzes DNA strand exchange in a unique reverse pathway. Here, we study the dynamics of DrRecA filaments formed on individual molecules of duplex and single-stranded DNA, and we follow conformational transitions triggered by ATP hydrolysis. Our results reveal that ATP hydrolysis promotes rapid DrRecA dissociation from duplex DNA, whereas on single-stranded DNA, DrRecA filaments interconvert between stretched and compressed conformations, which is a behavior shared by E.
  • The Possibility of an Extraterrestrial Origin of Biomolecules O

    The Possibility of an Extraterrestrial Origin of Biomolecules O

    Mini-review: Probing the limits of extremophilic life in extraterrestrial environment‐simulated experiments Claudia LAGE1*, Gabriel DALMASO1, Lia TEIXEIRA1, Amanda BENDIA1, Ivan PAULINO-LIMA2, Douglas GALANTE3, Eduardo JANOT-PACHECO3, Ximena ABREVAYA4, Armando AZÚA-BUSTOS5, Vivian PELIZZARI6, Alexandre ROSADO7 1 Laboratório de Radiações em Biologia, Instituto de Biofísica Carlos Chagas Filho, Universidade Federal do Rio de Janeiro, Brazil 2 NASA-Ames Research Center, USA 3 Instituto de Astronomia, Geofísica e Ciências Atmosféricas, Universidade de São Paulo, Brazil 4 Instituto de Astronomía y Física del Espacio, Universidad de Buenos Aires - CONICET, Argentina 5 Pontificia Universidad Catolica de Chile, Chile 6 Instituto Oceanográfico, Universidade de São Paulo, Brazil 7 Instituto de Microbiologia Prof Paulo Góes, Universidade Federal do Rio de Janeiro, Brazil * corresponding author Instituto de Biofisica Carlos Chagas Filho - UFRJ Centro de Ciencias da Saude, Bldg G Av. Carlos Chagas Filho, 373 Cidade Universitaria 21941-902 Rio de Janeiro RJ BRAZIL Phone numbers: +55 21 2562 6576 (office) 9964 6866 (mobile) 2280 8193 (FAX) E-mail: [email protected] Abstract Astrobiology is a brand new area of science that seeks to understand the origin and dynamics of life in the universe. Several hypotheses to explain life in the cosmic context have been developed throughout human history, but only now technology has allowed many of them to be tested. Laboratory experiments have been able to show how chemical elements essential to life, carbon, nitrogen, oxygen and hydrogen combine in biologically important compounds. Interestingly, these compounds are found universally. As these compounds were combined to the point of originating cells and complex organisms is still a challenge to be unveiled by science.
  • Diviva Is Essential in Deinococcus Radiodurans and Its C Terminal Domain Regulates New Septum Orientation During Cell Division

    Diviva Is Essential in Deinococcus Radiodurans and Its C Terminal Domain Regulates New Septum Orientation During Cell Division

    bioRxiv preprint doi: https://doi.org/10.1101/2020.04.09.033746; this version posted April 10, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. DivIVA is essential in Deinococcus radiodurans and its C terminal domain regulates new septum orientation during cell division Reema Chaudhary1,2, Swathi Kota1,2 and Hari S Misra1,2 * 1 Molecular Biology Division, Bhabha Atomic Research Centre, Mumbai- 400085 2 Life Sciences, Homi Bhabha National Institute, Mumbai- 400094 India *Corresponding author address Dr. Hari S Misra Molecular Biology Division Bhabha Atomic Research Centre Mumbai- 400094 India Tel: 91-22-25593821 Email: [email protected] bioRxiv preprint doi: https://doi.org/10.1101/2020.04.09.033746; this version posted April 10, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract FtsZ assembly at mid cell position in rod shaped bacteria is regulated by gradient of MinCDE complex across the poles. In round shaped bacteria, which lack predefined poles and the next plane of cell division is perpendicular to previous plane, the determination of site for FtsZ assembly is intriguing. Deinococcus radiodurans a coccus shaped bacterium, is characterized for its extraordinary resistance to DNA damage. Here we report that DivIVA a putative component of Min system in this bacterium (drDivIVA) interacts with cognate cell division and genome segregation proteins. The deletion of full length drDivIVA was found to be indispensable while its C-terminal deletion (△divIVAC) was dispensable but produced distinguishable phenotypes like slow growth, altered plane for new septum formation and angular septum.
  • Natural Transformation in Deinococcus Radiodurans: A

