Extremophiles (2016) 20:195–205 DOI 10.1007/s00792-016-0814-1 ORIGINAL PAPER DNA Gyrase of Deinococcus radiodurans is characterized as Type II bacterial topoisomerase and its activity is differentially regulated by PprA in vitro Swathi Kota1 · Yogendra S. Rajpurohit1 · Vijaya K. Charaka1,4 · Katsuya Satoh2 · Issay Narumi3 · Hari S. Misra1 Received: 8 October 2015 / Accepted: 20 January 2016 / Published online: 5 February 2016 © Springer Japan 2016 Abstract The multipartite genome of Deinococcus radio- W183R, which formed relatively short oligomers did not durans forms toroidal structure. It encodes topoisomerase interact with GyrA. The size of nucleoid in PprA mutant IB and both the subunits of DNA gyrase (DrGyr) while (1.9564 0.324 µm) was significantly bigger than the wild ± lacks other bacterial topoisomerases. Recently, PprA a plei- type (1.6437 0.345 µm). Thus, we showed that DrGyr ± otropic protein involved in radiation resistance in D. radio- confers all three activities of bacterial type IIA family DNA durans has been suggested for having roles in cell division topoisomerases, which are differentially regulated by PprA, and genome maintenance. In vivo interaction of PprA with highlighting the significant role of PprA in DrGyr activity topoisomerases has also been shown. DrGyr constituted regulation and genome maintenance in D. radiodurans. from recombinant gyrase A and gyrase B subunits showed decatenation, relaxation and supercoiling activities. Wild Keywords Deinococcus · DNA gyrase · Genome type PprA stimulated DNA relaxation activity while inhib- maintenance · PprA · Radioresistance ited supercoiling activity of DrGyr. Lysine133 to glutamic acid (K133E) and tryptophane183 to arginine (W183R) replacements resulted loss of DNA binding activity in Introduction PprA and that showed very little effect on DrGyr activi- ties in vitro. Interestingly, wild type PprA and its K133E Deinococcus radiodurans is a radioresistant bacterium that derivative continued interacting with GyrA in vivo while is known for its efficient DNA double strand break (DSB) repair (Zahradka et al. 2006; Ishino and Narumi 2015) and Communicated by L. Huang. an extraordinary tolerance to oxidative stress (Daly et al. 2010; Tian and Hua 2010; Misra et al. 2013). It contains a Electronic supplementary material The online version of this multipartite genome system comprising of chromosome I, article (doi:10.1007/s00792-016-0814-1) contains supplementary chromosome II and plasmids. Each of these genome ele- material, which is available to authorized users. ments are present in multiple copies (Minton 1994) and * Hari S. Misra packaged in the form of a doughnut shaped toroidal struc- [email protected] ture (Levin-Zaidman et al. 2003). A number of proteins including DNA topoisomerases have been found associ- 1 Molecular Biology Division, Bhabha Atomic Research ated with the nucleoid of this bacterium (de la Tour et al. Centre, Mumbai 400084, India 2013). In Escherichia coli, DNA topoisomerases roles in 2 Ion Beam Mutagenesis Research Group, Quantum Beam maintaining correct DNA topology as well as in the res- Science Center, Japan Atomic Energy Agency, Takasaki, Gunma 370‑1292, Japan olution of duplicated intertwined circular chromosome have been reported (Buck and Zechiedrich 2004). It has 3 Radiation Microbiology Laboratory, Department of Life Sciences, Toyo University, Itakura, Gunma 374‑0193, Japan been shown that DNA topoisomerase IV (TopoIV) but not DNA gyrase is responsible for decatenation of site-spe- 4 Present Address: Department of Radiation Oncology, Houston Methodist Research Institute, Houston Methodist cific recombination intermediates in E. coli chromosome Hospital, Houston, TX 77030, USA (Zechiedrich et al. 1997). More recently, it is observed that 1 3 196 Extremophiles (2016) 20:195–205 Topo IV is actually knots and unknots the sister duplexes Materials and methods of DNA during replication in E. coli (Lopez et al. 2012). The mechanisms underlying the regulation of mutu- Bacterial strains and plasmids ally incompatible (knot and unknot) activities of TopoIV in vivo are not known yet. The D. radiodurans genome D. radiodurans R1 (ATCC13939) was a gift from Profes- does not encode TopoIV but encodes DNA topoisomerase sor J. Ortner, Germany (Schaefer et al. 2000) and is main- IB (DraTopoIB) and DNA gyrase (DrGyr) (White et al. tained in TGY (0.5 % Bacto Tryptone, 0.3 % Bacto Yeast 1999). PprA (named after pleiotropic protein promot- Extract, and 0.1 % glucose) medium at 32 °C. E. coli strain ing DNA repair) has been known for its role in radiation DH5α is used for maintaining cloned genes on plasmids resistance in D. radiodurans (Narumi et al. 2004). Earlier, while E. coli BL21 (DE3) pLysS is used for the expression PprA was