    Natural Transformation in Deinococcus Radiodurans: A

    Natural Transformation in Deinococcus radiodurans: A Genetic Analysis Reveals the Major Roles of DprA, DdrB, RecA, RecF, and RecO Proteins Solenne Ithurbide, Geneviève Coste, Johnny Lisboa, Nicolas Eugénie, Esma Bentchikou, Claire Bouthier de la Tour, Dominique Liger, Fabrice Confalonieri, Suzanne Sommer, Sophie Quevillon-Cheruel, et al. To cite this version: Solenne Ithurbide, Geneviève Coste, Johnny Lisboa, Nicolas Eugénie, Esma Bentchikou, et al.. Natural Transformation in Deinococcus radiodurans: A Genetic Analysis Reveals the Major Roles of DprA, DdrB, RecA, RecF, and RecO Proteins. Frontiers in Microbiology, Frontiers Media, 2020, 11, pp.1253. 10.3389/fmicb.2020.01253. hal-02898103 HAL Id: hal-02898103 https://hal.archives-ouvertes.fr/hal-02898103 Submitted on 3 Sep 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. ORIGINAL RESEARCH published: 18 June 2020 doi: 10.3389/fmicb.2020.01253 Natural Transformation in Deinococcus radiodurans: A Genetic Edited by: Ludmila Chistoserdova, Analysis Reveals the Major Roles of University of Washington,
  • Antioxidants Used by Deinococcus Radiodurans and Implications for Antioxidant Drug Discovery

    Antioxidants Used by Deinococcus Radiodurans and Implications for Antioxidant Drug Discovery

    CORRESPONDENCE LINK TO ORIGINAL ARTICLE LINK TO AUTHOR’s REPLY In summary, it seems that the antioxi- dant defence system of D. radiodurans Antioxidants used by Deinococcus consists of several lines of antioxidants, including enzymes and non-enzymatic radiodurans and implications for small molecules, which is directly relevant to antioxidant drug discovery. Lipoic antioxidant drug discovery acid has been approved as an antioxidant drug, and therefore the other antioxidants used by D. radiodurans (that is, Mn(II) Hong-Yu Zhang, Xue-Juan Li, Na Gao and Ling-Ling Chen complexes and folates) are good start- ing points for finding novel antioxidant In his recent Opinion article (A new fact, the development of Mn(II)-containing drugs. perspective on radiation resistance based catalytic antioxidant drugs has attracted Hong-Yu Zhang is at the Institute of Bioinformatics and 5 on Deinococcus radiodurans. Nature Rev. much attention in recent years . However, National Key Laboratory of Crop Genetic Improvement, Microbiol. 7, 237–245 (2009))1, Michael as D. radiodurans contains a large number College of Life Science and Technology, Huazhong Daly proposes that high levels of manganese of metabolites, we speculate that other Agricultural University, Wuhan 430070, P. R. China. can protect proteins from the reactive compounds might also be responsible for the Xue-Juan Li, Na Gao and Ling-Ling Chen are at the oxygen species (ROS) that are produced antioxidant defence of D. radiodurans. Shandong Provincial Research Center for Bioinformatic Engineering and Technique, Center for Advanced Study, during irradiation. Owing to the close link Through searching the Kyoto Shandong University of Technology, between reactive oxygen species and various Encyclopedia of Genes and Genomes Zibo 255049, P.