shown to contribute in DSB repair by stimu- of recombinant protein. E. coli BL21 cells containing pET lating DNA ends joining activities of T4 DNA ligase, E. vectors (Novogen Inc.) and their derivatives while E. coli coli DNA ligase and a deinococcal DNA ligase (LigB) BTH101 containing pKNT25 and pUT18 plasmids (Kari- (Narumi et al. 2004; Kota et al. 2010). PprA and DraT- mova et al. 1998) and their derivatives were grown in LB opoIB were found in a multiprotein DNA processing com- broth with appropriate antibiotics. All recombinant tech- plex characterized from this bacterium (Kota and Misra niques used in this study were as described earlier (Sam- 2008). Molecular mechanisms underlying the packaging brook and Russell 2001). of multipartite genome in toroidal structure, its remodel- ling during replication, transcription, recombination and Generation of PprA mutants by random mutagenesis segregation, and faithful inheritance are largely unexplored in D. radiodurans. Recently, the identification of centro- The pprA gene was mutagenized by error-prone PCR or meric sequences in the chromosome I of D. radiodurans hydroxylamine treatment. For error-prone PCR, the pprA and functional characterization of its partitioning pro- gene was amplified using a GeneMorph PCR Mutagen- teins has been reported (Charaka and Misra 2012). Also, esis Kit (Stratagene, Inc) with a set of primers that were the interaction with DNA gyrase A subunit (GyrA) and used to generate the pprA expression plasmid pET3pprAwt DraTopoIB with PprA and the stimulation of DraTopoIB (Narumi et al. 2004). For hydroxylamine treatment, pET- activity by this protein have been demonstrated (Kota 3pprAwt was treated with 0.1 M potassium phosphate (pH et al. 2014a, b). Therefore, the involvement of deinococcal 6.0) containing 0.4 M hydroxylamine and 5 mM EDTA DNA topoisomerases and their possible interaction with at 68 °C for 1 h, and purified using a MinElute Reaction PprA in the maintenance of multipartite genome struc- Cleanup Kit (Qiagen, Inc). The purified plasmids were ture and functions would be worth understanding. Here, transformed into E. coli BMH 71-18 to efficiently fix muta- we report the functional characterization of recombinant tions. Plasmids were digested with NdeI and BamHI and DNA gyrase of D. radiodurans. Using purified recombi- mutated inserts were ligated into pET3a at NdeI and BamHI nant gyrase A and gyrase B (GyrB) subunits of D. radio- site, and introduced into E. coli BL21 (DE3) to select durans an active DNA gyrase enzyme was reconstituted. mutant clones. Large colonies grown on LB agar plates Interestingly, DrGyr showed all three activities like DNA were selected as candidate clones containing a mutation relaxation, supercoiling and decatenation of bacterial in the pprA gene. The presence of mutation was checked type IIA family DNA topoisomerases. PprA and its DNA by DNA sequencing and pprA A397G (K133E) and pprA binding mutant K133E interacted with GyrA. However, T547A (W183R) mutants have been used in this study. W183R mutant that had compromised both DNA binding and polymerization functions of PprA did not interact with Construction of expression plasmids GyrA. The relaxation activity of DrGyr was stimulated by wild type PprA but not by K133E and W183R derivatives. The ORF DR_1913 (gyrA) encoding GyrA and DR_0906 Interestingly, the DNA supercoiling activity of DrGyr (gyrB) GyrB subunits of DrGyr in the D. radiodurans was inhibited in the presence of wild type PprA but not genome were PCR amplified from genomic DNA using the mutants. These results suggested that DrGyr seems to be gene specific primers gryAF (5′ CGGGATCCATGACCGG a sole multifunctional type IIA family DNA topoisomer- AATTCAACCT 3′) and gyrAR (5′ AGCAAGCTTTTACAG ase in D. radiodurans, and the DNA binding characteristic CTCGTCTTCCTTGCGA 3′) for the gyrA, and gyrBF (5′ C of PprA is crucial for its regulation of DrGyr activities at GGGATCCATGAGCTTTTCCCATGC 3′) and gyrBR (5′ A least in vitro. The possibility of DrGyr and PprA interac- GCAAGCTTTCAGACGCTGATTTCAGCGA 3′) for the tion contributing in dynamic regulation of the chromo- gyrB, respectively. PCR amplified gyrA (2439 bp) and gyrB some functions during growth of this bacterium may be (1992 bp) were cloned in pET28a vector at BamHI and + suggested. HindIII sites to generate recombinant plasmids pETgyrA 1 3 Extremophiles (2016) 20:195–205 197 and pETgyrB. The PprA expression plasmids were con- 0.8 % agarose gel electrophoresis using TA buffer. Gel shift structed as described earlier (Narumi et al. 2004; Kota assay was also employed for checking the physical inter- and Misra 2006). The coding sequences of DNA bind- action of purified PprA and DrGyr subunits. For that plas- ing mutants K133E and W183R of pprA were cloned